WorldWideScience

Sample records for two-letter aperiodic sequences

  1. The Pagoda Sequence: a Ramble through Linear Complexity, Number Walls, D0L Sequences, Finite State Automata, and Aperiodic Tilings

    Directory of Open Access Journals (Sweden)

    Fred Lunnon

    2009-06-01

    Full Text Available We review the concept of the number wall as an alternative to the traditional linear complexity profile (LCP, and sketch the relationship to other topics such as linear feedback shift-register (LFSR and context-free Lindenmayer (D0L sequences. A remarkable ternary analogue of the Thue-Morse sequence is introduced having deficiency 2 modulo 3, and this property verified via the re-interpretation of the number wall as an aperiodic plane tiling.

  2. Energy band and transport properties in magnetic aperiodic graphene superlattices of Thue-Morse sequence

    Science.gov (United States)

    Yin, Yiheng; Niu, Yanxiong; Zhang, Huiyun; Zhang, Yuping; Liu, Haiyue

    2016-02-01

    Utilizing the transfer matrix method, we develop the electronic band structure and transport properties in Thue-Morse aperiodic graphene superlattices with magnetic barriers. It is found that the normal transmission is blocked and the position of the Dirac point can be shifted along the wavevector axis by changing the height and width ratio of magnetic barriers, which is intrinsic different from electronic field modulated superlattices. In addition, the angular threshold property of the transmission spectra and the oscillatory property of the conductance have been studied.

  3. Aperiodic order

    CERN Document Server

    Grimm, Uwe

    2017-01-01

    Quasicrystals are non-periodic solids that were discovered in 1982 by Dan Shechtman, Nobel Prize Laureate in Chemistry 2011. The mathematics that underlies this discovery or that proceeded from it, known as the theory of Aperiodic Order, is the subject of this comprehensive multi-volume series. This second volume begins to develop the theory in more depth. A collection of leading experts, among them Robert V. Moody, cover various aspects of crystallography, generalising appropriately from the classical case to the setting of aperiodically ordered structures. A strong focus is placed upon almost periodicity, a central concept of crystallography that captures the coherent repetition of local motifs or patterns, and its close links to Fourier analysis. The book opens with a foreword by Jeffrey C. Lagarias on the wider mathematical perspective and closes with an epilogue on the emergence of quasicrystals, written by Peter Kramer, one of the founders of the field.

  4. Characteristics of aperiodic sequence of slip events caused by interaction between seismic patches and that caused be self-organized stress heterogeneity

    Science.gov (United States)

    Kato, N.

    2017-12-01

    Numerical simulations of earthquake cycles are conducted to investigate the origin of complexity of earthquake recurrence. There are two main causes of the complexity. One is self-organized stress heterogeneity due to dynamical effect. The other is the effect of interaction between some fault patches. In the model, friction on the fault is assumed to obey a rate- and state-dependent friction law. Circular patches of velocity-weakening frictional property are assumed on the fault. On the remaining areas of the fault, velocity-strengthening friction is assumed. We consider three models: Single patch model, two-patch model, and three-patch model. In the first model, the dynamical effect is mainly examined. The latter two models take into consideration the effect of interaction as well as the dynamical effect. Complex multiperiodic or aperiodic sequences of slip events occur when slip behavior changes from the seismic to aseismic, and when the degree of interaction between seismic patches is intermediate. The former is observed in all the models, and the latter is observed in the two-patch model and the three-patch model. Evolution of spatial distribution of shear stress on the fault suggests that aperiodicity at the transition from seismic to aseismic slip is caused by self-organized stress heterogeneity. The iteration maps of recurrence intervals of slip events in aperiodic sequences are examined, and they are approximately expressed by simple curves for aperiodicity at the transition from seismic to aseismic slip. In contrast, the iteration maps for aperiodic sequences caused by interaction between seismic patches are scattered and they are not expressed by simple curves. This result suggests that complex sequences caused by different mechanisms may be distinguished.

  5. Investigations on the two-dimensional aperiodic plasma photonic crystals with fractal Fibonacci sequence

    Directory of Open Access Journals (Sweden)

    Hai-Feng Zhang

    2017-07-01

    Full Text Available In this paper, the properties of photonic band gaps (PBGs and defect modes of two-dimensional (2D fractal plasma photonic crystals (PPCs under a transverse-magnetic (TM wave are theoretically investigated by a modified plane wave expansion (PWE method. The configuration of 2D PPCs is the square lattices with the iteration rule of the Fibonacci sequence whose constituents are homogeneous and isotropic. The proposed 2D PPCs is filled with the dielectric cylinders in the plasma background. The accuracy and convergence of the present modified PWE method also are validated by a numerical example. The calculated results illustrate that the enough accuracy and good convergence can be achieved compared to the conventional PWE method, if the number of meshed grids is large enough. The dispersion curves of the proposed PPCs and 2D PPCs with a conventional square lattice are theoretically computed to study the properties of PBGs and defect modes. The simulated results demonstrate that the advantaged properties can be obtained in the proposed PPCs compared to the 2D conventional PPCs with similar lattices. If the Fibonacci sequence is introduced into the 2D PPCs, the larger PBGs and higher cutoff frequency can be achieved. The lower edges of PBGs are flat, which are originated from the Mie resonances. The defect modes can be considered as the quasi-localized states since the Fibonacci sequence has the self-similarity and non-periodicity at the same time. The effects of configurational parameters on the characters of the present PPCs are investigated. The results show that the PBGs and defect modes can be easily manipulated by tuning those parameters.

  6. Mathematics of aperiodic order

    CERN Document Server

    Lenz, Daniel; Savinien, Jean

    2015-01-01

    What is order that is not based on simple repetition, that is, periodicity? How must atoms be arranged in a material so that it diffracts like a quasicrystal? How can we describe aperiodically ordered systems mathematically? Originally triggered by the – later Nobel prize-winning – discovery of quasicrystals, the investigation of aperiodic order has since become a well-established and rapidly evolving field of mathematical research with close ties to a surprising variety of branches of mathematics and physics. This book offers an overview of the state of the art in the field of aperiodic order, presented in carefully selected authoritative surveys. It is intended for non-experts with a general background in mathematics, theoretical physics or computer science, and offers a highly accessible source of first-hand information for all those interested in this rich and exciting field. Topics covered include the mathematical theory of diffraction, the dynamical systems of tilings or Delone sets, their cohomolog...

  7. Aperiodic Volume Optics

    Science.gov (United States)

    Gerke, Tim D.

    Presented in this thesis is an investigation into aperiodic volume optical devices. The three main topics of research and discussion are the aperiodic volume optical devices that we call computer-generated volume holograms (CGVH), defects within periodic 3D photonic crystals, and non-periodic, but ordered 3D quasicrystals. The first of these devices, CGVHs, are designed and investigated numerically and experimentally. We study the performance of multi-layered amplitude computer-generated volume holograms in terms of efficiency and angular/frequency selectivity. Simulation results show that such aperiodic devices can increase diffraction efficiency relative to periodic amplitude volume holograms while maintaining angular and wavelength selectivity. CGVHs are also designed as voxelated volumes using a new projection optimization algorithm. They are investigated using a volumetric diffraction simulation and a standard 3D beam propagation technique as well as experimentally. Both simulation and experiment verify that the structures function according to their design. These represent the first diffractive structures that have the capacity for generating arbitrary transmission and reflection wave fronts and that provide the ability for multiplexing arbitrary functionality given different illumination conditions. Also investigated and discussed in this thesis are 3D photonic crystals and quasicrystals. We demonstrate that these devices can be fabricated using a femtosecond laser direct writing system that is particularly appropriate for fabrication of such arbitrary 3D structures. We also show that these devices can provide 3D partial bandgaps which could become complete bandgaps if fabricated using high index materials or by coating lower index materials with high index metals. Our fabrication method is particularly suited to the fabrication of engineered defects within the periodic or quasi-periodic systems. We demonstrate the potential for fabricating defects within

  8. Aperiodic-metamaterial-based absorber

    Directory of Open Access Journals (Sweden)

    Quanlong Yang

    2017-09-01

    Full Text Available The periodic-metamaterial-based perfect absorber has been studied broadly. Conversely, if the unit cell in the metamaterial-based absorber is arranged aperiodically (aperiodic-metamaterial-based absorber, how does it perform? Inspired by this, here we present a systematic study of the aperiodic-metamaterial-based absorber. By investigating the response of metamaterial absorbers based on periodic, Fibonacci, Thue-Morse, and quasicrystal lattices, we found that aperiodic-metamaterial-based absorbers could display similar absorption behaviors as the periodic one in one hand. However, their absorption behaviors show different tendency depending on the thicknesses of the spacer. Further studies on the angle and polarization dependence of the absorption behavior are also presented.

  9. Band structures and localization properties of aperiodic layered phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Yan Zhizhong, E-mail: zzyan@bit.edu.cn [Department of Applied Mathematics, Beijing Institute of Technology, Beijing 100081 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57078 Siegen (Germany)

    2012-03-15

    The band structures and localization properties of in-plane elastic waves with coupling of longitudinal and transverse modes oblique propagating in aperiodic phononic crystals based on Thue-Morse and Rudin-Shapiro sequences are studied. Using transfer matrix method, the concept of the localization factor is introduced and the correctness is testified through the Rytov dispersion relation. For comparison, the perfect periodic structure and the quasi-periodic Fibonacci system are also considered. In addition, the influences of the random disorder, local resonance, translational and/or mirror symmetries on the band structures of the aperiodic phononic crystals are analyzed in this paper.

  10. A Finite Abelian Group of Two-Letter Inversions

    Directory of Open Access Journals (Sweden)

    Sherwin E. Balbuena

    2015-11-01

    Full Text Available In abstract algebra, the study of concrete groups is fundamentally important to beginners. Most commonly used groups as examples are integer addition modulo n, real number addition and multiplication, permutation groups, and groups of symmetry. The last two examples are finite non-abelian groups and can be investigated with the aid of concrete representations. This study presents a finite abelian group of inversions of two letter symbols with vertical and horizontal axes of symmetry and whose binary operation is established through motions like alternation, rotation, reflection, and a combination of two or all motions.

  11. PREFACE: 6th International Conference on Aperiodic Crystals (APERIODIC'09)

    Science.gov (United States)

    Grimm, Uwe; McGrath, Rónán; Degtyareva, Olga; Sharma, Hem Raj

    2010-04-01

    Aperiodic Logo Aperiodic'09, the sixth International Conference on Aperiodic Crystals, took place in Liverpool 13-18 September 2009. It was the first major conference in this interdisciplinary research field held in the UK. The conference, which was organised under the auspices of the Commission on Aperiodic Crystals of the International Union of Crystallography (IUCr), followed on from Aperiodic'94 (Les Diablerets, Switzerland), Aperiodic'97 (Alpe d'Huez, France), Aperiodic'2000 (Nijmegen, The Netherlands), Aperiodic'03 (Belo Horizonte, Brazil) and Aperiodic'06 (Zao, Japan). The next conference in the series will take place in Australia in 2012. The Aperiodic conference series is itself the successor to a series of Conferences on Modulated Structures, Polytypes and Quasicrystals (MOSPOQ), which were held in Marseilles (France) in 1984, Wroclaw (Poland) in 1986, Varanasi (India) in 1988 and Balatonszeplak (Hungary) in 1991. The remit of the conference covers two broad areas of research on aperiodic crystals, incommensurately modulated and composite crystals on the one hand, and quasicrystals on the other hand, sharing the property that they are aperiodically ordered solids. In addition, the conference also featured recent research on complex metal alloys, which are in fact periodically ordered solids. However, the term complex refers to their large unit cells, which may contain thousands of atoms, and as a consequence complex metal alloys share some of the properties of quasicrystalline solids. Aperiodic'09 attracted about 110 participants from across the world, including 20 UK-based scientists (the second largest group after Japan who sent 21 delegates). A particular feature of the conference series is its interdisciplinary character, and once again the range of disciplines of participants included mathematics, physics, crystallography and materials science. The programme started with three tutorial lectures on Sunday afternoon, presenting introductory overviews

  12. Simulation of aperiodic bipedal sprinting.

    Science.gov (United States)

    Celik, Huseyin; Piazza, Stephen J

    2013-08-01

    Synthesis of legged locomotion through dynamic simulation is useful for exploration of the mechanical and control variables that contribute to efficient gait. Most previous simulations have made use of periodicity constraints, a sensible choice for investigations of steady-state walking or running. Sprinting from rest, however, is aperiodic by nature and this aperiodicity is central to the goal of the movement, as performance is determined in large part by a rapid acceleration phase early in the race. The purpose of this study was to create a novel simulation of aperiodic sprinting using a modified spring-loaded inverted pendulum (SLIP) biped model. The optimal control problem was to find the set of controls that minimized the time for the model to run 20 m, and this problem was solved using a direct multiple shooting algorithm that converts the original continuous time problem into piecewise discrete subproblems. The resulting nonlinear programming problem was solved iteratively using a sequential quadratic programming method. The starting point for the optimizer was an initial guess simulation that was a slow alternating-gait "jogging" simulation developed using proportional-derivative feedback to control trunk attitude, swing leg angle, and leg retraction and extension. The optimized aperiodic sprint simulation solution yielded a substantial improvement in locomotion time over the initial guess (2.79 s versus 6.64 s). Following optimization, the model produced forward impulses at the start of the sprint that were four times greater than those of the initial guess simulation, producing more rapid acceleration. Several gait features demonstrated in the optimized sprint simulation correspond to behaviors of human sprinters: forward trunk lean at the start; straightening of the trunk during acceleration; and a dive at the finish. Optimization resulted in reduced foot contact times (0.065 s versus 0.210 s), but contact times early in the optimized

  13. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  14. Optimal design of aperiodic, vertical silicon nanowire structures for photovoltaics.

    Science.gov (United States)

    Lin, Chenxi; Povinelli, Michelle L

    2011-09-12

    We design a partially aperiodic, vertically-aligned silicon nanowire array that maximizes photovoltaic absorption. The optimal structure is obtained using a random walk algorithm with transfer matrix method based electromagnetic forward solver. The optimal, aperiodic structure exhibits a 2.35 times enhancement in ultimate efficiency compared to its periodic counterpart. The spectral behavior mimics that of a periodic array with larger lattice constant. For our system, we find that randomly-selected, aperiodic structures invariably outperform the periodic array.

  15. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  16. Diffuse scattering from periodic and aperiodic crystals

    International Nuclear Information System (INIS)

    Frey, F.

    1997-01-01

    A (selective) review on diffuse scattering from periodic and aperiodic crystalline solids is given to demonstrate the wide field of applications in basic and applied research. After a general introduction in this field each topic is exemplified by one or two examples. Main emphasis is laid on recent work. More established work, e.g., on diffuse scattering from metals and alloys, polytypes, stacking disorder from layered structures, etc. is omitted due to the availability of excellent textbooks and reviews. Finally a short summary of recent developments of experimental methods and evaluation techniques is presented. (orig.)

  17. Creating aperiodic photonic structures by synthesized Mathieu-Gauss beams

    Science.gov (United States)

    Vasiljević, Jadranka M.; Zannotti, Alessandro; Timotijević, Dejan V.; Denz, Cornelia; Savić, Dragana M. Jović

    2017-08-01

    We demonstrate a kind of aperiodic photonic structure realized using the interference of multiple Mathieu-Gauss beams. Depending on the beam configurations, their mutual distances, angles of rotation, or phase relations we are able to observe different classes of such aperiodic optically induced refractive index structures. Our experimental approach is based on the optical induction in a single parallel writing process.

  18. Aperiodicity Correction for Rotor Tip Vortex Measurements

    Science.gov (United States)

    Ramasamy, Manikandan; Paetzel, Ryan; Bhagwat, Mahendra J.

    2011-01-01

    The initial roll-up of a tip vortex trailing from a model-scale, hovering rotor was measured using particle image velocimetry. The unique feature of the measurements was that a microscope was attached to the camera to allow much higher spatial resolution than hitherto possible. This also posed some unique challenges. In particular, the existing methodologies to correct for aperiodicity in the tip vortex locations could not be easily extended to the present measurements. The difficulty stemmed from the inability to accurately determine the vortex center, which is a prerequisite for the correction procedure. A new method is proposed for determining the vortex center, as well as the vortex core properties, using a least-squares fit approach. This approach has the obvious advantage that the properties are derived from not just a few points near the vortex core, but from a much larger area of flow measurements. Results clearly demonstrate the advantage in the form of reduced variation in the estimated core properties, and also the self-consistent results obtained using three different aperiodicity correction methods.

  19. Elastic wave localization in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity

    International Nuclear Information System (INIS)

    Yan Zhizhong; Zhang Chuanzeng; Wang Yuesheng

    2011-01-01

    The band structures of in-plane elastic waves propagating in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity are analyzed in this paper. The localization of wave propagation is discussed by introducing the concept of the localization factor, which is calculated by the plane-wave-based transfer-matrix method. By treating the random disorder and aperiodicity as the deviation from the periodicity in a special way, three kinds of aperiodic phononic crystals that have normally distributed random disorder, Thue-Morse and Rudin-Shapiro sequence in one direction and translational symmetry in the other direction are considered and the band structures are characterized using localization factors. Besides, as a special case, we analyze the band gap properties of a periodic planar layered composite containing a periodic array of square inclusions. The transmission coefficients based on eigen-mode matching theory are also calculated and the results show the same behaviors as the localization factor does. In the case of random disorders, the localization degree of the normally distributed random disorder is larger than that of the uniformly distributed random disorder although the eigenstates are both localized no matter what types of random disorders, whereas, for the case of Thue-Morse and Rudin-Shapiro structures, the band structures of Thue-Morse sequence exhibit similarities with the quasi-periodic (Fibonacci) sequence not present in the results of the Rudin-Shapiro sequence.

  20. Simulation of photonic waveguides with deterministic aperiodic nanostructures for biosensing

    DEFF Research Database (Denmark)

    Neustock, Lars Thorben; Paulsen, Moritz; Jahns, Sabrina

    2016-01-01

    Photonic waveguides with deterministic aperiodic corrugations offer rich spectral characteristics under surface-normal illumination. The finite-element method (FEM), the finite-difference time-domain (FDTD) method and a rigorous coupled wave algorithm (RCWA) are compared for computing the near...

  1. A method to identify aperiodic disturbances in the ionosphere

    Science.gov (United States)

    Wang, J.-S.; Chen, Z.; Huang, C.-M.

    2014-05-01

    In this paper, variations in the ionospheric F2 layer's critical frequency are decomposed into their periodic and aperiodic components. The latter include disturbances caused both by geophysical impacts on the ionosphere and random noise. The spectral whitening method (SWM), a signal-processing technique used in statistical estimation and/or detection, was used to identify aperiodic components in the ionosphere. The whitening algorithm adopted herein is used to divide the Fourier transform of the observed data series by a real envelope function. As a result, periodic components are suppressed and aperiodic components emerge as the dominant contributors. Application to a synthetic data set based on significant simulated periodic features of ionospheric observations containing artificial (and, hence, controllable) disturbances was used to validate the SWM for identification of aperiodic components. Although the random noise was somewhat enhanced by post-processing, the artificial disturbances could still be clearly identified. The SWM was then applied to real ionospheric observations. It was found to be more sensitive than the often-used monthly median method to identify geomagnetic effects. In addition, disturbances detected by the SWM were characterized by a Gaussian-type probability density function over all timescales, which further simplifies statistical analysis and suggests that the disturbances thus identified can be compared regardless of timescale.

  2. Topological aperiodicity for product systems over semigroups of Ore type

    DEFF Research Database (Denmark)

    Kwasniewski, Bartosz; Szymanski, Wojciech

    2016-01-01

    aperiodicity condition on the latter, we obtain the uniqueness theorem and a simplicity criterion for the algebras in question. These results generalize the corresponding ones for crossed products by discrete groups, due to Archbold and Spielberg, and for Exel's crossed products, due to Exel and Vershik...

  3. Effect of aperiodicity on the broadband reflection of silicon nanorod structures for photovoltaics.

    Science.gov (United States)

    Lin, Chenxi; Huang, Ningfeng; Povinelli, Michelle L

    2012-01-02

    We carry out a systematic numerical study of the effects of aperiodicity on silicon nanorod anti-reflection structures. We use the scattering matrix method to calculate the average reflection loss over the solar spectrum for periodic and aperiodic arrangements of nanorods. We find that aperiodicity can either improve or deteriorate the anti-reflection performance, depending on the nanorod diameter. We use a guided random-walk algorithm to design optimal aperiodic structures that exhibit lower reflection loss than both optimal periodic and random aperiodic structures.

  4. Wave propagation in one-dimensional solid-fluid quasi-periodic and aperiodic phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Chen Ali, E-mail: alchen@bjtu.edu.cn [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Wang Yuesheng [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57068 Siegen (Germany)

    2012-02-01

    The propagation of the elastic waves in one-dimensional (1D) solid-fluid quasi-periodic phononic crystals is studied by employing the concept of the localization factor, which is calculated by the transfer matrix method. The solid-fluid interaction effect at the interfaces between the solid and the fluid components is considered. For comparison, the periodic systems and aperiodic Thue-Morse sequence are also analyzed in this paper. The splitting phenomenon of the pass bands and bandgaps are discussed for these 1D solid-fluid systems. At last the influences of the material impedance ratios on the band structures of the 1D solid-fluid quasi-periodic phononic crystals arranged as Fibonacci sequence are discussed.

  5. SIMULATED PERFORMANCE OF TIMESCALE METRICS FOR APERIODIC LIGHT CURVES

    Energy Technology Data Exchange (ETDEWEB)

    Findeisen, Krzysztof; Hillenbrand, Lynne [Cahill Center for Astronomy and Astrophysics, California Institute of Technology, MC 249-17, Pasadena, CA 91125 (United States); Cody, Ann Marie, E-mail: krzys@astro.caltech.edu [Spitzer Science Center, California Institute of Technology, MC 314-6, Pasadena, CA 91125 (United States)

    2015-01-10

    Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs.

  6. Intrinsic periodic and aperiodic stochastic resonance in an electrochemical cell

    Science.gov (United States)

    Tiwari, Ishant; Phogat, Richa; Parmananda, P.; Ocampo-Espindola, J. L.; Rivera, M.

    2016-08-01

    In this paper we show the interaction of a composite of a periodic or aperiodic signal and intrinsic electrochemical noise with the nonlinear dynamics of an electrochemical cell configured to study the corrosion of iron in an acidic media. The anodic voltage setpoint (V0) in the cell is chosen such that the anodic current (I ) exhibits excitable fixed point behavior in the absence of noise. The subthreshold periodic (aperiodic) signal consists of a train of rectangular pulses with a fixed amplitude and width, separated by regular (irregular) time intervals. The irregular time intervals chosen are of deterministic and stochastic origins. The amplitude of the intrinsic internal noise, regulated by the concentration of chloride ions, is then monotonically increased, and the provoked dynamics are analyzed. The signal to noise ratio and the cross-correlation coefficient versus the chloride ions' concentration curves have a unimodal shape indicating the emergence of an intrinsic periodic or aperiodic stochastic resonance. The abscissa for the maxima of these unimodal curves correspond to the optimum value of intrinsic noise where maximum regularity of the invoked dynamics is observed. In the particular case of the intrinsic periodic stochastic resonance, the scanning electron microscope images for the electrode metal surfaces are shown for certain values of chloride ions' concentrations. These images, qualitatively, corroborate the emergence of order as a result of the interaction between the nonlinear dynamics and the composite signal.

  7. SIMULATED PERFORMANCE OF TIMESCALE METRICS FOR APERIODIC LIGHT CURVES

    International Nuclear Information System (INIS)

    Findeisen, Krzysztof; Hillenbrand, Lynne; Cody, Ann Marie

    2015-01-01

    Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs

  8. Control, synchronization, and enhanced reliability of aperiodic oscillations in the Mercury Beating Heart system

    Science.gov (United States)

    Kumar, Pawan; Parmananda, P.

    2018-04-01

    Experiments involving the Mercury Beating Heart (MBH) oscillator, exhibiting irregular (aperiodic) dynamics, are performed. In the first set of experiments, control over irregular dynamics of the MBH oscillator was obtained via a superimposed periodic voltage signal. These irregular (aperiodic) dynamics were recovered once the control was switched off. Subsequently, two MBH oscillators were coupled to attain synchronization of their aperiodic oscillations. Finally, two uncoupled MBH oscillators were subjected, repeatedly, to a common stochastic forcing, resulting in an enhancement of their mutual phase correlation.

  9. Self-similar transmission properties of aperiodic Cantor potentials in gapped graphene

    Science.gov (United States)

    Rodríguez-González, Rogelio; Rodríguez-Vargas, Isaac; Díaz-Guerrero, Dan Sidney; Gaggero-Sager, Luis Manuel

    2016-01-01

    We investigate the transmission properties of quasiperiodic or aperiodic structures based on graphene arranged according to the Cantor sequence. In particular, we have found self-similar behaviour in the transmission spectra, and most importantly, we have calculated the scalability of the spectra. To do this, we implement and propose scaling rules for each one of the fundamental parameters: generation number, height of the barriers and length of the system. With this in mind we have been able to reproduce the reference transmission spectrum, applying the appropriate scaling rule, by means of the scaled transmission spectrum. These scaling rules are valid for both normal and oblique incidence, and as far as we can see the basic ingredients to obtain self-similar characteristics are: relativistic Dirac electrons, a self-similar structure and the non-conservation of the pseudo-spin.

  10. The DNA electronic specific heat at low temperature: The role of aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Sarmento, R.G. [Departamento de Física, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Mendes, G.A. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Vasconcelos, M.S. [Escola de Ciências e Tecnologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Ujsághy, O. [Department of Theoretical Physics and Condensed Matter Research Group of the Hungarian Academy of Sciences, Budapest University of Technology and Economics, Budafoki út 8, H-1521 Budapest (Hungary); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza, CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza, CE (Brazil)

    2012-07-16

    The electronic specific heat spectra at constant volume (C{sub V}) of a long-range correlated extended ladder model, mimicking a DNA molecule, is theoretically analyzed for a stacked array of a double-stranded structure made up from the nucleotides guanine G, adenine A, cytosine C and thymine T. The role of the aperiodicity on C{sub V} is discussed, considering two different nucleotide arrangements with increasing disorder, namely the Fibonacci and the Rudin–Shapiro quasiperiodic structures. Comparisons are made for different values of the band fillings, considering also a finite segment of natural DNA, as part of the human chromosome Ch22. -- Highlights: ► Quasiperiodic sequence to mimic the DNA nucleotides arrangement. ► Electronic tight-binding Hamiltonian model. ► Electronic density of states. ► Electronic specific heat spectra.

  11. Shape control in wafer-based aperiodic 3D nanostructures

    International Nuclear Information System (INIS)

    Jeong, Hyeon-Ho; Mark, Andrew G; Gibbs, John G; Fischer, Peer; Reindl, Thomas; Waizmann, Ulrike; Weis, Jürgen

    2014-01-01

    Controlled local fabrication of three-dimensional (3D) nanostructures is important to explore and enhance the function of single nanodevices, but is experimentally challenging. We present a scheme based on e-beam lithography (EBL) written seeds, and glancing angle deposition (GLAD) grown structures to create nanoscale objects with defined shapes but in aperiodic arrangements. By using a continuous sacrificial corral surrounding the features of interest we grow isolated 3D nanostructures that have complex cross-sections and sidewall morphology that are surrounded by zones of clean substrate. (papers)

  12. Non-commutative Chern numbers for generic aperiodic discrete systems

    Science.gov (United States)

    Bourne, Chris; Prodan, Emil

    2018-06-01

    The search for strong topological phases in generic aperiodic materials and meta-materials is now vigorously pursued by the condensed matter physics community. In this work, we first introduce the concept of patterned resonators as a unifying theoretical framework for topological electronic, photonic, phononic etc (aperiodic) systems. We then discuss, in physical terms, the philosophy behind an operator theoretic analysis used to systematize such systems. A model calculation of the Hall conductance of a 2-dimensional amorphous lattice is given, where we present numerical evidence of its quantization in the mobility gap regime. Motivated by such facts, we then present the main result of our work, which is the extension of the Chern number formulas to Hamiltonians associated to lattices without a canonical labeling of the sites, together with index theorems that assure the quantization and stability of these Chern numbers in the mobility gap regime. Our results cover a broad range of applications, in particular, those involving quasi-crystalline, amorphous as well as synthetic (i.e. algorithmically generated) lattices.

  13. Thirty-two phase sequences design with good autocorrelation ...

    Indian Academy of Sciences (India)

    mum peak aperiodic autocorrelation sidelobe level one are called Barker Sequences. ... the generation and processing of polyphase signals have now become easy ..... Cook C E, Bernfield M 1967 An introduction to theory and application.

  14. Aperiodic nanoplasmonic devices for directional colour filtering and sensing.

    Science.gov (United States)

    Davis, Matthew S; Zhu, Wenqi; Xu, Ting; Lee, Jay K; Lezec, Henri J; Agrawal, Amit

    2017-11-07

    Exploiting the wave-nature of light in its simplest form, periodic architectures have enabled a panoply of tunable optical devices with the ability to perform useful functions such as filtering, spectroscopy, and multiplexing. Here, we remove the constraint of structural periodicity to enhance, simultaneously, the performance and functionality of passive plasmonic devices operating at optical frequencies. By using a physically intuitive, first-order interference model of plasmon-light interactions, we demonstrate a simple and efficient route towards designing devices with flexible, multi-spectral optical response, fundamentally not achievable using periodic architectures. Leveraging this approach, we experimentally implement ultra-compact directional light-filters and colour-sorters exhibiting angle- or spectrally-tunable optical responses with high contrast, and low spectral or spatial crosstalk. Expanding the potential of aperiodic systems to implement tailored spectral and angular responses, these results hint at promising applications in solar-energy harvesting, optical signal multiplexing, and integrated sensing.

  15. Thermal Emission Control via Bandgap Engineering in Aperiodically Designed Nanophotonic Devices

    Directory of Open Access Journals (Sweden)

    Enrique Maciá

    2015-05-01

    Full Text Available Aperiodic photonic crystals can open up novel routes for more efficient photon management due to increased degrees of freedom in their design along with the unique properties brought about by the long-range aperiodic order as compared to their periodic counterparts. In this work we first describe the fundamental notions underlying the idea of thermal emission/absorption control on the basis of the systematic use of aperiodic multilayer designs in photonic quasicrystals. Then, we illustrate the potential applications of this approach in order to enhance the performance of daytime radiative coolers and solar thermoelectric energy generators.

  16. Dynamical mechanisms for sensitive response of aperiodic firing cells to external stimulation

    International Nuclear Information System (INIS)

    Xie Yong; Xu Jianxue; Hu Sanjue; Kang Yanmei; Yang Hongjun; Duan Yubin

    2004-01-01

    An interesting phenomenon that aperiodic firing neurons have a higher sensitivity to drugs than periodic firing neurons have been reported for the chronically compressed dorsal root ganglion neurons in rats. In this study, the dynamical mechanisms for such a phenomenon are uncovered from the viewpoint of dynamical systems theory. We use the Rose-Hindmarsh neuron model to illustrate our opinions. Periodic orbit theory is introduced to characterize the dynamical behavior of aperiodic firing neurons. It is considered that bifurcations, crises and sensitive dependence of chaotic motions on control parameters can be the underlying mechanisms. And then, a similar analysis is applied to the modified Chay model describing the firing behavior of pancreatic beta cells. The same dynamical mechanisms can be obtained underlying that aperiodic firing cells are more sensitive to external stimulation than periodic firing ones. As a result, we conjecture that sensitive response of aperiodic firing cells to external stimulation is a universal property of excitable cells

  17. PERIODIC AND APERIODIC VARIABILITY IN THE MOLECULAR CLOUD ρ OPHIUCHUS

    International Nuclear Information System (INIS)

    Parks, J. Robert; Plavchan, Peter; Gee, Alan H.; White, Russel J.

    2014-01-01

    Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K s -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK s -band amplitudes from 0.044 to 2.31 mag and Δ(J – K s ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K s time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief variability mechanism

  18. PERIODIC AND APERIODIC VARIABILITY IN THE MOLECULAR CLOUD ρ OPHIUCHUS

    Energy Technology Data Exchange (ETDEWEB)

    Parks, J. Robert; Plavchan, Peter; Gee, Alan H. [Infrared Processing and Analysis Center, California Institute of Technology, Mail Code 100-22, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); White, Russel J., E-mail: parksj@chara.gsu.edu [Georgia State University, Department of Physics and Astronomy, 25 Park Place, Room 605, Atlanta, GA 30303 (United States)

    2014-03-01

    Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K{sub s} -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK{sub s} -band amplitudes from 0.044 to 2.31 mag and Δ(J – K{sub s} ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K{sub s} time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief

  19. Computational Modeling of Bloch Surface Waves in One-Dimensional Periodic and Aperiodic Multilayer Structures

    Science.gov (United States)

    Koju, Vijay

    -numerical approach, we show that a 1D photonic crystal, a multilayer structure composed of alternating layers of TiO2 and SiO2 , can be used to slow down light by a factor of up to 400. The results also show that better control of the speed of light can be achieved by changing the number of bilayers and the air-gap thickness appropriately. The existence of Bloch surface waves in periodic dielectric multilayer structures with a surface defect is well-known. Not yet recognized is that quasi-crystals and aperiodic dielectric multilayers can also support Bloch-like surface waves. We numerically show the excitation of Bloch-like surface waves in Fibonacci quasi-crystals, Thue-Morse aperiodic dielectric multilayers using the prism coupling method. We report improved surface electric field intensity and penetration depth of Bloch-like surface waves in the air side in such structures compared to their periodic counterparts. Bloch surface waves have also demonstrated significant potential in the field of bios-ensing technology. We further extend our study into a new type of multilayer structure based on Maximal-length sequence, which is a pseudo random sequence. We study the characteristics of Bloch surface waves in a 32 layered Maximal-length sequence multilayer and perform angular, as well as spectral sensitivity analysis for refractive index change detection. We demonstrate numerically that Maximal-length sequence multilayers significantly enhance the sensitivity of Bloch surface waves. Another type of structure that support Bloch surface waves are dielectric multilayer structures with a grating profile on the top-most layer. The grating profile adds an additional degree of freedom to the phase matching conditions for Bloch surface wave excitation. In such structures, the conditions for Bloch surface wave coupling can also be achieved by rotating both polar and azimuthal angles. The generation of Bloch surface waves as a function of azimuthal angle have similar characteristics to

  20. Radiation-disorder and aperiodicity in irradiated ceramics

    International Nuclear Information System (INIS)

    Hobbs, L.W.

    1992-01-01

    This final technical report documents the accomplishments of the program of research entitled ''Radiation Disorder and Aperiodicity in Irradiated Ceramics'' for the period June 22, 1989--June 21, 1992. This research forms the latest part on an on-going program, begun at MIT in 1983 under DOE support, which has had as its objectives investigation of the responses in radiation environments of ceramics heavily-irradiated with electrons, neutrons and ions, with potential applications to fusion energy technology and high-level nuclear waste storage. Materials investigated have included SiO 2 , MgAl 2 O 4 , Al 23 O 27 N 5 , SiC, BeO, LiAlO 2 , Li 2 ZrO 3 , CaTiO 3 KTaO 3 and Ca(Zr, Pu)Ti 2 O 7 . The program initially proposed for 1989 had as its major objectives two main thrusts: (1) research on defect aggregation in irradiated non-oxide ceramics, and (2) research on irradiation-induced amorphization of network silicas and phosphates

  1. Reclaiming Spare Capacity and Improving Aperiodic Response Times in Real-Time Environments

    Directory of Open Access Journals (Sweden)

    Liu Xue

    2011-01-01

    Full Text Available Abstract Scheduling recurring task sets that allow some instances of the tasks to be skipped produces holes in the schedule which are nonuniformly distributed. Similarly, when the recurring tasks are not strictly periodic but are sporadic, there is extra processor bandwidth arising because of irregular job arrivals. The additional computation capacity that results from skips or sporadic tasks can be reclaimed to service aperiodic task requests efficiently and quickly. We present techniques for improving the response times of aperiodic tasks by identifying nonuniformly distributed spare capacity—because of skips or sporadic tasks—in the schedule and adding such extra capacity to the capacity queue of a BASH server. These gaps can account for a significant portion of aperiodic capacity, and their reclamation results in considerable improvement to aperiodic response times. We present two schemes: NCLB-CBS, which performs well in periodic real-time environments with firm tasks, and NCLB-CUS, which can be deployed when the basic task set to schedule is sporadic. Evaluation via simulations and implementation suggests that performance improvements for aperiodic tasks can be obtained with limited additional overhead.

  2. Outer synchronization of complex networks with internal delay and coupling delay via aperiodically intermittent pinning control

    Science.gov (United States)

    Zhang, Chuan; Wang, Xingyuan; Wang, Chunpeng; Xia, Zhiqiu

    This paper concerns the outer synchronization problem between two complex delayed networks via the method of aperiodically intermittent pinning control. Apart from previous works, internal delay and coupling delay are both involved in this model, and the designed intermittent controllers can be aperiodic. The main work in this paper can be summarized as follows: First, two cases of aperiodically intermittent control with constant gain and adaptive gain are implemented, respectively. The intermittent control and pinning control are combined to reduce consumptions further. Then, based on the Lyapunov stability theory, synchronization protocols are given by strict derivation. Especially, the designed controllers are indeed simple and valid in application of theory to practice. Finally, numerical examples put the proposed control methods to the test.

  3. Structural color of a lycaenid butterfly: analysis of an aperiodic multilayer structure

    International Nuclear Information System (INIS)

    Yoshioka, S; Shimizu, Y; Kinoshita, S; Matsuhana, B

    2013-01-01

    We investigated the structural color of the green wing of the lycaenid butterfly Chrysozephyrus brillantinus. Electron microscopy revealed that the bottom plate of the cover scale on the wing consists of an alternating air–cuticle multilayer structure. However, the thicknesses of the layers were not constant but greatly differed depending on the layer, unlike the periodic multilayer designs often adopted for artificial laser-reflecting mirrors. The agreement between the experimentally determined and theoretically calculated reflectance spectra led us to conclude that the multilayer interference in the aperiodic system is the primary origin of the structural color. We analyzed optical interference in this aperiodic system using a simple analytical model and found that two spectral peaks arise from constructive interference among different parts of the multilayer structure. We discuss the advantages and disadvantages of the aperiodic system over a periodic one. (paper)

  4. An aperiodic phenomenon of the unscented Kalman filter in filtering noisy chaotic signals

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    A non-periodic oscillatory behavior of the unscented Kalman filter (UKF) when used to filter noisy contaminated chaotic signals is reported. We show both theoretically and experimentally that the gain of the UKF may not converge or diverge but oscillate aperiodically. More precisely, when a nonlinear system is periodic, the Kalman gain and error covariance of the UKF converge to zero. However, when the system being considered is chaotic, the Kalman gain either converges to a fixed point with a magnitude larger than zero or oscillates aperiodically.

  5. Acoustic transmittance of an aperiodic deterministic multilayer structure

    International Nuclear Information System (INIS)

    Madrigal-Melchor, J; Enciso-Muñoz, A; Contreras-Solorio, D A

    2013-01-01

    We study theoretically the acoustic transmission for a multilayer structure where the characteristic acoustic impedance follows the values generated by the self-similar sequence called the 1 s counting sequence . The transmission spectrum shows clearly self-similarity characteristics.

  6. Wide Area Prosumption Control and Sensitivities of Aperiodic Small Signal Stability Indicators

    DEFF Research Database (Denmark)

    Wittrock, Martin Lindholm; Jóhannsson, Hjörtur; Nielsen, Arne Hejde

    2014-01-01

    and patterns, stability indicators for aperiodic small signal angular stability (ASSA) are examined, while the concept of prosumption is described. The methodology presented is shown to be able to assess the margin to instability and to predict how this margin can be affected if a load is changed in the grid...

  7. Wide-Area Assessment of Aperiodic Small Signal Rotor Angle Stability in Real-Time

    DEFF Research Database (Denmark)

    Jóhannsson, Hjörtur; Nielsen, Arne Hejde; Østergaard, Jacob

    2014-01-01

    in rotor angle and a loss of synchronism, referred to as aperiodic small signal instability. The paper provides the theoretical background of the method and an analytical assessment criterion. Furthermore, a mathematical mapping of the generators' operating points that enables informative visualization...

  8. Influences of Fundamental Frequency, Formant Frequencies, Aperiodicity, and Spectrum Level on the Perception of Voice Gender

    Science.gov (United States)

    Skuk, Verena G.; Schweinberger, Stefan R.

    2014-01-01

    Purpose: To determine the relative importance of acoustic parameters (fundamental frequency [F0], formant frequencies [FFs], aperiodicity, and spectrum level [SL]) on voice gender perception, the authors used a novel parameter-morphing approach that, unlike spectral envelope shifting, allows the application of nonuniform scale factors to transform…

  9. Aperiodic spin state ordering of bistable molecules and its photoinducede erasing

    Czech Academy of Sciences Publication Activity Database

    Collet, E.; Watanabe, H.; Bréfuel, N.; Palatinus, Lukáš; Roudaut, L.; Toupet, L.; Tanaka, K.; Tuchagues, J.-P.; Fertey, P.; Ravy, S.; Toudic, B.; Cailleau, H.

    2012-01-01

    Roč. 109, č. 25 (2012), "257206-1"-"257206-5" ISSN 0031-9007 Institutional research plan: CEZ:AV0Z10100521 Keywords : photocrystallography * aperiodic structure * spin-state ordering Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 7.943, year: 2012

  10. Near-to far-field transformation in the aperiodic Fourier modal method

    NARCIS (Netherlands)

    Rook, R.; Pisarenco, M.; Setija, I.D.

    2013-01-01

    This paper addresses the task of obtaining the far-field spectrum for a finite structure given the near-field calculated by the aperiodic Fourier modal method in contrast-field formulation (AFMM-CFF). The AFMM-CFF efficiently calculates the solution to Maxwell's equations for a finite structure by

  11. Improving emission uniformity and linearizing band dispersion in nanowire arrays using quasi-aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, P. Duke [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Koleske, Daniel D. [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Povinelli, Michelle L. [Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Subramania, Ganapathi [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States)

    2017-10-01

    For this study, we experimentally investigate a new class of quasi-aperiodic structures for improving the emission pattern in nanowire arrays. Efficient normal emission, as well as lasing, can be obtained from III-nitride photonic crystal (PhC) nanowire arrays that utilize slow group velocity modes near the Γ-point in reciprocal space. However, due to symmetry considerations, the emitted far-field pattern of such modes are often ‘donut’-like. Many applications, including lighting for displays or lasers, require a more uniform beam profile in the far-field. Previous work has improved far-field beam uniformity of uncoupled modes by changing the shape of the emitting structure. However, in nanowire systems, the shape of nanowires cannot always be arbitrarily changed due to growth or etch considerations. Here, we investigate breaking symmetry by instead changing the position of emitters. Using a quasi-aperiodic geometry, which changes the emitter position within a photonic crystal supercell (2x2), we are able to linearize the photonic bandstructure near the Γ-point and greatly improve emitted far-field uniformity. We realize the III-nitride nanowires structures using a top-down fabrication procedure that produces nanowires with smooth, vertical sidewalls. Comparison of room-temperature micro-photoluminescence (µ-PL) measurements between periodic and quasi-aperiodic nanowire arrays reveal resonances in each structure, with the simple periodic structure producing a donut beam in the emitted far-field and the quasi-aperiodic structure producing a uniform Gaussian-like beam. We investigate the input pump power vs. output intensity in both systems and observe the simple periodic array exhibiting a non-linear relationship, indicative of lasing. We believe that the quasi-aperiodic approach studied here provides an alternate and promising strategy for shaping the emission pattern of nanoemitter systems.

  12. Simulation methods for multiperiodic and aperiodic nanostructured dielectric waveguides

    DEFF Research Database (Denmark)

    Paulsen, Moritz; Neustock, Lars Thorben; Jahns, Sabrina

    2017-01-01

    on Rudin–Shapiro, Fibonacci, and Thue–Morse binary sequences. The near-field and far-field properties are computed employing the finite-element method (FEM), the finite-difference time-domain (FDTD) method as well as a rigorous coupled wave algorithm (RCWA). The results show that all three methods...

  13. Simulation Methods for Multiperiodic and Aperiodic Nanostructured Dielectric Waveguides

    DEFF Research Database (Denmark)

    Paulsen, Moritz; Neustock, Lars Thorben; Jahns, Sabrina

    on Rudin-Shapiro, Fibonacci, and Thue-Morse binary sequences. The near-field and far-field properties are calculated employing the finite-element method (FEM), the finite- difference time-domain (FDTD) method as well as a rigorous coupled wave algorithm (RCWA). References [1] S. V. Boriskina, A. Gopinath...

  14. Wide-Area Assessment of Aperiodic Small Signal Rotor Angle Stability in Real-Time

    DEFF Research Database (Denmark)

    Jóhannsson, Hjörtur; Nielsen, Arne Hejde; Østergaard, Jacob

    2013-01-01

    This paper presents the details of a new real-time stability assessment method. The method assesses a particular mechanism of stability: each generator’s capability to generate sufficient steady state electromechanical torque. The lack of sufficient steady state torque causes aperiodic increase...... of multiple operating points is derived in the paper. Finally, results from time-domain simulation of instability scenarios in the Nordic32 test system are presented and results used for testing the assessment method. The results illustrate the method’s capability to efficiently identify the location...... in rotor angle and a loss of synchronism, referred to as aperiodic small signal instability. The paper provides the theoretical background of the method and an analytical assessment criterion. Furthermore, a mathematical mapping of the generators’ operating points that enables informative visualization...

  15. Aperiodic signals processing via parameter-tuning stochastic resonance in a photorefractive ring cavity

    Directory of Open Access Journals (Sweden)

    Xuefeng Li

    2014-04-01

    Full Text Available Based on solving numerically the generalized nonlinear Langevin equation describing the nonlinear dynamics of stochastic resonance by Fourth-order Runge-Kutta method, an aperiodic stochastic resonance based on an optical bistable system is numerically investigated. The numerical results show that a parameter-tuning stochastic resonance system can be realized by choosing the appropriate optical bistable parameters, which performs well in reconstructing aperiodic signals from a very high level of noise background. The influences of optical bistable parameters on the stochastic resonance effect are numerically analyzed via cross-correlation, and a maximum cross-correlation gain of 8 is obtained by optimizing optical bistable parameters. This provides a prospective method for reconstructing noise-hidden weak signals in all-optical signal processing systems.

  16. Analysis of Nonlinear Periodic and Aperiodic Media: Application to Optical Logic Gates

    Science.gov (United States)

    Yu, Yisheng

    This dissertation is about the analysis of nonlinear periodic and aperiodic media and their application to the design of intensity controlled all optical logic gates: AND, OR, and NOT. A coupled nonlinear differential equation that characterizes the electromagnetic wave propagation in a nonlinear periodic (and aperiodic) medium has been derived from the first principle. The equations are general enough that it reflects the effect of transverse modal fields and can be used to analyze both co-propagating and counter propagating waves. A numerical technique based on the finite differences method and absorbing boundary condition has been developed to solve the coupled differential equations here. The numerical method is simple and accurate. Unlike the method based on characteristics that has been reported in the literature, this method does not involve integration and step sizes of time and space coordinates are decoupled. The decoupling provides independent choice for time and space step sizes. The concept of "gap soliton" has also been re-examined. The dissertation consists of four manuscripts. Manuscript I reports on the design of all optical logic gates: AND, OR, and NOT based on the bistability property of nonlinear periodic and aperiodic waveguiding structures. The functioning of the logic gates has been shown by analysis. The numerical technique that has been developed to solve the nonlinear differential equations are addressed in manuscript II. The effect of transverse modal fields on the bistable property of nonlinear periodic medium is reported in manuscript III. The concept of "gap soliton" that are generated in a nonlinear periodic medium has been re-examined. The details on the finding of the re-examination are discussed in manuscript IV.

  17. Periodic and aperiodic flow patterns around an airfoil with leading-edge protuberances

    Science.gov (United States)

    Cai, Chang; Zuo, Zhigang; Maeda, Takao; Kamada, Yasunari; Li, Qing'an; Shimamoto, Kensei; Liu, Shuhong

    2017-11-01

    Recently leading-edge protuberances have attracted great attention as a passive method for separation control. In this paper, the effect of multiple leading-edge protuberances on the performance of a two-dimensional airfoil is investigated through experimental measurement of aerodynamic forces, surface tuft visualization, and numerical simulation. In contrast to the sharp stall of the baseline airfoil with large hysteresis effect during AOA (angle of attack) increasing and decreasing, the stall process of the modified airfoil with leading-edge protuberances is gentle and stable. Flow visualization revealed that the flow past each protuberance is periodic and symmetric at small AOAs. Streamwise vortices are generated on the shoulders of the protuberance, leading to a larger separation around the valley sections and a longer attachment along the peak sections. When some critical AOA is exceeded, aperiodic and asymmetric flow patterns occur on the protuberances at different spanwise positions, with leading-edge separation on some of the valley sections and non-stalled condition elsewhere. A combined mechanism, involving both the compartmentalization effect of the slender momentum-enhanced attached flows on the protuberance peaks and the downwash effect of the local stalled region with low circulation, is proposed to explain the generation of the aperiodic flow patterns. The influence of the number of protuberances is also investigated, which shows similar aperiodic flow patterns. The distance between the neighboring local stalled valley sections is found to be in the range of 4-7 times the protuberance wavelength. According to the proposed mechanism, it is speculated that the distance between the neighboring local stalled valley sections is inclined to increase with a smaller protuberance amplitude or at a larger AOA.

  18. Optimized emission in nanorod arrays through quasi-aperiodic inverse design.

    Science.gov (United States)

    Anderson, P Duke; Povinelli, Michelle L

    2015-06-01

    We investigate a new class of quasi-aperiodic nanorod structures for the enhancement of incoherent light emission. We identify one optimized structure using an inverse design algorithm and the finite-difference time-domain method. We carry out emission calculations on both the optimized structure as well as a simple periodic array. The optimized structure achieves nearly perfect light extraction while maintaining a high spontaneous emission rate. Overall, the optimized structure can achieve a 20%-42% increase in external quantum efficiency relative to a simple periodic design, depending on material quality.

  19. Combinations of response-reinforcer relations in periodic and aperiodic schedules.

    Science.gov (United States)

    Kuroda, Toshikazu; Cançado, Carlos R X; Lattal, Kennon A; Elcoro, Mirari; Dickson, Chata A; Cook, James E

    2013-03-01

    Key pecking of 4 pigeons was studied under a two-component multiple schedule in which food deliveries were arranged according to a fixed and a variable interfood interval. The percentage of response-dependent food in each component was varied, first in ascending (0, 10, 30, 70 and 100%) and then in descending orders, in successive conditions. The change in response rates was positively related to the percentage of response-dependent food in each schedule component. Across conditions, positively accelerated and linear patterns of responding occurred consistently in the fixed and variable components, respectively. These results suggest that the response-food dependency determines response rates in periodic and aperiodic schedules, and that the temporal distribution of food determines response patterns independently of the response-food dependency. Running rates, but not postfood pauses, also were positively related to the percentage of dependent food in each condition, in both fixed and variable components. Thus, the relation between overall response rate and the percentage of dependent food was mediated by responding that occurred after postfood pausing. The findings together extend previous studies wherein the dependency was either always present or absent, and increase the generality of the effects of variations in the response-food dependency from aperiodic to periodic schedules. © Society for the Experimental Analysis of Behavior.

