Kato, N.
2017-12-01
Numerical simulations of earthquake cycles are conducted to investigate the origin of complexity of earthquake recurrence. There are two main causes of the complexity. One is self-organized stress heterogeneity due to dynamical effect. The other is the effect of interaction between some fault patches. In the model, friction on the fault is assumed to obey a rate- and state-dependent friction law. Circular patches of velocity-weakening frictional property are assumed on the fault. On the remaining areas of the fault, velocity-strengthening friction is assumed. We consider three models: Single patch model, two-patch model, and three-patch model. In the first model, the dynamical effect is mainly examined. The latter two models take into consideration the effect of interaction as well as the dynamical effect. Complex multiperiodic or aperiodic sequences of slip events occur when slip behavior changes from the seismic to aseismic, and when the degree of interaction between seismic patches is intermediate. The former is observed in all the models, and the latter is observed in the two-patch model and the three-patch model. Evolution of spatial distribution of shear stress on the fault suggests that aperiodicity at the transition from seismic to aseismic slip is caused by self-organized stress heterogeneity. The iteration maps of recurrence intervals of slip events in aperiodic sequences are examined, and they are approximately expressed by simple curves for aperiodicity at the transition from seismic to aseismic slip. In contrast, the iteration maps for aperiodic sequences caused by interaction between seismic patches are scattered and they are not expressed by simple curves. This result suggests that complex sequences caused by different mechanisms may be distinguished.
International Nuclear Information System (INIS)
Yan Zhizhong; Zhang Chuanzeng; Wang Yuesheng
2011-01-01
The band structures of in-plane elastic waves propagating in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity are analyzed in this paper. The localization of wave propagation is discussed by introducing the concept of the localization factor, which is calculated by the plane-wave-based transfer-matrix method. By treating the random disorder and aperiodicity as the deviation from the periodicity in a special way, three kinds of aperiodic phononic crystals that have normally distributed random disorder, Thue-Morse and Rudin-Shapiro sequence in one direction and translational symmetry in the other direction are considered and the band structures are characterized using localization factors. Besides, as a special case, we analyze the band gap properties of a periodic planar layered composite containing a periodic array of square inclusions. The transmission coefficients based on eigen-mode matching theory are also calculated and the results show the same behaviors as the localization factor does. In the case of random disorders, the localization degree of the normally distributed random disorder is larger than that of the uniformly distributed random disorder although the eigenstates are both localized no matter what types of random disorders, whereas, for the case of Thue-Morse and Rudin-Shapiro structures, the band structures of Thue-Morse sequence exhibit similarities with the quasi-periodic (Fibonacci) sequence not present in the results of the Rudin-Shapiro sequence.
Directory of Open Access Journals (Sweden)
Fred Lunnon
2009-06-01
Full Text Available We review the concept of the number wall as an alternative to the traditional linear complexity profile (LCP, and sketch the relationship to other topics such as linear feedback shift-register (LFSR and context-free Lindenmayer (D0L sequences. A remarkable ternary analogue of the Thue-Morse sequence is introduced having deficiency 2 modulo 3, and this property verified via the re-interpretation of the number wall as an aperiodic plane tiling.
PREFACE: 6th International Conference on Aperiodic Crystals (APERIODIC'09)
Grimm, Uwe; McGrath, Rónán; Degtyareva, Olga; Sharma, Hem Raj
2010-04-01
Aperiodic Logo Aperiodic'09, the sixth International Conference on Aperiodic Crystals, took place in Liverpool 13-18 September 2009. It was the first major conference in this interdisciplinary research field held in the UK. The conference, which was organised under the auspices of the Commission on Aperiodic Crystals of the International Union of Crystallography (IUCr), followed on from Aperiodic'94 (Les Diablerets, Switzerland), Aperiodic'97 (Alpe d'Huez, France), Aperiodic'2000 (Nijmegen, The Netherlands), Aperiodic'03 (Belo Horizonte, Brazil) and Aperiodic'06 (Zao, Japan). The next conference in the series will take place in Australia in 2012. The Aperiodic conference series is itself the successor to a series of Conferences on Modulated Structures, Polytypes and Quasicrystals (MOSPOQ), which were held in Marseilles (France) in 1984, Wroclaw (Poland) in 1986, Varanasi (India) in 1988 and Balatonszeplak (Hungary) in 1991. The remit of the conference covers two broad areas of research on aperiodic crystals, incommensurately modulated and composite crystals on the one hand, and quasicrystals on the other hand, sharing the property that they are aperiodically ordered solids. In addition, the conference also featured recent research on complex metal alloys, which are in fact periodically ordered solids. However, the term complex refers to their large unit cells, which may contain thousands of atoms, and as a consequence complex metal alloys share some of the properties of quasicrystalline solids. Aperiodic'09 attracted about 110 participants from across the world, including 20 UK-based scientists (the second largest group after Japan who sent 21 delegates). A particular feature of the conference series is its interdisciplinary character, and once again the range of disciplines of participants included mathematics, physics, crystallography and materials science. The programme started with three tutorial lectures on Sunday afternoon, presenting introductory overviews
ERP Indices of Stimulus Prediction in Letter Sequences
Directory of Open Access Journals (Sweden)
Edith Kaan
2014-10-01
Full Text Available Given the current focus on anticipation in perception, action and cognition, including language processing, there is a need for a method to tap into predictive processing in situations in which cue and feedback stimuli are not explicitly marked as such. To this aim, event related potentials (ERPs were obtained while participants viewed alphabetic letter sequences (“A”, “B”, “C”, “D”, “E”, …, in which the letters were highly predictable, and random sequences (“S”, “B”, “A”, “I”, “F”, “M”, …, without feedback. Occasionally, the presentation of a letter in a sequence was delayed by 300 ms. During this delay period, an increased negativity was observed for predictive versus random sequences. In addition, the early positivity following the delay was larger for predictive compared with random sequences. These results suggest that expectation-sensitive ERP modulations can be elicited in anticipation of stimuli that are not explicit targets, rewards, feedback or instructions, and that a delay can strengthen the prediction for a particular stimulus. Applications to language processing will be discussed.
Aperiodic-metamaterial-based absorber
Directory of Open Access Journals (Sweden)
Quanlong Yang
2017-09-01
Full Text Available The periodic-metamaterial-based perfect absorber has been studied broadly. Conversely, if the unit cell in the metamaterial-based absorber is arranged aperiodically (aperiodic-metamaterial-based absorber, how does it perform? Inspired by this, here we present a systematic study of the aperiodic-metamaterial-based absorber. By investigating the response of metamaterial absorbers based on periodic, Fibonacci, Thue-Morse, and quasicrystal lattices, we found that aperiodic-metamaterial-based absorbers could display similar absorption behaviors as the periodic one in one hand. However, their absorption behaviors show different tendency depending on the thicknesses of the spacer. Further studies on the angle and polarization dependence of the absorption behavior are also presented.
Thirty-two phase sequences design with good autocorrelation ...
Indian Academy of Sciences (India)
mum peak aperiodic autocorrelation sidelobe level one are called Barker Sequences. ... the generation and processing of polyphase signals have now become easy ..... Cook C E, Bernfield M 1967 An introduction to theory and application.
Band structures and localization properties of aperiodic layered phononic crystals
Energy Technology Data Exchange (ETDEWEB)
Yan Zhizhong, E-mail: zzyan@bit.edu.cn [Department of Applied Mathematics, Beijing Institute of Technology, Beijing 100081 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57078 Siegen (Germany)
2012-03-15
The band structures and localization properties of in-plane elastic waves with coupling of longitudinal and transverse modes oblique propagating in aperiodic phononic crystals based on Thue-Morse and Rudin-Shapiro sequences are studied. Using transfer matrix method, the concept of the localization factor is introduced and the correctness is testified through the Rytov dispersion relation. For comparison, the perfect periodic structure and the quasi-periodic Fibonacci system are also considered. In addition, the influences of the random disorder, local resonance, translational and/or mirror symmetries on the band structures of the aperiodic phononic crystals are analyzed in this paper.
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Mathematics of aperiodic order
Lenz, Daniel; Savinien, Jean
2015-01-01
What is order that is not based on simple repetition, that is, periodicity? How must atoms be arranged in a material so that it diffracts like a quasicrystal? How can we describe aperiodically ordered systems mathematically? Originally triggered by the – later Nobel prize-winning – discovery of quasicrystals, the investigation of aperiodic order has since become a well-established and rapidly evolving field of mathematical research with close ties to a surprising variety of branches of mathematics and physics. This book offers an overview of the state of the art in the field of aperiodic order, presented in carefully selected authoritative surveys. It is intended for non-experts with a general background in mathematics, theoretical physics or computer science, and offers a highly accessible source of first-hand information for all those interested in this rich and exciting field. Topics covered include the mathematical theory of diffraction, the dynamical systems of tilings or Delone sets, their cohomolog...
The effect of letter string length and report condition on letter recognition accuracy.
Raghunandan, Avesh; Karmazinaite, Berta; Rossow, Andrea S
Letter sequence recognition accuracy has been postulated to be limited primarily by low-level visual factors. The influence of high level factors such as visual memory (load and decay) has been largely overlooked. This study provides insight into the role of these factors by investigating the interaction between letter sequence recognition accuracy, letter string length and report condition. Letter sequence recognition accuracy for trigrams and pentagrams were measured in 10 adult subjects for two report conditions. In the complete report condition subjects reported all 3 or all 5 letters comprising trigrams and pentagrams, respectively. In the partial report condition, subjects reported only a single letter in the trigram or pentagram. Letters were presented for 100ms and rendered in high contrast, using black lowercase Courier font that subtended 0.4° at the fixation distance of 0.57m. Letter sequence recognition accuracy was consistently higher for trigrams compared to pentagrams especially for letter positions away from fixation. While partial report increased recognition accuracy in both string length conditions, the effect was larger for pentagrams, and most evident for the final letter positions within trigrams and pentagrams. The effect of partial report on recognition accuracy for the final letter positions increased as eccentricity increased away from fixation, and was independent of the inner/outer position of a letter. Higher-level visual memory functions (memory load and decay) play a role in letter sequence recognition accuracy. There is also suggestion of additional delays imposed on memory encoding by crowded letter elements. Copyright © 2016 Spanish General Council of Optometry. Published by Elsevier España, S.L.U. All rights reserved.
Kumar, Pawan; Parmananda, P.
2018-04-01
Experiments involving the Mercury Beating Heart (MBH) oscillator, exhibiting irregular (aperiodic) dynamics, are performed. In the first set of experiments, control over irregular dynamics of the MBH oscillator was obtained via a superimposed periodic voltage signal. These irregular (aperiodic) dynamics were recovered once the control was switched off. Subsequently, two MBH oscillators were coupled to attain synchronization of their aperiodic oscillations. Finally, two uncoupled MBH oscillators were subjected, repeatedly, to a common stochastic forcing, resulting in an enhancement of their mutual phase correlation.
Grimm, Uwe
2017-01-01
Quasicrystals are non-periodic solids that were discovered in 1982 by Dan Shechtman, Nobel Prize Laureate in Chemistry 2011. The mathematics that underlies this discovery or that proceeded from it, known as the theory of Aperiodic Order, is the subject of this comprehensive multi-volume series. This second volume begins to develop the theory in more depth. A collection of leading experts, among them Robert V. Moody, cover various aspects of crystallography, generalising appropriately from the classical case to the setting of aperiodically ordered structures. A strong focus is placed upon almost periodicity, a central concept of crystallography that captures the coherent repetition of local motifs or patterns, and its close links to Fourier analysis. The book opens with a foreword by Jeffrey C. Lagarias on the wider mathematical perspective and closes with an epilogue on the emergence of quasicrystals, written by Peter Kramer, one of the founders of the field.
Reclaiming Spare Capacity and Improving Aperiodic Response Times in Real-Time Environments
Directory of Open Access Journals (Sweden)
Liu Xue
2011-01-01
Full Text Available Abstract Scheduling recurring task sets that allow some instances of the tasks to be skipped produces holes in the schedule which are nonuniformly distributed. Similarly, when the recurring tasks are not strictly periodic but are sporadic, there is extra processor bandwidth arising because of irregular job arrivals. The additional computation capacity that results from skips or sporadic tasks can be reclaimed to service aperiodic task requests efficiently and quickly. We present techniques for improving the response times of aperiodic tasks by identifying nonuniformly distributed spare capacity—because of skips or sporadic tasks—in the schedule and adding such extra capacity to the capacity queue of a BASH server. These gaps can account for a significant portion of aperiodic capacity, and their reclamation results in considerable improvement to aperiodic response times. We present two schemes: NCLB-CBS, which performs well in periodic real-time environments with firm tasks, and NCLB-CUS, which can be deployed when the basic task set to schedule is sporadic. Evaluation via simulations and implementation suggests that performance improvements for aperiodic tasks can be obtained with limited additional overhead.
Gerke, Tim D.
Presented in this thesis is an investigation into aperiodic volume optical devices. The three main topics of research and discussion are the aperiodic volume optical devices that we call computer-generated volume holograms (CGVH), defects within periodic 3D photonic crystals, and non-periodic, but ordered 3D quasicrystals. The first of these devices, CGVHs, are designed and investigated numerically and experimentally. We study the performance of multi-layered amplitude computer-generated volume holograms in terms of efficiency and angular/frequency selectivity. Simulation results show that such aperiodic devices can increase diffraction efficiency relative to periodic amplitude volume holograms while maintaining angular and wavelength selectivity. CGVHs are also designed as voxelated volumes using a new projection optimization algorithm. They are investigated using a volumetric diffraction simulation and a standard 3D beam propagation technique as well as experimentally. Both simulation and experiment verify that the structures function according to their design. These represent the first diffractive structures that have the capacity for generating arbitrary transmission and reflection wave fronts and that provide the ability for multiplexing arbitrary functionality given different illumination conditions. Also investigated and discussed in this thesis are 3D photonic crystals and quasicrystals. We demonstrate that these devices can be fabricated using a femtosecond laser direct writing system that is particularly appropriate for fabrication of such arbitrary 3D structures. We also show that these devices can provide 3D partial bandgaps which could become complete bandgaps if fabricated using high index materials or by coating lower index materials with high index metals. Our fabrication method is particularly suited to the fabrication of engineered defects within the periodic or quasi-periodic systems. We demonstrate the potential for fabricating defects within
Effect of aperiodicity on the broadband reflection of silicon nanorod structures for photovoltaics.
Lin, Chenxi; Huang, Ningfeng; Povinelli, Michelle L
2012-01-02
We carry out a systematic numerical study of the effects of aperiodicity on silicon nanorod anti-reflection structures. We use the scattering matrix method to calculate the average reflection loss over the solar spectrum for periodic and aperiodic arrangements of nanorods. We find that aperiodicity can either improve or deteriorate the anti-reflection performance, depending on the nanorod diameter. We use a guided random-walk algorithm to design optimal aperiodic structures that exhibit lower reflection loss than both optimal periodic and random aperiodic structures.
Simulation of aperiodic bipedal sprinting.
Celik, Huseyin; Piazza, Stephen J
2013-08-01
Synthesis of legged locomotion through dynamic simulation is useful for exploration of the mechanical and control variables that contribute to efficient gait. Most previous simulations have made use of periodicity constraints, a sensible choice for investigations of steady-state walking or running. Sprinting from rest, however, is aperiodic by nature and this aperiodicity is central to the goal of the movement, as performance is determined in large part by a rapid acceleration phase early in the race. The purpose of this study was to create a novel simulation of aperiodic sprinting using a modified spring-loaded inverted pendulum (SLIP) biped model. The optimal control problem was to find the set of controls that minimized the time for the model to run 20 m, and this problem was solved using a direct multiple shooting algorithm that converts the original continuous time problem into piecewise discrete subproblems. The resulting nonlinear programming problem was solved iteratively using a sequential quadratic programming method. The starting point for the optimizer was an initial guess simulation that was a slow alternating-gait "jogging" simulation developed using proportional-derivative feedback to control trunk attitude, swing leg angle, and leg retraction and extension. The optimized aperiodic sprint simulation solution yielded a substantial improvement in locomotion time over the initial guess (2.79 s versus 6.64 s). Following optimization, the model produced forward impulses at the start of the sprint that were four times greater than those of the initial guess simulation, producing more rapid acceleration. Several gait features demonstrated in the optimized sprint simulation correspond to behaviors of human sprinters: forward trunk lean at the start; straightening of the trunk during acceleration; and a dive at the finish. Optimization resulted in reduced foot contact times (0.065 s versus 0.210 s), but contact times early in the optimized
Optimal design of aperiodic, vertical silicon nanowire structures for photovoltaics.
Lin, Chenxi; Povinelli, Michelle L
2011-09-12
We design a partially aperiodic, vertically-aligned silicon nanowire array that maximizes photovoltaic absorption. The optimal structure is obtained using a random walk algorithm with transfer matrix method based electromagnetic forward solver. The optimal, aperiodic structure exhibits a 2.35 times enhancement in ultimate efficiency compared to its periodic counterpart. The spectral behavior mimics that of a periodic array with larger lattice constant. For our system, we find that randomly-selected, aperiodic structures invariably outperform the periodic array.
Structural color of a lycaenid butterfly: analysis of an aperiodic multilayer structure
International Nuclear Information System (INIS)
Yoshioka, S; Shimizu, Y; Kinoshita, S; Matsuhana, B
2013-01-01
We investigated the structural color of the green wing of the lycaenid butterfly Chrysozephyrus brillantinus. Electron microscopy revealed that the bottom plate of the cover scale on the wing consists of an alternating air–cuticle multilayer structure. However, the thicknesses of the layers were not constant but greatly differed depending on the layer, unlike the periodic multilayer designs often adopted for artificial laser-reflecting mirrors. The agreement between the experimentally determined and theoretically calculated reflectance spectra led us to conclude that the multilayer interference in the aperiodic system is the primary origin of the structural color. We analyzed optical interference in this aperiodic system using a simple analytical model and found that two spectral peaks arise from constructive interference among different parts of the multilayer structure. We discuss the advantages and disadvantages of the aperiodic system over a periodic one. (paper)
Zhang, Chuan; Wang, Xingyuan; Wang, Chunpeng; Xia, Zhiqiu
This paper concerns the outer synchronization problem between two complex delayed networks via the method of aperiodically intermittent pinning control. Apart from previous works, internal delay and coupling delay are both involved in this model, and the designed intermittent controllers can be aperiodic. The main work in this paper can be summarized as follows: First, two cases of aperiodically intermittent control with constant gain and adaptive gain are implemented, respectively. The intermittent control and pinning control are combined to reduce consumptions further. Then, based on the Lyapunov stability theory, synchronization protocols are given by strict derivation. Especially, the designed controllers are indeed simple and valid in application of theory to practice. Finally, numerical examples put the proposed control methods to the test.
Directory of Open Access Journals (Sweden)
Hai-Feng Zhang
2017-07-01
Full Text Available In this paper, the properties of photonic band gaps (PBGs and defect modes of two-dimensional (2D fractal plasma photonic crystals (PPCs under a transverse-magnetic (TM wave are theoretically investigated by a modified plane wave expansion (PWE method. The configuration of 2D PPCs is the square lattices with the iteration rule of the Fibonacci sequence whose constituents are homogeneous and isotropic. The proposed 2D PPCs is filled with the dielectric cylinders in the plasma background. The accuracy and convergence of the present modified PWE method also are validated by a numerical example. The calculated results illustrate that the enough accuracy and good convergence can be achieved compared to the conventional PWE method, if the number of meshed grids is large enough. The dispersion curves of the proposed PPCs and 2D PPCs with a conventional square lattice are theoretically computed to study the properties of PBGs and defect modes. The simulated results demonstrate that the advantaged properties can be obtained in the proposed PPCs compared to the 2D conventional PPCs with similar lattices. If the Fibonacci sequence is introduced into the 2D PPCs, the larger PBGs and higher cutoff frequency can be achieved. The lower edges of PBGs are flat, which are originated from the Mie resonances. The defect modes can be considered as the quasi-localized states since the Fibonacci sequence has the self-similarity and non-periodicity at the same time. The effects of configurational parameters on the characters of the present PPCs are investigated. The results show that the PBGs and defect modes can be easily manipulated by tuning those parameters.
Yin, Yiheng; Niu, Yanxiong; Zhang, Huiyun; Zhang, Yuping; Liu, Haiyue
2016-02-01
Utilizing the transfer matrix method, we develop the electronic band structure and transport properties in Thue-Morse aperiodic graphene superlattices with magnetic barriers. It is found that the normal transmission is blocked and the position of the Dirac point can be shifted along the wavevector axis by changing the height and width ratio of magnetic barriers, which is intrinsic different from electronic field modulated superlattices. In addition, the angular threshold property of the transmission spectra and the oscillatory property of the conductance have been studied.
Creating aperiodic photonic structures by synthesized Mathieu-Gauss beams
Vasiljević, Jadranka M.; Zannotti, Alessandro; Timotijević, Dejan V.; Denz, Cornelia; Savić, Dragana M. Jović
2017-08-01
We demonstrate a kind of aperiodic photonic structure realized using the interference of multiple Mathieu-Gauss beams. Depending on the beam configurations, their mutual distances, angles of rotation, or phase relations we are able to observe different classes of such aperiodic optically induced refractive index structures. Our experimental approach is based on the optical induction in a single parallel writing process.
Letter Knowledge in Parent–Child Conversations
Robins, Sarah; Treiman, Rebecca; Rosales, Nicole
2014-01-01
Learning about letters is an important component of emergent literacy. We explored the possibility that parent speech provides information about letters, and also that children’s speech reflects their own letter knowledge. By studying conversations transcribed in CHILDES (MacWhinney, 2000) between parents and children aged one to five, we found that alphabetic order influenced use of individual letters and letter sequences. The frequency of letters in children’s books influenced parent utterances throughout the age range studied, but children’s utterances only after age two. Conversations emphasized some literacy-relevant features of letters, such as their shapes and association with words, but not letters’ sounds. Describing these patterns and how they change over the preschool years offers important insight into the home literacy environment. PMID:25598577
The DNA electronic specific heat at low temperature: The role of aperiodicity
Energy Technology Data Exchange (ETDEWEB)
Sarmento, R.G. [Departamento de Física, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Mendes, G.A. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Vasconcelos, M.S. [Escola de Ciências e Tecnologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Ujsághy, O. [Department of Theoretical Physics and Condensed Matter Research Group of the Hungarian Academy of Sciences, Budapest University of Technology and Economics, Budafoki út 8, H-1521 Budapest (Hungary); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza, CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza, CE (Brazil)
2012-07-16
The electronic specific heat spectra at constant volume (C{sub V}) of a long-range correlated extended ladder model, mimicking a DNA molecule, is theoretically analyzed for a stacked array of a double-stranded structure made up from the nucleotides guanine G, adenine A, cytosine C and thymine T. The role of the aperiodicity on C{sub V} is discussed, considering two different nucleotide arrangements with increasing disorder, namely the Fibonacci and the Rudin–Shapiro quasiperiodic structures. Comparisons are made for different values of the band fillings, considering also a finite segment of natural DNA, as part of the human chromosome Ch22. -- Highlights: ► Quasiperiodic sequence to mimic the DNA nucleotides arrangement. ► Electronic tight-binding Hamiltonian model. ► Electronic density of states. ► Electronic specific heat spectra.
A method to identify aperiodic disturbances in the ionosphere
Wang, J.-S.; Chen, Z.; Huang, C.-M.
2014-05-01
In this paper, variations in the ionospheric F2 layer's critical frequency are decomposed into their periodic and aperiodic components. The latter include disturbances caused both by geophysical impacts on the ionosphere and random noise. The spectral whitening method (SWM), a signal-processing technique used in statistical estimation and/or detection, was used to identify aperiodic components in the ionosphere. The whitening algorithm adopted herein is used to divide the Fourier transform of the observed data series by a real envelope function. As a result, periodic components are suppressed and aperiodic components emerge as the dominant contributors. Application to a synthetic data set based on significant simulated periodic features of ionospheric observations containing artificial (and, hence, controllable) disturbances was used to validate the SWM for identification of aperiodic components. Although the random noise was somewhat enhanced by post-processing, the artificial disturbances could still be clearly identified. The SWM was then applied to real ionospheric observations. It was found to be more sensitive than the often-used monthly median method to identify geomagnetic effects. In addition, disturbances detected by the SWM were characterized by a Gaussian-type probability density function over all timescales, which further simplifies statistical analysis and suggests that the disturbances thus identified can be compared regardless of timescale.
Thermal Emission Control via Bandgap Engineering in Aperiodically Designed Nanophotonic Devices
Directory of Open Access Journals (Sweden)
Enrique Maciá
2015-05-01
Full Text Available Aperiodic photonic crystals can open up novel routes for more efficient photon management due to increased degrees of freedom in their design along with the unique properties brought about by the long-range aperiodic order as compared to their periodic counterparts. In this work we first describe the fundamental notions underlying the idea of thermal emission/absorption control on the basis of the systematic use of aperiodic multilayer designs in photonic quasicrystals. Then, we illustrate the potential applications of this approach in order to enhance the performance of daytime radiative coolers and solar thermoelectric energy generators.
Koju, Vijay
Photonic crystals and their use in exciting Bloch surface waves have received immense attention over the past few decades. This interest is mainly due to their applications in bio-sensing, wave-guiding, and other optical phenomena such as surface field enhanced Raman spectroscopy. Improvement in numerical modeling techniques, state of the art computing resources, and advances in fabrication techniques have also assisted in growing interest in this field. The ability to model photonic crystals computationally has benefited both the theoretical as well as experimental communities. It helps the theoretical physicists in solving complex problems which cannot be solved analytically and helps to acquire useful insights that cannot be obtained otherwise. Experimentalists, on the other hand, can test different variants of their devices by changing device parameters to optimize performance before fabrication. In this dissertation, we develop two commonly used numerical techniques, namely transfer matrix method, and rigorous coupled wave analysis, in C++ and MATLAB, and use two additional software packages, one open-source and another commercial, to model one-dimensional photonic crystals. Different variants of one-dimensional multilayered structures such as perfectly periodic dielectric multilayers, quasicrystals, aperiodic multilayer are modeled, along with one-dimensional photonic crystals with gratings on the top layer. Applications of Bloch surface waves, along with new and novel aperiodic dielectric multilayer structures that support Bloch surface waves are explored in this dissertation. We demonstrate a slow light configuration that makes use of Bloch Surface Waves as an intermediate excitation in a double-prism tunneling configuration. This method is simple compared to the more usual techniques for slowing light using the phenomenon of electromagnetically induced transparency in atomic gases or doped ionic crystals operated at temperatures below 4K. Using a semi
SIMULATED PERFORMANCE OF TIMESCALE METRICS FOR APERIODIC LIGHT CURVES
Energy Technology Data Exchange (ETDEWEB)
Findeisen, Krzysztof; Hillenbrand, Lynne [Cahill Center for Astronomy and Astrophysics, California Institute of Technology, MC 249-17, Pasadena, CA 91125 (United States); Cody, Ann Marie, E-mail: krzys@astro.caltech.edu [Spitzer Science Center, California Institute of Technology, MC 314-6, Pasadena, CA 91125 (United States)
2015-01-10
Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs.
SIMULATED PERFORMANCE OF TIMESCALE METRICS FOR APERIODIC LIGHT CURVES
International Nuclear Information System (INIS)
Findeisen, Krzysztof; Hillenbrand, Lynne; Cody, Ann Marie
2015-01-01
Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs
Wave propagation in one-dimensional solid-fluid quasi-periodic and aperiodic phononic crystals
Energy Technology Data Exchange (ETDEWEB)
Chen Ali, E-mail: alchen@bjtu.edu.cn [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Wang Yuesheng [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57068 Siegen (Germany)
2012-02-01
The propagation of the elastic waves in one-dimensional (1D) solid-fluid quasi-periodic phononic crystals is studied by employing the concept of the localization factor, which is calculated by the transfer matrix method. The solid-fluid interaction effect at the interfaces between the solid and the fluid components is considered. For comparison, the periodic systems and aperiodic Thue-Morse sequence are also analyzed in this paper. The splitting phenomenon of the pass bands and bandgaps are discussed for these 1D solid-fluid systems. At last the influences of the material impedance ratios on the band structures of the 1D solid-fluid quasi-periodic phononic crystals arranged as Fibonacci sequence are discussed.
Diffuse scattering from periodic and aperiodic crystals
International Nuclear Information System (INIS)
Frey, F.
1997-01-01
A (selective) review on diffuse scattering from periodic and aperiodic crystalline solids is given to demonstrate the wide field of applications in basic and applied research. After a general introduction in this field each topic is exemplified by one or two examples. Main emphasis is laid on recent work. More established work, e.g., on diffuse scattering from metals and alloys, polytypes, stacking disorder from layered structures, etc. is omitted due to the availability of excellent textbooks and reviews. Finally a short summary of recent developments of experimental methods and evaluation techniques is presented. (orig.)
Dynamical mechanisms for sensitive response of aperiodic firing cells to external stimulation
International Nuclear Information System (INIS)
Xie Yong; Xu Jianxue; Hu Sanjue; Kang Yanmei; Yang Hongjun; Duan Yubin
2004-01-01
An interesting phenomenon that aperiodic firing neurons have a higher sensitivity to drugs than periodic firing neurons have been reported for the chronically compressed dorsal root ganglion neurons in rats. In this study, the dynamical mechanisms for such a phenomenon are uncovered from the viewpoint of dynamical systems theory. We use the Rose-Hindmarsh neuron model to illustrate our opinions. Periodic orbit theory is introduced to characterize the dynamical behavior of aperiodic firing neurons. It is considered that bifurcations, crises and sensitive dependence of chaotic motions on control parameters can be the underlying mechanisms. And then, a similar analysis is applied to the modified Chay model describing the firing behavior of pancreatic beta cells. The same dynamical mechanisms can be obtained underlying that aperiodic firing cells are more sensitive to external stimulation than periodic firing ones. As a result, we conjecture that sensitive response of aperiodic firing cells to external stimulation is a universal property of excitable cells
The Syntax of Persuasion: Two Business Letters of Request.
Limaye, Mohan R.
1983-01-01
Business letter-writers are advised to develop reader empathy and benefit before they ask a favor. The author analyzed two model 16th century letters of request to determine if similar advice was given in the past, and found that the request was subordinate to building a mutually beneficial relationship. (PD)
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Composite Binary Sequences with a Large Ensemble and Zero Correlation Zone
Directory of Open Access Journals (Sweden)
S. S. Yudachev
2015-01-01
Full Text Available The article considers a proposed class of derived signals such as composite binary sequences for application in advanced spread spectrum radio systems of various purposes, using signals based on spectrum spreading by direct sequence method. Considered composite sequences, having a representative set of lengths and unique correlation properties, compares favorably with the widely used at present large ensembles formed on a single algorithmic basis. To evaluate the properties of the composite sequences generated on the basis of two components - the Barker code and Kerdock sequences, expressions of periodic and aperiodic correlation functions are given.An algorithm for generating practical ensembles of composite sequences is presented. On the basis of the algorithm and its software implementation in C #, the samples of the sequence ensembles of various lengths were obtained and their periodic and aperiodic correlation functions and statistical characteristics were studied in detail. As an illustration, some of the most typical correlation functions are presented. The most remarkable characteristics allowing a ssessing the feasibility of using this type of sequences in the design of specific types of radio systems are considered.On the basis of the proposed program and the performed calculations the conclusions can be drawn about the possibility of using the sequences of these classes, with the aim of reducing intra-system disturbance in the projected spread spectrum CDMA.
Aperiodicity Correction for Rotor Tip Vortex Measurements
Ramasamy, Manikandan; Paetzel, Ryan; Bhagwat, Mahendra J.
2011-01-01
The initial roll-up of a tip vortex trailing from a model-scale, hovering rotor was measured using particle image velocimetry. The unique feature of the measurements was that a microscope was attached to the camera to allow much higher spatial resolution than hitherto possible. This also posed some unique challenges. In particular, the existing methodologies to correct for aperiodicity in the tip vortex locations could not be easily extended to the present measurements. The difficulty stemmed from the inability to accurately determine the vortex center, which is a prerequisite for the correction procedure. A new method is proposed for determining the vortex center, as well as the vortex core properties, using a least-squares fit approach. This approach has the obvious advantage that the properties are derived from not just a few points near the vortex core, but from a much larger area of flow measurements. Results clearly demonstrate the advantage in the form of reduced variation in the estimated core properties, and also the self-consistent results obtained using three different aperiodicity correction methods.
Energy Technology Data Exchange (ETDEWEB)
Anderson, P. Duke [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Koleske, Daniel D. [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Povinelli, Michelle L. [Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Subramania, Ganapathi [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States)
2017-10-01
For this study, we experimentally investigate a new class of quasi-aperiodic structures for improving the emission pattern in nanowire arrays. Efficient normal emission, as well as lasing, can be obtained from III-nitride photonic crystal (PhC) nanowire arrays that utilize slow group velocity modes near the Γ-point in reciprocal space. However, due to symmetry considerations, the emitted far-field pattern of such modes are often ‘donut’-like. Many applications, including lighting for displays or lasers, require a more uniform beam profile in the far-field. Previous work has improved far-field beam uniformity of uncoupled modes by changing the shape of the emitting structure. However, in nanowire systems, the shape of nanowires cannot always be arbitrarily changed due to growth or etch considerations. Here, we investigate breaking symmetry by instead changing the position of emitters. Using a quasi-aperiodic geometry, which changes the emitter position within a photonic crystal supercell (2x2), we are able to linearize the photonic bandstructure near the Γ-point and greatly improve emitted far-field uniformity. We realize the III-nitride nanowires structures using a top-down fabrication procedure that produces nanowires with smooth, vertical sidewalls. Comparison of room-temperature micro-photoluminescence (µ-PL) measurements between periodic and quasi-aperiodic nanowire arrays reveal resonances in each structure, with the simple periodic structure producing a donut beam in the emitted far-field and the quasi-aperiodic structure producing a uniform Gaussian-like beam. We investigate the input pump power vs. output intensity in both systems and observe the simple periodic array exhibiting a non-linear relationship, indicative of lasing. We believe that the quasi-aperiodic approach studied here provides an alternate and promising strategy for shaping the emission pattern of nanoemitter systems.
Combinations of response-reinforcer relations in periodic and aperiodic schedules.
Kuroda, Toshikazu; Cançado, Carlos R X; Lattal, Kennon A; Elcoro, Mirari; Dickson, Chata A; Cook, James E
2013-03-01
Key pecking of 4 pigeons was studied under a two-component multiple schedule in which food deliveries were arranged according to a fixed and a variable interfood interval. The percentage of response-dependent food in each component was varied, first in ascending (0, 10, 30, 70 and 100%) and then in descending orders, in successive conditions. The change in response rates was positively related to the percentage of response-dependent food in each schedule component. Across conditions, positively accelerated and linear patterns of responding occurred consistently in the fixed and variable components, respectively. These results suggest that the response-food dependency determines response rates in periodic and aperiodic schedules, and that the temporal distribution of food determines response patterns independently of the response-food dependency. Running rates, but not postfood pauses, also were positively related to the percentage of dependent food in each condition, in both fixed and variable components. Thus, the relation between overall response rate and the percentage of dependent food was mediated by responding that occurred after postfood pausing. The findings together extend previous studies wherein the dependency was either always present or absent, and increase the generality of the effects of variations in the response-food dependency from aperiodic to periodic schedules. © Society for the Experimental Analysis of Behavior.
Periodic and aperiodic flow patterns around an airfoil with leading-edge protuberances
Cai, Chang; Zuo, Zhigang; Maeda, Takao; Kamada, Yasunari; Li, Qing'an; Shimamoto, Kensei; Liu, Shuhong
2017-11-01
Recently leading-edge protuberances have attracted great attention as a passive method for separation control. In this paper, the effect of multiple leading-edge protuberances on the performance of a two-dimensional airfoil is investigated through experimental measurement of aerodynamic forces, surface tuft visualization, and numerical simulation. In contrast to the sharp stall of the baseline airfoil with large hysteresis effect during AOA (angle of attack) increasing and decreasing, the stall process of the modified airfoil with leading-edge protuberances is gentle and stable. Flow visualization revealed that the flow past each protuberance is periodic and symmetric at small AOAs. Streamwise vortices are generated on the shoulders of the protuberance, leading to a larger separation around the valley sections and a longer attachment along the peak sections. When some critical AOA is exceeded, aperiodic and asymmetric flow patterns occur on the protuberances at different spanwise positions, with leading-edge separation on some of the valley sections and non-stalled condition elsewhere. A combined mechanism, involving both the compartmentalization effect of the slender momentum-enhanced attached flows on the protuberance peaks and the downwash effect of the local stalled region with low circulation, is proposed to explain the generation of the aperiodic flow patterns. The influence of the number of protuberances is also investigated, which shows similar aperiodic flow patterns. The distance between the neighboring local stalled valley sections is found to be in the range of 4-7 times the protuberance wavelength. According to the proposed mechanism, it is speculated that the distance between the neighboring local stalled valley sections is inclined to increase with a smaller protuberance amplitude or at a larger AOA.
Self-similar transmission properties of aperiodic Cantor potentials in gapped graphene
Rodríguez-González, Rogelio; Rodríguez-Vargas, Isaac; Díaz-Guerrero, Dan Sidney; Gaggero-Sager, Luis Manuel
2016-01-01
We investigate the transmission properties of quasiperiodic or aperiodic structures based on graphene arranged according to the Cantor sequence. In particular, we have found self-similar behaviour in the transmission spectra, and most importantly, we have calculated the scalability of the spectra. To do this, we implement and propose scaling rules for each one of the fundamental parameters: generation number, height of the barriers and length of the system. With this in mind we have been able to reproduce the reference transmission spectrum, applying the appropriate scaling rule, by means of the scaled transmission spectrum. These scaling rules are valid for both normal and oblique incidence, and as far as we can see the basic ingredients to obtain self-similar characteristics are: relativistic Dirac electrons, a self-similar structure and the non-conservation of the pseudo-spin.
Directory of Open Access Journals (Sweden)
Patrick Chi-wai LEE
2016-09-01
Full Text Available Based on two appeal letters from (i Oxfam Hong Kong and (ii Hong Kong Committee For United Nations Children's Fund (UNICEF, this paper aims to study the rhetorical choices of promotion and structural moves of two appeal letters, exploring whether the philanthropic discourse can be viewed in line with the promotional genre. The findings appear to reveal that there is a hybrid form of promotional genre in philanthropic discourse, with reference to Bhatia’s (1998 generic patterns in fund-raising discourse framework. There are similar structural moves of advertising, although the move sequences could vary. However, the move of “introducing the cause” is always found at the very beginning because the readers are more interested to realise what the main theme of the appeal letter is. In addition, appeal letters are found to be modelled in promotional genre, in which they are rhetorical choices of promotion attracting attention from readers – by using “you” and marked devices of attention getters. The findings in this study appear to be in line with the argument that promotional concerns have influenced the nature of philanthropic discourse.
An aperiodic phenomenon of the unscented Kalman filter in filtering noisy chaotic signals
Institute of Scientific and Technical Information of China (English)
无
2007-01-01
A non-periodic oscillatory behavior of the unscented Kalman filter (UKF) when used to filter noisy contaminated chaotic signals is reported. We show both theoretically and experimentally that the gain of the UKF may not converge or diverge but oscillate aperiodically. More precisely, when a nonlinear system is periodic, the Kalman gain and error covariance of the UKF converge to zero. However, when the system being considered is chaotic, the Kalman gain either converges to a fixed point with a magnitude larger than zero or oscillates aperiodically.
Maestre, H; Torregrosa, A J; Fernández-Pousa, C R; Rico, M L; Capmany, J
2008-05-01
We report a dual-wavelength continuous-wave laser at 542.4 and 546.8 nm based on an Nd(3+)-doped aperiodically poled lithium niobate crystal. Two fundamental infrared (IR) wavelengths at 1084.8 and 1093.6 nm are simultaneously oscillated and self-frequency-doubled to green. The aperiodic domain distribution patterned in the crystal allows for quasi-phase matched self-frequency-doubling of both IR fundamentals while avoiding their sum-frequency mixing.