  20. Investigation of aperiodic W/C multi-layer mirror for X-ray optics

    International Nuclear Information System (INIS)

    Wang Zhanshan; Cheng Xinbin; Zhu Jingtao; Huang Qiushi; Zhang Zhong; Chen Lingyan

    2011-01-01

    Design, fabrication and characterization of aperiodic tungsten/carbon (W/C) multi-layer mirror were studied. W/C multi-layer was designed as a broad-angle reflective supermirror for Cu-Kα line (λ = 0.154 nm) in the grazing incident angular range (0.9-1.1 deg.) using simulated annealing algorithm. To deposit the W/C depth-graded multi-layer mirror accurately, we introduce an effective layer growth rate as a function of layer thickness. This method greatly improves the reflectivity curve compared to the conventional multi-layer mirror prepared with constant growth rate. The deposited multi-layer mirror exhibits an average reflectivity of 19% over the grazing incident angle range of 0.88-1.08 deg. which mainly coincides with the designed value. Furthermore, the physical mechanisms were discussed and the re-sputtering process of light-atom layers is accounted for the modification of layer thicknesses which leads to the effective growth rates. Using this calibration method, the aperiodic multi-layer mirrors can be better fabricated for X-ray optics.

  1. Aperiodic linear networked control considering variable channel delays: application to robots coordination.

    Science.gov (United States)

    Santos, Carlos; Espinosa, Felipe; Santiso, Enrique; Mazo, Manuel

    2015-05-27

    One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

  2. Aperiodic Linear Networked Control Considering Variable Channel Delays: Application to Robots Coordination

    Directory of Open Access Journals (Sweden)

    Carlos Santos

    2015-05-01

    Full Text Available One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

  3. Application of the three-dimensional aperiodic Fourier modal method using arc elements in curvilinear coordinates.

    Science.gov (United States)

    Bucci, Davide; Martin, Bruno; Morand, Alain

    2012-03-01

    This paper deals with a full vectorial generalization of the aperiodic Fourier modal method (AFMM) in cylindrical coordinates. The goal is to predict some key characteristics such as the bending losses of waveguides having an arbitrary distribution of the transverse refractive index. After a description of the method, we compare the results of the cylindrical coordinates AFMM with simulations by the finite-difference time-domain (FDTD) method performed on an S-bend structure made by a 500 nm × 200 nm silicon core (n=3.48) in silica (n=1.44) at a wavelength λ=1550 nm, the bending radius varying from 0.5 up to 2 μm. The FDTD and AFMM results show differences comparable to the variations obtained by changing the parameters of the FDTD simulations.

  4. Real-time remedial action against aperiodic small signal rotor angle instability

    DEFF Research Database (Denmark)

    Weckesser, Johannes Tilman Gabriel; Jóhannsson, Hjörtur; Østergaard, Jacob

    2016-01-01

    This paper presents a method that in real-time determines remedial actions, which restore stable operation with respect to aperiodic small signal rotor angle stability (ASSRAS) when insecure or unstable operation has been detected. An ASSRAS assessment method is used to monitor the stability...... impedance plane to determine an active power redispatch among selected generators to restore stable and secure operation. Since the method is purely based on analytically derived expression, the computation of the remedial actions is fast and well suited for real-time operation. The method was tested...... boundary for each generator in real-time. The ASSRAS boundary represents the condition when a generator reaches the maximum steady state active power injection. The proposed control method exploits analytically derived expressions for the ASSRAS boundary and other characteristic curves in the injection...

  5. Stochastic resonance in a bistable system subject to multi-time-delayed feedback and aperiodic signal

    International Nuclear Information System (INIS)

    Li Jianlong; Zeng Lingzao

    2010-01-01

    We discuss in detail the effects of the multi-time-delayed feedback driven by an aperiodic signal on the output of a stochastic resonance (SR) system. The effective potential function and dynamical probability density function (PDF) are derived. To measure the performance of the SR system in the presence of a binary random signal, the bit error rate (BER) defined by the dynamical PDF is employed, as is commonly used in digital communications. We find that the delay time, strength of the feedback, and number of time-delayed terms can change the effective potential function and the effective amplitude of the signal, and then affect the BER of the SR system. The numerical simulations strongly support the theoretical results. The goal of this investigation is to explore the effects of the multi-time-delayed feedback on SR and give a guidance to nonlinear systems in the application of information processing.

  6. Multispectral selective near-perfect light absorption by graphene monolayer using aperiodic multilayer microstructures

    Science.gov (United States)

    Zand, Iman; Dalir, Hamed; Chen, Ray T.; Dowling, Jonathan P.

    2018-03-01

    We investigate one-dimensional aperiodic multilayer microstructures in order to achieve near-total absorptions at preselected wavelengths in a graphene monolayer. The proposed structures are designed using a genetic optimization algorithm coupled to a transfer matrix code. Coupled-mode-theory analysis, consistent with transfer matrix method results, indicates the existence of a critical coupling in the graphene monolayer for perfect absorptions. Our findings show that the near-total-absorption peaks are highly tunable and can be controlled simultaneously or independently in a wide range of wavelengths in the near-infrared and visible ranges. The proposed approach is metal-free, does not require surface texturing or patterning, and can be also applied for other two-dimensional materials.

  7. Aperiodic pressure pulsation under non optimal hydraulic turbine regimes at low swirl number

    Science.gov (United States)

    Skripkin, S. G.; Tsoy, M. A.; Kuibin, P. A.; Shtork, S. I.

    2017-09-01

    Off-design operating conditions of hydraulic turbines is hindered by pressure fluctuations in the draft tube of the turbine. A precessing helical vortex rope develops, which imperils the mechanical structure and limits the operation flexibility of hydropower station. Understanding of the underlying instabilities of precessing vortex rope at low swirl number is incomplete. In this paper flow regimes with different residual swirl is analysed, particular attention is paid to the regime with a small swirl parameter. Study defines upper and low boundaries of regime where aperiodic pressure surge is observed. Flow field at the runner exit is investigated by Laser Doppler Velocimetry and high-speed visualizations, which are complemented draft tube wall pressure measurements.

  8. Design of an amplifier model accounting for thermal effect in fully aperiodic large pitch fibers

    Science.gov (United States)

    Tragni, K.; Molardi, C.; Poli, F.; Dauliat, R.; Leconte, B.; Darwich, D.; du Jeu, R.; Malleville, M. A.; Jamier, R.; Selleri, S.; Roy, P.; Cucinotta, A.

    2018-02-01

    Yb-doped Photonic Crystal Fibers (PCFs) have triggered a significant power scaling into fiber-based lasers. However thermally-induced effects, like mode instability, can compromise the output beam quality. PCF design with improved Higher Order Mode (HOM) delocalization and effective thermal resilience can contain the problem. In particular, Fully- Aperiodic Large-Pitch Fibers (FA-LPFs) have shown interesting properties in terms of resilience to thermal effects. In this paper the performances of a Yb-doped FA-LPF amplifier are experimentally and numerically investigated. Modal properties and gain competition between Fundamental Mode (FM) and first HOM have been calculated, in presence of thermal effects. The main doped fiber characteristics have been derived by comparison between experimental and numerical results.

  9. Applied optics. Gain modulation by graphene plasmons in aperiodic lattice lasers.

    Science.gov (United States)

    Chakraborty, S; Marshall, O P; Folland, T G; Kim, Y-J; Grigorenko, A N; Novoselov, K S

    2016-01-15

    Two-dimensional graphene plasmon-based technologies will enable the development of fast, compact, and inexpensive active photonic elements because, unlike plasmons in other materials, graphene plasmons can be tuned via the doping level. Such tuning is harnessed within terahertz quantum cascade lasers to reversibly alter their emission. This is achieved in two key steps: first, by exciting graphene plasmons within an aperiodic lattice laser and, second, by engineering photon lifetimes, linking graphene's Fermi energy with the round-trip gain. Modal gain and hence laser spectra are highly sensitive to the doping of an integrated, electrically controllable, graphene layer. Demonstration of the integrated graphene plasmon laser principle lays the foundation for a new generation of active, programmable plasmonic metamaterials with major implications across photonics, material sciences, and nanotechnology. Copyright © 2016, American Association for the Advancement of Science.

  10. On the algebraic characterization of aperiodic tilings related to ADE-root systems

    International Nuclear Information System (INIS)

    Kellendonk, J.

    1992-09-01

    The algebraic characterization of sets of locally equivalent aperiodic tilings, being examples of quantum spaces, is conducted for a certain type of tilings in a manner proposed by A. Connes. These 2-dimensional tilings are obtained by application of the strip method to the root lattice of an ADE-Coxeter group. The plane along which the strip is constructed is determined by the canonical Coxeter element leading to the result that a 2- dimensional tiling decomposes into a cartesian product of two 1- dimensional tilings. The properties of the tilings are investigated, including selfsimilarity, and the determination of the relevant algebraic is considered, namely the ordered K 0 -group of an algebra naturaly assigned to the quantum space. The result also yields an application of the 2-dimensional abstract gap labelling theorem. (orig.)

  11. The Time Is Up: Compression of Visual Time Interval Estimations of Bimodal Aperiodic Patterns

    Science.gov (United States)

    Duarte, Fabiola; Lemus, Luis

    2017-01-01

    The ability to estimate time intervals subserves many of our behaviors and perceptual experiences. However, it is not clear how aperiodic (AP) stimuli affect our perception of time intervals across sensory modalities. To address this question, we evaluated the human capacity to discriminate between two acoustic (A), visual (V) or audiovisual (AV) time intervals of trains of scattered pulses. We first measured the periodicity of those stimuli and then sought for correlations with the accuracy and reaction times (RTs) of the subjects. We found that, for all time intervals tested in our experiment, the visual system consistently perceived AP stimuli as being shorter than the periodic (P) ones. In contrast, such a compression phenomenon was not apparent during auditory trials. Our conclusions are: first, the subjects exposed to P stimuli are more likely to measure their durations accurately. Second, perceptual time compression occurs for AP visual stimuli. Lastly, AV discriminations are determined by A dominance rather than by AV enhancement. PMID:28848406

  12. Dual-wavelength green laser with a 4.5 THz frequency difference based on self-frequency- doubling in Nd3+ -doped aperiodically poled lithium niobate.

    Science.gov (United States)

    Maestre, H; Torregrosa, A J; Fernández-Pousa, C R; Rico, M L; Capmany, J

    2008-05-01

    We report a dual-wavelength continuous-wave laser at 542.4 and 546.8 nm based on an Nd(3+)-doped aperiodically poled lithium niobate crystal. Two fundamental infrared (IR) wavelengths at 1084.8 and 1093.6 nm are simultaneously oscillated and self-frequency-doubled to green. The aperiodic domain distribution patterned in the crystal allows for quasi-phase matched self-frequency-doubling of both IR fundamentals while avoiding their sum-frequency mixing.

  13. Aperiodic dynamics in a deterministic adaptive network model of attitude formation in social groups

    Science.gov (United States)

    Ward, Jonathan A.; Grindrod, Peter

    2014-07-01

    Adaptive network models, in which node states and network topology coevolve, arise naturally in models of social dynamics that incorporate homophily and social influence. Homophily relates the similarity between pairs of nodes' states to their network coupling strength, whilst social influence causes coupled nodes' states to convergence. In this paper we propose a deterministic adaptive network model of attitude formation in social groups that includes these effects, and in which the attitudinal dynamics are represented by an activato-inhibitor process. We illustrate that consensus, corresponding to all nodes adopting the same attitudinal state and being fully connected, may destabilise via Turing instability, giving rise to aperiodic dynamics with sensitive dependence on initial conditions. These aperiodic dynamics correspond to the formation and dissolution of sub-groups that adopt contrasting attitudes. We discuss our findings in the context of cultural polarisation phenomena. Social influence. This reflects the fact that people tend to modify their behaviour and attitudes in response to the opinions of others [22-26]. We model social influence via diffusion: agents adjust their state according to a weighted sum (dictated by the evolving network) of the differences between their state and the states of their neighbours. Homophily. This relates the similarity of individuals' states to their frequency and strength of interaction [27]. Thus in our model, homophily drives the evolution of the weighted ‘social' network. A precise formulation of our model is given in Section 2. Social influence and homophily underpin models of social dynamics [21], which cover a wide range of sociological phenomena, including the diffusion of innovations [28-32], complex contagions [33-36], collective action [37-39], opinion dynamics [19,20,40,10,11,13,15,41,16], the emergence of social norms [42-44], group stability [45], social differentiation [46] and, of particular relevance

  14. Synchronization of coupled stochastic complex-valued dynamical networks with time-varying delays via aperiodically intermittent adaptive control

    Science.gov (United States)

    Wang, Pengfei; Jin, Wei; Su, Huan

    2018-04-01

    This paper deals with the synchronization problem of a class of coupled stochastic complex-valued drive-response networks with time-varying delays via aperiodically intermittent adaptive control. Different from the previous works, the intermittent control is aperiodic and adaptive, and the restrictions on the control width and time delay are removed, which lead to a larger application scope for this control strategy. Then, based on the Lyapunov method and Kirchhoff's Matrix Tree Theorem as well as differential inequality techniques, several novel synchronization conditions are derived for the considered model. Specially, impulsive control is also considered, which can be seen as a special case of the aperiodically intermittent control when the control width tends to zero. And the corresponding synchronization criteria are given as well. As an application of the theoretical results, a class of stochastic complex-valued coupled oscillators with time-varying delays is studied, and the numerical simulations are also given to demonstrate the effectiveness of the control strategies.

  15. Competition model for aperiodic stochastic resonance in a Fitzhugh-Nagumo model of cardiac sensory neurons.

    Science.gov (United States)

    Kember, G C; Fenton, G A; Armour, J A; Kalyaniwalla, N

    2001-04-01

    Regional cardiac control depends upon feedback of the status of the heart from afferent neurons responding to chemical and mechanical stimuli as transduced by an array of sensory neurites. Emerging experimental evidence shows that neural control in the heart may be partially exerted using subthreshold inputs that are amplified by noisy mechanical fluctuations. This amplification is known as aperiodic stochastic resonance (ASR). Neural control in the noisy, subthreshold regime is difficult to see since there is a near absence of any correlation between input and the output, the latter being the average firing (spiking) rate of the neuron. This lack of correlation is unresolved by traditional energy models of ASR since these models are unsuitable for identifying "cause and effect" between such inputs and outputs. In this paper, the "competition between averages" model is used to determine what portion of a noisy, subthreshold input is responsible, on average, for the output of sensory neurons as represented by the Fitzhugh-Nagumo equations. A physiologically relevant conclusion of this analysis is that a nearly constant amount of input is responsible for a spike, on average, and this amount is approximately independent of the firing rate. Hence, correlation measures are generally reduced as the firing rate is lowered even though neural control under this model is actually unaffected.

  16. A novel scenario of aperiodical impacts appearance in the turbine draft tube

    Science.gov (United States)

    Alekseenko, S. V.; Kuibin, P. A.; Shtork, S. I.; Skripkin, S. G.; Sonin, V. I.; Tsoy, M. A.; Ustimenko, A. S.

    2016-11-01

    The swirling flow in the discharge cone of hydroturbine is characterized by various self-induced instabilities and associated low frequency phenomena when the turbine is operated far from the best efficiency point. In particular, the precessing vortex rope develops at part-load regimes in the draft tube. This rope can serve a reason of the periodical low- frequency pressure oscillations in the whole hydrodynamical system. During the experimental research of flow structure in the discharge cone in a regime of free runner new interesting phenomenon was discovered. Due to instability some coils of helical vortex close to each other and reconnection appears with generation of a vortex ring. The experiments were fulfilled at the cavitational conditions when a cavity arises in the vortex core. So the phenomenon was registered with help of visualization by the high speed video recording. The vortex ring after the reconnection moves apart from the main vortex rope toward the wall and downstream. When it reaches the area with high pressure the cavity collapses with generation of pressure impact. The mechanism of cavitational vortex rings generation and their further collapse can serve as a prototype of the aperiodical pressure impacts inside the turbine draft tube.

  17. Theoretical and experimental study of bent fully aperiodic large-pitch fibers for enhancing the high-order modes delocalization

    Science.gov (United States)

    du Jeu, Rémi; Dauliat, Romain; Darwich, Dia; Auguste, Jean-Louis; Benoît, Aurélien; Leconte, Baptiste; Malleville, Marie-Alicia; Jamier, Raphaël.; Schuster, Kay; Roy, Philippe

    2018-02-01

    The power scaling of fiber lasers and amplifiers has triggered an extensive development of large-mode area fibers among which the most promising are the distributed mode filtering fibers and the large-pitch fibers. These structures enable for an effective higher-order modes delocalization and subsequently a singlemode emission. An interesting alternative consists in using the fully-aperiodic large-pitch fibers, into which the standard air-silica photonic crystal cladding is replaced by an aperiodic pattern made of solid low-index inclusions cladding. However, in such a structure, the core and the background cladding material surrounding it must have rigorously the same refractive index. Current synthesis processes and measurement techniques offer respectively a maximum resolution of 5×10-4 and 1×10-4 while the indexmatching must be as precise as 1×10-5 . Lately a gain material with a refractive index 1.5×10-4 higher than that of the background cladding material was fabricated, thus re-confining the first higher-order modes in the core. A numerical study is carried out on the benefit of bending such fully-aperiodic fiber to counteract this phenomenon. Optimized bending axis and radius have been determined. Experiments are done in a laser cavity operating at 1030 nm using an 88cm-long 51μm core diameter ytterbium-doped fiber. Results demonstrate an improvement of the M2 from 1.7 when the fiber is kept straight to 1.2 when it is bent with a 100 to 60 cm bend radius. These primary results are promising for future power scaling.

  18. Spectral characterisation of aperiodic normal-incidence Sb/B4C multilayer mirrors for the λ < 124 Å range

    Science.gov (United States)

    Vishnyakov, E. A.; Kopylets, I. A.; Kondratenko, V. V.; Kolesnikov, A. O.; Pirozhkov, A. S.; Ragozin, E. N.; Shatokhin, A. N.

    2018-03-01

    Three broadband aperiodic Sb/B4C multilayer mirrors were synthesised for the purposes of soft X-ray optics and spectroscopy in the wavelength range beyond the L-edge of Si (λ plasma radiation source and an electronic detector with a 2D spatial resolution (a CCD matrix with 13 × 13 μm sized pixels). The experimental spectra are compared with theoretical calculations. The effect of lower antimony and B4C layer densities on the reflection spectra is discussed.

  19. Achieving sub-50 nm controlled diameter of aperiodic Si nanowire arrays by ultrasonic catalyst removal for photonic applications

    Science.gov (United States)

    Chaliyawala, Harsh A.; Purohit, Zeel; Khanna, Sakshum; Ray, Abhijit; Pati, Ranjan K.; Mukhopadhyay, Indrajit

    2018-05-01

    We report an alternative approach to fabricate the vertically aligned aperiodic Si nanowire arrays by controlling the diameter of the Ag nanoparticles and tuneable ultrasonic removal. The process begins by sputtering the Ag thin film (t=5 nm) on the Si/SiO2 substrates. Followed by Ag thin film, annealed for various temperature (T=300°C, 400°C, 500°C and 600°C) to selectively achieve a high density, well-spaced and diameter controlled Ag nanoparticles (AgNPs) on the Si/SiO2 substrates. The sacrificial layer of AgNPs size indicates the controlled diameter of the Si nanowire arrays. Image J analysis for various annealed samples gives an indication of the high density, uniformity and equal distribution of closely packed AgNPs. Furthermore, the AgNPs covered with Au/Pd mesh (5 nm) as a template, was removed by ultrasonication in the etchant solution for several times in different intervals of preparation. The conventional and facile metal assisted electroless etching approach was finally employed to fabricate the vertically aperiodic sub-50 nm SiNWAs, can be applicable to various nanoscale opto-electronic applications.

  20. Carl Von Clausewitz: Two Letters on Strategy

    National Research Council Canada - National Science Library

    Paret, Peter; Moran, Daniel

    1984-01-01

    .... The Army War College wishes to express its gratitude to the co-editors and translators, Professor Peter Paret, Spruance Professor of International History at Stanford University, and Dr. Daniel Moran...

  1. The evolution of the Gutenberg-Richter, b-value, throughout periodic and aperiodic stick-slip cycles

    Science.gov (United States)

    Bolton, D. C.; Riviere, J.; Marone, C.; Johnson, P. A.

    2017-12-01

    The Gutenberg-Richter earthquake size statistic, b value, is a useful proxy for documenting the state of stress on a fault and understanding precursory phenomena preceding dynamic failure. It has been shown that the b value varies systematically as a function of position within the seismic cycle. Frictional studies on intact rock samples with saw-cut faults have shown that b value decreases continuously preceding failure. For intact rock samples, the spatiotemporal changes in b value are thought to be related to the evolution of asperities and micro-cracks. However, few studies have shown how b value evolves spatially and temporally for fault zones containing gouge and wear materials. We hypothesize that the micromechanical mechanisms acting within fault gouge, such as creation and destruction of force chains, grain rolling, sliding, jamming and fracturing play an important role in the evolution of b value and that they may have distinct signatures during periodic and aperiodic cycles of stick-slip frictional motion. We report results from experiments conducted on simulated fault gouge using a biaxial deformation apparatus in a double-direct shear configuration. Acoustic emissions (AEs) are recorded at 4 MHz from 36 P-polarized piezoelectric transducers, which are embedded in steel blocks located adjacent to the fault zone. We compute the frequency-magnitude distribution of detected AEs using a moving window in events where each window is overlapped by 75%. We report on the evolution of b value as a function of normal stress and gouge layer thickness. For periodic slip events, b value reaches a maximum value immediately after a slip event and decreases continuously until the next failure. Aperiodic slip events show similar trends in b-value initially, however unlike periodic slip events, b value reaches a steady state value before failure occurs. In addition, for periodic slip events the magnitude of the change in b value scales inversely with gouge layer thickness

  2. Evidence for deterministic chaos in aperiodic oscillations of acute lymphoblastic leukemia cells in long-term culture

    Science.gov (United States)

    Lambrou, George I.; Chatziioannou, Aristotelis; Vlahopoulos, Spiros; Moschovi, Maria; Chrousos, George P.

    Biological systems are dynamic and possess properties that depend on two key elements: initial conditions and the response of the system over time. Conceptualizing this on tumor models will influence conclusions drawn with regard to disease initiation and progression. Alterations in initial conditions dynamically reshape the properties of proliferating tumor cells. The present work aims to test the hypothesis of Wolfrom et al., that proliferation shows evidence for deterministic chaos in a manner such that subtle differences in the initial conditions give rise to non-linear response behavior of the system. Their hypothesis, tested on adherent Fao rat hepatoma cells, provides evidence that these cells manifest aperiodic oscillations in their proliferation rate. We have tested this hypothesis with some modifications to the proposed experimental setup. We have used the acute lymphoblastic leukemia cell line CCRF-CEM, as it provides an excellent substrate for modeling proliferation dynamics. Measurements were taken at time points varying from 24h to 48h, extending the assayed populations beyond that of previous published reports that dealt with the complex dynamic behavior of animal cell populations. We conducted flow cytometry studies to examine the apoptotic and necrotic rate of the system, as well as DNA content changes of the cells over time. The cells exhibited a proliferation rate of nonlinear nature, as this rate presented oscillatory behavior. The obtained data have been fit in known models of growth, such as logistic and Gompertzian growth.

  3. Quantum discord and classical correlation signatures of mobility edges in one-dimensional aperiodic single-electron systems

    International Nuclear Information System (INIS)

    Gong, Longyan; Zhu, Hao; Zhao, Shengmei; Cheng, Weiwen; Sheng, Yubo

    2012-01-01

    We investigate numerically the quantum discord and the classical correlation in a one-dimensional slowly varying potential model and a one-dimensional Soukoulis–Economou ones, respectively. There are well-defined mobility edges in the slowly varying potential model, while there are discrepancies on mobility edges in the Soukoulis–Economou ones. In the slowly varying potential model, we find that extended and localized states can be distinguished by both the quantum discord and the classical correlation. There are sharp transitions in the quantum discord and the classical correlation at mobility edges. Based on these, we study “mobility edges” in the Soukoulis–Economou model using the quantum discord and the classical correlation, which gives another perspectives for these “mobility edges”. All these provide us good quantities, i.e., the quantum discord and the classical correlation, to reflect mobility edges in these one-dimensional aperiodic single-electron systems. Moreover, our studies propose a consistent interpretation of the discrepancies between previous numerical results about the Soukoulis–Economou model. -- Highlights: ► Quantum discord and classical correlation can signal mobility edges in two models. ► An interpretation for mobility edges in the Soukoulis–Economou model is proposed. ► Quantum discord and classical correlation can reflect well localization properties.

  4. Composite Binary Sequences with a Large Ensemble and Zero Correlation Zone

    Directory of Open Access Journals (Sweden)

    S. S. Yudachev

    2015-01-01

    Full Text Available The article considers a proposed class of derived signals such as composite binary sequences for application in advanced spread spectrum radio systems of various purposes, using signals based on spectrum spreading by direct sequence method. Considered composite sequences, having a representative set of lengths and unique correlation properties, compares favorably with the widely used at present large ensembles formed on a single algorithmic basis. To evaluate the properties of the composite sequences generated on the basis of two components - the Barker code and Kerdock sequences, expressions of periodic and aperiodic correlation functions are given.An algorithm for generating practical ensembles of composite sequences is presented. On the basis of the algorithm and its software implementation in C #, the samples of the sequence ensembles of various lengths were obtained and their periodic and aperiodic correlation functions and statistical characteristics were studied in detail. As an illustration, some of the most typical correlation functions are presented. The most remarkable characteristics allowing a ssessing the feasibility of using this type of sequences in the design of specific types of radio systems are considered.On the basis of the proposed program and the performed calculations the conclusions can be drawn about the possibility of using the sequences of these classes, with the aim of reducing intra-system disturbance in the projected spread spectrum CDMA.

  5. Accurate step-hold tracking of smoothly varying periodic and aperiodic probability.

    Science.gov (United States)

    Ricci, Matthew; Gallistel, Randy

    2017-07-01

    Subjects observing many samples from a Bernoulli distribution are able to perceive an estimate of the generating parameter. A question of fundamental importance is how the current percept-what we think the probability now is-depends on the sequence of observed samples. Answers to this question are strongly constrained by the manner in which the current percept changes in response to changes in the hidden parameter. Subjects do not update their percept trial-by-trial when the hidden probability undergoes unpredictable and unsignaled step changes; instead, they update it only intermittently in a step-hold pattern. It could be that the step-hold pattern is not essential to the perception of probability and is only an artifact of step changes in the hidden parameter. However, we now report that the step-hold pattern obtains even when the parameter varies slowly and smoothly. It obtains even when the smooth variation is periodic (sinusoidal) and perceived as such. We elaborate on a previously published theory that accounts for: (i) the quantitative properties of the step-hold update pattern; (ii) subjects' quick and accurate reporting of changes; (iii) subjects' second thoughts about previously reported changes; (iv) subjects' detection of higher-order structure in patterns of change. We also call attention to the challenges these results pose for trial-by-trial updating theories.

  6. Experimental investigation of the transverse modal instabilities onset in high power fully-aperiodic-large-pitch fiber lasers

    Science.gov (United States)

    Malleville, Marie-Alicia; Benoît, Aurélien; Dauliat, Romain; Leconte, Baptiste; Darwich, Dia; du Jeu, Rémi; Jamier, Raphaël.; Schwuchow, Anka; Schuster, Kay; Roy, Philippe

    2018-02-01

    Over the last decade, significant work has been carried out in order to increase the energy/peak power provided by fiber lasers. Indeed, new microstructured fibers with large (or very large) mode area cores (LMA) such as Distributed Mode Filtering (DMF) fibers and Large-Pitch Fibers (LPF) have been developed to address this concern. These technologies have allowed diffraction-limited emission with core diameters higher than 80 μm, and have state-of-the-art performances in terms of pulse energy or peak power while keeping an excellent spatial beam quality. Although these fibers were designed to reach high power levels while maintaining a single transverse mode propagation, power scaling becomes quickly limited by the onset of transverse modal instabilities (TMI). This effect suddenly arises when a certain average power threshold is exceeded, drastically degrading the emitted beam quality. In this work, we investigate the influence of the core dimensions and the refractive index mismatch between the active core and the background cladding material, on the TMI power threshold in rod-type Fully-Aperiodic-LPF. This fiber structure was specifically designed to enhance the higher-order modes (HOMs) delocalization out of the gain region and thus push further the onset of modal instabilities. Using a 400W pump diode at 976 nm, the power scaling, as well as the spatial beam quality and its temporal behavior were investigated in laser configuration, which theoretically provides a lower TMI power threshold than the amplifier one due to the lack of selective excitation of the fundamental mode.

  7. Visuo-manual tracking: does intermittent control with aperiodic sampling explain linear power and non-linear remnant without sensorimotor noise?

    Science.gov (United States)

    Gollee, Henrik; Gawthrop, Peter J; Lakie, Martin; Loram, Ian D

    2017-11-01

    A human controlling an external system is described most easily and conventionally as linearly and continuously translating sensory input to motor output, with the inevitable output remnant, non-linearly related to the input, attributed to sensorimotor noise. Recent experiments show sustained manual tracking involves repeated refractoriness (insensitivity to sensory information for a certain duration), with the temporary 200-500 ms periods of irresponsiveness to sensory input making the control process intrinsically non-linear. This evidence calls for re-examination of the extent to which random sensorimotor noise is required to explain the non-linear remnant. This investigation of manual tracking shows how the full motor output (linear component and remnant) can be explained mechanistically by aperiodic sampling triggered by prediction error thresholds. Whereas broadband physiological noise is general to all processes, aperiodic sampling is associated with sensorimotor decision making within specific frontal, striatal and parietal networks; we conclude that manual tracking utilises such slow serial decision making pathways up to several times per second. The human operator is described adequately by linear translation of sensory input to motor output. Motor output also always includes a non-linear remnant resulting from random sensorimotor noise from multiple sources, and non-linear input transformations, for example thresholds or refractory periods. Recent evidence showed that manual tracking incurs substantial, serial, refractoriness (insensitivity to sensory information of 350 and 550 ms for 1st and 2nd order systems respectively). Our two questions are: (i) What are the comparative merits of explaining the non-linear remnant using noise or non-linear transformations? (ii) Can non-linear transformations represent serial motor decision making within the sensorimotor feedback loop intrinsic to tracking? Twelve participants (instructed to act in three prescribed

  8. Spreading Sequence Design and Theoretical Limits for Quasisynchronous CDMA Systems

    Directory of Open Access Journals (Sweden)

    Fan Pingzhi

    2004-01-01

    Full Text Available For various quasisynchronous (QS CDMA systems such as LAS-CDMA system which emerged recently, in order to reduce or eliminate the multiple access interference and multipath interference, it is required to design a set of spreading sequences which are mutually orthogonal within a designed shift zone, called orthogonal zone. For traditional orthogonal sequences, such as Walsh sequences and orthogonal Gold sequences, the orthogonality can only be achieved at the inphase point; in other words, the orthogonality is destroyed whenever there is a relative shift between the sequences, that is, their orthogonal zone is 0. In this paper, new concepts of generalized orthogonality (GO and generalized quasiorthogonality (GQO for spreading sequence design in both direct sequence (DS QS-CDMA systems and time/frequency hopping (TH/FH QS-CDMA systems are presented. Besides, selected GO/GQO sequence designs and general theoretical periodic and aperiodic limits, together with several applications in QS-CDMA systems, are also reviewed and analyzed.

  9. Sequence assembly

    DEFF Research Database (Denmark)

    Scheibye-Alsing, Karsten; Hoffmann, S.; Frankel, Annett Maria

    2009-01-01

    Despite the rapidly increasing number of sequenced and re-sequenced genomes, many issues regarding the computational assembly of large-scale sequencing data have remain unresolved. Computational assembly is crucial in large genome projects as well for the evolving high-throughput technologies and...... in genomic DNA, highly expressed genes and alternative transcripts in EST sequences. We summarize existing comparisons of different assemblers and provide a detailed descriptions and directions for download of assembly programs at: http://genome.ku.dk/resources/assembly/methods.html....

  10. Genome Sequencing

    DEFF Research Database (Denmark)

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based on transcr......The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...

  11. EXPERIMENTAL RESEARCHES OF ELECTRO-THERMAL RESISTIBILITY OF SEND-OFFS AND CABLES TO ACTION RATIONED ON THE INTERNATIONAL STANDARD OF IEC 62305-1-2010 OF APERIODIC IMPULSE OF CURRENT OF ARTIFICIAL LIGHTNING

    Directory of Open Access Journals (Sweden)

    M.I. Baranov

    2016-03-01

    Full Text Available Purpose. Experimental researches of electro-thermal resistibility of cable-explorer products, applied in the power electric circuits of objects of electric-power industry, to action on its copper and aluminum parts bearings a current rationed on the International Standard of IEC 62305-1-2010 aperiodic impulse 10/350 μs of current of artificial lightning. Methodology. Electrophysics bases of technique of high tensions and high pulsed currents (HPC, and also scientific and technical bases of planning of devices of high-voltage impulsive technique and measuring HPC in them. Results. Experimental a way the quantitative levels of maximal values maximum of possible and critical closenesses of aperiodic impulse 10/350 μs of current of artificial lightning with rationed on the international standard of IEC 62305-1-2010 peak-temporal parameters and admittances on them in copper (aluminum parts bearings a current of send-offs and cables with a polyethylene (PET and polyvinylchloride (PVCH isolation. Originality. First in world practice on the unique powerful high-voltage generator of HPC of artificial lightning experimental researches of resistibility to lightning of pre-production models of send-offs (cables are conducted with copper (aluminum tendons, PET and PVCH by an isolation, in-use in power electric circuits of electric-power industry objects. Practical value. The use in practice of protecting from lightning of the got results will allow substantially to promote functional and fire-prevention safety of engineering communications of objects of industrial electroenergy in the conditions of action on them of short shots of linear lightning.

  12. The algorithm of random length sequences synthesis for frame synchronization of digital television systems

    Directory of Open Access Journals (Sweden)

    Аndriy V. Sadchenko

    2015-12-01

    Full Text Available Digital television systems need to ensure that all digital signals processing operations are performed simultaneously and consistently. Frame synchronization dictated by the need to match phases of transmitter and receiver so that it would be possible to identify the start of a frame. As a frame synchronization signals are often used long length binary sequence with good aperiodic autocorrelation function. Aim: This work is dedicated to the development of the algorithm of random length sequences synthesis. Materials and Methods: The paper provides a comparative analysis of the known sequences, which can be used at present as synchronization ones, revealed their advantages and disadvantages. This work proposes the algorithm for the synthesis of binary synchronization sequences of random length with good autocorrelation properties based on noise generator with a uniform distribution law of probabilities. A "white noise" semiconductor generator is proposed to use as the initial material for the synthesis of binary sequences with desired properties. Results: The statistical analysis of the initial implementations of the "white noise" and synthesized sequences for frame synchronization of digital television is conducted. The comparative analysis of the synthesized sequences with known ones was carried out. The results show the benefits of obtained sequences in compare with known ones. The performed simulations confirm the obtained results. Conclusions: Thus, the search algorithm of binary synchronization sequences with desired autocorrelation properties received. According to this algorithm, the sequence can be longer in length and without length limitations. The received sync sequence can be used for frame synchronization in modern digital communication systems that will increase their efficiency and noise immunity.

  13. TRDistiller: a rapid filter for enrichment of sequence datasets with proteins containing tandem repeats.

    Science.gov (United States)

    Richard, François D; Kajava, Andrey V

    2014-06-01

    The dramatic growth of sequencing data evokes an urgent need to improve bioinformatics tools for large-scale proteome analysis. Over the last two decades, the foremost efforts of computer scientists were devoted to proteins with aperiodic sequences having globular 3D structures. However, a large portion of proteins contain periodic sequences representing arrays of repeats that are directly adjacent to each other (so called tandem repeats or TRs). These proteins frequently fold into elongated fibrous structures carrying different fundamental functions. Algorithms specific to the analysis of these regions are urgently required since the conventional approaches developed for globular domains have had limited success when applied to the TR regions. The protein TRs are frequently not perfect, containing a number of mutations, and some of them cannot be easily identified. To detect such "hidden" repeats several algorithms have been developed. However, the most sensitive among them are time-consuming and, therefore, inappropriate for large scale proteome analysis. To speed up the TR detection we developed a rapid filter that is based on the comparison of composition and order of short strings in the adjacent sequence motifs. Tests show that our filter discards up to 22.5% of proteins which are known to be without TRs while keeping almost all (99.2%) TR-containing sequences. Thus, we are able to decrease the size of the initial sequence dataset enriching it with TR-containing proteins which allows a faster subsequent TR detection by other methods. The program is available upon request. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Shotgun protein sequencing.

    Energy Technology Data Exchange (ETDEWEB)

    Faulon, Jean-Loup Michel; Heffelfinger, Grant S.

    2009-06-01

    A novel experimental and computational technique based on multiple enzymatic digestion of a protein or protein mixture that reconstructs protein sequences from sequences of overlapping peptides is described in this SAND report. This approach, analogous to shotgun sequencing of DNA, is to be used to sequence alternative spliced proteins, to identify post-translational modifications, and to sequence genetically engineered proteins.

  15. Multimodal sequence learning.

    Science.gov (United States)

    Kemény, Ferenc; Meier, Beat

    2016-02-01

    While sequence learning research models complex phenomena, previous studies have mostly focused on unimodal sequences. The goal of the current experiment is to put implicit sequence learning into a multimodal context: to test whether it can operate across different modalities. We used the Task Sequence Learning paradigm to test whether sequence learning varies across modalities, and whether participants are able to learn multimodal sequences. Our results show that implicit sequence learning is very similar regardless of the source modality. However, the presence of correlated task and response sequences was required for learning to take place. The experiment provides new evidence for implicit sequence learning of abstract conceptual representations. In general, the results suggest that correlated sequences are necessary for implicit sequence learning to occur. Moreover, they show that elements from different modalities can be automatically integrated into one unitary multimodal sequence. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Sequence Read Archive (SRA)

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Sequence Read Archive (SRA) stores raw sequencing data from the next generation of sequencing platforms including Roche 454 GS System®, Illumina Genome...

  17. Nonparametric combinatorial sequence models.

    Science.gov (United States)

    Wauthier, Fabian L; Jordan, Michael I; Jojic, Nebojsa

    2011-11-01

    This work considers biological sequences that exhibit combinatorial structures in their composition: groups of positions of the aligned sequences are "linked" and covary as one unit across sequences. If multiple such groups exist, complex interactions can emerge between them. Sequences of this kind arise frequently in biology but methodologies for analyzing them are still being developed. This article presents a nonparametric prior on sequences which allows combinatorial structures to emerge and which induces a posterior distribution over factorized sequence representations. We carry out experiments on three biological sequence families which indicate that combinatorial structures are indeed present and that combinatorial sequence models can more succinctly describe them than simpler mixture models. We conclude with an application to MHC binding prediction which highlights the utility of the posterior distribution over sequence representations induced by the prior. By integrating out the posterior, our method compares favorably to leading binding predictors.

  18. Genome Sequence Databases (Overview): Sequencing and Assembly

    Energy Technology Data Exchange (ETDEWEB)

    Lapidus, Alla L.

    2009-01-01

    From the date its role in heredity was discovered, DNA has been generating interest among scientists from different fields of knowledge: physicists have studied the three dimensional structure of the DNA molecule, biologists tried to decode the secrets of life hidden within these long molecules, and technologists invent and improve methods of DNA analysis. The analysis of the nucleotide sequence of DNA occupies a special place among the methods developed. Thanks to the variety of sequencing technologies available, the process of decoding the sequence of genomic DNA (or whole genome sequencing) has become robust and inexpensive. Meanwhile the assembly of whole genome sequences remains a challenging task. In addition to the need to assemble millions of DNA fragments of different length (from 35 bp (Solexa) to 800 bp (Sanger)), great interest in analysis of microbial communities (metagenomes) of different complexities raises new problems and pushes some new requirements for sequence assembly tools to the forefront. The genome assembly process can be divided into two steps: draft assembly and assembly improvement (finishing). Despite the fact that automatically performed assembly (or draft assembly) is capable of covering up to 98% of the genome, in most cases, it still contains incorrectly assembled reads. The error rate of the consensus sequence produced at this stage is about 1/2000 bp. A finished genome represents the genome assembly of much higher accuracy (with no gaps or incorrectly assembled areas) and quality ({approx}1 error/10,000 bp), validated through a number of computer and laboratory experiments.

  19. Long sequence correlation coprocessor

    Science.gov (United States)

    Gage, Douglas W.

    1994-09-01

    A long sequence correlation coprocessor (LSCC) accelerates the bitwise correlation of arbitrarily long digital sequences by calculating in parallel the correlation score for 16, for example, adjacent bit alignments between two binary sequences. The LSCC integrated circuit is incorporated into a computer system with memory storage buffers and a separate general purpose computer processor which serves as its controller. Each of the LSCC's set of sequential counters simultaneously tallies a separate correlation coefficient. During each LSCC clock cycle, computer enable logic associated with each counter compares one bit of a first sequence with one bit of a second sequence to increment the counter if the bits are the same. A shift register assures that the same bit of the first sequence is simultaneously compared to different bits of the second sequence to simultaneously calculate the correlation coefficient by the different counters to represent different alignments of the two sequences.

  20. Roles of repetitive sequences

    Energy Technology Data Exchange (ETDEWEB)

    Bell, G.I.

    1991-12-31

    The DNA of higher eukaryotes contains many repetitive sequences. The study of repetitive sequences is important, not only because many have important biological function, but also because they provide information on genome organization, evolution and dynamics. In this paper, I will first discuss some generic effects that repetitive sequences will have upon genome dynamics and evolution. In particular, it will be shown that repetitive sequences foster recombination among, and turnover of, the elements of a genome. I will then consider some examples of repetitive sequences, notably minisatellite sequences and telomere sequences as examples of tandem repeats, without and with respectively known function, and Alu sequences as an example of interspersed repeats. Some other examples will also be considered in less detail.

  1. Anomaly Detection in Sequences

    Data.gov (United States)

    National Aeronautics and Space Administration — We present a set of novel algorithms which we call sequenceMiner, that detect and characterize anomalies in large sets of high-dimensional symbol sequences that...

  2. DNA sequencing conference, 2

    Energy Technology Data Exchange (ETDEWEB)

    Cook-Deegan, R.M. [Georgetown Univ., Kennedy Inst. of Ethics, Washington, DC (United States); Venter, J.C. [National Inst. of Neurological Disorders and Strokes, Bethesda, MD (United States); Gilbert, W. [Harvard Univ., Cambridge, MA (United States); Mulligan, J. [Stanford Univ., CA (United States); Mansfield, B.K. [Oak Ridge National Lab., TN (United States)

    1991-06-19

    This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.

  3. sequenceMiner algorithm

    Data.gov (United States)

    National Aeronautics and Space Administration — Detecting and describing anomalies in large repositories of discrete symbol sequences. sequenceMiner has been open-sourced! Download the file below to try it out....

  4. Aperiodicity Correction for Rotor Tip Vortex Measurements

    Science.gov (United States)

    2011-05-01

    where α = 1.25643. The Iversen and the transitional models are not closed-form solutions but are formulated as solutions to an ordinary differential ...edition, 1932, pp. 592– 593. [7] Oseen, C. W., “ Uber Wirbelbewegung in Einer Reibenden Flussigkeit,” Ark. J. Mat. Astrom. Fys., Vol. 7, (Nonumber), 1912

  5. Radiation-induced aperiodicity in irradiated ceramics

    International Nuclear Information System (INIS)

    Hobbs, L.W.

    1993-02-01

    The experimental program is designed to reveal details of the metamict (amorphization, or crystal-to-glass) transformation in irradiated ceramics (silica compounds, less-connected lead phosphates). The silica compounds were amorphized using electrons, neutrons, and ions, while the phosphates were amorphized using ions (primarily) and neutrons. Energy-filtered electron microdiffraction, high-resoltuion transmission electron microscopy, and high-performance liquid-phase chromatography are being used

  6. The Fourier modal method for aperiodic structures

    NARCIS (Netherlands)

    Pisarenco, M.; Maubach, J.M.L.; Setija, I.D.; Mattheij, R.M.M.

    2010-01-01

    This paper extends the area of application of the Fourier modal method from periodic structures to non-periodic ones illuminated under arbitrary angles. This is achieved by placing perfectly matched layers at the lateral boundaries and reformulating the problem in terms of a contrast field.

  7. Renormalization transformation of periodic and aperiodic lattices

    International Nuclear Information System (INIS)

    Macia, Enrique; Rodriguez-Oliveros, Rogelio

    2006-01-01

    In this work we introduce a similarity transformation acting on transfer matrices describing the propagation of elementary excitations through either periodic or Fibonacci lattices. The proposed transformation can act at two different scale lengths. At the atomic scale the transformation allows one to express the systems' global transfer matrix in terms of an equivalent on-site model one. Correlation effects among different hopping terms are described by a series of local phase factors in that case. When acting on larger scale lengths, corresponding to short segments of the original lattice, the similarity transformation can be properly regarded as describing an effective renormalization of the chain. The nature of the resulting renormalized lattice significantly depends on the kind of order (i.e., periodic or quasiperiodic) of the original lattice, expressing a delicate balance between chemical complexity and topological order as a consequence of the renormalization process

  8. Kaks kirja vennale = Two Letters from Vincent van Gogh to his brother / Vincent van Gogh

    Index Scriptorium Estoniae

    Gogh, Vincent van, 1853-1890

    2008-01-01

    Kunstnik Vincent van Goghi kaks kirja oma vennale Theole. Tõlge vene keelest ja kommentaar Mehis Heinsaarelt. Ingliskeelsed kirjad raamatust "The Complete Letters of Vincent van Gogh", Thames and Hudson, 1979

  9. Sequences for Student Investigation

    Science.gov (United States)

    Barton, Jeffrey; Feil, David; Lartigue, David; Mullins, Bernadette

    2004-01-01

    We describe two classes of sequences that give rise to accessible problems for undergraduate research. These problems may be understood with virtually no prerequisites and are well suited for computer-aided investigation. The first sequence is a variation of one introduced by Stephen Wolfram in connection with his study of cellular automata. The…

  10. Sequence History Update Tool

    Science.gov (United States)

    Khanampompan, Teerapat; Gladden, Roy; Fisher, Forest; DelGuercio, Chris

    2008-01-01

    The Sequence History Update Tool performs Web-based sequence statistics archiving for Mars Reconnaissance Orbiter (MRO). Using a single UNIX command, the software takes advantage of sequencing conventions to automatically extract the needed statistics from multiple files. This information is then used to populate a PHP database, which is then seamlessly formatted into a dynamic Web page. This tool replaces a previous tedious and error-prone process of manually editing HTML code to construct a Web-based table. Because the tool manages all of the statistics gathering and file delivery to and from multiple data sources spread across multiple servers, there is also a considerable time and effort savings. With the use of The Sequence History Update Tool what previously took minutes is now done in less than 30 seconds, and now provides a more accurate archival record of the sequence commanding for MRO.

  11. HIV Sequence Compendium 2015

    Energy Technology Data Exchange (ETDEWEB)

    Foley, Brian Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Leitner, Thomas Kenneth [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Apetrei, Cristian [Univ. of Pittsburgh, PA (United States); Hahn, Beatrice [Univ. of Pennsylvania, Philadelphia, PA (United States); Mizrachi, Ilene [National Center for Biotechnology Information, Bethesda, MD (United States); Mullins, James [Univ. of Washington, Seattle, WA (United States); Rambaut, Andrew [Univ. of Edinburgh, Scotland (United Kingdom); Wolinsky, Steven [Northwestern Univ., Evanston, IL (United States); Korber, Bette Tina Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-10-05

    This compendium is an annual printed summary of the data contained in the HIV sequence database. We try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2015. Hence, though it is published in 2015 and called the 2015 Compendium, its contents correspond to the 2014 curated alignments on our website. The number of sequences in the HIV database is still increasing. In total, at the end of 2014, there were 624,121 sequences in the HIV Sequence Database, an increase of 7% since the previous year. This is the first year that the number of new sequences added to the database has decreased compared to the previous year. The number of near complete genomes (>7000 nucleotides) increased to 5834 by end of 2014. However, as in previous years, the compendium alignments contain only a fraction of these. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/ content/sequence/NEWALIGN/align.html As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.

  12. Mapping sequences by parts

    Directory of Open Access Journals (Sweden)

    Guziolowski Carito

    2007-09-01

    Full Text Available Abstract Background: We present the N-map method, a pairwise and asymmetrical approach which allows us to compare sequences by taking into account evolutionary events that produce shuffled, reversed or repeated elements. Basically, the optimal N-map of a sequence s over a sequence t is the best way of partitioning the first sequence into N parts and placing them, possibly complementary reversed, over the second sequence in order to maximize the sum of their gapless alignment scores. Results: We introduce an algorithm computing an optimal N-map with time complexity O (|s| × |t| × N using O (|s| × |t| × N memory space. Among all the numbers of parts taken in a reasonable range, we select the value N for which the optimal N-map has the most significant score. To evaluate this significance, we study the empirical distributions of the scores of optimal N-maps and show that they can be approximated by normal distributions with a reasonable accuracy. We test the functionality of the approach over random sequences on which we apply artificial evolutionary events. Practical Application: The method is illustrated with four case studies of pairs of sequences involving non-standard evolutionary events.

  13. The Colliding Beams Sequencer

    International Nuclear Information System (INIS)

    Johnson, D.E.; Johnson, R.P.

    1989-01-01

    The Colliding Beam Sequencer (CBS) is a computer program used to operate the pbar-p Collider by synchronizing the applications programs and simulating the activities of the accelerator operators during filling and storage. The Sequencer acts as a meta-program, running otherwise stand alone applications programs, to do the set-up, beam transfers, acceleration, low beta turn on, and diagnostics for the transfers and storage. The Sequencer and its operational performance will be described along with its special features which include a periodic scheduler and command logger. 14 refs., 3 figs

  14. Phylogenetic Trees From Sequences

    Science.gov (United States)

    Ryvkin, Paul; Wang, Li-San

    In this chapter, we review important concepts and approaches for phylogeny reconstruction from sequence data.We first cover some basic definitions and properties of phylogenetics, and briefly explain how scientists model sequence evolution and measure sequence divergence. We then discuss three major approaches for phylogenetic reconstruction: distance-based phylogenetic reconstruction, maximum parsimony, and maximum likelihood. In the third part of the chapter, we review how multiple phylogenies are compared by consensus methods and how to assess confidence using bootstrapping. At the end of the chapter are two sections that list popular software packages and additional reading.

  15. Gomphid DNA sequence data

    Data.gov (United States)

    U.S. Environmental Protection Agency — DNA sequence data for several genetic loci. This dataset is not publicly accessible because: It's already publicly available on GenBank. It can be accessed through...

  16. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  17. Dynamic Sequence Assignment.

    Science.gov (United States)

    1983-12-01

    D-136 548 DYNAMIIC SEQUENCE ASSIGNMENT(U) ADVANCED INFORMATION AND 1/2 DECISION SYSTEMS MOUNTAIN YIELW CA C A 0 REILLY ET AL. UNCLSSIIED DEC 83 AI/DS...I ADVANCED INFORMATION & DECISION SYSTEMS Mountain View. CA 94040 84 u ,53 V,..’. Unclassified _____ SCURITY CLASSIFICATION OF THIS PAGE REPORT...reviews some important heuristic algorithms developed for fas- ter solution of the sequence assignment problem. 3.1. DINAMIC MOGRAMUNIG FORMULATION FOR

  18. HIV Sequence Compendium 2010

    Energy Technology Data Exchange (ETDEWEB)

    Kuiken, Carla [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Foley, Brian [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Leitner, Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Apetrei, Christian [Univ. of Pittsburgh, PA (United States); Hahn, Beatrice [Univ. of Alabama, Tuscaloosa, AL (United States); Mizrachi, Ilene [National Center for Biotechnology Information, Bethesda, MD (United States); Mullins, James [Univ. of Washington, Seattle, WA (United States); Rambaut, Andrew [Univ. of Edinburgh, Scotland (United Kingdom); Wolinsky, Steven [Northwestern Univ., Evanston, IL (United States); Korber, Bette [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2010-12-31

    This compendium is an annual printed summary of the data contained in the HIV sequence database. In these compendia we try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2010. Hence, though it is called the 2010 Compendium, its contents correspond to the 2009 curated alignments on our website. The number of sequences in the HIV database is still increasing exponentially. In total, at the time of printing, there were 339,306 sequences in the HIV Sequence Database, an increase of 45% since last year. The number of near complete genomes (>7000 nucleotides) increased to 2576 by end of 2009, reflecting a smaller increase than in previous years. However, as in previous years, the compendium alignments contain only a small fraction of these. Included in the alignments are a small number of sequences representing each of the subtypes and the more prevalent circulating recombinant forms (CRFs) such as 01 and 02, as well as a few outgroup sequences (group O and N and SIV-CPZ). Of the rarer CRFs we included one representative each. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/content/sequence/NEWALIGN/align.html. Reprints are available from our website in the form of both HTML and PDF files. As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.

  19. General LTE Sequence

    OpenAIRE

    Billal, Masum

    2015-01-01

    In this paper,we have characterized sequences which maintain the same property described in Lifting the Exponent Lemma. Lifting the Exponent Lemma is a very powerful tool in olympiad number theory and recently it has become very popular. We generalize it to all sequences that maintain a property like it i.e. if p^{\\alpha}||a_k and p^\\b{eta}||n, then p^{{\\alpha}+\\b{eta}}||a_{nk}.

  20. Pairwise Sequence Alignment Library

    Energy Technology Data Exchange (ETDEWEB)

    2015-05-20

    Vector extensions, such as SSE, have been part of the x86 CPU since the 1990s, with applications in graphics, signal processing, and scientific applications. Although many algorithms and applications can naturally benefit from automatic vectorization techniques, there are still many that are difficult to vectorize due to their dependence on irregular data structures, dense branch operations, or data dependencies. Sequence alignment, one of the most widely used operations in bioinformatics workflows, has a computational footprint that features complex data dependencies. The trend of widening vector registers adversely affects the state-of-the-art sequence alignment algorithm based on striped data layouts. Therefore, a novel SIMD implementation of a parallel scan-based sequence alignment algorithm that can better exploit wider SIMD units was implemented as part of the Parallel Sequence Alignment Library (parasail). Parasail features: Reference implementations of all known vectorized sequence alignment approaches. Implementations of Smith Waterman (SW), semi-global (SG), and Needleman Wunsch (NW) sequence alignment algorithms. Implementations across all modern CPU instruction sets including AVX2 and KNC. Language interfaces for C/C++ and Python.

  1. Adaptive Processing for Sequence Alignment

    KAUST Repository

    Zidan, Mohammed A.; Bonny, Talal; Salama, Khaled N.

    2012-01-01

    Disclosed are various embodiments for adaptive processing for sequence alignment. In one embodiment, among others, a method includes obtaining a query sequence and a plurality of database sequences. A first portion of the plurality of database sequences is distributed to a central processing unit (CPU) and a second portion of the plurality of database sequences is distributed to a graphical processing unit (GPU) based upon a predetermined splitting ratio associated with the plurality of database sequences, where the database sequences of the first portion are shorter than the database sequences of the second portion. A first alignment score for the query sequence is determined with the CPU based upon the first portion of the plurality of database sequences and a second alignment score for the query sequence is determined with the GPU based upon the second portion of the plurality of database sequences.

  2. Adaptive Processing for Sequence Alignment

    KAUST Repository

    Zidan, Mohammed A.

    2012-01-26

    Disclosed are various embodiments for adaptive processing for sequence alignment. In one embodiment, among others, a method includes obtaining a query sequence and a plurality of database sequences. A first portion of the plurality of database sequences is distributed to a central processing unit (CPU) and a second portion of the plurality of database sequences is distributed to a graphical processing unit (GPU) based upon a predetermined splitting ratio associated with the plurality of database sequences, where the database sequences of the first portion are shorter than the database sequences of the second portion. A first alignment score for the query sequence is determined with the CPU based upon the first portion of the plurality of database sequences and a second alignment score for the query sequence is determined with the GPU based upon the second portion of the plurality of database sequences.

  3. Main sequence mass loss

    International Nuclear Information System (INIS)

    Brunish, W.M.; Guzik, J.A.; Willson, L.A.; Bowen, G.

    1987-01-01

    It has been hypothesized that variable stars may experience mass loss, driven, at least in part, by oscillations. The class of stars we are discussing here are the δ Scuti variables. These are variable stars with masses between about 1.2 and 2.25 M/sub θ/, lying on or very near the main sequence. According to this theory, high rotation rates enhance the rate of mass loss, so main sequence stars born in this mass range would have a range of mass loss rates, depending on their initial rotation velocity and the amplitude of the oscillations. The stars would evolve rapidly down the main sequence until (at about 1.25 M/sub θ/) a surface convection zone began to form. The presence of this convective region would slow the rotation, perhaps allowing magnetic braking to occur, and thus sharply reduce the mass loss rate. 7 refs

  4. Electricity sequence control

    International Nuclear Information System (INIS)

    Shin, Heung Ryeol

    2010-03-01

    The contents of the book are introduction of control system, like classification and control signal, introduction of electricity power switch, such as push-button and detection switch sensor for induction type and capacitance type machinery for control, solenoid valve, expression of sequence and type of electricity circuit about using diagram, time chart, marking and term, logic circuit like Yes, No, and, or and equivalence logic, basic electricity circuit, electricity sequence control, added condition, special program control about choice and jump of program, motor control, extra circuit on repeat circuit, pause circuit in a conveyer, safety regulations and rule about classification of electricity disaster and protective device for insulation.

  5. Next-generation sequencing

    DEFF Research Database (Denmark)

    Rieneck, Klaus; Bak, Mads; Jønson, Lars

    2013-01-01

    , Illumina); several millions of PCR sequences were analyzed. RESULTS: The results demonstrated the feasibility of diagnosing the fetal KEL1 or KEL2 blood group from cell-free DNA purified from maternal plasma. CONCLUSION: This method requires only one primer pair, and the large amount of sequence...... information obtained allows well for statistical analysis of the data. This general approach can be integrated into current laboratory practice and has numerous applications. Besides DNA-based predictions of blood group phenotypes, platelet phenotypes, or sickle cell anemia, and the determination of zygosity...

  6. Biological sequence analysis

    DEFF Research Database (Denmark)

    Durbin, Richard; Eddy, Sean; Krogh, Anders Stærmose

    This book provides an up-to-date and tutorial-level overview of sequence analysis methods, with particular emphasis on probabilistic modelling. Discussed methods include pairwise alignment, hidden Markov models, multiple alignment, profile searches, RNA secondary structure analysis, and phylogene...

  7. THE RHIC SEQUENCER

    International Nuclear Information System (INIS)

    VAN ZEIJTS, J.; DOTTAVIO, T.; FRAK, B.; MICHNOFF, R.

    2001-01-01

    The Relativistic Heavy Ion Collider (RHIC) has a high level asynchronous time-line driven by a controlling program called the ''Sequencer''. Most high-level magnet and beam related issues are orchestrated by this system. The system also plays an important task in coordinated data acquisition and saving. We present the program, operator interface, operational impact and experience

  8. Twin anemia polycythemia sequence

    NARCIS (Netherlands)

    Slaghekke, Femke

    2014-01-01

    In this thesis we describe that Twin Anemia Polycythemia Sequence (TAPS) is a form of chronic feto-fetal transfusion in monochorionic (identical) twins based on a small amount of blood transfusion through very small anastomoses. For the antenatal diagnosis of TAPS, Middle Cerebral Artery – Peak

  9. simple sequence repeat (SSR)

    African Journals Online (AJOL)

    In the present study, 78 mapped simple sequence repeat (SSR) markers representing 11 linkage groups of adzuki bean were evaluated for transferability to mungbean and related Vigna spp. 41 markers amplified characteristic bands in at least one Vigna species. The transferability percentage across the genotypes ranged ...

  10. Targeted sequencing of plant genomes

    Science.gov (United States)

    Mark D. Huynh

    2014-01-01

    Next-generation sequencing (NGS) has revolutionized the field of genetics by providing a means for fast and relatively affordable sequencing. With the advancement of NGS, wholegenome sequencing (WGS) has become more commonplace. However, sequencing an entire genome is still not cost effective or even beneficial in all cases. In studies that do not require a whole-...

  11. Almost convergence of triple sequences

    OpenAIRE

    Ayhan Esi; M.Necdet Catalbas

    2013-01-01

    In this paper we introduce and study the concepts of almost convergence and almost Cauchy for triple sequences. Weshow that the set of almost convergent triple sequences of 0's and 1's is of the first category and also almost everytriple sequence of 0's and 1's is not almost convergent.Keywords: almost convergence, P-convergent, triple sequence.

  12. A few Smarandache Integer Sequences

    OpenAIRE

    Ibstedt, Henry

    2010-01-01

    This paper deals with the analysis of a few Smarandache Integer Sequences which first appeared in Properties or the Numbers, F. Smarandache, University or Craiova Archives, 1975. The first four sequences are recurrence generated sequences while the last three are concatenation sequences.

  13. Allele Re-sequencing Technologies

    DEFF Research Database (Denmark)

    Byrne, Stephen; Farrell, Jacqueline Danielle; Asp, Torben

    2013-01-01

    The development of next-generation sequencing technologies has made sequencing an affordable approach for detection of genetic variations associated with various traits. However, the cost of whole genome re-sequencing still remains too high to be feasible for many plant species with large...... alternative to whole genome re-sequencing to identify causative genetic variations in plants. One challenge, however, will be efficient bioinformatics strategies for data handling and analysis from the increasing amount of sequence information....

  14. Multilocus Sequence Typing

    OpenAIRE

    Belén, Ana; Pavón, Ibarz; Maiden, Martin C.J.

    2009-01-01

    Multilocus sequence typing (MLST) was first proposed in 1998 as a typing approach that enables the unambiguous characterization of bacterial isolates in a standardized, reproducible, and portable manner using the human pathogen Neisseria meningitidis as the exemplar organism. Since then, the approach has been applied to a large and growing number of organisms by public health laboratories and research institutions. MLST data, shared by investigators over the world via the Internet, have been ...

  15. Achalasia Carcinoma Sequence

    OpenAIRE

    Makmun, Dadang

    2001-01-01

    We report a case of carcinoma of the esophagus in a 58 years old woman with achalasia, who has been diagnosed since 30 years ago, which initiated by surgical treatment (myotomy) and the symptoms recurred since 3 years ago. According to the progress of the disease, Malignancy was strongly suspected due to prolonged stasis and mucosal irritation caused by achalasia (achalasia carcinoma sequence). Because of these contributing factors for the development of serious complications such as Malignan...

  16. Sequencing BPS spectra

    Energy Technology Data Exchange (ETDEWEB)

    Gukov, Sergei [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Max-Planck-Institut für Mathematik,Vivatsgasse 7, D-53111 Bonn (Germany); Nawata, Satoshi [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Centre for Quantum Geometry of Moduli Spaces, University of Aarhus,Nordre Ringgade 1, DK-8000 (Denmark); Saberi, Ingmar [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Stošić, Marko [CAMGSD, Departamento de Matemática, Instituto Superior Técnico,Av. Rovisco Pais, 1049-001 Lisbon (Portugal); Mathematical Institute SANU,Knez Mihajlova 36, 11000 Belgrade (Serbia); Sułkowski, Piotr [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Faculty of Physics, University of Warsaw,ul. Pasteura 5, 02-093 Warsaw (Poland)

    2016-03-02

    This paper provides both a detailed study of color-dependence of link homologies, as realized in physics as certain spaces of BPS states, and a broad study of the behavior of BPS states in general. We consider how the spectrum of BPS states varies as continuous parameters of a theory are perturbed. This question can be posed in a wide variety of physical contexts, and we answer it by proposing that the relationship between unperturbed and perturbed BPS spectra is described by a spectral sequence. These general considerations unify previous applications of spectral sequence techniques to physics, and explain from a physical standpoint the appearance of many spectral sequences relating various link homology theories to one another. We also study structural properties of colored HOMFLY homology for links and evaluate Poincaré polynomials in numerous examples. Among these structural properties is a novel “sliding” property, which can be explained by using (refined) modular S-matrix. This leads to the identification of modular transformations in Chern-Simons theory and 3d N=2 theory via the 3d/3d correspondence. Lastly, we introduce the notion of associated varieties as classical limits of recursion relations of colored superpolynomials of links, and study their properties.

  17. Sequencing BPS spectra

    International Nuclear Information System (INIS)

    Gukov, Sergei; Nawata, Satoshi; Saberi, Ingmar; Stošić, Marko; Sułkowski, Piotr

    2016-01-01

    This paper provides both a detailed study of color-dependence of link homologies, as realized in physics as certain spaces of BPS states, and a broad study of the behavior of BPS states in general. We consider how the spectrum of BPS states varies as continuous parameters of a theory are perturbed. This question can be posed in a wide variety of physical contexts, and we answer it by proposing that the relationship between unperturbed and perturbed BPS spectra is described by a spectral sequence. These general considerations unify previous applications of spectral sequence techniques to physics, and explain from a physical standpoint the appearance of many spectral sequences relating various link homology theories to one another. We also study structural properties of colored HOMFLY homology for links and evaluate Poincaré polynomials in numerous examples. Among these structural properties is a novel “sliding” property, which can be explained by using (refined) modular S-matrix. This leads to the identification of modular transformations in Chern-Simons theory and 3d N=2 theory via the 3d/3d correspondence. Lastly, we introduce the notion of associated varieties as classical limits of recursion relations of colored superpolynomials of links, and study their properties.

  18. Image sequence analysis

    CERN Document Server

    1981-01-01

    The processing of image sequences has a broad spectrum of important applica­ tions including target tracking, robot navigation, bandwidth compression of TV conferencing video signals, studying the motion of biological cells using microcinematography, cloud tracking, and highway traffic monitoring. Image sequence processing involves a large amount of data. However, because of the progress in computer, LSI, and VLSI technologies, we have now reached a stage when many useful processing tasks can be done in a reasonable amount of time. As a result, research and development activities in image sequence analysis have recently been growing at a rapid pace. An IEEE Computer Society Workshop on Computer Analysis of Time-Varying Imagery was held in Philadelphia, April 5-6, 1979. A related special issue of the IEEE Transactions on Pattern Anal­ ysis and Machine Intelligence was published in November 1980. The IEEE Com­ puter magazine has also published a special issue on the subject in 1981. The purpose of this book ...

  19. Foundations of Sequence-to-Sequence Modeling for Time Series

    OpenAIRE

    Kuznetsov, Vitaly; Mariet, Zelda

    2018-01-01

    The availability of large amounts of time series data, paired with the performance of deep-learning algorithms on a broad class of problems, has recently led to significant interest in the use of sequence-to-sequence models for time series forecasting. We provide the first theoretical analysis of this time series forecasting framework. We include a comparison of sequence-to-sequence modeling to classical time series models, and as such our theory can serve as a quantitative guide for practiti...

  20. Novel expressed sequence tag- simple sequence repeats (EST ...

    African Journals Online (AJOL)

    Using different bioinformatic criteria, the SUCEST database was used to mine for simple sequence repeat (SSR) markers. Among 42,189 clusters, 1,425 expressed sequence tag- simple sequence repeats (EST-SSRs) were identified in silico. Trinucleotide repeats were the most abundant SSRs detected. Of 212 primer pairs ...

  1. Infinite sequences and series

    CERN Document Server

    Knopp, Konrad

    1956-01-01

    One of the finest expositors in the field of modern mathematics, Dr. Konrad Knopp here concentrates on a topic that is of particular interest to 20th-century mathematicians and students. He develops the theory of infinite sequences and series from its beginnings to a point where the reader will be in a position to investigate more advanced stages on his own. The foundations of the theory are therefore presented with special care, while the developmental aspects are limited by the scope and purpose of the book. All definitions are clearly stated; all theorems are proved with enough detail to ma

  2. Fast global sequence alignment technique

    KAUST Repository

    Bonny, Mohamed Talal; Salama, Khaled N.

    2011-01-01

    fast alignment algorithm, called 'Alignment By Scanning' (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the wellknown sequence alignment algorithms, the 'GAP' (which is heuristic) and the 'Needleman

  3. Next-Generation Sequencing Platforms

    Science.gov (United States)

    Mardis, Elaine R.

    2013-06-01

    Automated DNA sequencing instruments embody an elegant interplay among chemistry, engineering, software, and molecular biology and have built upon Sanger's founding discovery of dideoxynucleotide sequencing to perform once-unfathomable tasks. Combined with innovative physical mapping approaches that helped to establish long-range relationships between cloned stretches of genomic DNA, fluorescent DNA sequencers produced reference genome sequences for model organisms and for the reference human genome. New types of sequencing instruments that permit amazing acceleration of data-collection rates for DNA sequencing have been developed. The ability to generate genome-scale data sets is now transforming the nature of biological inquiry. Here, I provide an historical perspective of the field, focusing on the fundamental developments that predated the advent of next-generation sequencing instruments and providing information about how these instruments work, their application to biological research, and the newest types of sequencers that can extract data from single DNA molecules.

  4. Rapid Polymer Sequencer

    Science.gov (United States)

    Stolc, Viktor (Inventor); Brock, Matthew W (Inventor)

    2013-01-01

    Method and system for rapid and accurate determination of each of a sequence of unknown polymer components, such as nucleic acid components. A self-assembling monolayer of a selected substance is optionally provided on an interior surface of a pipette tip, and the interior surface is immersed in a selected liquid. A selected electrical field is impressed in a longitudinal direction, or in a transverse direction, in the tip region, a polymer sequence is passed through the tip region, and a change in an electrical current signal is measured as each polymer component passes through the tip region. Each of the measured changes in electrical current signals is compared with a database of reference electrical change signals, with each reference signal corresponding to an identified polymer component, to identify the unknown polymer component with a reference polymer component. The nanopore preferably has a pore inner diameter of no more than about 40 nm and is prepared by heating and pulling a very small section of a glass tubing.

  5. The advantages of SMRT sequencing

    OpenAIRE

    Roberts, Richard J; Carneiro, Mauricio O; Schatz, Michael C

    2013-01-01

    Of the current next-generation sequencing technologies, SMRT sequencing is sometimes overlooked. However, attributes such as long reads, modified base detection and high accuracy make SMRT a useful technology and an ideal approach to the complete sequencing of small genomes.

  6. Putting instruction sequences into effect

    NARCIS (Netherlands)

    Bergstra, J.A.

    2011-01-01

    An attempt is made to define the concept of execution of an instruction sequence. It is found to be a special case of directly putting into effect of an instruction sequence. Directly putting into effect of an instruction sequences comprises interpretation as well as execution. Directly putting into

  7. Region segmentation along image sequence

    International Nuclear Information System (INIS)

    Monchal, L.; Aubry, P.

    1995-01-01

    A method to extract regions in sequence of images is proposed. Regions are not matched from one image to the following one. The result of a region segmentation is used as an initialization to segment the following and image to track the region along the sequence. The image sequence is exploited as a spatio-temporal event. (authors). 12 refs., 8 figs

  8. Log-balanced combinatorial sequences

    Directory of Open Access Journals (Sweden)

    Tomislav Došlic

    2005-01-01

    Full Text Available We consider log-convex sequences that satisfy an additional constraint imposed on their rate of growth. We call such sequences log-balanced. It is shown that all such sequences satisfy a pair of double inequalities. Sufficient conditions for log-balancedness are given for the case when the sequence satisfies a two- (or more- term linear recurrence. It is shown that many combinatorially interesting sequences belong to this class, and, as a consequence, that the above-mentioned double inequalities are valid for all of them.

  9. New MR pulse sequence

    International Nuclear Information System (INIS)

    Harms, S.E.; Flamig, D.P.; Griffey, R.H.

    1990-01-01

    This paper describes a method for fat suppression for three-dimensional MR imaging. The FATS (fat-suppressed acquisition with echo time shortened) sequence employs a pair of opposing adiabatic half-passage RF pulses tuned on fat resonance. The imaging parameters are as follows: TR, 20 msec; TE, 21.7-3.2 msec; 1,024 x 128 x 128 acquired matrix; imaging time, approximately 11 minutes. A series of 54 examinations were performed. Excellent fat suppression with water excitation is achieved in all cases. The orbital images demonstrate superior resolution of small orbital lesions. The high signal-to-noise ratio (SNR) in cranial studies demonstrates excellent petrous bone and internal auditory canal anatomy

  10. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    Science.gov (United States)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  11. Universal sequence map (USM of arbitrary discrete sequences

    Directory of Open Access Journals (Sweden)

    Almeida Jonas S

    2002-02-01

    Full Text Available Abstract Background For over a decade the idea of representing biological sequences in a continuous coordinate space has maintained its appeal but not been fully realized. The basic idea is that any sequence of symbols may define trajectories in the continuous space conserving all its statistical properties. Ideally, such a representation would allow scale independent sequence analysis – without the context of fixed memory length. A simple example would consist on being able to infer the homology between two sequences solely by comparing the coordinates of any two homologous units. Results We have successfully identified such an iterative function for bijective mappingψ of discrete sequences into objects of continuous state space that enable scale-independent sequence analysis. The technique, named Universal Sequence Mapping (USM, is applicable to sequences with an arbitrary length and arbitrary number of unique units and generates a representation where map distance estimates sequence similarity. The novel USM procedure is based on earlier work by these and other authors on the properties of Chaos Game Representation (CGR. The latter enables the representation of 4 unit type sequences (like DNA as an order free Markov Chain transition table. The properties of USM are illustrated with test data and can be verified for other data by using the accompanying web-based tool:http://bioinformatics.musc.edu/~jonas/usm/. Conclusions USM is shown to enable a statistical mechanics approach to sequence analysis. The scale independent representation frees sequence analysis from the need to assume a memory length in the investigation of syntactic rules.

  12. Short sequence motifs, overrepresented in mammalian conservednon-coding sequences

    Energy Technology Data Exchange (ETDEWEB)

    Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna

    2007-02-21

    Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by

  13. Genomic sequencing in clinical trials

    OpenAIRE

    Mestan, Karen K; Ilkhanoff, Leonard; Mouli, Samdeep; Lin, Simon

    2011-01-01

    Abstract Human genome sequencing is the process by which the exact order of nucleic acid base pairs in the 24 human chromosomes is determined. Since the completion of the Human Genome Project in 2003, genomic sequencing is rapidly becoming a major part of our translational research efforts to understand and improve human health and disease. This article reviews the current and future directions of clinical research with respect to genomic sequencing, a technology that is just beginning to fin...

  14. Biosensors for DNA sequence detection

    Science.gov (United States)

    Vercoutere, Wenonah; Akeson, Mark

    2002-01-01

    DNA biosensors are being developed as alternatives to conventional DNA microarrays. These devices couple signal transduction directly to sequence recognition. Some of the most sensitive and functional technologies use fibre optics or electrochemical sensors in combination with DNA hybridization. In a shift from sequence recognition by hybridization, two emerging single-molecule techniques read sequence composition using zero-mode waveguides or electrical impedance in nanoscale pores.

  15. ABS: Sequence alignment by scanning

    KAUST Repository

    Bonny, Mohamed Talal

    2011-08-01

    Sequence alignment is an essential tool in almost any computational biology research. It processes large database sequences and considered to be high consumers of computation time. Heuristic algorithms are used to get approximate but fast results. We introduce fast alignment algorithm, called Alignment By Scanning (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the well-known alignment algorithms, the FASTA (which is heuristic) and the \\'Needleman-Wunsch\\' (which is optimal). The proposed algorithm achieves up to 76% enhancement in alignment score when it is compared with the FASTA Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

  16. ABS: Sequence alignment by scanning

    KAUST Repository

    Bonny, Mohamed Talal; Salama, Khaled N.

    2011-01-01

    Sequence alignment is an essential tool in almost any computational biology research. It processes large database sequences and considered to be high consumers of computation time. Heuristic algorithms are used to get approximate but fast results. We introduce fast alignment algorithm, called Alignment By Scanning (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the well-known alignment algorithms, the FASTA (which is heuristic) and the 'Needleman-Wunsch' (which is optimal). The proposed algorithm achieves up to 76% enhancement in alignment score when it is compared with the FASTA Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

  17. Fast global sequence alignment technique

    KAUST Repository

    Bonny, Mohamed Talal

    2011-11-01

    Bioinformatics database is growing exponentially in size. Processing these large amount of data may take hours of time even if super computers are used. One of the most important processing tool in Bioinformatics is sequence alignment. We introduce fast alignment algorithm, called \\'Alignment By Scanning\\' (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the wellknown sequence alignment algorithms, the \\'GAP\\' (which is heuristic) and the \\'Needleman-Wunsch\\' (which is optimal). The proposed algorithm achieves up to 51% enhancement in alignment score when it is compared with the GAP Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

  18. Multilocus Sequence Typing of Total-Genome-Sequenced Bacteria

    DEFF Research Database (Denmark)

    Larsen, Mette Voldby; Cosentino, Salvatore; Rasmussen, Simon

    2012-01-01

    Accurate strain identification is essential for anyone working with bacteria. For many species, multilocus sequence typing (MLST) is considered the "gold standard" of typing, but it is traditionally performed in an expensive and time-consuming manner. As the costs of whole-genome sequencing (WGS...

  19. Dog Y chromosomal DNA sequence: identification, sequencing and SNP discovery

    Directory of Open Access Journals (Sweden)

    Kirkness Ewen

    2006-10-01

    Full Text Available Abstract Background Population genetic studies of dogs have so far mainly been based on analysis of mitochondrial DNA, describing only the history of female dogs. To get a picture of the male history, as well as a second independent marker, there is a need for studies of biallelic Y-chromosome polymorphisms. However, there are no biallelic polymorphisms reported, and only 3200 bp of non-repetitive dog Y-chromosome sequence deposited in GenBank, necessitating the identification of dog Y chromosome sequence and the search for polymorphisms therein. The genome has been only partially sequenced for one male dog, disallowing mapping of the sequence into specific chromosomes. However, by comparing the male genome sequence to the complete female dog genome sequence, candidate Y-chromosome sequence may be identified by exclusion. Results The male dog genome sequence was analysed by Blast search against the human genome to identify sequences with a best match to the human Y chromosome and to the female dog genome to identify those absent in the female genome. Candidate sequences were then tested for male specificity by PCR of five male and five female dogs. 32 sequences from the male genome, with a total length of 24 kbp, were identified as male specific, based on a match to the human Y chromosome, absence in the female dog genome and male specific PCR results. 14437 bp were then sequenced for 10 male dogs originating from Europe, Southwest Asia, Siberia, East Asia, Africa and America. Nine haplotypes were found, which were defined by 14 substitutions. The genetic distance between the haplotypes indicates that they originate from at least five wolf haplotypes. There was no obvious trend in the geographic distribution of the haplotypes. Conclusion We have identified 24159 bp of dog Y-chromosome sequence to be used for population genetic studies. We sequenced 14437 bp in a worldwide collection of dogs, identifying 14 SNPs for future SNP analyses, and

  20. SVX Sequencer Board

    International Nuclear Information System (INIS)

    Utes, M.

    1997-01-01

    The SVX Sequencer boards are 9U by 280mm circuit boards that reside in slots 2 through 21 of each of eight Eurocard crates in the D0 Detector Platform. The basic purpose is to control the SVX chips for data acquisition and when a trigger occurs, to gather the SVX data and relay the data to the VRB boards in the Movable Counting House. Functions and features are as follows: (1) Initialization of eight SVX chip strings using the MIL-STD-1553 data bus; (2) Real time manipulation of the SVX control lines to effect data acquisition, digitization, and readout based on the NRZ/Clock signals from the Controller; (3) Conversion of 8-bit electrical SVX readout data to an optical signal operating at 1.062 Gbit/sec, sent to the VRB. Eight HDIs will be serviced per board; (4) Built-in logic analyzer which can record the most important control and data lines during a data acquisition cycle and put this recorded information onto the 1553 bus; (5) Identification header and end of data trailer tacked onto data stream; (6) 1553 register which can read the current values of the control and data lines; (7) 1553 register which can test the optical link; (8) 1553 registers for crossing pulse width, calibration pulse voltage, and calibration pipeline select; (9) 1553 register for reading the optical drivers status link; (10) 1553 register for power control of SVX chips and ignoring bad SVX strings; (11) Front panel displays and LEDs show the board status at a glance; (12) In-system programmable EPLDs are programmed via 1553 or Altera's 'Bitblaster'; (13) Automatic readout abort after 45us; (14) Supplies BUSY signal back to Trigger Framework; (15) Supports a heartbeat system to prevent excessive SVX current draw; and (16) Supports a SVX power trip feature if heartbeat failure occurs.

  1. Sequence Algebra, Sequence Decision Diagrams and Dynamic Fault Trees

    International Nuclear Information System (INIS)

    Rauzy, Antoine B.

    2011-01-01

    A large attention has been focused on the Dynamic Fault Trees in the past few years. By adding new gates to static (regular) Fault Trees, Dynamic Fault Trees aim to take into account dependencies among events. Merle et al. proposed recently an algebraic framework to give a formal interpretation to these gates. In this article, we extend Merle et al.'s work by adopting a slightly different perspective. We introduce Sequence Algebras that can be seen as Algebras of Basic Events, representing failures of non-repairable components. We show how to interpret Dynamic Fault Trees within this framework. Finally, we propose a new data structure to encode sets of sequences of Basic Events: Sequence Decision Diagrams. Sequence Decision Diagrams are very much inspired from Minato's Zero-Suppressed Binary Decision Diagrams. We show that all operations of Sequence Algebras can be performed on this data structure.

  2. Chameleon sequences in neurodegenerative diseases

    International Nuclear Information System (INIS)

    Bahramali, Golnaz; Goliaei, Bahram; Minuchehr, Zarrin; Salari, Ali

    2016-01-01

    Chameleon sequences can adopt either alpha helix sheet or a coil conformation. Defining chameleon sequences in PDB (Protein Data Bank) may yield to an insight on defining peptides and proteins responsible in neurodegeneration. In this research, we benefitted from the large PDB and performed a sequence analysis on Chameleons, where we developed an algorithm to extract peptide segments with identical sequences, but different structures. In order to find new chameleon sequences, we extracted a set of 8315 non-redundant protein sequences from the PDB with an identity less than 25%. Our data was classified to “helix to strand (HE)”, “helix to coil (HC)” and “strand to coil (CE)” alterations. We also analyzed the occurrence of singlet and doublet amino acids and the solvent accessibility in the chameleon sequences; we then sorted out the proteins with the most number of chameleon sequences and named them Chameleon Flexible Proteins (CFPs) in our dataset. Our data revealed that Gly, Val, Ile, Tyr and Phe, are the major amino acids in Chameleons. We also found that there are proteins such as Insulin Degrading Enzyme IDE and GTP-binding nuclear protein Ran (RAN) with the most number of chameleons (640 and 405 respectively). These proteins have known roles in neurodegenerative diseases. Therefore it can be inferred that other CFP's can serve as key proteins in neurodegeneration, and a study on them can shed light on curing and preventing neurodegenerative diseases.

  3. Direct, rapid RNA sequence analysis

    International Nuclear Information System (INIS)

    Peattie, D.A.

    1987-01-01

    The original methods of RNA sequence analysis were based on enzymatic production and chromatographic separation of overlapping oligonucleotide fragments from within an RNA molecule followed by identification of the mononucleotides comprising the oligomer. Over the past decade the field of nucleic acid sequencing has changed dramatically, however, and RNA molecules now can be sequenced in a variety of more streamlined fashions. Most of the more recent advances in RNA sequencing have involved one-dimensional electrophoretic separation of 32 P-end-labeled oligoribonucleotides on polyacrylamide gels. In this chapter the author discusses two of these methods for determining the nucleotide sequences of RNA molecules rapidly: the chemical method and the enzymatic method. Both methods are direct and degradative, i.e., they rely on fragmatic and chemical approaches should be utilized. The single-strand-specific ribonucleases (A, T 1 , T 2 , and S 1 ) provide an efficient means to locate double-helical regions rapidly, and the chemical reactions provide a means to determine the RNA sequence within these regions. In addition, the chemical reactions allow one to assign interactions to specific atoms and to distinguish secondary interactions from tertiary ones. If the RNA molecule is small enough to be sequenced directly by the enzymatic or chemical method, the probing reactions can be done easily at the same time as sequencing reactions

  4. Chameleon sequences in neurodegenerative diseases.

    Science.gov (United States)

    Bahramali, Golnaz; Goliaei, Bahram; Minuchehr, Zarrin; Salari, Ali

    2016-03-25

    Chameleon sequences can adopt either alpha helix sheet or a coil conformation. Defining chameleon sequences in PDB (Protein Data Bank) may yield to an insight on defining peptides and proteins responsible in neurodegeneration. In this research, we benefitted from the large PDB and performed a sequence analysis on Chameleons, where we developed an algorithm to extract peptide segments with identical sequences, but different structures. In order to find new chameleon sequences, we extracted a set of 8315 non-redundant protein sequences from the PDB with an identity less than 25%. Our data was classified to "helix to strand (HE)", "helix to coil (HC)" and "strand to coil (CE)" alterations. We also analyzed the occurrence of singlet and doublet amino acids and the solvent accessibility in the chameleon sequences; we then sorted out the proteins with the most number of chameleon sequences and named them Chameleon Flexible Proteins (CFPs) in our dataset. Our data revealed that Gly, Val, Ile, Tyr and Phe, are the major amino acids in Chameleons. We also found that there are proteins such as Insulin Degrading Enzyme IDE and GTP-binding nuclear protein Ran (RAN) with the most number of chameleons (640 and 405 respectively). These proteins have known roles in neurodegenerative diseases. Therefore it can be inferred that other CFP's can serve as key proteins in neurodegeneration, and a study on them can shed light on curing and preventing neurodegenerative diseases. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Farey sequences and resistor networks

    Indian Academy of Sciences (India)

    Green's function, while the perturbation of a network is investigated in [3]. ... In Theorem 1 below, we employ the Farey sequence to establish a strict .... We next show that the Farey sequence method is applicable for circuits with n or fewer.

  6. DNA Sequencing by Capillary Electrophoresis

    Science.gov (United States)

    Karger, Barry L.; Guttman, Andras

    2009-01-01

    Sequencing of human and other genomes has been at the center of interest in the biomedical field over the past several decades and is now leading toward an era of personalized medicine. During this time, DNA sequencing methods have evolved from the labor intensive slab gel electrophoresis, through automated multicapillary electrophoresis systems using fluorophore labeling with multispectral imaging, to the “next generation” technologies of cyclic array, hybridization based, nanopore and single molecule sequencing. Deciphering the genetic blueprint and follow-up confirmatory sequencing of Homo sapiens and other genomes was only possible by the advent of modern sequencing technologies that was a result of step by step advances with a contribution of academics, medical personnel and instrument companies. While next generation sequencing is moving ahead at break-neck speed, the multicapillary electrophoretic systems played an essential role in the sequencing of the Human Genome, the foundation of the field of genomics. In this prospective, we wish to overview the role of capillary electrophoresis in DNA sequencing based in part of several of our articles in this journal. PMID:19517496

  7. Graphene nanodevices for DNA sequencing

    NARCIS (Netherlands)

    Heerema, S.J.; Dekker, C.

    2016-01-01

    Fast, cheap, and reliable DNA sequencing could be one of the most disruptive innovations of this decade, as it will pave the way for personalized medicine. In pursuit of such technology, a variety of nanotechnology-based approaches have been explored and established, including sequencing with

  8. Chameleon sequences in neurodegenerative diseases

    Energy Technology Data Exchange (ETDEWEB)

    Bahramali, Golnaz [Institute of Biochemistry and Biophysics, University of Tehran, Tehran (Iran, Islamic Republic of); Goliaei, Bahram, E-mail: goliaei@ut.ac.ir [Institute of Biochemistry and Biophysics, University of Tehran, Tehran (Iran, Islamic Republic of); Minuchehr, Zarrin, E-mail: minuchehr@nigeb.ac.ir [Department of Systems Biotechnology, National Institute of Genetic Engineering and Biotechnology, (NIGEB), Tehran (Iran, Islamic Republic of); Salari, Ali [Department of Systems Biotechnology, National Institute of Genetic Engineering and Biotechnology, (NIGEB), Tehran (Iran, Islamic Republic of)

    2016-03-25

    Chameleon sequences can adopt either alpha helix sheet or a coil conformation. Defining chameleon sequences in PDB (Protein Data Bank) may yield to an insight on defining peptides and proteins responsible in neurodegeneration. In this research, we benefitted from the large PDB and performed a sequence analysis on Chameleons, where we developed an algorithm to extract peptide segments with identical sequences, but different structures. In order to find new chameleon sequences, we extracted a set of 8315 non-redundant protein sequences from the PDB with an identity less than 25%. Our data was classified to “helix to strand (HE)”, “helix to coil (HC)” and “strand to coil (CE)” alterations. We also analyzed the occurrence of singlet and doublet amino acids and the solvent accessibility in the chameleon sequences; we then sorted out the proteins with the most number of chameleon sequences and named them Chameleon Flexible Proteins (CFPs) in our dataset. Our data revealed that Gly, Val, Ile, Tyr and Phe, are the major amino acids in Chameleons. We also found that there are proteins such as Insulin Degrading Enzyme IDE and GTP-binding nuclear protein Ran (RAN) with the most number of chameleons (640 and 405 respectively). These proteins have known roles in neurodegenerative diseases. Therefore it can be inferred that other CFP's can serve as key proteins in neurodegeneration, and a study on them can shed light on curing and preventing neurodegenerative diseases.

  9. Commercial Art: Scope and Sequence.

    Science.gov (United States)

    Nashville - Davidson County Metropolitan Public Schools, TN.

    This scope and sequence guide, developed for a commercial art vocational education program, represents an initial step in the development of a systemwide articulated curriculum sequence for all vocational programs within the Metropolitan Nashville Public School System. It was developed as a result of needs expressed by teachers, parents, and the…

  10. Rapid Diagnostics of Onboard Sequences

    Science.gov (United States)

    Starbird, Thomas W.; Morris, John R.; Shams, Khawaja S.; Maimone, Mark W.

    2012-01-01

    Keeping track of sequences onboard a spacecraft is challenging. When reviewing Event Verification Records (EVRs) of sequence executions on the Mars Exploration Rover (MER), operators often found themselves wondering which version of a named sequence the EVR corresponded to. The lack of this information drastically impacts the operators diagnostic capabilities as well as their situational awareness with respect to the commands the spacecraft has executed, since the EVRs do not provide argument values or explanatory comments. Having this information immediately available can be instrumental in diagnosing critical events and can significantly enhance the overall safety of the spacecraft. This software provides auditing capability that can eliminate that uncertainty while diagnosing critical conditions. Furthermore, the Restful interface provides a simple way for sequencing tools to automatically retrieve binary compiled sequence SCMFs (Space Command Message Files) on demand. It also enables developers to change the underlying database, while maintaining the same interface to the existing applications. The logging capabilities are also beneficial to operators when they are trying to recall how they solved a similar problem many days ago: this software enables automatic recovery of SCMF and RML (Robot Markup Language) sequence files directly from the command EVRs, eliminating the need for people to find and validate the corresponding sequences. To address the lack of auditing capability for sequences onboard a spacecraft during earlier missions, extensive logging support was added on the Mars Science Laboratory (MSL) sequencing server. This server is responsible for generating all MSL binary SCMFs from RML input sequences. The sequencing server logs every SCMF it generates into a MySQL database, as well as the high-level RML file and dictionary name inputs used to create the SCMF. The SCMF is then indexed by a hash value that is automatically included in all command

  11. Accident sequence quantification with KIRAP

    International Nuclear Information System (INIS)

    Kim, Tae Un; Han, Sang Hoon; Kim, Kil You; Yang, Jun Eon; Jeong, Won Dae; Chang, Seung Cheol; Sung, Tae Yong; Kang, Dae Il; Park, Jin Hee; Lee, Yoon Hwan; Hwang, Mi Jeong.

    1997-01-01

    The tasks of probabilistic safety assessment(PSA) consists of the identification of initiating events, the construction of event tree for each initiating event, construction of fault trees for event tree logics, the analysis of reliability data and finally the accident sequence quantification. In the PSA, the accident sequence quantification is to calculate the core damage frequency, importance analysis and uncertainty analysis. Accident sequence quantification requires to understand the whole model of the PSA because it has to combine all event tree and fault tree models, and requires the excellent computer code because it takes long computation time. Advanced Research Group of Korea Atomic Energy Research Institute(KAERI) has developed PSA workstation KIRAP(Korea Integrated Reliability Analysis Code Package) for the PSA work. This report describes the procedures to perform accident sequence quantification, the method to use KIRAP's cut set generator, and method to perform the accident sequence quantification with KIRAP. (author). 6 refs

  12. Accident sequence quantification with KIRAP

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Tae Un; Han, Sang Hoon; Kim, Kil You; Yang, Jun Eon; Jeong, Won Dae; Chang, Seung Cheol; Sung, Tae Yong; Kang, Dae Il; Park, Jin Hee; Lee, Yoon Hwan; Hwang, Mi Jeong

    1997-01-01

    The tasks of probabilistic safety assessment(PSA) consists of the identification of initiating events, the construction of event tree for each initiating event, construction of fault trees for event tree logics, the analysis of reliability data and finally the accident sequence quantification. In the PSA, the accident sequence quantification is to calculate the core damage frequency, importance analysis and uncertainty analysis. Accident sequence quantification requires to understand the whole model of the PSA because it has to combine all event tree and fault tree models, and requires the excellent computer code because it takes long computation time. Advanced Research Group of Korea Atomic Energy Research Institute(KAERI) has developed PSA workstation KIRAP(Korea Integrated Reliability Analysis Code Package) for the PSA work. This report describes the procedures to perform accident sequence quantification, the method to use KIRAP`s cut set generator, and method to perform the accident sequence quantification with KIRAP. (author). 6 refs.

  13. Repeated DNA sequences in fungi

    Energy Technology Data Exchange (ETDEWEB)

    Dutta, S K

    1974-11-01

    Several fungal species, representatives of all broad groups like basidiomycetes, ascomycetes and phycomycetes, were examined for the nature of repeated DNA sequences by DNA:DNA reassociation studies using hydroxyapatite chromatography. All of the fungal species tested contained 10 to 20 percent repeated DNA sequences. There are approximately 100 to 110 copies of repeated DNA sequences of approximately 4 x 10/sup 7/ daltons piece size of each. Repeated DNA sequence homoduplexes showed on average 5/sup 0/C difference of T/sub e/50 (temperature at which 50 percent duplexes dissociate) values from the corresponding homoduplexes of unfractionated whole DNA. It is suggested that a part of repetitive sequences in fungi constitutes mitochondrial DNA and a part of it constitutes nuclear DNA. (auth)

  14. [Complete genome sequencing and sequence analysis of BCG Tice].

    Science.gov (United States)

    Wang, Zhiming; Pan, Yuanlong; Wu, Jun; Zhu, Baoli

    2012-10-04

    The objective of this study is to obtain the complete genome sequence of Bacillus Calmette-Guerin Tice (BCG Tice), in order to provide more information about the molecular biology of BCG Tice and design more reasonable vaccines to prevent tuberculosis. We assembled the data from high-throughput sequencing with SOAPdenovo software, with many contigs and scaffolds obtained. There are many sequence gaps and physical gaps remained as a result of regional low coverage and low quality. We designed primers at the end of contigs and performed PCR amplification in order to link these contigs and scaffolds. With various enzymes to perform PCR amplification, adjustment of PCR reaction conditions, and combined with clone construction to sequence, all the gaps were finished. We obtained the complete genome sequence of BCG Tice and submitted it to GenBank of National Center for Biotechnology Information (NCBI). The genome of BCG Tice is 4334064 base pairs in length, with GC content 65.65%. The problems and strategies during the finishing step of BCG Tice sequencing are illuminated here, with the hope of affording some experience to those who are involved in the finishing step of genome sequencing. The microarray data were verified by our results.

  15. GROUPING WEB ACCESS SEQUENCES uSING SEQUENCE ALIGNMENT METHOD

    OpenAIRE

    BHUPENDRA S CHORDIA; KRISHNAKANT P ADHIYA

    2011-01-01

    In web usage mining grouping of web access sequences can be used to determine the behavior or intent of a set of users. Grouping websessions is how to measure the similarity between web sessions. There are many shortcomings in traditional measurement methods. The taskof grouping web sessions based on similarity and consists of maximizing the intra-group similarity while minimizing the inter-groupsimilarity is done using sequence alignment method. This paper introduces a new method to group we...

  16. LPTAU, Quasi Random Sequence Generator

    International Nuclear Information System (INIS)

    Sobol, Ilya M.

    1993-01-01

    1 - Description of program or function: LPTAU generates quasi random sequences. These are uniformly distributed sets of L=M N points in the N-dimensional unit cube: I N =[0,1]x...x[0,1]. These sequences are used as nodes for multidimensional integration; as searching points in global optimization; as trial points in multi-criteria decision making; as quasi-random points for quasi Monte Carlo algorithms. 2 - Method of solution: Uses LP-TAU sequence generation (see references). 3 - Restrictions on the complexity of the problem: The number of points that can be generated is L 30 . The dimension of the space cannot exceed 51

  17. Weak disorder in Fibonacci sequences

    Energy Technology Data Exchange (ETDEWEB)

    Ben-Naim, E [Theoretical Division and Center for Nonlinear Studies, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Krapivsky, P L [Department of Physics and Center for Molecular Cybernetics, Boston University, Boston, MA 02215 (United States)

    2006-05-19

    We study how weak disorder affects the growth of the Fibonacci series. We introduce a family of stochastic sequences that grow by the normal Fibonacci recursion with probability 1 - {epsilon}, but follow a different recursion rule with a small probability {epsilon}. We focus on the weak disorder limit and obtain the Lyapunov exponent that characterizes the typical growth of the sequence elements, using perturbation theory. The limiting distribution for the ratio of consecutive sequence elements is obtained as well. A number of variations to the basic Fibonacci recursion including shift, doubling and copying are considered. (letter to the editor)

  18. Sequence analysis of Leukemia DNA

    Science.gov (United States)

    Nacong, Nasria; Lusiyanti, Desy; Irawan, Muhammad. Isa

    2018-03-01

    Cancer is a very deadly disease, one of which is leukemia disease or better known as blood cancer. The cancer cell can be detected by taking DNA in laboratory test. This study focused on local alignment of leukemia and non leukemia data resulting from NCBI in the form of DNA sequences by using Smith-Waterman algorithm. SmithWaterman algorithm was invented by TF Smith and MS Waterman in 1981. These algorithms try to find as much as possible similarity of a pair of sequences, by giving a negative value to the unequal base pair (mismatch), and positive values on the same base pair (match). So that will obtain the maximum positive value as the end of the alignment, and the minimum value as the initial alignment. This study will use sequences of leukemia and 3 sequences of non leukemia.

  19. Integrated sequence analysis. Final report

    International Nuclear Information System (INIS)

    Andersson, K.; Pyy, P.

    1998-02-01

    The NKS/RAK subprojet 3 'integrated sequence analysis' (ISA) was formulated with the overall objective to develop and to test integrated methodologies in order to evaluate event sequences with significant human action contribution. The term 'methodology' denotes not only technical tools but also methods for integration of different scientific disciplines. In this report, we first discuss the background of ISA and the surveys made to map methods in different application fields, such as man machine system simulation software, human reliability analysis (HRA) and expert judgement. Specific event sequences were, after the surveys, selected for application and testing of a number of ISA methods. The event sequences discussed in the report were cold overpressure of BWR, shutdown LOCA of BWR, steam generator tube rupture of a PWR and BWR disturbed signal view in the control room after an external event. Different teams analysed these sequences by using different ISA and HRA methods. Two kinds of results were obtained from the ISA project: sequence specific and more general findings. The sequence specific results are discussed together with each sequence description. The general lessons are discussed under a separate chapter by using comparisons of different case studies. These lessons include areas ranging from plant safety management (design, procedures, instrumentation, operations, maintenance and safety practices) to methodological findings (ISA methodology, PSA,HRA, physical analyses, behavioural analyses and uncertainty assessment). Finally follows a discussion about the project and conclusions are presented. An interdisciplinary study of complex phenomena is a natural way to produce valuable and innovative results. This project came up with structured ways to perform ISA and managed to apply the in practice. The project also highlighted some areas where more work is needed. In the HRA work, development is required for the use of simulators and expert judgement as

  20. Optimization of sequence alignment for simple sequence repeat regions

    Directory of Open Access Journals (Sweden)

    Ogbonnaya Francis C

    2011-07-01

    Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs. SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. Findings To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type. When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. Conclusions The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic

  1. ADDRESS SEQUENCES FOR MULTI RUN RAM TESTING

    Directory of Open Access Journals (Sweden)

    V. N. Yarmolik

    2014-01-01

    Full Text Available A universal approach for generation of address sequences with specified properties is proposed and analyzed. A modified version of the Antonov and Saleev algorithm for Sobol sequences genera-tion is chosen as a mathematical description of the proposed method. Within the framework of the proposed universal approach, the Sobol sequences form a subset of the address sequences. Other sub-sets are also formed, which are Gray sequences, anti-Gray sequences, counter sequences and sequenc-es with specified properties.

  2. Fast and secure retrieval of DNA sequences

    NARCIS (Netherlands)

    2014-01-01

    Sequence models are retrieved from a sequences index. The sequence models model DNA or RNA sequences stored in a database, and each comprises a finite memory tree source model and parameters for the finite memory tree source model. One or more DNA or RNA sequences stored in the database are

  3. Decidability of uniform recurrence of morphic sequences

    OpenAIRE

    Durand , Fabien

    2012-01-01

    We prove that the uniform recurrence of morphic sequences is decidable. For this we show that the number of derived sequences of uniformly recurrent morphic sequences is bounded. As a corollary we obtain that uniformly recurrent morphic sequences are primitive substitutive sequences.