Intrinsic periodic and aperiodic stochastic resonance in an electrochemical cell
Tiwari, Ishant; Phogat, Richa; Parmananda, P.; Ocampo-Espindola, J. L.; Rivera, M.
2016-08-01
In this paper we show the interaction of a composite of a periodic or aperiodic signal and intrinsic electrochemical noise with the nonlinear dynamics of an electrochemical cell configured to study the corrosion of iron in an acidic media. The anodic voltage setpoint (V0) in the cell is chosen such that the anodic current (I ) exhibits excitable fixed point behavior in the absence of noise. The subthreshold periodic (aperiodic) signal consists of a train of rectangular pulses with a fixed amplitude and width, separated by regular (irregular) time intervals. The irregular time intervals chosen are of deterministic and stochastic origins. The amplitude of the intrinsic internal noise, regulated by the concentration of chloride ions, is then monotonically increased, and the provoked dynamics are analyzed. The signal to noise ratio and the cross-correlation coefficient versus the chloride ions' concentration curves have a unimodal shape indicating the emergence of an intrinsic periodic or aperiodic stochastic resonance. The abscissa for the maxima of these unimodal curves correspond to the optimum value of intrinsic noise where maximum regularity of the invoked dynamics is observed. In the particular case of the intrinsic periodic stochastic resonance, the scanning electron microscope images for the electrode metal surfaces are shown for certain values of chloride ions' concentrations. These images, qualitatively, corroborate the emergence of order as a result of the interaction between the nonlinear dynamics and the composite signal.
Simulation of photonic waveguides with deterministic aperiodic nanostructures for biosensing
DEFF Research Database (Denmark)
Neustock, Lars Thorben; Paulsen, Moritz; Jahns, Sabrina
2016-01-01
Photonic waveguides with deterministic aperiodic corrugations offer rich spectral characteristics under surface-normal illumination. The finite-element method (FEM), the finite-difference time-domain (FDTD) method and a rigorous coupled wave algorithm (RCWA) are compared for computing the near...
Trace maps of general substitutional sequences
International Nuclear Information System (INIS)
Kolar, M.; Nori, F.
1990-01-01
It is shown that for arbitrary n, there exists a trace map for any n-letter substitutional sequence. Trace maps are explicitly obtained for the well-known circle and Rudin-Shapiro sequences which can be defined by means of substitution rules on three and four letters, respectively. The properties of the two trace maps and their consequences for various spectral properties are briefly discussed
A Finite Abelian Group of Two-Letter Inversions
Directory of Open Access Journals (Sweden)
Sherwin E. Balbuena
2015-11-01
Full Text Available In abstract algebra, the study of concrete groups is fundamentally important to beginners. Most commonly used groups as examples are integer addition modulo n, real number addition and multiplication, permutation groups, and groups of symmetry. The last two examples are finite non-abelian groups and can be investigated with the aid of concrete representations. This study presents a finite abelian group of inversions of two letter symbols with vertical and horizontal axes of symmetry and whose binary operation is established through motions like alternation, rotation, reflection, and a combination of two or all motions.
Non-commutative Chern numbers for generic aperiodic discrete systems
Bourne, Chris; Prodan, Emil
2018-06-01
The search for strong topological phases in generic aperiodic materials and meta-materials is now vigorously pursued by the condensed matter physics community. In this work, we first introduce the concept of patterned resonators as a unifying theoretical framework for topological electronic, photonic, phononic etc (aperiodic) systems. We then discuss, in physical terms, the philosophy behind an operator theoretic analysis used to systematize such systems. A model calculation of the Hall conductance of a 2-dimensional amorphous lattice is given, where we present numerical evidence of its quantization in the mobility gap regime. Motivated by such facts, we then present the main result of our work, which is the extension of the Chern number formulas to Hamiltonians associated to lattices without a canonical labeling of the sites, together with index theorems that assure the quantization and stability of these Chern numbers in the mobility gap regime. Our results cover a broad range of applications, in particular, those involving quasi-crystalline, amorphous as well as synthetic (i.e. algorithmically generated) lattices.
On Coding Non-Contiguous Letter Combinations
Directory of Open Access Journals (Sweden)
Frédéric eDandurand
2011-06-01
Full Text Available Starting from the hypothesis that printed word identification initially involves the parallel mapping of visual features onto location-specific letter identities, we analyze the type of information that would be involved in optimally mapping this location-specific orthographic code onto a location-invariant lexical code. We assume that some intermediate level of coding exists between individual letters and whole words, and that this involves the representation of letter combinations. We then investigate the nature of this intermediate level of coding given the constraints of optimality. This intermediate level of coding is expected to compress data while retaining as much information as possible about word identity. Information conveyed by letters is a function of how much they constrain word identity and how visible they are. Optimization of this coding is a combination of minimizing resources (using the most compact representations and maximizing information. We show that in a large proportion of cases, non-contiguous letter sequences contain more information than contiguous sequences, while at the same time requiring less precise coding. Moreover, we found that the best predictor of human performance in orthographic priming experiments was within-word ranking of conditional probabilities, rather than average conditional probabilities. We conclude that from an optimality perspective, readers learn to select certain contiguous and non-contiguous letter combinations as information that provides the best cue to word identity.
Topological aperiodicity for product systems over semigroups of Ore type
DEFF Research Database (Denmark)
Kwasniewski, Bartosz; Szymanski, Wojciech
2016-01-01
aperiodicity condition on the latter, we obtain the uniqueness theorem and a simplicity criterion for the algebras in question. These results generalize the corresponding ones for crossed products by discrete groups, due to Archbold and Spielberg, and for Exel's crossed products, due to Exel and Vershik...
Robins, Sarah; Ghosh, Dina; Rosales, Nicole; Treiman, Rebecca
2014-01-01
When formal literacy instruction begins, around the age of 5 or 6, children from families low in socioeconomic status (SES) tend to be less prepared than children from families of higher SES. The goal of our study is to explore one route through which SES may influence children's early literacy skills: informal conversations about letters. The study builds on previous studies (Robins and Treiman, 2009; Robins et al., 2012, 2014) of parent-child conversations that show how U. S. parents and their young children talk about writing and provide preliminary evidence about similarities and differences in parent-child conversations as a function of SES. Focusing on parents and children aged three to five, we conducted five separate analyses of these conversations, asking whether and how family SES influences the previously established patterns. Although we found talk about letters in both upper and lower SES families, there were differences in the nature of these conversations. The proportion of letter talk utterances that were questions was lower in lower SES families and, of all the letter names that lower SES families talked about, more of them were uttered in isolation rather than in sequences. Lower SES families were especially likely to associate letters with the child's name, and they placed more emphasis on sequences in alphabetic order. We found no SES differences in the factors that influenced use of particular letter names (monograms), but there were SES differences in two-letter sequences (digrams). Focusing on the alphabet and on associations between the child's name and the letters within it may help to interest the child in literacy activities, but they many not be very informative about the relationship between letters and words in general. Understanding the patterns in parent-child conversations about letters is an important first step for exploring their contribution to children's early literacy skills and school readiness.
The Philosophical and Mathematical Context of two Gerbert's Musical Letters to Constantine
Otisk, Marek
2015-04-01
The paper deals with two letters written by Gerbert of Aurillac to Constantine of Fleury. In these letters Gerbert points out some passages from Boethius’s Introduction to Music (II, 10; respectively IV, 2 and II, 21) concerning mathematical operations (multiplication and subtraction) with superparticular ratios i.e. ratios of the type (n+1) : n. The musical harmonies rule the Cosmos and the Celestial Spheres according to Martianus Capella De nuptiis Philologiae et Mercurii; Music is the basis for understanting Astronomy. This paper follows two main aims: philosophical importance of music as liberal art and mathematical basis of the Pythagorean tuning.
Aperiodic spin state ordering of bistable molecules and its photoinducede erasing
Czech Academy of Sciences Publication Activity Database
Collet, E.; Watanabe, H.; Bréfuel, N.; Palatinus, Lukáš; Roudaut, L.; Toupet, L.; Tanaka, K.; Tuchagues, J.-P.; Fertey, P.; Ravy, S.; Toudic, B.; Cailleau, H.
2012-01-01
Roč. 109, č. 25 (2012), "257206-1"-"257206-5" ISSN 0031-9007 Institutional research plan: CEZ:AV0Z10100521 Keywords : photocrystallography * aperiodic structure * spin-state ordering Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 7.943, year: 2012
Radiation-disorder and aperiodicity in irradiated ceramics
International Nuclear Information System (INIS)
Hobbs, L.W.
1992-01-01
This final technical report documents the accomplishments of the program of research entitled ''Radiation Disorder and Aperiodicity in Irradiated Ceramics'' for the period June 22, 1989--June 21, 1992. This research forms the latest part on an on-going program, begun at MIT in 1983 under DOE support, which has had as its objectives investigation of the responses in radiation environments of ceramics heavily-irradiated with electrons, neutrons and ions, with potential applications to fusion energy technology and high-level nuclear waste storage. Materials investigated have included SiO 2 , MgAl 2 O 4 , Al 23 O 27 N 5 , SiC, BeO, LiAlO 2 , Li 2 ZrO 3 , CaTiO 3 KTaO 3 and Ca(Zr, Pu)Ti 2 O 7 . The program initially proposed for 1989 had as its major objectives two main thrusts: (1) research on defect aggregation in irradiated non-oxide ceramics, and (2) research on irradiation-induced amorphization of network silicas and phosphates
Directory of Open Access Journals (Sweden)
Caroline eReilhac
2012-05-01
Full Text Available The ability to identify letters and encode their position is a crucial step of the word recognition process. However and despite their word identification problem, the ability of dyslexic children to encode letter-identity and letter-position within strings was not systematically investigated. This study aimed at filling this gap and further explored how letter identity and letter position encoding is modulated by letter context in developmental dyslexia. For this purpose, a letter-string comparison task was administered to French dyslexic children and two chronological-age (CA and reading-age (RA-matched control groups. Children had to judge whether two successively and briefly presented 4-letter-strings were identical or different. Letter-position and letter-identity were manipulated through the transposition (e.g., RTGM vs. RMGT or substitution of two letters (e.g., TSHF vs. TGHD. Non-words, pseudo-words and words were used as stimuli to investigate sub-lexical and lexical effects on letter encoding. Dyslexic children showed both substitution and transposition detection problems relative to CA controls. A substitution advantage over transpositions was only found for words in dyslexic children whereas it extended to pseudo-words in RA controls and to all type of items in CA controls. Letters were better identified in the dyslexic group when belonging to orthographically familiar strings. Letter position encoding was very impaired in dyslexic children who did not show any word context effect in contrast to CA controls. Overall, the current findings point to a strong letter identity and letter position encoding disorder in developmental dyslexia.
Eigenvalues of Words in Two Positive Definite Letters
Hillar, Christopher J; Johnson, Charles R
2005-01-01
The question of whether all words in two real positive definite letters have only positive eigenvalues is addressed and settled (negatively). This question was raised some time ago in connection with a long-standing problem in theoretical physics. A large class of words that do guarantee positive eigenvalues is identified, and considerable evidence is given for the conjecture that no other words do. In the process, a fundamental question about solvability of symmetric word equations is encoun...
Near-to far-field transformation in the aperiodic Fourier modal method
Rook, R.; Pisarenco, M.; Setija, I.D.
2013-01-01
This paper addresses the task of obtaining the far-field spectrum for a finite structure given the near-field calculated by the aperiodic Fourier modal method in contrast-field formulation (AFMM-CFF). The AFMM-CFF efficiently calculates the solution to Maxwell's equations for a finite structure by
Directory of Open Access Journals (Sweden)
Xuefeng Li
2014-04-01
Full Text Available Based on solving numerically the generalized nonlinear Langevin equation describing the nonlinear dynamics of stochastic resonance by Fourth-order Runge-Kutta method, an aperiodic stochastic resonance based on an optical bistable system is numerically investigated. The numerical results show that a parameter-tuning stochastic resonance system can be realized by choosing the appropriate optical bistable parameters, which performs well in reconstructing aperiodic signals from a very high level of noise background. The influences of optical bistable parameters on the stochastic resonance effect are numerically analyzed via cross-correlation, and a maximum cross-correlation gain of 8 is obtained by optimizing optical bistable parameters. This provides a prospective method for reconstructing noise-hidden weak signals in all-optical signal processing systems.
Directory of Open Access Journals (Sweden)
Sarah eRobins
2014-06-01
Full Text Available When formal literacy instruction begins, around the age of 5 or 6, children from families low in socioeconomic status (SES tend to be less prepared than children from families of higher SES. The goal of our study is to explore one route through which SES may influence children’s early literacy skills: informal conversations about letters. The study builds on previous studies (Robins, Treiman, & Rosales, 2014; Robins, Treiman, Rosales, & Otake, 2012; Robins & Treiman, 2009 that show how U. S. parents and their young children talk about writing and provides preliminary evidence about similarities and differences in parent–child conversations as a function of SES. Focusing on parents and children aged three to five, we conducted five separate analyses of these conversations, asking whether and how family SES influences the previously established patterns. Although we found talk about letters in both upper and lower SES families, there were differences in the nature of these conversations. The proportion of letter talk utterances that were questions was lower in lower SES families and, of all the letter names that lower SES families talked about, more of them were uttered in isolation rather than in sequences. Lower SES families were especially likely to associate letters with the child’s name, and they placed more emphasis on sequences in alphabetic order. We found no SES differences in the factors that influenced use of particular letter names (monograms, but there were SES differences in two-letter sequences (digrams. Focusing on the alphabet and on associations between the child’s name and the letters within it may help to interest the child in literacy activities, but they many not be very informative about the relationship between letters and words in general. Understanding the patterns in parent–child conversations about letters is an important first step for exploring their contribution to children’s early literacy skills and
Wide-Area Assessment of Aperiodic Small Signal Rotor Angle Stability in Real-Time
DEFF Research Database (Denmark)
Jóhannsson, Hjörtur; Nielsen, Arne Hejde; Østergaard, Jacob
2013-01-01
This paper presents the details of a new real-time stability assessment method. The method assesses a particular mechanism of stability: each generator’s capability to generate sufficient steady state electromechanical torque. The lack of sufficient steady state torque causes aperiodic increase...... of multiple operating points is derived in the paper. Finally, results from time-domain simulation of instability scenarios in the Nordic32 test system are presented and results used for testing the assessment method. The results illustrate the method’s capability to efficiently identify the location...... in rotor angle and a loss of synchronism, referred to as aperiodic small signal instability. The paper provides the theoretical background of the method and an analytical assessment criterion. Furthermore, a mathematical mapping of the generators’ operating points that enables informative visualization...
Wang, Pengfei; Jin, Wei; Su, Huan
2018-04-01
This paper deals with the synchronization problem of a class of coupled stochastic complex-valued drive-response networks with time-varying delays via aperiodically intermittent adaptive control. Different from the previous works, the intermittent control is aperiodic and adaptive, and the restrictions on the control width and time delay are removed, which lead to a larger application scope for this control strategy. Then, based on the Lyapunov method and Kirchhoff's Matrix Tree Theorem as well as differential inequality techniques, several novel synchronization conditions are derived for the considered model. Specially, impulsive control is also considered, which can be seen as a special case of the aperiodically intermittent control when the control width tends to zero. And the corresponding synchronization criteria are given as well. As an application of the theoretical results, a class of stochastic complex-valued coupled oscillators with time-varying delays is studied, and the numerical simulations are also given to demonstrate the effectiveness of the control strategies.
Applied optics. Gain modulation by graphene plasmons in aperiodic lattice lasers.
Chakraborty, S; Marshall, O P; Folland, T G; Kim, Y-J; Grigorenko, A N; Novoselov, K S
2016-01-15
Two-dimensional graphene plasmon-based technologies will enable the development of fast, compact, and inexpensive active photonic elements because, unlike plasmons in other materials, graphene plasmons can be tuned via the doping level. Such tuning is harnessed within terahertz quantum cascade lasers to reversibly alter their emission. This is achieved in two key steps: first, by exciting graphene plasmons within an aperiodic lattice laser and, second, by engineering photon lifetimes, linking graphene's Fermi energy with the round-trip gain. Modal gain and hence laser spectra are highly sensitive to the doping of an integrated, electrically controllable, graphene layer. Demonstration of the integrated graphene plasmon laser principle lays the foundation for a new generation of active, programmable plasmonic metamaterials with major implications across photonics, material sciences, and nanotechnology. Copyright © 2016, American Association for the Advancement of Science.
Gollee, Henrik; Gawthrop, Peter J; Lakie, Martin; Loram, Ian D
2017-11-01
A human controlling an external system is described most easily and conventionally as linearly and continuously translating sensory input to motor output, with the inevitable output remnant, non-linearly related to the input, attributed to sensorimotor noise. Recent experiments show sustained manual tracking involves repeated refractoriness (insensitivity to sensory information for a certain duration), with the temporary 200-500 ms periods of irresponsiveness to sensory input making the control process intrinsically non-linear. This evidence calls for re-examination of the extent to which random sensorimotor noise is required to explain the non-linear remnant. This investigation of manual tracking shows how the full motor output (linear component and remnant) can be explained mechanistically by aperiodic sampling triggered by prediction error thresholds. Whereas broadband physiological noise is general to all processes, aperiodic sampling is associated with sensorimotor decision making within specific frontal, striatal and parietal networks; we conclude that manual tracking utilises such slow serial decision making pathways up to several times per second. The human operator is described adequately by linear translation of sensory input to motor output. Motor output also always includes a non-linear remnant resulting from random sensorimotor noise from multiple sources, and non-linear input transformations, for example thresholds or refractory periods. Recent evidence showed that manual tracking incurs substantial, serial, refractoriness (insensitivity to sensory information of 350 and 550 ms for 1st and 2nd order systems respectively). Our two questions are: (i) What are the comparative merits of explaining the non-linear remnant using noise or non-linear transformations? (ii) Can non-linear transformations represent serial motor decision making within the sensorimotor feedback loop intrinsic to tracking? Twelve participants (instructed to act in three prescribed
Analysis of Nonlinear Periodic and Aperiodic Media: Application to Optical Logic Gates
Yu, Yisheng
This dissertation is about the analysis of nonlinear periodic and aperiodic media and their application to the design of intensity controlled all optical logic gates: AND, OR, and NOT. A coupled nonlinear differential equation that characterizes the electromagnetic wave propagation in a nonlinear periodic (and aperiodic) medium has been derived from the first principle. The equations are general enough that it reflects the effect of transverse modal fields and can be used to analyze both co-propagating and counter propagating waves. A numerical technique based on the finite differences method and absorbing boundary condition has been developed to solve the coupled differential equations here. The numerical method is simple and accurate. Unlike the method based on characteristics that has been reported in the literature, this method does not involve integration and step sizes of time and space coordinates are decoupled. The decoupling provides independent choice for time and space step sizes. The concept of "gap soliton" has also been re-examined. The dissertation consists of four manuscripts. Manuscript I reports on the design of all optical logic gates: AND, OR, and NOT based on the bistability property of nonlinear periodic and aperiodic waveguiding structures. The functioning of the logic gates has been shown by analysis. The numerical technique that has been developed to solve the nonlinear differential equations are addressed in manuscript II. The effect of transverse modal fields on the bistable property of nonlinear periodic medium is reported in manuscript III. The concept of "gap soliton" that are generated in a nonlinear periodic medium has been re-examined. The details on the finding of the re-examination are discussed in manuscript IV.
Wide-Area Assessment of Aperiodic Small Signal Rotor Angle Stability in Real-Time
DEFF Research Database (Denmark)
Jóhannsson, Hjörtur; Nielsen, Arne Hejde; Østergaard, Jacob
2014-01-01
in rotor angle and a loss of synchronism, referred to as aperiodic small signal instability. The paper provides the theoretical background of the method and an analytical assessment criterion. Furthermore, a mathematical mapping of the generators' operating points that enables informative visualization...
Wide Area Prosumption Control and Sensitivities of Aperiodic Small Signal Stability Indicators
DEFF Research Database (Denmark)
Wittrock, Martin Lindholm; Jóhannsson, Hjörtur; Nielsen, Arne Hejde
2014-01-01
and patterns, stability indicators for aperiodic small signal angular stability (ASSA) are examined, while the concept of prosumption is described. The methodology presented is shown to be able to assess the margin to instability and to predict how this margin can be affected if a load is changed in the grid...
Composing chaotic music from the letter m
Sotiropoulos, Anastasios D.
Chaotic music is composed from a proposed iterative map depicting the letter m, relating the pitch, duration and loudness of successive steps. Each of the two curves of the letter m is based on the classical logistic map. Thus, the generating map is xn+1 = r xn(1/2 - xn) for xn between 0 and 1/2 defining the first curve, and xn+1 = r (xn - 1/2)(1 - xn) for xn between 1/2 and 1 representing the second curve. The parameter r which determines the height(s) of the letter m varies from 2 to 16, the latter value ensuring fully developed chaotic solutions for the whole letter m; r = 8 yielding full chaotic solutions only for its first curve. The m-model yields fixed points, bifurcation points and chaotic regions for each separate curve, as well as values of the parameter r greater than 8 which produce inter-fixed points, inter-bifurcation points and inter-chaotic regions from the interplay of the two curves. Based on this, music is composed from mapping the m- recurrence model solutions onto actual notes. The resulting musical score strongly depends on the sequence of notes chosen by the composer to define the musical range corresponding to the range of the chaotic mathematical solutions x from 0 to 1. Here, two musical ranges are used; one is the middle chromatic scale and the other is the seven- octaves range. At the composer's will and, for aesthetics, within the same composition, notes can be the outcome of different values of r and/or shifted in any octave. Compositions with endings of non-repeating note patterns result from values of r in the m-model that do not produce bifurcations. Scores of chaotic music composed from the m-model and the classical logistic model are presented.
Egeland, Jens
2015-01-01
The Wechsler Adult Intelligence Scale (WAIS) is one of the most frequently used tests among psychologists. In the fourth edition of the test (WAIS-IV), the subtests Digit Span and Letter-Number Sequencing are expanded for better measurement of working memory (WM). However, it is not clear whether the new extended tasks contribute sufficient complexity to be sensitive measures of manipulation WM, nor do we know to what degree WM capacity differs between the visual and the auditory modality because the WAIS-IV only tests the auditory modality. Performance by a mixed sample of 226 patients referred for neuropsychological examination on the Digit Span and Letter-Number Sequencing subtests from the WAIS-IV and on Spatial Span from the Wechsler Memory Scale-Third Edition was analyzed in two confirmatory factor analyses to investigate whether a unitary WM model or divisions based on modality or level/complexity best fit the data. The modality model showed the best fit when analyzing summed scores for each task as well as scores for the longest span. The clinician is advised to apply tests with higher manipulation load and to consider testing visual span as well before drawing conclusions about impaired WM from the WAIS-IV.
Investigation of aperiodic W/C multi-layer mirror for X-ray optics
International Nuclear Information System (INIS)
Wang Zhanshan; Cheng Xinbin; Zhu Jingtao; Huang Qiushi; Zhang Zhong; Chen Lingyan
2011-01-01
Design, fabrication and characterization of aperiodic tungsten/carbon (W/C) multi-layer mirror were studied. W/C multi-layer was designed as a broad-angle reflective supermirror for Cu-Kα line (λ = 0.154 nm) in the grazing incident angular range (0.9-1.1 deg.) using simulated annealing algorithm. To deposit the W/C depth-graded multi-layer mirror accurately, we introduce an effective layer growth rate as a function of layer thickness. This method greatly improves the reflectivity curve compared to the conventional multi-layer mirror prepared with constant growth rate. The deposited multi-layer mirror exhibits an average reflectivity of 19% over the grazing incident angle range of 0.88-1.08 deg. which mainly coincides with the designed value. Furthermore, the physical mechanisms were discussed and the re-sputtering process of light-atom layers is accounted for the modification of layer thicknesses which leads to the effective growth rates. Using this calibration method, the aperiodic multi-layer mirrors can be better fabricated for X-ray optics.
Shape control in wafer-based aperiodic 3D nanostructures
International Nuclear Information System (INIS)
Jeong, Hyeon-Ho; Mark, Andrew G; Gibbs, John G; Fischer, Peer; Reindl, Thomas; Waizmann, Ulrike; Weis, Jürgen
2014-01-01
Controlled local fabrication of three-dimensional (3D) nanostructures is important to explore and enhance the function of single nanodevices, but is experimentally challenging. We present a scheme based on e-beam lithography (EBL) written seeds, and glancing angle deposition (GLAD) grown structures to create nanoscale objects with defined shapes but in aperiodic arrangements. By using a continuous sacrificial corral surrounding the features of interest we grow isolated 3D nanostructures that have complex cross-sections and sidewall morphology that are surrounded by zones of clean substrate. (papers)
Zand, Iman; Dalir, Hamed; Chen, Ray T.; Dowling, Jonathan P.
2018-03-01
We investigate one-dimensional aperiodic multilayer microstructures in order to achieve near-total absorptions at preselected wavelengths in a graphene monolayer. The proposed structures are designed using a genetic optimization algorithm coupled to a transfer matrix code. Coupled-mode-theory analysis, consistent with transfer matrix method results, indicates the existence of a critical coupling in the graphene monolayer for perfect absorptions. Our findings show that the near-total-absorption peaks are highly tunable and can be controlled simultaneously or independently in a wide range of wavelengths in the near-infrared and visible ranges. The proposed approach is metal-free, does not require surface texturing or patterning, and can be also applied for other two-dimensional materials.
Evans, Mary Ann; Bell, Michelle; Shaw, Deborah; Moretti, Shelley; Page, Jodi
2006-01-01
In this study 149 kindergarten children were assessed for knowledge of letter names and letter sounds, phonological awareness, and cognitive abilities. Through this it examined child and letter characteristics influencing the acquisition of alphabetic knowledge in a naturalistic context, the relationship between letter-sound knowledge and…
Perea, Manuel; Lupker, Stephen J.
2004-01-01
Nonwords created by transposing two "adjacent" letters (i.e., transposed-letter (TL) nonwords like "jugde") are very effective at activating the lexical representation of their base words. This fact poses problems for most computational models of word recognition (e.g., the interactive-activation model and its extensions), which assume that exact…
Directory of Open Access Journals (Sweden)
Hermundur Sigmundsson
2017-09-01
Full Text Available This study explored whether there is a gender difference in letter-sound knowledge when children start at school. 485 children aged 5–6 years completed assessment of letter-sound knowledge, i.e., large letters; sound of large letters; small letters; sound of small letters. The findings indicate a significant difference between girls and boys in all four factors tested in this study in favor of the girls. There are still no clear explanations to the basis of a presumed gender difference in letter-sound knowledge. That the findings have origin in neuro-biological factors cannot be excluded, however, the fact that girls probably have been exposed to more language experience/stimulation compared to boys, lends support to explanations derived from environmental aspects.
On the algebraic characterization of aperiodic tilings related to ADE-root systems
International Nuclear Information System (INIS)
Kellendonk, J.
1992-09-01
The algebraic characterization of sets of locally equivalent aperiodic tilings, being examples of quantum spaces, is conducted for a certain type of tilings in a manner proposed by A. Connes. These 2-dimensional tilings are obtained by application of the strip method to the root lattice of an ADE-Coxeter group. The plane along which the strip is constructed is determined by the canonical Coxeter element leading to the result that a 2- dimensional tiling decomposes into a cartesian product of two 1- dimensional tilings. The properties of the tilings are investigated, including selfsimilarity, and the determination of the relevant algebraic is considered, namely the ordered K 0 -group of an algebra naturaly assigned to the quantum space. The result also yields an application of the 2-dimensional abstract gap labelling theorem. (orig.)
Critical contrastive rhetoric: The influence of L2 letter writing instruction on L1letter writing
Directory of Open Access Journals (Sweden)
Mehrnoosh Fakharzadeh
2014-08-01
Full Text Available The present study employed critical contrastive rhetoric to investigate the L2 to L1 transfer of organizational pattern and directness level of speech acts in business complaint letters. By examining the L1 complaint letters of 30 tourism university students in two phases of study, pre and post instruction of English complaint letter, the study revealed that the rhetorical organization of Persian letters are in a state of hybridity. The post instruction comparison of letters, however, showed a tendency towards applying English conventions both in organization and directness level of complaint speech act in the L1 complaint letters. The results also revealed that after instruction the expert in the field of tourism viewed some letters as inappropriate in terms of politeness which is reflected through some lexical items.
ERP correlates of letter identity and letter position are modulated by lexical frequency
Vergara-Martínez, Marta; Perea, Manuel; Gómez, Pablo; Swaab, Tamara Y.
2013-01-01
The encoding of letter position is a key aspect in all recently proposed models of visual-word recognition. We analyzed the impact of lexical frequency on letter position assignment by examining the temporal dynamics of lexical activation induced by pseudowords extracted from words of different frequencies. For each word (e.g., BRIDGE), we created two pseudowords: A transposed-letter (TL: BRIGDE) and a replaced-letter pseudoword (RL: BRITGE). ERPs were recorded while participants read words and pseudowords in two tasks: Semantic categorization (Experiment 1) and lexical decision (Experiment 2). For high-frequency stimuli, similar ERPs were obtained for words and TL-pseudowords, but the N400 component to words was reduced relative to RL-pseudowords, indicating less lexical/semantic activation. In contrast, TL- and RL-pseudowords created from low-frequency stimuli elicited similar ERPs. Behavioral responses in the lexical decision task paralleled this asymmetry. The present findings impose constraints on computational and neural models of visual-word recognition. PMID:23454070
Optimized emission in nanorod arrays through quasi-aperiodic inverse design.
Anderson, P Duke; Povinelli, Michelle L
2015-06-01
We investigate a new class of quasi-aperiodic nanorod structures for the enhancement of incoherent light emission. We identify one optimized structure using an inverse design algorithm and the finite-difference time-domain method. We carry out emission calculations on both the optimized structure as well as a simple periodic array. The optimized structure achieves nearly perfect light extraction while maintaining a high spontaneous emission rate. Overall, the optimized structure can achieve a 20%-42% increase in external quantum efficiency relative to a simple periodic design, depending on material quality.
Santos, Carlos; Espinosa, Felipe; Santiso, Enrique; Mazo, Manuel
2015-05-27
One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.
Directory of Open Access Journals (Sweden)
Carlos Santos
2015-05-01
Full Text Available One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.
Directory of Open Access Journals (Sweden)
Duborjal Hervé
2008-02-01
Full Text Available Abstract Background Pathogens such as fungi, bacteria and especially viruses, are highly variable even within an individual host, intensifying the difficulty of distinguishing and accurately quantifying numerous allelic variants co-existing in a single nucleic acid sample. The majority of currently available techniques are based on real-time PCR or primer extension and often require multiplexing adjustments that impose a practical limitation of the number of alleles that can be monitored simultaneously at a single locus. Results Here, we describe a novel method that allows the simultaneous quantification of numerous allelic variants in a single reaction tube and without multiplexing. Quantitative Single-letter Sequencing (QSS begins with a single PCR amplification step using a pair of primers flanking the polymorphic region of interest. Next, PCR products are submitted to single-letter sequencing with a fluorescently-labelled primer located upstream of the polymorphic region. The resulting monochromatic electropherogram shows numerous specific diagnostic peaks, attributable to specific variants, signifying their presence/absence in the DNA sample. Moreover, peak fluorescence can be quantified and used to estimate the frequency of the corresponding variant in the DNA population. Using engineered allelic markers in the genome of Cauliflower mosaic virus, we reliably monitored six different viral genotypes in DNA extracted from infected plants. Evaluation of the intrinsic variance of this method, as applied to both artificial plasmid DNA mixes and viral genome populations, demonstrates that QSS is a robust and reliable method of detection and quantification for variants with a relative frequency of between 0.05 and 1. Conclusion This simple method is easily transferable to many other biological systems and questions, including those involving high throughput analysis, and can be performed in any laboratory since it does not require specialized
Implied reading direction and prioritization of letter encoding.
Holcombe, Alex O; Nguyen, Elizabeth H L; Goodbourn, Patrick T
2017-10-01
Capacity limits hinder processing of multiple stimuli, contributing to poorer performance for identifying two briefly presented letters than for identifying a single letter. Higher accuracy is typically found for identifying the letter on the left, which has been attributed to a right-hemisphere dominance for selective attention. Here, we use rapid serial visual presentation (RSVP) of letters in two locations at once. The letters to be identified are simultaneous and cued by rings. In the first experiment, we manipulated implied reading direction by rotating or mirror-reversing the letters to face to the left rather than to the right. The left-side performance advantage was eliminated. In the second experiment, letters were positioned above and below fixation, oriented such that they appeared to face downward (90° clockwise rotation) or upward (90° counterclockwise rotation). Again consistent with an effect of implied reading direction, performance was better for the top position in the downward condition, but not in the upward condition. In both experiments, mixture modeling of participants' report errors revealed that attentional sampling from the two locations was approximately simultaneous, ruling out the theory that the letter on one side was processed first, followed by a shift of attention to sample the other letter. Thus, the orientation of the letters apparently controls not when the letters are sampled from the scene, but rather the dynamics of a subsequent process, such as tokenization or memory consolidation. Implied reading direction appears to determine the letter prioritized at a high-level processing bottleneck. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
From the correspondence of M. P. Drahomanov: two unknown letters to M. V. Vodovozov of 1894
Directory of Open Access Journals (Sweden)
Kirzhaiev S. M.
2017-01-01
Full Text Available This publication introduces into scientific discourse little-known letters of prominent Ukrainian scholar, politician and publicist M. P. Drahomanov (1841-1895, discovered in the fond of V. I. Vernadsky in the Archive of the Russian Academy of Sciences in Moscow. Two letters written in the latest period of the life of M. P. Drahomanov, which are addressed to young economist and publicist Mykola Vasyliovych Vodovozov (1870-1896, expand the source base not only for M. P. Drahomanov’s biographers. They show his ties with Russian liberals, who later formed the core of the party of constitutional democrats. A preface to the publication contains a biography of M. V. Vodovozov, and the author makes a hypothesis on the history of an acquaintance of the correspondent and the addressee, which could be connected with M. V. Vodovozov’s brother, V. V. Vodovozov, and members of the “Shelter Fraternity”, and through them with M. P. Drahomanov. The analysis of the published letters proves that M. P. Drahomanov endeavored to widen through the “Shelter Fraternity” members his contacts with democratic circles in Russia, and also to find financial support for publishing letters of Bakunin and Struve.
Skuk, Verena G.; Schweinberger, Stefan R.
2014-01-01
Purpose: To determine the relative importance of acoustic parameters (fundamental frequency [F0], formant frequencies [FFs], aperiodicity, and spectrum level [SL]) on voice gender perception, the authors used a novel parameter-morphing approach that, unlike spectral envelope shifting, allows the application of nonuniform scale factors to transform…
A Stimulus Sampling Theory of Letter Identity and Order
Norris, Dennis; Kinoshita, Sachiko; van Casteren, Maarten
2010-01-01
Early on during word recognition, letter positions are not accurately coded. Evidence for this comes from transposed-letter (TL) priming effects, in which letter strings generated by transposing two adjacent letters (e.g., "jugde") produce large priming effects, more than primes with the letters replaced in the corresponding position (e.g.,…
Directory of Open Access Journals (Sweden)
Thomas eLachmann
2014-07-01
Full Text Available Normally-skilled reading involves special processing strategies for letters, which are habitually funneled into an abstract letter code. On the basis of previous studies we argue that this habit leads to the preferred usage of an analytic strategy for the processing of letters, while non-letters are preferably processed via a holistic strategy. The well-known Global Precedence Effect (GPE seems to contradict to this assumption, since, with compound, hierarchical figures, including letter items, faster responses are observed to the global than to the local level of the figure, as well as an asymmetric interference effect from global to local level. We argue that with letters these effects depend on presentation conditions; only when they elicit the processing strategies automatized for reading, an analytic strategy for letters in contrast to non-letters is to be expected. We compared the GPE for letters and non-letters in central viewing, with the global stimulus size close to the functional visual field in whole word reading (6.5o of visual angle and local stimuli close to the critical size for fluent reading of individual letters (.5o of visual angle. Under these conditions, the GPE remained robust for non-letters. For letters, however, it disappeared: letters showed no overall response time advantage for the global level and symmetric congruence effects (local-to-global as well as global-to local interference. We interpret these results as according to the view that reading is based on resident analytic visual processing strategies for letters.
Anonymous letters? DNA and fingerprints technologies combined to solve a case.
Barbaro, A; Cormaci, P; Teatino, A; La Marca, A; Barbaro, A
2004-12-02
Two brothers, living in two different cities, received two different anonymous letters. We performed latent prints development and DNA research on the letters and also on a glass used by a cousin suspected to be the letters' sender.
Samuel Hartlib on the death of Descartes: a rediscovered letter to Henry More
Penman, Leigh T. I.
2015-01-01
This paper discloses the content of a previously overlooked epistle by the Anglo-Prussian intelligencer Samuel Hartlib to Henry More concerning the death of René Descartes. After a discussion situating the letter within the sequence of the More–Hartlib correspondence, an analysis of the rhetorical structure of the epistle is offered, followed by a brief assessment of Hartlib's attitude towards Descartes, and the identification of his source concerning the news of the philosopher's death. An account of the transmission of the letter via a nineteenth-century periodical is also provided. The text of Hartlib's letter and an overlooked passage of Hartlib's diary concerning Descartes's death, which draws on the content of the More letter, are presented as appendixes.
Spreading Sequence Design and Theoretical Limits for Quasisynchronous CDMA Systems
Directory of Open Access Journals (Sweden)
Fan Pingzhi
2004-01-01
Full Text Available For various quasisynchronous (QS CDMA systems such as LAS-CDMA system which emerged recently, in order to reduce or eliminate the multiple access interference and multipath interference, it is required to design a set of spreading sequences which are mutually orthogonal within a designed shift zone, called orthogonal zone. For traditional orthogonal sequences, such as Walsh sequences and orthogonal Gold sequences, the orthogonality can only be achieved at the inphase point; in other words, the orthogonality is destroyed whenever there is a relative shift between the sequences, that is, their orthogonal zone is 0. In this paper, new concepts of generalized orthogonality (GO and generalized quasiorthogonality (GQO for spreading sequence design in both direct sequence (DS QS-CDMA systems and time/frequency hopping (TH/FH QS-CDMA systems are presented. Besides, selected GO/GQO sequence designs and general theoretical periodic and aperiodic limits, together with several applications in QS-CDMA systems, are also reviewed and analyzed.
du Jeu, Rémi; Dauliat, Romain; Darwich, Dia; Auguste, Jean-Louis; Benoît, Aurélien; Leconte, Baptiste; Malleville, Marie-Alicia; Jamier, Raphaël.; Schuster, Kay; Roy, Philippe
2018-02-01
The power scaling of fiber lasers and amplifiers has triggered an extensive development of large-mode area fibers among which the most promising are the distributed mode filtering fibers and the large-pitch fibers. These structures enable for an effective higher-order modes delocalization and subsequently a singlemode emission. An interesting alternative consists in using the fully-aperiodic large-pitch fibers, into which the standard air-silica photonic crystal cladding is replaced by an aperiodic pattern made of solid low-index inclusions cladding. However, in such a structure, the core and the background cladding material surrounding it must have rigorously the same refractive index. Current synthesis processes and measurement techniques offer respectively a maximum resolution of 5×10-4 and 1×10-4 while the indexmatching must be as precise as 1×10-5 . Lately a gain material with a refractive index 1.5×10-4 higher than that of the background cladding material was fabricated, thus re-confining the first higher-order modes in the core. A numerical study is carried out on the benefit of bending such fully-aperiodic fiber to counteract this phenomenon. Optimized bending axis and radius have been determined. Experiments are done in a laser cavity operating at 1030 nm using an 88cm-long 51μm core diameter ytterbium-doped fiber. Results demonstrate an improvement of the M2 from 1.7 when the fiber is kept straight to 1.2 when it is bent with a 100 to 60 cm bend radius. These primary results are promising for future power scaling.