  4. Sequence Factorization with Multiple References.

    Directory of Open Access Journals (Sweden)

    Sebastian Wandelt

    Full Text Available The success of high-throughput sequencing has lead to an increasing number of projects which sequence large populations of a species. Storage and analysis of sequence data is a key challenge in these projects, because of the sheer size of the datasets. Compression is one simple technology to deal with this challenge. Referential factorization and compression schemes, which store only the differences between input sequence and a reference sequence, gained lots of interest in this field. Highly-similar sequences, e.g., Human genomes, can be compressed with a compression ratio of 1,000:1 and more, up to two orders of magnitude better than with standard compression techniques. Recently, it was shown that the compression against multiple references from the same species can boost the compression ratio up to 4,000:1. However, a detailed analysis of using multiple references is lacking, e.g., for main memory consumption and optimality. In this paper, we describe one key technique for the referential compression against multiple references: The factorization of sequences. Based on the notion of an optimal factorization, we propose optimization heuristics and identify parameter settings which greatly influence 1 the size of the factorization, 2 the time for factorization, and 3 the required amount of main memory. We evaluate a total of 30 setups with a varying number of references on data from three different species. Our results show a wide range of factorization sizes (optimal to an overhead of up to 300%, factorization speed (0.01 MB/s to more than 600 MB/s, and main memory usage (few dozen MB to dozens of GB. Based on our evaluation, we identify the best configurations for common use cases. Our evaluation shows that multi-reference factorization is much better than single-reference factorization.

  5. Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.

    Science.gov (United States)

    Tan, M K

    1991-08-01

    A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

  6. Genome Sequences of Oryza Species

    KAUST Repository

    Kumagai, Masahiko; Tanaka, Tsuyoshi; Ohyanagi, Hajime; Hsing, Yue-Ie C.; Itoh, Takeshi

    2018-01-01

    This chapter summarizes recent data obtained from genome sequencing, annotation projects, and studies on the genome diversity of Oryza sativa and related Oryza species. O. sativa, commonly known as Asian rice, is the first monocot species whose complete genome sequence was deciphered based on physical mapping by an international collaborative effort. This genome, along with its accurate and comprehensive annotation, has become an indispensable foundation for crop genomics and breeding. With the development of innovative sequencing technologies, genomic studies of O. sativa have dramatically increased; in particular, a large number of cultivars and wild accessions have been sequenced and compared with the reference rice genome. Since de novo genome sequencing has become cost-effective, the genome of African cultivated rice, O. glaberrima, has also been determined. Comparative genomic studies have highlighted the independent domestication processes of different rice species, but it also turned out that Asian and African rice share a common gene set that has experienced similar artificial selection. An international project aimed at constructing reference genomes and examining the genome diversity of wild Oryza species is currently underway, and the genomes of some species are publicly available. This project provides a platform for investigations such as the evolution, development, polyploidization, and improvement of crops. Studies on the genomic diversity of Oryza species, including wild species, should provide new insights to solve the problem of growing food demands in the face of rapid climatic changes.

  7. Genome Sequences of Oryza Species

    KAUST Repository

    Kumagai, Masahiko

    2018-02-14

    This chapter summarizes recent data obtained from genome sequencing, annotation projects, and studies on the genome diversity of Oryza sativa and related Oryza species. O. sativa, commonly known as Asian rice, is the first monocot species whose complete genome sequence was deciphered based on physical mapping by an international collaborative effort. This genome, along with its accurate and comprehensive annotation, has become an indispensable foundation for crop genomics and breeding. With the development of innovative sequencing technologies, genomic studies of O. sativa have dramatically increased; in particular, a large number of cultivars and wild accessions have been sequenced and compared with the reference rice genome. Since de novo genome sequencing has become cost-effective, the genome of African cultivated rice, O. glaberrima, has also been determined. Comparative genomic studies have highlighted the independent domestication processes of different rice species, but it also turned out that Asian and African rice share a common gene set that has experienced similar artificial selection. An international project aimed at constructing reference genomes and examining the genome diversity of wild Oryza species is currently underway, and the genomes of some species are publicly available. This project provides a platform for investigations such as the evolution, development, polyploidization, and improvement of crops. Studies on the genomic diversity of Oryza species, including wild species, should provide new insights to solve the problem of growing food demands in the face of rapid climatic changes.

  8. Transformed composite sequences for improved qubit addressing

    Science.gov (United States)

    Merrill, J. True; Doret, S. Charles; Vittorini, Grahame; Addison, J. P.; Brown, Kenneth R.

    2014-10-01

    Selective laser addressing of a single atom or atomic ion qubit can be improved using narrow-band composite pulse sequences. We describe a Lie-algebraic technique to generalize known narrow-band sequences and introduce sequences related by dilation and rotation of sequence generators. Our method improves known narrow-band sequences by decreasing both the pulse time and the residual error. Finally, we experimentally demonstrate these composite sequences using 40Ca+ ions trapped in a surface-electrode ion trap.

  9. Properties of Deterministic Aperiodic Photonic Nanostructures for Biosensors

    DEFF Research Database (Denmark)

    Paulsen, Moritz; Jahns, Sabrina; Neustock, Lars Thorben

    changes in the analyte region on top of the structure [1]. By specific biofunctionalization of the crystal surface, specific molecule capture is achieved. We demonstrated a handheld intensity-based measurement setup that allows for imaging detection of binding events at the surface [1]. To enhance......-Shapiro) consisting of a nanoimprinted photo mold layer providing the nanostructure and a TiO2 high index layer (fig. 1). The measured characteristics (band diagram, far field) of these devices are compared to the ones of mono- and multiperiodic nanostructures. Near-field and far-field calculations are carried out...

  10. Spatial filters on demand based on aperiodic Photonic Crystals

    Energy Technology Data Exchange (ETDEWEB)

    Gailevicius, Darius; Purlys, Vytautas; Peckus, Martynas; Gadonas, Roaldas [Laser Research Center, Department of Quantum Electronics, Vilnius University (Lithuania); Staliunas, Kestutis [DONLL, Departament de Fisica, Universitat Politecnica de Catalunya (UPC), Terrassa (Spain); Institucio Catalana de Recerca i Estudis Avancats (ICREA), Barcelona (Spain)

    2017-08-15

    Photonic Crystal spatial filters, apart from stand-alone spatial filtering function, can also suppress multi-transverse-mode operation in laser resonators. Here it is shown that such photonic crystals can be designed by solving the inverse problem: for a given spatial filtering profile. Optimized Photonic Crystal filters were fabricated in photosensitive glass. Experiments have shown that such filters provide a more pronounced filtering effect for total and partial transmissivity conditions. (copyright 2017 by WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  11. Aperiodic topological order in the domain configurations of functional materials

    Science.gov (United States)

    Huang, Fei-Ting; Cheong, Sang-Wook

    2017-03-01

    In numerous functional materials, such as steels, ferroelectrics and magnets, new functionalities can be achieved through the engineering of the domain structures, which are associated with the ordering of certain parameters within the material. The recent progress in technologies that enable imaging at atomic-scale spatial resolution has transformed our understanding of domain topology, revealing that, along with simple stripe-like or irregularly shaped domains, intriguing vortex-type topological domain configurations also exist. In this Review, we present a new classification scheme of 'Zm Zn domains with Zl vortices' for 2D macroscopic domain structures with m directional variants and n translational antiphases. This classification, together with the concepts of topological protection and topological charge conservation, can be applied to a wide range of materials, such as multiferroics, improper ferroelectrics, layered transition metal dichalcogenides and magnetic superconductors, as we discuss using selected examples. The resulting topological considerations provide a new basis for the understanding of the formation, kinetics, manipulation and property optimization of domains and domain boundaries in functional materials.

  12. Sequences, groups, and number theory

    CERN Document Server

    Rigo, Michel

    2018-01-01

    This collaborative book presents recent trends on the study of sequences, including combinatorics on words and symbolic dynamics, and new interdisciplinary links to group theory and number theory. Other chapters branch out from those areas into subfields of theoretical computer science, such as complexity theory and theory of automata. The book is built around four general themes: number theory and sequences, word combinatorics, normal numbers, and group theory. Those topics are rounded out by investigations into automatic and regular sequences, tilings and theory of computation, discrete dynamical systems, ergodic theory, numeration systems, automaton semigroups, and amenable groups.  This volume is intended for use by graduate students or research mathematicians, as well as computer scientists who are working in automata theory and formal language theory. With its organization around unified themes, it would also be appropriate as a supplemental text for graduate level courses.

  13. Explaining the harmonic sequence paradox.

    Science.gov (United States)

    Schmidt, Ulrich; Zimper, Alexander

    2012-05-01

    According to the harmonic sequence paradox, an expected utility decision maker's willingness to pay for a gamble whose expected payoffs evolve according to the harmonic series is finite if and only if his marginal utility of additional income becomes zero for rather low payoff levels. Since the assumption of zero marginal utility is implausible for finite payoff levels, expected utility theory - as well as its standard generalizations such as cumulative prospect theory - are apparently unable to explain a finite willingness to pay. This paper presents first an experimental study of the harmonic sequence paradox. Additionally, it demonstrates that the theoretical argument of the harmonic sequence paradox only applies to time-patient decision makers, whereas the paradox is easily avoided if time-impatience is introduced. ©2011 The British Psychological Society.

  14. Integrated sequence analysis. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Andersson, K.; Pyy, P

    1998-02-01

    The NKS/RAK subprojet 3 `integrated sequence analysis` (ISA) was formulated with the overall objective to develop and to test integrated methodologies in order to evaluate event sequences with significant human action contribution. The term `methodology` denotes not only technical tools but also methods for integration of different scientific disciplines. In this report, we first discuss the background of ISA and the surveys made to map methods in different application fields, such as man machine system simulation software, human reliability analysis (HRA) and expert judgement. Specific event sequences were, after the surveys, selected for application and testing of a number of ISA methods. The event sequences discussed in the report were cold overpressure of BWR, shutdown LOCA of BWR, steam generator tube rupture of a PWR and BWR disturbed signal view in the control room after an external event. Different teams analysed these sequences by using different ISA and HRA methods. Two kinds of results were obtained from the ISA project: sequence specific and more general findings. The sequence specific results are discussed together with each sequence description. The general lessons are discussed under a separate chapter by using comparisons of different case studies. These lessons include areas ranging from plant safety management (design, procedures, instrumentation, operations, maintenance and safety practices) to methodological findings (ISA methodology, PSA,HRA, physical analyses, behavioural analyses and uncertainty assessment). Finally follows a discussion about the project and conclusions are presented. An interdisciplinary study of complex phenomena is a natural way to produce valuable and innovative results. This project came up with structured ways to perform ISA and managed to apply the in practice. The project also highlighted some areas where more work is needed. In the HRA work, development is required for the use of simulators and expert judgement as

  15. Matrix transformations and sequence spaces

    International Nuclear Information System (INIS)

    Nanda, S.

    1983-06-01

    In most cases the most general linear operator from one sequence space into another is actually given by an infinite matrix and therefore the theory of matrix transformations has always been of great interest in the study of sequence spaces. The study of general theory of matrix transformations was motivated by the special results in summability theory. This paper is a review article which gives almost all known results on matrix transformations. This also suggests a number of open problems for further study and will be very useful for research workers. (author)

  16. Green's theorem and Gorenstein sequences

    OpenAIRE

    Ahn, Jeaman; Migliore, Juan C.; Shin, Yong-Su

    2016-01-01

    We study consequences, for a standard graded algebra, of extremal behavior in Green's Hyperplane Restriction Theorem. First, we extend his Theorem 4 from the case of a plane curve to the case of a hypersurface in a linear space. Second, assuming a certain Lefschetz condition, we give a connection to extremal behavior in Macaulay's theorem. We apply these results to show that $(1,19,17,19,1)$ is not a Gorenstein sequence, and as a result we classify the sequences of the form $(1,a,a-2,a,1)$ th...

  17. Sequences in language and text

    CERN Document Server

    Mikros, George K

    2015-01-01

    The aim of this volume is to present the diverse but highly interesting area of the quantitative analysis of the sequence of various linguistic structures. The collected articles present a wide spectrum of quantitative analyses of linguistic syntagmatic structures and explore novel sequential linguistic entities. This volume will be interesting to all researchers studying linguistics using quantitative methods.

  18. Probabilistic studies of accident sequences

    International Nuclear Information System (INIS)

    Villemeur, A.; Berger, J.P.

    1986-01-01

    For several years, Electricite de France has carried out probabilistic assessment of accident sequences for nuclear power plants. In the framework of this program many methods were developed. As the interest in these studies was increasing and as adapted methods were developed, Electricite de France has undertaken a probabilistic safety assessment of a nuclear power plant [fr

  19. MRI sequences and their parameters

    International Nuclear Information System (INIS)

    Teissier, J.M.

    1993-01-01

    Listing basic sequences and their present variants makes a synthetic classification of the various acquisition modes possible. The knowledge of the advantages of each of them, as well as of their disadvantages and restraints, seems to be an essential prerequisite to an optimal utilization of each magnetic resonance imaging system. (author)

  20. Degree sequence in message transfer

    Science.gov (United States)

    Yamuna, M.

    2017-11-01

    Message encryption is always an issue in current communication scenario. Methods are being devised using various domains. Graphs satisfy numerous unique properties which can be used for message transfer. In this paper, I propose a message encryption method based on degree sequence of graphs.

  1. Fractals in DNA sequence analysis

    Institute of Scientific and Technical Information of China (English)

    Yu Zu-Guo(喻祖国); Vo Anh; Gong Zhi-Min(龚志民); Long Shun-Chao(龙顺潮)

    2002-01-01

    Fractal methods have been successfully used to study many problems in physics, mathematics, engineering, finance,and even in biology. There has been an increasing interest in unravelling the mysteries of DNA; for example, how can we distinguish coding and noncoding sequences, and the problems of classification and evolution relationship of organisms are key problems in bioinformatics. Although much research has been carried out by taking into consideration the long-range correlations in DNA sequences, and the global fractal dimension has been used in these works by other people, the models and methods are somewhat rough and the results are not satisfactory. In recent years, our group has introduced a time series model (statistical point of view) and a visual representation (geometrical point of view)to DNA sequence analysis. We have also used fractal dimension, correlation dimension, the Hurst exponent and the dimension spectrum (multifractal analysis) to discuss problems in this field. In this paper, we introduce these fractal models and methods and the results of DNA sequence analysis.

  2. On primes in Lucas sequences

    Czech Academy of Sciences Publication Activity Database

    Křížek, Michal; Somer, L.

    2015-01-01

    Roč. 53, č. 1 (2015), s. 2-23 ISSN 0015-0517 R&D Projects: GA ČR GA14-02067S Institutional support: RVO:67985840 Keywords : Lucas sequence * primes Subject RIV: BA - General Mathematics http://www.fq.math.ca/Abstracts/53-1/somer.pdf

  3. Is sequence awareness mandatory for perceptual sequence learning: An assessment using a pure perceptual sequence learning design.

    Science.gov (United States)

    Deroost, Natacha; Coomans, Daphné

    2018-02-01

    We examined the role of sequence awareness in a pure perceptual sequence learning design. Participants had to react to the target's colour that changed according to a perceptual sequence. By varying the mapping of the target's colour onto the response keys, motor responses changed randomly. The effect of sequence awareness on perceptual sequence learning was determined by manipulating the learning instructions (explicit versus implicit) and assessing the amount of sequence awareness after the experiment. In the explicit instruction condition (n = 15), participants were instructed to intentionally search for the colour sequence, whereas in the implicit instruction condition (n = 15), they were left uninformed about the sequenced nature of the task. Sequence awareness after the sequence learning task was tested by means of a questionnaire and the process-dissociation-procedure. The results showed that the instruction manipulation had no effect on the amount of perceptual sequence learning. Based on their report to have actively applied their sequence knowledge during the experiment, participants were subsequently regrouped in a sequence strategy group (n = 14, of which 4 participants from the implicit instruction condition and 10 participants from the explicit instruction condition) and a no-sequence strategy group (n = 16, of which 11 participants from the implicit instruction condition and 5 participants from the explicit instruction condition). Only participants of the sequence strategy group showed reliable perceptual sequence learning and sequence awareness. These results indicate that perceptual sequence learning depends upon the continuous employment of strategic cognitive control processes on sequence knowledge. Sequence awareness is suggested to be a necessary but not sufficient condition for perceptual learning to take place. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Teaching Task Sequencing via Verbal Mediation.

    Science.gov (United States)

    Rusch, Frank R.; And Others

    1987-01-01

    Verbal sequence training was used to teach a moderately mentally retarded woman to sequence job-related tasks. Learning to say the tasks in the proper sequence resulted in the employee performing her tasks in that sequence, and the employee was capable of mediating her own work behavior when scheduled changes occurred. (Author/JDD)

  5. Repdigits in k-Lucas sequences

    Indian Academy of Sciences (India)

    57(2) 2000 243-254) proved that 11 is the largest number with only one distinct digit (the so-called repdigit) in the sequence ( L n ( 2 ) ) n . In this paper, we address a similar problem in the family of -Lucas sequences. We also show that the -Lucas sequences have similar properties to those of -Fibonacci sequences ...

  6. Nonparametric Inference for Periodic Sequences

    KAUST Repository

    Sun, Ying

    2012-02-01

    This article proposes a nonparametric method for estimating the period and values of a periodic sequence when the data are evenly spaced in time. The period is estimated by a "leave-out-one-cycle" version of cross-validation (CV) and complements the periodogram, a widely used tool for period estimation. The CV method is computationally simple and implicitly penalizes multiples of the smallest period, leading to a "virtually" consistent estimator of integer periods. This estimator is investigated both theoretically and by simulation.We also propose a nonparametric test of the null hypothesis that the data have constantmean against the alternative that the sequence of means is periodic. Finally, our methodology is demonstrated on three well-known time series: the sunspots and lynx trapping data, and the El Niño series of sea surface temperatures. © 2012 American Statistical Association and the American Society for Quality.

  7. Multi-qubit compensation sequences

    International Nuclear Information System (INIS)

    Tomita, Y; Merrill, J T; Brown, K R

    2010-01-01

    The Hamiltonian control of n qubits requires precision control of both the strength and timing of interactions. Compensation pulses relax the precision requirements by reducing unknown but systematic errors. Using composite pulse techniques designed for single qubits, we show that systematic errors for n-qubit systems can be corrected to arbitrary accuracy given either two non-commuting control Hamiltonians with identical systematic errors or one error-free control Hamiltonian. We also examine composite pulses in the context of quantum computers controlled by two-qubit interactions. For quantum computers based on the XY interaction, single-qubit composite pulse sequences naturally correct systematic errors. For quantum computers based on the Heisenberg or exchange interaction, the composite pulse sequences reduce the logical single-qubit gate errors but increase the errors for logical two-qubit gates.

  8. Cassini Mission Sequence Subsystem (MSS)

    Science.gov (United States)

    Alland, Robert

    2011-01-01

    This paper describes my work with the Cassini Mission Sequence Subsystem (MSS) team during the summer of 2011. It gives some background on the motivation for this project and describes the expected benefit to the Cassini program. It then introduces the two tasks that I worked on - an automatic system auditing tool and a series of corrections to the Cassini Sequence Generator (SEQ_GEN) - and the specific objectives these tasks were to accomplish. Next, it details the approach I took to meet these objectives and the results of this approach, followed by a discussion of how the outcome of the project compares with my initial expectations. The paper concludes with a summary of my experience working on this project, lists what the next steps are, and acknowledges the help of my Cassini colleagues.

  9. Sequence complexity and work extraction

    International Nuclear Information System (INIS)

    Merhav, Neri

    2015-01-01

    We consider a simplified version of a solvable model by Mandal and Jarzynski, which constructively demonstrates the interplay between work extraction and the increase of the Shannon entropy of an information reservoir which is in contact with a physical system. We extend Mandal and Jarzynski’s main findings in several directions: first, we allow sequences of correlated bits rather than just independent bits. Secondly, at least for the case of binary information, we show that, in fact, the Shannon entropy is only one measure of complexity of the information that must increase in order for work to be extracted. The extracted work can also be upper bounded in terms of the increase in other quantities that measure complexity, like the predictability of future bits from past ones. Third, we provide an extension to the case of non-binary information (i.e. a larger alphabet), and finally, we extend the scope to the case where the incoming bits (before the interaction) form an individual sequence, rather than a random one. In this case, the entropy before the interaction can be replaced by the Lempel–Ziv (LZ) complexity of the incoming sequence, a fact that gives rise to an entropic meaning of the LZ complexity, not only in information theory, but also in physics. (paper)

  10. Entropic fluctuations in DNA sequences

    Science.gov (United States)

    Thanos, Dimitrios; Li, Wentian; Provata, Astero

    2018-03-01

    The Local Shannon Entropy (LSE) in blocks is used as a complexity measure to study the information fluctuations along DNA sequences. The LSE of a DNA block maps the local base arrangement information to a single numerical value. It is shown that despite this reduction of information, LSE allows to extract meaningful information related to the detection of repetitive sequences in whole chromosomes and is useful in finding evolutionary differences between organisms. More specifically, large regions of tandem repeats, such as centromeres, can be detected based on their low LSE fluctuations along the chromosome. Furthermore, an empirical investigation of the appropriate block sizes is provided and the relationship of LSE properties with the structure of the underlying repetitive units is revealed by using both computational and mathematical methods. Sequence similarity between the genomic DNA of closely related species also leads to similar LSE values at the orthologous regions. As an application, the LSE covariance function is used to measure the evolutionary distance between several primate genomes.

  11. Method and apparatus for biological sequence comparison

    Science.gov (United States)

    Marr, T.G.; Chang, W.I.

    1997-12-23

    A method and apparatus are disclosed for comparing biological sequences from a known source of sequences, with a subject (query) sequence. The apparatus takes as input a set of target similarity levels (such as evolutionary distances in units of PAM), and finds all fragments of known sequences that are similar to the subject sequence at each target similarity level, and are long enough to be statistically significant. The invention device filters out fragments from the known sequences that are too short, or have a lower average similarity to the subject sequence than is required by each target similarity level. The subject sequence is then compared only to the remaining known sequences to find the best matches. The filtering member divides the subject sequence into overlapping blocks, each block being sufficiently large to contain a minimum-length alignment from a known sequence. For each block, the filter member compares the block with every possible short fragment in the known sequences and determines a best match for each comparison. The determined set of short fragment best matches for the block provide an upper threshold on alignment values. Regions of a certain length from the known sequences that have a mean alignment value upper threshold greater than a target unit score are concatenated to form a union. The current block is compared to the union and provides an indication of best local alignment with the subject sequence. 5 figs.

  12. Memory and learning with rapid audiovisual sequences

    Science.gov (United States)

    Keller, Arielle S.; Sekuler, Robert

    2015-01-01

    We examined short-term memory for sequences of visual stimuli embedded in varying multisensory contexts. In two experiments, subjects judged the structure of the visual sequences while disregarding concurrent, but task-irrelevant auditory sequences. Stimuli were eight-item sequences in which varying luminances and frequencies were presented concurrently and rapidly (at 8 Hz). Subjects judged whether the final four items in a visual sequence identically replicated the first four items. Luminances and frequencies in each sequence were either perceptually correlated (Congruent) or were unrelated to one another (Incongruent). Experiment 1 showed that, despite encouragement to ignore the auditory stream, subjects' categorization of visual sequences was strongly influenced by the accompanying auditory sequences. Moreover, this influence tracked the similarity between a stimulus's separate audio and visual sequences, demonstrating that task-irrelevant auditory sequences underwent a considerable degree of processing. Using a variant of Hebb's repetition design, Experiment 2 compared musically trained subjects and subjects who had little or no musical training on the same task as used in Experiment 1. Test sequences included some that intermittently and randomly recurred, which produced better performance than sequences that were generated anew for each trial. The auditory component of a recurring audiovisual sequence influenced musically trained subjects more than it did other subjects. This result demonstrates that stimulus-selective, task-irrelevant learning of sequences can occur even when such learning is an incidental by-product of the task being performed. PMID:26575193

  13. Memory and learning with rapid audiovisual sequences.

    Science.gov (United States)

    Keller, Arielle S; Sekuler, Robert

    2015-01-01

    We examined short-term memory for sequences of visual stimuli embedded in varying multisensory contexts. In two experiments, subjects judged the structure of the visual sequences while disregarding concurrent, but task-irrelevant auditory sequences. Stimuli were eight-item sequences in which varying luminances and frequencies were presented concurrently and rapidly (at 8 Hz). Subjects judged whether the final four items in a visual sequence identically replicated the first four items. Luminances and frequencies in each sequence were either perceptually correlated (Congruent) or were unrelated to one another (Incongruent). Experiment 1 showed that, despite encouragement to ignore the auditory stream, subjects' categorization of visual sequences was strongly influenced by the accompanying auditory sequences. Moreover, this influence tracked the similarity between a stimulus's separate audio and visual sequences, demonstrating that task-irrelevant auditory sequences underwent a considerable degree of processing. Using a variant of Hebb's repetition design, Experiment 2 compared musically trained subjects and subjects who had little or no musical training on the same task as used in Experiment 1. Test sequences included some that intermittently and randomly recurred, which produced better performance than sequences that were generated anew for each trial. The auditory component of a recurring audiovisual sequence influenced musically trained subjects more than it did other subjects. This result demonstrates that stimulus-selective, task-irrelevant learning of sequences can occur even when such learning is an incidental by-product of the task being performed.

  14. Multineuronal Spike Sequences Repeat with Millisecond Precision

    Directory of Open Access Journals (Sweden)

    Koki eMatsumoto

    2013-06-01

    Full Text Available Cortical microcircuits are nonrandomly wired by neurons. As a natural consequence, spikes emitted by microcircuits are also nonrandomly patterned in time and space. One of the prominent spike organizations is a repetition of fixed patterns of spike series across multiple neurons. However, several questions remain unsolved, including how precisely spike sequences repeat, how the sequences are spatially organized, how many neurons participate in sequences, and how different sequences are functionally linked. To address these questions, we monitored spontaneous spikes of hippocampal CA3 neurons ex vivo using a high-speed functional multineuron calcium imaging technique that allowed us to monitor spikes with millisecond resolution and to record the location of spiking and nonspiking neurons. Multineuronal spike sequences were overrepresented in spontaneous activity compared to the statistical chance level. Approximately 75% of neurons participated in at least one sequence during our observation period. The participants were sparsely dispersed and did not show specific spatial organization. The number of sequences relative to the chance level decreased when larger time frames were used to detect sequences. Thus, sequences were precise at the millisecond level. Sequences often shared common spikes with other sequences; parts of sequences were subsequently relayed by following sequences, generating complex chains of multiple sequences.

  15. Static multiplicities in heterogeneous azeotropic distillation sequences

    DEFF Research Database (Denmark)

    Esbjerg, Klavs; Andersen, Torben Ravn; Jørgensen, Sten Bay

    1998-01-01

    In this paper the results of a bifurcation analysis on heterogeneous azeotropic distillation sequences are given. Two sequences suitable for ethanol dehydration are compared: The 'direct' and the 'indirect' sequence. It is shown, that the two sequences, despite their similarities, exhibit very...... different static behavior. The method of Petlyuk and Avet'yan (1971), Bekiaris et al. (1993), which assumes infinite reflux and infinite number of stages, is extended to and applied on heterogeneous azeotropic distillation sequences. The predictions are substantiated through simulations. The static sequence...

  16. Blind sequence-length estimation of low-SNR cyclostationary sequences

    CSIR Research Space (South Africa)

    Vlok, JD

    2014-06-01

    Full Text Available Several existing direct-sequence spread spectrum (DSSS) detection and estimation algorithms assume prior knowledge of the symbol period or sequence length, although very few sequence-length estimation techniques are available in the literature...

  17. Infinite matrices and sequence spaces

    CERN Document Server

    Cooke, Richard G

    2014-01-01

    This clear and correct summation of basic results from a specialized field focuses on the behavior of infinite matrices in general, rather than on properties of special matrices. Three introductory chapters guide students to the manipulation of infinite matrices, covering definitions and preliminary ideas, reciprocals of infinite matrices, and linear equations involving infinite matrices.From the fourth chapter onward, the author treats the application of infinite matrices to the summability of divergent sequences and series from various points of view. Topics include consistency, mutual consi

  18. Parallel motif extraction from very long sequences

    KAUST Repository

    Sahli, Majed; Mansour, Essam; Kalnis, Panos

    2013-01-01

    Motifs are frequent patterns used to identify biological functionality in genomic sequences, periodicity in time series, or user trends in web logs. In contrast to a lot of existing work that focuses on collections of many short sequences, modern

  19. Computational analysis of sequence selection mechanisms.

    Science.gov (United States)

    Meyerguz, Leonid; Grasso, Catherine; Kleinberg, Jon; Elber, Ron

    2004-04-01

    Mechanisms leading to gene variations are responsible for the diversity of species and are important components of the theory of evolution. One constraint on gene evolution is that of protein foldability; the three-dimensional shapes of proteins must be thermodynamically stable. We explore the impact of this constraint and calculate properties of foldable sequences using 3660 structures from the Protein Data Bank. We seek a selection function that receives sequences as input, and outputs survival probability based on sequence fitness to structure. We compute the number of sequences that match a particular protein structure with energy lower than the native sequence, the density of the number of sequences, the entropy, and the "selection" temperature. The mechanism of structure selection for sequences longer than 200 amino acids is approximately universal. For shorter sequences, it is not. We speculate on concrete evolutionary mechanisms that show this behavior.

  20. The recurrence sequences via Sylvester matrices

    Science.gov (United States)

    Karaduman, Erdal; Deveci, Ömür

    2017-07-01

    In this work, we define the Pell-Jacobsthal-Slyvester sequence and the Jacobsthal-Pell-Slyvester sequence by using the Slyvester matrices which are obtained from the characteristic polynomials of the Pell and Jacobsthal sequences and then, we study the sequences defined modulo m. Also, we obtain the cyclic groups and the semigroups from the generating matrices of these sequences when read modulo m and then, we derive the relationships among the orders of the cyclic groups and the periods of the sequences. Furthermore, we redefine Pell-Jacobsthal-Slyvester sequence and the Jacobsthal-Pell-Slyvester sequence by means of the elements of the groups and then, we examine them in the finite groups.

  1. ON SOME RECURRENCE TYPE SMARANDACHE SEQUENCES

    OpenAIRE

    MAJUMDAR, A.A.K.; GUNARTO, H.

    2000-01-01

    In this paper, we study some properties of ten recurrence type Smarandache sequences, namely, the Smarandache odd, even, prime product, square product, higher-power product, permutation, consecutive, reverse, symmetric, and pierced chain sequences.

  2. "First generation" automated DNA sequencing technology.

    Science.gov (United States)

    Slatko, Barton E; Kieleczawa, Jan; Ju, Jingyue; Gardner, Andrew F; Hendrickson, Cynthia L; Ausubel, Frederick M

    2011-10-01

    Beginning in the 1980s, automation of DNA sequencing has greatly increased throughput, reduced costs, and enabled large projects to be completed more easily. The development of automation technology paralleled the development of other aspects of DNA sequencing: better enzymes and chemistry, separation and imaging technology, sequencing protocols, robotics, and computational advancements (including base-calling algorithms with quality scores, database developments, and sequence analysis programs). Despite the emergence of high-throughput sequencing platforms, automated Sanger sequencing technology remains useful for many applications. This unit provides background and a description of the "First-Generation" automated DNA sequencing technology. It also includes protocols for using the current Applied Biosystems (ABI) automated DNA sequencing machines. © 2011 by John Wiley & Sons, Inc.

  3. Comparative analysis of sequences from PT 2013

    DEFF Research Database (Denmark)

    Mikkelsen, Susie Sommer

    Sheatfish and not EHNV. Generally, mistakes occurred at the ends of the sequences. This can be due to several factors. One is that the sequence has not been trimmed of the sequence primer sites. Another is the lack of quality control of the chromatogram. Finally, sequencing in just one direction can result...... diseases in Europe. As part of the EURL proficiency test for fish diseases it is required to sequence any RANA virus isolates found in any of the samples. It is also highly recommended to sequence the ISA virus to determine whether it be HPRΔ or HPR0. Furthermore, it is recommended that any VHSV and IHNV...... isolates be genotyped. As part of the evaluation of the proficiency results it was decided this year to look into the quality and similarity of the sequence results for selected viruses. Ampoule III in the proficiency test 2013 contained an EHNV isolate. The EURL received 43 sequences from 41 laboratories...

  4. Perfect sequences over the real quaternions

    OpenAIRE

    Kuznetsov, Oleg

    2017-01-01

    In this Thesis, perfect sequences over the real quaternions are first considered. Definitions for the right and left periodic autocorrelation functions are given, and right and left perfect sequences introduced. It is shown that the right (left) perfection of any sequence implies the left (right) perfection, so concepts of right and left perfect sequences over the real quaternions are equivalent. Unitary transformations of the quaternion space ℍ are then considered. Using the equivalence of t...

  5. Information decomposition method to analyze symbolical sequences

    International Nuclear Information System (INIS)

    Korotkov, E.V.; Korotkova, M.A.; Kudryashov, N.A.

    2003-01-01

    The information decomposition (ID) method to analyze symbolical sequences is presented. This method allows us to reveal a latent periodicity of any symbolical sequence. The ID method is shown to have advantages in comparison with application of the Fourier transformation, the wavelet transform and the dynamic programming method to look for latent periodicity. Examples of the latent periods for poetic texts, DNA sequences and amino acids are presented. Possible origin of a latent periodicity for different symbolical sequences is discussed

  6. Parallel sequencing lives, or what makes large sequencing projects successful.

    Science.gov (United States)

    Quilez, Javier; Vidal, Enrique; Dily, François Le; Serra, François; Cuartero, Yasmina; Stadhouders, Ralph; Graf, Thomas; Marti-Renom, Marc A; Beato, Miguel; Filion, Guillaume

    2017-11-01

    T47D_rep2 and b1913e6c1_51720e9cf were 2 Hi-C samples. They were born and processed at the same time, yet their fates were very different. The life of b1913e6c1_51720e9cf was simple and fruitful, while that of T47D_rep2 was full of accidents and sorrow. At the heart of these differences lies the fact that b1913e6c1_51720e9cf was born under a lab culture of Documentation, Automation, Traceability, and Autonomy and compliance with the FAIR Principles. Their lives are a lesson for those who wish to embark on the journey of managing high-throughput sequencing data. © The Author 2017. Published by Oxford University Press.

  7. MatrixPlot: visualizing sequence constraints

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Stærfeldt, Hans Henrik; Lund, Ole

    1999-01-01

    MatrixPlot: visualizing sequence constraints. Sub-title Abstract Summary : MatrixPlot is a program for making high-quality matrix plots, such as mutual information plots of sequence alignments and distance matrices of sequences with known three-dimensional coordinates. The user can add information...

  8. Comparative genomics beyond sequence-based alignments

    DEFF Research Database (Denmark)

    Þórarinsson, Elfar; Yao, Zizhen; Wiklund, Eric D.

    2008-01-01

    Recent computational scans for non-coding RNAs (ncRNAs) in multiple organisms have relied on existing multiple sequence alignments. However, as sequence similarity drops, a key signal of RNA structure--frequent compensating base changes--is increasingly likely to cause sequence-based alignment me...

  9. DNA sequence modeling based on context trees

    NARCIS (Netherlands)

    Kusters, C.J.; Ignatenko, T.; Roland, J.; Horlin, F.

    2015-01-01

    Genomic sequences contain instructions for protein and cell production. Therefore understanding and identification of biologically and functionally meaningful patterns in DNA sequences is of paramount importance. Modeling of DNA sequences in its turn can help to better understand and identify such

  10. Compact flow diagrams for state sequences

    NARCIS (Netherlands)

    Buchin, K.A.; Buchin, M.E.; Gudmundsson, J.; Horton, M.J.; Sijben, S.

    2016-01-01

    We introduce the concept of compactly representing a large number of state sequences, e.g., sequences of activities, as a flow diagram. We argue that the flow diagram representation gives an intuitive summary that allows the user to detect patterns among large sets of state sequences. Simplified,

  11. Blazar Sequence in Fermi Era Liang Chen

    Indian Academy of Sciences (India)

    Abstract. In this paper, we review the latest research results on the topic of blazar sequence. It seems that the blazar sequence is phenomenally ruled out, while the theoretical blazar sequence still holds. We point out that black hole mass is a dominated parameter accounting for high-power- high-synchrotron-peaked and ...

  12. Tidying up international nucleotide sequence databases: ecological, geographical and sequence quality annotation of its sequences of mycorrhizal fungi.

    Science.gov (United States)

    Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

    2011-01-01

    Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.

  13. Permutation Entropy for Random Binary Sequences

    Directory of Open Access Journals (Sweden)

    Lingfeng Liu

    2015-12-01

    Full Text Available In this paper, we generalize the permutation entropy (PE measure to binary sequences, which is based on Shannon’s entropy, and theoretically analyze this measure for random binary sequences. We deduce the theoretical value of PE for random binary sequences, which can be used to measure the randomness of binary sequences. We also reveal the relationship between this PE measure with other randomness measures, such as Shannon’s entropy and Lempel–Ziv complexity. The results show that PE is consistent with these two measures. Furthermore, we use PE as one of the randomness measures to evaluate the randomness of chaotic binary sequences.

  14. The 2016 Kumamoto earthquake sequence.

    Science.gov (United States)

    Kato, Aitaro; Nakamura, Kouji; Hiyama, Yohei

    2016-01-01

    Beginning in April 2016, a series of shallow, moderate to large earthquakes with associated strong aftershocks struck the Kumamoto area of Kyushu, SW Japan. An M j 7.3 mainshock occurred on 16 April 2016, close to the epicenter of an M j 6.5 foreshock that occurred about 28 hours earlier. The intense seismicity released the accumulated elastic energy by right-lateral strike slip, mainly along two known, active faults. The mainshock rupture propagated along multiple fault segments with different geometries. The faulting style is reasonably consistent with regional deformation observed on geologic timescales and with the stress field estimated from seismic observations. One striking feature of this sequence is intense seismic activity, including a dynamically triggered earthquake in the Oita region. Following the mainshock rupture, postseismic deformation has been observed, as well as expansion of the seismicity front toward the southwest and northwest.

  15. Data selector group sequencer interface

    International Nuclear Information System (INIS)

    Zizka, G.; Turko, B.

    1984-01-01

    A CAMAC-based module for high rate data selection and transfer to Tracor Northern TN-1700 multichannel analysis system is described. The module can select any group of 4096 consecutive addresses of events, in the range of 24 bits. This module solves the problem of connecting a number of time digitizing systems to the memory of a multichannel analyzer. Continuous processing rate up to 200,000 events per second along with the live display make the testing of the above systems very efficient and relatively inexpensive. The module also can be programmed for storing the preset group of addresses into more than one section of the memory. The events are analyzed in each section of the memory during the preset time. Multiple spectra can thus be taken automatically in a sequence

  16. A main sequence for quasars

    Science.gov (United States)

    Marziani, Paola; Dultzin, Deborah; Sulentic, Jack W.; Del Olmo, Ascensión; Negrete, C. A.; Martínez-Aldama, Mary L.; D'Onofrio, Mauro; Bon, Edi; Bon, Natasa; Stirpe, Giovanna M.

    2018-03-01

    The last 25 years saw a major step forward in the analysis of optical and UV spectroscopic data of large quasar samples. Multivariate statistical approaches have led to the definition of systematic trends in observational properties that are the basis of physical and dynamical modeling of quasar structure. We discuss the empirical correlates of the so-called “main sequence” associated with the quasar Eigenvector 1, its governing physical parameters and several implications on our view of the quasar structure, as well as some luminosity effects associated with the virialized component of the line emitting regions. We also briefly discuss quasars in a segment of the main sequence that includes the strongest FeII emitters. These sources show a small dispersion around a well-defined Eddington ratio value, a property which makes them potential Eddington standard candles.

  17. The 2016 Kumamoto earthquake sequence

    Science.gov (United States)

    KATO, Aitaro; NAKAMURA, Kouji; HIYAMA, Yohei

    2016-01-01

    Beginning in April 2016, a series of shallow, moderate to large earthquakes with associated strong aftershocks struck the Kumamoto area of Kyushu, SW Japan. An Mj 7.3 mainshock occurred on 16 April 2016, close to the epicenter of an Mj 6.5 foreshock that occurred about 28 hours earlier. The intense seismicity released the accumulated elastic energy by right-lateral strike slip, mainly along two known, active faults. The mainshock rupture propagated along multiple fault segments with different geometries. The faulting style is reasonably consistent with regional deformation observed on geologic timescales and with the stress field estimated from seismic observations. One striking feature of this sequence is intense seismic activity, including a dynamically triggered earthquake in the Oita region. Following the mainshock rupture, postseismic deformation has been observed, as well as expansion of the seismicity front toward the southwest and northwest. PMID:27725474

  18. A Main Sequence for Quasars

    Directory of Open Access Journals (Sweden)

    Paola Marziani

    2018-03-01

    Full Text Available The last 25 years saw a major step forward in the analysis of optical and UV spectroscopic data of large quasar samples. Multivariate statistical approaches have led to the definition of systematic trends in observational properties that are the basis of physical and dynamical modeling of quasar structure. We discuss the empirical correlates of the so-called “main sequence” associated with the quasar Eigenvector 1, its governing physical parameters and several implications on our view of the quasar structure, as well as some luminosity effects associated with the virialized component of the line emitting regions. We also briefly discuss quasars in a segment of the main sequence that includes the strongest FeII emitters. These sources show a small dispersion around a well-defined Eddington ratio value, a property which makes them potential Eddington standard candles.

  19. RANDNA: a random DNA sequence generator.

    Science.gov (United States)

    Piva, Francesco; Principato, Giovanni

    2006-01-01

    Monte Carlo simulations are useful to verify the significance of data. Genomic regularities, such as the nucleotide correlations or the not uniform distribution of the motifs throughout genomic or mature mRNA sequences, exist and their significance can be checked by means of the Monte Carlo test. The test needs good quality random sequences in order to work, moreover they should have the same nucleotide distribution as the sequences in which the regularities have been found. Random DNA sequences are also useful to estimate the background score of an alignment, that is a threshold below which the resulting score is merely due to chance. We have developed RANDNA, a free software which allows to produce random DNA or RNA sequences setting both their length and the percentage of nucleotide composition. Sequences having the same nucleotide distribution of exonic, intronic or intergenic sequences can be generated. Its graphic interface makes it possible to easily set the parameters that characterize the sequences being produced and saved in a text format file. The pseudo-random number generator function of Borland Delphi 6 is used, since it guarantees a good randomness, a long cycle length and a high speed. We have checked the quality of sequences generated by the software, by means of well-known tests, both by themselves and versus genuine random sequences. We show the good quality of the generated sequences. The software, complete with examples and documentation, is freely available to users from: http://www.introni.it/en/software.

  20. Locomotor sequence learning in visually guided walking

    DEFF Research Database (Denmark)

    Choi, Julia T; Jensen, Peter; Nielsen, Jens Bo

    2016-01-01

    walking. In addition, we determined how age (i.e., healthy young adults vs. children) and biomechanical factors (i.e., walking speed) affected the rate and magnitude of locomotor sequence learning. The results showed that healthy young adults (age 24 ± 5 years, N = 20) could learn a specific sequence...... of step lengths over 300 training steps. Younger children (age 6-10 years, N = 8) have lower baseline performance, but their magnitude and rate of sequence learning was the same compared to older children (11-16 years, N = 10) and healthy adults. In addition, learning capacity may be more limited...... to modify step length from one trial to the next. Our sequence learning paradigm is derived from the serial reaction-time (SRT) task that has been used in upper limb studies. Both random and ordered sequences of step lengths were used to measure sequence-specific and sequence non-specific learning during...

  1. The RNA world, automatic sequences and oncogenetics

    Energy Technology Data Exchange (ETDEWEB)

    Tahir Shah, K

    1993-04-01

    We construct a model of the RNA world in terms of naturally evolving nucleotide sequences assuming only Crick-Watson base pairing and self-cleaving/splicing capability. These sequences have the following properties. (1) They are recognizable by an automation (or automata). That is, to each k-sequence, there exist a k-automation which accepts, recognizes or generates the k-sequence. These are known as automatic sequences. Fibonacci and Morse-Thue sequences are the most natural outcome of pre-biotic chemical conditions. (2) Infinite (resp. large) sequences are self-similar (resp. nearly self-similar) under certain rewrite rules and consequently give rise to fractal (resp.fractal-like) structures. Computationally, such sequences can also be generated by their corresponding deterministic parallel re-write system, known as a DOL system. The self-similar sequences are fixed points of their respective rewrite rules. Some of these automatic sequences have the capability that they can read or ``accept`` other sequences while others can detect errors and trigger error-correcting mechanisms. They can be enlarged and have block and/or palindrome structure. Linear recurring sequences such as Fibonacci sequence are simply Feed-back Shift Registers, a well know model of information processing machines. We show that a mutation of any rewrite rule can cause a combinatorial explosion of error and relates this to oncogenetical behavior. On the other hand, a mutation of sequences that are not rewrite rules, leads to normal evolutionary change. Known experimental results support our hypothesis. (author). Refs.

  2. The RNA world, automatic sequences and oncogenetics

    International Nuclear Information System (INIS)

    Tahir Shah, K.

    1993-04-01

    We construct a model of the RNA world in terms of naturally evolving nucleotide sequences assuming only Crick-Watson base pairing and self-cleaving/splicing capability. These sequences have the following properties. 1) They are recognizable by an automation (or automata). That is, to each k-sequence, there exist a k-automation which accepts, recognizes or generates the k-sequence. These are known as automatic sequences. Fibonacci and Morse-Thue sequences are the most natural outcome of pre-biotic chemical conditions. 2) Infinite (resp. large) sequences are self-similar (resp. nearly self-similar) under certain rewrite rules and consequently give rise to fractal (resp.fractal-like) structures. Computationally, such sequences can also be generated by their corresponding deterministic parallel re-write system, known as a DOL system. The self-similar sequences are fixed points of their respective rewrite rules. Some of these automatic sequences have the capability that they can read or 'accept' other sequences while others can detect errors and trigger error-correcting mechanisms. They can be enlarged and have block and/or palindrome structure. Linear recurring sequences such as Fibonacci sequence are simply Feed-back Shift Registers, a well know model of information processing machines. We show that a mutation of any rewrite rule can cause a combinatorial explosion of error and relates this to oncogenetical behavior. On the other hand, a mutation of sequences that are not rewrite rules, leads to normal evolutionary change. Known experimental results support our hypothesis. (author). Refs

  3. Targeted assembly of short sequence reads.

    Directory of Open Access Journals (Sweden)

    René L Warren

    Full Text Available As next-generation sequence (NGS production continues to increase, analysis is becoming a significant bottleneck. However, in situations where information is required only for specific sequence variants, it is not necessary to assemble or align whole genome data sets in their entirety. Rather, NGS data sets can be mined for the presence of sequence variants of interest by localized assembly, which is a faster, easier, and more accurate approach. We present TASR, a streamlined assembler that interrogates very large NGS data sets for the presence of specific variants by only considering reads within the sequence space of input target sequences provided by the user. The NGS data set is searched for reads with an exact match to all possible short words within the target sequence, and these reads are then assembled stringently to generate a consensus of the target and flanking sequence. Typically, variants of a particular locus are provided as different target sequences, and the presence of the variant in the data set being interrogated is revealed by a successful assembly outcome. However, TASR can also be used to find unknown sequences that flank a given target. We demonstrate that TASR has utility in finding or confirming genomic mutations, polymorphisms, fusions and integration events. Targeted assembly is a powerful method for interrogating large data sets for the presence of sequence variants of interest. TASR is a fast, flexible and easy to use tool for targeted assembly.

  4. Pareto optimal pairwise sequence alignment.

    Science.gov (United States)

    DeRonne, Kevin W; Karypis, George

    2013-01-01

    Sequence alignment using evolutionary profiles is a commonly employed tool when investigating a protein. Many profile-profile scoring functions have been developed for use in such alignments, but there has not yet been a comprehensive study of Pareto optimal pairwise alignments for combining multiple such functions. We show that the problem of generating Pareto optimal pairwise alignments has an optimal substructure property, and develop an efficient algorithm for generating Pareto optimal frontiers of pairwise alignments. All possible sets of two, three, and four profile scoring functions are used from a pool of 11 functions and applied to 588 pairs of proteins in the ce_ref data set. The performance of the best objective combinations on ce_ref is also evaluated on an independent set of 913 protein pairs extracted from the BAliBASE RV11 data set. Our dynamic-programming-based heuristic approach produces approximated Pareto optimal frontiers of pairwise alignments that contain comparable alignments to those on the exact frontier, but on average in less than 1/58th the time in the case of four objectives. Our results show that the Pareto frontiers contain alignments whose quality is better than the alignments obtained by single objectives. However, the task of identifying a single high-quality alignment among those in the Pareto frontier remains challenging.

  5. Hierarchically nested river landform sequences

    Science.gov (United States)

    Pasternack, G. B.; Weber, M. D.; Brown, R. A.; Baig, D.

    2017-12-01

    River corridors exhibit landforms nested within landforms repeatedly down spatial scales. In this study we developed, tested, and implemented a new way to create river classifications by mapping domains of fluvial processes with respect to the hierarchical organization of topographic complexity that drives fluvial dynamism. We tested this approach on flow convergence routing, a morphodynamic mechanism with different states depending on the structure of nondimensional topographic variability. Five nondimensional landform types with unique functionality (nozzle, wide bar, normal channel, constricted pool, and oversized) represent this process at any flow. When this typology is nested at base flow, bankfull, and floodprone scales it creates a system with up to 125 functional types. This shows how a single mechanism produces complex dynamism via nesting. Given the classification, we answered nine specific scientific questions to investigate the abundance, sequencing, and hierarchical nesting of these new landform types using a 35-km gravel/cobble river segment of the Yuba River in California. The nested structure of flow convergence routing landforms found in this study revealed that bankfull landforms are nested within specific floodprone valley landform types, and these types control bankfull morphodynamics during moderate to large floods. As a result, this study calls into question the prevailing theory that the bankfull channel of a gravel/cobble river is controlled by in-channel, bankfull, and/or small flood flows. Such flows are too small to initiate widespread sediment transport in a gravel/cobble river with topographic complexity.

  6. Sequencing intractable DNA to close microbial genomes.

    Directory of Open Access Journals (Sweden)

    Richard A Hurt

    Full Text Available Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled "intractable" resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such problematic regions in the "non-contiguous finished" Desulfovibrio desulfuricans ND132 genome (6 intractable gaps and the Desulfovibrio africanus genome (1 intractable gap. The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. The developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

  7. Sequencing Intractable DNA to Close Microbial Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Hurt, Jr., Richard Ashley [ORNL; Brown, Steven D [ORNL; Podar, Mircea [ORNL; Palumbo, Anthony Vito [ORNL; Elias, Dwayne A [ORNL

    2012-01-01

    Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled intractable resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such difficult regions in the non-contiguous finished Desulfovibrio desulfuricans ND132 genome (6 intractable gaps) and the Desulfovibrio africanus genome (1 intractable gap). The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. These developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

  8. Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags

    Science.gov (United States)

    de Souza, Sandro J.; Camargo, Anamaria A.; Briones, Marcelo R. S.; Costa, Fernando F.; Nagai, Maria Aparecida; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; de Fátima Sonati, Maria; Tajara, Eloiza H.; Valentini, Sandro R.; Acencio, Marcio; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Bengtson, Mário Henrique; Carraro, Dirce M.; Carvalho, Alex F.; Carvalho, Lúcia Helena; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Costa, Maria Cristina R.; Curcio, Cyntia; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Leite, Luciana C. C.; Maia, Gustavo; Majumder, Paromita; Marins, Mozart; Matsukuma, Adriana; Melo, Analy S. A.; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana Gilbert; Rahal, Paula; Rainho, Claudia A.; da Ro's, Nancy; de Sá, Renata G.; Sales, Magaly M.; da Silva, Neusa P.; Silva, Tereza C.; da Silva, Wilson; Simão, Daniel F.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Zalcberg, Heloisa; Brentani, Ricardo R.; Reis, Luis F. L.; Dias-Neto, Emmanuel; Simpson, Andrew J. G.