Lott, Susan Nitzberg; Carney, Aimee Syms; Glezer, Laurie S; Friedman, Rhonda B
2010-11-01
BACKGROUND: Letter-by-letter readers identify each letter of the word they are reading serially in left to right order before recognizing the word. When their letter naming is also impaired, letter-by-letter reading is inaccurate and can render even single word reading very poor. Tactile and/or kinesthetic strategies have been reported to improve reading in these patients, but only under certain conditions or for a limited set of stimuli. AIMS: The primary aim of the current study was to determine whether a tactile/kinesthetic treatment could significantly improve reading specifically under normal reading conditions, i.e. reading untrained words presented in free vision and read without overt use of the strategy. METHODS #ENTITYSTARTX00026; PROCEDURES: Three chronic letter-by-letter readers participated in a tactile/kinesthetic treatment aimed at first improving letter naming accuracy (phase 1) and then letter-by-letter reading speed (phase 2). In a multiple case series design, accuracy and speed of reading untrained words without overt use of the trained tactile/kinesthetic strategy was assessed before phase 1, after phase 1 and again after phase 2. OUTCOMES #ENTITYSTARTX00026; RESULTS: All three patients significantly improved both their speed and accuracy reading untrained words without overt use of the trained tactile/kinesthetic strategy. All three patients required the additional practice in phase 2 to achieve significant improvement. Treatment did not target sentence level reading, yet two of the three patients became so adept that they could read entire sentences. CONCLUSIONS: This study replicates previous findings on the efficacy of tactile/kinesthetic treatment for letter-by-letter readers with poor letter naming. It further demonstrates that this treatment can alter cognitive processing such that words never specifically trained can be read in free vision without overtly using the trained strategy. The data suggest that an important element in achieving
Structured printed referral letter (form letter; saves time and improves communication
Directory of Open Access Journals (Sweden)
R.P.J.C. Ramanayake
2013-01-01
Full Text Available Referral of patients to hospitals, specialists and other institutions is an essential part of primary health care. Patients are referred to specialists when investigation or therapeutic options are exhausted in primary care or when opinion or advice is needed from them. Referral has considerable implications for patients, health care system and health care costs. Good communication between primary and secondary care is essential for the smooth running of any health care system. Referral and reply letters are the sole means of communication between doctors most of the time and breakdown in communication could lead to poor continuity of care, delayed diagnoses, polypharmacy, increased litigation risk and unnecessary testing. A referral letter also helps to avoid patient dissatisfaction and loss of confidence in family physician. Studies of referral letters have reported that specialists are dissatisfied with their quality and content. Inclusion of letter writing skills in the medical curriculum, peer assessment and feedback have shown to improve the quality of referral letters. . Form letters have shown to enhance information content and communication in referral process. In Sri Lanka referral letters are usually hand written and frequent complaints are that these letters do not contain adequate information and retrieval of information is a problem due to poor legibility and clarity. Sometimes Primary care doctors refer patients to hospitals and specialists with only verbal instructions. To address these short comings this form letter was introduced. Based on the guidelines and systematic review of published articles, items of information to be included were decided. Printed forms of the letter are kept in the practice and the doctor has to just fill up relevant information under each heading. The objectives of introducing this structured referral letter was to improve the quality and standard of referral letters and save time for both general
The letter knowledge assessment tool.
Pedro, Cassandra; Lousada, Marisa; Pereira, Rita; Hall, Andreia; Jesus, Luis M T
2017-10-10
There is a need to develop letter knowledge assessment tools to characterise the letter knowledge in Portuguese pre-schoolers and to compare it with pre-schoolers from other countries, but there are no tools for this purpose in Portugal. The aim of this paper is to describe the development and validation procedures of the Prova de Avaliação de Competências de Pré-Literacia (PACPL), which assesses letter knowledge. This study includes data that has been gathered in two phases: pilot and main study. In the pilot study, an expert panel of six speech and language pathologists analysed the instrument. Children (n = 216) aged 5;0-7;11 participated in the main study that reports data related to the psychometric characteristics of the PACPL. Content validity, internal consistency, reliability and contributing factors to performance were examined statistically. A modified Bland-Altman method revealed good agreement amongst evaluators. The main study showed that the PACPL has a very good internal consistency and high inter-rater (96.2% of agreement and a Cohen's k value of 0.92) and intra-rater (95.6% of agreement and a Cohen's k value of 0.91) agreement. Construct validity of the PCAPL was also assured (Cronbach's α of 0.982). Significant differences were found between age groups with children increasing their letter knowledge with age. In addition, they were better at identifying than at producing both letter names and letter sounds. The PACPL is a valid and reliable instrument to assess letter knowledge in Portuguese children.
Letter and symbol identification: No evidence for letter-specific crowding mechanisms.
Castet, Eric; Descamps, Marine; Denis-Noël, Ambre; Colé, Pascale
2017-09-01
It has been proposed that letters, as opposed to symbols, trigger specialized crowding processes, boosting identification of the first and last letters of words. This hypothesis is based on evidence that single-letter accuracy as a function of within-string position has a W shape (the classic serial position function [SPF] in psycholinguistics) whereas an inverted V shape is obtained when measured with symbols. Our main goal was to test the robustness of the latter result. Our hypothesis was that any letter/symbol difference might result from short-term visual memory processes (due to the partial report [PR] procedures used in SPF studies) rather than from crowding. We therefore removed the involvement of short-term memory by precueing target-item position and compared SPFs with precueing and postcueing. Perimetric complexity was stringently matched between letters and symbols. In postcueing conditions similar to previous studies, we did not reproduce the inverted V shape for symbols: Clear-cut W shapes were observed with an overall smaller accuracy for symbols compared to letters. This letter/symbol difference was dramatically reduced in precueing conditions in keeping with our prediction. Our results are not consistent with the claim that letter strings trigger specialized crowding processes. We argue that PR procedures are not fit to isolate crowding processes.
Letters and Letter Writing in Early Modern Culture: An Introduction
Directory of Open Access Journals (Sweden)
Gabriella Del Lungo Camiciotti
2014-04-01
Full Text Available The recently renewed scholarly interest in historical letters and letter writing has given rise to several studies which explore the culture of epistolarity from different perspectives. The article offers an introduction to recent scholarship on epistolary discourse and practices in early modern culture. Given the importance of letters as data for several types of diachronic investigation, the article focuses on three points that are crucial for an understanding of the relevance of epistolary discourse itself in early modern European culture. Firstly, letters are invaluable data for historical linguistics, to which they provide information for the history of languages, and sociohistorical and sociolinguistic research. A second recent field of investigation considers letters as documents and material items; the results of research in this area have contributed to the reconstruction of official relationships and information exchanges in past cultures and shed light on social interaction. A third, more traditional area of study, deals with the letter as a form that has given rise to many different genres across the centuries, both practical and literary.
When Do First Letters Mnemonics Aid Recall?
Morris, P. E.; Cook, N.
1978-01-01
The evidence for the effectiveness of the first letter mnemonic technique is confused. There are at least three studies showing no effect, and one where an improvement in recall occurred. Reports two experiments which attempted to locate the conditions under which the first letter mnemonic is effective. (Author/RK)
Aperiodic nanoplasmonic devices for directional colour filtering and sensing.
Davis, Matthew S; Zhu, Wenqi; Xu, Ting; Lee, Jay K; Lezec, Henri J; Agrawal, Amit
2017-11-07
Exploiting the wave-nature of light in its simplest form, periodic architectures have enabled a panoply of tunable optical devices with the ability to perform useful functions such as filtering, spectroscopy, and multiplexing. Here, we remove the constraint of structural periodicity to enhance, simultaneously, the performance and functionality of passive plasmonic devices operating at optical frequencies. By using a physically intuitive, first-order interference model of plasmon-light interactions, we demonstrate a simple and efficient route towards designing devices with flexible, multi-spectral optical response, fundamentally not achievable using periodic architectures. Leveraging this approach, we experimentally implement ultra-compact directional light-filters and colour-sorters exhibiting angle- or spectrally-tunable optical responses with high contrast, and low spectral or spatial crosstalk. Expanding the potential of aperiodic systems to implement tailored spectral and angular responses, these results hint at promising applications in solar-energy harvesting, optical signal multiplexing, and integrated sensing.
The evolution of the Gutenberg-Richter, b-value, throughout periodic and aperiodic stick-slip cycles
Bolton, D. C.; Riviere, J.; Marone, C.; Johnson, P. A.
2017-12-01
The Gutenberg-Richter earthquake size statistic, b value, is a useful proxy for documenting the state of stress on a fault and understanding precursory phenomena preceding dynamic failure. It has been shown that the b value varies systematically as a function of position within the seismic cycle. Frictional studies on intact rock samples with saw-cut faults have shown that b value decreases continuously preceding failure. For intact rock samples, the spatiotemporal changes in b value are thought to be related to the evolution of asperities and micro-cracks. However, few studies have shown how b value evolves spatially and temporally for fault zones containing gouge and wear materials. We hypothesize that the micromechanical mechanisms acting within fault gouge, such as creation and destruction of force chains, grain rolling, sliding, jamming and fracturing play an important role in the evolution of b value and that they may have distinct signatures during periodic and aperiodic cycles of stick-slip frictional motion. We report results from experiments conducted on simulated fault gouge using a biaxial deformation apparatus in a double-direct shear configuration. Acoustic emissions (AEs) are recorded at 4 MHz from 36 P-polarized piezoelectric transducers, which are embedded in steel blocks located adjacent to the fault zone. We compute the frequency-magnitude distribution of detected AEs using a moving window in events where each window is overlapped by 75%. We report on the evolution of b value as a function of normal stress and gouge layer thickness. For periodic slip events, b value reaches a maximum value immediately after a slip event and decreases continuously until the next failure. Aperiodic slip events show similar trends in b-value initially, however unlike periodic slip events, b value reaches a steady state value before failure occurs. In addition, for periodic slip events the magnitude of the change in b value scales inversely with gouge layer thickness
The Time Is Up: Compression of Visual Time Interval Estimations of Bimodal Aperiodic Patterns
Duarte, Fabiola; Lemus, Luis
2017-01-01
The ability to estimate time intervals subserves many of our behaviors and perceptual experiences. However, it is not clear how aperiodic (AP) stimuli affect our perception of time intervals across sensory modalities. To address this question, we evaluated the human capacity to discriminate between two acoustic (A), visual (V) or audiovisual (AV) time intervals of trains of scattered pulses. We first measured the periodicity of those stimuli and then sought for correlations with the accuracy and reaction times (RTs) of the subjects. We found that, for all time intervals tested in our experiment, the visual system consistently perceived AP stimuli as being shorter than the periodic (P) ones. In contrast, such a compression phenomenon was not apparent during auditory trials. Our conclusions are: first, the subjects exposed to P stimuli are more likely to measure their durations accurately. Second, perceptual time compression occurs for AP visual stimuli. Lastly, AV discriminations are determined by A dominance rather than by AV enhancement. PMID:28848406
Tamayo, F; Casals-Coll, M; Sánchez-Benavides, G; Quintana, M; Manero, R M; Rognoni, T; Calvo, L; Palomo, R; Aranciva, F; Peña-Casanova, J
2012-01-01
Verbal and visuospatial span, Letter-Number Sequencing, Trail Making Test, and Symbol Digit Modalities Test are frequently used in clinical practice to assess attention, executive functions and memory. In the present study, as part of the Spanish normative studies of NEURONORMA young adults Project, normative data adjusted by age and education are provided for digits, Corsi Block-Tapping Task, Letter-Number Sequencing, Trail Making Test, and Symbol Digit Modalities Test. The sample consisted of 179 participants from 18 to 49 years old, who were cognitively normal. Tables to convert raw scores to scaled scores are provided. Age and education adjusted scores are provided by applying linear regressions. Education affected scores in most of the attention tests; age was found to be related to the visuospatial span and to speed of visuomotor tracking, and there was no relationship as regards sex. The data obtained will be useful in the clinical evaluation of young Spanish adults. Copyright © 2011 Sociedad Española de Neurología. Published by Elsevier Espana. All rights reserved.
Characterizing the D2 statistic: word matches in biological sequences.
Forêt, Sylvain; Wilson, Susan R; Burden, Conrad J
2009-01-01
Word matches are often used in sequence comparison methods, either as a measure of sequence similarity or in the first search steps of algorithms such as BLAST or BLAT. The D2 statistic is the number of matches of words of k letters between two sequences. Recent advances have been made in the characterization of this statistic and in the approximation of its distribution. Here, these results are extended to the case of approximate word matches. We compute the exact value of the variance of the D2 statistic for the case of a uniform letter distribution, and introduce a method to provide accurate approximations of the variance in the remaining cases. This enables the distribution of D2 to be approximated for typical situations arising in biological research. We apply these results to the identification of cis-regulatory modules, and show that this method detects such sequences with a high accuracy. The ability to approximate the distribution of D2 for both exact and approximate word matches will enable the use of this statistic in a more precise manner for sequence comparison, database searches, and identification of transcription factor binding sites.
Does consolidation of visuospatial sequence knowledge depend on eye movements?
Directory of Open Access Journals (Sweden)
Daphné Coomans
Full Text Available In the current study, we assessed whether visuospatial sequence knowledge is retained over 24 hours and whether this retention is dependent on the occurrence of eye movements. Participants performed two sessions of a serial reaction time (SRT task in which they had to manually react to the identity of a target letter pair presented in one of four locations around a fixation cross. When the letter pair 'XO' was presented, a left response had to be given, when the letter pair 'OX' was presented, a right response was required. In the Eye Movements (EM condition, eye movements were necessary to perform the task since the fixation cross and the target were separated by at least 9° visual angle. In the No Eye Movements (NEM condition, on the other hand, eye movements were minimized by keeping the distance from the fixation cross to the target below 1° visual angle and by limiting the stimulus presentation to 100 ms. Since the target identity changed randomly in both conditions, no manual response sequence was present in the task. However, target location was structured according to a deterministic sequence in both the EM and NEM condition. Learning of the target location sequence was determined at the end of the first session and 24 hours after initial learning. Results indicated that the sequence learning effect in the SRT task diminished, yet remained significant, over the 24 hour interval in both conditions. Importantly, the difference in eye movements had no impact on the transfer of sequence knowledge. These results suggest that the retention of visuospatial sequence knowledge occurs alike, irrespective of whether this knowledge is supported by eye movements or not.
What Do Letter Migration Errors Reveal About Letter Position Coding in Visual Word Recognition?
Davis, Colin J.; Bowers, Jeffrey S.
2004-01-01
Dividing attention across multiple words occasionally results in misidentifications whereby letters apparently migrate between words. Previous studies have found that letter migrations preserve within-word letter position, which has been interpreted as support for position-specific letter coding. To investigate this issue, the authors used word…
Scientific Letter: Monosymptomatic Hypochondriacal Psychosis ...
African Journals Online (AJOL)
Scientific Letter: Monosymptomatic Hypochondriacal Psychosis (somatic delusional disorder): A report of two cases. ... African Journal of Psychiatry. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives.
Kim, Sang Hyun
2013-12-01
The purpose of this study was to examine the concordance between a checklist's categories of professor recommendation letters and characteristics of the self-introduction letter. Checklists of professor recommendation letters were analyzed and classified into cognitive, social, and affective domains. Simple correlation was performed to determine whether the characteristics of the checklists were concordant with those of the self-introduction letter. The difference in ratings of the checklists by pass or fail grades was analyzed by independent sample t-test. Logistic regression analysis was performed to determine whether a pass or fail grade was influenced by ratings on the checklists. The Cronbach alpha value of the checklists was 0.854. Initiative, as an affective domain, in the professor's recommendation letter was highly ranked among the six checklist categories. Self-directed learning in the self-introduction letter was influenced by a pass or fail grade by logistic regression analysis (pprofessor recommendation letters and the sum of all characteristics in the self-introduction letter.
PERIODIC AND APERIODIC VARIABILITY IN THE MOLECULAR CLOUD ρ OPHIUCHUS
International Nuclear Information System (INIS)
Parks, J. Robert; Plavchan, Peter; Gee, Alan H.; White, Russel J.
2014-01-01
Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K s -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK s -band amplitudes from 0.044 to 2.31 mag and Δ(J – K s ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K s time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief variability mechanism
PERIODIC AND APERIODIC VARIABILITY IN THE MOLECULAR CLOUD ρ OPHIUCHUS
Energy Technology Data Exchange (ETDEWEB)
Parks, J. Robert; Plavchan, Peter; Gee, Alan H. [Infrared Processing and Analysis Center, California Institute of Technology, Mail Code 100-22, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); White, Russel J., E-mail: parksj@chara.gsu.edu [Georgia State University, Department of Physics and Astronomy, 25 Park Place, Room 605, Atlanta, GA 30303 (United States)
2014-03-01
Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K{sub s} -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK{sub s} -band amplitudes from 0.044 to 2.31 mag and Δ(J – K{sub s} ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K{sub s} time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief
Real-time remedial action against aperiodic small signal rotor angle instability
DEFF Research Database (Denmark)
Weckesser, Johannes Tilman Gabriel; Jóhannsson, Hjörtur; Østergaard, Jacob
2016-01-01
This paper presents a method that in real-time determines remedial actions, which restore stable operation with respect to aperiodic small signal rotor angle stability (ASSRAS) when insecure or unstable operation has been detected. An ASSRAS assessment method is used to monitor the stability...... impedance plane to determine an active power redispatch among selected generators to restore stable and secure operation. Since the method is purely based on analytically derived expression, the computation of the remedial actions is fast and well suited for real-time operation. The method was tested...... boundary for each generator in real-time. The ASSRAS boundary represents the condition when a generator reaches the maximum steady state active power injection. The proposed control method exploits analytically derived expressions for the ASSRAS boundary and other characteristic curves in the injection...
Angles of Refraction: The Letters of Mary Delany
Directory of Open Access Journals (Sweden)
Eleonora Chiavetta
2014-04-01
Full Text Available Mary Delany (1700-1788 is particularly famous for her paper-cuttings or ‘mosaicks’ based on botanical subjects. A very lively woman of fashion, she was close to Queen Charlotte and one of the Bluestocking Ladies. She left a vivid portrait of life and society in eighteenth century England and Ireland in the six volumes of her Autobiography and Letters, edited in 1861 by her descendant Lady Llanover. Her autobiography is made up of 18 letters sent to her most intimate friend, Margaret Cavendish, Duchess of Portland. The first letter is dated 1740, but in this, as in the following ones, Mrs. Delany narrates her past life to her friend, starting from the early years of her life, describing her unhappy marriage, financial difficulties as a widow, and family relationships. Along with these ‘autobiographical’ letters, other letters written by her to her sister Ann are introduced, which date to the periods of life Mrs. Delany is dealing with. The aim of this paper is to focus on the textual, linguistic and content differences between the two letter types, and analyse how the identity of Mary Delany is differently constructed and perceived in the explicit autobiographical letters addressed to the Duchess of Portland, and the ones written to her sister.
A STUDY ON LEGIBILITY OF LETTERING
Directory of Open Access Journals (Sweden)
Merve ERSAN,
2016-04-01
Full Text Available In the most general sense, lettering is the art of drawing letters, in which the letter forms carry illustrtive features. In this research which is titled "An Analysis on Legibility in Letterings Used in Print Advertisements", letterings used in and specially designed for print ads are analysed and their contribution to the ads are examined. Legibility, which is the fundamental function of writing and typography is examined in the field of lettering that has an illustrative approach. Also, the article puts emphasis on the technique and form’s contribution on content in letterings. Keywords: Lettering, print advertisements, letter design, illustration, legibility.
Peer assessment of outpatient consultation letters – feasibility and satisfaction
Directory of Open Access Journals (Sweden)
Dojeiji Suzan
2007-05-01
Full Text Available Abstract Background Written correspondence is one of the most important forms of communication between health care providers, yet there is little feedback provided to specialists. The objective of this study was to determine the feasibility and satisfaction of a peer assessment program on consultation letters and to determine inter-rater reliability between family physicians and specialists. Methods A rating scale of nine 5-point Likert scale items including specific content, style items, education value of the letter and an overall rating was developed from a previous validated tool. Nine Internal Medicine specialists/subspecialists from two tertiary care centres submitted 10 letters with patient and physician identifiers removed. Two Internal Medicine specialists, and 2 family physicians from the other centre rated each letter (to protect writer anonymity. A satisfaction survey was sent to each writer and rater after collation of the results. A follow-up survey was sent 6–8 months later. Results There was a high degree of satisfaction with the process and feedback. The rating scale information was felt to be useful and appropriate for evaluating the quality of consultation letters by 6/7 writers. 5/7 seven writers felt that the feedback they received resulted in immediate changes to their letters. Six months later, 6/9 writers indicated they had maintained changes in their letters. Raters rank ordered letters similarly (Cronbach's alpha 0.57–0.84 but mean scores were highly variant. At site 1 there were significant differences in scoring brevity (p Conclusion Most participants found peer assessment of letters feasible and beneficial and longstanding changes occurred in some individuals. Family physicians and specialists appear to have different expectations on some items. Further studies on reliability and validity, with a larger sample, are required before high stakes professional assessments include consultation letters.
Letter position coding across modalities: the case of Braille readers.
Perea, Manuel; García-Chamorro, Cristina; Martín-Suesta, Miguel; Gómez, Pablo
2012-01-01
The question of how the brain encodes letter position in written words has attracted increasing attention in recent years. A number of models have recently been proposed to accommodate the fact that transposed-letter stimuli like jugde or caniso are perceptually very close to their base words. Here we examined how letter position coding is attained in the tactile modality via Braille reading. The idea is that Braille word recognition may provide more serial processing than the visual modality, and this may produce differences in the input coding schemes employed to encode letters in written words. To that end, we conducted a lexical decision experiment with adult Braille readers in which the pseudowords were created by transposing/replacing two letters. We found a word-frequency effect for words. In addition, unlike parallel experiments in the visual modality, we failed to find any clear signs of transposed-letter confusability effects. This dissociation highlights the differences between modalities. The present data argue against models of letter position coding that assume that transposed-letter effects (in the visual modality) occur at a relatively late, abstract locus.
The nucleotide sequences of two leghemoglobin genes from soybean
DEFF Research Database (Denmark)
Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O
1982-01-01
We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...
Melanie Klein's letters addressed to Marcelle Spira (1955-1960).
Quinodoz, Jean-Michel
2009-12-01
Between 1955 and 1960, Melanie Klein wrote some 45 hitherto unpublished letters to Marcelle Spira, the Swiss psychoanalyst living at that time in Geneva. In 2006, after Spira's death, these letters were deposited with the Raymond de Saussure Psychoanalysis Centre in Geneva. They are the only known letters that Klein addressed to her psychoanalyst colleagues. Several topics are mentioned in them: (1) the meetings between the two women in Geneva and London; (2) Spira's contribution to Boulanger's translation into French of The Psychoanalysis of Children, which Klein herself carefully revised; (3) the papers that Klein was at that time working on, including Envy and Gratitude; (4) Spira's own work; (5) the difficulties that Spira, a Kleinian psychoanalyst who trained in Buenos Aires, was encountering in her attempt to be admitted to the Swiss Psychoanalytical Society; and (6) a few items of personal and family news. In addition to the invaluable historical information that these letters provide, they offer us a very moving epistolary self-portrait of Melanie Klein, enabling us to discover her personality in the final years of her life - she died in September 1960, just two months after writing her last letter to Spira.
[Representation of letter position in visual word recognition process].
Makioka, S
1994-08-01
Two experiments investigated the representation of letter position in visual word recognition process. In Experiment 1, subjects (12 undergraduates and graduates) were asked to detect a target word in a briefly-presented probe. Probes consisted of two kanji words. The latters which formed targets (critical letters) were always contained in probes. (e.g. target: [symbol: see text] probe: [symbol: see text]) High false alarm rate was observed when critical letters occupied the same within-word relative position (left or right within the word) in the probe words as in the target word. In Experiment 2 (subject were ten undergraduates and graduates), spaces adjacent to probe words were replaced by randomly chosen hiragana letters (e.g. [symbol: see text]), because spaces are not used to separate words in regular Japanese sentences. In addition to the effect of within-word relative position as in Experiment 1, the effect of between-word relative position (left or right across the probe words) was observed. These results suggest that information about within-word relative position of a letter is used in word recognition process. The effect of within-word relative position was explained by a connectionist model of word recognition.
Aperiodic pressure pulsation under non optimal hydraulic turbine regimes at low swirl number
Skripkin, S. G.; Tsoy, M. A.; Kuibin, P. A.; Shtork, S. I.
2017-09-01
Off-design operating conditions of hydraulic turbines is hindered by pressure fluctuations in the draft tube of the turbine. A precessing helical vortex rope develops, which imperils the mechanical structure and limits the operation flexibility of hydropower station. Understanding of the underlying instabilities of precessing vortex rope at low swirl number is incomplete. In this paper flow regimes with different residual swirl is analysed, particular attention is paid to the regime with a small swirl parameter. Study defines upper and low boundaries of regime where aperiodic pressure surge is observed. Flow field at the runner exit is investigated by Laser Doppler Velocimetry and high-speed visualizations, which are complemented draft tube wall pressure measurements.
Chaliyawala, Harsh A.; Purohit, Zeel; Khanna, Sakshum; Ray, Abhijit; Pati, Ranjan K.; Mukhopadhyay, Indrajit
2018-05-01
We report an alternative approach to fabricate the vertically aligned aperiodic Si nanowire arrays by controlling the diameter of the Ag nanoparticles and tuneable ultrasonic removal. The process begins by sputtering the Ag thin film (t=5 nm) on the Si/SiO2 substrates. Followed by Ag thin film, annealed for various temperature (T=300°C, 400°C, 500°C and 600°C) to selectively achieve a high density, well-spaced and diameter controlled Ag nanoparticles (AgNPs) on the Si/SiO2 substrates. The sacrificial layer of AgNPs size indicates the controlled diameter of the Si nanowire arrays. Image J analysis for various annealed samples gives an indication of the high density, uniformity and equal distribution of closely packed AgNPs. Furthermore, the AgNPs covered with Au/Pd mesh (5 nm) as a template, was removed by ultrasonication in the etchant solution for several times in different intervals of preparation. The conventional and facile metal assisted electroless etching approach was finally employed to fabricate the vertically aperiodic sub-50 nm SiNWAs, can be applicable to various nanoscale opto-electronic applications.
Letter position coding across modalities: the case of Braille readers.
Directory of Open Access Journals (Sweden)
Manuel Perea
Full Text Available The question of how the brain encodes letter position in written words has attracted increasing attention in recent years. A number of models have recently been proposed to accommodate the fact that transposed-letter stimuli like jugde or caniso are perceptually very close to their base words.Here we examined how letter position coding is attained in the tactile modality via Braille reading. The idea is that Braille word recognition may provide more serial processing than the visual modality, and this may produce differences in the input coding schemes employed to encode letters in written words. To that end, we conducted a lexical decision experiment with adult Braille readers in which the pseudowords were created by transposing/replacing two letters.We found a word-frequency effect for words. In addition, unlike parallel experiments in the visual modality, we failed to find any clear signs of transposed-letter confusability effects. This dissociation highlights the differences between modalities.The present data argue against models of letter position coding that assume that transposed-letter effects (in the visual modality occur at a relatively late, abstract locus.
Fogerty, Daniel; Humes, Larry E; Busey, Thomas A
2016-01-01
Age-related temporal-processing declines of rapidly presented sequences may involve contributions of sensory memory. This study investigated recall for rapidly presented auditory (vowel) and visual (letter) sequences presented at six different stimulus onset asynchronies (SOA) that spanned threshold SOAs for sequence identification. Younger, middle-aged, and older adults participated in all tasks. Results were investigated at both equivalent performance levels (i.e., SOA threshold) and at identical physical stimulus values (i.e., SOAs). For four-item sequences, results demonstrated best performance for the first and last items in the auditory sequences, but only the first item for visual sequences. For two-item sequences, adults identified the second vowel or letter significantly better than the first. Overall, when temporal-order performance was equated for each individual by testing at SOA thresholds, recall accuracy for each position across the age groups was highly similar. These results suggest that modality-specific processing declines of older adults primarily determine temporal-order performance for rapid sequences. However, there is some evidence for a second amodal processing decline in older adults related to early sensory memory for final items in a sequence. This selective deficit was observed particularly for longer sequence lengths and was not accounted for by temporal masking.
Credit Card Debt Hardship Letter Samples
lissa coffey
2016-01-01
Having trouble with your credit card debt? Below you will find examples of hardship letters. There are several things to consider when writing a credit card hardship letter. A hardship letter is the first step to letting the credit card company know that things are bad. This free credit card hardship letter sample is only a guide in order to start the negotiation. Credit card debt hardship letter example, hardship letter to credit card. If you are having trouble paying off your debt and need ...
Directory of Open Access Journals (Sweden)
I.M. Mirgaleev
2016-12-01
Full Text Available We bring to attention of specialists an undated letter of Ottoman ruler Mehmed II Fatih to the Great Horde khan Ahmad from the collection of famous collector of Ottoman charters Feridun-bey [1, S. 289]. The addressee is the famous ruler of the Great Horde, khan Ahmad. Daulat Khan mentioned in the letter is Nur-Davlet. He was connected with khan Ahmad, and, as indicated by the letter, he had also set in close contact with the Ottomans whose ruler openly declares in a letter that “our sight of benevolence and patronage is directed toward him”. Thereby the Sultan made it clear to the “principal” Tatar khan Akhmad that Nur-Davlet was under the patronage of the Ottoman Empire. Considering the period of activity of Nur-Davlet in Crimea, presumably the letter was written in 1477. Famous researcher of the Crimean Khanate V.D. Smirnov had already examined the letter and the question of why Ahmad Khan was named the Crimean khan in the title of the letter [2, p. 221–222].
Letter-transposition effects are not universal: The impact of transposing letters in Hebrew.
Velan, Hadas; Frost, Ram
2009-10-01
We examined the effects of letter transposition in Hebrew in three masked-priming experiments. Hebrew, like English has an alphabetic orthography where sequential and contiguous letter strings represent phonemes. However, being a Semitic language it has a non-concatenated morphology that is based on root derivations. Experiment 1 showed that transposed-letter (TL) root primes inhibited responses to targets derived from the non-transposed root letters, and that this inhibition was unrelated to relative root frequency. Experiment 2 replicated this result and showed that if the transposed letters of the root created a nonsense-root that had no lexical representation, then no inhibition and no facilitation were obtained. Finally, Experiment 3 demonstrated that in contrast to English, French, or Spanish, TL nonword primes did not facilitate recognition of targets, and when the root letters embedded in them consisted of a legal root morpheme, they produced inhibition. These results suggest that lexical space in alphabetic orthographies may be structured very differently in different languages if their morphological structure diverges qualitatively. In Hebrew, lexical space is organized according to root families rather than simple orthographic structure, so that all words derived from the same root are interconnected or clustered together, independent of overall orthographic similarity.
International Nuclear Information System (INIS)
Anon.
1993-01-01
Thursday 5 November was another major milestone en route to the establishment of the experimental programme for CERN's LHC protonproton collider to be built in the 27- kilometre LEP tunnel. After initial discussions of 'Expressions of Interest' at the specially arranged meeting at Evian-les-Bains, France, earlier this year (May, page 1), three Letters of Intent have emerged, together involving nearly 2000 physicists from research institutes all over the world. As well as these researchers listed on the documents, the plans in fact involve many additional technical specialists who work behind the scenes. It was a historic moment as these three detector proposals were aired at the first open meeting of the new LHC Experiments Committee. CERN's main auditorium and a large overflow room receiving relayed video pictures were both packed. From these three schemes - ATLAS, CMS and L3P - and the first reactions to their letters of intent, eventually two projects will emerge, for which full technical proposals will be prepared, including construction plans and credible costings
Harvard Education Letter. Volume 23, Number 6, November-December 2007
Chauncey, Caroline, Ed.
2007-01-01
"Harvard Education Letter" is published bimonthly by the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Charting a New Course toward Racial Integration: Districts Seek Legal Routes to Capture the Benefits of Diversity (Brigid Schulte); (2) Voluntary Integration: Two Views--(a)…
Trends in the Employment Process: Resumes and Job Application Letters.
Spinks, Neld; Wells, Barron
1999-01-01
Surveys of Fortune 500 companies in 1978, 1985, and 1995 revealed trends and preferences in content of resumes and cover letters. Compared to earlier years, current preferences were for both letters and resumes in the initial contact, more emphasis on grammar and spelling, and acceptance of two-page resumes. (SK)
Transposed-letter priming of prelexical orthographic representations.
Kinoshita, Sachiko; Norris, Dennis
2009-01-01
A prime generated by transposing two internal letters (e.g., jugde) produces strong priming of the original word (judge). In lexical decision, this transposed-letter (TL) priming effect is generally weak or absent for nonword targets; thus, it is unclear whether the origin of this effect is lexical or prelexical. The authors describe the Bayesian Reader theory of masked priming (D. Norris & S. Kinoshita, 2008), which explains why nonwords do not show priming in lexical decision but why they do in the cross-case same-different task. This analysis is followed by 3 experiments that show that priming in this task is not based on low-level perceptual similarity between the prime and target, or on phonology, to make the case that priming is based on prelexical orthographic representation. The authors then use this task to demonstrate equivalent TL priming effects for nonwords and words. The results are interpreted as the first reliable evidence based on the masked priming procedure that letter position is not coded absolutely within the prelexical, orthographic representation. The implications of the results for current letter position coding schemes are discussed.
Otsuka, Sachio; Saiki, Jun
2016-02-01
Prior studies have shown that visual statistical learning (VSL) enhances familiarity (a type of memory) of sequences. How do statistical regularities influence the processing of each triplet element and inserted distractors that disrupt the regularity? Given that increased attention to triplets induced by VSL and inhibition of unattended triplets, we predicted that VSL would promote memory for each triplet constituent, and degrade memory for inserted stimuli. Across the first two experiments, we found that objects from structured sequences were more likely to be remembered than objects from random sequences, and that letters (Experiment 1) or objects (Experiment 2) inserted into structured sequences were less likely to be remembered than those inserted into random sequences. In the subsequent two experiments, we examined an alternative account for our results, whereby the difference in memory for inserted items between structured and random conditions is due to individuation of items within random sequences. Our findings replicated even when control letters (Experiment 3A) or objects (Experiment 3B) were presented before or after, rather than inserted into, random sequences. Our findings suggest that statistical learning enhances memory for each item in a regular set and impairs memory for items that disrupt the regularity. Copyright © 2015 Elsevier B.V. All rights reserved.
Writing more informative letters of reference.
Wright, Scott M; Ziegelstein, Roy C
2004-05-01
Writing a meaningful and valuable letter of reference is not an easy task. Several factors influence the quality of any letter of reference. First, the accuracy and reliability of the writer's impressions and judgment depend on how well he knows the individual being described. Second, the writer's frame of reference, which is determined by the number of persons at the same level that he has worked with, will impact the context and significance of his beliefs and estimations. Third, the letter-writing skills of the person composing the letter will naturally affect the letter. To support the other components of a candidate's application, a letter of reference should provide specific examples of how an individual's behavior or attitude compares to a reference group and should assess "intangibles" that are hard to glean from a curriculum vitae or from test scores. This report offers suggestions that should help physicians write more informative letters of reference.
Peden, Ann R
2018-03-01
Dr. Hildegard Peplau, considered to be our first modern Nurse theorist and the Mother of Psychiatric Nursing, was a prolific writer, engaging in correspondence with colleagues and students who sought her professional and theoretical expertise. Through these letters, she influenced psychiatric nursing while maintaining a broad international network of professional colleagues. An analysis of letters, written between 1990 and 1998, provides insights into Peplau's last decade of professional life and a model of how to support the next generation of nurse scholars. Using content analysis, 24 letters received between 1990 and 1998 were read, reread, and coded. Recurring themes were identified. Three themes were identified. These include Peplau, the Person: Living a Life of Professional Balance; Lighting a Spark: Investing in the Next Generation; and Work in the Vineyards of Nursing: Maintaining a Life of Scholarship. The letters depict Peplau's keen intellect, her wide professional network, her leisure time spent with family and friends, and her own work to assure that her theoretical legacy continued. Peplau's insights continue to be relevant as psychiatric mental health nursing leaders engage in activities to support the next generation of scholars and leaders.
Vishnyakov, E. A.; Kopylets, I. A.; Kondratenko, V. V.; Kolesnikov, A. O.; Pirozhkov, A. S.; Ragozin, E. N.; Shatokhin, A. N.
2018-03-01
Three broadband aperiodic Sb/B4C multilayer mirrors were synthesised for the purposes of soft X-ray optics and spectroscopy in the wavelength range beyond the L-edge of Si (λ plasma radiation source and an electronic detector with a 2D spatial resolution (a CCD matrix with 13 × 13 μm sized pixels). The experimental spectra are compared with theoretical calculations. The effect of lower antimony and B4C layer densities on the reflection spectra is discussed.
The legibility of letters and words
DEFF Research Database (Denmark)
Beier, Sofie
2016-01-01
The saying made famous by Mathew Carter that "type is a beautiful group of letters, not a group of beautiful letters”, highlights the fact that although a typeface consists of a number of letters it is when the letters are assembled in a word that they become type. However, research indicates...... that what makes letters legible in isolation is not necessarily the same as what makes them legible in words. Is it possible to create a typeface where both letters and words have a high level of legibility or are those factors so different that they cannot be combined? Through a literature review...... on relevant experimental investigations, I will in this talk present examples of when the legibility findings on letters and words correlate and when they differ....
Duñabeitia, Jon Andoni; Dimitropoulou, María; Estévez, Adelina; Carreiras, Manuel
2013-01-01
The visual word recognition system recruits neuronal systems originally developed for object perception which are characterized by orientation insensitivity to mirror reversals. It has been proposed that during reading acquisition beginning readers have to “unlearn” this natural tolerance to mirror reversals in order to efficiently discriminate letters and words. Therefore, it is supposed that this unlearning process takes place in a gradual way and that reading expertise modulates mirror-letter discrimination. However, to date no supporting evidence for this has been obtained. We present data from an eye-movement study that investigated the degree of sensitivity to mirror-letters in a group of beginning readers and a group of expert readers. Participants had to decide which of the two strings presented on a screen corresponded to an auditorily presented word. Visual displays always included the correct target word and one distractor word. Results showed that those distractors that were the same as the target word except for the mirror lateralization of two internal letters attracted participants’ attention more than distractors created by replacement of two internal letters. Interestingly, the time course of the effects was found to be different for the two groups, with beginning readers showing a greater tolerance (decreased sensitivity) to mirror-letters than expert readers. Implications of these findings are discussed within the framework of preceding evidence showing how reading expertise modulates letter identification. PMID:24273596
Study of EEG during Sternberg Tasks with Different Direction of Arrangement for Letters
Kamihoriuchi, Kenji; Nuruki, Atsuo; Matae, Tadashi; Kurono, Asutsugu; Yunokuchi, Kazutomo
In previous study, we recorded electroencephalogram (EEG) of patients with dementia and healthy subjects during Sternberg task. But, only one presentation method of Sternberg task was considered in previous study. Therefore, we examined whether the EEG was different in two different presentation methods wrote letters horizontally and wrote letters vertically in this study. We recorded EEG of six healthy subjects during Sternberg task using two different presentation methods. The result was not different in EEG topography of all subjects. In all subjects, correct rate increased in case of vertically arranged letters.
Design of an amplifier model accounting for thermal effect in fully aperiodic large pitch fibers
Tragni, K.; Molardi, C.; Poli, F.; Dauliat, R.; Leconte, B.; Darwich, D.; du Jeu, R.; Malleville, M. A.; Jamier, R.; Selleri, S.; Roy, P.; Cucinotta, A.
2018-02-01
Yb-doped Photonic Crystal Fibers (PCFs) have triggered a significant power scaling into fiber-based lasers. However thermally-induced effects, like mode instability, can compromise the output beam quality. PCF design with improved Higher Order Mode (HOM) delocalization and effective thermal resilience can contain the problem. In particular, Fully- Aperiodic Large-Pitch Fibers (FA-LPFs) have shown interesting properties in terms of resilience to thermal effects. In this paper the performances of a Yb-doped FA-LPF amplifier are experimentally and numerically investigated. Modal properties and gain competition between Fundamental Mode (FM) and first HOM have been calculated, in presence of thermal effects. The main doped fiber characteristics have been derived by comparison between experimental and numerical results.
cDNA sequences of two apolipoproteins from lamprey
International Nuclear Information System (INIS)
Pontes, M.; Xu, X.; Graham, D.; Riley, M.; Doolittle, R.F.
1987-01-01
The messages for two small but abundant apolipoproteins found in lamprey blood plasma were cloned with the aid of oligonucleotide probes based on amino-terminal sequences. In both cases, numerous clones were identified in a lamprey liver cDNA library, consistent with the great abundance of these proteins in lamprey blood. One of the cDNAs (LAL1) has a coding region of 105 amino acids that corresponds to a 21-residue signal peptide, a putative 8-residue propeptide, and the 76-residue mature protein found in blood. The other cDNA (LAL2) codes for a total of 191 residues, the first 23 of which constitute a signal peptide. The two proteins, which occur in the high-density lipoprotein fraction of ultracentrifuged plasma, have amino acid compositions similar to those of apolipoproteins found in mammalian blood; computer analysis indicates that the sequences are largely helix-permissive. When the sequences were searched against an amino acid sequence data base, rat apolipoprotein IV was the best matching candidate in both cases. Although a reasonable alignment can be made with that sequence and LAL1, definitive assignment of the two lamprey proteins to typical mammalian classes cannot be made at this point
Selective retrieval of memory and concept sequences through neuro-windows
Kakeya, Hideki; Okabe, Yoichi
1999-01-01
This letter presents a crosscorrelational associative memory model which realizes selective retrieval of pattern sequences. When hierarchically correlated sequences are memorized, sequences of the correlational centers can be defined as the concept sequences. The authors propose a modified neuro-window method which enables selective retrieval of memory sequences and concept sequences. It is also shown that the proposed model realizes capacity expansion of the memory which stores random sequen...
Contemporary trends in the research of the Letter to Philemon
Directory of Open Access Journals (Sweden)
Bartosz Adamczewski
2005-03-01
Full Text Available In the period of last two or three decades interpretation of the Letter to Philemon has undergone significant changes. Exegetes applying the historical-critical method proposed recently several new ways of reconstructing the situation that occasioned Paul’s writing the letter. It has been suggested e.g. that Onesimus was no runaway, but probably an envoy from Colossae, or Philemon’s estranged brother, or a slave justifiably seeking intercession, or a roamer. Synchronic methods applied by many exegetes (structural, rhetorical, narrative and pragmatic criticism elucidate various kinds of influence of the letter upon the reader. More and more popular becomes also nowadays manifold liberationist approach. However, beyond applying these various hermeneutic procedures there is also, at least for believing exegetes, an important task of adequate explaining the significance of the Letter to Philemon as an inspired writing.
A graphical method is presented for displaying how binding proteins and other macromolecules interact with individual bases of nucleotide sequences. Characters representing the sequence are either oriented normally and placed above a line indicating favorable contact, or upside-down and placed below the line indicating unfavorable contact. The positive or negative height of each letter shows the contribution of that base to the average sequence conservation of the binding site, as represented by a sequence logo.
Directory of Open Access Journals (Sweden)
Naama eFriedmann
2015-07-01
Full Text Available We explored morphological decomposition in reading, the locus in the reading process in which it takes place and its nature, comparing different types of morphemes. We assessed these questions through the analysis of letter position errors in readers with letter position dyslexia(LPD. LPD is a selective impairment to letter position encoding in the early stage of word reading, which results in letter migrations (cloud-could. We used the fact that migrations in LPD occur mainly in word-interior letters, whereas exterior letters rarely migrate.The rationale was that if morphological decomposition occurs prior to letter position encoding and strips off affixes, word-interior letters adjacent to an affix (signs-signs would become exterior following affix-stripping and hence exhibit fewer migrations.We tested 11 Hebrew readers with developmental LPD and 1 with acquired LPD in 6 experiments of reading aloud, lexical decision, and comprehension, at the single word and sentence levels. We examined migrations next to inflectional,derivational,or bound function morphemes compared with exterior letters.Root letters adjacent to inflectional and derivational morphemes were treated like middle letters, and migrated frequently, whereas root letters adjacent to bound function morphemes patterned with exterior letters, and almost never migrated. Given that LPD is a pre-lexical deficit, these results indicate that morphological decomposition takes place in an early, pre-lexical stage. Morphologically complex nonwords showed the same pattern, indicating that this decomposition is structurally, rather than lexically, driven.We suggest that letter position encoding takes place before morphological analysis, but in some cases, as with bound function morphemes, the complex word is re-analyzed as two separate words. In this reanalysis, letter positions in each constituent word are encoded separately,and hence the exterior letters of the root are treated as exterior and
Richard, François D; Kajava, Andrey V
2014-06-01
The dramatic growth of sequencing data evokes an urgent need to improve bioinformatics tools for large-scale proteome analysis. Over the last two decades, the foremost efforts of computer scientists were devoted to proteins with aperiodic sequences having globular 3D structures. However, a large portion of proteins contain periodic sequences representing arrays of repeats that are directly adjacent to each other (so called tandem repeats or TRs). These proteins frequently fold into elongated fibrous structures carrying different fundamental functions. Algorithms specific to the analysis of these regions are urgently required since the conventional approaches developed for globular domains have had limited success when applied to the TR regions. The protein TRs are frequently not perfect, containing a number of mutations, and some of them cannot be easily identified. To detect such "hidden" repeats several algorithms have been developed. However, the most sensitive among them are time-consuming and, therefore, inappropriate for large scale proteome analysis. To speed up the TR detection we developed a rapid filter that is based on the comparison of composition and order of short strings in the adjacent sequence motifs. Tests show that our filter discards up to 22.5% of proteins which are known to be without TRs while keeping almost all (99.2%) TR-containing sequences. Thus, we are able to decrease the size of the initial sequence dataset enriching it with TR-containing proteins which allows a faster subsequent TR detection by other methods. The program is available upon request. Copyright © 2014 Elsevier Inc. All rights reserved.
Suggestopaedia-Canada. Information Letter, No. 4.
Racle, Gabriel
This issue of the information letter consists of two articles, "Music Therapy" and "Research and Applications of Psychomusical Techniques"; a review of the book, "La musicotherapie et les methods nouvelles d'association des techniques" by Guilhot and Cecourt, and a bibliography of books on music therapy written in…
Letter-Transposition Effects Are Not Universal: The Impact of Transposing Letters in Hebrew
Velan, Hadas; Frost, Ram
2009-01-01
We examined the effects of letter-transposition in Hebrew in three masked-priming experiments. Hebrew, like English has an alphabetic orthography where sequential and contiguous letter strings represent phonemes. However, being a Semitic language it has a non-concatenated morphology that is based on root derivations. Experiment 1 showed that…
7 CFR 3560.709 - Demand letter.
2010-01-01
... 7 Agriculture 15 2010-01-01 2010-01-01 false Demand letter. 3560.709 Section 3560.709 Agriculture... DIRECT MULTI-FAMILY HOUSING LOANS AND GRANTS Unauthorized Assistance § 3560.709 Demand letter. (a) If a... repayment schedule, the Agency will send the borrower a demand letter specifying: (1) The amount of...
Department of Homeland Security — Documents, including different types of Letters of MAP Revision (LOMR) and Letters of Map Amendment (LOMA), which are issued by FEMA to revise or amend the flood...
Allograph priming is based on abstract letter identities: Evidence from Japanese kana.
Kinoshita, Sachiko; Schubert, Teresa; Verdonschot, Rinus G
2018-04-23
It is well-established that allographs like the uppercase and lowercase forms of the Roman alphabet (e.g., a and A) map onto the same "abstract letter identity," orthographic representations that are independent of the visual form. Consistent with this, in the allograph match task ("Are 'a' and 'A' the same letter?"), priming by a masked letter prime is equally robust for visually dissimilar prime-target pairs (e.g., d and D) and similar pairs (e.g., c and C). However, in principle this pattern of priming is also consistent with the possibility that allograph priming is purely phonological, based on the letter name. Because different allographic forms of the same letter, by definition, share a letter name, it is impossible to rule out this possibility a priori. In the present study, we investigated the influence of shared letter names by taking advantage of the fact that Japanese is written in two distinct writing systems, syllabic kana-that has two parallel forms, hiragana and katakana-and logographic kanji. Using the allograph match task, we tested whether a kanji prime with the same pronunciation as the target kana (e.g., - い, both pronounced /i/) produces the same amount of priming as a kana prime in the opposite kana form (e.g., イ- い). We found that the kana primes produced substantially greater priming than the phonologically identical kanji prime, which we take as evidence that allograph priming is based on abstract kana identity, not purely phonology. (PsycINFO Database Record (c) 2018 APA, all rights reserved).
31 CFR 29.511 - Demand letters.
2010-07-01
... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Demand letters. 29.511 Section 29.511... Overpayments § 29.511 Demand letters. Except as provided in § 29.516(e), before starting collection action to recover an overpayment, the Benefits Administrator must send a demand letter that informs the debtor in...
Analysis of letter name knowledge using Rasch measurement.
Bowles, Ryan P; Skibbe, Lori E; Justice, Laura M
2011-01-01
Letter name knowledge (LNK) is a key predictor of later reading ability and has been emphasized strongly in recent educational policy. Studies of LNK have implicitly treated it as a unidimensional construct with all letters equally relevant to its measurement. However, some empirical research suggests that contextual factors can affect the measurement of LNK. In this study, we analyze responses from 909 children on measures of LNK using the Rasch model and its extensions, and consider two contextual factors: the format of assessment and the own-name advantage, which states that children are more likely to know letters in their own first names. Results indicate that both contextual factors have important impacts on measurement and that LNK does not meet the requirements of Rasch measurement even when accounting for the contextual factors. These findings introduce philosophical concerns for measurement of constrained skills which have limited content for assessment.
Letter Dice. Technical Note No. 6.
Gunter, Jock
Letter and syllable dice devised for a project in rural Ecuador provide inexpensive, easily reproducible learning materials for practice in basic literary skills. Eleven wooden cubes with six letters on each cube are cast onto a surface and the player constructs words from the letters on the top side of the dice. After a word is formed and…
DEFF Research Database (Denmark)
2017-01-01
This piece was a letter directed towards various ministers in the parliament, targeted at raising a discussion on the values in the education of architects in Denmark and various related topics.......This piece was a letter directed towards various ministers in the parliament, targeted at raising a discussion on the values in the education of architects in Denmark and various related topics....
Kaks kirja vennale = Two Letters from Vincent van Gogh to his brother / Vincent van Gogh
Gogh, Vincent van, 1853-1890
2008-01-01
Kunstnik Vincent van Goghi kaks kirja oma vennale Theole. Tõlge vene keelest ja kommentaar Mehis Heinsaarelt. Ingliskeelsed kirjad raamatust "The Complete Letters of Vincent van Gogh", Thames and Hudson, 1979
Weak disorder in Fibonacci sequences
Energy Technology Data Exchange (ETDEWEB)
Ben-Naim, E [Theoretical Division and Center for Nonlinear Studies, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Krapivsky, P L [Department of Physics and Center for Molecular Cybernetics, Boston University, Boston, MA 02215 (United States)
2006-05-19
We study how weak disorder affects the growth of the Fibonacci series. We introduce a family of stochastic sequences that grow by the normal Fibonacci recursion with probability 1 - {epsilon}, but follow a different recursion rule with a small probability {epsilon}. We focus on the weak disorder limit and obtain the Lyapunov exponent that characterizes the typical growth of the sequence elements, using perturbation theory. The limiting distribution for the ratio of consecutive sequence elements is obtained as well. A number of variations to the basic Fibonacci recursion including shift, doubling and copying are considered. (letter to the editor)
Different letter-processing strategies in diagnostic subgroups of developmental dyslexia.
Lachmann, Thomas; van Leeuwen, Cees
2008-07-01
Normally reading adults (N = 15) and primary school children (N = 24) and two diagnostic subgroups of children with developmental dyslexia (N = 21)-all native German speakers-performed a successive same-different task with pairs of letters and nonletters (pseudoletters or geometrical shapes). The first item of a pair was always presented on its own, and the second either on its own or surrounded by a congruent or incongruent nontarget shape. Adults showed congruence effects with nonletters but not with letters, and children with both types of stimuli. Frequent-word reading-impaired dyslexics (N = 11) in addition showed dramatically slower overall reaction times. Nonword reading-impaired dyslexics (N = 10) showed congruence effects with nonletters but negative congruence effects with letters. The results support the notion that normal readers have established a special visual processing strategy for letters. Processing speed rather than reading expertise seems crucial for this strategy to emerge. The contrasting effects between subgroups of dyslexics reveal specific underlying deficits.
Resource Letter: GW-1: Global warming
Firor, John W.
1994-06-01
This Resource Letter provides a guide to the literature on the possibility of a human-induced climate change—a global warming. Journal articles and books are cited for the following topics: the Greenhouse Effect, sources of infrared-trapping gases, climate models and their uncertainties, verification of climate models, past climate changes, and economics, ethics, and politics of policy responses to climate change. [The letter E after an item indicates elementary level or material of general interest to persons becoming informed in the field. The letter I, for intermediate level, indicates material of somewhat more specialized nature, and the letter A indicates rather specialized or advanced material.
LETTER TO THE EDITOR: Exhaustive search for low-autocorrelation binary sequences
Mertens, S.
1996-09-01
Binary sequences with low autocorrelations are important in communication engineering and in statistical mechanics as ground states of the Bernasconi model. Computer searches are the main tool in the construction of such sequences. Owing to the exponential size 0305-4470/29/18/005/img1 of the configuration space, exhaustive searches are limited to short sequences. We discuss an exhaustive search algorithm with run-time characteristic 0305-4470/29/18/005/img2 and apply it to compile a table of exact ground states of the Bernasconi model up to N = 48. The data suggest F > 9 for the optimal merit factor in the limit 0305-4470/29/18/005/img3.
Potier, M; Dutriaux, A; Orti, R; Groet, J; Gibelin, N; Karadima, G; Lutfalla, G; Lynn, A; Van Broeckhoven, C; Chakravarti, A; Petersen, M; Nizetic, D; Delabar, J; Rossier, J
1998-08-01
Physical mapping across a duplication can be a tour de force if the region is larger than the size of a bacterial clone. This was the case of the 170- to 275-kb duplication present on the long arm of chromosome 21 in normal human at 21q11.1 (proximal region) and at 21q22.1 (distal region), which we described previously. We have constructed sequence-ready contigs of the two copies of the duplication of which all the clones are genuine representatives of one copy or the other. This required the identification of four duplicon polymorphisms that are copy-specific and nonallelic variations in the sequence of the STSs. Thirteen STSs were mapped inside the duplicated region and 5 outside but close to the boundaries. Among these STSs 10 were end clones from YACs, PACs, or cosmids, and the average interval between two markers in the duplicated region was 16 kb. Eight PACs and cosmids showing minimal overlaps were selected in both copies of the duplication. Comparative sequence analysis along the duplication showed three single-basepair changes between the two copies over 659 bp sequenced (4 STSs), suggesting that the duplication is recent (less than 4 mya). Two CpG islands were located in the duplication, but no genes were identified after a 36-kb cosmid from the proximal copy of the duplication was sequenced. The homology of this chromosome 21 duplicated region with the pericentromeric regions of chromosomes 13, 2, and 18 suggests that the mechanism involved is probably similar to pericentromeric-directed mechanisms described in interchromosomal duplications. Copyright 1998 Academic Press.
International Nuclear Information System (INIS)
Mackinnon, A.J.
2011-01-01
This letter confirms that the Laboratory for Laser Energetics (LLE) was an important part of the FY10 NIF Polar Drive Exploding Pusher experiments on the National Ignition Facility (NIF). These experiments were designed by LLE to produce requested neutron yields to calibrate and qualify nuclear diagnostics. LLE built a deuterium-tritium filling system for the glass shells and provided them to LLNL for mounting. In FY10, four exploding pusher implosions were performed with measured neutron yields within a factor of two of requested and ion temperatures within 20% of requested. These implosions are proving to be an ideal platform for commissioning the nuclear diagnostic suite on the NIF and are achieving all of the objectives planned for this campaign.
Two methods for studying the X-ray variability
Yan, Shu-Ping; Ji, Li; Méndez, Mariano; Wang, Na; Liu, Siming; Li, Xiang-Dong
2016-01-01
The X-ray aperiodic variability and quasi-periodic oscillation (QPO) are the important tools to study the structure of the accretion flow of X-ray binaries. However, the origin of the complex X-ray variability from X-ray binaries remains yet unsolved. We proposed two methods for studying the X-ray
Four Versions of the Christus by the Massys: Deciphering the Meaning of the Letters
Directory of Open Access Journals (Sweden)
Vicente Jara Vera
2017-02-01
Full Text Available The Flemish painters Quentin Massys and his son Jan Massys appear to be the authors of four works with a very similar motif, the bust of Jesus Christ. These canvasses can be found in different locations today: the Prado Museum in Madrid (Spain, the RKD Netherlands Institute for Art History of The Hague (Netherlands, the Kunstmuseum Winterthur (Switzerland, and another one in a private collection. Written on the edge of the robe around the neck, these canvasses display a series of Hebrew or pseudo-Hebrew letters. We offer the complete solution deciphered, until today incomplete, for three of them, with a very similar letter sequence. Finally, we resolve completely one of the canvasses, which, until today, had no known solution.
Two tandemly repeated telomere-associated sequences in Nicotiana plumbaginifolia.
Chen, C M; Wang, C T; Wang, C J; Ho, C H; Kao, Y Y; Chen, C C
1997-12-01
Two tandemly repeated telomere-associated sequences, NP3R and NP4R, have been isolated from Nicotiana plumbaginifolia. The length of a repeating unit for NP3R and NP4R is 165 and 180 nucleotides respectively. The abundance of NP3R, NP4R and telomeric repeats is, respectively, 8.4 x 10(4), 6 x 10(3) and 1.5 x 10(6) copies per haploid genome of N. plumbaginifolia. Fluorescence in situ hybridization revealed that NP3R is located at the ends and/or in interstitial regions of all 10 chromosomes and NP4R on the terminal regions of three chromosomes in the haploid genome of N. plumbaginifolia. Sequence homology search revealed that not only are NP3R and NP4R homologous to HRS60 and GRS, respectively, two tandem repeats isolated from N. tabacum, but that NP3R and NP4R are also related to each other, suggesting that they originated from a common ancestral sequence. The role of these repeated sequences in chromosome healing is discussed based on the observation that two to three copies of a telomere-similar sequence were present in each repeating unit of NP3R and NP4R.
48 CFR 42.504 - Postaward letters.
2010-10-01
... CONTRACT ADMINISTRATION AND AUDIT SERVICES Postaward Orientation 42.504 Postaward letters. In some circumstances, a letter or other written form of communication to the contractor may be adequate postaward...
Bucci, Davide; Martin, Bruno; Morand, Alain
2012-03-01
This paper deals with a full vectorial generalization of the aperiodic Fourier modal method (AFMM) in cylindrical coordinates. The goal is to predict some key characteristics such as the bending losses of waveguides having an arbitrary distribution of the transverse refractive index. After a description of the method, we compare the results of the cylindrical coordinates AFMM with simulations by the finite-difference time-domain (FDTD) method performed on an S-bend structure made by a 500 nm × 200 nm silicon core (n=3.48) in silica (n=1.44) at a wavelength λ=1550 nm, the bending radius varying from 0.5 up to 2 μm. The FDTD and AFMM results show differences comparable to the variations obtained by changing the parameters of the FDTD simulations.
Fukatsu, Takema; Kuratani, Shigeru
2016-02-01
A new open-access journal, Zoological Letters, was launched as a sister journal to Zoological Science, in January 2015. The new journal aims at publishing topical papers of high quality from a wide range of basic zoological research fields. This review highlights the notable reviews and research articles that have been published in the first year of Zoological Letters, providing an overview on the current achievements and future directions of the journal.
Directory of Open Access Journals (Sweden)
Kathleen Pithouse-Morgan
2012-02-01
Full Text Available Using reflective letter-writing as a method of generating data, a group of four researchers embarked on a collaborative autoethnographic inquiry into the emotional dimensions of researching social aspects of HIV & AIDS. In this article, we use the medium of a narrative dialogue to represent and re-examine our reflective letter-writing method. The dialogue draws attention to key features of reflective letter-writing as a collaborative autoethnographic research method and, in so doing, highlights and explores the nature, potential significance, and challenges of this method. Our discussion points to the value of a collaborative process of reflective letter-writing as a way for researchers to access and portray emotional aspects of their research experience, to deepen their engagement with these emotional dimensions, and to gain insight into their own and others' lived research experiences.
Written Communications Simulation: Write Me a Letter.
North Carolina State Dept. of Public Instruction, Raleigh. Div. of Vocational Education.
This simulation is intended for use as a culminating activity after students have been exposed to personal and/or business letter writing, use of reference manuals, typing of letters, mailing procedures, typing of numbers, punctuation practice, and filing procedures. Stated objectives are to enable students to type a mailable letter; to inspect,…
Aperiodic dynamics in a deterministic adaptive network model of attitude formation in social groups
Ward, Jonathan A.; Grindrod, Peter
2014-07-01
Adaptive network models, in which node states and network topology coevolve, arise naturally in models of social dynamics that incorporate homophily and social influence. Homophily relates the similarity between pairs of nodes' states to their network coupling strength, whilst social influence causes coupled nodes' states to convergence. In this paper we propose a deterministic adaptive network model of attitude formation in social groups that includes these effects, and in which the attitudinal dynamics are represented by an activato-inhibitor process. We illustrate that consensus, corresponding to all nodes adopting the same attitudinal state and being fully connected, may destabilise via Turing instability, giving rise to aperiodic dynamics with sensitive dependence on initial conditions. These aperiodic dynamics correspond to the formation and dissolution of sub-groups that adopt contrasting attitudes. We discuss our findings in the context of cultural polarisation phenomena. Social influence. This reflects the fact that people tend to modify their behaviour and attitudes in response to the opinions of others [22-26]. We model social influence via diffusion: agents adjust their state according to a weighted sum (dictated by the evolving network) of the differences between their state and the states of their neighbours. Homophily. This relates the similarity of individuals' states to their frequency and strength of interaction [27]. Thus in our model, homophily drives the evolution of the weighted ‘social' network. A precise formulation of our model is given in Section 2. Social influence and homophily underpin models of social dynamics [21], which cover a wide range of sociological phenomena, including the diffusion of innovations [28-32], complex contagions [33-36], collective action [37-39], opinion dynamics [19,20,40,10,11,13,15,41,16], the emergence of social norms [42-44], group stability [45], social differentiation [46] and, of particular relevance
Writing More Informative Letters of Reference
Wright, Scott M; Ziegelstein, Roy C
2004-01-01
Writing a meaningful and valuable letter of reference is not an easy task. Several factors influence the quality of any letter of reference. First, the accuracy and reliability of the writer's impressions and judgment depend on how well he knows the individual being described. Second, the writer's frame of reference, which is determined by the number of persons at the same level that he has worked with, will impact the context and significance of his beliefs and estimations. Third, the letter...
Use of Standard Guidelines for Department of Medicine Summary Letters.
Fitz, Matthew; La Rochelle, Jeffrey; Lang, Valerie; DeWaay, Deborah; Adams, William; Nasraty, Farah
2018-04-12
Phenomenon: Fourth-year medical students obtain Department of Medicine (DOM) letters ("Chair" letters) to support their residency applications. Writing and interpreting DOM letters are challenging. There is heterogeneity in the letters that makes it difficult to both write and read these letters. The purpose of this study is to determine the value of new guidelines developed by a task force of clerkship directors and program directors in internal medicine and assess the implementation of these guidelines. The Clerkship Directors in Internal Medicine performed a cross-sectional survey of internal medicine clerkship directors at U.S. and Canadian medical schools in 2014. In addition, the primary author's institution reviewed 1,347 DOM letters between 2012 and 2014 to assess the implementation of these guidelines. The survey response rate was 78%. DOM letter writers reported the guidelines were better, easier to implement, and more compatible with the purpose of DOM letters than previously. Most letter readers reported that letters using the guidelines were more credible. Writers of DOM letters in lower academic ranks rated the letters with guidelines higher in several domains than those in higher academic ranks. Readers of DOM letters in higher academic ranks rated the letters with guidelines higher in several domains than those in lower academic ranks. In the DOM letters examined, the odds of meeting each guideline increased with each additional year. However, for 3 guidelines there was an initial decline in adherence from 2012 to 2013 before increasing again in 2014-the recommended length, clerkship description, and detailed narrative guidelines. Letters solely written by a chair were less likely to incorporate the guidelines. Insights: Clerkship directors often write the DOM letters and identify with the purpose of the guidelines. As writers, lower ranking academic faculty value the guidelines more than higher ranking academic faculty. As readers of DOM letters
THE SPIRITUALITY OF THE LETTER TO THE GALATIANS
African Journals Online (AJOL)
attention. In fact, I am aware of only two studies that focus on Galatians in .... does not explicitly use the term “coming age” here or elsewhere in his letters, .... framework according to which history is divided into the period before and the.
Letter of Polish Hetman Jan Zamoyski “About Passage of Tatars through Pokuttya in 1594”.
Directory of Open Access Journals (Sweden)
Roman Hautala
2017-06-01
Full Text Available The present article contains the text of the letter sent by Polish hetman Jan Zamoyski to Cardinal Cinzio Aldobrandini August 12, 1594 describing the circumstances of the recent invasion of Tatar troops in Hungary. Judging by contents of the letter, Zamoyski did not hide his desire to be justified in the eyes of the Roman Curia for the ineffectiveness of his actions, which would have to prevent Tatars to invade Hungary through Ukrainian territory that was subordinated to Rzeczpospolita. Thus, this letter is interesting for two reasons. In the first place, Zamoyski’s letter contains detailed information about movement of Tartar troops to the west and stratagemme of khan Ghazi Giray, which allowed Tatars to lull Polish hetman and painlessly penetrate into Hungarian territory. On the other hand, the letter contains somewhat clumsy attempts of Zamoyski to justify his unsuccessful actions, which represent a particular interest. This article, therefore, contains the Latin text of the letter and its Russian translation as well as the preface and necessary comments to the text explaining the reasons and the very course of Tatar invasion of the Kingdom of Hungary. In addition, the authors placed facsimiles of two handwritten copies of the letter from the Biblioteca Ambrosiana in Milan at the end of the article.
Maritime Geo-Fence Letter Report
2016-07-01
1 Classification | CG-926 RDC | author | audience | month year Maritime Geo-Fence Letter Report Authors: Irene Gonin and Gregory...Johnson Distribution Statement A: Approved for public release; distribution is unlimited. July 2016 Report No. CG-D-10-16 Maritime Geo-Fence...United States Coast Guard Research & Development Center 1 Chelsea Street New London, CT 06320 Maritime Geo-Fence Letter Report 1
International Nuclear Information System (INIS)
Gong, Longyan; Zhu, Hao; Zhao, Shengmei; Cheng, Weiwen; Sheng, Yubo
2012-01-01
We investigate numerically the quantum discord and the classical correlation in a one-dimensional slowly varying potential model and a one-dimensional Soukoulis–Economou ones, respectively. There are well-defined mobility edges in the slowly varying potential model, while there are discrepancies on mobility edges in the Soukoulis–Economou ones. In the slowly varying potential model, we find that extended and localized states can be distinguished by both the quantum discord and the classical correlation. There are sharp transitions in the quantum discord and the classical correlation at mobility edges. Based on these, we study “mobility edges” in the Soukoulis–Economou model using the quantum discord and the classical correlation, which gives another perspectives for these “mobility edges”. All these provide us good quantities, i.e., the quantum discord and the classical correlation, to reflect mobility edges in these one-dimensional aperiodic single-electron systems. Moreover, our studies propose a consistent interpretation of the discrepancies between previous numerical results about the Soukoulis–Economou model. -- Highlights: ► Quantum discord and classical correlation can signal mobility edges in two models. ► An interpretation for mobility edges in the Soukoulis–Economou model is proposed. ► Quantum discord and classical correlation can reflect well localization properties.
James, Karin H; Atwood, Thea P
2009-02-01
Functional specialization in the brain is considered a hallmark of efficient processing. It is therefore not surprising that there are brain areas specialized for processing letters. To better understand the causes of functional specialization for letters, we explore the emergence of this pattern of response in the ventral processing stream through a training paradigm. Previously, we hypothesized that the specialized response pattern seen during letter perception may be due in part to our experience in writing letters. The work presented here investigates whether or not this aspect of letter processing-the integration of sensorimotor systems through writing-leads to functional specialization in the visual system. To test this idea, we investigated whether or not different types of experiences with letter-like stimuli ("pseudoletters") led to functional specialization similar to that which exists for letters. Neural activation patterns were measured using functional magnetic resonance imaging (fMRI) before and after three different types of training sessions. Participants were trained to recognize pseudoletters by writing, typing, or purely visual practice. Results suggested that only after writing practice did neural activation patterns to pseudoletters resemble patterns seen for letters. That is, neural activation in the left fusiform and dorsal precentral gyrus was greater when participants viewed pseudoletters than other, similar stimuli but only after writing experience. Neural activation also increased after typing practice in the right fusiform and left precentral gyrus, suggesting that in some areas, any motor experience may change visual processing. The results of this experiment suggest an intimate interaction among perceptual and motor systems during pseudoletter perception that may be extended to everyday letter perception.
Adolescent Suidice--An Open Letter to Counselors.
Wolfe, Jane
1988-01-01
A mother of a 16 year-old suicide victim writes to school counselors who let her down by not informing her of important changes in her son's activities, personality, and choice of friends at school. The letter also addresses two psychologists in a psychiatric hospital who suppressed information about the boy's suicidal intentions and his…
High-Throughput Block Optical DNA Sequence Identification.
Sagar, Dodderi Manjunatha; Korshoj, Lee Erik; Hanson, Katrina Bethany; Chowdhury, Partha Pratim; Otoupal, Peter Britton; Chatterjee, Anushree; Nagpal, Prashant
2018-01-01
Optical techniques for molecular diagnostics or DNA sequencing generally rely on small molecule fluorescent labels, which utilize light with a wavelength of several hundred nanometers for detection. Developing a label-free optical DNA sequencing technique will require nanoscale focusing of light, a high-throughput and multiplexed identification method, and a data compression technique to rapidly identify sequences and analyze genomic heterogeneity for big datasets. Such a method should identify characteristic molecular vibrations using optical spectroscopy, especially in the "fingerprinting region" from ≈400-1400 cm -1 . Here, surface-enhanced Raman spectroscopy is used to demonstrate label-free identification of DNA nucleobases with multiplexed 3D plasmonic nanofocusing. While nanometer-scale mode volumes prevent identification of single nucleobases within a DNA sequence, the block optical technique can identify A, T, G, and C content in DNA k-mers. The content of each nucleotide in a DNA block can be a unique and high-throughput method for identifying sequences, genes, and other biomarkers as an alternative to single-letter sequencing. Additionally, coupling two complementary vibrational spectroscopy techniques (infrared and Raman) can improve block characterization. These results pave the way for developing a novel, high-throughput block optical sequencing method with lossy genomic data compression using k-mer identification from multiplexed optical data acquisition. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Structural and sequence features of two residue turns in beta-hairpins.
Madan, Bharat; Seo, Sung Yong; Lee, Sun-Gu
2014-09-01
Beta-turns in beta-hairpins have been implicated as important sites in protein folding. In particular, two residue β-turns, the most abundant connecting elements in beta-hairpins, have been a major target for engineering protein stability and folding. In this study, we attempted to investigate and update the structural and sequence properties of two residue turns in beta-hairpins with a large data set. For this, 3977 beta-turns were extracted from 2394 nonhomologous protein chains and analyzed. First, the distribution, dihedral angles and twists of two residue turn types were determined, and compared with previous data. The trend of turn type occurrence and most structural features of the turn types were similar to previous results, but for the first time Type II turns in beta-hairpins were identified. Second, sequence motifs for the turn types were devised based on amino acid positional potentials of two-residue turns, and their distributions were examined. From this study, we could identify code-like sequence motifs for the two residue beta-turn types. Finally, structural and sequence properties of beta-strands in the beta-hairpins were analyzed, which revealed that the beta-strands showed no specific sequence and structural patterns for turn types. The analytical results in this study are expected to be a reference in the engineering or design of beta-hairpin turn structures and sequences. © 2014 Wiley Periodicals, Inc.
Philosophical Intelligence: Letters, Print, and Experiment during Napoleon's Continental Blockade.
Watts, Iain P
2015-12-01
This essay investigates scientific exchanges between Britain and France from 1806 to 1814, at the height of the Napoleonic Wars. It argues for a picture of scientific communication that sees letters and printed texts not as separate media worlds, but as interconnected bearers of time-critical information within a single system of intelligence gathering and experimental practice. During this period, Napoleon Bonaparte's Continental System blockade severed most links between Britain and continental Europe, yet scientific communications continued--particularly on electrochemistry, a subject of fierce rivalry between Britain and France. The essay traces these exchanges using the archive of a key go-between, the English man of science Sir Charles Blagden. The first two sections look at Blagden's letter-writing operation, reconstructing how he harnessed connections with neutral American diplomats, merchants, and the State to get scientific intelligence between London and Paris. The third section, following Blagden's words from Britain to France to America, looks at how information in letters cross-fertilized with information in print. The final section considers how letters and print were used together to solve the difficult practical problem of replicating experiments across the blockade.
Teaching Complaint and Adjustment Letters--And Tact (My Favorite Assignment).
Deimling, Paula
1992-01-01
Describes a three-part assignment in which each student writes a complaint letter and an adjustment letter responding to another student's complaint letter. Discusses how the third part of the assignment--journal entries--allows students to formulate their own criteria for excellent letters based upon their reactions to the letters they receive.…
A novel scenario of aperiodical impacts appearance in the turbine draft tube
Alekseenko, S. V.; Kuibin, P. A.; Shtork, S. I.; Skripkin, S. G.; Sonin, V. I.; Tsoy, M. A.; Ustimenko, A. S.
2016-11-01
The swirling flow in the discharge cone of hydroturbine is characterized by various self-induced instabilities and associated low frequency phenomena when the turbine is operated far from the best efficiency point. In particular, the precessing vortex rope develops at part-load regimes in the draft tube. This rope can serve a reason of the periodical low- frequency pressure oscillations in the whole hydrodynamical system. During the experimental research of flow structure in the discharge cone in a regime of free runner new interesting phenomenon was discovered. Due to instability some coils of helical vortex close to each other and reconnection appears with generation of a vortex ring. The experiments were fulfilled at the cavitational conditions when a cavity arises in the vortex core. So the phenomenon was registered with help of visualization by the high speed video recording. The vortex ring after the reconnection moves apart from the main vortex rope toward the wall and downstream. When it reaches the area with high pressure the cavity collapses with generation of pressure impact. The mechanism of cavitational vortex rings generation and their further collapse can serve as a prototype of the aperiodical pressure impacts inside the turbine draft tube.
cDNA sequences of two inducible T-cell genes
Energy Technology Data Exchange (ETDEWEB)
Kwon, B.S. (Indiana Univ. School of Medicine, Indianapolis (USA) Guthrie Research Institute, Sayre, PA (USA)); Weissman, S.M. (Yale Univ., New Haven, CT (USA))
1989-03-01
The authors have previously described a set of human T-lymphocyte-specific cDNA clones isolated by a modified differential screening procedure. Apparent full-length cDNAs containing the sequences of 14 of the 16 initial isolates were sequenced and were found to represent five different species of mRNA; three of the five species were identical to previously reported cDNA sequences of preproenkephalin, T-cell-replacing factor, and a serine esterase, respectively. The other two species, 4-1BB and L2G25B, were inducible sequences found in mRNA from both a cytolytic T-lymphocyte and a helper T-lymphocyte clone and were not previously described in T-cell mRNA; these mRNA sequences encode peptides of 256 and 92 amino acids, respectively. Both peptides contain putative leader sequences. The protein encoded by 4-1BB also has a potential membrane anchor segment and other features also seen in known receptor proteins.
Growth and decay of a two-dimensional oxide quasicrystal: High-temperature in situ microscopy
Energy Technology Data Exchange (ETDEWEB)
Foerster, Stefan [Physik-Institut, Universitaet Zuerich (Switzerland); Institute of Physics, Martin-Luther-Universitaet Halle-Wittenberg, Halle (Germany); Flege, Jan Ingo; Falta, Jens [Institute of Solid State Physics, University of Bremen (Germany); MAPEX Center for Materials and Processes, University of Bremen (Germany); Zollner, Eva Maria; Schumann, Florian Otto; Hammer, Rene; Bayat, Alireza; Schindler, Karl-Michael [Institute of Physics, Martin-Luther-Universitaet Halle-Wittenberg, Halle (Germany); Widdra, Wolf [Institute of Physics, Martin-Luther-Universitaet Halle-Wittenberg, Halle (Germany); Max-Planck-Institut fuer Mikrostrukturphysik, Halle (Germany)
2017-01-15
The recently discovered two-dimensional oxide quasicrystal (OQC) derived from BaTiO{sub 3} on Pt(111) is the first material in which a spontaneous formation of an aperiodic structure at the interface to a periodic support has been observed. Herein, we report in situ low-energy electron microscopy (LEEM) studies on the fundamental processes involved in the OQC growth. The OQC formation proceeds in two steps via of an amorphous two-dimensional wetting layer. At 1170 K the long-range aperiodic order of the OQC develops. Annealing in O{sub 2} induces the reverse process, the conversion of the OQC into BaTiO{sub 3} islands and bare Pt(111), which has been monitored by in situ LEEM. A quantitative analysis of the temporal decay of the OQC shows that oxygen adsorption on bare Pt patches is the rate limiting step of this dewetting process. (copyright 2016 by WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Exploring Corporate Rhetoric: Metadiscourse in the CEO's Letter.
Hyland, Ken
1998-01-01
Examines how metadiscourse is used to create a positive corporate image in 137 CEOs' letters, showing how CEOs use nonpropositional material to realize rational, credible, and affective appeals. Reveals the essentially rhetorical nature of CEOs' letters by comparing the frequency and distribution of metadiscourse in their letters and directors'…
Weak universality in inhomogeneous Ising quantum chains
International Nuclear Information System (INIS)
Karevski, Dragi
2006-01-01
The Ising quantum chain with arbitrary coupling distribution {λ i } leading to an anisotropic scaling is considered. The smallest gap of the chain is connected to the surface magnetization by the relation Λ 1 = m s ({λ i })m s ({λ -1 i }). For some aperiodic distribution {λ i }, a weak universality of the critical behaviour is found. (letter to the editor)
Perea, Manuel; Jiménez, María; Martín-Suesta, Miguel; Gómez, Pablo
2015-04-01
This article explores how letter position coding is attained during braille reading and its implications for models of word recognition. When text is presented visually, the reading process easily adjusts to the jumbling of some letters (jugde-judge), with a small cost in reading speed. Two explanations have been proposed: One relies on a general mechanism of perceptual uncertainty at the visual level, and the other focuses on the activation of an abstract level of representation (i.e., bigrams) that is shared by all orthographic codes. Thus, these explanations make differential predictions about reading in a tactile modality. In the present study, congenitally blind readers read sentences presented on a braille display that tracked the finger position. The sentences either were intact or involved letter transpositions. A parallel experiment was conducted in the visual modality. Results revealed a substantially greater reading cost for the sentences with transposed-letter words in braille readers. In contrast with the findings with sighted readers, in which there is a cost of transpositions in the external (initial and final) letters, the reading cost in braille readers occurs serially, with a large cost for initial letter transpositions. Thus, these data suggest that the letter-position-related effects in visual word recognition are due to the characteristics of the visual stream.