    2000-01-01

    Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central coding regions of the resulting transcripts. They are termed ORF expressed sequence tags (ORESTES). The 250,000 ORESTES were assembled into 81,429 contigs. Of these, 1,181 (1.45%) were found to match sequences in chromosome 22 with at least one ORESTES contig for 162 (65.6%) of the 247 known genes, for 67 (44.6%) of the 150 related genes, and for 45 of the 148 (30.4%) EST-predicted genes on this chromosome. Using a set of stringent criteria to validate our sequences, we identified a further 219 previously unannotated transcribed sequences on chromosome 22. Of these, 171 were in fact also defined by EST or full length cDNA sequences available in GenBank but not utilized in the initial annotation of the first human chromosome sequence. Thus despite representing less than 15% of all expressed human sequences in the public databases at the time of the present analysis, ORESTES sequences defined 48 transcribed sequences on chromosome 22 not defined by other sequences. All of the transcribed sequences defined by ORESTES coincided with DNA regions predicted as encoding exons by genscan. (http://genes.mit.edu/GENSCAN.html). PMID:11070084

  9. cis sequence effects on gene expression

    Directory of Open Access Journals (Sweden)

    Jacobs Kevin

    2007-08-01

    Full Text Available Abstract Background Sequence and transcriptional variability within and between individuals are typically studied independently. The joint analysis of sequence and gene expression variation (genetical genomics provides insight into the role of linked sequence variation in the regulation of gene expression. We investigated the role of sequence variation in cis on gene expression (cis sequence effects in a group of genes commonly studied in cancer research in lymphoblastoid cell lines. We estimated the proportion of genes exhibiting cis sequence effects and the proportion of gene expression variation explained by cis sequence effects using three different analytical approaches, and compared our results to the literature. Results We generated gene expression profiling data at N = 697 candidate genes from N = 30 lymphoblastoid cell lines for this study and used available candidate gene resequencing data at N = 552 candidate genes to identify N = 30 candidate genes with sufficient variance in both datasets for the investigation of cis sequence effects. We used two additive models and the haplotype phylogeny scanning approach of Templeton (Tree Scanning to evaluate association between individual SNPs, all SNPs at a gene, and diplotypes, with log-transformed gene expression. SNPs and diplotypes at eight candidate genes exhibited statistically significant (p cis sequence effects in our study, respectively. Conclusion Based on analysis of our results and the extant literature, one in four genes exhibits significant cis sequence effects, and for these genes, about 30% of gene expression variation is accounted for by cis sequence variation. Despite diverse experimental approaches, the presence or absence of significant cis sequence effects is largely supported by previously published studies.

  10. Multiple tag labeling method for DNA sequencing

    Science.gov (United States)

    Mathies, R.A.; Huang, X.C.; Quesada, M.A.

    1995-07-25

    A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.

  11. Exome sequencing and genetic testing for MODY.

    Directory of Open Access Journals (Sweden)

    Stefan Johansson

    Full Text Available Genetic testing for monogenic diabetes is important for patient care. Given the extensive genetic and clinical heterogeneity of diabetes, exome sequencing might provide additional diagnostic potential when standard Sanger sequencing-based diagnostics is inconclusive.The aim of the study was to examine the performance of exome sequencing for a molecular diagnosis of MODY in patients who have undergone conventional diagnostic sequencing of candidate genes with negative results.We performed exome enrichment followed by high-throughput sequencing in nine patients with suspected MODY. They were Sanger sequencing-negative for mutations in the HNF1A, HNF4A, GCK, HNF1B and INS genes. We excluded common, non-coding and synonymous gene variants, and performed in-depth analysis on filtered sequence variants in a pre-defined set of 111 genes implicated in glucose metabolism.On average, we obtained 45 X median coverage of the entire targeted exome and found 199 rare coding variants per individual. We identified 0-4 rare non-synonymous and nonsense variants per individual in our a priori list of 111 candidate genes. Three of the variants were considered pathogenic (in ABCC8, HNF4A and PPARG, respectively, thus exome sequencing led to a genetic diagnosis in at least three of the nine patients. Approximately 91% of known heterozygous SNPs in the target exomes were detected, but we also found low coverage in some key diabetes genes using our current exome sequencing approach. Novel variants in the genes ARAP1, GLIS3, MADD, NOTCH2 and WFS1 need further investigation to reveal their possible role in diabetes.Our results demonstrate that exome sequencing can improve molecular diagnostics of MODY when used as a complement to Sanger sequencing. However, improvements will be needed, especially concerning coverage, before the full potential of exome sequencing can be realized.

  12. Identifying driver mutations in sequenced cancer genomes

    DEFF Research Database (Denmark)

    Raphael, Benjamin J; Dobson, Jason R; Oesper, Layla

    2014-01-01

    High-throughput DNA sequencing is revolutionizing the study of cancer and enabling the measurement of the somatic mutations that drive cancer development. However, the resulting sequencing datasets are large and complex, obscuring the clinically important mutations in a background of errors, nois...... patterns of mutual exclusivity. These techniques, coupled with advances in high-throughput DNA sequencing, are enabling precision medicine approaches to the diagnosis and treatment of cancer....

  13. EGNAS: an exhaustive DNA sequence design algorithm

    Directory of Open Access Journals (Sweden)

    Kick Alfred

    2012-06-01

    Full Text Available Abstract Background The molecular recognition based on the complementary base pairing of deoxyribonucleic acid (DNA is the fundamental principle in the fields of genetics, DNA nanotechnology and DNA computing. We present an exhaustive DNA sequence design algorithm that allows to generate sets containing a maximum number of sequences with defined properties. EGNAS (Exhaustive Generation of Nucleic Acid Sequences offers the possibility of controlling both interstrand and intrastrand properties. The guanine-cytosine content can be adjusted. Sequences can be forced to start and end with guanine or cytosine. This option reduces the risk of “fraying” of DNA strands. It is possible to limit cross hybridizations of a defined length, and to adjust the uniqueness of sequences. Self-complementarity and hairpin structures of certain length can be avoided. Sequences and subsequences can optionally be forbidden. Furthermore, sequences can be designed to have minimum interactions with predefined strands and neighboring sequences. Results The algorithm is realized in a C++ program. TAG sequences can be generated and combined with primers for single-base extension reactions, which were described for multiplexed genotyping of single nucleotide polymorphisms. Thereby, possible foldback through intrastrand interaction of TAG-primer pairs can be limited. The design of sequences for specific attachment of molecular constructs to DNA origami is presented. Conclusions We developed a new software tool called EGNAS for the design of unique nucleic acid sequences. The presented exhaustive algorithm allows to generate greater sets of sequences than with previous software and equal constraints. EGNAS is freely available for noncommercial use at http://www.chm.tu-dresden.de/pc6/EGNAS.

  14. Genome Sequencing and Analysis Conference IV

    Energy Technology Data Exchange (ETDEWEB)

    1993-12-31

    J. Craig Venter and C. Thomas Caskey co-chaired Genome Sequencing and Analysis Conference IV held at Hilton Head, South Carolina from September 26--30, 1992. Venter opened the conference by noting that approximately 400 researchers from 16 nations were present four times as many participants as at Genome Sequencing Conference I in 1989. Venter also introduced the Data Fair, a new component of the conference allowing exchange and on-site computer analysis of unpublished sequence data.

  15. FRESCO: Referential compression of highly similar sequences.

    Science.gov (United States)

    Wandelt, Sebastian; Leser, Ulf

    2013-01-01

    In many applications, sets of similar texts or sequences are of high importance. Prominent examples are revision histories of documents or genomic sequences. Modern high-throughput sequencing technologies are able to generate DNA sequences at an ever-increasing rate. In parallel to the decreasing experimental time and cost necessary to produce DNA sequences, computational requirements for analysis and storage of the sequences are steeply increasing. Compression is a key technology to deal with this challenge. Recently, referential compression schemes, storing only the differences between a to-be-compressed input and a known reference sequence, gained a lot of interest in this field. In this paper, we propose a general open-source framework to compress large amounts of biological sequence data called Framework for REferential Sequence COmpression (FRESCO). Our basic compression algorithm is shown to be one to two orders of magnitudes faster than comparable related work, while achieving similar compression ratios. We also propose several techniques to further increase compression ratios, while still retaining the advantage in speed: 1) selecting a good reference sequence; and 2) rewriting a reference sequence to allow for better compression. In addition,we propose a new way of further boosting the compression ratios by applying referential compression to already referentially compressed files (second-order compression). This technique allows for compression ratios way beyond state of the art, for instance,4,000:1 and higher for human genomes. We evaluate our algorithms on a large data set from three different species (more than 1,000 genomes, more than 3 TB) and on a collection of versions of Wikipedia pages. Our results show that real-time compression of highly similar sequences at high compression ratios is possible on modern hardware.

  16. Robustness analysis of chiller sequencing control

    International Nuclear Information System (INIS)

    Liao, Yundan; Sun, Yongjun; Huang, Gongsheng

    2015-01-01

    Highlights: • Uncertainties with chiller sequencing control were systematically quantified. • Robustness of chiller sequencing control was systematically analyzed. • Different sequencing control strategies were sensitive to different uncertainties. • A numerical method was developed for easy selection of chiller sequencing control. - Abstract: Multiple-chiller plant is commonly employed in the heating, ventilating and air-conditioning system to increase operational feasibility and energy-efficiency under part load condition. In a multiple-chiller plant, chiller sequencing control plays a key role in achieving overall energy efficiency while not sacrifices the cooling sufficiency for indoor thermal comfort. Various sequencing control strategies have been developed and implemented in practice. Based on the observation that (i) uncertainty, which cannot be avoided in chiller sequencing control, has a significant impact on the control performance and may cause the control fail to achieve the expected control and/or energy performance; and (ii) in current literature few studies have systematically addressed this issue, this paper therefore presents a study on robustness analysis of chiller sequencing control in order to understand the robustness of various chiller sequencing control strategies under different types of uncertainty. Based on the robustness analysis, a simple and applicable method is developed to select the most robust control strategy for a given chiller plant in the presence of uncertainties, which will be verified using case studies

  17. Multiplexed microsatellite recovery using massively parallel sequencing

    Science.gov (United States)

    Jennings, T.N.; Knaus, B.J.; Mullins, T.D.; Haig, S.M.; Cronn, R.C.

    2011-01-01

    Conservation and management of natural populations requires accurate and inexpensive genotyping methods. Traditional microsatellite, or simple sequence repeat (SSR), marker analysis remains a popular genotyping method because of the comparatively low cost of marker development, ease of analysis and high power of genotype discrimination. With the availability of massively parallel sequencing (MPS), it is now possible to sequence microsatellite-enriched genomic libraries in multiplex pools. To test this approach, we prepared seven microsatellite-enriched, barcoded genomic libraries from diverse taxa (two conifer trees, five birds) and sequenced these on one lane of the Illumina Genome Analyzer using paired-end 80-bp reads. In this experiment, we screened 6.1 million sequences and identified 356958 unique microreads that contained di- or trinucleotide microsatellites. Examination of four species shows that our conversion rate from raw sequences to polymorphic markers compares favourably to Sanger- and 454-based methods. The advantage of multiplexed MPS is that the staggering capacity of modern microread sequencing is spread across many libraries; this reduces sample preparation and sequencing costs to less than $400 (USD) per species. This price is sufficiently low that microsatellite libraries could be prepared and sequenced for all 1373 organisms listed as 'threatened' and 'endangered' in the United States for under $0.5M (USD).

  18. Digital Recovery Sequencer - Advanced Concept Ejection Seats

    National Research Council Canada - National Science Library

    Ross, David A; Cotter, Lee; Culhane, David; Press, Matthew J

    2005-01-01

    .... Continued usage of the Analog Sequencer is undesirable due to limitations with respect to its installed life, electronic component obsolescence, flexibility to accommodate seat safety improvements...

  19. Quantitative phenotyping via deep barcode sequencing.

    Science.gov (United States)

    Smith, Andrew M; Heisler, Lawrence E; Mellor, Joseph; Kaper, Fiona; Thompson, Michael J; Chee, Mark; Roth, Frederick P; Giaever, Guri; Nislow, Corey

    2009-10-01

    Next-generation DNA sequencing technologies have revolutionized diverse genomics applications, including de novo genome sequencing, SNP detection, chromatin immunoprecipitation, and transcriptome analysis. Here we apply deep sequencing to genome-scale fitness profiling to evaluate yeast strain collections in parallel. This method, Barcode analysis by Sequencing, or "Bar-seq," outperforms the current benchmark barcode microarray assay in terms of both dynamic range and throughput. When applied to a complex chemogenomic assay, Bar-seq quantitatively identifies drug targets, with performance superior to the benchmark microarray assay. We also show that Bar-seq is well-suited for a multiplex format. We completely re-sequenced and re-annotated the yeast deletion collection using deep sequencing, found that approximately 20% of the barcodes and common priming sequences varied from expectation, and used this revised list of barcode sequences to improve data quality. Together, this new assay and analysis routine provide a deep-sequencing-based toolkit for identifying gene-environment interactions on a genome-wide scale.

  20. Hardware Accelerated Sequence Alignment with Traceback

    Directory of Open Access Journals (Sweden)

    Scott Lloyd

    2009-01-01

    in a timely manner. Known methods to accelerate alignment on reconfigurable hardware only address sequence comparison, limit the sequence length, or exhibit memory and I/O bottlenecks. A space-efficient, global sequence alignment algorithm and architecture is presented that accelerates the forward scan and traceback in hardware without memory and I/O limitations. With 256 processing elements in FPGA technology, a performance gain over 300 times that of a desktop computer is demonstrated on sequence lengths of 16000. For greater performance, the architecture is scalable to more processing elements.

  1. Multipliers on Generalized Mixed Norm Sequence Spaces

    Directory of Open Access Journals (Sweden)

    Oscar Blasco

    2014-01-01

    Full Text Available Given 1≤p,q≤∞ and sequences of integers (nkk and (nk′k such that nk≤nk′≤nk+1, the generalized mixed norm space ℓℐ(p,q is defined as those sequences (ajj such that ((∑j∈Ik‍|aj|p1/pk∈ℓq where Ik={j∈ℕ0 s.t. nk≤jsequence λ=(λjj to belong to the space of multipliers (ℓℐ(r,s,ℓ(u,v, for different sequences ℐ and of intervals in ℕ0, are determined.

  2. Recursive sequences in first-year calculus

    Science.gov (United States)

    Krainer, Thomas

    2016-02-01

    This article provides ready-to-use supplementary material on recursive sequences for a second-semester calculus class. It equips first-year calculus students with a basic methodical procedure based on which they can conduct a rigorous convergence or divergence analysis of many simple recursive sequences on their own without the need to invoke inductive arguments as is typically required in calculus textbooks. The sequences that are accessible to this kind of analysis are predominantly (eventually) monotonic, but also certain recursive sequences that alternate around their limit point as they converge can be considered.

  3. A measurement of disorder in binary sequences

    Science.gov (United States)

    Gong, Longyan; Wang, Haihong; Cheng, Weiwen; Zhao, Shengmei

    2015-03-01

    We propose a complex quantity, AL, to characterize the degree of disorder of L-length binary symbolic sequences. As examples, we respectively apply it to typical random and deterministic sequences. One kind of random sequences is generated from a periodic binary sequence and the other is generated from the logistic map. The deterministic sequences are the Fibonacci and Thue-Morse sequences. In these analyzed sequences, we find that the modulus of AL, denoted by |AL | , is a (statistically) equivalent quantity to the Boltzmann entropy, the metric entropy, the conditional block entropy and/or other quantities, so it is a useful quantitative measure of disorder. It can be as a fruitful index to discern which sequence is more disordered. Moreover, there is one and only one value of |AL | for the overall disorder characteristics. It needs extremely low computational costs. It can be easily experimentally realized. From all these mentioned, we believe that the proposed measure of disorder is a valuable complement to existing ones in symbolic sequences.

  4. Polynomial sequences generated by infinite Hessenberg matrices

    Directory of Open Access Journals (Sweden)

    Verde-Star Luis

    2017-01-01

    Full Text Available We show that an infinite lower Hessenberg matrix generates polynomial sequences that correspond to the rows of infinite lower triangular invertible matrices. Orthogonal polynomial sequences are obtained when the Hessenberg matrix is tridiagonal. We study properties of the polynomial sequences and their corresponding matrices which are related to recurrence relations, companion matrices, matrix similarity, construction algorithms, and generating functions. When the Hessenberg matrix is also Toeplitz the polynomial sequences turn out to be of interpolatory type and we obtain additional results. For example, we show that every nonderogative finite square matrix is similar to a unique Toeplitz-Hessenberg matrix.

  5. Genomic sequencing of Pleistocene cave bears

    Energy Technology Data Exchange (ETDEWEB)

    Noonan, James P.; Hofreiter, Michael; Smith, Doug; Priest, JamesR.; Rohland, Nadin; Rabeder, Gernot; Krause, Johannes; Detter, J. Chris; Paabo, Svante; Rubin, Edward M.

    2005-04-01

    Despite the information content of genomic DNA, ancient DNA studies to date have largely been limited to amplification of mitochondrial DNA due to technical hurdles such as contamination and degradation of ancient DNAs. In this study, we describe two metagenomic libraries constructed using unamplified DNA extracted from the bones of two 40,000-year-old extinct cave bears. Analysis of {approx}1 Mb of sequence from each library showed that, despite significant microbial contamination, 5.8 percent and 1.1 percent of clones in the libraries contain cave bear inserts, yielding 26,861 bp of cave bear genome sequence. Alignment of this sequence to the dog genome, the closest sequenced genome to cave bear in terms of evolutionary distance, revealed roughly the expected ratio of cave bear exons, repeats and conserved noncoding sequences. Only 0.04 percent of all clones sequenced were derived from contamination with modern human DNA. Comparison of cave bear with orthologous sequences from several modern bear species revealed the evolutionary relationship of these lineages. Using the metagenomic approach described here, we have recovered substantial quantities of mammalian genomic sequence more than twice as old as any previously reported, establishing the feasibility of ancient DNA genomic sequencing programs.

  6. Design of Long Period Pseudo-Random Sequences from the Addition of -Sequences over

    Directory of Open Access Journals (Sweden)

    Ren Jian

    2004-01-01

    Full Text Available Pseudo-random sequence with good correlation property and large linear span is widely used in code division multiple access (CDMA communication systems and cryptology for reliable and secure information transmission. In this paper, sequences with long period, large complexity, balance statistics, and low cross-correlation property are constructed from the addition of -sequences with pairwise-prime linear spans (AMPLS. Using -sequences as building blocks, the proposed method proved to be an efficient and flexible approach to construct long period pseudo-random sequences with desirable properties from short period sequences. Applying the proposed method to , a signal set is constructed.

  7. Compressing DNA sequence databases with coil

    Directory of Open Access Journals (Sweden)

    Hendy Michael D

    2008-05-01

    Full Text Available Abstract Background Publicly available DNA sequence databases such as GenBank are large, and are growing at an exponential rate. The sheer volume of data being dealt with presents serious storage and data communications problems. Currently, sequence data is usually kept in large "flat files," which are then compressed using standard Lempel-Ziv (gzip compression – an approach which rarely achieves good compression ratios. While much research has been done on compressing individual DNA sequences, surprisingly little has focused on the compression of entire databases of such sequences. In this study we introduce the sequence database compression software coil. Results We have designed and implemented a portable software package, coil, for compressing and decompressing DNA sequence databases based on the idea of edit-tree coding. coil is geared towards achieving high compression ratios at the expense of execution time and memory usage during compression – the compression time represents a "one-off investment" whose cost is quickly amortised if the resulting compressed file is transmitted many times. Decompression requires little memory and is extremely fast. We demonstrate a 5% improvement in compression ratio over state-of-the-art general-purpose compression tools for a large GenBank database file containing Expressed Sequence Tag (EST data. Finally, coil can efficiently encode incremental additions to a sequence database. Conclusion coil presents a compelling alternative to conventional compression of flat files for the storage and distribution of DNA sequence databases having a narrow distribution of sequence lengths, such as EST data. Increasing compression levels for databases having a wide distribution of sequence lengths is a direction for future work.

  8. Direct chloroplast sequencing: comparison of sequencing platforms and analysis tools for whole chloroplast barcoding.

    Directory of Open Access Journals (Sweden)

    Marta Brozynska

    Full Text Available Direct sequencing of total plant DNA using next generation sequencing technologies generates a whole chloroplast genome sequence that has the potential to provide a barcode for use in plant and food identification. Advances in DNA sequencing platforms may make this an attractive approach for routine plant identification. The HiSeq (Illumina and Ion Torrent (Life Technology sequencing platforms were used to sequence total DNA from rice to identify polymorphisms in the whole chloroplast genome sequence of a wild rice plant relative to cultivated rice (cv. Nipponbare. Consensus chloroplast sequences were produced by mapping sequence reads to the reference rice chloroplast genome or by de novo assembly and mapping of the resulting contigs to the reference sequence. A total of 122 polymorphisms (SNPs and indels between the wild and cultivated rice chloroplasts were predicted by these different sequencing and analysis methods. Of these, a total of 102 polymorphisms including 90 SNPs were predicted by both platforms. Indels were more variable with different sequencing methods, with almost all discrepancies found in homopolymers. The Ion Torrent platform gave no apparent false SNP but was less reliable for indels. The methods should be suitable for routine barcoding using appropriate combinations of sequencing platform and data analysis.

  9. Step out - Step in Sequencing Games

    NARCIS (Netherlands)

    Musegaas, M.; Borm, P.E.M.; Quant, M.

    2014-01-01

    In this paper a new class of relaxed sequencing games is introduced: the class of Step out - Step in sequencing games. In this relaxation any player within a coalition is allowed to step out from his position in the processing order and to step in at any position later in the processing order.

  10. Step out-step in sequencing games

    NARCIS (Netherlands)

    Musegaas, Marieke; Borm, Peter; Quant, Marieke

    2015-01-01

    In this paper a new class of relaxed sequencing games is introduced: the class of Step out–Step in sequencing games. In this relaxation any player within a coalition is allowed to step out from his position in the processing order and to step in at any position later in the processing order. First,

  11. Enhanced throughput for infrared automated DNA sequencing

    Science.gov (United States)

    Middendorf, Lyle R.; Gartside, Bill O.; Humphrey, Pat G.; Roemer, Stephen C.; Sorensen, David R.; Steffens, David L.; Sutter, Scott L.

    1995-04-01

    Several enhancements have been developed and applied to infrared automated DNA sequencing resulting in significantly higher throughput. A 41 cm sequencing gel (31 cm well- to-read distance) combines high resolution of DNA sequencing fragments with optimized run times yielding two runs per day of 500 bases per sample. A 66 cm sequencing gel (56 cm well-to-read distance) produces sequence read lengths of up to 1000 bases for ds and ss templates using either T7 polymerase or cycle-sequencing protocols. Using a multichannel syringe to load 64 lanes allows 16 samples (compatible with 96-well format) to be visualized for each run. The 41 cm gel configuration allows 16,000 bases per day (16 samples X 500 bases/sample X 2 ten hour runs/day) to be sequenced with the advantages of infrared technology. Enhancements to internal labeling techniques using an infrared-labeled dATP molecule (Boehringer Mannheim GmbH, Penzberg, Germany; Sequenase (U.S. Biochemical) have also been made. The inclusion of glycerol in the sequencing reactions yields greatly improved results for some primer and template combinations. The inclusion of (alpha) -Thio-dNTP's in the labeling reaction increases signal intensity two- to three-fold.

  12. Thread extraction for polyadic instruction sequences

    NARCIS (Netherlands)

    Bergstra, J.; Middelburg, C.

    2011-01-01

    In this paper, we study the phenomenon that instruction sequences are split into fragments which somehow produce a joint behaviour. In order to bring this phenomenon better into the picture, we formalize a simple mechanism by which several instruction sequence fragments can produce a joint

  13. Genome sequence of Lactobacillus rhamnosus ATCC 8530.

    Science.gov (United States)

    Pittet, Vanessa; Ewen, Emily; Bushell, Barry R; Ziola, Barry

    2012-02-01

    Lactobacillus rhamnosus is found in the human gastrointestinal tract and is important for probiotics. We became interested in L. rhamnosus isolate ATCC 8530 in relation to beer spoilage and hops resistance. We report here the genome sequence of this isolate, along with a brief comparison to other available L. rhamnosus genome sequences.

  14. Genome Sequence of Lactobacillus rhamnosus ATCC 8530

    OpenAIRE

    Pittet, Vanessa; Ewen, Emily; Bushell, Barry R.; Ziola, Barry

    2012-01-01

    Lactobacillus rhamnosus is found in the human gastrointestinal tract and is important for probiotics. We became interested in L. rhamnosus isolate ATCC 8530 in relation to beer spoilage and hops resistance. We report here the genome sequence of this isolate, along with a brief comparison to other available L. rhamnosus genome sequences.

  15. Question-answer sequences in survey interviews

    NARCIS (Netherlands)

    Dijkstra, W.; Ongena, Y.P.

    2006-01-01

    Interaction analysis was used to analyze a total of 14,265 question-answer sequences of (Q-A Sequences) 80 questions that originated from two face-to-face and three telephone surveys. The analysis was directed towards the causes and effects of particular interactional problems. Our results showed

  16. Trace maps for arbitrary substitution sequences

    International Nuclear Information System (INIS)

    Avishai, Y.

    1993-01-01

    The discovery of quasi-crystals and their 1-dimensional modeling have led to a deep mathematical study of Schroedinger operators with an arbitrary deterministic potential sequence. In this work we address this problem and find trace maps for an arbitrary substitution sequence. our trace maps have lower dimensionality than those of Kolar and Nori, which make them quite attractive for actual applications. (authors)

  17. Stochastic modelling of daily rainfall sequences

    NARCIS (Netherlands)

    Buishand, T.A.

    1977-01-01

    Rainfall series of different climatic regions were analysed with the aim of generating daily rainfall sequences. A survey of the data is given in I, 1. When analysing daily rainfall sequences one must be aware of the following points:
    a. Seasonality. Because of seasonal variation

  18. Learning of Sensory Sequences in Cerebellar Patients

    Science.gov (United States)

    Frings, Markus; Boenisch, Raoul; Gerwig, Marcus; Diener, Hans-Christoph; Timmann, Dagmar

    2004-01-01

    A possible role of the cerebellum in detecting and recognizing event sequences has been proposed. The present study sought to determine whether patients with cerebellar lesions are impaired in the acquisition and discrimination of sequences of sensory stimuli of different modalities. A group of 26 cerebellar patients and 26 controls matched for…

  19. On peculiar Šindel sequences

    Czech Academy of Sciences Publication Activity Database

    Křížek, Michal; Somer, L.

    2010-01-01

    Roč. 17, č. 2 (2010), s. 129-140 ISSN 0972-5555 R&D Projects: GA AV ČR(CZ) IAA100190803 Institutional research plan: CEZ:AV0Z10190503 Keywords : quadratic residue * Chinese remainder theorem * primitive Šindel sequences * Prague clock sequence Subject RIV: BA - General Mathematics http://www.pphmj.com/abstract/5095.htm

  20. Protecting genomic sequence anonymity with generalization lattices.

    Science.gov (United States)

    Malin, B A

    2005-01-01

    Current genomic privacy technologies assume the identity of genomic sequence data is protected if personal information, such as demographics, are obscured, removed, or encrypted. While demographic features can directly compromise an individual's identity, recent research demonstrates such protections are insufficient because sequence data itself is susceptible to re-identification. To counteract this problem, we introduce an algorithm for anonymizing a collection of person-specific DNA sequences. The technique is termed DNA lattice anonymization (DNALA), and is based upon the formal privacy protection schema of k -anonymity. Under this model, it is impossible to observe or learn features that distinguish one genetic sequence from k-1 other entries in a collection. To maximize information retained in protected sequences, we incorporate a concept generalization lattice to learn the distance between two residues in a single nucleotide region. The lattice provides the most similar generalized concept for two residues (e.g. adenine and guanine are both purines). The method is tested and evaluated with several publicly available human population datasets ranging in size from 30 to 400 sequences. Our findings imply the anonymization schema is feasible for the protection of sequences privacy. The DNALA method is the first computational disclosure control technique for general DNA sequences. Given the computational nature of the method, guarantees of anonymity can be formally proven. There is room for improvement and validation, though this research provides the groundwork from which future researchers can construct genomics anonymization schemas tailored to specific datasharing scenarios.

  1. Occupational Sequences: Auto Engines 1. AT 121.

    Science.gov (United States)

    Korb, A. W.; And Others

    In an attempt to individualize an automotive course, the Vocational-Technical Division of Northern Montana College has developed Occupational Sequences for an engine rebuilding course. Occupational Sequences, a learning or teaching aid, is an analysis of numbered operations involved in engine rebuilding. Job sheets, included in the book, provide a…

  2. Sequencing Events: Exploring Art and Art Jobs.

    Science.gov (United States)

    Stephens, Pamela Geiger; Shaddix, Robin K.

    2000-01-01

    Presents an activity for upper-elementary students that correlates the actions of archaeologists, patrons, and artists with the sequencing of events in a logical order. Features ancient Egyptian art images. Discusses the preparation of materials, motivation, a pre-writing activity, and writing a story in sequence. (CMK)

  3. Wijsman Orlicz Asymptotically Ideal -Statistical Equivalent Sequences

    Directory of Open Access Journals (Sweden)

    Bipan Hazarika

    2013-01-01

    in Wijsman sense and present some definitions which are the natural combination of the definition of asymptotic equivalence, statistical equivalent, -statistical equivalent sequences in Wijsman sense. Finally, we introduce the notion of Cesaro Orlicz asymptotically -equivalent sequences in Wijsman sense and establish their relationship with other classes.

  4. Nitrogen chronology of massive main sequence stars

    NARCIS (Netherlands)

    Köhler, K.; Borzyszkowski, M.; Brott, I.; Langer, N.; de Koter, A.

    2012-01-01

    Context. Rotational mixing in massive main sequence stars is predicted to monotonically increase their surface nitrogen abundance with time. Aims. We use this effect to design a method for constraining the age and the inclination angle of massive main sequence stars, given their observed luminosity,

  5. Massively parallel sequencing of forensic STRs

    DEFF Research Database (Denmark)

    Parson, Walther; Ballard, David; Budowle, Bruce

    2016-01-01

    The DNA Commission of the International Society for Forensic Genetics (ISFG) is reviewing factors that need to be considered ahead of the adoption by the forensic community of short tandem repeat (STR) genotyping by massively parallel sequencing (MPS) technologies. MPS produces sequence data that...

  6. Novel algorithms for protein sequence analysis

    NARCIS (Netherlands)

    Ye, Kai

    2008-01-01

    Each protein is characterized by its unique sequential order of amino acids, the so-called protein sequence. Biology”s paradigm is that this order of amino acids determines the protein”s architecture and function. In this thesis, we introduce novel algorithms to analyze protein sequences. Chapter 1

  7. Cyprinus carpio Genome sequencing and assembly

    NARCIS (Netherlands)

    Kolder, I.C.R.M.; Plas-Duivesteijn, van der Suzanne J.; Tan, G.; Wiegertjes, G.; Forlenza, M.; Guler, A.T.; Travin, D.Y.; Nakao, M.; Moritomo, T.; Irnazarow, I.; Jansen, H.J.

    2013-01-01

    Sequencing of the common carp (Cyprinus carpio carpio Linnaeus, 1758) genome, with the objective of establishing carp as a model organism to supplement the closely related zebrafish (Danio rerio). The sequenced individual is a homozygous female (by gynogenesis) of R3 x R8 carp, the heterozygous

  8. Sequence Comparison: Close and Open problems

    NARCIS (Netherlands)

    Lenzini, Gabriele; Cerrai, P.; Freguglia, P.

    Comparing sequences is a very important activity both in computer science and in a many other areas as well. For example thank to text editors, everyone knows the particular instance of a sequence comparison problem knonw as ``string mathcing problem''. It consists in searching a given work

  9. Pig genome sequence - analysis and publication strategy

    DEFF Research Database (Denmark)

    Archibald, Alan L.; Bolund, Lars; Churcher, Carol

    2010-01-01

    preferentially selected for sequencing. In accordance with the Bermuda and Fort Lauderdale agreements and the more recent Toronto Statement the data have been released into public sequence repositories (Genbank/EMBL, NCBI/Ensembl trace repositories) in a timely manner and in advance of publication. CONCLUSIONS...

  10. Swab-to-Sequence: Real-time Data Analysis Platform for the Biomolecule Sequencer

    Data.gov (United States)

    National Aeronautics and Space Administration — DNA was successfully sequenced on the ISS in 2016, but the DNA sequenced was prepared on the ground. With FY’16 IRAD funds, the same team developed a...

  11. From Sequence to Morphology - Long-Range Correlations in Complete Sequenced Genomes

    NARCIS (Netherlands)

    T.A. Knoch (Tobias)

    2004-01-01

    textabstractThe largely unresolved sequential organization, i.e. the relations within DNA sequences, and its connection to the three-dimensional organization of genomes was investigated by correlation analyses of completely sequenced chromosomes from Viroids, Archaea, Bacteria, Arabidopsis

  12. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  13. Snake Genome Sequencing: Results and Future Prospects.

    Science.gov (United States)

    Kerkkamp, Harald M I; Kini, R Manjunatha; Pospelov, Alexey S; Vonk, Freek J; Henkel, Christiaan V; Richardson, Michael K

    2016-12-01

    Snake genome sequencing is in its infancy-very much behind the progress made in sequencing the genomes of humans, model organisms and pathogens relevant to biomedical research, and agricultural species. We provide here an overview of some of the snake genome projects in progress, and discuss the biological findings, with special emphasis on toxinology, from the small number of draft snake genomes already published. We discuss the future of snake genomics, pointing out that new sequencing technologies will help overcome the problem of repetitive sequences in assembling snake genomes. Genome sequences are also likely to be valuable in examining the clustering of toxin genes on the chromosomes, in designing recombinant antivenoms and in studying the epigenetic regulation of toxin gene expression.

  14. Sequencing Cyclic Peptides by Multistage Mass Spectrometry

    Science.gov (United States)

    Mohimani, Hosein; Yang, Yu-Liang; Liu, Wei-Ting; Hsieh, Pei-Wen; Dorrestein, Pieter C.; Pevzner, Pavel A.

    2012-01-01

    Some of the most effective antibiotics (e.g., Vancomycin and Daptomycin) are cyclic peptides produced by non-ribosomal biosynthetic pathways. While hundreds of biomedically important cyclic peptides have been sequenced, the computational techniques for sequencing cyclic peptides are still in their infancy. Previous methods for sequencing peptide antibiotics and other cyclic peptides are based on Nuclear Magnetic Resonance spectroscopy, and require large amount (miligrams) of purified materials that, for most compounds, are not possible to obtain. Recently, development of mass spectrometry based methods has provided some hope for accurate sequencing of cyclic peptides using picograms of materials. In this paper we develop a method for sequencing of cyclic peptides by multistage mass spectrometry, and show its advantages over single stage mass spectrometry. The method is tested on known and new cyclic peptides from Bacillus brevis, Dianthus superbus and Streptomyces griseus, as well as a new family of cyclic peptides produced by marine bacteria. PMID:21751357

  15. Snake Genome Sequencing: Results and Future Prospects

    Directory of Open Access Journals (Sweden)

    Harald M. I. Kerkkamp

    2016-12-01

    Full Text Available Snake genome sequencing is in its infancy—very much behind the progress made in sequencing the genomes of humans, model organisms and pathogens relevant to biomedical research, and agricultural species. We provide here an overview of some of the snake genome projects in progress, and discuss the biological findings, with special emphasis on toxinology, from the small number of draft snake genomes already published. We discuss the future of snake genomics, pointing out that new sequencing technologies will help overcome the problem of repetitive sequences in assembling snake genomes. Genome sequences are also likely to be valuable in examining the clustering of toxin genes on the chromosomes, in designing recombinant antivenoms and in studying the epigenetic regulation of toxin gene expression.

  16. Sequencing and comparing whole mitochondrial genomes ofanimals

    Energy Technology Data Exchange (ETDEWEB)

    Boore, Jeffrey L.; Macey, J. Robert; Medina, Monica

    2005-04-22

    Comparing complete animal mitochondrial genome sequences is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. Not only are they much more informative than shorter sequences of individual genes for inferring evolutionary relatedness, but these data also provide sets of genome-level characters, such as the relative arrangements of genes, that can be especially powerful. We describe here the protocols commonly used for physically isolating mtDNA, for amplifying these by PCR or RCA, for cloning,sequencing, assembly, validation, and gene annotation, and for comparing both sequences and gene arrangements. On several topics, we offer general observations based on our experiences to date with determining and comparing complete mtDNA sequences.

  17. Divide and conquer: enriching environmental sequencing data.

    Directory of Open Access Journals (Sweden)

    Anne Bergeron

    2007-09-01

    Full Text Available In environmental sequencing projects, a mix of DNA from a whole microbial community is fragmented and sequenced, with one of the possible goals being to reconstruct partial or complete genomes of members of the community. In communities with high diversity of species, a significant proportion of the sequences do not overlap any other fragment in the sample. This problem will arise not only in situations with a relatively even distribution of many species, but also when the community in a particular environment is routinely dominated by the same few species. In the former case, no genomes may be assembled at all, while in the latter case a few dominant species in an environment will always be sequenced at high coverage to the detriment of coverage of the greater number of sparse species.Here we show that, with the same global sequencing effort, separating the species into two or more sub-communities prior to sequencing can yield a much higher proportion of sequences that can be assembled. We first use the Lander-Waterman model to show that, if the expected percentage of singleton sequences is higher than 25%, then, under the uniform distribution hypothesis, splitting the community is always a wise choice. We then construct simulated microbial communities to show that the results hold for highly non-uniform distributions. We also show that, for the distributions considered in the experiments, it is possible to estimate quite accurately the relative diversity of the two sub-communities.Given the fact that several methods exist to split microbial communities based on physical properties such as size, density, surface biochemistry, or optical properties, we strongly suggest that groups involved in environmental sequencing, and expecting high diversity, consider splitting their communities in order to maximize the information content of their sequencing effort.

  18. Sequence Matters but How Exactly? A Method for Evaluating Activity Sequences from Data

    Science.gov (United States)

    Doroudi, Shayan; Holstein, Kenneth; Aleven, Vincent; Brunskill, Emma

    2016-01-01

    How should a wide variety of educational activities be sequenced to maximize student learning? Although some experimental studies have addressed this question, educational data mining methods may be able to evaluate a wider range of possibilities and better handle many simultaneous sequencing constraints. We introduce Sequencing Constraint…

  19. Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags

    DEFF Research Database (Denmark)

    de Souza, S J; Camargo, A A; Briones, M R

    2000-01-01

    Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central ...

  20. Advantages of genome sequencing by long-read sequencer using SMRT technology in medical area.

    Science.gov (United States)

    Nakano, Kazuma; Shiroma, Akino; Shimoji, Makiko; Tamotsu, Hinako; Ashimine, Noriko; Ohki, Shun; Shinzato, Misuzu; Minami, Maiko; Nakanishi, Tetsuhiro; Teruya, Kuniko; Satou, Kazuhito; Hirano, Takashi

    2017-07-01

    PacBio RS II is the first commercialized third-generation DNA sequencer able to sequence a single molecule DNA in real-time without amplification. PacBio RS II's sequencing technology is novel and unique, enabling the direct observation of DNA synthesis by DNA polymerase. PacBio RS II confers four major advantages compared to other sequencing technologies: long read lengths, high consensus accuracy, a low degree of bias, and simultaneous capability of epigenetic characterization. These advantages surmount the obstacle of sequencing genomic regions such as high/low G+C, tandem repeat, and interspersed repeat regions. Moreover, PacBio RS II is ideal for whole genome sequencing, targeted sequencing, complex population analysis, RNA sequencing, and epigenetics characterization. With PacBio RS II, we have sequenced and analyzed the genomes of many species, from viruses to humans. Herein, we summarize and review some of our key genome sequencing projects, including full-length viral sequencing, complete bacterial genome and almost-complete plant genome assemblies, and long amplicon sequencing of a disease-associated gene region. We believe that PacBio RS II is not only an effective tool for use in the basic biological sciences but also in the medical/clinical setting.

  1. A comparative evaluation of sequence classification programs

    Directory of Open Access Journals (Sweden)

    Bazinet Adam L

    2012-05-01

    Full Text Available Abstract Background A fundamental problem in modern genomics is to taxonomically or functionally classify DNA sequence fragments derived from environmental sampling (i.e., metagenomics. Several different methods have been proposed for doing this effectively and efficiently, and many have been implemented in software. In addition to varying their basic algorithmic approach to classification, some methods screen sequence reads for ’barcoding genes’ like 16S rRNA, or various types of protein-coding genes. Due to the sheer number and complexity of methods, it can be difficult for a researcher to choose one that is well-suited for a particular analysis. Results We divided the very large number of programs that have been released in recent years for solving the sequence classification problem into three main categories based on the general algorithm they use to compare a query sequence against a database of sequences. We also evaluated the performance of the leading programs in each category on data sets whose taxonomic and functional composition is known. Conclusions We found significant variability in classification accuracy, precision, and resource consumption of sequence classification programs when used to analyze various metagenomics data sets. However, we observe some general trends and patterns that will be useful to researchers who use sequence classification programs.

  2. CATEGORIZATION OF EVENT SEQUENCES FOR LICENSE APPLICATION

    Energy Technology Data Exchange (ETDEWEB)

    G.E. Ragan; P. Mecheret; D. Dexheimer

    2005-04-14

    The purposes of this analysis are: (1) Categorize (as Category 1, Category 2, or Beyond Category 2) internal event sequences that may occur before permanent closure of the repository at Yucca Mountain. (2) Categorize external event sequences that may occur before permanent closure of the repository at Yucca Mountain. This includes examining DBGM-1 seismic classifications and upgrading to DBGM-2, if appropriate, to ensure Beyond Category 2 categorization. (3) State the design and operational requirements that are invoked to make the categorization assignments valid. (4) Indicate the amount of material put at risk by Category 1 and Category 2 event sequences. (5) Estimate frequencies of Category 1 event sequences at the maximum capacity and receipt rate of the repository. (6) Distinguish occurrences associated with normal operations from event sequences. It is beyond the scope of the analysis to propose design requirements that may be required to control radiological exposure associated with normal operations. (7) Provide a convenient compilation of the results of the analysis in tabular form. The results of this analysis are used as inputs to the consequence analyses in an iterative design process that is depicted in Figure 1. Categorization of event sequences for permanent retrieval of waste from the repository is beyond the scope of this analysis. Cleanup activities that take place after an event sequence and other responses to abnormal events are also beyond the scope of the analysis.

  3. Exploration of noncoding sequences in metagenomes.

    Directory of Open Access Journals (Sweden)

    Fabián Tobar-Tosse

    Full Text Available Environment-dependent genomic features have been defined for different metagenomes, whose genes and their associated processes are related to specific environments. Identification of ORFs and their functional categories are the most common methods for association between functional and environmental features. However, this analysis based on finding ORFs misses noncoding sequences and, therefore, some metagenome regulatory or structural information could be discarded. In this work we analyzed 23 whole metagenomes, including coding and noncoding sequences using the following sequence patterns: (G+C content, Codon Usage (Cd, Trinucleotide Usage (Tn, and functional assignments for ORF prediction. Herein, we present evidence of a high proportion of noncoding sequences discarded in common similarity-based methods in metagenomics, and the kind of relevant information present in those. We found a high density of trinucleotide repeat sequences (TRS in noncoding sequences, with a regulatory and adaptive function for metagenome communities. We present associations between trinucleotide values and gene function, where metagenome clustering correlate with microorganism adaptations and kinds of metagenomes. We propose here that noncoding sequences have relevant information to describe metagenomes that could be considered in a whole metagenome analysis in order to improve their organization, classification protocols, and their relation with the environment.

  4. CATEGORIZATION OF EVENT SEQUENCES FOR LICENSE APPLICATION

    International Nuclear Information System (INIS)

    G.E. Ragan; P. Mecheret; D. Dexheimer

    2005-01-01

    The purposes of this analysis are: (1) Categorize (as Category 1, Category 2, or Beyond Category 2) internal event sequences that may occur before permanent closure of the repository at Yucca Mountain. (2) Categorize external event sequences that may occur before permanent closure of the repository at Yucca Mountain. This includes examining DBGM-1 seismic classifications and upgrading to DBGM-2, if appropriate, to ensure Beyond Category 2 categorization. (3) State the design and operational requirements that are invoked to make the categorization assignments valid. (4) Indicate the amount of material put at risk by Category 1 and Category 2 event sequences. (5) Estimate frequencies of Category 1 event sequences at the maximum capacity and receipt rate of the repository. (6) Distinguish occurrences associated with normal operations from event sequences. It is beyond the scope of the analysis to propose design requirements that may be required to control radiological exposure associated with normal operations. (7) Provide a convenient compilation of the results of the analysis in tabular form. The results of this analysis are used as inputs to the consequence analyses in an iterative design process that is depicted in Figure 1. Categorization of event sequences for permanent retrieval of waste from the repository is beyond the scope of this analysis. Cleanup activities that take place after an event sequence and other responses to abnormal events are also beyond the scope of the analysis

  5. On site DNA barcoding by nanopore sequencing.

    Directory of Open Access Journals (Sweden)

    Michele Menegon

    Full Text Available Biodiversity research is becoming increasingly dependent on genomics, which allows the unprecedented digitization and understanding of the planet's biological heritage. The use of genetic markers i.e. DNA barcoding, has proved to be a powerful tool in species identification. However, full exploitation of this approach is hampered by the high sequencing costs and the absence of equipped facilities in biodiversity-rich countries. In the present work, we developed a portable sequencing laboratory based on the portable DNA sequencer from Oxford Nanopore Technologies, the MinION. Complementary laboratory equipment and reagents were selected to be used in remote and tough environmental conditions. The performance of the MinION sequencer and the portable laboratory was tested for DNA barcoding in a mimicking tropical environment, as well as in a remote rainforest of Tanzania lacking electricity. Despite the relatively high sequencing error-rate of the MinION, the development of a suitable pipeline for data analysis allowed the accurate identification of different species of vertebrates including amphibians, reptiles and mammals. In situ sequencing of a wild frog allowed us to rapidly identify the species captured, thus confirming that effective DNA barcoding in the field is possible. These results open new perspectives for real-time-on-site DNA sequencing thus potentially increasing opportunities for the understanding of biodiversity in areas lacking conventional laboratory facilities.

  6. Comparison of two Next Generation sequencing platforms for full genome sequencing of Classical Swine Fever Virus

    DEFF Research Database (Denmark)

    Fahnøe, Ulrik; Pedersen, Anders Gorm; Höper, Dirk

    2013-01-01

    to the consensus sequence. Additionally, we got an average sequence depth for the genome of 4000 for the Iontorrent PGM and 400 for the FLX platform making the mapping suitable for single nucleotide variant (SNV) detection. The analysis revealed a single non-silent SNV A10665G leading to the amino acid change D......Next Generation Sequencing (NGS) is becoming more adopted into viral research and will be the preferred technology in the years to come. We have recently sequenced several strains of Classical Swine Fever Virus (CSFV) by NGS on both Genome Sequencer FLX (GS FLX) and Iontorrent PGM platforms...

  7. Sequencing of chloroplast genome using whole cellular DNA and Solexa sequencing technology

    Directory of Open Access Journals (Sweden)

    Jian eWu

    2012-11-01

    Full Text Available Sequencing of the chloroplast genome using traditional sequencing methods has been difficult because of its size (>120 kb and the complicated procedures required to prepare templates. To explore the feasibility of sequencing the chloroplast genome using DNA extracted from whole cells and Solexa sequencing technology, we sequenced whole cellular DNA isolated from leaves of three Brassica rapa accessions with one lane per accession. In total, 246 Mb, 362Mb, 361 Mb sequence data were generated for the three accessions Chiifu-401-42, Z16 and FT, respectively. Microreads were assembled by reference-guided assembly using the cpDNA sequences of B. rapa, Arabidopsis thaliana, and Nicotiana tabacum. We achieved coverage of more than 99.96% of the cp genome in the three tested accessions using the B. rapa sequence as the reference. When A. thaliana or N. tabacum sequences were used as references, 99.7–99.8% or 95.5–99.7% of the B. rapa chloroplast genome was covered, respectively. These results demonstrated that sequencing of whole cellular DNA isolated from young leaves using the Illumina Genome Analyzer is an efficient method for high-throughput sequencing of chloroplast genome.

  8. Rapid and Accurate Sequencing of Enterovirus Genomes Using MinION Nanopore Sequencer.

    Science.gov (United States)

    Wang, Ji; Ke, Yue Hua; Zhang, Yong; Huang, Ke Qiang; Wang, Lei; Shen, Xin Xin; Dong, Xiao Ping; Xu, Wen Bo; Ma, Xue Jun

    2017-10-01

    Knowledge of an enterovirus genome sequence is very important in epidemiological investigation to identify transmission patterns and ascertain the extent of an outbreak. The MinION sequencer is increasingly used to sequence various viral pathogens in many clinical situations because of its long reads, portability, real-time accessibility of sequenced data, and very low initial costs. However, information is lacking on MinION sequencing of enterovirus genomes. In this proof-of-concept study using Enterovirus 71 (EV71) and Coxsackievirus A16 (CA16) strains as examples, we established an amplicon-based whole genome sequencing method using MinION. We explored the accuracy, minimum sequencing time, discrimination and high-throughput sequencing ability of MinION, and compared its performance with Sanger sequencing. Within the first minute (min) of sequencing, the accuracy of MinION was 98.5% for the single EV71 strain and 94.12%-97.33% for 10 genetically-related CA16 strains. In as little as 14 min, 99% identity was reached for the single EV71 strain, and in 17 min (on average), 99% identity was achieved for 10 CA16 strains in a single run. MinION is suitable for whole genome sequencing of enteroviruses with sufficient accuracy and fine discrimination and has the potential as a fast, reliable and convenient method for routine use. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  9. Computer simulation of replacement sequences in copper

    International Nuclear Information System (INIS)

    Schiffgens, J.O.; Schwartz, D.W.; Ariyasu, R.G.; Cascadden, S.E.

    1978-01-01

    Results of computer simulations of , , and replacement sequences in copper are presented, including displacement thresholds, focusing energies, energy losses per replacement, and replacement sequence lengths. These parameters are tabulated for six interatomic potentials and shown to vary in a systematic way with potential stiffness and range. Comparisons of results from calculations made with ADDES, a quasi-dynamical code, and COMENT, a dynamical code, show excellent agreement, demonstrating that the former can be calibrated and used satisfactorily in the analysis of low energy displacement cascades. Upper limits on , , and replacement sequences were found to be approximately 10, approximately 30, and approximately 14 replacements, respectively. (author)

  10. Whole-genome sequencing of veterinary pathogens

    DEFF Research Database (Denmark)

    Ronco, Troels

    -electrophoresis and single-locus sequencing has been widely used to characterize such types of veterinary pathogens. However, DNA sequencing techniques have become fast and cost effective in recent years and whole-genome sequencing data provide a much higher discriminative power and reproducibility than any...... genetic background. This indicates that dairy cows can be natural carriers of S. aureus subtypes that in certain cases lead to CM. A group of isolates that mostly belonged to ST151 carried three pathogenicity islands that were primarily found in this group. The prevalence of resistance genes was generally...