International Nuclear Information System (INIS)
Li Jianlong; Zeng Lingzao
2010-01-01
We discuss in detail the effects of the multi-time-delayed feedback driven by an aperiodic signal on the output of a stochastic resonance (SR) system. The effective potential function and dynamical probability density function (PDF) are derived. To measure the performance of the SR system in the presence of a binary random signal, the bit error rate (BER) defined by the dynamical PDF is employed, as is commonly used in digital communications. We find that the delay time, strength of the feedback, and number of time-delayed terms can change the effective potential function and the effective amplitude of the signal, and then affect the BER of the SR system. The numerical simulations strongly support the theoretical results. The goal of this investigation is to explore the effects of the multi-time-delayed feedback on SR and give a guidance to nonlinear systems in the application of information processing.
Student Teacher Letters of Reference: A Critical Analysis
Mason, Richard W.; Schroeder, Mark P.
2012-01-01
Letters of reference are commonly used in acquiring a job in education. Despite serious issues of validity and reliability in writing and evaluating letters, there is a dearth of research that systematically examines the evaluation process and defines the constructs that define high quality letters. The current study used NVivo to examine 160…
Sixty-Minute Review of Letter Writing
Cunningham, Donald H.; Graham, Louise
1974-01-01
The article describes a one-hour presentation which provides a basic stereotyped pattern of letter organization for the four types of letters (order, request, claim, and reply) the business of secretarial student is most likely to have to write. The four paragraphs of the pattern are: purpose, explanation, optional, and closing. (AG)
Griffith, Jessica; McLaughlin, T. F.; Neyman, Jen; Donica, Denise K.; Robison, Milena
2013-01-01
The purpose of this study was to evaluate and measure the effectiveness of Handwriting Without Tears (HWT) modified gray block paper with letter writing on two preschool students diagnosed with developmental delays in pre-academics. Two students were selected from a self-contained special education preschool classroom in the Pacific Northwest. All…
A Study of the Effect of Letter Spacing on the Reading Speed of Young Readers with Low Vision
McLeish, Eve
2007-01-01
The aims of this study were two-fold: firstly, to establish a method of applying consistent letter spacing to documents using MS Word, and secondly, to investigate the effect of increased letter spacing on the reading speeds of readers with low vision. Tests on 14 readers with low vision showed that increased letter spacing benefited their reading…
Verse Letter from Gregory of Nazianzus to Vitalianus
Directory of Open Access Journals (Sweden)
Erika Brodňanská
2012-12-01
Full Text Available The article offers a complex view of the poetic letter of Gregory of Nazianzus II, II, 3 Ad Vitalianum, which has not yet been the subject of modern criticism. The letter is a plea by Vitalianus’ banished sons for their father to take them back. Based on the manuscript tradition, the article’s author concludes that the fictional author of the letter is the son Phocas rather than Peter. The disrupted relationship between father and sons is reflected in both the content of the poem and the forms of salutations used: the seemingly positive epithets φέριστε, μακάρτατε, and φίλε; forms of address which directly express a certain distance and coldness (μέγα φέρτατε, ὦ ἄνα, or even animosity towards the father (ὀλοώτατε δαῖμον, ὦ κακόβουλε. The poetic letter has a concentric structure (A; B; C; D; E; F; G; F´; E´; D´; C´; B´; A´, with individual components linked for the most part thematically. The letter is written in dactylic hexameter. The most frequently used metre in the verses is the holodactyl, and the most frequent caesura is the caesura post tertium trochaeum. As far as the breach of Hermann’s bridge in verses is concerned, and based on the understanding of the term ‘word’ in metrics, the author of the article concludes that in the majority of cases the breach is only ‘visual’, and cannot be detected when listened to. Gregory did not avoid three true hiatuses; and in two verses, in order to keep the rhythm of dactylic hexameter, it is essential to measure a long syllable as a short one. However, metric errors may be related to prosodic licence.
Hoorens, Vera; Takano, Keisuke; Franck, Erik; Roberts, John E; Raes, Filip
2015-09-01
We tested the usefulness of name-letter preference scores as indirect indicators of self-esteem by exploring whether multiple unsupervised self-administrations of letter rating tasks within a short period of time yield useful data. We also examined whether preferences for initials and noninitial name-letters tap different aspects of self-esteem. Participants from a community sample (N = 164; 58 men and 106 women, 17-67 years, Mage = 34.57, SD = 13.28) completed daily letter rating tasks and state self-esteem questionnaires for 7 consecutive days. They also completed a trait self-esteem questionnaire on the first measurement day as well as 6 months later. Preference scores for first-name initials were stronger but more unstable than preference scores for other name-letters. Preferences for first-name initials were primarily associated with directly measured state self-esteem whereas preferences for noninitials were primarily associated with directly measured trait self-esteem even if the latter was measured 6 months later. Thus, we showed that preferences for initials and noninitials are not simply interchangeable. Previous letter rating studies, which almost exclusively used initial preferences, should be interpreted in terms of state rather than trait self-esteem. In future studies, researchers should focus on the name-letter preference that reflects the aspect of self-esteem they wish to address. (c) 2015 APA, all rights reserved.
TMS Over the Cerebellum Interferes with Short-term Memory of Visual Sequences.
Ferrari, C; Cattaneo, Z; Oldrati, V; Casiraghi, L; Castelli, F; D'Angelo, E; Vecchi, T
2018-04-30
Growing evidence suggests that the cerebellum is not only involved in motor functions, but it significantly contributes to sensory and cognitive processing as well. In particular, it has been hypothesized that the cerebellum identifies recurrent serial events and recognizes their violations. Here we used transcranial magnetic stimulation (TMS) to shed light on the role of the cerebellum in short-term memory of visual sequences. In two experiments, we found that TMS over the right cerebellar hemisphere impaired participants' ability to recognize the correct order of appearance of geometrical stimuli varying in shape and/or size. In turn, cerebellar TMS did not affect recognition of highly familiar short sequences of letters or numbers. Overall, our data suggest that the cerebellum is involved in memorizing the order in which (concatenated) stimuli appear, this process being important for sequence learning.
Advice letter on policy instruments renewable electricity
International Nuclear Information System (INIS)
2011-01-01
In a letter of July 2010 the Energy Council made recommendations for a policy framework with more obligations and fewer subsidies. This included the Energy Council's advice to investigate whether the introduction of a supplier obligation could play a major role in the realisation of the CO2 emission target of the Netherlands and increase the share of renewable energy in line with European agreements. This advice letter deals with one aspect of the broader considerations: the share of renewable electricity and the kind of incentive framework that is needed to achieve the target concerned. In this letter we will examine the possibilities of the SDE+ support (financial incentive for renewable energy) scheme and the supplier obligation, the effects on the market and the consequences for achieving the target. This letter closes with conclusions and recommendations. [nl
Alphabetical: How Every Letter Tells a Story
Rosen, Michael
2013-01-01
From minding your Ps and Qs to wondering why X should mark the spot, Alphabetical is a book for everyone who loves words and language. Whether it's how letters are arranged on keyboards or Viking runes, textspeak or zip codes, this book will change the way you think about letters for ever. How on Earth did we fix upon our twenty-six letters, what do they really mean, and how did we come to write them down in the first place? Michael Rosen takes you on an unforgettable adventure through the hi...
When do letter features migrate? A boundary condition for feature-integration theory.
Butler, B E; Mewhort, D J; Browse, R A
1991-01-01
Feature-integration theory postulates that a lapse of attention will allow letter features to change position and to recombine as illusory conjunctions (Treisman & Paterson, 1984). To study such errors, we used a set of uppercase letters known to yield illusory conjunctions in each of three tasks. The first, a bar-probe task, showed whole-character mislocations but not errors based on feature migration and recombination. The second, a two-alternative forced-choice detection task, allowed subjects to focus on the presence or absence of subletter features and showed illusory conjunctions based on feature migration and recombination. The third was also a two-alternative forced-choice detection task, but we manipulated the subjects' knowledge of the shape of the stimuli: In the case-certain condition, the stimuli were always in uppercase, but in the case-uncertain condition, the stimuli could appear in either upper- or lowercase. Subjects in the case-certain condition produced illusory conjunctions based on feature recombination, whereas subjects in the case-uncertain condition did not. The results suggest that when subjects can view the stimuli as feature groups, letter features regroup as illusory conjunctions; when subjects encode the stimuli as letters, whole items may be mislocated, but subletter features are not. Thus, illusory conjunctions reflect the subject's processing strategy, rather than the architecture of the visual system.
Analysis and synthesis of nuclear medical letters in the field of nephrological diseases
International Nuclear Information System (INIS)
Kley, K.H.
1979-01-01
The task of this study consisted in providing the conditions for the automized issue of nuclear nephrological medical letters based on the nuclear medical polyclinic Marburg Selex system working for 8 years now. Part of the task was to develop the structure and coding of the medical letter content appropriately for EDP documentation, as in the Selex system all data for medical letter acquisition are simultaneously acquired on a data carrier for EDP documentation. The analysis of commonly provided medical letters also exhibited in this field the known weaknesses: especially insufficient systematics and the all-over information of interfering redundances. The work describes in detail how the required thesaurus has been worked out and structured into obligatory and optional rough and detailed components. A general form was developed for the findings of paired organs and the special form for nuclear nephrological medical letters was adapted to it. Of the auxiliaries worked out for the doctor in setting up the working instructions to operate the Selex system, scriptate leaflet, short vocabulary album; the two former are presented fully and the latter with typical examples. The result of this work can basically also be applied to other hardware. (orig.) [de
Visual and Artistic Functions of Letters in Khaghani’s Poetry
Directory of Open Access Journals (Sweden)
Mohsen Zolfaghari
2013-11-01
Full Text Available Abstract The intensity of emotion and fluctuation of meaning in the poet's mind causes him to go beyond the ordinary language and convey intellectual and emotional meanings through metaphors, similes and linguistic preparations. He has sharp eyes and a sensitive spirit and creative temperament and attempts strengthening his own literary language and creating personal style by inventing novel images, showing the creativity and imagination and entering in various arenas of imagination. This point more than anything else could be done by presenting images and new figures. Perhaps in the sixth century, and especially in Azerbaijani school, more than other periods, poets have been looking for creating innovative style in eloquence. Their major attempts were mainly in imaging, a wide field that they have competed. It is obvious that in this illustration the alphabet letters would be very helpful. Khaghani's Divan of poetry, as one of the greatest poets of this school, is the perfect poetical book of paintings in which meaning has been hidden under a delicate pattern and new different scientific, cultural and religious images. Letters are a broad range of elements that put a new field in front of the poet and he is aware of the potential features of the letters, new images, and artistic creativity techniques as well. This paper shows descriptive - analytical study of various aspects of Khaghani’s poetry and frequency of letters in the alphabet letters, alphabetic-based authenticity of images, different similarity reasons, semantic and literal multi-relevance of letters in the context of poetry, producing figures of speech based on letters, sensational relationship exists between images and letters which have been shown in his poetry. Letter have a double and even multiple application in Khaghani's poetic works (divan and moreover the construction of words and conveying meaning which is the real and common usage, they were used as artistic instruments
Digit and letter alexia in carbon monoxide poisoning
Institute of Scientific and Technical Information of China (English)
Qingyu Shen; Xiaoming Rong; Rui Pan; Ying Peng; Wei Peng; Yamei Tang
2012-01-01
This study examined a 24-year-old patient with delayed encephalopathy, who was admitted to hospital with complaints of headache and visual impairment 1 week after acute carbon monoxide poisoning. The results of a visual field assessment, electroencephalography and head magnetic resonance imaging indicated damage to the cerebral cortex. After a 2-week treatment period, the patient had recovered from the visual impairment, but exhibited digit- and letter-reading difficulty. The Chinese aphasia battery and the number and letter battery supplement were conducted. The results revealed that the patient exhibited digit and letter alexia, while the ability to read Chinese characters was preserved. In contrast, the patient exhibited a deficit in Chinese character writing, while number and letter writing remained intact. Following treatment, reading and writing ability was improved and electroencephalographic abnormalities were ameliorated. Overall, our experimental findings demonstrated that delayed encephalopathy following acute carbon monoxide poisoning was characterized by digit and letter alexia.
The Indirect Empathic Approach to Claim Letters.
Bell, James D.
1985-01-01
In discussing letter-writing methods for business communication classes, the article explains that claim letter formats other than the direct approach are not only legitimate, but also effective, and suggests that the approach selected should depend upon the circumstances surrounding the claim. (CT)
Culture and subculture in transactional letter writing
DEFF Research Database (Denmark)
Shaw, Philip; Okamura, Akiko
2000-01-01
This study examines the relative contributions of subculture membership and mother-tongue status/target culture membership in writing transactional letters. We examined the letters accompanying articles initially submitted for publication by 26 NSE and 23 NNSE academics, and compared them with ef...
Draft genome sequences of two virulent serotypes of avian Pasteurella multocida
Here we report the draft genome sequences of two virulent avian strains of Pasteurella multocida. Comparative analyses of these genomes were done with the published genome sequence of avirulent Pasteurella multocida strain Pm70....
Draft Genome Sequences of Two Virulent Serotypes of Avian Pasteurella multocida
Abrahante, Juan E.; Johnson, Timothy J.; Hunter, Samuel S.; Maheswaran, Samuel K.; Hauglund, Melissa J.; Bayles, Darrell O.; Tatum, Fred M.; Briggs, Robert E.
2013-01-01
Here we report the draft genome sequences of two virulent avian strains of Pasteurella multocida. Comparative analyses of these genomes were done with the published genome sequence of avirulent P.?multocida strain Pm70.
Directory of Open Access Journals (Sweden)
Ilaria Bizzozero
2013-05-01
Full Text Available Background/Aims: In Alzheimer's dementia (AD, letter fluency is less impaired than category fluency. To check whether category fluency and letter fluency depend differently on semantics and attention, 53 mild AD patients were given animal and letter fluency tasks, two semantic tests (the Verbal Semantic Questionnaire and the BORB Association Match test, and two attentional tests (the Stroop Colour-Word Interference test and the Digit Cancellation test. Methods: We conducted a LISREL confirmatory factor analysis to check the extent to which category fluency and letter fluency tasks were related to semantics and attention, viewed as latent variables. Results: Both types of fluency tasks were related to the latent variable Semantics but not to the latent variable Attention. Conclusions: Our findings warn against interpreting the disproportionate impairment of AD patients on category and letter fluency as a contrast between semantics and attention.
Directory of Open Access Journals (Sweden)
Lawrence Gregory Appelbaum
2009-11-01
Full Text Available The decoding of visually presented line segments into letters, and letters into words, is critical to fluent reading abilities. Here we investigate the temporal dynamics of visual orthographic processes, focusing specifically on right hemisphere contributions and interactions between the hemispheres involved in the implicit processing of visually presented words, consonants, false fonts, and symbolic strings. High-density EEG was recorded while participants detected infrequent, simple, perceptual targets (dot strings embedded amongst a of character strings. Beginning at 130ms, orthographic and non-orthographic stimuli were distinguished by a sequence of ERP effects over occipital recording sites. These early latency occipital effects were dominated by enhanced right-sided negative-polarity activation for non-orthographic stimuli that peaked at around 180ms. This right-sided effect was followed by bilateral positive occipital activity for false-fonts, but not symbol strings. Moreover the size of components of this later positive occipital wave was inversely correlated with the right-sided ROcc180 wave, suggesting that subjects who had larger early right-sided activation for non-orthographic stimuli had less need for more extended bilateral (e.g. interhemispheric processing of those stimuli shortly later. Additional early (130-150ms negative-polarity activity over left occipital cortex and longer-latency centrally distributed responses (>300ms were present, likely reflecting implicit activation of the previously reported ‘visual-word-form’ area and N400-related responses, respectively. Collectively, these results provide a close look at some relatively unexplored portions of the temporal flow of information processing in the brain related to the implicit processing of potentially linguistic information and provide valuable information about the interactions between hemispheres supporting visual orthographic processing.
50 CFR 216.257 - Letters of Authorization.
2010-10-01
... ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE MAMMALS REGULATIONS GOVERNING THE TAKING AND IMPORTING OF MARINE MAMMALS Taking Marine Mammals Incidental to Conducting Precision Strike Weapon Missions in the Gulf of Mexico § 216.257 Letters of Authorization. (a) A Letter of Authorization, unless suspended or revoked...
International Nuclear Information System (INIS)
2004-01-01
The present collection of letters from JINR, Dubna, contains nine separate letters on data on elastic (p,n) charge exchange: compilation, the potentialities of δ-electron control of luminosity in experiments with internal targets at the Nuclotron, pion broadening and low-mass dilepton production, fluctuation of electromagnetic cascade axis in dense amorphous segmented media, the forward detector of the ANKE spectrometer. Tracking system and its use in data analysis, quantum field theory with three-dimensional vector time, curvature decomposition and the Einstein-Yang-Mills equations, an integral equation for the spinor amplitude of a massive neutral Dirac particle in a curved space time with arbitrary geometry and surprising resonances in 147 Sm(nα) 144 Nd reaction
Experimental test of contemporary mathematical models of visual letter recognition.
Townsend, J T; Ashby, F G
1982-12-01
A letter confusion experiment that used brief durations manipulated payoffs across the four stimulus letters, which were composed of line segments equal in length. The observers were required to report the features they perceived as well as to give a letter response. The early feature-sampling process is separated from the later letter-decision process in the substantive feature models, and predictions are thus obtained for the frequencies of feature report as well as letter report. Four substantive visual feature-processing models are developed and tested against one another and against three models of a more descriptive nature. The substantive models predict the decisional letter report phase much better than they do the feature-sampling phase, but the best overall 4 X 4 letter confusion matrix fits are obtained with one of the descriptive models, the similarity choice model. The present and other recent results suggest that the assumption that features are sampled in a stochastically independent manner may not be generally valid. The traditional high-threshold conceptualization of feature sampling is also falsified by the frequent reporting by observers of features not contained in the stimulus letter.
Draft Genome Sequences of Two Virulent Serotypes of Avian Pasteurella multocida
Abrahante, Juan E.; Johnson, Timothy J.; Hunter, Samuel S.; Maheswaran, Samuel K.; Hauglund, Melissa J.; Bayles, Darrell O.; Tatum, Fred M.
2013-01-01
Here we report the draft genome sequences of two virulent avian strains of Pasteurella multocida. Comparative analyses of these genomes were done with the published genome sequence of avirulent P. multocida strain Pm70. PMID:23405337
Directory of Open Access Journals (Sweden)
Paulo Roberto Gonçalves Segundo
2014-07-01
Full Text Available This article aims to describe and analyze, through a representational and negotiative approach, the discursive construction of the fire that took place in the dance club Kiss, in Santa Maria, in January 2013, based on a corpus composed by readers’ letters published in the newspaper Folha de S. Paulo in the days that followed the event. In order to do so, we used theoretical presuppositions and analytical categories related to systemic functional linguistics, focusing on the relation between lexicon-grammatical and discursive-semantic classes in terms of the ideational and interpersonal metafunctions. We concluded that these letters are marked by the prevalence of critical and exhortative text models, marked by a high incidence of negative judgments of social esteem and social sanction, focused on the construction of a frame of incapacity, omission and impropriety, responsible for the recurrence of this kind of events. Thus, there are, in this letters, evidences of the updating of a rhetoric-affective sequence of indignation – that supports the conception of several letters – embedded in the critical and exhortative models of textual production.
Standardized letters of recommendation and successful match into otolaryngology.
Kimple, Adam J; McClurg, Stanley W; Del Signore, Anthony G; Tomoum, Mohamed O; Lin, Feng-Chang; Senior, Brent A
2016-05-01
Historically, narrative letters of recommendation have been utilized in the selection of applicants for otolaryngology residency programs. In the last two application cycles, our specialty adopted a standardized letter of recommendation (SLOR). The intent was to decrease time burden for letter writers and to provide readers with an objective evaluation of applicants. The objective of this study was to determine attributes in the SLOR that correlate with matching into a residency program. We performed a retrospective study using SLOR, United States Medical Licensing Examination (USMLE) step 1 scores, and matched outcomes of applicants who applied to our institution for the 2013 and 2014 match cycle. We included the following variables from the SLOR in the statistical analysis to determine which ones were associated with matching: patient care, medical knowledge, communication skills, procedural skills, research, initiative and drive, commitment to otolaryngology, commitment to academic medicine, match potential, and USMLE1 scores. We identified 532 applicants and 963 SLOR. In successful applicants, scores for patient care, medical knowledge, communication skills, initiative and drive, and match potential were statistically higher (P otolaryngology, commitment to academic medicine, and USMLE step 1 scores were not higher among successfully matched applicants. Although SLOR can save time for letter writers and provide an objective description of applicants, the utility of individual domains within the SLOR is questionable. Additionally, it is concerning that applicants' professionalism and procedural skills are not correlated with matching in our specialty. NA. Laryngoscope, 126:1071-1076, 2016. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.
Extra-large letter spacing improves reading in dyslexia
Zorzi, Marco; Barbiero, Chiara; Facoetti, Andrea; Lonciari, Isabella; Carrozzi, Marco; Montico, Marcella; Bravar, Laura; George, Florence; Pech-Georgel, Catherine; Ziegler, Johannes C.
2012-01-01
Although the causes of dyslexia are still debated, all researchers agree that the main challenge is to find ways that allow a child with dyslexia to read more words in less time, because reading more is undisputedly the most efficient intervention for dyslexia. Sophisticated training programs exist, but they typically target the component skills of reading, such as phonological awareness. After the component skills have improved, the main challenge remains (that is, reading deficits must be treated by reading more—a vicious circle for a dyslexic child). Here, we show that a simple manipulation of letter spacing substantially improved text reading performance on the fly (without any training) in a large, unselected sample of Italian and French dyslexic children. Extra-large letter spacing helps reading, because dyslexics are abnormally affected by crowding, a perceptual phenomenon with detrimental effects on letter recognition that is modulated by the spacing between letters. Extra-large letter spacing may help to break the vicious circle by rendering the reading material more easily accessible. PMID:22665803
Gompel, Marjolein; van Bon, Wim H. J.; Schreuder, Robert
2004-01-01
Two aspects of word reading were investigated in two word-naming experiments: the identification of the constituent letters of a word and the processing of letter-order information. Both experiments showed qualitative differences between children with low vision and sighted children, but no quantitative or qualitative differences within the group…
The Predictive Validity of Teacher Candidate Letters of Reference
Mason, Richard W.; Schroeder, Mark P.
2014-01-01
Letters of reference are widely used as an essential part of the hiring process of newly licensed teachers. While the predictive validity of these letters of reference has been called into question it has never been empirically studied. The current study examined the predictive validity of the quality of letters of reference for forty-one student…
Directory of Open Access Journals (Sweden)
Аndriy V. Sadchenko
2015-12-01
Full Text Available Digital television systems need to ensure that all digital signals processing operations are performed simultaneously and consistently. Frame synchronization dictated by the need to match phases of transmitter and receiver so that it would be possible to identify the start of a frame. As a frame synchronization signals are often used long length binary sequence with good aperiodic autocorrelation function. Aim: This work is dedicated to the development of the algorithm of random length sequences synthesis. Materials and Methods: The paper provides a comparative analysis of the known sequences, which can be used at present as synchronization ones, revealed their advantages and disadvantages. This work proposes the algorithm for the synthesis of binary synchronization sequences of random length with good autocorrelation properties based on noise generator with a uniform distribution law of probabilities. A "white noise" semiconductor generator is proposed to use as the initial material for the synthesis of binary sequences with desired properties. Results: The statistical analysis of the initial implementations of the "white noise" and synthesized sequences for frame synchronization of digital television is conducted. The comparative analysis of the synthesized sequences with known ones was carried out. The results show the benefits of obtained sequences in compare with known ones. The performed simulations confirm the obtained results. Conclusions: Thus, the search algorithm of binary synchronization sequences with desired autocorrelation properties received. According to this algorithm, the sequence can be longer in length and without length limitations. The received sync sequence can be used for frame synchronization in modern digital communication systems that will increase their efficiency and noise immunity.
Teaching letter sounds to kindergarten English language learners using incremental rehearsal.
Peterson, Meredith; Brandes, Dana; Kunkel, Amy; Wilson, Jennifer; Rahn, Naomi L; Egan, Andrea; McComas, Jennifer
2014-02-01
Proficiency in letter-sound correspondence is important for decoding connected text. This study examined the effects of an evidence-based intervention, incremental rehearsal (IR), on the letter-sound expression of three kindergarten English language learners (ELLs) performing below the district benchmark for letter-sound fluency. Participants were native speakers of Hmong, Spanish, and Polish. A multiple-baseline design across sets of unknown letter sounds was used to evaluate the effects of IR on letter-sound expression. Visual analysis of the data showed an increase in level and trend when IR was introduced in each phase. Percentage of all non-overlapping data (PAND) ranged from 95% to 100%. All participants exceeded expected growth and reached the spring district benchmark for letter-sound fluency. Results suggest that IR is a promising intervention for increasing letter-sound expression for ELLs who evidence delays in acquiring letter sounds. Copyright © 2013 Society for the Study of School Psychology. Published by Elsevier Ltd. All rights reserved.
40 CFR 280.99 - Letter of credit.
2010-07-01
... (UST) Financial Responsibility § 280.99 Letter of credit. (a) An owner or operator may satisfy the... brackets are to be replaced with the relevant information and the brackets deleted: Irrevocable Standby.... We certify that the wording of this letter of credit is identical to the wording specified in 40 CFR...
International Nuclear Information System (INIS)
2004-01-01
The present collection of letters from JINR, Dubna, contains eight separate letters on analysis of experimental data on relativistic nuclear collisions in the Lobachevski space, relativistic contribution of the final-state interaction to deuteron photodisintegration, on the charge asymmetry of the like-sign lepton pairs induced by B - B bar - production asymmetry, limits on the ν e → ν e neutrino oscillation parameters from an experiment at the IHEP-JINR neutrino detector, excitation of high spin isomers in photonuclear reactions, study of product formation in proton-nuclear reactions on the 129 I target induced by 660-MeV protons, application of jet pumps in the cryogenic system of the Nuclotron - superconducting accelerator of relativistic particles and study of the silicon drift detector performance with inclined tracks
Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.
2017-07-01
DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.
Comradely Greetings: The Prison Letters of Nadya and Slavoj
Directory of Open Access Journals (Sweden)
Marco Briziarelli
2015-02-01
Full Text Available Žižek and Tolokonnikova’s exchange letters provides the reader with the suggestive image and evocative words of two intellectuals speaking from very different contexts. This article discusses the relevance of this volume in the context of localized global capitalism and an equally localized global struggle against it.
Disabled vs nondisabled readers: perceptual vs higher-order processing of one vs three letters.
Allegretti, C L; Puglisi, J T
1986-10-01
12 disabled and 12 nondisabled readers (mean age, 11 yr.) were compared on a letter-search task which separated perceptual processing from higher-order processing. Participants were presented a first stimulus (for 200 msec. to minimize eye movements) followed by a second stimulus immediately to estimate the amount of information initially perceived or after a 3000-msec. interval to examine information more permanently stored. Participants were required to decide whether any letter present in the first stimulus was also present in the second. Two processing loads (1 and 3 letters) were examined. Disabled readers showed more pronounced deficits when they were given very little time to process information or more information to process.
Camproux, A C; Tufféry, P
2005-08-05
Understanding and predicting protein structures depend on the complexity and the accuracy of the models used to represent them. We have recently set up a Hidden Markov Model to optimally compress protein three-dimensional conformations into a one-dimensional series of letters of a structural alphabet. Such a model learns simultaneously the shape of representative structural letters describing the local conformation and the logic of their connections, i.e. the transition matrix between the letters. Here, we move one step further and report some evidence that such a model of protein local architecture also captures some accurate amino acid features. All the letters have specific and distinct amino acid distributions. Moreover, we show that words of amino acids can have significant propensities for some letters. Perspectives point towards the prediction of the series of letters describing the structure of a protein from its amino acid sequence.
Protecting unknown two-qubit entangled states by nesting Uhrig's dynamical decoupling sequences
International Nuclear Information System (INIS)
Mukhtar, Musawwadah; Soh, Wee Tee; Saw, Thuan Beng; Gong, Jiangbin
2010-01-01
Future quantum technologies rely heavily on good protection of quantum entanglement against environment-induced decoherence. A recent study showed that an extension of Uhrig's dynamical decoupling (UDD) sequence can (in theory) lock an arbitrary but known two-qubit entangled state to the Nth order using a sequence of N control pulses [Mukhtar et al., Phys. Rev. A 81, 012331 (2010)]. By nesting three layers of explicitly constructed UDD sequences, here we first consider the protection of unknown two-qubit states as superposition of two known basis states, without making assumptions of the system-environment coupling. It is found that the obtained decoherence suppression can be highly sensitive to the ordering of the three UDD layers and can be remarkably effective with the correct ordering. The detailed theoretical results are useful for general understanding of the nature of controlled quantum dynamics under nested UDD. As an extension of our three-layer UDD, it is finally pointed out that a completely unknown two-qubit state can be protected by nesting four layers of UDD sequences. This work indicates that when UDD is applicable (e.g., when the environment has a sharp frequency cutoff and when control pulses can be taken as instantaneous pulses), dynamical decoupling using nested UDD sequences is a powerful approach for entanglement protection.
International Nuclear Information System (INIS)
2002-01-01
The present collection of letters from JINR, Dubna, contains ten separate records on Wien filter using in exploring on low-energy radioactive nuclei, memory effects in dissipative nucleus-nucleus collision, topological charge and topological susceptibility in connection with translation and gauge invariance, solutions of the multitime Dirac equation, the maximum entropy technique. System's statistical description, the charged conductor inside dielectric. Solution of boundary condition by means of auxiliary charges and the method of linear algebraic equations, optical constants of the TGS single crystal irradiated by power pulsed electron beam, interatomic pair potential and n-e amplitude from slow neutron scattering by noble gases, the two-coordinate multiwire proportional chamber of the high spatial resolution and neutron drip line in the region of O-Mg isotopes
The elaboration of motor programs for the automation of letter production.
Thibon, Laurence Séraphin; Gerber, Silvain; Kandel, Sonia
2018-01-01
We investigated how children learn to write letters. Letter writing evolves from stroke-by-stroke to whole-letter programming. Children of ages 6 to 9 (N=98) wrote letters of varying complexity on a digitizer. At ages 6 and 7 movement duration, dysfluency and trajectory increased with stroke number. This indicates that the motor program they activated mainly coded information on stroke production. Stroke number affected the older children's production much less, suggesting that they programmed stroke chunks or the whole letter. The fact that movement duration and dysfluency decreased from ages 6 to 8, and remained stable at ages 8 and 9 suggests that automation of letter writing begins at age 8. Automation seems to require the elaboration of stroke chunks and/or letter-sized motor programs. Copyright © 2017 Elsevier B.V. All rights reserved.
Sequence determination and analysis of the NSs genes of two tospoviruses.
Hallwass, Mariana; Leastro, Mikhail O; Lima, Mirtes F; Inoue-Nagata, Alice K; Resende, Renato O
2012-03-01
The tospoviruses groundnut ringspot virus (GRSV) and zucchini lethal chlorosis virus (ZLCV) cause severe losses in many crops, especially in solanaceous and cucurbit species. In this study, the non-structural NSs gene and the 5'UTRs of these two biologically distinct tospoviruses were cloned and sequenced. The NSs sequence of GRSV and ZLCV were both 1,404 nucleotides long. Pairwise comparison showed that the NSs amino acid sequence of GRSV shared 69.6% identity with that of ZLCV and 75.9% identity with that of TSWV, while the NSs sequence of ZLCV and TSWV shared 67.9% identity. Phylogenetic analysis based on NSs sequences confirmed that these viruses cluster in the American clade.
Lambrou, George I.; Chatziioannou, Aristotelis; Vlahopoulos, Spiros; Moschovi, Maria; Chrousos, George P.
Biological systems are dynamic and possess properties that depend on two key elements: initial conditions and the response of the system over time. Conceptualizing this on tumor models will influence conclusions drawn with regard to disease initiation and progression. Alterations in initial conditions dynamically reshape the properties of proliferating tumor cells. The present work aims to test the hypothesis of Wolfrom et al., that proliferation shows evidence for deterministic chaos in a manner such that subtle differences in the initial conditions give rise to non-linear response behavior of the system. Their hypothesis, tested on adherent Fao rat hepatoma cells, provides evidence that these cells manifest aperiodic oscillations in their proliferation rate. We have tested this hypothesis with some modifications to the proposed experimental setup. We have used the acute lymphoblastic leukemia cell line CCRF-CEM, as it provides an excellent substrate for modeling proliferation dynamics. Measurements were taken at time points varying from 24h to 48h, extending the assayed populations beyond that of previous published reports that dealt with the complex dynamic behavior of animal cell populations. We conducted flow cytometry studies to examine the apoptotic and necrotic rate of the system, as well as DNA content changes of the cells over time. The cells exhibited a proliferation rate of nonlinear nature, as this rate presented oscillatory behavior. The obtained data have been fit in known models of growth, such as logistic and Gompertzian growth.
Pseudo-synesthesia through reading books with colored letters.
Directory of Open Access Journals (Sweden)
Olympia Colizoli
Full Text Available BACKGROUND: Synesthesia is a phenomenon where a stimulus produces consistent extraordinary subjective experiences. A relatively common type of synesthesia involves perception of color when viewing letters (e.g. the letter 'a' always appears as light blue. In this study, we examine whether traits typically regarded as markers of synesthesia can be acquired by simply reading in color. METHODOLOGY/PRINCIPAL FINDINGS: Non-synesthetes were given specially prepared colored books to read. A modified Stroop task was administered before and after reading. A perceptual crowding task was administered after reading. Reading one book (>49,000 words was sufficient to induce effects regarded as behavioral markers for synesthesia. The results of the Stroop tasks indicate that it is possible to learn letter-color associations through reading in color (F(1, 14 = 5.85, p = .030. Furthermore, Stroop effects correlated with subjective reports about experiencing letters in color (r(13 = 0.51, p = .05. The frequency of viewing letters is related to the level of association as seen by the difference in the Stroop effect size between upper- and lower-case letters (t(14 = 2.79, p = .014 and in a subgroup of participants whose Stroop effects increased as they continued to read in color. Readers did not show significant performance advantages on the crowding task compared to controls. Acknowledging the many differences between trainees and synesthetes, results suggest that it may be possible to acquire a subset of synesthetic behavioral traits in adulthood through training. CONCLUSION/SIGNIFICANCE: To our knowledge, this is the first evidence of acquiring letter-color associations through reading in color. Reading in color appears to be a promising avenue in which we may explore the differences and similarities between synesthetes and non-synesthetes. Additionally, reading in color is a plausible method for a long-term 'synesthetic' training program.
Earth Data Analysis Center, University of New Mexico — The National Flood Hazard Layer (NFHL) data incorporates all Digital Flood Insurance Rate Map(DFIRM) databases published by FEMA, and any Letters Of Map Revision...
International Nuclear Information System (INIS)
2004-01-01
The present collection of letters from JINR, Dubna, contains nine separate letters on nonlocal chiral quark model with confinement, perturbation of finite-lattice spectral levels by nearby nuclear resonances, on the application of 'Z 0 + jet' events for determining the gluon distribution in a proton at the LHC, account of light velocity constancy in the Galilean problem on the free movement of a particle and its fall onto the ground, first results of crystal deflector investigations at the Nuclotron external beams, decay parameters of K mesons, measured at proton synchrotron U-70 using 'Hyperon' set-up and modern world data, prototype of atomic-emission spectrometer on the basis of one-electrode impulse RF discharge for analytical measurements, polarimeter for Nuclotron internal beam and primordial bubbles of colour superconducting quark matter
Directory of Open Access Journals (Sweden)
Marjan Yazdanpanahi
2016-07-01
Full Text Available This paper discusses two novels The Private Memoirs and Confessions of a Justified Sinner and The Scarlet Letter written by James Hogg and Nathaniel Hawthorn from the perspective of Jacques Lacan theories: the mirror stage, the-name-of-the-father and desire. The mirror stage refers to historical value and an essential libidinal relationship with the body-image. The-name-of-the-father is defined as the prohibitive role of the father as the one who lays down the incest taboo in the Oedipus complex. Meanwhile, desire is neither the appetite for satisfaction, nor the demand for love, but the difference that results from the subtraction of the first from the second.
Patient information letters on nutrition: development and implementation.
Binsbergen, J.J. van; Drenthen, A.J.
2003-01-01
BACKGROUND: In 1998 the Dutch College of General Practitioners (NHG) began developing patient information letters (PILs), based on the practice guidelines for family physicians (FPs) (NHG standards). Five nutritional guidance letters have since been developed with the Dutch Nutrition Center.
Directory of Open Access Journals (Sweden)
Junji eOhyama
2016-02-01
Full Text Available We examined how the temporal and spatial predictability of a task-irrelevant visual event affects the detection and memory of a visual item embedded in a continuously changing sequence. Participants observed 11 sequentially presented letters, during which a task-irrelevant visual event was either present or absent. Predictabilities of spatial location and temporal position of the event were controlled in 2 × 2 conditions. In the spatially predictable conditions, the event occurred at the same location within the stimulus sequence or at another location, while, in the spatially unpredictable conditions, it occurred at random locations. In the temporally predictable conditions, the event timing was fixed relative to the order of the letters, while in the temporally unpredictable condition, it could not be predicted from the letter order. Participants performed a working memory task and a target detection reaction time task. Memory accuracy was higher for a letter simultaneously presented at the same location as the event in the temporally unpredictable conditions, irrespective of the spatial predictability of the event. On the other hand, the detection reaction times were only faster for a letter simultaneously presented at the same location as the event when the event was both temporally and spatially predictable. Thus, to facilitate ongoing detection processes, an event must be predictable both in space and time, while memory processes are enhanced by temporally unpredictable (i.e., surprising events. Evidently, temporal predictability has differential effects on detection and memory of a visual item embedded in a sequence of images.
Color associations for days and letters across different languages
Rouw, Romke; Case, Laura; Gosavi, Radhika; Ramachandran, Vilayanur
2014-01-01
While colors are commonplace in everyday metaphors, relatively little is known about implicit color associations to linguistic or semantic concepts in a general population. In this study, we test color associations for ordered linguistic concepts (letters and days). The culture and language specificity of these effects was examined in a large group (457) of Dutch-speaking participants, 92 English-speaking participants, and 49 Hindi-speaking participants. Non-random distributions of color choices were revealed; consistencies were found across the three language groups in color preferences for both days and letters. Interestingly, while the Hindi-speaking participants were presented with letter stimuli matched on phonology, their pattern of letter-to-color preferences still showed similarities with Dutch- and English-speaking participants. Furthermore, we found that that the color preferences corresponded between participants indicating to have conscious color experiences with letters or days (putative synesthetes) and participants who do not (non-synesthetes). We also explored possible mechanisms underlying the color preferences. There were a few specific associations, including red for “A,” red for “Monday,” and white for “Sunday.” We also explored more general mechanisms, such as overall color preferences as shown by Simner et al. (2005). While certainly not all variation can be explained or predicted, the results show that regularities are present in color-to-letter or color-to-day preferences in both putative synesthetes and non-synesthetes across languages. Both letter-to-color and day-to-color preferences were influenced by multiple factors. The findings support a notion of abstract concepts (such as days and letters) that are not represented in isolation, but are connected to perceptual representational systems. Interestingly, at least some of these connections to color representations are shared across different language/cultural groups. PMID
Color associations for days and letters across different languages
Directory of Open Access Journals (Sweden)
Romke eRouw
2014-05-01
Full Text Available While colors are commonplace in everyday metaphors, relatively little is known about implicit color associations to linguistic or semantic concepts in a general population. In this study, we test color associations for ordered linguistic concepts (letters and days. The culture and language specificity of these effects was examined in a large group (457 of Dutch-speaking participants, 92 English-speaking participants, and 49 Hindi-speaking participants. Non-random distributions of color choices were revealed; consistencies were found across the three language groups in color preferences for both days and letters. Interestingly, while the Hindi-speaking participants were presented with letter stimuli matched on phonology, their pattern of letter-to-color preferences still showed similarities with Dutch- and English-speaking participants. Furthermore, we found that that the color preferences corresponded between participants indicating to have conscious color experiences with letters or days (putative synesthetes and participants who do not (non-synesthetes. We also explored possible mechanisms underlying the color preferences. There were a few specific associations, including red for A, red for Monday, and white for Sunday. We also explored more general mechanisms, such as overall color preferences shown by Simner et al (2005. While certainly not all variation can be explained or predicted, the results show that regularities are present in color-to-letter or color-to-day preferences in both putative synesthetes and non-synesthetes across languages. Both letter-to-color and day-to-color preferences were influenced by multiple factors. The findings support a notion of abstract concepts (such as days and letters that are not represented in isolation, but are connected to perceptual representational systems. Interestingly, at least some of these connections to color representations are shared across different language/cultural groups.