  11. Spreadsheet macros for coloring sequence alignments.

    Science.gov (United States)

    Haygood, M G

    1993-12-01

    This article describes a set of Microsoft Excel macros designed to color amino acid and nucleotide sequence alignments for review and preparation of visual aids. The colored alignments can then be modified to emphasize features of interest. Procedures for importing and coloring sequences are described. The macro file adds a new menu to the menu bar containing sequence-related commands to enable users unfamiliar with Excel to use the macros more readily. The macros were designed for use with Macintosh computers but will also run with the DOS version of Excel.

  12. Tensor products of higher almost split sequences

    OpenAIRE

    Pasquali, Andrea

    2015-01-01

    We investigate how the higher almost split sequences over a tensor product of algebras are related to those over each factor. Herschend and Iyama gave a precise criterion for when the tensor product of an $n$-representation finite algebra and an $m$-representation finite algebra is $(n+m)$-representation finite. In this case we give a complete description of the higher almost split sequences over the tensor product by expressing every higher almost split sequence as the mapping cone of a suit...

  13. Arbitrarily accurate twin composite π -pulse sequences

    Science.gov (United States)

    Torosov, Boyan T.; Vitanov, Nikolay V.

    2018-04-01

    We present three classes of symmetric broadband composite pulse sequences. The composite phases are given by analytic formulas (rational fractions of π ) valid for any number of constituent pulses. The transition probability is expressed by simple analytic formulas and the order of pulse area error compensation grows linearly with the number of pulses. Therefore, any desired compensation order can be produced by an appropriate composite sequence; in this sense, they are arbitrarily accurate. These composite pulses perform equally well as or better than previously published ones. Moreover, the current sequences are more flexible as they allow total pulse areas of arbitrary integer multiples of π .

  14. Modeling of Prepregs during Automated Draping Sequences

    DEFF Research Database (Denmark)

    Krogh, Christian; Glud, Jens Ammitzbøll; Jakobsen, Johnny

    2017-01-01

    algorithm used to generate target points on the mold which are used as input to a draping sequence planner. The draping sequence planner prescribes the displacement history for each gripper in the drape tool and these displacements are then applied to each gripper in a transient model of the draping...... sequence. The model is based on a transient finite element analysis with the material’s constitutive behavior currently being approximated as linear elastic orthotropic. In-plane tensile and bias-extension tests as well as bending tests are conducted and used as input for the model. The virtual draping...

  15. Deep-sequencing protocols influence the results obtained in small-RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Joern Toedling

    Full Text Available Second-generation sequencing is a powerful method for identifying and quantifying small-RNA components of cells. However, little attention has been paid to the effects of the choice of sequencing platform and library preparation protocol on the results obtained. We present a thorough comparison of small-RNA sequencing libraries generated from the same embryonic stem cell lines, using different sequencing platforms, which represent the three major second-generation sequencing technologies, and protocols. We have analysed and compared the expression of microRNAs, as well as populations of small RNAs derived from repetitive elements. Despite the fact that different libraries display a good correlation between sequencing platforms, qualitative and quantitative variations in the results were found, depending on the protocol used. Thus, when comparing libraries from different biological samples, it is strongly recommended to use the same sequencing platform and protocol in order to ensure the biological relevance of the comparisons.

  16. Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform

    Directory of Open Access Journals (Sweden)

    Shan Wei

    2018-05-01

    Full Text Available Real-time sequencing of short DNA reads has a wide variety of clinical and research applications including screening for mutations, target sequences and aneuploidy. We recently demonstrated that MinION, a nanopore-based DNA sequencing device the size of a USB drive, could be used for short-read DNA sequencing. In this study, an ultra-rapid multiplex library preparation and sequencing method for the MinION is presented and applied to accurately test normal diploid and aneuploidy samples’ genomic DNA in under three hours, including library preparation and sequencing. This novel method shows great promise as a clinical diagnostic test for applications requiring rapid short-read DNA sequencing.

  17. Probabilistic Motor Sequence Yields Greater Offline and Less Online Learning than Fixed Sequence.

    Science.gov (United States)

    Du, Yue; Prashad, Shikha; Schoenbrun, Ilana; Clark, Jane E

    2016-01-01

    It is well acknowledged that motor sequences can be learned quickly through online learning. Subsequently, the initial acquisition of a motor sequence is boosted or consolidated by offline learning. However, little is known whether offline learning can drive the fast learning of motor sequences (i.e., initial sequence learning in the first training session). To examine offline learning in the fast learning stage, we asked four groups of young adults to perform the serial reaction time (SRT) task with either a fixed or probabilistic sequence and with or without preliminary knowledge (PK) of the presence of a sequence. The sequence and PK were manipulated to emphasize either procedural (probabilistic sequence; no preliminary knowledge (NPK)) or declarative (fixed sequence; with PK) memory that were found to either facilitate or inhibit offline learning. In the SRT task, there were six learning blocks with a 2 min break between each consecutive block. Throughout the session, stimuli followed the same fixed or probabilistic pattern except in Block 5, in which stimuli appeared in a random order. We found that PK facilitated the learning of a fixed sequence, but not a probabilistic sequence. In addition to overall learning measured by the mean reaction time (RT), we examined the progressive changes in RT within and between blocks (i.e., online and offline learning, respectively). It was found that the two groups who performed the fixed sequence, regardless of PK, showed greater online learning than the other two groups who performed the probabilistic sequence. The groups who performed the probabilistic sequence, regardless of PK, did not display online learning, as indicated by a decline in performance within the learning blocks. However, they did demonstrate remarkably greater offline improvement in RT, which suggests that they are learning the probabilistic sequence offline. These results suggest that in the SRT task, the fast acquisition of a motor sequence is driven

  18. Optimization of a sequence of reactors

    DEFF Research Database (Denmark)

    Vidal, Rene Victor Valqui

    1991-01-01

    Concerns the optimal production of sulphuric acid in a sequence of reactors. Using a suitable approximation to the objective function, this problem can easily be solved using the maximum principle. A numerical example documents the applicability of the suggested approach...

  19. Fluency First: Reversing the Traditional ESL Sequence.

    Science.gov (United States)

    MacGowan-Gilhooly, Adele

    1991-01-01

    Describes an ESL department's whole language approach to writing and reading, replacing its traditional grammar-based ESL instructional sequence. Reports the positive quantitative and qualitative results of the first three years of using the new approach. (KEH)

  20. Expressed sequence tags (ESTs) and single nucleotide ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... the discovery of the DNA, a new area of modern plant biotechnology begun. In plant ... Marker Assisted Breeding and Sequence Tagged Sites. (STS) are all in use in modern ...... and behaviour in the honey bee. Genome Res.

  1. DNA Replication Profiling Using Deep Sequencing.

    Science.gov (United States)

    Saayman, Xanita; Ramos-Pérez, Cristina; Brown, Grant W

    2018-01-01

    Profiling of DNA replication during progression through S phase allows a quantitative snap-shot of replication origin usage and DNA replication fork progression. We present a method for using deep sequencing data to profile DNA replication in S. cerevisiae.

  2. Supervised Sequence Labelling with Recurrent Neural Networks

    CERN Document Server

    Graves, Alex

    2012-01-01

    Supervised sequence labelling is a vital area of machine learning, encompassing tasks such as speech, handwriting and gesture recognition, protein secondary structure prediction and part-of-speech tagging. Recurrent neural networks are powerful sequence learning tools—robust to input noise and distortion, able to exploit long-range contextual information—that would seem ideally suited to such problems. However their role in large-scale sequence labelling systems has so far been auxiliary.    The goal of this book is a complete framework for classifying and transcribing sequential data with recurrent neural networks only. Three main innovations are introduced in order to realise this goal. Firstly, the connectionist temporal classification output layer allows the framework to be trained with unsegmented target sequences, such as phoneme-level speech transcriptions; this is in contrast to previous connectionist approaches, which were dependent on error-prone prior segmentation. Secondly, multidimensional...

  3. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  4. Interference management using direct sequence spread spectrum ...

    African Journals Online (AJOL)

    Interference management using direct sequence spread spectrum (DSSS) technique ... Journal of Fundamental and Applied Sciences ... Keywords: DSSS, LTE network; Wi-Fi network; SINR; interference management and interference power.

  5. Characterizing leader sequences of CRISPR loci

    DEFF Research Database (Denmark)

    Alkhnbashi, Omer; Shah, Shiraz Ali; Garrett, Roger Antony

    2016-01-01

    The CRISPR-Cas system is an adaptive immune system in many archaea and bacteria, which provides resistance against invading genetic elements. The first phase of CRISPR-Cas immunity is called adaptation, in which small DNA fragments are excised from genetic elements and are inserted into a CRISPR...... array generally adjacent to its so called leader sequence at one end of the array. It has been shown that transcription initiation and adaptation signals of the CRISPR array are located within the leader. However, apart from promoters, there is very little knowledge of sequence or structural motifs...... sequences by focusing on the consensus repeat of the adjacent CRISPR array and weak upstream conservation signals. We applied our tool to the analysis of a comprehensive genomic database and identified several characteristic properties of leader sequences specific to archaea and bacteria, ranging from...

  6. Sequencing Information Management System (SIMS). Final report

    Energy Technology Data Exchange (ETDEWEB)

    Fields, C.

    1996-02-15

    A feasibility study to develop a requirements analysis and functional specification for a data management system for large-scale DNA sequencing laboratories resulted in a functional specification for a Sequencing Information Management System (SIMS). This document reports the results of this feasibility study, and includes a functional specification for a SIMS relational schema. The SIMS is an integrated information management system that supports data acquisition, management, analysis, and distribution for DNA sequencing laboratories. The SIMS provides ad hoc query access to information on the sequencing process and its results, and partially automates the transfer of data between laboratory instruments, analysis programs, technical personnel, and managers. The SIMS user interfaces are designed for use by laboratory technicians, laboratory managers, and scientists. The SIMS is designed to run in a heterogeneous, multiplatform environment in a client/server mode. The SIMS communicates with external computational and data resources via the internet.

  7. Galaxy LIMS for next-generation sequencing

    NARCIS (Netherlands)

    Scholtalbers, J.; Rossler, J.; Sorn, P.; Graaf, J. de; Boisguerin, V.; Castle, J.; Sahin, U.

    2013-01-01

    SUMMARY: We have developed a laboratory information management system (LIMS) for a next-generation sequencing (NGS) laboratory within the existing Galaxy platform. The system provides lab technicians standard and customizable sample information forms, barcoded submission forms, tracking of input

  8. Sequencing Closterium moniliferum: Future prospects in nuclear ...

    African Journals Online (AJOL)

    Akanksha Pandey

    2012-10-06

    Oct 6, 2012 ... Abstract Genome sequencing can play a vital role in health and several other domains such as in .... ter have imposed some serious questions over the security is- ... strontium and barium from aqueous environment and store.

  9. Generalized locally Toeplitz sequences theory and applications

    CERN Document Server

    Garoni, Carlo

    2017-01-01

    Based on their research experience, the authors propose a reference textbook in two volumes on the theory of generalized locally Toeplitz sequences and their applications. This first volume focuses on the univariate version of the theory and the related applications in the unidimensional setting, while the second volume, which addresses the multivariate case, is mainly devoted to concrete PDE applications. This book systematically develops the theory of generalized locally Toeplitz (GLT) sequences and presents some of its main applications, with a particular focus on the numerical discretization of differential equations (DEs). It is the first book to address the relatively new field of GLT sequences, which occur in numerous scientific applications and are especially dominant in the context of DE discretizations. Written for applied mathematicians, engineers, physicists, and scientists who (perhaps unknowingly) encounter GLT sequences in their research, it is also of interest to those working in the fields of...

  10. High resolution sequence stratigraphy in China

    International Nuclear Information System (INIS)

    Zhang Shangfeng; Zhang Changmin; Yin Yanshi; Yin Taiju

    2008-01-01

    Since high resolution sequence stratigraphy was introduced into China by DENG Hong-wen in 1995, it has been experienced two development stages in China which are the beginning stage of theory research and development of theory research and application, and the stage of theoretical maturity and widely application that is going into. It is proved by practices that high resolution sequence stratigraphy plays more and more important roles in the exploration and development of oil and gas in Chinese continental oil-bearing basin and the research field spreads to the exploration of coal mine, uranium mine and other strata deposits. However, the theory of high resolution sequence stratigraphy still has some shortages, it should be improved in many aspects. The authors point out that high resolution sequence stratigraphy should be characterized quantitatively and modelized by computer techniques. (authors)

  11. Genetic sequences derived from suppression subtractive ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-06-17

    Jun 17, 2008 ... their possible roles in Xanthomonas albilineans ... Technology, P. O. Box 1334, Durban 4000, Republic of South Africa. Accepted 4 ... Clones selected were sequenced (using a Perkin Elmer ABI PRISM Dye terminator cycle.

  12. Special Issue: Next Generation DNA Sequencing

    Directory of Open Access Journals (Sweden)

    Paul Richardson

    2010-10-01

    Full Text Available Next Generation Sequencing (NGS refers to technologies that do not rely on traditional dideoxy-nucleotide (Sanger sequencing where labeled DNA fragments are physically resolved by electrophoresis. These new technologies rely on different strategies, but essentially all of them make use of real-time data collection of a base level incorporation event across a massive number of reactions (on the order of millions versus 96 for capillary electrophoresis for instance. The major commercial NGS platforms available to researchers are the 454 Genome Sequencer (Roche, Illumina (formerly Solexa Genome analyzer, the SOLiD system (Applied Biosystems/Life Technologies and the Heliscope (Helicos Corporation. The techniques and different strategies utilized by these platforms are reviewed in a number of the papers in this special issue. These technologies are enabling new applications that take advantage of the massive data produced by this next generation of sequencing instruments. [...

  13. Nursing Student Perceptions Regarding Simulation Experience Sequencing.

    Science.gov (United States)

    Woda, Aimee A; Gruenke, Theresa; Alt-Gehrman, Penny; Hansen, Jamie

    2016-09-01

    The use of simulated learning experiences (SLEs) have increased within nursing curricula with positive learning outcomes for nursing students. The purpose of this study is to explore nursing students' perceptions of their clinical decision making (CDM) related to the block sequencing of different patient care experiences, SLEs versus hospital-based learning experiences (HLEs). A qualitative descriptive design used open-ended survey questions to generate information about the block sequencing of SLEs and its impact on nursing students' perceived CDM. Three themes emerged from the data: Preexperience Anxiety, Real-Time Decision Making, and Increased Patient Care Experiences. Nursing students identified that having SLEs prior to HLEs provided several benefits. Even when students preferred SLEs prior to HLEs, the sequence did not impact their CDM. This suggests that alternating block sequencing can be used without impacting the students' perceptions of their ability to make decisions. [J Nurs Educ. 2016;55(9):528-532.]. Copyright 2016, SLACK Incorporated.

  14. Sequence finishing and mapping of Drosophila melanogasterheterochromatin

    Energy Technology Data Exchange (ETDEWEB)

    Hoskins, Roger A.; Carlson, Joseph W.; Kennedy, Cameron; Acevedo,David; Evans-Holm, Martha; Frise, Erwin; Wan, Kenneth H.; Park, Soo; Mendez-Lago, Maria; Rossi, Fabrizio; Villasante, Alfredo; Dimitri,Patrizio; Karpen, Gary H.; Celniker, Susan E.

    2007-06-15

    Genome sequences for most metazoans are incomplete due tothe presence of repeated DNA in the pericentromeric heterochromatin. Theheterochromatic regions of D. melanogaster contain 20 Mb of sequenceamenable to mapping, sequence assembly and finishing. Here we describethe generation of 15 Mb of finished or improved heterochromatic sequenceusing available clone resources and assembly and mapping methods. We alsoconstructed a BAC-based physical map that spans approximately 13 Mb ofthe pericentromeric heterochromatin, and a cytogenetic map that positionsapproximately 11 Mb of BAC contigs and sequence scaffolds in specificchromosomal locations. The integrated sequence assembly and maps greatlyimprove our understanding of the structure and composition of this poorlyunderstood fraction of a metazoan genome and provide a framework forfunctional analyses.

  15. ASAP: Amplification, sequencing & annotation of plastomes

    Directory of Open Access Journals (Sweden)

    Folta Kevin M

    2005-12-01

    Full Text Available Abstract Background Availability of DNA sequence information is vital for pursuing structural, functional and comparative genomics studies in plastids. Traditionally, the first step in mining the valuable information within a chloroplast genome requires sequencing a chloroplast plasmid library or BAC clones. These activities involve complicated preparatory procedures like chloroplast DNA isolation or identification of the appropriate BAC clones to be sequenced. Rolling circle amplification (RCA is being used currently to amplify the chloroplast genome from purified chloroplast DNA and the resulting products are sheared and cloned prior to sequencing. Herein we present a universal high-throughput, rapid PCR-based technique to amplify, sequence and assemble plastid genome sequence from diverse species in a short time and at reasonable cost from total plant DNA, using the large inverted repeat region from strawberry and peach as proof of concept. The method exploits the highly conserved coding regions or intergenic regions of plastid genes. Using an informatics approach, chloroplast DNA sequence information from 5 available eudicot plastomes was aligned to identify the most conserved regions. Cognate primer pairs were then designed to generate ~1 – 1.2 kb overlapping amplicons from the inverted repeat region in 14 diverse genera. Results 100% coverage of the inverted repeat region was obtained from Arabidopsis, tobacco, orange, strawberry, peach, lettuce, tomato and Amaranthus. Over 80% coverage was obtained from distant species, including Ginkgo, loblolly pine and Equisetum. Sequence from the inverted repeat region of strawberry and peach plastome was obtained, annotated and analyzed. Additionally, a polymorphic region identified from gel electrophoresis was sequenced from tomato and Amaranthus. Sequence analysis revealed large deletions in these species relative to tobacco plastome thus exhibiting the utility of this method for structural and

  16. Ancestral sequence alignment under optimal conditions

    Directory of Open Access Journals (Sweden)

    Brown Daniel G

    2005-11-01

    Full Text Available Abstract Background Multiple genome alignment is an important problem in bioinformatics. An important subproblem used by many multiple alignment approaches is that of aligning two multiple alignments. Many popular alignment algorithms for DNA use the sum-of-pairs heuristic, where the score of a multiple alignment is the sum of its induced pairwise alignment scores. However, the biological meaning of the sum-of-pairs of pairs heuristic is not obvious. Additionally, many algorithms based on the sum-of-pairs heuristic are complicated and slow, compared to pairwise alignment algorithms. An alternative approach to aligning alignments is to first infer ancestral sequences for each alignment, and then align the two ancestral sequences. In addition to being fast, this method has a clear biological basis that takes into account the evolution implied by an underlying phylogenetic tree. In this study we explore the accuracy of aligning alignments by ancestral sequence alignment. We examine the use of both maximum likelihood and parsimony to infer ancestral sequences. Additionally, we investigate the effect on accuracy of allowing ambiguity in our ancestral sequences. Results We use synthetic sequence data that we generate by simulating evolution on a phylogenetic tree. We use two different types of phylogenetic trees: trees with a period of rapid growth followed by a period of slow growth, and trees with a period of slow growth followed by a period of rapid growth. We examine the alignment accuracy of four ancestral sequence reconstruction and alignment methods: parsimony, maximum likelihood, ambiguous parsimony, and ambiguous maximum likelihood. Additionally, we compare against the alignment accuracy of two sum-of-pairs algorithms: ClustalW and the heuristic of Ma, Zhang, and Wang. Conclusion We find that allowing ambiguity in ancestral sequences does not lead to better multiple alignments. Regardless of whether we use parsimony or maximum likelihood, the

  17. Fibonacci difference sequence spaces for modulus functions

    Directory of Open Access Journals (Sweden)

    Kuldip Raj

    2015-05-01

    Full Text Available In the present paper we introduce Fibonacci difference sequence spaces l(F, Ƒ, p, u and  l_∞(F, Ƒ, p, u by using a sequence of modulus functions and a new band matrix F. We also make an effort to study some inclusion relations, topological and geometric properties of these spaces. Furthermore, the alpha, beta, gamma duals and matrix transformation of the space l(F, Ƒ, p, u are determined.

  18. Parallel motif extraction from very long sequences

    KAUST Repository

    Sahli, Majed

    2013-01-01

    Motifs are frequent patterns used to identify biological functionality in genomic sequences, periodicity in time series, or user trends in web logs. In contrast to a lot of existing work that focuses on collections of many short sequences, modern applications require mining of motifs in one very long sequence (i.e., in the order of several gigabytes). For this case, there exist statistical approaches that are fast but inaccurate; or combinatorial methods that are sound and complete. Unfortunately, existing combinatorial methods are serial and very slow. Consequently, they are limited to very short sequences (i.e., a few megabytes), small alphabets (typically 4 symbols for DNA sequences), and restricted types of motifs. This paper presents ACME, a combinatorial method for extracting motifs from a single very long sequence. ACME arranges the search space in contiguous blocks that take advantage of the cache hierarchy in modern architectures, and achieves almost an order of magnitude performance gain in serial execution. It also decomposes the search space in a smart way that allows scalability to thousands of processors with more than 90% speedup. ACME is the only method that: (i) scales to gigabyte-long sequences; (ii) handles large alphabets; (iii) supports interesting types of motifs with minimal additional cost; and (iv) is optimized for a variety of architectures such as multi-core systems, clusters in the cloud, and supercomputers. ACME reduces the extraction time for an exact-length query from 4 hours to 7 minutes on a typical workstation; handles 3 orders of magnitude longer sequences; and scales up to 16, 384 cores on a supercomputer. Copyright is held by the owner/author(s).

  19. Enhanced Dynamic Algorithm of Genome Sequence Alignments

    OpenAIRE

    Arabi E. keshk

    2014-01-01

    The merging of biology and computer science has created a new field called computational biology that explore the capacities of computers to gain knowledge from biological data, bioinformatics. Computational biology is rooted in life sciences as well as computers, information sciences, and technologies. The main problem in computational biology is sequence alignment that is a way of arranging the sequences of DNA, RNA or protein to identify the region of similarity and relationship between se...

  20. Trace maps of general substitutional sequences

    International Nuclear Information System (INIS)

    Kolar, M.; Nori, F.

    1990-01-01

    It is shown that for arbitrary n, there exists a trace map for any n-letter substitutional sequence. Trace maps are explicitly obtained for the well-known circle and Rudin-Shapiro sequences which can be defined by means of substitution rules on three and four letters, respectively. The properties of the two trace maps and their consequences for various spectral properties are briefly discussed

  1. Human Chromosome 7: DNA Sequence and Biology

    OpenAIRE

    Scherer, Stephen W.; Cheung, Joseph; MacDonald, Jeffrey R.; Osborne, Lucy R.; Nakabayashi, Kazuhiko; Herbrick, Jo-Anne; Carson, Andrew R.; Parker-Katiraee, Layla; Skaug, Jennifer; Khaja, Razi; Zhang, Junjun; Hudek, Alexander K.; Li, Martin; Haddad, May; Duggan, Gavin E.

    2003-01-01

    DNA sequence and annotation of the entire human chromosome 7, encompassing nearly 158 million nucleotides of DNA and 1917 gene structures, are presented. To generate a higher order description, additional structural features such as imprinted genes, fragile sites, and segmental duplications were integrated at the level of the DNA sequence with medical genetic data, including 440 chromosome rearrangement breakpoints associated with disease. This approach enabled the discovery of candidate gene...

  2. DESCRIPTION OF THE RHIC SEQUENCER SYSTEM

    International Nuclear Information System (INIS)

    DOTTAVIO, T.; FRAK, B.; MORRIS, J.; SATOGATA, T.; VAN ZEIJTS, J.

    2001-01-01

    The movement of the Relativistic Heavy Ion Collider (RHIC) through its various states (eg. injection, acceleration, storage, collisions) is controlled by an application called the Sequencer. This program orchestrates most magnet and instrumentation systems and is responsible for the coordinated acquisition and saving of data from various systems. The Sequencer system, its software infrastructure, support programs, and the language used to drive it are discussed in this paper. Initial operational experience is also described

  3. Complete Genome Sequence of Ikoma Lyssavirus

    OpenAIRE

    Marston, Denise A.; Ellis, Richard J.; Horton, Daniel L.; Kuzmin, Ivan V.; Wise, Emma L.; McElhinney, Lorraine M.; Banyard, Ashley C.; Ngeleja, Chanasa; Keyyu, Julius; Cleaveland, Sarah; Lembo, Tiziana; Rupprecht, Charles E.; Fooks, Anthony R.

    2012-01-01

    Lyssaviruses (family Rhabdoviridae) constitute one of the most important groups of viral zoonoses globally. All lyssaviruses cause the disease rabies, an acute progressive encephalitis for which, once symptoms occur, there is no effective cure. Currently available vaccines are highly protective against the predominantly circulating lyssavirus species. Using next-generation sequencing technologies, we have obtained the whole-genome sequence for a novel lyssavirus, Ikoma lyssavirus (IKOV), isol...

  4. Chromatid interchanges at intrachromosomal telomeric DNA sequences

    International Nuclear Information System (INIS)

    Fernandez, J.L.; Vazquez-Gundin, F.; Bilbao, A.; Gosalvez, J.; Goyanes, V.

    1997-01-01

    Chinese hamster Don cells were exposed to X-rays, mitomycin C and teniposide (VM-26) to induce chromatid exchanges (quadriradials and triradials). After fluorescence in situ hybridization (FISH) of telomere sequences it was found that interstitial telomere-like DNA sequence arrays presented around five times more breakage-rearrangements than the genome overall. This high recombinogenic capacity was independent of the clastogen, suggesting that this susceptibility is not related to the initial mechanisms of DNA damage. (author)

  5. On statistical acceleration convergence of double sequences

    Directory of Open Access Journals (Sweden)

    Bipan Hazarika

    2017-04-01

    Full Text Available In this article the notion of statistical acceleration convergence of double sequences in Pringsheim's sense has been introduced. We prove the decompostion theorems for  statistical acceleration convergence of double sequences and some theorems related to that concept have been established using the four dimensional matrix transformations. We provided some examples, where the results of acceleration convergence fails to hold for the statistical cases.

  6. Filovirus Glycoprotein Sequence, Structure and Virulence

    OpenAIRE

    Phillips, J. C.

    2014-01-01

    Leading Ebola subtypes exhibit a wide mortality range, here explained at the molecular level by using fractal hydropathic scaling of amino acid sequences based on protein self-organized criticality. Specific hydrophobic features in the hydrophilic mucin-like domain suffice to account for the wide mortality range. Significance statement: Ebola virus is spreading rapidly in Africa. The connection between protein amino acid sequence and mortality is identified here.

  7. Aspects of coverage in medical DNA sequencing

    Directory of Open Access Journals (Sweden)

    Wilson Richard K

    2008-05-01

    Full Text Available Abstract Background DNA sequencing is now emerging as an important component in biomedical studies of diseases like cancer. Short-read, highly parallel sequencing instruments are expected to be used heavily for such projects, but many design specifications have yet to be conclusively established. Perhaps the most fundamental of these is the redundancy required to detect sequence variations, which bears directly upon genomic coverage and the consequent resolving power for discerning somatic mutations. Results We address the medical sequencing coverage problem via an extension of the standard mathematical theory of haploid coverage. The expected diploid multi-fold coverage, as well as its generalization for aneuploidy are derived and these expressions can be readily evaluated for any project. The resulting theory is used as a scaling law to calibrate performance to that of standard BAC sequencing at 8× to 10× redundancy, i.e. for expected coverages that exceed 99% of the unique sequence. A differential strategy is formalized for tumor/normal studies wherein tumor samples are sequenced more deeply than normal ones. In particular, both tumor alleles should be detected at least twice, while both normal alleles are detected at least once. Our theory predicts these requirements can be met for tumor and normal redundancies of approximately 26× and 21×, respectively. We explain why these values do not differ by a factor of 2, as might intuitively be expected. Future technology developments should prompt even deeper sequencing of tumors, but the 21× value for normal samples is essentially a constant. Conclusion Given the assumptions of standard coverage theory, our model gives pragmatic estimates for required redundancy. The differential strategy should be an efficient means of identifying potential somatic mutations for further study.

  8. Determinant Representations of Sequences: A Survey

    Directory of Open Access Journals (Sweden)

    Moghaddamfar A. R.

    2014-01-01

    Full Text Available This is a survey of recent results concerning (integer matrices whose leading principal minors are well-known sequences such as Fibonacci, Lucas, Jacobsthal and Pell (subsequences. There are different ways for constructing such matrices. Some of these matrices are constructed by homogeneous or nonhomogeneous recurrence relations, and others are constructed by convolution of two sequences. In this article, we will illustrate the idea of these methods by constructing some integer matrices of this type.

  9. Normal form theory and spectral sequences

    OpenAIRE

    Sanders, Jan A.

    2003-01-01

    The concept of unique normal form is formulated in terms of a spectral sequence. As an illustration of this technique some results of Baider and Churchill concerning the normal form of the anharmonic oscillator are reproduced. The aim of this paper is to show that spectral sequences give us a natural framework in which to formulate normal form theory. © 2003 Elsevier Science (USA). All rights reserved.

  10. Bunches of random cross-correlated sequences

    International Nuclear Information System (INIS)

    Maystrenko, A A; Melnik, S S; Pritula, G M; Usatenko, O V

    2013-01-01

    The statistical properties of random cross-correlated sequences constructed by the convolution method (likewise referred to as the Rice or the inverse Fourier transformation) are examined. We clarify the meaning of the filtering function—the kernel of the convolution operator—and show that it is the value of the cross-correlation function which describes correlations between the initial white noise and constructed correlated sequences. The matrix generalization of this method for constructing a bunch of N cross-correlated sequences is presented. Algorithms for their generation are reduced to solving the problem of decomposition of the Fourier transform of the correlation matrix into a product of two mutually conjugate matrices. Different decompositions are considered. The limits of weak and strong correlations for the one-point probability and pair correlation functions of sequences generated by the method under consideration are studied. Special cases of heavy-tailed distributions of the generated sequences are analyzed. We show that, if the filtering function is rather smooth, the distribution function of generated variables has the Gaussian or Lévy form depending on the analytical properties of the distribution (or characteristic) functions of the initial white noise. Anisotropic properties of statistically homogeneous random sequences related to the asymmetry of a filtering function are revealed and studied. These asymmetry properties are expressed in terms of the third- or fourth-order correlation functions. Several examples of the construction of correlated chains with a predefined correlation matrix are given. (paper)

  11. Leaf sequencing algorithms for segmented multileaf collimation

    International Nuclear Information System (INIS)

    Kamath, Srijit; Sahni, Sartaj; Li, Jonathan; Palta, Jatinder; Ranka, Sanjay

    2003-01-01

    The delivery of intensity-modulated radiation therapy (IMRT) with a multileaf collimator (MLC) requires the conversion of a radiation fluence map into a leaf sequence file that controls the movement of the MLC during radiation delivery. It is imperative that the fluence map delivered using the leaf sequence file is as close as possible to the fluence map generated by the dose optimization algorithm, while satisfying hardware constraints of the delivery system. Optimization of the leaf sequencing algorithm has been the subject of several recent investigations. In this work, we present a systematic study of the optimization of leaf sequencing algorithms for segmental multileaf collimator beam delivery and provide rigorous mathematical proofs of optimized leaf sequence settings in terms of monitor unit (MU) efficiency under most common leaf movement constraints that include minimum leaf separation constraint and leaf interdigitation constraint. Our analytical analysis shows that leaf sequencing based on unidirectional movement of the MLC leaves is as MU efficient as bidirectional movement of the MLC leaves

  12. Leaf sequencing algorithms for segmented multileaf collimation

    Energy Technology Data Exchange (ETDEWEB)

    Kamath, Srijit [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States); Sahni, Sartaj [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States); Li, Jonathan [Department of Radiation Oncology, University of Florida, Gainesville, FL (United States); Palta, Jatinder [Department of Radiation Oncology, University of Florida, Gainesville, FL (United States); Ranka, Sanjay [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States)

    2003-02-07

    The delivery of intensity-modulated radiation therapy (IMRT) with a multileaf collimator (MLC) requires the conversion of a radiation fluence map into a leaf sequence file that controls the movement of the MLC during radiation delivery. It is imperative that the fluence map delivered using the leaf sequence file is as close as possible to the fluence map generated by the dose optimization algorithm, while satisfying hardware constraints of the delivery system. Optimization of the leaf sequencing algorithm has been the subject of several recent investigations. In this work, we present a systematic study of the optimization of leaf sequencing algorithms for segmental multileaf collimator beam delivery and provide rigorous mathematical proofs of optimized leaf sequence settings in terms of monitor unit (MU) efficiency under most common leaf movement constraints that include minimum leaf separation constraint and leaf interdigitation constraint. Our analytical analysis shows that leaf sequencing based on unidirectional movement of the MLC leaves is as MU efficient as bidirectional movement of the MLC leaves.

  13. A neurocomputational model of automatic sequence production.

    Science.gov (United States)

    Helie, Sebastien; Roeder, Jessica L; Vucovich, Lauren; Rünger, Dennis; Ashby, F Gregory

    2015-07-01

    Most behaviors unfold in time and include a sequence of submovements or cognitive activities. In addition, most behaviors are automatic and repeated daily throughout life. Yet, relatively little is known about the neurobiology of automatic sequence production. Past research suggests a gradual transfer from the associative striatum to the sensorimotor striatum, but a number of more recent studies challenge this role of the BG in automatic sequence production. In this article, we propose a new neurocomputational model of automatic sequence production in which the main role of the BG is to train cortical-cortical connections within the premotor areas that are responsible for automatic sequence production. The new model is used to simulate four different data sets from human and nonhuman animals, including (1) behavioral data (e.g., RTs), (2) electrophysiology data (e.g., single-neuron recordings), (3) macrostructure data (e.g., TMS), and (4) neurological circuit data (e.g., inactivation studies). We conclude with a comparison of the new model with existing models of automatic sequence production and discuss a possible new role for the BG in automaticity and its implication for Parkinson's disease.

  14. A Unified Theoretical Framework for Cognitive Sequencing.

    Science.gov (United States)

    Savalia, Tejas; Shukla, Anuj; Bapi, Raju S

    2016-01-01

    The capacity to sequence information is central to human performance. Sequencing ability forms the foundation stone for higher order cognition related to language and goal-directed planning. Information related to the order of items, their timing, chunking and hierarchical organization are important aspects in sequencing. Past research on sequencing has emphasized two distinct and independent dichotomies: implicit vs. explicit and goal-directed vs. habits. We propose a theoretical framework unifying these two streams. Our proposal relies on brain's ability to implicitly extract statistical regularities from the stream of stimuli and with attentional engagement organizing sequences explicitly and hierarchically. Similarly, sequences that need to be assembled purposively to accomplish a goal require engagement of attentional processes. With repetition, these goal-directed plans become habits with concomitant disengagement of attention. Thus, attention and awareness play a crucial role in the implicit-to-explicit transition as well as in how goal-directed plans become automatic habits. Cortico-subcortical loops basal ganglia-frontal cortex and hippocampus-frontal cortex loops mediate the transition process. We show how the computational principles of model-free and model-based learning paradigms, along with a pivotal role for attention and awareness, offer a unifying framework for these two dichotomies. Based on this framework, we make testable predictions related to the potential influence of response-to-stimulus interval (RSI) on developing awareness in implicit learning tasks.

  15. A Unified Theoretical Framework for Cognitive Sequencing

    Directory of Open Access Journals (Sweden)

    Tejas Savalia

    2016-11-01

    Full Text Available The capacity to sequence information is central to human performance. Sequencing ability forms the foundation stone for higher order cognition related to language and goal-directed planning. Information related to the order of items, their timing, chunking and hierarchical organization are important aspects in sequencing. Past research on sequencing has emphasized two distinct and independent dichotomies: implicit versus explicit and goal-directed versus habits. We propose a theoretical framework unifying these two streams. Our proposal relies on brain's ability to implicitly extract statistical regularities from the stream of stimuli and with attentional engagement organizing sequences explicitly and hierarchically. Similarly, sequences that need to be assembled purposively to accomplish a goal require engagement of attentional processes. With repetition, these goal-directed plans become habits with concomitant disengagement of attention. Thus attention and awareness play a crucial role in the implicit-to-explicit transition as well as in how goal-directed plans become automatic habits. Cortico-subcortical loops ─ basal ganglia-frontal cortex and hippocampus-frontal cortex loops ─ mediate the transition process. We show how the computational principles of model-free and model-based learning paradigms, along with a pivotal role for attention and awareness, offer a unifying framework for these two dichotomies. Based on this framework, we make testable predictions related to the potential influence of response-to-stimulus interval (RSI on developing awareness in implicit learning tasks.

  16. Sequence determinants of human microsatellite variability

    Directory of Open Access Journals (Sweden)

    Jakobsson Mattias

    2009-12-01

    Full Text Available Abstract Background Microsatellite loci are frequently used in genomic studies of DNA sequence repeats and in population studies of genetic variability. To investigate the effect of sequence properties of microsatellites on their level of variability we have analyzed genotypes at 627 microsatellite loci in 1,048 worldwide individuals from the HGDP-CEPH cell line panel together with the DNA sequences of these microsatellites in the human RefSeq database. Results Calibrating PCR fragment lengths in individual genotypes by using the RefSeq sequence enabled us to infer repeat number in the HGDP-CEPH dataset and to calculate the mean number of repeats (as opposed to the mean PCR fragment length, under the assumption that differences in PCR fragment length reflect differences in the numbers of repeats in the embedded repeat sequences. We find the mean and maximum numbers of repeats across individuals to be positively correlated with heterozygosity. The size and composition of the repeat unit of a microsatellite are also important factors in predicting heterozygosity, with tetra-nucleotide repeat units high in G/C content leading to higher heterozygosity. Finally, we find that microsatellites containing more separate sets of repeated motifs generally have higher heterozygosity. Conclusions These results suggest that sequence properties of microsatellites have a significant impact in determining the features of human microsatellite variability.

  17. Sequence comparison and phylogenetic analysis of core gene of ...

    African Journals Online (AJOL)

    Phylogenetic analysis suggests that our sequences are clustered with sequences reported from Japan. This is the first phylogenetic analysis of HCV core gene from Pakistani population. Our sequences and sequences from Japan are grouped into same cluster in the phylogenetic tree. Sequence comparison and ...

  18. Synaptotagmin gene content of the sequenced genomes

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2004-07-01

    Full Text Available Abstract Background Synaptotagmins exist as a large gene family in mammals. There is much interest in the function of certain family members which act crucially in the regulated synaptic vesicle exocytosis required for efficient neurotransmission. Knowledge of the functions of other family members is relatively poor and the presence of Synaptotagmin genes in plants indicates a role for the family as a whole which is wider than neurotransmission. Identification of the Synaptotagmin genes within completely sequenced genomes can provide the entire Synaptotagmin gene complement of each sequenced organism. Defining the detailed structures of all the Synaptotagmin genes and their encoded products can provide a useful resource for functional studies and a deeper understanding of the evolution of the gene family. The current rapid increase in the number of sequenced genomes from different branches of the tree of life, together with the public deposition of evolutionarily diverse transcript sequences make such studies worthwhile. Results I have compiled a detailed list of the Synaptotagmin genes of Caenorhabditis, Anopheles, Drosophila, Ciona, Danio, Fugu, Mus, Homo, Arabidopsis and Oryza by examining genomic and transcript sequences from public sequence databases together with some transcript sequences obtained by cDNA library screening and RT-PCR. I have compared all of the genes and investigated the relationship between plant Synaptotagmins and their non-Synaptotagmin counterparts. Conclusions I have identified and compared 98 Synaptotagmin genes from 10 sequenced genomes. Detailed comparison of transcript sequences reveals abundant and complex variation in Synaptotagmin gene expression and indicates the presence of Synaptotagmin genes in all animals and land plants. Amino acid sequence comparisons indicate patterns of conservation and diversity in function. Phylogenetic analysis shows the origin of Synaptotagmins in multicellular eukaryotes and their

  19. PIMS sequencing extension: a laboratory information management system for DNA sequencing facilities

    Directory of Open Access Journals (Sweden)

    Baldwin Stephen A

    2011-03-01

    Full Text Available Abstract Background Facilities that provide a service for DNA sequencing typically support large numbers of users and experiment types. The cost of services is often reduced by the use of liquid handling robots but the efficiency of such facilities is hampered because the software for such robots does not usually integrate well with the systems that run the sequencing machines. Accordingly, there is a need for software systems capable of integrating different robotic systems and managing sample information for DNA sequencing services. In this paper, we describe an extension to the Protein Information Management System (PIMS that is designed for DNA sequencing facilities. The new version of PIMS has a user-friendly web interface and integrates all aspects of the sequencing process, including sample submission, handling and tracking, together with capture and management of the data. Results The PIMS sequencing extension has been in production since July 2009 at the University of Leeds DNA Sequencing Facility. It has completely replaced manual data handling and simplified the tasks of data management and user communication. Samples from 45 groups have been processed with an average throughput of 10000 samples per month. The current version of the PIMS sequencing extension works with Applied Biosystems 3130XL 96-well plate sequencer and MWG 4204 or Aviso Theonyx liquid handling robots, but is readily adaptable for use with other combinations of robots. Conclusions PIMS has been extended to provide a user-friendly and integrated data management solution for DNA sequencing facilities that is accessed through a normal web browser and allows simultaneous access by multiple users as well as facility managers. The system integrates sequencing and liquid handling robots, manages the data flow, and provides remote access to the sequencing results. The software is freely available, for academic users, from http://www.pims-lims.org/.

  20. PIMS sequencing extension: a laboratory information management system for DNA sequencing facilities.

    Science.gov (United States)

    Troshin, Peter V; Postis, Vincent Lg; Ashworth, Denise; Baldwin, Stephen A; McPherson, Michael J; Barton, Geoffrey J

    2011-03-07

    Facilities that provide a service for DNA sequencing typically support large numbers of users and experiment types. The cost of services is often reduced by the use of liquid handling robots but the efficiency of such facilities is hampered because the software for such robots does not usually integrate well with the systems that run the sequencing machines. Accordingly, there is a need for software systems capable of integrating different robotic systems and managing sample information for DNA sequencing services. In this paper, we describe an extension to the Protein Information Management System (PIMS) that is designed for DNA sequencing facilities. The new version of PIMS has a user-friendly web interface and integrates all aspects of the sequencing process, including sample submission, handling and tracking, together with capture and management of the data. The PIMS sequencing extension has been in production since July 2009 at the University of Leeds DNA Sequencing Facility. It has completely replaced manual data handling and simplified the tasks of data management and user communication. Samples from 45 groups have been processed with an average throughput of 10000 samples per month. The current version of the PIMS sequencing extension works with Applied Biosystems 3130XL 96-well plate sequencer and MWG 4204 or Aviso Theonyx liquid handling robots, but is readily adaptable for use with other combinations of robots. PIMS has been extended to provide a user-friendly and integrated data management solution for DNA sequencing facilities that is accessed through a normal web browser and allows simultaneous access by multiple users as well as facility managers. The system integrates sequencing and liquid handling robots, manages the data flow, and provides remote access to the sequencing results. The software is freely available, for academic users, from http://www.pims-lims.org/.

  1. Bellerophon: a program to detect chimeric sequences in multiple sequence alignments.

    Science.gov (United States)

    Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

    2004-09-22

    Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments. Bellerophon is available as an interactive web server at http://foo.maths.uq.edu.au/~huber/bellerophon.pl

  2. Clinical evaluation of further-developed MRCP sequences in comparison with standard MRCP sequences

    International Nuclear Information System (INIS)

    Hundt, W.; Scheidler, J.; Reiser, M.; Petsch, R.

    2002-01-01

    The purpose of this study was the comparison of technically improved single-shot magnetic resonance cholangiopancreatography (MRCP) sequences with standard single-shot rapid acquisition with relaxation enhancement (RARE) and half-Fourier acquired single-shot turbo spin-echo (HASTE) sequences in evaluating the normal and abnormal biliary duct system. The bile duct system of 45 patients was prospectively investigated on a 1.5-T MRI system. The investigation was performed with RARE and HASTE MR cholangiography sequences with standard and high spatial resolutions, and with a delayed-echo half-Fourier RARE (HASTE) sequence. Findings of the improved MRCP sequences were compared with the standard MRCP sequences. The level of confidence in assessing the diagnosis was divided into five groups. The Wilcoxon signed-rank test at a level of p<0.05 was applied. In 15 patients no pathology was found. The MRCP showed stenoses of the bile duct system in 10 patients and choledocholithiasis and cholecystolithiasis in 16 patients. In 12 patients a dilatation of the bile duct system was found. Comparison of the low- and high spatial resolution sequences and the short and long TE times of the half-Fourier RARE (HASTE) sequence revealed no statistically significant differences regarding accuracy of the examination. The diagnostic confidence level in assessing normal or pathological findings for the high-resolution RARE and half-Fourier RARE (HASTE) was significantly better than for the standard sequences. For the delayed-echo half-Fourier RARE (HASTE) sequence no statistically significant difference was seen. The high-resolution RARE and half-Fourier RARE (HASTE) sequences had a higher confidence level, but there was no significant difference in diagnosis in terms of detection and assessment of pathological changes in the biliary duct system compared with standard sequences. (orig.)

  3. Preliminary hazard analysis using sequence tree method

    International Nuclear Information System (INIS)

    Huang Huiwen; Shih Chunkuan; Hung Hungchih; Chen Minghuei; Yih Swu; Lin Jiinming

    2007-01-01

    A system level PHA using sequence tree method was developed to perform Safety Related digital I and C system SSA. The conventional PHA is a brainstorming session among experts on various portions of the system to identify hazards through discussions. However, this conventional PHA is not a systematic technique, the analysis results strongly depend on the experts' subjective opinions. The analysis quality cannot be appropriately controlled. Thereby, this research developed a system level sequence tree based PHA, which can clarify the relationship among the major digital I and C systems. Two major phases are included in this sequence tree based technique. The first phase uses a table to analyze each event in SAR Chapter 15 for a specific safety related I and C system, such as RPS. The second phase uses sequence tree to recognize what I and C systems are involved in the event, how the safety related systems work, and how the backup systems can be activated to mitigate the consequence if the primary safety systems fail. In the sequence tree, the defense-in-depth echelons, including Control echelon, Reactor trip echelon, ESFAS echelon, and Indication and display echelon, are arranged to construct the sequence tree structure. All the related I and C systems, include digital system and the analog back-up systems are allocated in their specific echelon. By this system centric sequence tree based analysis, not only preliminary hazard can be identified systematically, the vulnerability of the nuclear power plant can also be recognized. Therefore, an effective simplified D3 evaluation can be performed as well. (author)

  4. Inverted temperature sequences: role of deformation partitioning

    Science.gov (United States)

    Grujic, D.; Ashley, K. T.; Coble, M. A.; Coutand, I.; Kellett, D.; Whynot, N.

    2015-12-01

    The inverted metamorphism associated with the Main Central thrust zone in the Himalaya has been historically attributed to a number of tectonic processes. Here we show that there is actually a composite peak and deformation temperature sequence that formed in succession via different tectonic processes. The deformation partitioning seems to the have played a key role, and the magnitude of each process has varied along strike of the orogen. To explain the formation of the inverted metamorphic sequence across the Lesser Himalayan Sequence (LHS) in eastern Bhutan, we used Raman spectroscopy of carbonaceous material (RSCM) to determine the peak metamorphic temperatures and Ti-in-quartz thermobarometry to determine the deformation temperatures combined with thermochronology including published apatite and zircon U-Th/He and fission-track data and new 40Ar/39Ar dating of muscovite. The dataset was inverted using 3D-thermal-kinematic modeling to constrain the ranges of geological parameters such as fault geometry and slip rates, location and rates of localized basal accretion, and thermal properties of the crust. RSCM results indicate that there are two peak temperature sequences separated by a major thrust within the LHS. The internal temperature sequence shows an inverted peak temperature gradient of 12 °C/km; in the external (southern) sequence, the peak temperatures are constant across the structural sequence. Thermo-kinematic modeling suggest that the thermochronologic and thermobarometric data are compatible with a two-stage scenario: an Early-Middle Miocene phase of fast overthrusting of a hot hanging wall over a downgoing footwall and inversion of the synkinematic isotherms, followed by the formation of the external duplex developed by dominant underthrusting and basal accretion. To reconcile our observations with the experimental data, we suggest that pervasive ductile deformation within the upper LHS and along the Main Central thrust zone at its top stopped at

  5. Mixed Sequence Reader: A Program for Analyzing DNA Sequences with Heterozygous Base Calling

    Science.gov (United States)

    Chang, Chun-Tien; Tsai, Chi-Neu; Tang, Chuan Yi; Chen, Chun-Houh; Lian, Jang-Hau; Hu, Chi-Yu; Tsai, Chia-Lung; Chao, Angel; Lai, Chyong-Huey; Wang, Tzu-Hao; Lee, Yun-Shien

    2012-01-01

    The direct sequencing of PCR products generates heterozygous base-calling fluorescence chromatograms that are useful for identifying single-nucleotide polymorphisms (SNPs), insertion-deletions (indels), short tandem repeats (STRs), and paralogous genes. Indels and STRs can be easily detected using the currently available Indelligent or ShiftDetector programs, which do not search reference sequences. However, the detection of other genomic variants remains a challenge due to the lack of appropriate tools for heterozygous base-calling fluorescence chromatogram data analysis. In this study, we developed a free web-based program, Mixed Sequence Reader (MSR), which can directly analyze heterozygous base-calling fluorescence chromatogram data in .abi file format using comparisons with reference sequences. The heterozygous sequences are identified as two distinct sequences and aligned with reference sequences. Our results showed that MSR may be used to (i) physically locate indel and STR sequences and determine STR copy number by searching NCBI reference sequences; (ii) predict combinations of microsatellite patterns using the Federal Bureau of Investigation Combined DNA Index System (CODIS); (iii) determine human papilloma virus (HPV) genotypes by searching current viral databases in cases of double infections; (iv) estimate the copy number of paralogous genes, such as β-defensin 4 (DEFB4) and its paralog HSPDP3. PMID:22778697

  6. Enrichment of target sequences for next-generation sequencing applications in research and diagnostics.

    Science.gov (United States)

    Altmüller, Janine; Budde, Birgit S; Nürnberg, Peter

    2014-02-01

    Abstract Targeted re-sequencing such as gene panel sequencing (GPS) has become very popular in medical genetics, both for research projects and in diagnostic settings. The technical principles of the different enrichment methods have been reviewed several times before; however, new enrichment products are constantly entering the market, and researchers are often puzzled about the requirement to take decisions about long-term commitments, both for the enrichment product and the sequencing technology. This review summarizes important considerations for the experimental design and provides helpful recommendations in choosing the best sequencing strategy for various research projects and diagnostic applications.

  7. Detection of M-Sequences from Spike Sequence in Neuronal Networks

    Directory of Open Access Journals (Sweden)

    Yoshi Nishitani

    2012-01-01

    Full Text Available In circuit theory, it is well known that a linear feedback shift register (LFSR circuit generates pseudorandom bit sequences (PRBS, including an M-sequence with the maximum period of length. In this study, we tried to detect M-sequences known as a pseudorandom sequence generated by the LFSR circuit from time series patterns of stimulated action potentials. Stimulated action potentials were recorded from dissociated cultures of hippocampal neurons grown on a multielectrode array. We could find several M-sequences from a 3-stage LFSR circuit (M3. These results show the possibility of assembling LFSR circuits or its equivalent ones in a neuronal network. However, since the M3 pattern was composed of only four spike intervals, the possibility of an accidental detection was not zero. Then, we detected M-sequences from random spike sequences which were not generated from an LFSR circuit and compare the result with the number of M-sequences from the originally observed raster data. As a result, a significant difference was confirmed: a greater number of “0–1” reversed the 3-stage M-sequences occurred than would have accidentally be detected. This result suggests that some LFSR equivalent circuits are assembled in neuronal networks.

  8. A safe an easy method for building consensus HIV sequences from 454 massively parallel sequencing data.

    Science.gov (United States)

    Fernández-Caballero Rico, Jose Ángel; Chueca Porcuna, Natalia; Álvarez Estévez, Marta; Mosquera Gutiérrez, María Del Mar; Marcos Maeso, María Ángeles; García, Federico

    2018-02-01

    To show how to generate a consensus sequence from the information of massive parallel sequences data obtained from routine HIV anti-retroviral resistance studies, and that may be suitable for molecular epidemiology studies. Paired Sanger (Trugene-Siemens) and next-generation sequencing (NGS) (454 GSJunior-Roche) HIV RT and protease sequences from 62 patients were studied. NGS consensus sequences were generated using Mesquite, using 10%, 15%, and 20% thresholds. Molecular evolutionary genetics analysis (MEGA) was used for phylogenetic studies. At a 10% threshold, NGS-Sanger sequences from 17/62 patients were phylogenetically related, with a median bootstrap-value of 88% (IQR83.5-95.5). Association increased to 36/62 sequences, median bootstrap 94% (IQR85.5-98)], using a 15% threshold. Maximum association was at the 20% threshold, with 61/62 sequences associated, and a median bootstrap value of 99% (IQR98-100). A safe method is presented to generate consensus sequences from HIV-NGS data at 20% threshold, which will prove useful for molecular epidemiological studies. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  9. Sequencing of BAC pools by different next generation sequencing platforms and strategies

    Directory of Open Access Journals (Sweden)

    Scholz Uwe

    2011-10-01

    Full Text Available Abstract Background Next generation sequencing of BACs is a viable option for deciphering the sequence of even large and highly repetitive genomes. In order to optimize this strategy, we examined the influence of read length on the quality of Roche/454 sequence assemblies, to what extent Illumina/Solexa mate pairs (MPs improve the assemblies by scaffolding and whether barcoding of BACs is dispensable. Results Sequencing four BACs with both FLX and Titanium technologies revealed similar sequencing accuracy, but showed that the longer Titanium reads produce considerably less misassemblies and gaps. The 454 assemblies of 96 barcoded BACs were improved by scaffolding 79% of the total contig length with MPs from a non-barcoded library. Assembly of the unmasked 454 sequences without separation by barcodes revealed chimeric contig formation to be a major problem, encompassing 47% of the total contig length. Masking the sequences reduced this fraction to 24%. Conclusion Optimal BAC pool sequencing should be based on the longest available reads, with barcoding essential for a comprehensive assessment of both repetitive and non-repetitive sequence information. When interest is restricted to non-repetitive regions and repeats are masked prior to assembly, barcoding is non-essential. In any case, the assemblies can be improved considerably by scaffolding with non-barcoded BAC pool MPs.

  10. Sequence comparison and phylogenetic analysis of core gene of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-07-19

    Jul 19, 2010 ... and antisense primers, a single band of 573 base pairs .... Amino acid sequence alignment of Cluster I and Cluster II of phylogenetic tree. First ten sequences ... sequence weighting, postion-spiecific gap penalties and weight.

  11. Axioms for behavioural congruence of single-pass instruction sequences

    NARCIS (Netherlands)

    Bergstra, J.A.; Middelburg, C.A.

    2017-01-01

    In program algebra, an algebraic theory of single-pass instruction sequences, three congruences on instruction sequences are paid attention to: instruction sequence congruence, structural congruence, and behavioural congruence. Sound and complete axiom systems for the first two congruences were

  12. Tournaments, oriented graphs and football sequences

    Directory of Open Access Journals (Sweden)

    Pirzada S.

    2017-08-01

    Full Text Available Consider the result of a soccer league competition where n teams play each other exactly once. A team gets three points for each win and one point for each draw. The total score obtained by each team vi is called the f-score of vi and is denoted by fi. The sequences of all f-scores [fi]i=1n$\\left[ {{\\rm{f}}_{\\rm{i}} } \\right]_{{\\rm{i}} = 1}^{\\rm{n}} $ arranged in non-decreasing order is called the f-score sequence of the competition. We raise the following problem: Which sequences of non-negative integers in non-decreasing order is a football sequence, that is the outcome of a soccer league competition. We model such a competition by an oriented graph with teams represented by vertices in which the teams play each other once, with an arc from team u to team v if and only if u defeats v. We obtain some necessary conditions for football sequences and some characterizations under restrictions.

  13. SNAD: sequence name annotation-based designer

    Directory of Open Access Journals (Sweden)

    Gorbalenya Alexander E

    2009-08-01

    Full Text Available Abstract Background A growing diversity of biological data is tagged with unique identifiers (UIDs associated with polynucleotides and proteins to ensure efficient computer-mediated data storage, maintenance, and processing. These identifiers, which are not informative for most people, are often substituted by biologically meaningful names in various presentations to facilitate utilization and dissemination of sequence-based knowledge. This substitution is commonly done manually that may be a tedious exercise prone to mistakes and omissions. Results Here we introduce SNAD (Sequence Name Annotation-based Designer that mediates automatic conversion of sequence UIDs (associated with multiple alignment or phylogenetic tree, or supplied as plain text list into biologically meaningful names and acronyms. This conversion is directed by precompiled or user-defined templates that exploit wealth of annotation available in cognate entries of external databases. Using examples, we demonstrate how this tool can be used to generate names for practical purposes, particularly in virology. Conclusion A tool for controllable annotation-based conversion of sequence UIDs into biologically meaningful names and acronyms has been developed and placed into service, fostering links between quality of sequence annotation, and efficiency of communication and knowledge dissemination among researchers.

  14. Variable depth recursion algorithm for leaf sequencing

    International Nuclear Information System (INIS)

    Siochi, R. Alfredo C.

    2007-01-01

    The processes of extraction and sweep are basic segmentation steps that are used in leaf sequencing algorithms. A modified version of a commercial leaf sequencer changed the way that the extracts are selected and expanded the search space, but the modification maintained the basic search paradigm of evaluating multiple solutions, each one consisting of up to 12 extracts and a sweep sequence. While it generated the best solutions compared to other published algorithms, it used more computation time. A new, faster algorithm selects one extract at a time but calls itself as an evaluation function a user-specified number of times, after which it uses the bidirectional sweeping window algorithm as the final evaluation function. To achieve a performance comparable to that of the modified commercial leaf sequencer, 2-3 calls were needed, and in all test cases, there were only slight improvements beyond two calls. For the 13 clinical test maps, computation speeds improved by a factor between 12 and 43, depending on the constraints, namely the ability to interdigitate and the avoidance of the tongue-and-groove under dose. The new algorithm was compared to the original and modified versions of the commercial leaf sequencer. It was also compared to other published algorithms for 1400, random, 15x15, test maps with 3-16 intensity levels. In every single case the new algorithm provided the best solution

  15. Modeling of prepregs during automated draping sequences

    Science.gov (United States)

    Krogh, Christian; Glud, Jens A.; Jakobsen, Johnny

    2017-10-01

    The behavior of wowen prepreg fabric during automated draping sequences is investigated. A drape tool under development with an arrangement of grippers facilitates the placement of a woven prepreg fabric in a mold. It is essential that the draped configuration is free from wrinkles and other defects. The present study aims at setting up a virtual draping framework capable of modeling the draping process from the initial flat fabric to the final double curved shape and aims at assisting the development of an automated drape tool. The virtual draping framework consists of a kinematic mapping algorithm used to generate target points on the mold which are used as input to a draping sequence planner. The draping sequence planner prescribes the displacement history for each gripper in the drape tool and these displacements are then applied to each gripper in a transient model of the draping sequence. The model is based on a transient finite element analysis with the material's constitutive behavior currently being approximated as linear elastic orthotropic. In-plane tensile and bias-extension tests as well as bending tests are conducted and used as input for the model. The virtual draping framework shows a good potential for obtaining a better understanding of the drape process and guide the development of the drape tool. However, results obtained from using the framework on a simple test case indicate that the generation of draping sequences is non-trivial.

  16. Extended sequence diagram for human system interaction

    International Nuclear Information System (INIS)

    Hwang, Jong Rok; Choi, Sun Woo; Ko, Hee Ran; Kim, Jong Hyun

    2012-01-01

    Unified Modeling Language (UML) is a modeling language in the field of object oriented software engineering. The sequence diagram is a kind of interaction diagram that shows how processes operate with one another and in what order. It is a construct of a message sequence chart. It depicts the objects and classes involved in the scenario and the sequence of messages exchanged between the objects needed to carry out the functionality of the scenario. This paper proposes the Extended Sequence Diagram (ESD), which is capable of depicting human system interaction for nuclear power plants, as well as cognitive process of operators analysis. In the conventional sequence diagram, there is a limit to only identify the activities of human and systems interactions. The ESD is extended to describe operators' cognitive process in more detail. The ESD is expected to be used as a task analysis method for describing human system interaction. The ESD can also present key steps causing abnormal operations or failures and diverse human errors based on cognitive condition

  17. Sequence analysis by iterated maps, a review.

    Science.gov (United States)

    Almeida, Jonas S

    2014-05-01

    Among alignment-free methods, Iterated Maps (IMs) are on a particular extreme: they are also scale free (order free). The use of IMs for sequence analysis is also distinct from other alignment-free methodologies in being rooted in statistical mechanics instead of computational linguistics. Both of these roots go back over two decades to the use of fractal geometry in the characterization of phase-space representations. The time series analysis origin of the field is betrayed by the title of the manuscript that started this alignment-free subdomain in 1990, 'Chaos Game Representation'. The clash between the analysis of sequences as continuous series and the better established use of Markovian approaches to discrete series was almost immediate, with a defining critique published in same journal 2 years later. The rest of that decade would go by before the scale-free nature of the IM space was uncovered. The ensuing decade saw this scalability generalized for non-genomic alphabets as well as an interest in its use for graphic representation of biological sequences. Finally, in the past couple of years, in step with the emergence of BigData and MapReduce as a new computational paradigm, there is a surprising third act in the IM story. Multiple reports have described gains in computational efficiency of multiple orders of magnitude over more conventional sequence analysis methodologies. The stage appears to be now set for a recasting of IMs with a central role in processing nextgen sequencing results.

  18. Harnessing Whole Genome Sequencing in Medical Mycology.

    Science.gov (United States)

    Cuomo, Christina A

    2017-01-01

    Comparative genome sequencing studies of human fungal pathogens enable identification of genes and variants associated with virulence and drug resistance. This review describes current approaches, resources, and advances in applying whole genome sequencing to study clinically important fungal pathogens. Genomes for some important fungal pathogens were only recently assembled, revealing gene family expansions in many species and extreme gene loss in one obligate species. The scale and scope of species sequenced is rapidly expanding, leveraging technological advances to assemble and annotate genomes with higher precision. By using iteratively improved reference assemblies or those generated de novo for new species, recent studies have compared the sequence of isolates representing populations or clinical cohorts. Whole genome approaches provide the resolution necessary for comparison of closely related isolates, for example, in the analysis of outbreaks or sampled across time within a single host. Genomic analysis of fungal pathogens has enabled both basic research and diagnostic studies. The increased scale of sequencing can be applied across populations, and new metagenomic methods allow direct analysis of complex samples.

  19. OTU analysis using metagenomic shotgun sequencing data.

    Directory of Open Access Journals (Sweden)

    Xiaolin Hao

    Full Text Available Because of technological limitations, the primer and amplification biases in targeted sequencing of 16S rRNA genes have veiled the true microbial diversity underlying environmental samples. However, the protocol of metagenomic shotgun sequencing provides 16S rRNA gene fragment data with natural immunity against the biases raised during priming and thus the potential of uncovering the true structure of microbial community by giving more accurate predictions of operational taxonomic units (OTUs. Nonetheless, the lack of statistically rigorous comparison between 16S rRNA gene fragments and other data types makes it difficult to interpret previously reported results using 16S rRNA gene fragments. Therefore, in the present work, we established a standard analysis pipeline that would help confirm if the differences in the data are true or are just due to potential technical bias. This pipeline is built by using simulated data to find optimal mapping and OTU prediction methods. The comparison between simulated datasets revealed a relationship between 16S rRNA gene fragments and full-length 16S rRNA sequences that a 16S rRNA gene fragment having a length >150 bp provides the same accuracy as a full-length 16S rRNA sequence using our proposed pipeline, which could serve as a good starting point for experimental design and making the comparison between 16S rRNA gene fragment-based and targeted 16S rRNA sequencing-based surveys possible.

  20. Attentional load and implicit sequence learning.

    Science.gov (United States)

    Shanks, David R; Rowland, Lee A; Ranger, Mandeep S

    2005-06-01

    A widely employed conceptualization of implicit learning hypothesizes that it makes minimal demands on attentional resources. This conjecture was investigated by comparing learning under single-task and dual-task conditions in the sequential reaction time (SRT) task. Participants learned probabilistic sequences, with dual-task participants additionally having to perform a counting task using stimuli that were targets in the SRT display. Both groups were then tested for sequence knowledge under single-task (Experiments 1 and 2) or dual-task (Experiment 3) conditions. Participants also completed a free generation task (Experiments 2 and 3) under inclusion or exclusion conditions to determine if sequence knowledge was conscious or unconscious in terms of its access to intentional control. The experiments revealed that the secondary task impaired sequence learning and that sequence knowledge was consciously accessible. These findings disconfirm both the notion that implicit learning is able to proceed normally under conditions of divided attention, and that the acquired knowledge is inaccessible to consciousness. A unitary framework for conceptualizing implicit and explicit learning is proposed.

  1. BLEACHING EUCALYPTUS PULPS WITH SHORT SEQUENCES

    Directory of Open Access Journals (Sweden)

    Flaviana Reis Milagres

    2011-03-01

    Full Text Available Eucalyptus spp kraft pulp, due to its high content of hexenuronic acids, is quite easy to bleach. Therefore, investigations have been made attempting to decrease the number of stages in the bleaching process in order to minimize capital costs. This study focused on the evaluation of short ECF (Elemental Chlorine Free and TCF (Totally Chlorine Free sequences for bleaching oxygen delignified Eucalyptus spp kraft pulp to 90% ISO brightness: PMoDP (Molybdenum catalyzed acid peroxide, chlorine dioxide and hydrogen peroxide, PMoD/P (Molybdenum catalyzed acid peroxide, chlorine dioxide and hydrogen peroxide, without washing PMoD(PO (Molybdenum catalyzed acid peroxide, chlorine dioxide and pressurized peroxide, D(EPODP (chlorine dioxide, extraction oxidative with oxygen and peroxide, chlorine dioxide and hydrogen peroxide, PMoQ(PO (Molybdenum catalyzed acid peroxide, DTPA and pressurized peroxide, and XPMoQ(PO (Enzyme, molybdenum catalyzed acid peroxide, DTPA and pressurized peroxide. Uncommon pulp treatments, such as molybdenum catalyzed acid peroxide (PMo and xylanase (X bleaching stages, were used. Among the ECF alternatives, the two-stage PMoD/P sequence proved highly cost-effective without affecting pulp quality in relation to the traditional D(EPODP sequence and produced better quality effluent in relation to the reference. However, a four stage sequence, XPMoQ(PO, was required to achieve full brightness using the TCF technology. This sequence was highly cost-effective although it only produced pulp of acceptable quality.

  2. Human Genome Sequencing in Health and Disease

    Science.gov (United States)

    Gonzaga-Jauregui, Claudia; Lupski, James R.; Gibbs, Richard A.

    2013-01-01

    Following the “finished,” euchromatic, haploid human reference genome sequence, the rapid development of novel, faster, and cheaper sequencing technologies is making possible the era of personalized human genomics. Personal diploid human genome sequences have been generated, and each has contributed to our better understanding of variation in the human genome. We have consequently begun to appreciate the vastness of individual genetic variation from single nucleotide to structural variants. Translation of genome-scale variation into medically useful information is, however, in its infancy. This review summarizes the initial steps undertaken in clinical implementation of personal genome information, and describes the application of whole-genome and exome sequencing to identify the cause of genetic diseases and to suggest adjuvant therapies. Better analysis tools and a deeper understanding of the biology of our genome are necessary in order to decipher, interpret, and optimize clinical utility of what the variation in the human genome can teach us. Personal genome sequencing may eventually become an instrument of common medical practice, providing information that assists in the formulation of a differential diagnosis. We outline herein some of the remaining challenges. PMID:22248320

  3. Metal resistance sequences and transgenic plants

    Science.gov (United States)

    Meagher, Richard Brian; Summers, Anne O.; Rugh, Clayton L.

    1999-10-12

    The present invention provides nucleic acid sequences encoding a metal ion resistance protein, which are expressible in plant cells. The metal resistance protein provides for the enzymatic reduction of metal ions including but not limited to divalent Cu, divalent mercury, trivalent gold, divalent cadmium, lead ions and monovalent silver ions. Transgenic plants which express these coding sequences exhibit increased resistance to metal ions in the environment as compared with plants which have not been so genetically modified. Transgenic plants with improved resistance to organometals including alkylmercury compounds, among others, are provided by the further inclusion of plant-expressible organometal lyase coding sequences, as specifically exemplified by the plant-expressible merB coding sequence. Furthermore, these transgenic plants which have been genetically modified to express the metal resistance coding sequences of the present invention can participate in the bioremediation of metal contamination via the enzymatic reduction of metal ions. Transgenic plants resistant to organometals can further mediate remediation of organic metal compounds, for example, alkylmetal compounds including but not limited to methyl mercury, methyl lead compounds, methyl cadmium and methyl arsenic compounds, in the environment by causing the freeing of mercuric or other metal ions and the reduction of the ionic mercury or other metal ions to the less toxic elemental mercury or other metals.

  4. Winnowing sequences from a database search.

    Science.gov (United States)

    Berman, P; Zhang, Z; Wolf, Y I; Koonin, E V; Miller, W

    2000-01-01

    In database searches for sequence similarity, matches to a distinct sequence region (e.g., protein domain) are frequently obscured by numerous matches to another region of the same sequence. In order to cope with this problem, algorithms are developed to discard redundant matches. One model for this problem begins with a list of intervals, each with an associated score; each interval gives the range of positions in the query sequence that align to a database sequence, and the score is that of the alignment. If interval I is contained in interval J, and I's score is less than J's, then I is said to be dominated by J. The problem is then to identify each interval that is dominated by at least K other intervals, where K is a given level of "tolerable redundancy." An algorithm is developed to solve the problem in O(N log N) time and O(N*) space, where N is the number of intervals and N* is a precisely defined value that never exceeds N and is frequently much smaller. This criterion for discarding database hits has been implemented in the Blast program, as illustrated herein with examples. Several variations and extensions of this approach are also described.

  5. Progressive multiple sequence alignments from triplets

    Directory of Open Access Journals (Sweden)

    Stadler Peter F

    2007-07-01

    Full Text Available Abstract Background The quality of progressive sequence alignments strongly depends on the accuracy of the individual pairwise alignment steps since gaps that are introduced at one step cannot be removed at later aggregation steps. Adjacent insertions and deletions necessarily appear in arbitrary order in pairwise alignments and hence form an unavoidable source of errors. Research Here we present a modified variant of progressive sequence alignments that addresses both issues. Instead of pairwise alignments we use exact dynamic programming to align sequence or profile triples. This avoids a large fractions of the ambiguities arising in pairwise alignments. In the subsequent aggregation steps we follow the logic of the Neighbor-Net algorithm, which constructs a phylogenetic network by step-wisely replacing triples by pairs instead of combining pairs to singletons. To this end the three-way alignments are subdivided into two partial alignments, at which stage all-gap columns are naturally removed. This alleviates the "once a gap, always a gap" problem of progressive alignment procedures. Conclusion The three-way Neighbor-Net based alignment program aln3nn is shown to compare favorably on both protein sequences and nucleic acids sequences to other progressive alignment tools. In the latter case one easily can include scoring terms that consider secondary structure features. Overall, the quality of resulting alignments in general exceeds that of clustalw or other multiple alignments tools even though our software does not included heuristics for context dependent (mismatch scores.

  6. End Sequencing and Finger Printing of Human & Mouse BAC Libraries

    Energy Technology Data Exchange (ETDEWEB)

    Fraser, C

    2005-09-27

    This project provided for continued end sequencing of existing and new BAC libraries constructed to support human sequencing as well as to initiate BAC end sequencing from the mouse BAC libraries constructed to support mouse sequencing. The clones, the sequences, and the fingerprints are now an available resource for the community at large. Research and development of new metaodologies for BAC end sequencing have reduced costs and increase throughput.

  7. 10KP: A phylodiverse genome sequencing plan

    Science.gov (United States)

    Cheng, Shifeng; Melkonian, Michael; Brockington, Samuel; Archibald, John M; Delaux, Pierre-Marc; Melkonian, Barbara; Mavrodiev, Evgeny V; Sun, Wenjing; Fu, Yuan; Yang, Huanming; Soltis, Douglas E; Graham, Sean W; Soltis, Pamela S; Liu, Xin; Xu, Xun

    2018-01-01

    Abstract Understanding plant evolution and diversity in a phylogenomic context is an enormous challenge due, in part, to limited availability of genome-scale data across phylodiverse species. The 10KP (10,000 Plants) Genome Sequencing Project will sequence and characterize representative genomes from every major clade of embryophytes, green algae, and protists (excluding fungi) within the next 5 years. By implementing and continuously improving leading-edge sequencing technologies and bioinformatics tools, 10KP will catalogue the genome content of plant and protist diversity and make these data freely available as an enduring foundation for future scientific discoveries and applications. 10KP is structured as an international consortium, open to the global community, including botanical gardens, plant research institutes, universities, and private industry. Our immediate goal is to establish a policy framework for this endeavor, the principles of which are outlined here. PMID:29618049

  8. 10KP: A phylodiverse genome sequencing plan.

    Science.gov (United States)

    Cheng, Shifeng; Melkonian, Michael; Smith, Stephen A; Brockington, Samuel; Archibald, John M; Delaux, Pierre-Marc; Li, Fay-Wei; Melkonian, Barbara; Mavrodiev, Evgeny V; Sun, Wenjing; Fu, Yuan; Yang, Huanming; Soltis, Douglas E; Graham, Sean W; Soltis, Pamela S; Liu, Xin; Xu, Xun; Wong, Gane Ka-Shu

    2018-03-01

    Understanding plant evolution and diversity in a phylogenomic context is an enormous challenge due, in part, to limited availability of genome-scale data across phylodiverse species. The 10KP (10,000 Plants) Genome Sequencing Project will sequence and characterize representative genomes from every major clade of embryophytes, green algae, and protists (excluding fungi) within the next 5 years. By implementing and continuously improving leading-edge sequencing technologies and bioinformatics tools, 10KP will catalogue the genome content of plant and protist diversity and make these data freely available as an enduring foundation for future scientific discoveries and applications. 10KP is structured as an international consortium, open to the global community, including botanical gardens, plant research institutes, universities, and private industry. Our immediate goal is to establish a policy framework for this endeavor, the principles of which are outlined here.

  9. Automated constraint checking of spacecraft command sequences

    Science.gov (United States)

    Horvath, Joan C.; Alkalaj, Leon J.; Schneider, Karl M.; Spitale, Joseph M.; Le, Dang

    1995-01-01

    Robotic spacecraft are controlled by onboard sets of commands called "sequences." Determining that sequences will have the desired effect on the spacecraft can be expensive in terms of both labor and computer coding time, with different particular costs for different types of spacecraft. Specification languages and appropriate user interface to the languages can be used to make the most effective use of engineering validation time. This paper describes one specification and verification environment ("SAVE") designed for validating that command sequences have not violated any flight rules. This SAVE system was subsequently adapted for flight use on the TOPEX/Poseidon spacecraft. The relationship of this work to rule-based artificial intelligence and to other specification techniques is discussed, as well as the issues that arise in the transfer of technology from a research prototype to a full flight system.

  10. Transforming clinical microbiology with bacterial genome sequencing.

    Science.gov (United States)

    Didelot, Xavier; Bowden, Rory; Wilson, Daniel J; Peto, Tim E A; Crook, Derrick W

    2012-09-01

    Whole-genome sequencing of bacteria has recently emerged as a cost-effective and convenient approach for addressing many microbiological questions. Here, we review the current status of clinical microbiology and how it has already begun to be transformed by using next-generation sequencing. We focus on three essential tasks: identifying the species of an isolate, testing its properties, such as resistance to antibiotics and virulence, and monitoring the emergence and spread of bacterial pathogens. We predict that the application of next-generation sequencing will soon be sufficiently fast, accurate and cheap to be used in routine clinical microbiology practice, where it could replace many complex current techniques with a single, more efficient workflow.

  11. The double main sequence of Omega Centauri

    Science.gov (United States)

    Bedin, L. R.; Piotto, G.; Anderson, J.; King, I. R.; Cassisi, S.; Momany, Y.

    Recent, high precision photometry of Omega Centauri, the biggest Galactic globular cluster, has been obtained with Hubble Space Telescope (HST). The color magnitude diagram reveals an unexpected bifurcation of colors in the main sequence (MS). The newly found double MS, the multiple turnoffs and subgiant branches, and other sequences discovered in the past along the red giant branch of this cluster add up to a fascinating but frustrating puzzle. Among the possible explanations for the blue main sequence an anomalous overabundance of helium is suggested. The hypothesis will be tested with a set of FLAMES@VLT data we have recently obtained (ESO DDT program), and with forthcoming ACS@HST images. Based on observations with the NASA/ESA Hubble Space Telescope, obtained at the Space Telescope Science Institute, which is operated by AURA, Inc., under NASA contract NAS 5-26555.

  12. Heuristics for multiobjective multiple sequence alignment.

    Science.gov (United States)

    Abbasi, Maryam; Paquete, Luís; Pereira, Francisco B

    2016-07-15

    Aligning multiple sequences arises in many tasks in Bioinformatics. However, the alignments produced by the current software packages are highly dependent on the parameters setting, such as the relative importance of opening gaps with respect to the increase of similarity. Choosing only one parameter setting may provide an undesirable bias in further steps of the analysis and give too simplistic interpretations. In this work, we reformulate multiple sequence alignment from a multiobjective point of view. The goal is to generate several sequence alignments that represent a trade-off between maximizing the substitution score and minimizing the number of indels/gaps in the sum-of-pairs score function. This trade-off gives to the practitioner further information about the similarity of the sequences, from which she could analyse and choose the most plausible alignment. We introduce several heuristic approaches, based on local search procedures, that compute a set of sequence alignments, which are representative of the trade-off between the two objectives (substitution score and indels). Several algorithm design options are discussed and analysed, with particular emphasis on the influence of the starting alignment and neighborhood search definitions on the overall performance. A perturbation technique is proposed to improve the local search, which provides a wide range of high-quality alignments. The proposed approach is tested experimentally on a wide range of instances. We performed several experiments with sequences obtained from the benchmark database BAliBASE 3.0. To evaluate the quality of the results, we calculate the hypervolume indicator of the set of score vectors returned by the algorithms. The results obtained allow us to identify reasonably good choices of parameters for our approach. Further, we compared our method in terms of correctly aligned pairs ratio and columns correctly aligned ratio with respect to reference alignments. Experimental results show

  13. Image correlation method for DNA sequence alignment.

    Science.gov (United States)

    Curilem Saldías, Millaray; Villarroel Sassarini, Felipe; Muñoz Poblete, Carlos; Vargas Vásquez, Asticio; Maureira Butler, Iván

    2012-01-01

    The complexity of searches and the volume of genomic data make sequence alignment one of bioinformatics most active research areas. New alignment approaches have incorporated digital signal processing techniques. Among these, correlation methods are highly sensitive. This paper proposes a novel sequence alignment method based on 2-dimensional images, where each nucleic acid base is represented as a fixed gray intensity pixel. Query and known database sequences are coded to their pixel representation and sequence alignment is handled as object recognition in a scene problem. Query and database become object and scene, respectively. An image correlation process is carried out in order to search for the best match between them. Given that this procedure can be implemented in an optical correlator, the correlation could eventually be accomplished at light speed. This paper shows an initial research stage where results were "digitally" obtained by simulating an optical correlation of DNA sequences represented as images. A total of 303 queries (variable lengths from 50 to 4500 base pairs) and 100 scenes represented by 100 x 100 images each (in total, one million base pair database) were considered for the image correlation analysis. The results showed that correlations reached very high sensitivity (99.01%), specificity (98.99%) and outperformed BLAST when mutation numbers increased. However, digital correlation processes were hundred times slower than BLAST. We are currently starting an initiative to evaluate the correlation speed process of a real experimental optical correlator. By doing this, we expect to fully exploit optical correlation light properties. As the optical correlator works jointly with the computer, digital algorithms should also be optimized. The results presented in this paper are encouraging and support the study of image correlation methods on sequence alignment.

  14. Dynamic programming algorithms for biological sequence comparison.

    Science.gov (United States)

    Pearson, W R; Miller, W

    1992-01-01

    Efficient dynamic programming algorithms are available for a broad class of protein and DNA sequence comparison problems. These algorithms require computer time proportional to the product of the lengths of the two sequences being compared [O(N2)] but require memory space proportional only to the sum of these lengths [O(N)]. Although the requirement for O(N2) time limits use of the algorithms to the largest computers when searching protein and DNA sequence databases, many other applications of these algorithms, such as calculation of distances for evolutionary trees and comparison of a new sequence to a library of sequence profiles, are well within the capabilities of desktop computers. In particular, the results of library searches with rapid searching programs, such as FASTA or BLAST, should be confirmed by performing a rigorous optimal alignment. Whereas rapid methods do not overlook significant sequence similarities, FASTA limits the number of gaps that can be inserted into an alignment, so that a rigorous alignment may extend the alignment substantially in some cases. BLAST does not allow gaps in the local regions that it reports; a calculation that allows gaps is very likely to extend the alignment substantially. Although a Monte Carlo evaluation of the statistical significance of a similarity score with a rigorous algorithm is much slower than the heuristic approach used by the RDF2 program, the dynamic programming approach should take less than 1 hr on a 386-based PC or desktop Unix workstation. For descriptive purposes, we have limited our discussion to methods for calculating similarity scores and distances that use gap penalties of the form g = rk. Nevertheless, programs for the more general case (g = q+rk) are readily available. Versions of these programs that run either on Unix workstations, IBM-PC class computers, or the Macintosh can be obtained from either of the authors.

  15. Exome Sequencing in Suspected Monogenic Dyslipidemias

    Science.gov (United States)

    Stitziel, Nathan O.; Peloso, Gina M.; Abifadel, Marianne; Cefalu, Angelo B.; Fouchier, Sigrid; Motazacker, M. Mahdi; Tada, Hayato; Larach, Daniel B.; Awan, Zuhier; Haller, Jorge F.; Pullinger, Clive R.; Varret, Mathilde; Rabès, Jean-Pierre; Noto, Davide; Tarugi, Patrizia; Kawashiri, Masa-aki; Nohara, Atsushi; Yamagishi, Masakazu; Risman, Marjorie; Deo, Rahul; Ruel, Isabelle; Shendure, Jay; Nickerson, Deborah A.; Wilson, James G.; Rich, Stephen S.; Gupta, Namrata; Farlow, Deborah N.; Neale, Benjamin M.; Daly, Mark J.; Kane, John P.; Freeman, Mason W.; Genest, Jacques; Rader, Daniel J.; Mabuchi, Hiroshi; Kastelein, John J.P.; Hovingh, G. Kees; Averna, Maurizio R.; Gabriel, Stacey; Boileau, Catherine; Kathiresan, Sekar

    2015-01-01

    Background Exome sequencing is a promising tool for gene mapping in Mendelian disorders. We utilized this technique in an attempt to identify novel genes underlying monogenic dyslipidemias. Methods and Results We performed exome sequencing on 213 selected family members from 41 kindreds with suspected Mendelian inheritance of extreme levels of low-density lipoprotein (LDL) cholesterol (after candidate gene sequencing excluded known genetic causes for high LDL cholesterol families) or high-density lipoprotein (HDL) cholesterol. We used standard analytic approaches to identify candidate variants and also assigned a polygenic score to each individual in order to account for their burden of common genetic variants known to influence lipid levels. In nine families, we identified likely pathogenic variants in known lipid genes (ABCA1, APOB, APOE, LDLR, LIPA, and PCSK9); however, we were unable to identify obvious genetic etiologies in the remaining 32 families despite follow-up analyses. We identified three factors that limited novel gene discovery: (1) imperfect sequencing coverage across the exome hid potentially causal variants; (2) large numbers of shared rare alleles within families obfuscated causal variant identification; and (3) individuals from 15% of families carried a significant burden of common lipid-related alleles, suggesting complex inheritance can masquerade as monogenic disease. Conclusions We identified the genetic basis of disease in nine of 41 families; however, none of these represented novel gene discoveries. Our results highlight the promise and limitations of exome sequencing as a discovery technique in suspected monogenic dyslipidemias. Considering the confounders identified may inform the design of future exome sequencing studies. PMID:25632026

  16. The evolutionary sequence: origin and emergences

    Science.gov (United States)

    Fox, S. W.

    1986-01-01

    The evolutionary sequence is being reexamined experimentally from a "Big Bang"origin to the protocell and from the emergence of protocell and variety of species to Darwin's mental power (mind) and society (The Descent of Man). A most fundamentally revisionary consequence of experiments is an emphasis on endogenous ordering. This principle, seen vividly in ordered copolymerization of amino acids, has had new impact on the theory of Darwinian evolution and has been found to apply to the entire sequence. Herein, I will discuss some problems of dealing with teaching controversial subjects.

  17. The computational linguistics of biological sequences

    Energy Technology Data Exchange (ETDEWEB)

    Searls, D. [Univ. of Pennsylvania, Philadelphia, PA (United States)

    1995-12-31

    This tutorial was one of eight tutorials selected to be presented at the Third International Conference on Intelligent Systems for Molecular Biology which was held in the United Kingdom from July 16 to 19, 1995. Protein sequences are analogous in many respects, particularly their folding behavior. Proteins have a much richer variety of interactions, but in theory the same linguistic principles could come to bear in describing dependencies between distant residues that arise by virtue of three-dimensional structure. This tutorial will concentrate on nucleic acid sequences.

  18. Applications of High Throughput Nucleotide Sequencing

    DEFF Research Database (Denmark)

    Waage, Johannes Eichler

    equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...

  19. Digital image sequence processing, compression, and analysis

    CERN Document Server

    Reed, Todd R

    2004-01-01

    IntroductionTodd R. ReedCONTENT-BASED IMAGE SEQUENCE REPRESENTATIONPedro M. Q. Aguiar, Radu S. Jasinschi, José M. F. Moura, andCharnchai PluempitiwiriyawejTHE COMPUTATION OF MOTIONChristoph Stiller, Sören Kammel, Jan Horn, and Thao DangMOTION ANALYSIS AND DISPLACEMENT ESTIMATION IN THE FREQUENCY DOMAINLuca Lucchese and Guido Maria CortelazzoQUALITY OF SERVICE ASSESSMENT IN NEW GENERATION WIRELESS VIDEO COMMUNICATIONSGaetano GiuntaERROR CONCEALMENT IN DIGITAL VIDEOFrancesco G.B. De NataleIMAGE SEQUENCE RESTORATION: A WIDER PERSPECTIVEAnil KokaramVIDEO SUMMARIZATIONCuneyt M. Taskiran and Edward

  20. Output-Sensitive Pattern Extraction in Sequences

    DEFF Research Database (Denmark)

    Grossi, Roberto; Menconi, Giulia; Pisanti, Nadia

    2014-01-01

    Genomic Analysis, Plagiarism Detection, Data Mining, Intrusion Detection, Spam Fighting and Time Series Analysis are just some examples of applications where extraction of recurring patterns in sequences of objects is one of the main computational challenges. Several notions of patterns exist...... or extend them causes a loss of significant information (where the number of occurrences changes). Output-sensitive algorithms have been proposed to enumerate and list these patterns, taking polynomial time O(nc) per pattern for constant c > 1, which is impractical for massive sequences of very large length...

  1. Value of a newly sequenced bacterial genome

    DEFF Research Database (Denmark)

    Barbosa, Eudes; Aburjaile, Flavia F; Ramos, Rommel Tj

    2014-01-01

    and annotation will not be undertaken. It is important to know what is lost when we settle for a draft genome and to determine the "scientific value" of a newly sequenced genome. This review addresses the expected impact of newly sequenced genomes on antibacterial discovery and vaccinology. Also, it discusses...... heightened expectations that NGS would boost antibacterial discovery and vaccine development. Although many possible drug and vaccine targets have been discovered, the success rate of genome-based analysis has remained below expectations. Furthermore, NGS has had consequences for genome quality, resulting...

  2. Simulating efficiently the evolution of DNA sequences.

    Science.gov (United States)

    Schöniger, M; von Haeseler, A

    1995-02-01

    Two menu-driven FORTRAN programs are described that simulate the evolution of DNA sequences in accordance with a user-specified model. This general stochastic model allows for an arbitrary stationary nucleotide composition and any transition-transversion bias during the process of base substitution. In addition, the user may define any hypothetical model tree according to which a family of sequences evolves. The programs suggest the computationally most inexpensive approach to generate nucleotide substitutions. Either reproducible or non-repeatable simulations, depending on the method of initializing the pseudo-random number generator, can be performed. The corresponding options are offered by the interface menu.

  3. Final sonorant sequences in the Celje dialect

    Directory of Open Access Journals (Sweden)

    Alja Ferme

    2006-12-01

    Full Text Available In this paper I will analyse final sonorant sequencesin the Celje variety of Slovene. In §2 various definitions of a consonant cluster will be discussed and the definition needed for further development ofthe article will be provided. In §3 I will present pretheoretical arguments against treating all final sonorant sequences as consonant clusters. In addition, a seemingly special behaviour of a small group of sequences will be pointed out. The government phonology framework will be introduced in §4. In §5 the hin the given theoretical framework.

  4. Bordism, stable homotopy and adams spectral sequences

    CERN Document Server

    Kochman, Stanley O

    1996-01-01

    This book is a compilation of lecture notes that were prepared for the graduate course "Adams Spectral Sequences and Stable Homotopy Theory" given at The Fields Institute during the fall of 1995. The aim of this volume is to prepare students with a knowledge of elementary algebraic topology to study recent developments in stable homotopy theory, such as the nilpotence and periodicity theorems. Suitable as a text for an intermediate course in algebraic topology, this book provides a direct exposition of the basic concepts of bordism, characteristic classes, Adams spectral sequences, Brown-Peter

  5. Complete genome sequence of Ikoma lyssavirus.

    Science.gov (United States)

    Marston, Denise A; Ellis, Richard J; Horton, Daniel L; Kuzmin, Ivan V; Wise, Emma L; McElhinney, Lorraine M; Banyard, Ashley C; Ngeleja, Chanasa; Keyyu, Julius; Cleaveland, Sarah; Lembo, Tiziana; Rupprecht, Charles E; Fooks, Anthony R

    2012-09-01

    Lyssaviruses (family Rhabdoviridae) constitute one of the most important groups of viral zoonoses globally. All lyssaviruses cause the disease rabies, an acute progressive encephalitis for which, once symptoms occur, there is no effective cure. Currently available vaccines are highly protective against the predominantly circulating lyssavirus species. Using next-generation sequencing technologies, we have obtained the whole-genome sequence for a novel lyssavirus, Ikoma lyssavirus (IKOV), isolated from an African civet in Tanzania displaying clinical signs of rabies. Genetically, this virus is the most divergent within the genus Lyssavirus. Characterization of the genome will help to improve our understanding of lyssavirus diversity and enable investigation into vaccine-induced immunity and protection.

  6. Lacunary ideal convergence of multiple sequences

    Directory of Open Access Journals (Sweden)

    Bipan Hazarika

    2016-01-01

    Full Text Available An ideal I is a family of subsets of N×N which is closed under taking finite unions and subsets of its elements. In this article, the concept of lacunary ideal convergence of double sequences has been introduced. Also the relation between lacunary ideal convergent and lacunary Cauchy double sequences has been established. Furthermore, the notions of lacunary ideal limit point and lacunary ideal cluster points have been introduced and find the relation between these two notions. Finally, we have studied the properties such as solidity, monotonic.

  7. The evolutionary sequence: origin and emergences.

    Science.gov (United States)

    Fox, S W

    1986-03-01

    The evolutionary sequence is being reexamined experimentally from a "Big Bang"origin to the protocell and from the emergence of protocell and variety of species to Darwin's mental power (mind) and society (The Descent of Man). A most fundamentally revisionary consequence of experiments is an emphasis on endogenous ordering. This principle, seen vividly in ordered copolymerization of amino acids, has had new impact on the theory of Darwinian evolution and has been found to apply to the entire sequence. Herein, I will discuss some problems of dealing with teaching controversial subjects.

  8. Ancestral sequence reconstruction with Maximum Parsimony

    OpenAIRE

    Herbst, Lina; Fischer, Mareike

    2017-01-01

    One of the main aims in phylogenetics is the estimation of ancestral sequences based on present-day data like, for instance, DNA alignments. One way to estimate the data of the last common ancestor of a given set of species is to first reconstruct a phylogenetic tree with some tree inference method and then to use some method of ancestral state inference based on that tree. One of the best-known methods both for tree inference as well as for ancestral sequence inference is Maximum Parsimony (...

  9. Finding the most significant common sequence and structure motifs in a set of RNA sequences

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Heyer, L.J.; Stormo, G.D.

    1997-01-01

    We present a computational scheme to locally align a collection of RNA sequences using sequence and structure constraints, In addition, the method searches for the resulting alignments with the most significant common motifs, among all possible collections, The first part utilizes a simplified...

  10. Genome Sequence of Australian Indigenous Wine Yeast Torulaspora delbrueckii COFT1 Using Nanopore Sequencing.

    Science.gov (United States)

    Tondini, Federico; Jiranek, Vladimir; Grbin, Paul R; Onetto, Cristobal A

    2018-04-26

    Here, we report the first sequenced genome of an indigenous Australian wine isolate of Torulaspora delbrueckii using the Oxford Nanopore MinION and Illumina HiSeq sequencing platforms. The genome size is 9.4 Mb and contains 4,831 genes. Copyright © 2018 Tondini et al.

  11. Identification of 10 882 porcine microsatellite sequences and virtual mapping of 4528 of these sequences

    DEFF Research Database (Denmark)

    Karlskov-Mortensen, Peter; Hu, Z.L.; Gorodkin, Jan

    2007-01-01

    the human genome (BLAST cut-off threshold = 1 x 10-5). All microsatellite sequences placed on the comparative map are accessible at http://www.animalgenome.org/QTLdb/pig.html . These sequences increase the number of identified microsatellites in the porcine genome by several orders of magnitude...

  12. The sequence of spacers between the consensus sequences modulates the strength of procaryotic promoters

    DEFF Research Database (Denmark)

    Jensen, Peter Ruhdal; Hammer, Karin

    1998-01-01

    A library of synthetic promoters for Lactococcus lactis was constructed, in which the known consensus sequences were kept constant while the sequences of the separating spacers were randomized. The library consists of 38 promoters which differ in strength from 0.3 relative units, and up to more t......-reactors and cell factories....

  13. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  14. Sequence embedding for fast construction of guide trees for multiple sequence alignment

    LENUS (Irish Health Repository)

    Blackshields, Gordon

    2010-05-14

    Abstract Background The most widely used multiple sequence alignment methods require sequences to be clustered as an initial step. Most sequence clustering methods require a full distance matrix to be computed between all pairs of sequences. This requires memory and time proportional to N 2 for N sequences. When N grows larger than 10,000 or so, this becomes increasingly prohibitive and can form a significant barrier to carrying out very large multiple alignments. Results In this paper, we have tested variations on a class of embedding methods that have been designed for clustering large numbers of complex objects where the individual distance calculations are expensive. These methods involve embedding the sequences in a space where the similarities within a set of sequences can be closely approximated without having to compute all pair-wise distances. Conclusions We show how this approach greatly reduces computation time and memory requirements for clustering large numbers of sequences and demonstrate the quality of the clusterings by benchmarking them as guide trees for multiple alignment. Source code is available for download from http:\\/\\/www.clustal.org\\/mbed.tgz.

  15. Automated cleaning and pre-processing of immunoglobulin gene sequences from high-throughput sequencing

    Directory of Open Access Journals (Sweden)

    Miri eMichaeli

    2012-12-01

    Full Text Available High throughput sequencing (HTS yields tens of thousands to millions of sequences that require a large amount of pre-processing work to clean various artifacts. Such cleaning cannot be performed manually. Existing programs are not suitable for immunoglobulin (Ig genes, which are variable and often highly mutated. This paper describes Ig-HTS-Cleaner (Ig High Throughput Sequencing Cleaner, a program containing a simple cleaning procedure that successfully deals with pre-processing of Ig sequences derived from HTS, and Ig-Indel-Identifier (Ig Insertion – Deletion Identifier, a program for identifying legitimate and artifact insertions and/or deletions (indels. Our programs were designed for analyzing Ig gene sequences obtained by 454 sequencing, but they are applicable to all types of sequences and sequencing platforms. Ig-HTS-Cleaner and Ig-Indel-Identifier have been implemented in Java and saved as executable JAR files, supported on Linux and MS Windows. No special requirements are needed in order to run the programs, except for correctly constructing the input files as explained in the text. The programs' performance has been tested and validated on real and simulated data sets.

  16. Viewing multiple sequence alignments with the JavaScript Sequence Alignment Viewer (JSAV).

    Science.gov (United States)

    Martin, Andrew C R

    2014-01-01

    The JavaScript Sequence Alignment Viewer (JSAV) is designed as a simple-to-use JavaScript component for displaying sequence alignments on web pages. The display of sequences is highly configurable with options to allow alternative coloring schemes, sorting of sequences and 'dotifying' repeated amino acids. An option is also available to submit selected sequences to another web site, or to other JavaScript code. JSAV is implemented purely in JavaScript making use of the JQuery and JQuery-UI libraries. It does not use any HTML5-specific options to help with browser compatibility. The code is documented using JSDOC and is available from http://www.bioinf.org.uk/software/jsav/.

  17. Error Analysis of Deep Sequencing of Phage Libraries: Peptides Censored in Sequencing

    Directory of Open Access Journals (Sweden)

    Wadim L. Matochko

    2013-01-01

    Full Text Available Next-generation sequencing techniques empower selection of ligands from phage-display libraries because they can detect low abundant clones and quantify changes in the copy numbers of clones without excessive selection rounds. Identification of errors in deep sequencing data is the most critical step in this process because these techniques have error rates >1%. Mechanisms that yield errors in Illumina and other techniques have been proposed, but no reports to date describe error analysis in phage libraries. Our paper focuses on error analysis of 7-mer peptide libraries sequenced by Illumina method. Low theoretical complexity of this phage library, as compared to complexity of long genetic reads and genomes, allowed us to describe this library using convenient linear vector and operator framework. We describe a phage library as N×1 frequency vector n=ni, where ni is the copy number of the ith sequence and N is the theoretical diversity, that is, the total number of all possible sequences. Any manipulation to the library is an operator acting on n. Selection, amplification, or sequencing could be described as a product of a N×N matrix and a stochastic sampling operator (Sa. The latter is a random diagonal matrix that describes sampling of a library. In this paper, we focus on the properties of Sa and use them to define the sequencing operator (Seq. Sequencing without any bias and errors is Seq=Sa IN, where IN is a N×N unity matrix. Any bias in sequencing changes IN to a nonunity matrix. We identified a diagonal censorship matrix (CEN, which describes elimination or statistically significant downsampling, of specific reads during the sequencing process.

  18. Genome sequencing for obstetricians & gynaecologists | Kent ...

    African Journals Online (AJOL)

    The medical profession has been waiting for a decade to be invigorated by the sequencing of the human genome, arguably the greatest scientific project ever. The technology has been spectacular but the results of the project have yielded more unexpected results than definitive answers – many about the very nature of our ...

  19. Sequence crystallization during isotherm evaporation of southern ...

    African Journals Online (AJOL)

    Southern Algerian's natural brine sampled from chott Baghdad may be a source of mineral salts with a high economic value. These salts are recoverable by simple solar evaporation. Indeed, during isothermal solar evaporation, it is possible to recover mineral salts and to determine the precipitation sequences of different ...

  20. Time sequence photography of Roosters Comb

    Science.gov (United States)

    The importance of understanding natural landscape changes is key in properly determining rangeland ecology. Time sequence photography allows a landscape snapshot to be documented and enables the ability to compare natural changes overtime. Photographs of Roosters Comb were taken from the same vantag...

  1. Recalling visual serial order for verbal sequences

    NARCIS (Netherlands)

    Logie, R.H.; Saito, S.; Morita, A.; Varma, S.; Norris, D.

    2016-01-01

    We report three experiments in which participants performed written serial recall of visually presented verbal sequences with items varying in visual similarity. In Experiments 1 and 2 native speakers of Japanese recalled visually presented Japanese Kanji characters. In Experiment 3, native speakers

  2. Complex Sequencing Problems and Local Search Heuristics

    NARCIS (Netherlands)

    Brucker, P.; Hurink, Johann L.; Osman, I.H.; Kelly, J.P.

    1996-01-01

    Many problems can be formulated as complex sequencing problems. We will present problems in flexible manufacturing that have such a formulation and apply local search methods like iterative improvement, simulated annealing and tabu search to solve these problems. Computational results are reported.

  3. Neurocognitive mechanisms of action sequence processing

    NARCIS (Netherlands)

    Monroy, C.D.

    2017-01-01

    Imagine an ordinary action sequence, such as making a peanut butter sandwich. You first reach for two bread slices, grasp your peanut butter jar, open the jar, reach for a knife, insert it into your jar… and so forth. Even the simplest actions contain a complex stream of information from movements,

  4. Genome shotgun sequencing and development of microsatellite ...

    African Journals Online (AJOL)

    Analysis of the gerbera genome DNA ('Raon') general library showed that sequences of (AT), (AG), (AAG) and (AAT) repeats appeared most often, whereas (AC), (AAC) and (ACC) were the least frequent. Primer pairs were designed for 80 loci. Only eight primer pairs produced reproducible polymorphic bands in the 28 ...

  5. Using "Arabidopsis" Genetic Sequences to Teach Bioinformatics

    Science.gov (United States)

    Zhang, Xiaorong

    2009-01-01

    This article describes a new approach to teaching bioinformatics using "Arabidopsis" genetic sequences. Several open-ended and inquiry-based laboratory exercises have been designed to help students grasp key concepts and gain practical skills in bioinformatics, using "Arabidopsis" leucine-rich repeat receptor-like kinase (LRR…

  6. Mitochondrial DNA sequence evolution in shorebird populations

    NARCIS (Netherlands)

    Wenink, P.W.