Michelangelo, a Tireless Letter Writer
Directory of Open Access Journals (Sweden)
Adelin Charles Fiorato
2014-04-01
Full Text Available A titan of artistic creation, the sculptor-painter-architect Michelangelo was also a tireless letter writer. Five hundred and eighteen of his letters have reached us, stretching from his youth to the eve of his death, but we know that many others have been lost. Written in a kind of familiar Florentine and in a style of minimalist ‘realism’ – which does not prevent the presence of either impetuous polemical flights or pages of literary indulgence – these letters deal mainly with everyday subjects: day-by-day relationships, either endearing or resentful, with his relatives, financial or property matters and, above all, the marriage problems which concerned his nephew Leonardo, the sole heir of the family. But one also discovers in them the artist’s warm feelings of friendship and love, his poetic and aesthetic exchanges, his relationships, often conflictual, with his fellow-artists and patrons as well as his reflections on old age and death. All in all, these letters represent a documentary chronicle of a Florentine bourgeois family and the technical hassle of an entrepreneur’s activity. If, on the one hand, the Carteggio does not shed light either on Michelangelo’s conception of art or the way in which he realized his works, on the other it illustrates certain latent aspects of his projects, as well as of his personality, which was at the same time melancholy and aggressive, surprisingly whole and manifold. This luxuriant correspondence presents, so to speak, a ‘genetic’ interest, since it reveals the hidden face of the brilliant conceiver and creator, of the artist and entrepreneur struggling with the obstacles whose overcoming makes creation possible.
How To Write a Business Letter. Power of the Printed Word.
Forbes, Malcolm
Business letters should turn people on rather than turning them off. To write a good business letter, know what the goal is before starting to write, call the reader by name, tell what the letter is about in the first paragraph, refer to dates when answering letters, and write from the reader's point of view. Be positive, be nice, and be natural.…
Coverage and Rate of Downlink Sequence Transmissions with Reliability Guarantees
DEFF Research Database (Denmark)
Park, Jihong; Popovski, Petar
2017-01-01
Real-time distributed control is a promising application of 5G in which communication links should satisfy certain reliability guarantees. In this letter, we derive closed-form maximum average rate when a device (e.g. industrial machine) downloads a sequence of n operational commands through cell...
DOCUMENTARY LETTER OF CREDIT IN THE REGULATION OF 600-PARIS PUBLICATION
Directory of Open Access Journals (Sweden)
VASILE NEMES
2011-04-01
Full Text Available In the year 2007 was adopted the Publication no. 600 of Paris regarding the Rules and the Uniform Practices for documentary letters of credit which replaced the Publication no. 500. Publication no. 600 (UCP 600 is applied to all the irrevocable documentary letters of credit when the parties make express reference to these Rules. The Publication no. 600 includes uniform rules, international practices and standards of irrevocable documentary letters of credit. The new Publication has brought a number of changes on the issues regarding the performance of the letters of credit, both in the relationship with the nonbanking institutions participants and in the relationship between the credit institutions participating in the performance of the letter of credit. This study, without being exhaustive, aims to capture the main aspects of novelty brought by the publication no. 600 and their legal approach to the new perspective of the international trade relations. It has in view, in particular, the irrevocable character of the letter of credit, the elaboration method and procedure of the letter of credit, the participants to the unfolding of the specific relationship of the letter of credit and the main duties of the involved credit institutions.
Return to sender: Constantijn Huygens as a man of letters
Gosseye, L.; Blom, F.; Leerintveld, A.
2013-01-01
Return to Sender takes as its starting point Constantijn Huygens’ letters and shows us the author in his different guises: intimus of René Descartes, translator of John Donne, collector of art, writer of flirtatious love letters and the author of a long consolatory letter-poem for an ailing friend
Evidence for magnocellular involvement in the identification of flanked letters
Omtzigt, D.; Hendriks, A.W.C.J.; Kolk, H.H.J.
2002-01-01
Little is known about the role of the magno system in reading. One important hypothesis is that this system is involved in the allocation of attention. We reasoned that the presentation of a single letter automatically draws attention to this letter, whereas in the case of a flanked letter, an
Indian Academy of Sciences (India)
We reproduce an english translation of one of these letters below, in which ... contemporary scientific knowledge, and that under the circumstances ... generation it became necessary to limit the numbers because of lack of space, so that, in.
Pseudo-synesthesia through reading books with colored letters
Colizoli, O.; Murre, J.M.J.; Rouw, R.
2012-01-01
Background Synesthesia is a phenomenon where a stimulus produces consistent extraordinary subjective experiences. A relatively common type of synesthesia involves perception of color when viewing letters (e.g. the letter ‘a’ always appears as light blue). In this study, we examine whether traits
Letters on nuclear controversy
International Nuclear Information System (INIS)
Kafka, P.; Maier-Leibnitz, H.
1982-01-01
Heinz Maier-Leibnitz a well-known scientist, nuclear physicist, for 50 years, who publicily supported the idea not to overrate the dangers of peaceful utilization of nuclear energy, has grown tired of talking only to colleagues. He invites a junior fellow physicist, who held engaged speeches against the nuclear power plant Zwentendorf, to an exchange of thoughts. Peter Kafka, an astro-physicist studied the self organisation of the universe from the big bang to the economic crisis and encountered the question of which conditions have to be fulfilled to prevent progress from becoming caranogenous. He became one of the spokesmen of 'political ecology' and called for resistance again large-scale technological use of scientific knowledge. He was enthusiastic about the idea of an exchange of letters, because he - just like his partner - believes in gaining knowledge by discussion. The variety of subjects is sketched briefly in form of three lectures. In the letters both scientists discuss intensly about: - Freedom of science and responsibility of science. - Decisions on energy questions under time-pressure. - Risks of nuclear plants. - Large scale technology and large-scale research or decentralization. - Energy utilization and energy waste. - Nuclear energy and alternatives. - Sense and nonsense of detailed future planning. In the end no one has convinced the other. The reader however finds a lot of new incentives in the letters - printed in unabridged form - a lot of new and significant arguments for a discussion which has only just started. (orig.) [de
Jiwa, Moyez; Arnet, Hayley; Bulsara, Max; Ee, Hooi C; Harwood, Abby
2009-01-01
Access to specialists is mediated by general practitioners in many countries. In these settings, specialists rely on information in referral letters when deciding which cases to schedule for their clinics. Two-hundred and seven consecutive referral letters to gastroenterologists were scored for the amount of information relayed to the specialist, using a published schedule. The 'quality' scores for these referral letters were compared for four groups of patients: patients diagnosed with histological lesion, those with no histological lesion, those who failed to attend clinic, or those who had a diagnosis unknown. Forty-two referral letters were generated with a range of quality scores. Four gastroenterologists were asked to identify which letters described patients 'likely' to have a significant or benign colorectal condition, and whether they could triage the cases for their clinic given only the information in the letters. It was not possible to differentiate which letters related to patients in each of the four categories (P = 0.6). Patients who failed to attend were more symptomatic than those with a histological lesion (35.4 versus 28.2, mean difference 7.14, 95% confidence interval (CI) 14.1 to 0.15, P = 0.045). Patients referred 'urgently' were not, on the basis of the referral letters, the most symptomatic group (29.7 versus 27, mean difference 2.7, 95% CI -3.4 to 8.8, P = 0.38). The specialists failed to agree on the proportion of cases that could be triaged for their clinics. The cases that could be triaged contained more information (mean 66.38 versus 49.86, mean difference 16, 95% CI 1.3-31.7, P information relayed and the diagnosis of a histological lesion. However, more information was helpful when deciding which patients to schedule first. By corollary, patients referred with lesser documentation of their clinical presentation may be denied 'urgent' access to the gastroenterology clinic.
Asset securitization and rate of return: A study on letters of guarantee
Wu, Binghui
2018-01-01
Using the theory of asset securitization, we analyze the feasibility of the securitization of letters of guarantee in theory. In the process of constructing the model of rate of return of securities backed by letters of guarantee, we propose two indices: the risk probability of asset-backed securities and the loss rate of asset-backed securities to analyze the cash flow of securities. On the basis of no arbitrage principle, the expression of rate of return of securities backed by letters of guarantee is put forward. In order to study the relationship between the rate of return of securities and other influential factor in the model, a simulation experiment is designed. The experiment results show that (i) an increasing risk probability of cash flow or a short maturity date also make the return rate of securities increase and (ii) the return rate of securities is higher in economic boom than that in economic recession when other parameters remain unchanged.
International Nuclear Information System (INIS)
Ivanov, V.V.
2003-01-01
The present collection of letters from JINR, Dubna, contains ten separate records on the microscopic entropy and nonlocality, conditional density matrix: systems and subsystems in quantum mechanics, physics of quantum computation, flipping qubits, quantum zeno effect for N-level Friedrichs model, universal hybrid quantum processors, formation of the SU(3)-polarization states in atom-quantum electromagnetic field system under condition of the Bose-Einstein condensate existence, periodical sequences (trajectories) of outcomes of atomic state measurement on exit from the micromaser cavity, an algebraic method to solve the Tavis-Cummings problem, quantum teleportation of nuclear matter and its investigation
DEFF Research Database (Denmark)
Clausen, Anders; Mikkelsen, Marie Just; Schrøder, I.
2004-01-01
The nucleotide sequence of two novel plasmids isolated from the extreme thermophilic anaerobic bacterium Anaerocellum thermophilum DSM6725 (A. thermophilum), growing optimally at 70degreesC, has been determined. pBAS2 was found to be a 3653 bp plasmid with a GC content of 43%, and the sequence re...... with highest similarity to DNA repair protein from Campylobacter jejuni (25% aa). Orf34 showed similarity to sigma factors with highest similarity (28% aa) to the sporulation specific Sigma factor, Sigma 28(K) from Bacillus thuringiensis....
7 CFR 1737.80 - Description of characteristics letter.
2010-01-01
... the amount of the proposed loan, its purposes, rate of interest, loan security requirements, and other... SERVICE, DEPARTMENT OF AGRICULTURE PRE-LOAN POLICIES AND PROCEDURES COMMON TO INSURED AND GUARANTEED TELECOMMUNICATIONS LOANS Characteristics Letter § 1737.80 Description of characteristics letter. (a) After all of the...
Enamel-Caries Prevention Using Two Applications of Fluoride-Laser Sequence.
Noureldin, Amal; Quintanilla, Ines; Kontogiorgos, Elias; Jones, Daniel
2016-03-01
Studies demonstrated a significant synergism between fluoride and laser in reduction of enamel solubility. However, minimal research has focused on testing the sequence of their application and no other research investigated the preventive effect of repeated applications of a combined treatment. This study investigated the effect of two applications of fluoride-laser sequence on the resistance of sound enamel to cariogenic challenge compared to one-time application. Sixty enamel slabs were cut from 10 human incisors, ground flat, polished and coated with nail varnish except a 2 x 2 mm window. Specimens were randomly assigned into five groups of 12 specimens; (CON-) negative-control received no treatment, (CON+) positive-control received pH challenge, (FV) treated with M fluoride varnish, (F-L1) one-application fluoride-varnish followed by CO2 laser-treatment (short-pulsed 10.6 µm, 2.4J/ cm2, 10HZ, 10sec), and (F-L2) two-applications of fluoride varnish-laser treatment. Specimens were left in distilled water for one day between applications. Except CON-, all groups were submitted to pH cycling for 9-days (8 demin/ remin + 1 day remineralisation bath) at 37°C. Enamel demineralization was quantitatively evaluated by measurement of Knoop surface-microhardness (SM H) (50-grams/10 seconds). Data were analyzed using one-way ANOVA (p ≤ 0.05) followed by Duncan's Multiple Range Test. Within the limitations of this study, it was found that one or two applications of fluoride-laser sequence significantly improved resistance of the sound enamel surface to acid attack compared to FV-treated group. Although the two applications of fluoride-laser sequence (F-L1 and F-L2) showed higher SMH values, significant resistance to demineralization was only obtained with repeated applications.
Pseudo-Synesthesia through Reading Books with Colored Letters
Colizoli, Olympia; Murre, Jaap M. J.; Rouw, Romke
2012-01-01
Background Synesthesia is a phenomenon where a stimulus produces consistent extraordinary subjective experiences. A relatively common type of synesthesia involves perception of color when viewing letters (e.g. the letter ‘a’ always appears as light blue). In this study, we examine whether traits typically regarded as markers of synesthesia can be acquired by simply reading in color. Methodology/Principal Findings Non-synesthetes were given specially prepared colored books to read. A modified Stroop task was administered before and after reading. A perceptual crowding task was administered after reading. Reading one book (>49,000 words) was sufficient to induce effects regarded as behavioral markers for synesthesia. The results of the Stroop tasks indicate that it is possible to learn letter-color associations through reading in color (F(1, 14) = 5.85, p = .030). Furthermore, Stroop effects correlated with subjective reports about experiencing letters in color (r(13) = 0.51, p = .05). The frequency of viewing letters is related to the level of association as seen by the difference in the Stroop effect size between upper- and lower-case letters (t(14) = 2.79, p = .014) and in a subgroup of participants whose Stroop effects increased as they continued to read in color. Readers did not show significant performance advantages on the crowding task compared to controls. Acknowledging the many differences between trainees and synesthetes, results suggest that it may be possible to acquire a subset of synesthetic behavioral traits in adulthood through training. Conclusion/Significance To our knowledge, this is the first evidence of acquiring letter-color associations through reading in color. Reading in color appears to be a promising avenue in which we may explore the differences and similarities between synesthetes and non-synesthetes. Additionally, reading in color is a plausible method for a long-term ‘synesthetic’ training program. PMID
30 CFR 1.3 - Use of letters and acronym MSHA.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Use of letters and acronym MSHA. 1.3 Section 1.3 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR OFFICIAL EMBLEM AND...; ESTABLISHMENT AND USE OF OFFICIAL EMBLEM § 1.3 Use of letters and acronym MSHA. The letters and acronym MSHA may...
Letters of Marcus Antonius Kappus from colonial America IV
Directory of Open Access Journals (Sweden)
Janez Stanonik
1989-12-01
Full Text Available The letter of Marcus Antonius Kappus which we publish in our present the fourth - continuation of his letters from Colonial America, is not preserved - as the first three letters are - in a manuscript. Instead we find it published in the famous contemporary collection of Jesuitic letters which appeared from 1728 till 1758 under the editorship of Joseph Stöcklein and his successors in Augsburg and Graz under the title Der neue Welt-Bott mit Allerhand Nachrichten derer Missionariorum Soc. Jesu. Kappus' letter can be found in vol. I, part II, p. 86-88 under the number 56. It has never since 1728 been reprinted in German, neither has it ever been published in an English translation. Our reprint of the German text is justified because Stöcklein's collection is generally not available even in the largest libraries, especially in America. An English translation can be useful because of the difficulties the old form of its German with its localisms can cause to its readers.
Name-letter branding under scrutiny: real products, new algorithms, and the probability of buying.
Stieger, Stefan
2010-06-01
People like letters matching their own first and last name initials more than nonname letters. This name-letter effect has also been found for brands, i.e., people like brands resembling their own name letters (initial or first three). This has been termed name-letter branding effect. In the present study of 199 participants, ages 12 to 79 years, this name-letter branding effect was found for a modified design (1) using real products, (2) concentrating on product names rather than brand names, (3) using five different products for each letter of the Roman alphabet, (4) asking for the buying probability, and (5) using recently introduced algorithms, controlling for individual response tendencies (i.e., liking all letters more or less) and general normative popularity of particular letters (i.e., some letters are generally preferred more than other letters).
Directory of Open Access Journals (Sweden)
Gojko eŽarić
2015-06-01
Full Text Available A failure to build solid letter-speech sound associations may contribute to reading impairments in developmental dyslexia. Whether this reduced neural integration of letters and speech sounds changes over time within individual children and how this relates to behavioral gains in reading skills remains unknown. In this research, we examined changes in event-related potential (ERP measures of letter-speech sound integration over a 6-month period during which 9-year-old dyslexic readers (n=17 followed a training in letter-speech sound coupling next to their regular reading curriculum. We presented the Dutch spoken vowels /a/ and /o/ as standard and deviant stimuli in one auditory and two audiovisual oddball conditions. In one audiovisual condition (AV0, the letter ‘a’ was presented simultaneously with the vowels, while in the other (AV200 it was preceding vowel onset for 200 ms. Prior to the training (T1, dyslexic readers showed the expected pattern of typical auditory mismatch responses, together with the absence of letter-speech sound effects in a late negativity (LN window. After the training (T2, our results showed earlier (and enhanced crossmodal effects in the LN window. Most interestingly, earlier LN latency at T2 was significantly related to higher behavioral accuracy in letter-speech sound coupling. On a more general level, the timing of the earlier mismatch negativity (MMN in the simultaneous condition (AV0 measured at T1, significantly related to reading fluency at both T1 and T2 as well as with reading gains. Our findings suggest that the reduced neural integration of letters and speech sounds in dyslexic children may show moderate improvement with reading instruction and training and that behavioral improvements relate especially to individual differences in the timing of this neural integration.
Open Letter to Religious Leaders about Sex Education
American Journal of Sexuality Education, 2011
2011-01-01
The "Open Letter to Religious Leaders about Sex Education" reinforces scriptural and theological commitments to truth-telling in calling for "full and honest education about sexual and reproductive health." This "Open Letter" was published in 2002, at about the midpoint of a decade-long federal government commitment to…
ACCURATE 3D SCANNING OF DAMAGED ANCIENT GREEK INSCRIPTIONS FOR REVEALING WEATHERED LETTERS
Directory of Open Access Journals (Sweden)
A. I. Papadaki
2015-02-01
Full Text Available In this paper two non-invasive non-destructive alternative techniques to the traditional and invasive technique of squeezes are presented alongside with specialized developed processing methods, aiming to help the epigraphists to reveal and analyse weathered letters in ancient Greek inscriptions carved in masonry or marble. The resulting 3D model would serve as a detailed basis for the epigraphists to try to decipher the inscription. The data were collected by using a Structured Light scanner. The creation of the final accurate three dimensional model is a complicated procedure requiring large computation cost and human effort. It includes the collection of geometric data in limited space and time, the creation of the surface, the noise filtering and the merging of individual surfaces. The use of structured light scanners is time consuming and requires costly hardware and software. Therefore an alternative methodology for collecting 3D data of the inscriptions was also implemented for reasons of comparison. Hence, image sequences from varying distances were collected using a calibrated DSLR camera aiming to reconstruct the 3D scene through SfM techniques in order to evaluate the efficiency and the level of precision and detail of the obtained reconstructed inscriptions. Problems in the acquisition processes as well as difficulties in the alignment step and mesh optimization are also encountered. A meta-processing framework is proposed and analysed. Finally, the results of processing and analysis and the different 3D models are critically inspected and then evaluated by a specialist in terms of accuracy, quality and detail of the model and the capability of revealing damaged and ”hidden” letters.
Accurate 3d Scanning of Damaged Ancient Greek Inscriptions for Revealing Weathered Letters
Papadaki, A. I.; Agrafiotis, P.; Georgopoulos, A.; Prignitz, S.
2015-02-01
In this paper two non-invasive non-destructive alternative techniques to the traditional and invasive technique of squeezes are presented alongside with specialized developed processing methods, aiming to help the epigraphists to reveal and analyse weathered letters in ancient Greek inscriptions carved in masonry or marble. The resulting 3D model would serve as a detailed basis for the epigraphists to try to decipher the inscription. The data were collected by using a Structured Light scanner. The creation of the final accurate three dimensional model is a complicated procedure requiring large computation cost and human effort. It includes the collection of geometric data in limited space and time, the creation of the surface, the noise filtering and the merging of individual surfaces. The use of structured light scanners is time consuming and requires costly hardware and software. Therefore an alternative methodology for collecting 3D data of the inscriptions was also implemented for reasons of comparison. Hence, image sequences from varying distances were collected using a calibrated DSLR camera aiming to reconstruct the 3D scene through SfM techniques in order to evaluate the efficiency and the level of precision and detail of the obtained reconstructed inscriptions. Problems in the acquisition processes as well as difficulties in the alignment step and mesh optimization are also encountered. A meta-processing framework is proposed and analysed. Finally, the results of processing and analysis and the different 3D models are critically inspected and then evaluated by a specialist in terms of accuracy, quality and detail of the model and the capability of revealing damaged and "hidden" letters.
Analyzing International Letters in a Business Communication Class.
Devet, Bonnie
1998-01-01
Shows how students can use persuasive principles of communication (format and writer's purpose) and of classical rhetoric (organization, ethos, pathos, logos, and style) to improve their ability to analyze business letters. Shows how applying these principles to the analysis of business letters from other countries helps students write better and…
Photonic density of states of two-dimensional quasicrystalline photonic structures
International Nuclear Information System (INIS)
Jia Lin; Bita, Ion; Thomas, Edwin L.
2011-01-01
A large photonic band gap (PBG) is highly favorable for photonic crystal devices. One of the most important goals of PBG materials research is identifying structural design strategies for maximizing the gap size. We provide a comprehensive analysis of the PBG properties of two-dimensional (2D) quasicrystals (QCs), where rotational symmetry, dielectric fill factor, and structural morphology were varied systematically in order to identify correlations between structure and PBG width at a given dielectric contrast (13:1, Si:air). The transverse electric (TE) and transverse magnetic (TM) PBGs of 12 types of QCs are investigated (588 structures). We discovered a 12mm QC with a 56.5% TE PBG, the largest reported TE PBG for an aperiodic crystal to date. We also report here a QC morphology comprising ''throwing star''-like dielectric domains, with near-circular air cores and interconnecting veins emanating radially around the core. This interesting morphology leads to a complete PBG of ∼20% , which is the largest reported complete PBG for aperiodic crystals.
Aiello, Marilena; Merola, Sheila; Lasaponara, Stefano; Pinto, Mario; Tomaiuolo, Francesco; Doricchi, Fabrizio
2018-01-31
The possibility of allocating attentional resources to the "global" shape or to the "local" details of pictorial stimuli helps visual processing. Investigations with hierarchical Navon letters, that are large "global" letters made up of small "local" ones, consistently demonstrate a right hemisphere advantage for global processing and a left hemisphere advantage for local processing. Here we investigated how the visual and phonological features of the global and local components of Navon letters influence these hemispheric advantages. In a first study in healthy participants, we contrasted the hemispheric processing of hierarchical letters with global and local items competing for response selection, to the processing of hierarchical letters in which a letter, a false-letter conveying no phonological information or a geometrical shape presented at the unattended level did not compete for response selection. In a second study, we investigated the hemispheric processing of hierarchical stimuli in which global and local letters were both visually and phonologically congruent (e.g. large uppercase G made of smaller uppercase G), visually incongruent and phonologically congruent (e.g. large uppercase G made of small lowercase g) or visually incongruent and phonologically incongruent (e.g. large uppercase G made of small lowercase or uppercase M). In a third study, we administered the same tasks to a right brain damaged patient with a lesion involving pre-striate areas engaged by global processing. The results of the first two experiments showed that the global abilities of the left hemisphere are limited because of its strong susceptibility to interference from local letters even when these are irrelevant to the task. Phonological features played a crucial role in this interference because the interference was entirely maintained also when letters at the global and local level were presented in different uppercase vs. lowercase formats. In contrast, when local features
The distributed neural system for top-down letter processing: an fMRI study
Liu, Jiangang; Feng, Lu; Li, Ling; Tian, Jie
2011-03-01
This fMRI study used Psychophysiological interaction (PPI) to investigate top-down letter processing with an illusory letter detection task. After an initial training that became increasingly difficult, participant was instructed to detect a letter from pure noise images where there was actually no letter. Such experimental paradigm allowed for isolating top-down components of letter processing and minimizing the influence of bottom-up perceptual input. A distributed cortical network of top-down letter processing was identified by analyzing the functional connectivity patterns of letter-preferential area (LA) within the left fusiform gyrus. Such network extends from the visual cortex to high level cognitive cortexes, including the left middle frontal gyrus, left medial frontal gyrus, left superior parietal gyrus, bilateral precuneus, and left inferior occipital gyrus. These findings suggest that top-down letter processing contains not only regions for processing of letter phonology and appearance, but also those involved in internal information generation and maintenance, and attention and memory processing.
DuBois, Matthew R; Volpe, Robert J; Burns, Matthew K; Hoffman, Jessica A
2016-12-01
Knowledge of letters sounds has been identified as a primary objective of preschool instruction and intervention. Despite this designation, large disparities exist in the number of letter sounds children know at school entry. Enhancing caregivers' ability to teach their preschool-aged children letter sounds may represent an effective practice for reducing this variability and ensuring that more children are prepared to experience early school success. This study used a non-concurrent multiple-baseline-across-participants design to evaluate the effectiveness of caregivers (N=3) delivering a computer-assisted tutoring program (Tutoring Buddy) targeting letter sound knowledge to their preschool-aged children. Visual analyses and effect size estimates derived from Percentage of All Non-Overlapping Data (PAND) statistics indicated consistent results for letter sound acquisition, as 6weeks of intervention yielded large effects for letter sound knowledge (LSK) across all three children. Large effect sizes were also found for letter sound fluency (LSF) and nonsense word fluency (NWF) for two children. All three caregivers rated the intervention as highly usable and were able to administer it with high levels of fidelity. Taken together, the results of the present study found Tutoring Buddy to be an effective, simple, and usable way for the caregivers to support their children's literacy development. Copyright © 2016 Society for the Study of School Psychology. Published by Elsevier Ltd. All rights reserved.
Professional Citation Practices in Child Maltreatment Forensic Letters
Schryer, Catherine F.; Bell, Stephanie; Mian, Marcellina; Spafford, Marlee M.; Lingard, Lorelei
2011-01-01
Using rhetorical genre theory and research on reported speech, this study investigates the citation practices in 81 forensic letters written by paediatricians and nurse practitioners that provide their opinion for the courts as to whether a child has experienced maltreatment. These letters exist in a complex social situation where a lack of…
Letter concerning Li2B4O7 thermoluminescence dosimeters
International Nuclear Information System (INIS)
Soares, C.G.
1979-01-01
This letter reports the comparison of two commercially available types of lithium borate thermoluminesence dosimeters: one in which crystalline lithium borate was pressed into chips, and the other in which lithium borate was dispersed in a glass matrix. When irradiated with cobalt 60 gamma radiation, the response of a single sample of each type was reproducible to within 1%. However, differences between the two samples were apparent in their long term storage characteristics
Forensic linguistics: Applications of forensic linguistics methods to anonymous letters
NOVÁKOVÁ, Veronika
2011-01-01
The title of my bachelor work is ?Forensic linguistics: Applications of forensic linguistics methods to anonymous letters?. Forensic linguistics is young and not very known branch of applied linguistics. This bachelor work wants to introduce forensic linguistics and its method. The bachelor work has two parts ? theory and practice. The theoretical part informs about forensic linguistics in general. Its two basic aspects utilized in forensic science and respective methods. The practical part t...
Readability of "Dear Patient" device advisory notification letters created by a device manufacturer.
Mueller, Luke A; Sharma, Arjun; Ottenberg, Abigale L; Mueller, Paul S
2013-04-01
In 2006, the Heart Rhythm Society (HRS) recommended that cardiovascular implantable electronic device (CIED) manufacturers use advisory notification letters to communicate with affected patients. To evaluate the readability of the HRS sample "patient device advisory notification" letter and those created by 1 CIED manufacturer. The HRS sample letter and 25 Boston Scientific Corporation letters dated from 2005 through 2011 were evaluated by using 6 readability tests. Readability (Flesch-Kincaid score) of the HRS sample letter was grade level 12.5, and median readability of the device manufacturer letters was grade level 12.8 (range 10.8-18.9). Similar results were obtained by using other readability scales. No letters had readability scores at the National Work Group on Literacy and Health's recommended reading level-fifth grade; the letters' readability exceeded this recommended level by an average of 7.7 grades (95% confidence interval 6.9-8.5; Preadability scores at the average reading level of US adults-eighth grade; the letters' readability exceeded this level by an average of 4.7 grades (95% confidence interval 3.9-5.5; Preadability of the HRS sample letter and those created by a CIED manufacturer significantly exceeded the recommended and average US adults' reading skill levels. Such letters are unlikely to be informative to many patients. CIED manufacturers should ensure that advisory letters are comprehensible to most affected patients. Copyright © 2013 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.
Visual and Artistic Functions of Letters Khaghani’s Poetry
Directory of Open Access Journals (Sweden)
Dr. M. Zolfaghari
Full Text Available The intensity of emotion and vibration of meaning in the poet's mind causes him to go beyond the ordinary language and through metaphors, similes and linguistic preparation he conveys intellectual and emotional meanings. He has a sharp eye and a sensitive spirit and creative temprement and by inventing new images shows the creativity and imagination in various arenas and attempts in the way of literary strength and creating personal style and this point more than anything else must be done by presenting images and newness. Perhaps in the sixth century, and especially in Azerbaijani school, more than other periods, poets have been looking for creating innovative style in eloquence. Their major attempts were mainly in imaging, it was a wide field that they have competed and it is natural that in this illustration the alphabet letters would be very helpful. Khaghani poetry as one of the greatest poets of this school has the perfect poetrical book of painting and meaning, and delicated pattern in new and different scientific, cultural and religious paintings and letters are a broad range of elements that put a new field in front of the poet and he is aware of the potential features of the letters and also the new images and the artistic creativity.This paper shows descriptive - analytical study of various aspects of Khaghani’s poetry and frequency of letters in the alphabet, authentic images based on alphabet, taken at different pseudo relevance of poetry in the context of multiple semantic and literal characters, making figures of speech based on literary characters, images and characters and the sense of connection . . . which has been shown in his poetry.Letter has double and even multiple uses in Khaghani poetic works (divan and more than the construction of words which is the real and common sense that is used as an artistic. There is a world in the heart of every letter, word and morpheme lies in the poet's point of view is the last and
Letter Frequency Analysis of Lithuanian and Other Languages Using the Latin Alphabet
Directory of Open Access Journals (Sweden)
Gintautas Grigas
2015-12-01
Full Text Available It is important to evaluate specificities of alphabets, particularly the letter frequencies while designing keyboards, analyzing texts, designing games based on alphabets, and doing some text mining. In order to adequately compare lettter frequences of Lithuanian language to other languages in the Internet space, Wikipedia source was selected which content is common to different languages. The method of letter frequency jumps is used. The main attention is paid to the analysis of letter frequencies at the boundary between native letters and foreign letters used in Lithuanian and other languages.
Letter-By-Letter Reading: Natural Recovery and Response to Treatment
Directory of Open Access Journals (Sweden)
Pélagie M. Beeson
2005-01-01
Full Text Available The present investigation provides a longitudinal study of an individual (RB with acquired alexia following left posterior cerebral artery stroke. At initial testing, RB exhibited acquired alexia characterized by letter-by-letter (LBL reading, mild anomic aphasia, and acquired agraphia. Repeated measures of reading accuracy and rate were collected for single words and text over the course of one year, along with probes of naming and spelling abilities. Improvements associated with natural recovery (i.e., without treatment were documented up to the fourth month post onset, when text reading appeared to be relatively stable. Multiple oral reading (MOR treatment was initiated at 22 weeks post-stroke, and additional improvements in reading rate and accuracy for text were documented that were greater than those expected on the basis of spontaneous recovery alone. Over the course of one year, reading reaction times for single words improved, and the word-length effect that is the hallmark of LBL reading diminished. RB's response to treatment supports the therapeutic value of MOR treatment to in LBL readers. His residual impairment of reading and spelling one-year post stroke raised the question as to whether further progress was impeded by degraded orthographic knowledge.
Standardized Letter of Recommendation for Otolaryngology Residency Selection
Perkins, Jonathan N.; Liang, Conan; McFann, Kim; Abaza, Mona M.; Streubel, Sven-Olrik; Prager, Jeremy D.
2013-01-01
Objectives/Hypothesis Develop a standardized letter of recommendation (SLOR) for otolaryngology residency application that investigates the qualities desired in residents and letter writer’s experience. Compare this SLOR to narrative letters of recommendation (NLOR). Study Design Prospective SLOR/NLOR Comparison. Methods The SLOR was sent to a NLOR writer for each applicant. The applicant’s NLOR/SLOR pair was blinded and ranked in seven categories by three reviewers. Inter-rater reliability and NLOR/SLOR rankings were compared. Means of cumulative NLOR and SLOR scores were compared to our departmental rank list. Results Thirty-one SLORs (66%) were collected. The SLORs had higher inter-rater reliability for applicant’s qualifications for otolaryngology, global assessment, summary statement, and overall letter ranking. Writer’s background, comparison to contemporaries/predecessors, and letter review ease had higher inter-rater reliability on the NLORs. Mean SLOR rankings were higher for writer’s background (p=0.0007), comparison of applicant to contemporaries/predecessors (p=0.0031), and letter review ease (p<0.0001). Mean SLOR writing time was 4.17±2.18 minutes. Mean ranking time was significantly lower (p<0.0001) for the SLORs (39.24±23.45 seconds) compared to the NLORs (70.95±40.14 seconds). Means of cumulative SLOR scores correlated with our rank list (p=0.004), whereas means of cumulative NLOR scores did not (p=0.18). Means of cumulative NLOR and SLOR scores did not correlate (p=0.26). Conclusions SLORs require little writing time, save reviewing time, and are easier to review compared to NLORs. Our SLOR had higher inter-rater reliability in 4 of 7 categories and was correlated with our rank list. This tool conveys standardized information in an efficient manner. PMID:23172646
Should intellectual property be disseminated by "forwarding" rejected letters without permission?
Gupta, V K
1996-08-01
Substantive scientific letter writing is a cost-effective mode of complementing observational and experimental research. The value of such philosophically uncommitted and unsponsored well-balanced scientific activity has been relegated. Critical letter writing entails the abilities to: maintain rational scepticism; refuse to conform in order to explain data; persist in keeping common sense centre-stage; exercise logic to evaluate the biological significance of mathematical figures, including statistics, and the ability to sustain the will to share insights regarding disease mechanisms on an ostensibly lower research platform. During peer review, innovative letter writing may share the occasionally unfortunate fate of innovative research. Rejected scientific letters do not automatically lose copyright. Periodicals with high letter loads will see some valuable contributions wasted, but that is the price for maintaining autonomy in scientific publication. The scientific community is an integrated whole that must respect the rights of authors at all levels. Unauthorised forwarding of rejected letters sets the dangerous precedent of justifying unjust means.
Letters to a Young Baller: Exploring Epistolary Criticism
Chawansky, Megan
2010-01-01
This article explores the possibilities of epistolary criticism within the realm of sport studies and aspires to encourage scholars to consider the use of non-traditional sport memorabilia and source materials when telling emotive stories about sport and sport practices. The use of letters and the letter-writing format to tell a personal narrative…
[Patients' letters and pre-modern medical lay-culture].
Stolberg, Michael
2007-01-01
Consulting by letter was fairly common practice among the educated, upper classes of early modern Europe. Surviving letters of consultation written by patients, relatives or friends count among the most valuable source for the analysis of pre-modern experiences of disease and the body. This essay gives a brief overview of the various types of consultation letters and related documents which resulted from this practice before tracing the historical development of epistolary consultations from the late Middle Ages through the heyday medical correspondence in the 18th c. before its decline in the 19th c. It presents "experience", "self-fashioning" and "discourse" as three particularly fruitful levels of analysis on which patients' letters can be used within the wider framework of a cultural history of medicine. These three levels of analysis, or three distinct approaches, enable historians to access a greater awareness of the ways in which the experience of illness and the body is culturally framed with an analysis of the performative effects of patients' narratives and the influence of medical discourse among the wider society.
Whole-Genome Sequences of Two Borrelia afzelii and Two Borrelia garinii Lyme Disease Agent Isolates
Energy Technology Data Exchange (ETDEWEB)
Casjens, S.R.; Dunn, J.; Mongodin, E. F.; Qiu, W.-G.; Luft, B. J.; Fraser-Liggett, C. M.; Schutzer, S. E.
2011-12-01
Human Lyme disease is commonly caused by several species of spirochetes in the Borrelia genus. In Eurasia these species are largely Borrelia afzelii, B. garinii, B. burgdorferi, and B. bavariensis sp. nov. Whole-genome sequencing is an excellent tool for investigating and understanding the influence of bacterial diversity on the pathogenesis and etiology of Lyme disease. We report here the whole-genome sequences of four isolates from two of the Borrelia species that cause human Lyme disease, B. afzelii isolates ACA-1 and PKo and B. garinii isolates PBr and Far04.
Collected Letters of José Martí: a linguistic approach
Directory of Open Access Journals (Sweden)
Guerra, Ana Jústiz
2012-01-01
Full Text Available Any approach to José Marti’s literary production should consider the study of his collected letters, which are noticeable for its content and expressive devices. This article synthesizes the criteria of former researchers who have considered Marti’s collected letters as a privileged genre among the multiple and diverse cultivated by the Apostle (speeches, dramas, essays, journal article, short stories and literary criticism. The collected letters takes a large proportion of his prolific literary production and its expressive force has been widely recognized as a source of inspiration for other poets. His collection of letters is outstanding and lasting in time for its expressive magnificence, its depth of content and precise choice of words. Originally written for a definite addressee, the letters are currently read by new generations of readers, who rediscover a new message in each. Topic considered in this article is part of a wider range study which is been prepared as Ph. D. thesis.
The Complaint Letter and Response.
Shukla, P. K.
1998-01-01
Describes an assignment in which students write a letter of complaint, and discusses how this assignment aids students in seeing the importance of effective written communication to their daily lives. (SR)
International Nuclear Information System (INIS)
2004-01-01
The present collection of letters from JINR, Dubna, contains thirteen separate letters on start-to-end simulations of SASE FEL at the TESLA test facility, possible ways of improvement of the FEM oscillator with a Bragg resonator, the status and perspectives of the electron cooling method development, crystalline ion beams in storage rings, latest results of modeling of LHC beam injection, charge exchange injection in a synchrotron equipped with an electron cooling system, fringe and hysteresis effects in electron guns, nonstationary regimes of electron flow formation in secondary emission inverse coaxial diodes, a proposal of the experiment testing of the fine structure of the Vavilov-Cherenkov radiation, computer simulation of the electron beam dynamics at the accelerator structure and the injector of S-band linac with energies of 3 and 10 MeV, calculation of the electron beam dynamics of the accelerator LUE-200, the accelerator-accumulation facility ITEP-TWAC and accelerators-drivers of electronuclear facilities
ABI Base Recall: Automatic Correction and Ends Trimming of DNA Sequences.
Elyazghi, Zakaria; Yazouli, Loubna El; Sadki, Khalid; Radouani, Fouzia
2017-12-01
Automated DNA sequencers produce chromatogram files in ABI format. When viewing chromatograms, some ambiguities are shown at various sites along the DNA sequences, because the program implemented in the sequencing machine and used to call bases cannot always precisely determine the right nucleotide, especially when it is represented by either a broad peak or a set of overlaying peaks. In such cases, a letter other than A, C, G, or T is recorded, most commonly N. Thus, DNA sequencing chromatograms need manual examination: checking for mis-calls and truncating the sequence when errors become too frequent. The purpose of this paper is to develop a program allowing the automatic correction of these ambiguities. This application is a Web-based program powered by Shiny and runs under R platform for an easy exploitation. As a part of the interface, we added the automatic ends clipping option, alignment against reference sequences, and BLAST. To develop and test our tool, we collected several bacterial DNA sequences from different laboratories within Institut Pasteur du Maroc and performed both manual and automatic correction. The comparison between the two methods was carried out. As a result, we note that our program, ABI base recall, accomplishes good correction with a high accuracy. Indeed, it increases the rate of identity and coverage and minimizes the number of mismatches and gaps, hence it provides solution to sequencing ambiguities and saves biologists' time and labor.
Optimal choice of word length when comparing two Markov sequences using a χ 2-statistic.
Bai, Xin; Tang, Kujin; Ren, Jie; Waterman, Michael; Sun, Fengzhu
2017-10-03
Alignment-free sequence comparison using counts of word patterns (grams, k-tuples) has become an active research topic due to the large amount of sequence data from the new sequencing technologies. Genome sequences are frequently modelled by Markov chains and the likelihood ratio test or the corresponding approximate χ 2 -statistic has been suggested to compare two sequences. However, it is not known how to best choose the word length k in such studies. We develop an optimal strategy to choose k by maximizing the statistical power of detecting differences between two sequences. Let the orders of the Markov chains for the two sequences be r 1 and r 2 , respectively. We show through both simulations and theoretical studies that the optimal k= max(r 1 ,r 2 )+1 for both long sequences and next generation sequencing (NGS) read data. The orders of the Markov chains may be unknown and several methods have been developed to estimate the orders of Markov chains based on both long sequences and NGS reads. We study the power loss of the statistics when the estimated orders are used. It is shown that the power loss is minimal for some of the estimators of the orders of Markov chains. Our studies provide guidelines on choosing the optimal word length for the comparison of Markov sequences.
Burroughs's Postcolonial Visions in The Yage Letters
Keomany, Melanie
2016-01-01
In her article "Burroughs's Postcolonial Visions in The Yage Letters" Melanie Keomany discusses the contents of William S. Burroughs and Allen Ginsberg's The Yage Letters which could be dismissed as openly bigoted and racist. Keomany posits that the text reveals valuable connections between the colonial expansion of the eighteenth century and 1950s USA and Latin America. By re-shaping Burroughs's lived experiences in the Amazon into a text where the narrator William Lee mimics sardonically an...
Waldman, Anne; Becker, Robin
2002-01-01
Presents words of encouragement to a young poet. Includes empathetic words and motivating ideas. Presents a letter including a quote from "Tintern Abbey" by William Wordsworth and ideas about that quote. (SG)
The impact of familiarization strategies on the missing-letter effect.
Plamondon, Andréanne; Roy-Charland, Annie; Chamberland, Justin; Quenneville, Joannie; Laforge, Christian
2017-08-01
When reading a text and searching for a target letter, readers make more omissions of the target letter if it is embedded in frequent function words than if it is in rare content words. While word frequency effects are consistently found, few studies have examined the impacts of passage familiarity on the missing-letter effect and studies that have present conflicting evidence. The present study examines the effects of passage familiarity, as well as the impacts of passage familiarization strategy promoting surface or deep encoding, on the missing-letter effect. Participants were familiarized with a passage by retyping a text, replacing all common nouns with synonyms, or generating a text on the same topic as that of the original text, and then completed a letter search task on the familiar passage as well as an unfamiliar passage. In Experiment 1, when both familiar and unfamiliar passages use the same words, results revealed fewer omissions for the retyping and synonyms conditions. However, in Experiment 2, when different words are used in both types of texts, no effect of familiarization strategy was observed. Furthermore, the missing-letter effect is maintained in all conditions, adding support to the robustness of the effect regardless of familiarity with the text.
Distribution of genotype network sizes in sequence-to-structure genotype-phenotype maps.
Manrubia, Susanna; Cuesta, José A
2017-04-01
An essential quantity to ensure evolvability of populations is the navigability of the genotype space. Navigability, understood as the ease with which alternative phenotypes are reached, relies on the existence of sufficiently large and mutually attainable genotype networks. The size of genotype networks (e.g. the number of RNA sequences folding into a particular secondary structure or the number of DNA sequences coding for the same protein structure) is astronomically large in all functional molecules investigated: an exhaustive experimental or computational study of all RNA folds or all protein structures becomes impossible even for moderately long sequences. Here, we analytically derive the distribution of genotype network sizes for a hierarchy of models which successively incorporate features of increasingly realistic sequence-to-structure genotype-phenotype maps. The main feature of these models relies on the characterization of each phenotype through a prototypical sequence whose sites admit a variable fraction of letters of the alphabet. Our models interpolate between two limit distributions: a power-law distribution, when the ordering of sites in the prototypical sequence is strongly constrained, and a lognormal distribution, as suggested for RNA, when different orderings of the same set of sites yield different phenotypes. Our main result is the qualitative and quantitative identification of those features of sequence-to-structure maps that lead to different distributions of genotype network sizes. © 2017 The Author(s).
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
Acoustic transmittance of an aperiodic deterministic multilayer structure
International Nuclear Information System (INIS)
Madrigal-Melchor, J; Enciso-Muñoz, A; Contreras-Solorio, D A
2013-01-01
We study theoretically the acoustic transmission for a multilayer structure where the characteristic acoustic impedance follows the values generated by the self-similar sequence called the 1 s counting sequence . The transmission spectrum shows clearly self-similarity characteristics.
Open letter to EU Commission about proposed EDC Criteria
DEFF Research Database (Denmark)
Ågerstrand, Marlene; Bero, Lisa; Beronius, Anna
2016-01-01
Open letter in response to the proposed criteria for identification and regulation of endocrine disrupting chemicals, under the PPP and Biocides Regulations......Open letter in response to the proposed criteria for identification and regulation of endocrine disrupting chemicals, under the PPP and Biocides Regulations...
50 CFR 216.258 - Renewal of Letters of Authorization.
2010-10-01
... ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE MAMMALS REGULATIONS GOVERNING THE TAKING AND IMPORTING OF MARINE MAMMALS Taking Marine Mammals Incidental to Conducting Precision Strike Weapon Missions in the Gulf of Mexico § 216.258 Renewal of Letters of Authorization. (a) A Letter of Authorization...
David Bohm : causality and chance, letters to three women
2017-01-01
The letters transcribed in this book were written by physicist David Bohm to three close female acquaintances in the period 1950 to 1956. They provide a background to his causal interpretation of quantum mechanics and the Marxist philosophy that inspired his scientific work in quantum theory, probability and statistical mechanics. In his letters, Bohm reveals the ideas that led to his ground breaking book Causality and Chance in Modern Physics. The political arguments as well as the acute personal problems contained in these letters help to give a rounded, human picture of this leading scientist and twentieth century thinker.
Puranik, Cynthia S.; Lonigan, Christopher J.; Kim, Young-Suk
2011-01-01
The purpose of this study was to examine which emergent literacy skills contribute to preschool children’s emergent writing (name-writing, letter-writing, and spelling) skills. Emergent reading and writing tasks were administered to 296 preschool children aged 4–5 years. Print knowledge and letter-writing skills made positive contributions to name writing; whereas alphabet knowledge, print knowledge, and name writing made positive contributions to letter writing. Both name-writing and letter-writing skills made significant contributions to the prediction of spelling after controlling for age, parental education, print knowledge, phonological awareness, and letter-name and letter-sound knowledge; however, only letter-writing abilities made a significant unique contribution to the prediction of spelling when both letter-writing and name-writing skills were considered together. Name writing reflects knowledge of some letters rather than a broader knowledge of letters that may be needed to support early spelling. Children’s letter-writing skills may be a better indicator of children’s emergent literacy and developing spelling skills than are their name-writing skills at the end of the preschool year. Spelling is a developmentally complex skill beginning in preschool and includes letter writing and blending skills, print knowledge, and letter-name and letter-sound knowledge. PMID:21927537
Two-Stage orders sequencing system for mixed-model assembly
Zemczak, M.; Skolud, B.; Krenczyk, D.
2015-11-01
In the paper, the authors focus on the NP-hard problem of orders sequencing, formulated similarly to Car Sequencing Problem (CSP). The object of the research is the assembly line in an automotive industry company, on which few different models of products, each in a certain number of versions, are assembled on the shared resources, set in a line. Such production type is usually determined as a mixed-model production, and arose from the necessity of manufacturing customized products on the basis of very specific orders from single clients. The producers are nowadays obliged to provide each client the possibility to determine a huge amount of the features of the product they are willing to buy, as the competition in the automotive market is large. Due to the previously mentioned nature of the problem (NP-hard), in the given time period only satisfactory solutions are sought, as the optimal solution method has not yet been found. Most of the researchers that implemented inaccurate methods (e.g. evolutionary algorithms) to solving sequencing problems dropped the research after testing phase, as they were not able to obtain reproducible results, and met problems while determining the quality of the received solutions. Therefore a new approach to solving the problem, presented in this paper as a sequencing system is being developed. The sequencing system consists of a set of determined rules, implemented into computer environment. The system itself works in two stages. First of them is connected with the determination of a place in the storage buffer to which certain production orders should be sent. In the second stage of functioning, precise sets of sequences are determined and evaluated for certain parts of the storage buffer under certain criteria.
LETTERS OF MARIA KUNCEWICZOWA TO HER LATE HUSBAND
Directory of Open Access Journals (Sweden)
Anna Wzorek
2017-04-01
Full Text Available The article discusses the last book of Maria Kuncewiczowa – a set of twenty-three letters (provided with a postscript addressed to her deceased husband. The uniqueness of this correspondence, presented in literary form, lies in the fact that the recipient is dead, treated by the sender as someone constantly present in the real world and still associated with the temporality. "Listy do Jerzego" ("Letters to Jerzy" are – as Tadeusz Swat, one of the reviewers say – “an attempt at denial of death, to save Jerzy by love, memory, and literature.” The analysis of the work highlights the occurring axiological categories. It has been demonstrated that "Letters to Jerzy" is a book about eternal love reaching beyond the grave (in this respect, in stark contrast with "Tristan" 1946, felt with dignity of old age, and finally transcending into faith. "Letters to Jerzy" is also an attempt to reduce the suffering of the writer over the loss of her beloved husband. To some extent, therefore, they correspond to her earlier work "Cudzoziemka" ("Foreigner" in which Kuncewiczowa liberates from the negative emotions associated with the death of her mother.
Referral letters to the psychiatrist in Nigeria: is communication ...
African Journals Online (AJOL)
history, may not be elements that non-psychiatrist phy- sicians routinely collect during their examinations and, therefore, one would not expect such information to be available to be included in referral letters. Conclusion. Deficits in communication or information transfer through referral letters to the psychiatrist are common.
Referral letters to the psychiatrist in Nigeria: is communication ...
African Journals Online (AJOL)
Result: A majority (>80%) of the referral letters had no information on the current medication list, relevant psychosocial history, outline of management to date, results of investigations to date, and known allergies. Conclusion: Deficits in communication or information transfer through referral letters to the psychiatrist are ...
Comparison and evaluation of two exome capture kits and sequencing platforms for variant calling.
Zhang, Guoqiang; Wang, Jianfeng; Yang, Jin; Li, Wenjie; Deng, Yutian; Li, Jing; Huang, Jun; Hu, Songnian; Zhang, Bing
2015-08-05
To promote the clinical application of next-generation sequencing, it is important to obtain accurate and consistent variants of target genomic regions at low cost. Ion Proton, the latest updated semiconductor-based sequencing instrument from Life Technologies, is designed to provide investigators with an inexpensive platform for human whole exome sequencing that achieves a rapid turnaround time. However, few studies have comprehensively compared and evaluated the accuracy of variant calling between Ion Proton and Illumina sequencing platforms such as HiSeq 2000, which is the most popular sequencing platform for the human genome. The Ion Proton sequencer combined with the Ion TargetSeq Exome Enrichment Kit together make up TargetSeq-Proton, whereas SureSelect-Hiseq is based on the Agilent SureSelect Human All Exon v4 Kit and the HiSeq 2000 sequencer. Here, we sequenced exonic DNA from four human blood samples using both TargetSeq-Proton and SureSelect-HiSeq. We then called variants in the exonic regions that overlapped between the two exome capture kits (33.6 Mb). The rates of shared variant loci called by two sequencing platforms were from 68.0 to 75.3% in four samples, whereas the concordance of co-detected variant loci reached 99%. Sanger sequencing validation revealed that the validated rate of concordant single nucleotide polymorphisms (SNPs) (91.5%) was higher than the SNPs specific to TargetSeq-Proton (60.0%) or specific to SureSelect-HiSeq (88.3%). With regard to 1-bp small insertions and deletions (InDels), the Sanger sequencing validated rates of concordant variants (100.0%) and SureSelect-HiSeq-specific (89.6%) were higher than those of TargetSeq-Proton-specific (15.8%). In the sequencing of exonic regions, a combination of using of two sequencing strategies (SureSelect-HiSeq and TargetSeq-Proton) increased the variant calling specificity for concordant variant loci and the sensitivity for variant loci called by any one platform. However, for the
Love letters to the dead: resurrecting an epistolary art.
Lander, Dorothy A; Graham-Pole, John R
This article explores the art of letter-writing, specifically to our beloved dead, as a form of autoethnographic research, pedagogy, and care work. As university teachers and qualitative researchers in palliative and end-of-life care, we review the literature and history of epistolary communications with the deceased, as a prelude to writing our own letters. John writes to his long-dead mother and Dorothy to her recently deceased spouse Patrick, each letter followed by a reflective dialogue between us. Through this dialogue, we highlight the potential application of this art, or handcraft, to formal and informal palliative care, and the implications for practice, pedagogy, policy, and research. We propose that such direct, non-mediated, communications can offer a valuable form of healing for bereaved people. The therapeutic potential of letter writing and the abundance of literary and popular culture exemplars of responses from the dead are also largely unexplored in death education and research.
1998-01-01
Reforming the General Chemistry Textbook individual letters by Edward T. Samulski; Stephen J. Hawkes; Stephen J. Fisher; J. Stephen Hartman; A. R. H. Cole; Stanley Pine, Ronald Archer, and Herbert Kaesz; Jimmy Reeves; Robert Hill; and Brock Spencer, C. Bradley Moore and Nedah Rose. Re: article by R. J. Gillespie The author replies
Directory of Open Access Journals (Sweden)
Pavel I. Lysikov
2017-11-01
Full Text Available This research work is dedicated to the problem of dating of the Byzantine scholar and monk Maximos Planudes’ letters to the general, pinkernes Alexios Philanthropenos and his companion, monk Melchisedek Akropolites. Our goal is to date these letters on the basis of their content and data from other sources and to reconstruct chronological sequence of their writing. The period of time when Alexios Philanthropenos was in office of dux of Thrakision (1293–1295 during which he conducted some military operations against the Turks of beyliks Germiyan and Menteєe has a special place in the history of the Byzantine-Turkish wars in the early Palaiologan era. At this time the Byzantine state made some of its last successful military efforts in this struggle. By studying this theme the present article makes a contribution to research the Byzantine wars against the Turks and the military art and military organization of the empire in the late 13th century. Following the explicit consideration of some disputed items in dating of Maximos Planudes’ letters to the persons mentioned above (42 letters the author specifies the chronological sequence of their writing and clarifies the stages of the Alexios Philanthropenos’ military activity in Asia Minor. This article also makes a contribution to using of epistolographic data in historical study.
37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.
2010-07-01
... mature protein, with the number 1. When presented, the amino acids preceding the mature protein, e.g... acids. (1) The amino acids in a protein or peptide sequence shall be listed using the three-letter... data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...
Directory of Open Access Journals (Sweden)
Shraga Blazer
2015-01-01
Full Text Available [Extract] Dear Friends and Colleagues, In August of 2014, Manduca P et al. published “An open letter for the people in Gaza” in The Lancet. This letter was the response of those authors to their perspective of what was happening in Gaza during the summer-long conflict between Israel and Gaza. Israel was finally responding to years of bombardment from Gaza into civilian areas in the south of Israel. Two of the authors of the letters were known anti-Semites, and held connections with David Duke, a former Ku Klux Klan Grand Wizard in Louisiana and advocate of Nazism. Both these authors expressed sympathy and support for Duke’s rabidly anti-Jewish positions. In their letter they accused Israel’s medical community of complicity in committing terrible atrocities and even implied that chemical warfare was being used by Israel. ...
Sanocki, Thomas; Dyson, Mary C
2012-01-01
Letter identification is a critical front end of the reading process. In general, conceptualizations of the identification process have emphasized arbitrary sets of distinctive features. However, a richer view of letter processing incorporates principles from the field of type design, including an emphasis on uniformities across letters within a font. The importance of uniformities is supported by a small body of research indicating that consistency of font increases letter identification efficiency. We review design concepts and the relevant literature, with the goal of stimulating further thinking about letter processing during reading.
Undergraduate nursing students writing therapeutic letters to families: an educational strategy.
Erlingsson, Christen
2009-02-01
Writing therapeutic letters to families is discussed in this article as an educational strategy encouraging students to think reflectively about family nursing. At the University of Kalmar, Sweden, undergraduate nursing students in a primary care module interviewed families using the Calgary Family Assessment Model and wrote therapeutic letters to these families. This article describes (a) the examination process, which was the context for writing therapeutic letters, (b) results of analyses of the letters, and (c) student's post-examination evaluation comments. Results indicate that most students needed encouragement to focus on the family's strengths and resources instead of focusing on own feelings or problems they perceived the family as having. Students also needed support in relinquishing their hierarchical role of "expert nurse." Students' evaluation comments showed that writing therapeutic letters provided students with opportunities to reflect about the connections between family nursing theory and the family itself.
A Fragmentary Archive: Migratory Feelings in Early Anglo-Saxon Women's Letters.
Watt, Diane
2017-01-01
The letters by Anglo-Saxon women in the Boniface correspondence are connected by cultural practices and emotions centered on the conversion mission that functioned to maintain connections between the Anglo-Saxon diaspora. A striking recurring focus of these letters is on loss and isolation, which connects them to the Old English elegies. Many of the letters describe the writers' traumatic experiences that result from the death or absence of kin. These are women who endured the trauma of being left behind when others migrated overseas or who, in traveling away from their homeland, found themselves isolated in an alien environment, displaced in time as well as space. This article offers an analysis of the letters, focusing on the queer temporalities they explore, the queer emotions they evoke, and the queer kinships that they forge. It argues that the women's letters represent fragments of an early queer archive of migratory feelings.
1999-01-01
An open letter was published by Latin American and Caribbean women during the Special Session of the UN General Assembly on the International Conference on Population and Development. The letter generally focused on the Church¿s stand on women's reproductive rights. In particular, it questioned the Church on the following aspects of reproductive health, which include: 1) maternal death related to lack of access to reproductive health care; 2) Vatican representatives insisting that only parents can supervise their children education and health, which also lead to many cases of sexual abuse and incest; 3) women's sexual inequality and daily violence; 4) the Vatican delegation blocking the advances of contraception, sexual education, and HIV prevention; 5) problems of migrants and allocation of resources; and 6) the Church failing to recognize the capacity of young people to make decisions based on their own conscience.
Scientific Letter: High-intent suicide and the Beck's Suicide Intent ...
African Journals Online (AJOL)
Scientific Letter: High-intent suicide and the Beck's Suicide Intent scale: a case report. ... African Journal of Psychiatry. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current ... Abstract. Scientific Letter - No Abstract Available ...
[Changes in CIRUGIA ESPANOLA Letters to the Editor between 2000 and 2007].
Rosell-Pradas, Jorge; Sánchez-Cantalejo, Emilio
2008-09-01
To describe the frequency and bibliographic characteristics of letters to the editor in the journal, Cirugía Española published between 2000 and 2007 and to compare the differences in the periods between 2000-2003 and 2004-2007. A descriptive and cross-sectional study, using the letters to the editor published in Spanish surgery between 2000 and 2007, as observation units. The variables considered were: the number of letters according to the volume and year of publication, substantive content of the paper, text length, graphics resources use, number of signatories and their professional profile, institutions of the authors, by origin and number of Autonomous Communities and number of bibliographical references. To meet the second objective, we compared letters from the period 2000-2003 with the period 2004-2007 against the rest of variables considered as a result. We used descriptive statistics and statistical analysis for comparison of distributions (chi2), with a level of significance of p < 0.05, using the SPSS software (Version 15.0). We identified 312 documents classified as letters. Between 2002 and 2005 their number was small. Often referring to clinical cases 187 (59.9%) and related letters, 98 (31.4%). Of those, 81.1% met the standard length of the text and only 6 letters (1.9%) was the use of graphics exceeded. In 122 letters (39.1%) the permitted number of authors was exceeded. They were mostly contributed by surgeons, 238 cases (76.3%), usually a single hospital, with 294 letters (94.2%) mainly from, Catalonia, Andalusia, Madrid and Valencia. Only 58.1% of the letters complied with the permitted number of references. More related letters were published in the last period (59 letters; 42.1%) than during the years 2000-2003 (39 letters; 22.7%) (chi2 = 14.79; p < 0.001). The correct length of the text improved in the second period, 136 (97.1%), compared to the first 117 (68%) (chi2 = 42.67; p < 0.001. The graphics resources were used properly in both
32 CFR 884.17 - Commander's instruction letter to member.
2010-07-01
... instruction letter to member. Subject: Instructions in Case of Release on Bail or Personal Recognizance 1. You... 32 National Defense 6 2010-07-01 2010-07-01 false Commander's instruction letter to member. 884.17... civilian custody on bail or on your own recognizance, report immediately in person or by telephone to the...
Letter and Colour Matching Tasks: Parametric Measures of Developmental Working Memory Capacity
Powell, Tamara L.; Arsalidou, Marie; Vogan, Vanessa M.; Taylor, Margot J.
2014-01-01
We investigated the mediating role of interference in developmental assessments of working memory (WM) capacity across childhood, adolescence, and young adulthood. One hundred and forty-two participants completed two versions of visuospatial (colour matching task, CMT) and verbal (letter matching task, LMT) WM tasks, which systematically varied cognitive load in a high and low interference condition. Results showed similar developmental trajectories across high interference contexts (CMT- and...
DEFF Research Database (Denmark)
Lylloff, Jeanette Eva; Hansen, Lea Benedicte Skov; Jepsen, Morten
2015-01-01
Arsukibacterium ikkense GCM72(T) and a close relative, Arsukibacterium sp. MJ3, were isolated from two cold and alkaline environments as producers of extracellular proteolytic enzymes active at high pH and low temperature. This report describes the two draft genome sequences, which may serve...
Lost and Found, Letters and Methods: Assessing Attitudes toward Chiropractic and Medical Care
Directory of Open Access Journals (Sweden)
Hannah Kern
2010-10-01
Full Text Available Attitudes toward traditional and chiropractic medicine were compared using Milgram's lost letter technique. A total of 192 letters were placed on the windshields of vehicles in parking lots at six restaurants and department stores in each of four quadrants of a medium-sized, Southeastern city. These letters were addressed to "Admissions" at either a fictitious Institute of Medicine or Institute of Chiropractic Care. Return addresses included either a male or a female name. Thus, those who found a lost letter were faced with the option of returning or not returning a letter from either a male or a female, addressed to an Institute of traditional or non-traditional medicine. After examining previous studies which had used the lost letter technique, numerous methodological improvements were implemented. For example, letters were randomly assigned to potential drop spots for each of 24 study locations (six study locations in each of four city quadrants, and a Latin square design was used to control for possible order effects in the four study conditions that were implemented. Nearly 65% of the letters (124 of 192 were returned. We found: 1 letters addressed to a fictitious Institute of Chiropractic Care were just as likely to be returned as those addressed to a fictitious Institute of Medicine; 2 letters with female return addresses were as likely to be returned as those with male return addresses; 3 there was no interaction between study conditions; 4 based on what was essentially a replication study, a comparison of the pattern of returns using the first and second cycle of lost letters (n = 96 for each cycle revealed an equivalent pattern of no-difference findings. DOI: 10.2458/azu_jmmss.v1i1.78
A classification of marked hijaiyah letters' pronunciation using hidden Markov model
Wisesty, Untari N.; Mubarok, M. Syahrul; Adiwijaya
2017-08-01
Hijaiyah letters are the letters that arrange the words in Al Qur'an consisting of 28 letters. They symbolize the consonant sounds. On the other hand, the vowel sounds are symbolized by harokat/marks. Speech recognition system is a system used to process the sound signal to be data so that it can be recognized by computer. To build the system, some stages are needed i.e characteristics/feature extraction and classification. In this research, LPC and MFCC extraction method, K-Means Quantization vector and Hidden Markov Model classification are used. The data used are the 28 letters and 6 harakat with the total class of 168. After several are testing done, it can be concluded that the system can recognize the pronunciation pattern of marked hijaiyah letter very well in the training data with its highest accuracy of 96.1% using the feature of LPC extraction and 94% using the MFCC. Meanwhile, when testing system is used, the accuracy decreases up to 41%.
The A.I.D.A. Plan and the Writing of Sales Letters.
Jong, Rowena
A study based on textual analysis of sales letters is reported that evaluates the Attention, Interest, Desire, and Action (AIDA) approach to teaching the writing of sales letters. Thirty business letters written by undergraduate business students and executives were analyzed. The forms of cohesion, voice pattern, and information focus of the…
22 CFR 201.71 - Terms of letters of credit.
2010-04-01
... shall not be inconsistent with or contrary to the terms of the letter of commitment. Any such letter of credit or agreement may be modified or extended at any time in such a manner and to such extent as is acceptable to the approved applicant and the bank: Provided, That such modification or extension may not be...
Serial recall of rhythms and verbal sequences: Impacts of concurrent tasks and irrelevant sound.
Hall, Debbora; Gathercole, Susan E
2011-08-01
Rhythmic grouping enhances verbal serial recall, yet very little is known about memory for rhythmic patterns. The aim of this study was to compare the cognitive processes supporting memory for rhythmic and verbal sequences using a range of concurrent tasks and irrelevant sounds. In Experiment 1, both concurrent articulation and paced finger tapping during presentation and during a retention interval impaired rhythm recall, while letter recall was only impaired by concurrent articulation. In Experiments 2 and 3, irrelevant sound consisted of irrelevant speech or tones, changing-state or steady-state sound, and syncopated or paced sound during presentation and during a retention interval. Irrelevant speech was more damaging to rhythm and letter recall than was irrelevant tone sound, but there was no effect of changing state on rhythm recall, while letter recall accuracy was disrupted by changing-state sound. Pacing of sound did not consistently affect either rhythm or letter recall. There are similarities in the way speech and rhythms are processed that appear to extend beyond reliance on temporal coding mechanisms involved in serial-order recall.
Kember, G C; Fenton, G A; Armour, J A; Kalyaniwalla, N
2001-04-01
Regional cardiac control depends upon feedback of the status of the heart from afferent neurons responding to chemical and mechanical stimuli as transduced by an array of sensory neurites. Emerging experimental evidence shows that neural control in the heart may be partially exerted using subthreshold inputs that are amplified by noisy mechanical fluctuations. This amplification is known as aperiodic stochastic resonance (ASR). Neural control in the noisy, subthreshold regime is difficult to see since there is a near absence of any correlation between input and the output, the latter being the average firing (spiking) rate of the neuron. This lack of correlation is unresolved by traditional energy models of ASR since these models are unsuitable for identifying "cause and effect" between such inputs and outputs. In this paper, the "competition between averages" model is used to determine what portion of a noisy, subthreshold input is responsible, on average, for the output of sensory neurons as represented by the Fitzhugh-Nagumo equations. A physiologically relevant conclusion of this analysis is that a nearly constant amount of input is responsible for a spike, on average, and this amount is approximately independent of the firing rate. Hence, correlation measures are generally reduced as the firing rate is lowered even though neural control under this model is actually unaffected.
24 CFR 242.49 - Funds and finances: deposits and letters of credit.
2010-04-01
... collection under the letter of credit. In the event a demand for payment thereunder is not immediately met... letters of credit. 242.49 Section 242.49 Housing and Urban Development Regulations Relating to Housing and...: deposits and letters of credit. (a) Deposits. Where HUD requires the mortgagor to make a deposit of cash or...
Scientific Letter: Stabbing nails into the neck: an unusual self ...
African Journals Online (AJOL)
Scientific Letter: Stabbing nails into the neck: an unusual self-damaging behavior mandating neurosurgery. A Aghabiklooei, R Aghabiklooei, N Zamani. Abstract. Scientific Letter - No Abstract Available. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT.
A two-step recognition of signal sequences determines the translocation efficiency of proteins.
Belin, D; Bost, S; Vassalli, J D; Strub, K
1996-02-01
The cytosolic and secreted, N-glycosylated, forms of plasminogen activator inhibitor-2 (PAI-2) are generated by facultative translocation. To study the molecular events that result in the bi-topological distribution of proteins, we determined in vitro the capacities of several signal sequences to bind the signal recognition particle (SRP) during targeting, and to promote vectorial transport of murine PAI-2 (mPAI-2). Interestingly, the six signal sequences we compared (mPAI-2 and three mutated derivatives thereof, ovalbumin and preprolactin) were found to have the differential activities in the two events. For example, the mPAI-2 signal sequence first binds SRP with moderate efficiency and secondly promotes the vectorial transport of only a fraction of the SRP-bound nascent chains. Our results provide evidence that the translocation efficiency of proteins can be controlled by the recognition of their signal sequences at two steps: during SRP-mediated targeting and during formation of a committed translocation complex. This second recognition may occur at several time points during the insertion/translocation step. In conclusion, signal sequences have a more complex structure than previously anticipated, allowing for multiple and independent interactions with the translocation machinery.
Kerzel, Dirk; Gauch, Angélique; Buetti, Simona
2010-10-01
Improvements of perceptual performance following the presentation of peripheral cues have been ascribed to accelerated accrual of information, enhanced contrast perception, and decision bias. We investigated effects of peripheral cues on the perception of Gabor and letter stimuli. Non-predictive, peripheral cues improved perceptual accuracy when the stimuli were masked. In contrast, peripheral cues degraded perception of low-contrast letters and did not affect the perception of low-contrast Gabors. The results suggest that involuntary attention accelerates accrual of information but are not entirely consistent with the idea that involuntary attention enhances subjective contrast. Rather, peripheral cues may cause crowding with single letter targets of low contrast. Further, we investigated the effect of the amount of uncertainty on involuntary attention. Cueing effects were (initially) larger when there were more possible target locations. In addition, cueing effects were larger when error feedback was absent and observers had no knowledge of results. Despite these strategic factors, location uncertainty was not sufficient to produce cueing effects, showing that location uncertainty paired with non-predictive cues reveals perceptual and not (only) decisional processes.
DEFF Research Database (Denmark)
Beier, Sofie; Ejlers, Steen
2011-01-01
The talk will focus on Danish type designers and their work on Æ (AE), Ø (Oslash) and Å (Aring). These 'anomalies' found in the Danish written language, often causes difficulties for type designers. The counters of Ø/ø sometimes appear overcrowded, the uppercase Æ can result in an uncomfortably o......' attempt to create the optimal variation of these letters, we will give a brief introduction to the Danish typography tradition ranging from the early 20th Century and up until today....
1999-09-01
All the Letters to the Editor in this issue are in the same PostScript or PDF file. Contents The imaginary Sun? Harold Aspden Energy Science Ltd, PO Box 35, Southampton SO16 7RB, UK Difficult physics? Tim Akrill Chief Examiner, A-level Physics, Edexcel Foundation Was it a dream? Bill Jarvis 6 Peggy's Mill Road, Edinburgh EH4 6JY
International Nuclear Information System (INIS)
1962-01-01
On 2 March 1962 the Director General, pursuant to a decision taken by the Board of Governors on 28 February, addressed a letter to the Governor from Japan cancelling those provisions of the letter of 24 March 1959 that related to the safeguards against diversion applicable to the JRR-3 research reactor project. On 20 June the Director General, pursuant to a decision taken by the Board on 14 June, addressed a further letter to the Governor cancelling the remaining provisions of the letter of 24 March 1959, which related to health and safety measures for the project. The texts of the two letters in question are reproduced in this document for the information of all Members
Harvard Education Letter. Volume 26, Number 4, July-August 2010
Chauncey, Caroline T., Ed.
2010-01-01
"Harvard Education Letter" is published bimonthly at the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Learning Progressions in Science: A New Approach Emphasizes Sustained Instruction in Big Ideas (Patti Hartigan); (2) Putting the "Boy Crisis" in…
29 CFR 1621.3 - Procedure for requesting an opinion letter.
2010-07-01
... 1621.3 Labor Regulations Relating to Labor (Continued) EQUAL EMPLOYMENT OPPORTUNITY COMMISSION PROCEDURES-THE EQUAL PAY ACT § 1621.3 Procedure for requesting an opinion letter. (a) A request for an opinion letter should be submitted in writing to the Chairman, Equal Employment Opportunity Commission...
Pirates at Parties: Letter Position Processing in Developing Readers
Kohnen, Saskia; Castles, Anne
2013-01-01
There has been much recent interest in letter position coding in adults, but little is known about the development of this process in children learning to read. Here, the letter position coding abilities of 127 children in Grades 2, 3, and 4 (aged 7-10 years) were examined by comparing their performance in reading aloud "migratable" words (e.g.,…
Referral letters to the emergency department: is the medication list accurate?
LENUS (Irish Health Repository)
McCullagh, M
2015-02-01
Medication errors are common when patients transfer across healthcare boundaries. This study was designed to investigate the quality of information on medicines provided by general practitioners (GPs) on emergency department (ED) referral letters. A convenience sample of referral letters to the ED of a teaching hospital was reviewed. The medication list and\\/or patient\\'s drug allergy status were noted. Medicines reconciliation including patient (or carer) interview was conducted to determine the patient\\'s actual home medication list. This was compared with the GP list and any discrepancies were identified and addressed. A total of 92 referral letters were included in the analysis of which 60 were computer-generated and 32 were hand-written. GPs provided dose and frequency of administration information in 47 (51%) of the letters sampled i.e. 44 (71%) computer-generated versus 3 (10%) hand-written; p < 0.001. In addition, the patient was taking their medicines exactly as per the GP list in 20 (22%) of cases. The patient\\'s drug allergy status was documented in 13 (14%) of the letters.
Harvard Education Letter. Volume 23, Number 1, January-February 2007
Chauncey, Caroline, Ed.
2007-01-01
"Harvard Education Letter" is published bimonthly at the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Response to Intervention: A New Approach to Reading Instruction Aims to Catch Struggling Readers Early (Nancy Walser); (2) Getting Advisory Right: Focus and…
Harvard Education Letter. Volume 26, Number 2, March-April 2010
Chauncey, Caroline T., Ed.
2010-01-01
"Harvard Education Letter" is published bimonthly at the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Online Testing, Version 1.0: Oregon's Adaptive Computer-Based Accountability Test Offers a Peek at a Brave New Future (Robert Rothman); (2) Beyond…
Harvard Education Letter. Volume 26, Number 5, September-October 2010
Walser, Nancy, Ed.
2010-01-01
"Harvard Education Letter" is published bimonthly at the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Scenes from the School Turnaround Movement: Passion, Frustration, Mid-Course Corrections Mark Rapid Reforms (Laura Pappano); (2) The Media Savvy Educator:…
Harvard Education Letter. Volume 28, Number 2, March-April 2012
Chauncey, Caroline T., Ed.
2012-01-01
"Harvard Education Letter" is published bimonthly at the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Course Credits on the Quick: Controversial Online Recovery Programs Speed the Path to Graduation (Andrew Brownstein); (2) Collaborating to Make Schools More Inclusive…
Harvard Education Letter. Volume 27, Number 4, July-August 2011
Chauncey, Caroline T., Ed.
2011-01-01
"Harvard Education Letter" is published bimonthly at the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Integrated Data Systems Link Schools and Communities: Researchers Combine School and Non-School Data to Inform Interventions and Policy (Patti Hartigan);…
Harvard Education Letter. Volume 25, Number 3, May-June 2009
Chauncey, Caroline T., Ed.
2009-01-01
"Harvard Education Letter" is published bimonthly by the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Improving Teaching and Learning through Instructional Rounds (Lee Teitel); (2) Developmentally Appropriate Practice in the Age of Testing: New Reports Outline Key Principles…
Harvard Education Letter. Volume 25, Number 6, November-December 2009
Chauncey, Caroline T., Ed.
2009-01-01
"Harvard Education Letter" is published bimonthly by the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) "Platooning" Instruction: Districts Weigh Pros and Cons of Departmentalizing Elementary Schools (Lucy Hood); (2) Behind the Classroom Door: A Rare Glimpse Indicates the…
Harvard Education Letter. Volume 24, Number 4, July-August 2008
Chauncey, Caroline, Ed.
2008-01-01
"Harvard Education Letter" is published bimonthly by the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Taking the Measure of New Teachers: California Shifts from Standardized Tests to Performance-Based Assessment as a Condition of Licensure (Robert Rothman);…
Harvard Education Letter. Volume 27, Number 1, January-February 2011
Walser, Caroline T., Ed.
2011-01-01
"Harvard Education Letter" is published bimonthly at the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) The Greening of Environmental Ed: Teachers Focus on Complexity, Evidence, and Letting Students Draw Their Own Conclusions (Lucy Hood); (2) Like Teacher,…
Harvard Education Letter. Volume 27, Number 3, May-June 2011
Chauncey, Caroline T., Ed.
2011-01-01
"Harvard Education Letter" is published bimonthly at the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Bringing Art into School, Byte by Byte: Innovative Programs Use Technology to Expand Access to the Arts (Patti Hartigan); (2) Differentiated Instruction…
Harvard Education Letter. Volume 25, Number 4, July-August 2009
Chauncey, Caroline T., Ed.
2009-01-01
"Harvard Education Letter" is published bimonthly by the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Putting the Brakes on "Summer Slide": Modified School Calendars Build in Time to Enrich Learning and Sustain Gains (Brigid Schulte); (2) Closing…
Harvard Education Letter. Volume 25, Number 1, January-February 2009
Chauncey, Caroline, Ed.
2009-01-01
"Harvard Education Letter" is published bimonthly by the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Learning Across Distance: Virtual-Instruction Programs Are Growing Rapidly, but the Impact on "Brick-and-Mortar" Classrooms Is Still up in the Air…
Two cases of a fetus with sirenomelia sequence.
Horikoshi, Tsuguhiro; Kikuchi, Akihiko; Tatematsu, Mikiko; Matsumoto, Yasuhiro; Hayashi, Akiko; Unno, Nobuya
2005-09-01
We report two cases of a fetus with sirenomelia sequence which showed oligohydramnios and a single umbilical artery. The first case was of a single fetus with symelia apus and only one leg. Prenatal diagnosis of this case was possible. The second case was of a dichorionic-diamniotic twin pregnancy in which one fetus had symelia dipus with two fused lower extremities. Prenatal diagnosis of the condition was not made. In both cases, the fetuses died shortly after birth from respiratory distress due to severe pulmonary hypoplasia. Absence of urinary tract, imperforate anus, and spine deformity were confirmed in both cases. Although prenatal diagnosis of symelia dipus seems difficult, this condition must be considered in a fetus with severe oligohydramnios.
How to write effective business letters: scribing information for pharmacists.
Hamilton, C W
1993-11-01
Pharmacists frequently write letters but lack specific training on how to do it well. This review summarizes strategies for improving business correspondence, emphasizes basic writing guidelines, and offers practical advice for pharmacists. The first steps for effective communication are careful planning and identifying the main message to be conveyed. The purpose for writing should be stated in the opening paragraph of the letter. To ensure a successful outcome, actions needed should be clearly summarized and visually highlighted. The tone of the letter should reflect a reasonable speech pattern, not the cryptic writing found in many scientific papers. The layout of the letter should be inviting, which is readily achievable through judicious use of word processing. Many delivery options are available, such as traditional postal services, express mail, and facsimile transmission. Readers are encouraged to test these basic writing principles and decide for themselves whether these recommendations affect the success of business correspondence.