    1994-01-01

    This thesis describes the global molecular population structure of two shorebird species, in particular of the dunlin, Calidris alpina, by means of comparative sequence analysis of the most variable part of the mitochondrial DNA (mtDNA) genome. There are several reasons

  7. Detecting change in stochastic sound sequences.

    Directory of Open Access Journals (Sweden)

    Benjamin Skerritt-Davis

    2018-05-01

    Full Text Available Our ability to parse our acoustic environment relies on the brain's capacity to extract statistical regularities from surrounding sounds. Previous work in regularity extraction has predominantly focused on the brain's sensitivity to predictable patterns in sound sequences. However, natural sound environments are rarely completely predictable, often containing some level of randomness, yet the brain is able to effectively interpret its surroundings by extracting useful information from stochastic sounds. It has been previously shown that the brain is sensitive to the marginal lower-order statistics of sound sequences (i.e., mean and variance. In this work, we investigate the brain's sensitivity to higher-order statistics describing temporal dependencies between sound events through a series of change detection experiments, where listeners are asked to detect changes in randomness in the pitch of tone sequences. Behavioral data indicate listeners collect statistical estimates to process incoming sounds, and a perceptual model based on Bayesian inference shows a capacity in the brain to track higher-order statistics. Further analysis of individual subjects' behavior indicates an important role of perceptual constraints in listeners' ability to track these sensory statistics with high fidelity. In addition, the inference model facilitates analysis of neural electroencephalography (EEG responses, anchoring the analysis relative to the statistics of each stochastic stimulus. This reveals both a deviance response and a change-related disruption in phase of the stimulus-locked response that follow the higher-order statistics. These results shed light on the brain's ability to process stochastic sound sequences.

  8. Weak contractions via $\\lambda$-sequences

    OpenAIRE

    Agyingi, Collins Amburo; Gaba, Yaé Ulrich

    2018-01-01

    In this note, we discuss common fixed point for a family of self mapping defined on a metric type space and satisfying a weakly contractive condition. In our development, we make use of the $\\lambda$-sequence approach and also of a certain class of real valued maps. We derive some implications for self-mappings on quasi-pseudometric type spaces.

  9. Improving sequence segmentation learning by predicting trigrams

    NARCIS (Netherlands)

    van den Bosch, A.; Daelemans, W.; Dagan, I.; Gildea, D.

    2005-01-01

    Symbolic machine-learning classifiers are known to suffer from near-sightedness when performing sequence segmentation (chunking) tasks in natural language processing: without special architectural additions they are oblivious of the decisions they made earlier when making new ones. We introduce a

  10. Multiple Genome Sequences of Lactobacillus plantarum Strains

    OpenAIRE

    Kafka, Thomas A.; Geissler, Andreas J.; Vogel, Rudi F.

    2017-01-01

    ABSTRACT We report here the genome sequences of four Lactobacillus plantarum strains which vary in surface hydrophobicity. Bioinformatic analysis, using additional genomes of Lactobacillus plantarum strains, revealed a possible correlation between the cell wall teichoic acid-type and cell surface hydrophobicity and provide the basis for consecutive analyses.

  11. Getting Limits off the Ground via Sequences

    Science.gov (United States)

    Gass, Frederick

    2006-01-01

    Most beginning calculus courses spend little or no time on a technical definition of the limit concept. In most of the remaining courses, the definition presented is the traditional epsilon-delta definition. An alternative approach that bases the definition on infinite sequences has occasionally appeared in commercial textbooks but has not yet…

  12. Service Processes as a Sequence of Events

    NARCIS (Netherlands)

    P.C. Verhoef (Peter); G. Antonides (Gerrit); A.N. de Hoog

    2002-01-01

    textabstractIn this paper the service process is considered as a sequence of events. Using theory from economics and psychology a model is formulated that explains how the utility of each event affects the overall evaluation of the service process. In this model we especially account for the

  13. Automatic Sequences and Zip-Specifications

    NARCIS (Netherlands)

    Grabmayer, C.A.; Endrullis, J.; Hendriks, D.; Klop, J.W.; Moss, L.S.

    2012-01-01

    We consider infinite sequences of symbols, also known as streams, and the decidability question for equality of streams defined in a restricted format. This restricted format consists of prefixing a symbol at the head of a stream, of the stream function `zip', and recursion variables. Here `zip'

  14. Supplementary data: Comparative studies on sequence ...

    Indian Academy of Sciences (India)

    Unknown

    Page 1. Supplementary data: Comparative studies on sequence characteristics around translation initiation codon in four eukaryotes. Qingpo Liu and Qingzhong Xue. J. Genet. 84, 317–322. Table 1. Spearman's rank correlation coefficients of 39 base positions around the AUG codon in the four eukaryotic species studied.

  15. Function-Based Algorithms for Biological Sequences

    Science.gov (United States)

    Mohanty, Pragyan Sheela P.

    2015-01-01

    Two problems at two different abstraction levels of computational biology are studied. At the molecular level, efficient pattern matching algorithms in DNA sequences are presented. For gene order data, an efficient data structure is presented capable of storing all gene re-orderings in a systematic manner. A common characteristic of presented…

  16. Draft Genome Sequence of Lactobacillus rhamnosus 2166.

    OpenAIRE

    Karlyshev, Andrey V.; Melnikov, Vyacheslav G.; Kosarev, Igor V.; Abramov, Vyacheslav M.

    2014-01-01

    In this report, we present a draft sequence of the genome of Lactobacillus rhamnosus strain 2166, a potential novel probiotic. Genome annotation and read mapping onto a reference genome of L. rhamnosus strain GG allowed for the identification of the differences and similarities in the genomic contents and gene arrangements of these strains.

  17. Realise : reconstruction of reality from image sequences

    NARCIS (Netherlands)

    Leymarie, F.; de la Fortelle, A.; Koenderink, Jan J.; Kappers, A. M L; Stavridi, M.; van Ginneken, B.; Muller, S.; Krake, S.; Faugeras, O.; Robert, L.; Gauclin, C.; Laveau, S.; Zeller, C.; Anon,

    1996-01-01

    REALISE has for principal goals to extract from sequences of images, acquired with a moving camera, information necessary for determining the 3D (CAD-like) structure of a real-life scene together with information about the radiometric signatures of surfaces bounding the extracted 3D objects (e.g.

  18. Automated Testing with Targeted Event Sequence Generation

    DEFF Research Database (Denmark)

    Jensen, Casper Svenning; Prasad, Mukul R.; Møller, Anders

    2013-01-01

    Automated software testing aims to detect errors by producing test inputs that cover as much of the application source code as possible. Applications for mobile devices are typically event-driven, which raises the challenge of automatically producing event sequences that result in high coverage...

  19. Abundance, composition and distribution of simple sequence ...

    Indian Academy of Sciences (India)

    δ∗(W-29, W-70) = 1.25; δ∗(W-93, W-70 = 0.75)) even though they originate from different geographical regions. We can, therefore, infer that the WSSV sequences are closely related by ancestry. Table 3. Dinucleotide relative abundance in the ...

  20. Regulatory sequence of cupin family gene

    Science.gov (United States)

    Hood, Elizabeth; Teoh, Thomas

    2017-07-25

    This invention is in the field of plant biology and agriculture and relates to novel seed specific promoter regions. The present invention further provide methods of producing proteins and other products of interest and methods of controlling expression of nucleic acid sequences of interest using the seed specific promoter regions.

  1. Compact flow diagrams for state sequences

    NARCIS (Netherlands)

    Buchin, Kevin; Buchin, Maike; Gudmundsson, Joachim; Horton, Michael; Sijben, Stef

    2017-01-01

    We introduce the concept of using a flow diagram to compactly represent the segmentation of a large number of state sequences according to a set of criteria. We argue that this flow diagram representation gives an intuitive summary that allows the user to detect patterns within the segmentations. In

  2. Retrieval and Representation of Nucleotide Sequence of ...

    African Journals Online (AJOL)

    Nigerian Journal of Basic and Applied Science (March, 2013), 21(1): 27-32 ... Full Length R esearch A rticle ... The present study highlights data retrieval and representation. .... the end of information and the start of the sequence on the next ...

  3. Complete Genome Sequence of Staphylococcus epidermidis 1457.

    Science.gov (United States)

    Galac, Madeline R; Stam, Jason; Maybank, Rosslyn; Hinkle, Mary; Mack, Dietrich; Rohde, Holger; Roth, Amanda L; Fey, Paul D

    2017-06-01

    Staphylococcus epidermidis 1457 is a frequently utilized strain that is amenable to genetic manipulation and has been widely used for biofilm-related research. We report here the whole-genome sequence of this strain, which encodes 2,277 protein-coding genes and 81 RNAs within its 2.4-Mb genome and plasmid. Copyright © 2017 Galac et al.

  4. On VC-density over indiscernible sequences

    OpenAIRE

    Guingona, Vincent; Hill, Cameron Donnay

    2011-01-01

    In this paper, we study VC-density over indiscernible sequences (denoted VC_ind-density). We answer an open question in [1], showing that VC_ind-density is always integer valued. We also show that VC_ind-density and dp-rank coincide in the natural way.

  5. GIF Video Sentiment Detection Using Semantic Sequence

    Directory of Open Access Journals (Sweden)

    Dazhen Lin

    2017-01-01

    Full Text Available With the development of social media, an increasing number of people use short videos in social media applications to express their opinions and sentiments. However, sentiment detection of short videos is a very challenging task because of the semantic gap problem and sequence based sentiment understanding problem. In this context, we propose a SentiPair Sequence based GIF video sentiment detection approach with two contributions. First, we propose a Synset Forest method to extract sentiment related semantic concepts from WordNet to build a robust SentiPair label set. This approach considers the semantic gap between label words and selects a robust label subset which is related to sentiment. Secondly, we propose a SentiPair Sequence based GIF video sentiment detection approach that learns the semantic sequence to understand the sentiment from GIF videos. Our experiment results on GSO-2016 (GIF Sentiment Ontology data show that our approach not only outperforms four state-of-the-art classification methods but also shows better performance than the state-of-the-art middle level sentiment ontology features, Adjective Noun Pairs (ANPs.

  6. Hidden Markov models for labeled sequences

    DEFF Research Database (Denmark)

    Krogh, Anders Stærmose

    1994-01-01

    A hidden Markov model for labeled observations, called a class HMM, is introduced and a maximum likelihood method is developed for estimating the parameters of the model. Instead of training it to model the statistics of the training sequences it is trained to optimize recognition. It resembles MMI...

  7. Comparison of 61 Sequenced Escherichia coli Genomes

    DEFF Research Database (Denmark)

    Lukjancenko, Oksana; Wassenaar, T. M.; Ussery, David

    2010-01-01

    Escherichia coli is an important component of the biosphere and is an ideal model for studies of processes involved in bacterial genome evolution. Sixty-one publically available E. coli and Shigella spp. sequenced genomes are compared, using basic methods to produce phylogenetic and proteomics...

  8. The Pizza Problem: A Solution with Sequences

    Science.gov (United States)

    Shafer, Kathryn G.; Mast, Caleb J.

    2008-01-01

    This article addresses the issues of coaching and assessing. A preservice middle school teacher's unique solution to the Pizza problem was not what the professor expected. The student's solution strategy, based on sequences and a reinvention of Pascal's triangle, is explained in detail. (Contains 8 figures.)

  9. Rapid-Sequence Serial Sexual Homicides.

    Science.gov (United States)

    Schlesinger, Louis B; Ramirez, Stephanie; Tusa, Brittany; Jarvis, John P; Erdberg, Philip

    2017-03-01

    Serial sexual murderers have been described as committing homicides in a methodical manner, taking substantial time between offenses to elude the authorities. The results of our study of the temporal patterns (i.e., the length of time between homicides) of a nonrandom national sample of 44 serial sexual murderers and their 201 victims indicate that this representation may not always be accurate. Although 25 offenders (56.8%) killed with longer than a 14-day period between homicides, a sizeable subgroup was identified: 19 offenders (43.2%) who committed homicides in rapid-sequence fashion, with fewer than 14 days between all or some of the murders. Six offenders (13.6%) killed all their victims in one rapid-sequence, spree-like episode, with homicides just days apart or sometimes two murders in the same day. Thirteen offenders (29.5%) killed in one or two rapid-sequence clusters (i.e., more than one murder within a 14-day period, as well as additional homicides with greater than 14 days between each). The purpose of our study was to describe this subgroup of rapid-sequence offenders who have not been identified until now. These findings argue for accelerated forensic assessments of dangerousness and public safety when a sexual murder is detected. Psychiatric disorders with rapidly occurring symptom patterns, or even atypical mania or mood dysregulation, may serve as exemplars for understanding this extraordinary group of offenders. © 2017 American Academy of Psychiatry and the Law.

  10. Asymptotic behaviour of firmly non expansive sequences

    International Nuclear Information System (INIS)

    Rouhani, B.D.

    1993-04-01

    We introduce the notion of firmly non expansive sequences in a Banach space and present several results concerning their asymptotic behaviour extending previous results and giving an affirmative answer to an open question raised by S. Reich and I. Shafir. Applications to averaged mappings are also given. (author). 16 refs

  11. Recurrence plot analysis of DNA sequences

    Energy Technology Data Exchange (ETDEWEB)

    Wu Zuobing [State Key Laboratory of Nonlinear Mechanics, Institute of Mechanics, Chinese Academy of Sciences, Beijing 100080 (China)]. E-mail: wuzb@lnm.imech.ac.cn

    2004-11-15

    Recurrence plot technique of DNA sequences is established on metric representation and employed to analyze correlation structure of nucleotide strings. It is found that, in the transference of nucleotide strings, a human DNA fragment has a major correlation distance, but a yeast chromosome's correlation distance has a constant increasing.

  12. Artificial Intelligence Controls Tape-Recording Sequence

    Science.gov (United States)

    Schwuttke, Ursula M.; Otamura, Roy M.; Zottarelli, Lawrence J.

    1989-01-01

    Developmental expert-system computer program intended to schedule recording of large amounts of data on limited amount of magnetic tape. Schedules recording using two sets of rules. First set incorporates knowledge of locations for recording of new data. Second set incorporates knowledge about issuing commands to recorder. Designed primarily for use on Voyager Spacecraft, also applicable to planning and sequencing in industry.

  13. Modular pulse sequencing in a tokamak system

    International Nuclear Information System (INIS)

    Chew, A.C.; Lee, S.; Saw, S.H.

    1992-01-01

    Pulse technique applied in the timing and sequencing of the various part of the MUT tokamak system are discussed. The modular architecture of the pulse generating device highlights the versatile application of the simple physical concepts in precise and complicated research experiment. (author)

  14. Predictive uncertainty in auditory sequence processing

    DEFF Research Database (Denmark)

    Hansen, Niels Chr.; Pearce, Marcus T

    2014-01-01

    in a melodic sequence (inferred uncertainty). Finally, we simulate listeners' perception of expectedness and uncertainty using computational models of auditory expectation. A detailed model comparison indicates which model parameters maximize fit to the data and how they compare to existing models...

  15. ϕ-statistically quasi Cauchy sequences

    Directory of Open Access Journals (Sweden)

    Bipan Hazarika

    2016-04-01

    Full Text Available Let P denote the space whose elements are finite sets of distinct positive integers. Given any element σ of P, we denote by p(σ the sequence {pn(σ} such that pn(σ=1 for n ∈ σ and pn(σ=0 otherwise. Further Ps={σ∈P:∑n=1∞pn(σ≤s}, i.e. Ps is the set of those σ whose support has cardinality at most s. Let (ϕn be a non-decreasing sequence of positive integers such that nϕn+1≤(n+1ϕn for all n∈N and the class of all sequences (ϕn is denoted by Φ. Let E⊆N. The number δϕ(E=lims→∞1ϕs|{k∈σ,σ∈Ps:k∈E}| is said to be the ϕ-density of E. A sequence (xn of points in R is ϕ-statistically convergent (or Sϕ-convergent to a real number ℓ for every ε > 0 if the set {n∈N:|xn−ℓ|≥ɛ} has ϕ-density zero. We introduce ϕ-statistically ward continuity of a real function. A real function is ϕ-statistically ward continuous if it preserves ϕ-statistically quasi Cauchy sequences where a sequence (xn is called to be ϕ-statistically quasi Cauchy (or Sϕ-quasi Cauchy when (Δxn=(xn+1−xn is ϕ-statistically convergent to 0. i.e. a sequence (xn of points in R is called ϕ-statistically quasi Cauchy (or Sϕ-quasi Cauchy for every ε > 0 if {n∈N:|xn+1−xn|≥ɛ} has ϕ-density zero. Also we introduce the concept of ϕ-statistically ward compactness and obtain results related to ϕ-statistically ward continuity, ϕ-statistically ward compactness, statistically ward continuity, ward continuity, ward compactness, ordinary compactness, uniform continuity, ordinary continuity, δ-ward continuity, and slowly oscillating continuity.

  16. Genomic Sequence Variation Markup Language (GSVML).

    Science.gov (United States)

    Nakaya, Jun; Kimura, Michio; Hiroi, Kaei; Ido, Keisuke; Yang, Woosung; Tanaka, Hiroshi

    2010-02-01

    With the aim of making good use of internationally accumulated genomic sequence variation data, which is increasing rapidly due to the explosive amount of genomic research at present, the development of an interoperable data exchange format and its international standardization are necessary. Genomic Sequence Variation Markup Language (GSVML) will focus on genomic sequence variation data and human health applications, such as gene based medicine or pharmacogenomics. We developed GSVML through eight steps, based on case analysis and domain investigations. By focusing on the design scope to human health applications and genomic sequence variation, we attempted to eliminate ambiguity and to ensure practicability. We intended to satisfy the requirements derived from the use case analysis of human-based clinical genomic applications. Based on database investigations, we attempted to minimize the redundancy of the data format, while maximizing the data covering range. We also attempted to ensure communication and interface ability with other Markup Languages, for exchange of omics data among various omics researchers or facilities. The interface ability with developing clinical standards, such as the Health Level Seven Genotype Information model, was analyzed. We developed the human health-oriented GSVML comprising variation data, direct annotation, and indirect annotation categories; the variation data category is required, while the direct and indirect annotation categories are optional. The annotation categories contain omics and clinical information, and have internal relationships. For designing, we examined 6 cases for three criteria as human health application and 15 data elements for three criteria as data formats for genomic sequence variation data exchange. The data format of five international SNP databases and six Markup Languages and the interface ability to the Health Level Seven Genotype Model in terms of 317 items were investigated. GSVML was developed as

  17. Neural mechanisms of sequence generation in songbirds

    Science.gov (United States)

    Langford, Bruce

    Animal models in research are useful for studying more complex behavior. For example, motor sequence generation of actions requiring good muscle coordination such as writing with a pen, playing an instrument, or speaking, may involve the interaction of many areas in the brain, each a complex system in itself; thus it can be difficult to determine causal relationships between neural behavior and the behavior being studied. Birdsong, however, provides an excellent model behavior for motor sequence learning, memory, and generation. The song consists of learned sequences of notes that are spectrographically stereotyped over multiple renditions of the song, similar to syllables in human speech. The main areas of the songbird brain involve in singing are known, however, the mechanisms by which these systems store and produce song are not well understood. We used a custom built, head-mounted, miniature motorized microdrive to chronically record the neural firing patterns of identified neurons in HVC, a pre-motor cortical nucleus which has been shown to be important in song timing. These were done in Bengalese finch which generate a song made up of stereotyped notes but variable note sequences. We observed song related bursting in neurons projecting to Area X, a homologue to basal ganglia, and tonic firing in HVC interneurons. Interneuron had firing rate patterns that were consistent over multiple renditions of the same note sequence. We also designed and built a light-weight, low-powered wireless programmable neural stimulator using Bluetooth Low Energy Protocol. It was able to generate perturbations in the song when current pulses were administered to RA, which projects to the brainstem nucleus responsible for syringeal muscle control.

  18. Insight into biases and sequencing errors for amplicon sequencing with the Illumina MiSeq platform.

    Science.gov (United States)

    Schirmer, Melanie; Ijaz, Umer Z; D'Amore, Rosalinda; Hall, Neil; Sloan, William T; Quince, Christopher

    2015-03-31

    With read lengths of currently up to 2 × 300 bp, high throughput and low sequencing costs Illumina's MiSeq is becoming one of the most utilized sequencing platforms worldwide. The platform is manageable and affordable even for smaller labs. This enables quick turnaround on a broad range of applications such as targeted gene sequencing, metagenomics, small genome sequencing and clinical molecular diagnostics. However, Illumina error profiles are still poorly understood and programs are therefore not designed for the idiosyncrasies of Illumina data. A better knowledge of the error patterns is essential for sequence analysis and vital if we are to draw valid conclusions. Studying true genetic variation in a population sample is fundamental for understanding diseases, evolution and origin. We conducted a large study on the error patterns for the MiSeq based on 16S rRNA amplicon sequencing data. We tested state-of-the-art library preparation methods for amplicon sequencing and showed that the library preparation method and the choice of primers are the most significant sources of bias and cause distinct error patterns. Furthermore we tested the efficiency of various error correction strategies and identified quality trimming (Sickle) combined with error correction (BayesHammer) followed by read overlapping (PANDAseq) as the most successful approach, reducing substitution error rates on average by 93%. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Full-length sequencing and identification of novel polymorphisms in ...

    Indian Academy of Sciences (India)

    The aim of this work was to sequence the entirecoding region of ACACA gene in Valle del Belice sheep breed to identify polymorphic sites. A total of 51 coding exons of ACACA gene were sequenced in 32 individuals of Valle del Belice sheep breed. Sequencing analysis and alignment of obtained sequences showed the ...

  20. The categorical limit of a sequence of dynamical systems

    NARCIS (Netherlands)

    Cuijpers, P.J.L.; Borgström, J.; Luttik, B.

    2013-01-01

    Modeling a sequence of design steps, or a sequence of parameter settings, yields a sequence of dynamical systems. In many cases, such a sequence is intended to approximate a certain limit case. However, formally defining that limit turns out to be subject to ambiguity. Depending on the

  1. Nonlinear deterministic structures and the randomness of protein sequences

    CERN Document Server

    Huang Yan Zhao

    2003-01-01

    To clarify the randomness of protein sequences, we make a detailed analysis of a set of typical protein sequences representing each structural classes by using nonlinear prediction method. No deterministic structures are found in these protein sequences and this implies that they behave as random sequences. We also give an explanation to the controversial results obtained in previous investigations.

  2. BlockLogo: Visualization of peptide and sequence motif conservation

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Kudahl, Ulrich Johan; Simon, Christian

    2013-01-01

    BlockLogo is a web-server application for the visualization of protein and nucleotide fragments, continuous protein sequence motifs, and discontinuous sequence motifs using calculation of block entropy from multiple sequence alignments. The user input consists of a multiple sequence alignment, se...

  3. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  4. The Sequencing of Basic Chemistry Topics by Physical Science Teachers

    Science.gov (United States)

    Sibanda, Doras; Hobden, Paul

    2016-01-01

    The purpose of this study was to find out teachers' preferred teaching sequence for basic chemistry topics in Physical Science in South Africa, to obtain their reasons underpinning their preferred sequence, and to compare these sequences with the prescribed sequences in the current curriculum. The study was located within a pragmatic paradigm and…

  5. An automated annotation tool for genomic DNA sequences using

    Indian Academy of Sciences (India)

    Genomic sequence data are often available well before the annotated sequence is published. We present a method for analysis of genomic DNA to identify coding sequences using the GeneScan algorithm and characterize these resultant sequences by BLAST. The routines are used to develop a system for automated ...

  6. Hardness of deriving invertible sequences from finite state machines

    DEFF Research Database (Denmark)

    Hierons, Robert M.; Mousavi, Mohammad Reza; Thomsen, Michael Kirkedal

    2017-01-01

    invertible sequences; these allow one to construct additional UIOs once a UIO has been found. We consider three optimisation problems associated with invertible sequences: deciding whether there is a (proper) invertible sequence of length at least K; deciding whether there is a set of invertible sequences...

  7. The Polytopic-k-Step Fibonacci Sequences in Finite Groups

    Directory of Open Access Journals (Sweden)

    Ömür Deveci

    2011-01-01

    Full Text Available We study the polytopic-k-step Fibonacci sequences, the polytopic-k-step Fibonacci sequences modulo m, and the polytopic-k-step Fibonacci sequences in finite groups. Also, we examine the periods of the polytopic-k-step Fibonacci sequences in semidihedral group SD2m.

  8. The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.

    Science.gov (United States)

    Khoe, Clairine V; Chung, Long H; Murray, Vincent

    2018-06-01

    The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

  9. Noncoding sequence classification based on wavelet transform analysis: part I

    Science.gov (United States)

    Paredes, O.; Strojnik, M.; Romo-Vázquez, R.; Vélez Pérez, H.; Ranta, R.; Garcia-Torales, G.; Scholl, M. K.; Morales, J. A.

    2017-09-01

    DNA sequences in human genome can be divided into the coding and noncoding ones. Coding sequences are those that are read during the transcription. The identification of coding sequences has been widely reported in literature due to its much-studied periodicity. Noncoding sequences represent the majority of the human genome. They play an important role in gene regulation and differentiation among the cells. However, noncoding sequences do not exhibit periodicities that correlate to their functions. The ENCODE (Encyclopedia of DNA elements) and Epigenomic Roadmap Project projects have cataloged the human noncoding sequences into specific functions. We study characteristics of noncoding sequences with wavelet analysis of genomic signals.

  10. Simple sequence repeat marker development from bacterial artificial chromosome end sequences and expressed sequence tags of flax (Linum usitatissimum L.).

    Science.gov (United States)

    Cloutier, Sylvie; Miranda, Evelyn; Ward, Kerry; Radovanovic, Natasa; Reimer, Elsa; Walichnowski, Andrzej; Datla, Raju; Rowland, Gordon; Duguid, Scott; Ragupathy, Raja

    2012-08-01

    Flax is an important oilseed crop in North America and is mostly grown as a fibre crop in Europe. As a self-pollinated diploid with a small estimated genome size of ~370 Mb, flax is well suited for fast progress in genomics. In the last few years, important genetic resources have been developed for this crop. Here, we describe the assessment and comparative analyses of 1,506 putative simple sequence repeats (SSRs) of which, 1,164 were derived from BAC-end sequences (BESs) and 342 from expressed sequence tags (ESTs). The SSRs were assessed on a panel of 16 flax accessions with 673 (58 %) and 145 (42 %) primer pairs being polymorphic in the BESs and ESTs, respectively. With 818 novel polymorphic SSR primer pairs reported in this study, the repertoire of available SSRs in flax has more than doubled from the combined total of 508 of all previous reports. Among nucleotide motifs, trinucleotides were the most abundant irrespective of the class, but dinucleotides were the most polymorphic. SSR length was also positively correlated with polymorphism. Two dinucleotide (AT/TA and AG/GA) and two trinucleotide (AAT/ATA/TAA and GAA/AGA/AAG) motifs and their iterations, different from those reported in many other crops, accounted for more than half of all the SSRs and were also more polymorphic (63.4 %) than the rest of the markers (42.7 %). This improved resource promises to be useful in genetic, quantitative trait loci (QTL) and association mapping as well as for anchoring the physical/genetic map with the whole genome shotgun reference sequence of flax.

  11. The SWISS-PROT protein sequence data bank: current status.

    OpenAIRE

    Bairoch, A; Boeckmann, B

    1994-01-01

    SWISS-PROT is an annotated protein sequence database established in 1986 and maintained collaboratively, since 1988, by the Department of Medical Biochemistry of the University of Geneva and the EMBL Data Library. The SWISS-PROT protein sequence data bank consist of sequence entries. Sequence entries are composed of different lines types, each with their own format. For standardization purposes the format of SWISS-PROT follows as closely as possible that of the EMBL Nucleotide Sequence Databa...

  12. Next Generation DNA Sequencing and the Future of Genomic Medicine

    OpenAIRE

    Anderson, Matthew W.; Schrijver, Iris

    2010-01-01

    In the years since the first complete human genome sequence was reported, there has been a rapid development of technologies to facilitate high-throughput sequence analysis of DNA (termed “next-generation” sequencing). These novel approaches to DNA sequencing offer the promise of complete genomic analysis at a cost feasible for routine clinical diagnostics. However, the ability to more thoroughly interrogate genomic sequence raises a number of important issues with regard to result interpreta...

  13. Targeted Gene Sequencing and Whole-Exome Sequencing in Autopsied Fetuses with Prenatally Diagnosed Kidney Anomalies

    DEFF Research Database (Denmark)

    Rasmussen, M; Sunde, L; Nielsen, M L

    2018-01-01

    Identification of fetal kidney anomalies invites questions about underlying causes and recurrence risk in future pregnancies. We therefore investigated the diagnostic yield of next-generation sequencing in fetuses with bilateral kidney anomalies and the correlation between disrupted genes and fetal...... phenotypes. Fetuses with bilateral kidney anomalies were screened using an in-house-designed kidney-gene panel. In families where candidate variants were not identified, whole-exome sequencing was performed. Genes uncovered by this analysis were added to our kidney-panel. We identified likely deleterious...... of nephronophthisis. Exome sequencing identified ROBO1 variants in one family and a GREB1L variant in another family. GREB1L and ROBO1 were added to our kidney-gene panel and additional variants were identified. Next-generation sequencing substantially contributes to identifying causes of fetal kidney anomalies...

  14. Poincaré recurrences of DNA sequences

    Science.gov (United States)

    Frahm, K. M.; Shepelyansky, D. L.

    2012-01-01

    We analyze the statistical properties of Poincaré recurrences of Homo sapiens, mammalian, and other DNA sequences taken from the Ensembl Genome data base with up to 15 billion base pairs. We show that the probability of Poincaré recurrences decays in an algebraic way with the Poincaré exponent β≈4 even if the oscillatory dependence is well pronounced. The correlations between recurrences decay with an exponent ν≈0.6 that leads to an anomalous superdiffusive walk. However, for Homo sapiens sequences, with the largest available statistics, the diffusion coefficient converges to a finite value on distances larger than one million base pairs. We argue that the approach based on Poncaré recurrences determines new proximity features between different species and sheds a new light on their evolution history.

  15. Tritium pellet injection sequences for TFTR

    International Nuclear Information System (INIS)

    Houlberg, W.A.; Milora, S.L.; Attenberger, S.E.; Singer, C.E.; Schmidt, G.L.

    1983-01-01

    Tritium pellet injection into neutral deuterium, beam heated deuterium plasmas in the Tokamak Fusion Test Reactor (TFTR) is shown to be an attractive means of (1) minimizing tritium use per tritium discharge and over a sequence of tritium discharges; (2) greatly reducing the tritium load in the walls, limiters, getters, and cryopanels; (3) maintaining or improving instantaneous neutron production (Q); (4) reducing or eliminating deuterium-tritium (D-T) neutron production in non-optimized discharges; and (5) generally adding flexibility to the experimental sequences leading to optimal Q operation. Transport analyses of both compression and full-bore TFTR plasmas are used to support the above observations and to provide the basis for a proposed eight-pellet gas gun injector for the 1986 tritium experiments

  16. Bioinformatics for Next Generation Sequencing Data

    Directory of Open Access Journals (Sweden)

    Alberto Magi

    2010-09-01

    Full Text Available The emergence of next-generation sequencing (NGS platforms imposes increasing demands on statistical methods and bioinformatic tools for the analysis and the management of the huge amounts of data generated by these technologies. Even at the early stages of their commercial availability, a large number of softwares already exist for analyzing NGS data. These tools can be fit into many general categories including alignment of sequence reads to a reference, base-calling and/or polymorphism detection, de novo assembly from paired or unpaired reads, structural variant detection and genome browsing. This manuscript aims to guide readers in the choice of the available computational tools that can be used to face the several steps of the data analysis workflow.

  17. Seismic sequences in the Sombrero Seismic Zone

    Science.gov (United States)

    Pulliam, J.; Huerfano, V. A.; ten Brink, U.; von Hillebrandt, C.

    2007-05-01

    The northeastern Caribbean, in the vicinity of Puerto Rico and the Virgin Islands, has a long and well-documented history of devastating earthquakes and tsunamis, including major events in 1670, 1787, 1867, 1916, 1918, and 1943. Recently, seismicity has been concentrated to the north and west of the British Virgin Islands, in the region referred to as the Sombrero Seismic Zone by the Puerto Rico Seismic Network (PRSN). In the combined seismicity catalog maintained by the PRSN, several hundred small to moderate magnitude events can be found in this region prior to 2006. However, beginning in 2006 and continuing to the present, the rate of seismicity in the Sombrero suddenly increased, and a new locus of activity developed to the east of the previous location. Accurate estimates of seismic hazard, and the tsunamigenic potential of seismic events, depend on an accurate and comprehensive understanding of how strain is being accommodated in this corner region. Are faults locked and accumulating strain for release in a major event? Or is strain being released via slip over a diffuse system of faults? A careful analysis of seismicity patterns in the Sombrero region has the potential to both identify faults and modes of failure, provided the aggregation scheme is tuned to properly identify related events. To this end, we experimented with a scheme to identify seismic sequences based on physical and temporal proximity, under the assumptions that (a) events occur on related fault systems as stress is refocused by immediately previous events and (b) such 'stress waves' die out with time, so that two events that occur on the same system within a relatively short time window can be said to have a similar 'trigger' in ways that two nearby events that occurred years apart cannot. Patterns that emerge from the identification, temporal sequence, and refined locations of such sequences of events carry information about stress accommodation that is obscured by large clouds of

  18. [Fibrocystic breast disease--breast cancer sequence].

    Science.gov (United States)

    Habor, V; Habor, A; Copotoiu, C; Panţîru, A

    2010-01-01

    Fibrocystic breast disease has developed a major issue: the breast cancer sequence. Its involvement regarding the increse of breast cancer risk has 2 aspects: it may be either the marker of a prone tissue or a premalignant hystological deffect. Difficult differential diagnosis of benign proliferative breast lession and carcinoma led to the idea of sequency between the two: cancer does not initiate on normal mammary epithelia; it takes several proliferative stages for it to occur. In our series we analized a number of 677 breast surgical procedures where the pathologic examination reveals 115 cases (17%) of coexistence between cancer and fibrocystic breast disease. This aspect has proved to be related to earlier debut of breast cancer, suggesting that epithelial hyperplasia is a risk factor for breast cancer.

  19. The characterization of twenty sequenced human genomes.

    Directory of Open Access Journals (Sweden)

    Kimberly Pelak

    2010-09-01

    Full Text Available We present the analysis of twenty human genomes to evaluate the prospects for identifying rare functional variants that contribute to a phenotype of interest. We sequenced at high coverage ten "case" genomes from individuals with severe hemophilia A and ten "control" genomes. We summarize the number of genetic variants emerging from a study of this magnitude, and provide a proof of concept for the identification of rare and highly-penetrant functional variants by confirming that the cause of hemophilia A is easily recognizable in this data set. We also show that the number of novel single nucleotide variants (SNVs discovered per genome seems to stabilize at about 144,000 new variants per genome, after the first 15 individuals have been sequenced. Finally, we find that, on average, each genome carries 165 homozygous protein-truncating or stop loss variants in genes representing a diverse set of pathways.

  20. Learning sequences on the subject of energy

    International Nuclear Information System (INIS)

    1986-01-01

    The ten learning sequences follow on one another. Each picks on a particular aspect from the energy field. The subject notebooks are self-contained and can therefore be used independently. Apart from actual data and energy-related information, the information for the teacher contains: - proposals for teaching - suggestions for further activities - sample solutions for the pupil's sheets - references to the literature and media. The worksheets for the pupils are different; it should be possible to use the learning sequences in all classes of secondary school stage 1. The multicoloured foils for projectors should motivate, on the one hand, and on the other hand should help to check the results of learning. (orig./HP) [de

  1. Motif discovery in ranked lists of sequences

    DEFF Research Database (Denmark)

    Nielsen, Morten Muhlig; Tataru, Paula; Madsen, Tobias

    2016-01-01

    Motif analysis has long been an important method to characterize biological functionality and the current growth of sequencing-based genomics experiments further extends its potential. These diverse experiments often generate sequence lists ranked by some functional property. There is therefore...... advantage of the regular expression feature, including enrichments for combinations of different microRNA seed sites. The method is implemented and made publicly available as an R package and supports high parallelization on multi-core machinery....... a growing need for motif analysis methods that can exploit this coupled data structure and be tailored for specific biological questions. Here, we present an exploratory motif analysis tool, Regmex (REGular expression Motif EXplorer), which offers several methods to evaluate the correlation of motifs...

  2. Statistical processing of large image sequences.

    Science.gov (United States)

    Khellah, F; Fieguth, P; Murray, M J; Allen, M

    2005-01-01

    The dynamic estimation of large-scale stochastic image sequences, as frequently encountered in remote sensing, is important in a variety of scientific applications. However, the size of such images makes conventional dynamic estimation methods, for example, the Kalman and related filters, impractical. In this paper, we present an approach that emulates the Kalman filter, but with considerably reduced computational and storage requirements. Our approach is illustrated in the context of a 512 x 512 image sequence of ocean surface temperature. The static estimation step, the primary contribution here, uses a mixture of stationary models to accurately mimic the effect of a nonstationary prior, simplifying both computational complexity and modeling. Our approach provides an efficient, stable, positive-definite model which is consistent with the given correlation structure. Thus, the methods of this paper may find application in modeling and single-frame estimation.

  3. Sequence Matching Analysis for Curriculum Development

    Directory of Open Access Journals (Sweden)

    Liem Yenny Bendatu

    2015-06-01

    Full Text Available Many organizations apply information technologies to support their business processes. Using the information technologies, the actual events are recorded and utilized to conform with predefined model. Conformance checking is an approach to measure the fitness and appropriateness between process model and actual events. However, when there are multiple events with the same timestamp, the traditional approach unfit to result such measures. This study attempts to develop a sequence matching analysis. Considering conformance checking as the basis of this approach, this proposed approach utilizes the current control flow technique in process mining domain. A case study in the field of educational process has been conducted. This study also proposes a curriculum analysis framework to test the proposed approach. By considering the learning sequence of students, it results some measurements for curriculum development. Finally, the result of the proposed approach has been verified by relevant instructors for further development.

  4. Sequence-to-Sequence Prediction of Vehicle Trajectory via LSTM Encoder-Decoder Architecture

    OpenAIRE

    Park, Seong Hyeon; Kim, ByeongDo; Kang, Chang Mook; Chung, Chung Choo; Choi, Jun Won

    2018-01-01

    In this paper, we propose a deep learning based vehicle trajectory prediction technique which can generate the future trajectory sequence of surrounding vehicles in real time. We employ the encoder-decoder architecture which analyzes the pattern underlying in the past trajectory using the long short-term memory (LSTM) based encoder and generates the future trajectory sequence using the LSTM based decoder. This structure produces the $K$ most likely trajectory candidates over occupancy grid ma...

  5. An evaluation of Comparative Genome Sequencing (CGS by comparing two previously-sequenced bacterial genomes

    Directory of Open Access Journals (Sweden)

    Herring Christopher D

    2007-08-01

    Full Text Available Abstract Background With the development of new technology, it has recently become practical to resequence the genome of a bacterium after experimental manipulation. It is critical though to know the accuracy of the technique used, and to establish confidence that all of the mutations were detected. Results In order to evaluate the accuracy of genome resequencing using the microarray-based Comparative Genome Sequencing service provided by Nimblegen Systems Inc., we resequenced the E. coli strain W3110 Kohara using MG1655 as a reference, both of which have been completely sequenced using traditional sequencing methods. CGS detected 7 of 8 small sequence differences, one large deletion, and 9 of 12 IS element insertions present in W3110, but did not detect a large chromosomal inversion. In addition, we confirmed that CGS also detected 2 SNPs, one deletion and 7 IS element insertions that are not present in the genome sequence, which we attribute to changes that occurred after the creation of the W3110 lambda clone library. The false positive rate for SNPs was one per 244 Kb of genome sequence. Conclusion CGS is an effective way to detect multiple mutations present in one bacterium relative to another, and while highly cost-effective, is prone to certain errors. Mutations occurring in repeated sequences or in sequences with a high degree of secondary structure may go undetected. It is also critical to follow up on regions of interest in which SNPs were not called because they often indicate deletions or IS element insertions.

  6. Transcriptome sequencing of the Microarray Quality Control (MAQC RNA reference samples using next generation sequencing

    Directory of Open Access Journals (Sweden)

    Thierry-Mieg Danielle

    2009-06-01

    Full Text Available Abstract Background Transcriptome sequencing using next-generation sequencing platforms will soon be competing with DNA microarray technologies for global gene expression analysis. As a preliminary evaluation of these promising technologies, we performed deep sequencing of cDNA synthesized from the Microarray Quality Control (MAQC reference RNA samples using Roche's 454 Genome Sequencer FLX. Results We generated more that 3.6 million sequence reads of average length 250 bp for the MAQC A and B samples and introduced a data analysis pipeline for translating cDNA read counts into gene expression levels. Using BLAST, 90% of the reads mapped to the human genome and 64% of the reads mapped to the RefSeq database of well annotated genes with e-values ≤ 10-20. We measured gene expression levels in the A and B samples by counting the numbers of reads that mapped to individual RefSeq genes in multiple sequencing runs to evaluate the MAQC quality metrics for reproducibility, sensitivity, specificity, and accuracy and compared the results with DNA microarrays and Quantitative RT-PCR (QRTPCR from the MAQC studies. In addition, 88% of the reads were successfully aligned directly to the human genome using the AceView alignment programs with an average 90% sequence similarity to identify 137,899 unique exon junctions, including 22,193 new exon junctions not yet contained in the RefSeq database. Conclusion Using the MAQC metrics for evaluating the performance of gene expression platforms, the ExpressSeq results for gene expression levels showed excellent reproducibility, sensitivity, and specificity that improved systematically with increasing shotgun sequencing depth, and quantitative accuracy that was comparable to DNA microarrays and QRTPCR. In addition, a careful mapping of the reads to the genome using the AceView alignment programs shed new light on the complexity of the human transcriptome including the discovery of thousands of new splice variants.

  7. Sequence trajectory generation for garment handling systems

    OpenAIRE

    Liu, Honghai; Lin, Hua

    2008-01-01

    This paper presents a novel generic approach to the planning strategy of garment handling systems. An assumption is proposed to separate the components of such systems into a component for intelligent gripper techniques and a component for handling planning strategies. Researchers can concentrate on one of the two components first, then merge the two problems together. An algorithm is addressed to generate the trajectory position and a clothes handling sequence of clothes partitions, which ar...

  8. Adenovirus sequences required for replication in vivo.

    OpenAIRE

    Wang, K; Pearson, G D

    1985-01-01

    We have studied the in vivo replication properties of plasmids carrying deletion mutations within cloned adenovirus terminal sequences. Deletion mapping located the adenovirus DNA replication origin entirely within the first 67 bp of the adenovirus inverted terminal repeat. This region could be further subdivided into two functional domains: a minimal replication origin and an adjacent auxillary region which boosted the efficiency of replication by more than 100-fold. The minimal origin occup...

  9. Implicity Defined Neural Networks for Sequence Labeling

    Science.gov (United States)

    2017-02-13

    assumption - that a hid- den variable changes its state based only on its current state and observables. In finding maximum likelihood state sequences...this setup, we have the following variables : data X labels Y parameters θ and functions: implicit hidden layer definition H = F (θ, ξ,H) loss function L...tagging task. In future work, we intend to consider implicit varia - tions of other archetectures, such as the LSTM, as well as additional, more challenging

  10. Irreducible Tests for Space Mission Sequencing Software

    Science.gov (United States)

    Ferguson, Lisa

    2012-01-01

    As missions extend further into space, the modeling and simulation of their every action and instruction becomes critical. The greater the distance between Earth and the spacecraft, the smaller the window for communication becomes. Therefore, through modeling and simulating the planned operations, the most efficient sequence of commands can be sent to the spacecraft. The Space Mission Sequencing Software is being developed as the next generation of sequencing software to ensure the most efficient communication to interplanetary and deep space mission spacecraft. Aside from efficiency, the software also checks to make sure that communication during a specified time is even possible, meaning that there is not a planet or moon preventing reception of a signal from Earth or that two opposing commands are being given simultaneously. In this way, the software not only models the proposed instructions to the spacecraft, but also validates the commands as well.To ensure that all spacecraft communications are sequenced properly, a timeline is used to structure the data. The created timelines are immutable and once data is as-signed to a timeline, it shall never be deleted nor renamed. This is to prevent the need for storing and filing the timelines for use by other programs. Several types of timelines can be created to accommodate different types of communications (activities, measurements, commands, states, events). Each of these timeline types requires specific parameters and all have options for additional parameters if needed. With so many combinations of parameters available, the robustness and stability of the software is a necessity. Therefore a baseline must be established to ensure the full functionality of the software and it is here where the irreducible tests come into use.

  11. Implicitly Defined Neural Networks for Sequence Labeling

    Science.gov (United States)

    2017-07-31

    ularity has soared for the Long Short - Term Memory (LSTM) (Hochreiter and Schmidhuber, 1997) and vari- ants such as Gated Recurrent Unit (GRU) (Cho et...610. Sepp Hochreiter and Jürgen Schmidhuber. 1997. Long short - term memory . Neural computation 9(8):1735– 1780. Zhiheng Huang, Wei Xu, and Kai Yu. 2015...network are coupled together, in order to improve perfor- mance on complex, long -range dependencies in either direction of a sequence. We contrast our

  12. Analysis of Neuronal Sequences Using Pairwise Biases

    Science.gov (United States)

    2015-08-27

    semantic memory (knowledge of facts) and implicit memory (e.g., how to ride a bike ). Evidence for the participation of the hippocampus in the formation of...hippocampal formation in an attempt to be cured of severe epileptic seizures. Although the surgery was successful in regards to reducing the frequency and...very different from each other in many ways including duration and number of spikes. Still, these sequences share a similar trend in the general order

  13. Mitochondrial DNA sequence-based phylogenetic relationship ...

    Indian Academy of Sciences (India)

    cophaga ranges from 0.037–0.106 and 0.049–0.207 for COI and ND5 genes, respectively (tables 2 and 3). Analysis of genetic distance on the basis of sequence difference for both the mitochondrial genes shows very little genetic difference. The discrepancy in the phylogenetic trees based on individ- ual genes may be due ...

  14. The Sirenomelia Sequence: A Case History

    Directory of Open Access Journals (Sweden)

    Anis Fadhlaoui

    2010-01-01

    Full Text Available We report a case of sirenomelia sequence observed in an incident of preterm labor during the 29th gestational week. According to some authors, this syndrome should be classified separately from caudal regression syndrome and is likely to be the result of an abnormality taking place during the fourth gestational week, causing developmental abnormalities in the lower extremities, pelvis, genitalia, urinary tract and digestive organs. Despite recent progress in pathology, the etiopathogenesis of sirenomelia is still debated.

  15. The Sirenomelia Sequence: A Case History

    Science.gov (United States)

    Fadhlaoui, Anis; Khrouf, Mohamed; Gaigi, Soumaya; Zhioua, Fethi; Chaker, Anis

    2010-01-01

    We report a case of sirenomelia sequence observed in an incident of preterm labor during the 29th gestational week. According to some authors, this syndrome should be classified separately from caudal regression syndrome and is likely to be the result of an abnormality taking place during the fourth gestational week, causing developmental abnormalities in the lower extremities, pelvis, genitalia, urinary tract and digestive organs. Despite recent progress in pathology, the etiopathogenesis of sirenomelia is still debated. PMID:21769253

  16. The sirenomelia sequence: a case history.

    Science.gov (United States)

    Fadhlaoui, Anis; Khrouf, Mohamed; Gaigi, Soumaya; Zhioua, Fethi; Chaker, Anis

    2010-01-01

    We report a case of sirenomelia sequence observed in an incident of preterm labor during the 29th gestational week. According to some authors, this syndrome should be classified separately from caudal regression syndrome and is likely to be the result of an abnormality taking place during the fourth gestational week, causing developmental abnormalities in the lower extremities, pelvis, genitalia, urinary tract and digestive organs. Despite recent progress in pathology, the etiopathogenesis of sirenomelia is still debated.

  17. Clinical applications of sequencing take center stage

    OpenAIRE

    Glusman, Gustavo

    2013-01-01

    A report on the Advances in Genome Biology and Technology (AGBT) meeting, Marco Island, Florida, USA, February 20-23, 2013. This year's Advances in Genome Biology and Technology (AGBT) meeting reflected the current state of 'next generation' sequencing (NGS) technologies: significantly reduced competition and innovation, and a strong focus on standardization and application. Announcements of technological breakthroughs - a hallmark of previous AGBT meetings - were markedly absent, but existin...

  18. Image registration method for medical image sequences

    Science.gov (United States)

    Gee, Timothy F.; Goddard, James S.

    2013-03-26

    Image registration of low contrast image sequences is provided. In one aspect, a desired region of an image is automatically segmented and only the desired region is registered. Active contours and adaptive thresholding of intensity or edge information may be used to segment the desired regions. A transform function is defined to register the segmented region, and sub-pixel information may be determined using one or more interpolation methods.

  19. Cranial modularity and sequence heterochrony in mammals.

    Science.gov (United States)

    Goswami, Anjali

    2007-01-01

    Heterochrony, the temporal shifting of developmental events relative to each other, requires a degree of autonomy among those processes or structures. Modularity, the division of larger structures or processes into autonomous sets of internally integrated units, is often discussed in relation to the concept of heterochrony. However, the relationship between the developmental modules derived from studies of heterochrony and evolutionary modules, which should be of adaptive importance and relate to the genotype-phenotype map, has not been explicitly studied. I analyzed a series of sectioned and whole cleared-and-stained embryological and neonatal specimens, supplemented with published ontogenetic data, to test the hypothesis that bones within the same phenotypic modules, as determined by morphometric analysis, are developmentally integrated and will display coordinated heterochronic shifts across taxa. Modularity was analyzed in cranial bone ossification sequences of 12 therian mammals. A dataset of 12-18 developmental events was used to assess if modularity in developmental sequences corresponds to six phenotypic modules, derived from a recent morphometric analysis of cranial modularity in mammals. Kendall's tau was used to measure rank correlations, with randomization tests for significance. If modularity in developmental sequences corresponds to observed phenotypic modules, bones within a single phenotypic module should show integration of developmental timing, maintaining the same timing of ossification relative to each other, despite differences in overall ossification sequences across taxa. Analyses did not find any significant conservation of developmental timing within the six phenotypic modules, meaning that bones that are highly integrated in adult morphology are not significantly integrated in developmental timing.

  20. Complete Genome Sequences of 44 Arthrobacter Phages.

    Science.gov (United States)

    Klyczek, Karen K; Jacobs-Sera, Deborah; Adair, Tamarah L; Adams, Sandra D; Ball, Sarah L; Benjamin, Robert C; Bonilla, J Alfred; Breitenberger, Caroline A; Daniels, Charles J; Gaffney, Bobby L; Harrison, Melinda; Hughes, Lee E; King, Rodney A; Krukonis, Gregory P; Lopez, A Javier; Monsen-Collar, Kirsten; Pizzorno, Marie C; Rinehart, Claire A; Staples, Amanda K; Stowe, Emily L; Garlena, Rebecca A; Russell, Daniel A; Cresawn, Steven G; Pope, Welkin H; Hatfull, Graham F

    2018-02-01

    We report here the complete genome sequences of 44 phages infecting Arthrobacter sp. strain ATCC 21022. These phages have double-stranded DNA genomes with sizes ranging from 15,680 to 70,707 bp and G+C contents from 45.1% to 68.5%. All three tail types (belonging to the families Siphoviridae , Myoviridae , and Podoviridae ) are represented. Copyright © 2018 Klyczek et al.