John von Neumann selected letters
2005-01-01
John von Neuman was perhaps the most influential mathematician of the twentieth century, especially if his broad influence outside mathematics is included. Not only did he contribute to almost all branches of mathematics and created new fields, but he also changed post-World War II history with his work on the design of computers and with being a sought-after technical advisor to many figures in the U.S. military-political establishment in the 1940s and 1950s. The present volume is the first substantial collection of (previously mainly unpublished) letters written by von Neumann to colleagues, friends, government officials, and others. The letters give us a glimpse of the thinking of John von Neumann about mathematics, physics, computer science, science management, education, consulting, politics, and war. Readers of quite diverse backgrounds will find much of interest in this fascinating first-hand look at one of the towering figures of twentieth century science.
Pointer, Jonathan S.
2010-01-01
Purpose To quantify the difference between recognition (letter) and resolution (Landolt) visual acuity (VA) in a group of normally sighted subjects. Is it reasonable to assume that the two acuity measures are clinically equivalent? Methods A pair of 6 m acuity test charts was produced: one comprised letters and the other Landolt broken rings. Construction of both charts conformed to the logMAR design format. Monocular VA was determined for the dominant eye of 300 screened and normally sighted optometric patients aged 16 to 40, each wearing an optical refractive (spectacle) correction. Results Letter acuity was superior to Landolt acuity (P≤0.0001). The mean paired acuity difference was -0.041 logMAR (standard deviation 0.034): the 95% limits of agreement were ±0.067 logMAR units or ±3.3 chart optotype. Repeatability was high and similar for each chart type (±2.1 and ±2.4 optotype for letter and Landolt, respectively). Gender, test sequence, and laterality of the dominant eye (left or right) were each non-statistically significant variables. Conclusions For normally sighted subjects wearing an optimal refractive correction, a bias was recorded in favour of recognition over resolution acuity: the clinical difference amounted to approximately 40% of one logMAR chart line, with similar high repeatability for either chart optotype. We conclude that the assumption of clinical equivalence between letter and Landolt acuity is reasonable under optimum test conditions.
Harvard Education Letter. Volume 22, Number 6, November-December 2006
Chauncey, Caroline, Ed.
2006-01-01
"Harvard Education Letter" is published bimonthly at the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) (In)formative Assessments: New Tests and Activities Can Help Teachers Guide Student Learning (Robert Rothman); (2) Recent Research on the Achievement Gap: How Lifestyle…
Harvard Education Letter. Volume 25, Number 5, September-October 2009
Chauncey, Caroline T., Ed.
2009-01-01
"Harvard Education Letter" is published bimonthly by the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) The Invisible Hand in Education Policy: Behind the Scenes, Economists Wield Unprecedented Influence (David McKay Wilson); (2) Bonding and Bridging: Schools Open Doors for…
Harvard Education Letter. Volume 26, Number 1, January-February 2010
Chauncey, Caroline T., Ed.
2010-01-01
"Harvard Education Letter" is published bimonthly at the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Charters and Unions: What's the Future for This Unorthodox Relationship? (Alexander Russo); (2) From Special Ed to Higher Ed: Transition Planning for Disabled Students Focuses…
Harvard Education Letter. Volume 24, Number 3, May-June 2008
Chauncey, Caroline, Ed.
2008-01-01
"Harvard Education Letter" is published bimonthly by the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) "Equity, Access, and Opportunity": Despite Challenges, More Districts Adopt One-to-One Laptop Programs (Colleen Gillard); (2) Small Kids, Big Words: Research-Based Strategies…
Harvard Education Letter. Volume 26, Number 6, November-December 2010
Walser, Nancy, Ed.
2010-01-01
"Harvard Education Letter" is published bimonthly at the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Video Games Take Testing to the Next Level: Researchers See Promise in Game-Like Assessments That Measure Complex Skills (Robert Rothman); (2) An Academic…
Harvard Education Letter. Volume 28, Number 1, January-February 2012
Walser, Nancy, Ed.
2012-01-01
"Harvard Education Letter" is published bimonthly at the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Using Theater to Teach Social Skills: Researchers Document Improvements for Children with Autism (Patti Hartigan); (2) The Family Model of Schooling Revisited: Few Teachers,…
Harvard Education Letter. Volume 23, Number 5, September-October 2007
Chauncey, Caroline, Ed.
2007-01-01
"Harvard Education Letter" is published bimonthly by the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Confronting the Autism Epidemic: New Expectations for Children with Autism Means a New Role for Public Schools (Kate McKenna); (2) Internet Research 101:…
Intertextuality in Ba's So Long a Letter and Umunnakwe's Dear ...
African Journals Online (AJOL)
Intertextuality takes for granted the interdependence of literary texts because every artistic creation is a re-echoing of past knowledge. Mariama Ba's So Long A Letter and Ndubisi Umunnakwe's Dear Ramatoulaye are African examples. This work examines how Ba's So Long A Letter intertextualises with Umunnakwe's Dear ...
24 CFR 200.63 - Required deposits and letters of credit.
2010-04-01
... Commissioner for collection under the letter of credit. In the event a demand for payment thereunder is not... credit. 200.63 Section 200.63 Housing and Urban Development Regulations Relating to Housing and Urban... Required deposits and letters of credit. (a) Deposits. Where the Commissioner requires the mortgagor to...
Harvard Education Letter. Volume 21, Number 6, November-December 2005
Chauncey, Caroline, Ed.
2005-01-01
"Harvard Education Letter" is published bimonthly at the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Is History... History?: Standards, Accountability, and the Future of Our Nation's Past (Robert Rothman); (2) Curriculum Access for All: How Teachers Can Use Universal Design…
DEFF Research Database (Denmark)
Dolka, Beata; Boyen, Filip; Butaye, Patrick
2015-01-01
Here, we report the draft genome sequences of two commensal Enterococcus cecorum strains (1710s23 and 1711s24), cultivated from the ceca of healthy laying hens originating from different farms in Belgium.......Here, we report the draft genome sequences of two commensal Enterococcus cecorum strains (1710s23 and 1711s24), cultivated from the ceca of healthy laying hens originating from different farms in Belgium....
Genome Sequences of Two Copper-Resistant Escherichia coli Strains Isolated from Copper-Fed Pigs
DEFF Research Database (Denmark)
Lüthje, Freja L.; Hasman, Henrik; Aarestrup, Frank Møller
2014-01-01
The draft genome sequences of two copper-resistant Escherichia coli strains were determined. These had been isolated from copper-fed pigs and contained additional putative operons conferring copper and other metal and metalloid resistances.......The draft genome sequences of two copper-resistant Escherichia coli strains were determined. These had been isolated from copper-fed pigs and contained additional putative operons conferring copper and other metal and metalloid resistances....
Electronic Discharge Letter Mobile App
Lezcano, Leonardo; Triana, Michel; Ternier, Stefaan; Hartkopf, Kathleen; Stieger, Lina; Schroeder, Hanna; Sopka, Sasa; Drachsler, Hendrik; Maher, Bridget; Henn, Patrick; Orrego, Carola; Specht, Marcus
2014-01-01
The electronic discharge letter mobile app takes advantage of Near Field Communication (NFC) within the PATIENT project and a related post-doc study. NFC enabled phones to read passive RFID tags, but can also use this short-range wireless technology to exchange (small) messages. NFC in that sense
Traditions of martyrdom in the Ignatian Letters
Directory of Open Access Journals (Sweden)
S. Fuhrmann
2011-06-01
Full Text Available The letters of Ignatius represent one of the key texts for the emergence of martyrdom during the second century AD in Christianity. This article is concerned with the question whether Ignatius contributed to a “theology of martyrdom” or whether he rather relied on previous traditions. The author argues, by undertaking an analysis of certain pragmatics and semantics, that the motif of martyrdom is solely used to buttress Ignatius’ claim for authority among his intended addressees by referring to an understanding of martyrdom that has its roots in the New Testament. An identification of the author of the letters with a historical martyr is regarded as unlikely.
Exome sequencing identifies mutations in ABCD1 and DACH2 in two brothers with a distinct phenotype
Zhang, Yanliang; Liu, Yanhui; Li, Ya; Duan, Yong; Zhang, Keyun; Wang, Junwang; Dai, Yong
2014-01-01
Background We report on two brothers with a distinct syndromic phenotype and explore the potential pathogenic cause. Methods Cytogenetic tests and exome sequencing were performed on the two brothers and their parents. Variants detected by exome sequencing were validated by Sanger sequencing. Results The main phenotype of the two brothers included congenital language disorder, growth retardation, intellectual disability, difficulty in standing and walking, and urinary and fecal incontinence. T...
Harvard Education Letter. Volume 27, Number 2, March-April 2011
Walser, Nancy, Ed.
2011-01-01
"Harvard Education Letter" is published bimonthly at the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Hybrid Schools for the iGeneration: New Schools Combine "Bricks" and "Clicks" (Brigid Schulte); (2) Dual Language Programs on the Rise: "Enrichment" Model Puts Content Learning…
Harvard Education Letter. Volume 26, Number 3, May-June 2010
Chauncey, Caroline T., Ed.
2010-01-01
"Harvard Education Letter" is published bimonthly at the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Unleashing the "Brain Power" of Groups in the Classroom: The Neuroscience behind Collaborative Work (Nancy Walser); (2) Putting AP to the Test: New Research Assesses the…
Harvard Education Letter. Volume 25, Number 2, March-April 2009
Chauncey, Caroline, Ed.
2009-01-01
"Harvard Education Letter" is published bimonthly by the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Money and Motivation: New Initiatives Rekindle Debate over the Link between Rewards and Student Achievement (David McKay Wilson); (2) An Inexact Science: What Are the Technical…
Harvard Education Letter. Volume 24, Number 6, November-December 2008
Chauncey, Caroline, Ed.
2008-01-01
"Harvard Education Letter" is published bimonthly by the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) When Worlds Collide: Universal PreK Brings New Challenges for Public Elementary Schools (David McKay Wilson); (2) Answers and Questions: Schools Survey Their Students--and…
Harvard Education Letter. Volume 27, Number 6, November-December 2011
Walser, Nancy, Ed.
2011-01-01
"Harvard Education Letter" is published bimonthly at the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) With Cheating on the Rise, Schools Respond (David McKay Wilson); (2) Waldorf Education in Public Schools: Educators Adopt--and Adapt--This Developmental, Arts-Rich Approach…
Harvard Education Letter. Volume 24, Number 2, March-April 2008
Chauncey, Caroline, Ed.
2008-01-01
"Harvard Education Letter" is published bimonthly at the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Educating Teenage Immigrants: High Schools Experiment with Ways to Group New English-Language Learners (Lucy Hood); (2) Hot Topics and Key Words: Pilot Project Brings Teachers…
Letter-Sound Reading: Teaching Preschool Children Print-to-Sound Processing
Wolf, Gail Marie
2016-01-01
This intervention study investigated the growth of letter sound reading and growth of consonant-vowel-consonant (CVC) word decoding abilities for a representative sample of 41 US children in preschool settings. Specifically, the study evaluated the effectiveness of a 3-step letter-sound teaching intervention in teaching preschool children to…
Why Doctors Do Not Answer Referral Letters | Smith | South African ...
African Journals Online (AJOL)
Background: Healthcare workers at primary healthcare (PHC) clinics are frustrated by the fact that they do not receive replies to their referral letters to doctors. Referral letters act as permission slips to allow patients easy access to treatment by specialists at secondary and tertiary service levels and communicate reasons for ...
21 CFR 170.6 - Opinion letters on food additive status.
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Opinion letters on food additive status. 170.6... (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) FOOD ADDITIVES General Provisions § 170.6 Opinion letters on food additive status. (a) Over the years the Food and Drug Administration has given informal...
Teaching Braille Letters, Numerals, Punctuation, and Contractions to Sighted Individuals
Putnam, Brittany C.; Tiger, Jeffrey H.
2015-01-01
Braille-character recognition is one of the foundational skills required for teachers of braille. Prior research has evaluated computer programming for teaching braille-to-print letter relations (e.g., Scheithauer & Tiger, 2012). In the current study, we developed a program (the Visual Braille Trainer) to teach not only letters but also…
Harvard Education Letter. Volume 24, Number 1, January-February 2008
Chauncey, Caroline, Ed.
2008-01-01
"Harvard Education Letter" is published bimonthly at the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Leadership Lessons From Schools Becoming "Data Wise" (Jennifer L. Steele and Kathryn Parker Boudett); (2) A Guide on the Side: Mentors Help New Leaders Prepare for Life in the…
Harvard Education Letter. Volume 27, Number 5, September-October 2011
Chauncey, Caroline T., Ed.
2011-01-01
"Harvard Education Letter" is published bimonthly at the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Teaching Students to Ask Their Own Questions: One Small Change Can Yield Big Results (Dan Rothstein and Luz Santana); (2) Voice of Experience: Jerry Weast--Leading a System…
Harvard Education Letter. Volume 23, Number 2, March-April 2007
Chauncey, Caroline, Ed.
2007-01-01
"Harvard Education Letter" is published bimonthly at the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) More Than "Making Nice": Getting Teachers to (Truly) Collaborate (Laura Pappano); (2) "Doing the Critical Things First": An Aligned Approach to PreK and Early Elementary Math;…
Harvard Education Letter. Volume 24, Number 5, September-October 2008
Chauncey, Caroline, Ed.
2008-01-01
"Harvard Education Letter" is published bimonthly by the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Teaching 21st Century Skills: What Does It Look Like in Practice? (Nancy Walser); (2) Getting and Spending: Schools and Districts Share Lessons on the Effective Uses of…
21 CFR 570.6 - Opinion letters on food additive status.
2010-04-01
... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Opinion letters on food additive status. 570.6... (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS FOOD ADDITIVES General Provisions § 570.6 Opinion letters on food additive status. (a) Over the years the Food and Drug Administration has given informal...
Mud, Blood, and Bullet Holes: Teaching History with War Letters
Carroll, Andrew
2013-01-01
From handwritten letters of the American Revolution to typed emails from Iraq and Afghanistan, correspondence from U.S. troops offers students deep insight into the specific conflicts and experiences of soldiers. Over 100,000 correspondences have been donated to the Legacy Project, a national initiative launched in 1998 to preserve war letters by…
Edwards, R; White, M; Gray, J; Fischbacher, C
2001-07-01
There is growing interest in methods of teaching critical appraisal skills at undergraduate and postgraduate levels. We describe an approach using a journal club and subsequent letter writing to teach critical appraisal and writing skills to medical undergraduates. The exercise occurs during a 3-week public health medicine attachment in the third year of the undergraduate curriculum. Students work in small groups to appraise a recently published research paper, present their findings to their peers in a journal club, and draft a letter to the journal editor. Evaluation took place through: informal and formal feedback from students; number of letters written, submitted and published, and a comparison of marks obtained by students submitting a literature review assignment with and without critical appraisal teaching during the public health attachment. Feedback from students was overwhelmingly positive. In the first 3(1/2) years, 26 letters have been published or accepted for publication, and 58 letters published on the Internet. There were no significant differences in overall marks or marks for the critical appraisal component of the literature review assignments between the two student groups. We believe our approach is an innovative and enjoyable method for teaching critical appraisal and writing skills to medical students. Lack of difference in marks in the literature review between the student groups may reflect its insensitivity as an outcome measure, contamination by other critical appraisal teaching, or true ineffectiveness.
46 CFR 308.522 - Collateral deposit fund, letter of transmittal, Form MA-302.
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Collateral deposit fund, letter of transmittal, Form MA... Collateral deposit fund, letter of transmittal, Form MA-302. The standard form of letter of transmittal for use in establishing a collateral deposit fund, may be obtained from the American War Risk Agency or...
Resource Letter MP-3: The Manhattan Project and Related Nuclear Research
Reed, B. Cameron
2016-10-01
This Resource Letter is a supplement to the earlier Resource Letters MP-1 and MP-2, and provides further sources on the Manhattan Project and related research. Books, review papers, journal articles, videos, and websites are cited for the following topics: general works, technical works, biographical and autobiographical works, foreign wartime nuclear programs and related allied intelligence, the use of the bombs against Hiroshima and Nagasaki, technical papers of historical interest, postwar policy and technical developments, and educational materials. Together, these three Resource Letters describe nearly 400 sources of information on the Manhattan Project.
Whole-exome sequencing revealed two novel mutations in Usher syndrome.
Koparir, Asuman; Karatas, Omer Faruk; Atayoglu, Ali Timucin; Yuksel, Bayram; Sagiroglu, Mahmut Samil; Seven, Mehmet; Ulucan, Hakan; Yuksel, Adnan; Ozen, Mustafa
2015-06-01
Usher syndrome is a clinically and genetically heterogeneous autosomal recessive inherited disorder accompanied by hearing loss and retinitis pigmentosa (RP). Since the associated genes are various and quite large, we utilized whole-exome sequencing (WES) as a diagnostic tool to identify the molecular basis of Usher syndrome. DNA from a 12-year-old male diagnosed with Usher syndrome was analyzed by WES. Mutations detected were confirmed by Sanger sequencing. The pathogenicity of these mutations was determined by in silico analysis. A maternally inherited deleterious frameshift mutation, c.14439_14454del in exon 66 and a paternally inherited non-sense c.10830G>A stop-gain SNV in exon 55 of USH2A were found as two novel compound heterozygous mutations. Both of these mutations disrupt the C terminal of USH2A protein. As a result, WES revealed two novel compound heterozygous mutations in a Turkish USH2A patient. This approach gave us an opportunity to have an appropriate diagnosis and provide genetic counseling to the family within a reasonable time. Copyright © 2015 Elsevier B.V. All rights reserved.
Whole genome sequencing and bioinformatics analysis of two Egyptian genomes.
ElHefnawi, Mahmoud; Jeon, Sungwon; Bhak, Youngjune; ElFiky, Asmaa; Horaiz, Ahmed; Jun, JeHoon; Kim, Hyunho; Bhak, Jong
2018-05-15
We report two Egyptian male genomes (EGP1 and EGP2) sequenced at ~ 30× sequencing depths. EGP1 had 4.7 million variants, where 198,877 were novel variants while EGP2 had 209,109 novel variants out of 4.8 million variants. The mitochondrial haplogroup of the two individuals were identified to be H7b1 and L2a1c, respectively. We also identified the Y haplogroup of EGP1 (R1b) and EGP2 (J1a2a1a2 > P58 > FGC11). EGP1 had a mutation in the NADH gene of the mitochondrial genome ND4 (m.11778 G > A) that causes Leber's hereditary optic neuropathy. Some SNPs shared by the two genomes were associated with an increased level of cholesterol and triglycerides, probably related with Egyptians obesity. Comparison of these genomes with African and Western-Asian genomes can provide insights on Egyptian ancestry and genetic history. This resource can be used to further understand genomic diversity and functional classification of variants as well as human migration and evolution across Africa and Western-Asia. Copyright © 2017. Published by Elsevier B.V.
Dear Hacker Letters to the Editor of 2600
Goldstein, Emmanuel
2010-01-01
Actual letters written to the leading hackers' magazine. For 25 years, 2600: The Hacker Quarterly has given voice to the hacker community in all its manifestations. This collection of letters to the magazine reveals the thoughts and viewpoints of hackers, both white and black hat, as well as hacker wannabes, technophiles, and people concerned about computer security. Insightful and entertaining, the exchanges illustrate 2600 's vast readership, from teenage rebels, anarchists, and survivalists to law enforcement, consumer advocates, and worried parents.: 2600: The Hacker Quarterly has been the
Harvard Education Letter. Volume 23, Number 3, May-June 2007
Chauncey, Caroline, Ed.
2007-01-01
"Harvard Education Letter" is published bimonthly by the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) The Road to School Improvement: It's Hard, It's Bumpy, and It Takes as Long as It Takes (Richard F. Elmore and Elizabeth A. City); (2) Better Teaching with Web Tools: How…
Harvard Education Letter. Volume 23, Number 4, July-August 2007
Chauncey, Caroline, Ed.
2007-01-01
"Harvard Education Letter" is published bimonthly by the Harvard Graduate School of Education. This issue of "Harvard Education Letter" contains the following articles: (1) Meeting of the Minds: The Parent-Teacher Conference Is the Cornerstone of School-Home Relations. How Can It Work for All Families? (Laura Pappano); (2) In Search of That "Third…
Open letter to Mr Christian Bataille, Deputy of Nord region, France. Open letter on nuclear energy
International Nuclear Information System (INIS)
Delacroix P
2007-02-01
The author, by means of a letter to the deputy Christian Bataille, presents arguments to the shutdown of old nuclear power plants. He points out the environmental and economical arguments in favor of a decrease of the nuclear power use in France. (A.L.B.)
50 CFR 216.219 - Renewal and modifications of Letters of Authorization.
2010-10-01
... OCEANIC AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE MAMMALS REGULATIONS GOVERNING THE TAKING AND IMPORTING OF MARINE MAMMALS Taking of Marine Mammals Incidental to Explosive Severance.... Gulf of Mexico § 216.219 Renewal and modifications of Letters of Authorization. (a) A Letter of...
Aihara, H.; Oreglia, M.; Berger, E.L.; Guarino, V.; Repond, J.; Weerts, H.; Xia, L.; Zhang, J.; Zhang, Q.; Srivastava, A.; Butler, J.M.; Goldstein, Joel; Velthuis, J.; Radeka, V.; Zhu, R.-Y.; Lutz, P.; de Roeck, A.; Elsener, K.; Gaddi, A.; Gerwig, H.; Grefe, C.; Klempt, W.; Linssen, L.; Schlatter, D.; Speckmayer, P.; Thom, J.; Yang, J.; Christian, D.C.; Cihangir, S.; Cooper, W.E.; Demarteau, M.; Fisk, H.E.; Garren, L.A.; Krempetz, K.; Kutschke, R.K.; Lipton, R.; Para, A.; Tschirhart, R.; Wenzel, H.; Yarema, R.; Grunewald, M.; Pankov, A.; U., Gomel State Tech.; Dutta, T.; Dauncey, P.D.; Balbuena, J.P.; Fleta, C.; Lozano, M.; Ullan, M.; Christian, G.B.; Faus-Golfe, A.; Fuster, J.; Lacasta, C.; Marinnas, C.; Vos, M.; Duarte, J.; Fernandez, M.; Gonzalez, J.; Jaramillo, R.; Lopez, Virto A.; Martinez-Eivero, C.; Moya, D.; Ruiz-Mimeno, A.; Vila, I.; Colledani, C.; Dorokhov, A.; Hu-Guo, C.; Winter, M.; Moortgat-Pick, G.; Onoprienko, D.V.; Kim, G.N.; Park, H.; Adloff, C.; Blaha, J.; Blaising, J.-J.; Cap, S.; Chefdeville, M.; Drancourt, C.; Espargiliare, A.; Gaglione, R.; Geffroy, N.; Jacquemier, J.; Karyotakis, Y.; Prast, J.; Vouters, G.; Gronberg, J.; Walston, S.; Wright, D.; Sawyer, L.; Laloum, M.; Ciobanu, C.; Chauveau, J.; Savoy-Navarro, A.; Andricek, L.; Moser, H.-G.; Cowan, R.f.; Fisher, P.; Yamamoto, R.K.; Kenney, ClMl; Boos, E.E.; Merkin, M.; Chen, S.; Chakraborty, D.; Dyshkant, A.; Hedin, D.; Zutshi, V.; Galkin, V.; D'Ascenzo, N.; Ossetski, D.; Saveliev, V.; Kapusta, F.; De Masi, R.; Vrba, V.; Lu, C.; McDonald, K.T.; Smith, A.J.S.; Bortoletto, D.; Coath, R.; Crooks, J.; Damerell, C.; Gibson, M.; Nichols, A.; Stanitzki, M.; Strube, J.; Turchetta, R.; Tyndel, M.; Weber, M.; Worm, S.; Zhang, Z.; Barklow, T.L.; Belymam, A.; Breidenbach, M.; Cassell, R.; Craddock, W.; Deaconu, C.; Dragone, A.; Graf, N.A.; Haller, G.; Herbst, R.; Hewett, J.L.; Jaros, J.A.; Johnson, A.S.; Kim, P.C.; MacFarlane, D.B.; Markiewicz, T.; Maruyama, T.; McCormick, J.; Moffeit, K.; Neal, H.A.; Nelson, T.K.; Oriunno, M.; Partridge, R.; Peskin, M.E.; Rizzo, T.G.; Rowson, P.; Su, D.; Woods, M.; Chakrabarti, S.; Dieguez, A.; Garrido, Ll.; Kaminski, J.; Conway, J.S.; Chertok, M.; Gunion, J.; Holbrook, B.; Lander, R.L.; Tripathi, S.M.; Fadeyev, V.; Schumm, B.A.; Oreglia, M.; Gill, J.; Nauenberg, U.; Oleinik, G.; Wagner, S.R.; Ranjan, K.; Shivpuri, R.; Varner, G.S.; Orava, R.; Van Kooten, R.; Bilki, B.; Charles, M.; Kim, T.J.; Mallik, U.; Norbeck, E.; Onel, Y.; Brau, B.P.; Willocq, S.; Taylor, G.N.; Riles, Keith; Yang, H.-J.; Kriske, R.; Cremaldi, L.; Rahmat, R.; Lastovicka-Medin, G.; Seidel, S.; Hildreth, M.D.; Wayne, M.; Brau, J.E.; Frey, R.; Sinev, N.; Strom, D.M.; Torrence, E.; Banda, Y.; Burrows, P.N.; Devetak, E.; Foster, B.; Lastovicka, T.; Li, Y.-M.; Nomerotski, A.; Riera-Babures, J.; Vilasis-Cardona, X.; Manly, S.; Adeva, B.; Iglesias Escudero, C.; Vazquez Regueiro, P.; Saborido Silva, J.J.; Gallas Torreira, A.; Gao, D.; Jie, W.; Jungfeng, Y.; Li, C.; Liu, S.; Liu, Y.; Sun, Y.; Wang, Q.; Yi, J.; Yonggang, W.; Zhao, Z.; De, K.; Farbin, A.; Park, S.; Smith, J.; White, A.P.; Yu, J.; Lou, X.C.; Abe, T.; Iwasaki, M.; Lubatti, H.J.; Band, H.R.; Feyzi, F.; Prepost, R.; Karchin, P.E.; Milstene, C.; Baltay, C.; Dhawan, S.; Kwon, Y.-J.
2009-01-01
Letter of intent describing SiD (Silicon Detector) for consideration by the International Linear Collider IDAG panel. This detector concept is founded on the use of silicon detectors for vertexing, tracking, and electromagnetic calorimetry. The detector has been cost-optimized as a general-purpose detector for a 500 GeV electron-positron linear collider.
Validation of an iPad test of letter contrast sensitivity.
Kollbaum, Pete S; Jansen, Meredith E; Kollbaum, Elli J; Bullimore, Mark A
2014-03-01
An iPad-based letter contrast sensitivity test was developed (ridgevue.com) consisting of two letters on each page of an iBook. The contrast decreases from 80% (logCS = 0.1) to 0.5% (logCS = 2.3) by 0.1 log units per page. The test was compared to the Pelli-Robson Test and the Freiburg Acuity and Contrast Test. Twenty normally sighted subjects and 20 low-vision subjects were tested monocularly at 1 m using each test wearing their habitual correction. After a 5-minute break, subjects were retested with each test in reverse order. Two different letter charts were used for both the Pelli-Robson and iPad tests, and the order of testing was varied systematically. For the Freiburg test, the target was a variable contrast Landolt C presented at eight possible orientations and used a 30-trial Best PEST procedure. Repeatability and agreement were assessed by determining the 95% limits of agreement (LoA) ± 1.96 SD of the differences between administrations or tests. All three tests showed good repeatability in terms of the 95% LoA: iPad = ± 0.19, Pelli-Robson = ± 0.19, and Freiburg = ± 0.15. The iPad test showed good agreement with the Freiburg test with similar mean (± SD) logCS (iPad = 1.98 ± 0.11, Freiburg = 1.96 ± 0.06) and with narrow 95% LoA (± 0.24), but the Pelli-Robson test gave significantly lower values (1.65 ± 0.04). Low-vision subjects had slightly poorer repeatability (iPad = ± 0.24, Pelli-Robson = ± 0.23, Freiburg = ± 0.21). Agreement between the iPad and Freiburg tests was good (iPad = 1.45 ± 0.40, Freiburg = 1.54 ± 0.37), but the Pelli-Robson test gave significantly lower values (1.30 ± 0.30). The iPad test showed similar repeatability and may be a rapid and convenient alternative to some existing measures. The Pelli-Robson test gave lower values than the other tests.
Poth, Christian H; Schneider, Werner X
2016-01-01
Human vision is organized in discrete processing episodes (e.g., eye fixations or task-steps). Object information must be transmitted across episodes to enable episodic short-term recognition: recognizing whether a current object has been seen in a previous episode. We ask whether episodic short-term recognition presupposes that objects have been encoded into capacity-limited visual working memory (VWM), which retains visual information for report. Alternatively, it could rely on the activation of visual features or categories that occurs before encoding into VWM. We assessed the dependence of episodic short-term recognition on VWM by a new paradigm combining letter report and probe recognition. Participants viewed displays of 10 letters and reported as many as possible after a retention interval (whole report). Next, participants viewed a probe letter and indicated whether it had been one of the 10 letters (probe recognition). In Experiment 1, probe recognition was more accurate for letters that had been encoded into VWM (reported letters) compared with non-encoded letters (non-reported letters). Interestingly, those letters that participants reported in their whole report had been near to one another within the letter displays. This suggests that the encoding into VWM proceeded in a spatially clustered manner. In Experiment 2, participants reported only one of 10 letters (partial report) and probes either referred to this letter, to letters that had been near to it, or far from it. Probe recognition was more accurate for near than for far letters, although none of these letters had to be reported. These findings indicate that episodic short-term recognition is constrained to a small number of simultaneously presented objects that have been encoded into VWM.
Directory of Open Access Journals (Sweden)
Christian H. Poth
2016-09-01
Full Text Available Human vision is organized in discrete processing episodes (e.g. eye fixations or task-steps. Object information must be transmitted across episodes to enable episodic short-term recognition: recognizing whether a current object has been seen in a previous episode. We ask whether episodic short-term recognition presupposes that objects have been encoded into capacity-limited visual working memory (VWM, which retains visual information for report. Alternatively, it could rely on the activation of visual features or categories that occurs before encoding into VWM. We assessed the dependence of episodic short-term recognition on VWM by a new paradigm combining letter report and probe recognition. Participants viewed displays of ten letters and reported as many as possible after a retention interval (whole report. Next, participants viewed a probe letter and indicated whether it had been one of the ten letters (probe recognition. In Experiment 1, probe recognition was more accurate for letters that had been encoded into VWM (reported letters compared with non-encoded letters (non-reported letters. Interestingly, those letters that participants reported in their whole report had been near to one another within the letter displays. This suggests that the encoding into VWM proceeded in a spatially clustered manner. In Experiment 2 participants reported only one of ten letters (partial report and probes either referred to this letter, to letters that had been near to it, or far from it. Probe recognition was more accurate for near than for far letters, although none of these letters had to be reported. These findings indicate that episodic short-term recognition is constrained to a small number of simultaneously presented objects that have been encoded into VWM.
Piasta, Shayne B.; Phillips, Beth M.; Williams, Jeffrey M.; Bowles, Ryan P.; Anthony, Jason L.
2016-01-01
Early childhood teachers are increasingly encouraged to support children's development of letter-sound abilities. Assessment of letter-sound knowledge is key in planning for effective instruction, yet the letter-sound knowledge assessments currently available and suitable for preschool-age children demonstrate significant limitations. The purpose…
Comparative analyses of two Geraniaceae transcriptomes using next-generation sequencing.
Zhang, Jin; Ruhlman, Tracey A; Mower, Jeffrey P; Jansen, Robert K
2013-12-29
Organelle genomes of Geraniaceae exhibit several unusual evolutionary phenomena compared to other angiosperm families including accelerated nucleotide substitution rates, widespread gene loss, reduced RNA editing, and extensive genomic rearrangements. Since most organelle-encoded proteins function in multi-subunit complexes that also contain nuclear-encoded proteins, it is likely that the atypical organellar phenomena affect the evolution of nuclear genes encoding organellar proteins. To begin to unravel the complex co-evolutionary interplay between organellar and nuclear genomes in this family, we sequenced nuclear transcriptomes of two species, Geranium maderense and Pelargonium x hortorum. Normalized cDNA libraries of G. maderense and P. x hortorum were used for transcriptome sequencing. Five assemblers (MIRA, Newbler, SOAPdenovo, SOAPdenovo-trans [SOAPtrans], Trinity) and two next-generation technologies (454 and Illumina) were compared to determine the optimal transcriptome sequencing approach. Trinity provided the highest quality assembly of Illumina data with the deepest transcriptome coverage. An analysis to determine the amount of sequencing needed for de novo assembly revealed diminishing returns of coverage and quality with data sets larger than sixty million Illumina paired end reads for both species. The G. maderense and P. x hortorum transcriptomes contained fewer transcripts encoding the PLS subclass of PPR proteins relative to other angiosperms, consistent with reduced mitochondrial RNA editing activity in Geraniaceae. In addition, transcripts for all six plastid targeted sigma factors were identified in both transcriptomes, suggesting that one of the highly divergent rpoA-like ORFs in the P. x hortorum plastid genome is functional. The findings support the use of the Illumina platform and assemblers optimized for transcriptome assembly, such as Trinity or SOAPtrans, to generate high-quality de novo transcriptomes with broad coverage. In addition
Several Families of Sequences with Low Correlation and Large Linear Span
Zeng, Fanxin; Zhang, Zhenyu
In DS-CDMA systems and DS-UWB radios, low correlation of spreading sequences can greatly help to minimize multiple access interference (MAI) and large linear span of spreading sequences can reduce their predictability. In this letter, new sequence sets with low correlation and large linear span are proposed. Based on the construction Trm1[Trnm(αbt+γiαdt)]r for generating p-ary sequences of period pn-1, where n=2m, d=upm±v, b=u±v, γi∈GF(pn), and p is an arbitrary prime number, several methods to choose the parameter d are provided. The obtained sequences with family size pn are of four-valued, five-valued, six-valued or seven-valued correlation and the maximum nontrivial correlation value is (u+v-1)pm-1. The simulation by a computer shows that the linear span of the new sequences is larger than that of the sequences with Niho-type and Welch-type decimations, and similar to that of [10].
Directory of Open Access Journals (Sweden)
Herring Christopher D
2007-08-01
Full Text Available Abstract Background With the development of new technology, it has recently become practical to resequence the genome of a bacterium after experimental manipulation. It is critical though to know the accuracy of the technique used, and to establish confidence that all of the mutations were detected. Results In order to evaluate the accuracy of genome resequencing using the microarray-based Comparative Genome Sequencing service provided by Nimblegen Systems Inc., we resequenced the E. coli strain W3110 Kohara using MG1655 as a reference, both of which have been completely sequenced using traditional sequencing methods. CGS detected 7 of 8 small sequence differences, one large deletion, and 9 of 12 IS element insertions present in W3110, but did not detect a large chromosomal inversion. In addition, we confirmed that CGS also detected 2 SNPs, one deletion and 7 IS element insertions that are not present in the genome sequence, which we attribute to changes that occurred after the creation of the W3110 lambda clone library. The false positive rate for SNPs was one per 244 Kb of genome sequence. Conclusion CGS is an effective way to detect multiple mutations present in one bacterium relative to another, and while highly cost-effective, is prone to certain errors. Mutations occurring in repeated sequences or in sequences with a high degree of secondary structure may go undetected. It is also critical to follow up on regions of interest in which SNPs were not called because they often indicate deletions or IS element insertions.
Letter-sound processing deficits in children with developmental dyslexia: An ERP study.
Moll, Kristina; Hasko, Sandra; Groth, Katharina; Bartling, Jürgen; Schulte-Körne, Gerd
2016-04-01
The time course during letter-sound processing was investigated in children with developmental dyslexia (DD) and typically developing (TD) children using electroencephalography. Thirty-eight children with DD and 25 TD children participated in a visual-auditory oddball paradigm. Event-related potentials (ERPs) elicited by standard and deviant stimuli in an early (100-190 ms) and late (560-750 ms) time window were analysed. In the early time window, ERPs elicited by the deviant stimulus were delayed and less left lateralized over fronto-temporal electrodes for children with DD compared to TD children. In the late time window, children with DD showed higher amplitudes extending more over right frontal electrodes. Longer latencies in the early time window and stronger right hemispheric activation in the late time window were associated with slower reading and naming speed. Additionally, stronger right hemispheric activation in the late time window correlated with poorer phonological awareness skills. Deficits in early stages of letter-sound processing influence later more explicit cognitive processes during letter-sound processing. Identifying the neurophysiological correlates of letter-sound processing and their relation to reading related skills provides insight into the degree of automaticity during letter-sound processing beyond behavioural measures of letter-sound-knowledge. Copyright © 2016 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.
Sense-Making and Map-Making: War Letters as Personal Geographies
Directory of Open Access Journals (Sweden)
Christina Knopf
2014-11-01
Full Text Available Structured in three parts, this article will briefly review David Herman’s idea of “spatial reference” in narrative, particularly in epistolary form, and explain the research method used in this project; introduce military geographies and demonstrate how various spatial references function in war letters; and, lastly, illustrate the value of war letters as spatial artifacts and subjective cartography.
A Novel Handwritten Letter Recognizer Using Enhanced Evolutionary Neural Network
Mahmoudi, Fariborz; Mirzashaeri, Mohsen; Shahamatnia, Ehsan; Faridnia, Saed
This paper introduces a novel design for handwritten letter recognition by employing a hybrid back-propagation neural network with an enhanced evolutionary algorithm. Feeding the neural network consists of a new approach which is invariant to translation, rotation, and scaling of input letters. Evolutionary algorithm is used for the global search of the search space and the back-propagation algorithm is used for the local search. The results have been computed by implementing this approach for recognizing 26 English capital letters in the handwritings of different people. The computational results show that the neural network reaches very satisfying results with relatively scarce input data and a promising performance improvement in convergence of the hybrid evolutionary back-propagation algorithms is exhibited.
Some Influences of Greek and Roman Rhetoric on Early Letter Writing.
Hildebrandt, Herbert W.
1988-01-01
Describes how letter writing, especially business letters, was influenced by Greek and Roman oral rhetoricians. Discusses three precepts of oral rhetoric--inventio, dispositio, and style--and notes that the classical theories' reflection in written communication can be seen in selected Italian, German, and English epistolographic works. (MM)
Humane Letters: Notes on the Concept of Integrity and the Meanings of Humanism
Higgins, Chris
2009-01-01
In this article, the author calls for an analysis of integrity and contends that attempting to describe wholeness precisely and incisively is not necessarily a contradiction in terms. The author makes some distinctions about integrity using two moves, one inspired by Plato, and one by Aristotle. The author uses the phrase "humane letters" to name…
An exploratory study of early letter-sound knowledge in a low socio-economic context in South Africa
Directory of Open Access Journals (Sweden)
Shelley O'Carroll
2011-05-01
Full Text Available This paper explores one aspect of early literacy development in a low socio-economic context in South Africa. Assessments conducted with a sample of children from two disadvantaged communities in Cape Town indicated that in this context, almost half of the learners entering Grade One were unable to recognise any letters. A Grade R intervention conducted by volunteers showed that children from this context were able to learn letter-sounds in Grade R through a programme that focused on teaching letter-sounds in the context of building language skills, emergent writing and concepts about print. In order to strengthen the effectiveness of the intervention, the volunteer programme was supplemented by support for the Grade R teacher and teaching assistant. Follow-up assessments of one of the intervention groups at the end of Grade One revealed significant correlations between early Grade One letter knowledge and end of Grade One word reading and spelling skills. The findings of this exploratory study are in line with research that shows the importance of letter-sound knowledge in the earliest stages of learning to read. This raises concerns about the historical lack of emphasis in the Grade R curriculum on this aspect of early literacy development. Although the study has a narrow focus and conclusions cannot be drawn about other aspects of early literacy learning in this context, the results suggest an urgent need for quality Grade R teacher training programmes with a specific focus on emergent literacy.
Politeness Strategies in Good-news Business Letters
Institute of Scientific and Technical Information of China (English)
毕争; 李纳
2008-01-01
This paper analyzes the presentation of politeness in good-news business letters at the lexical,syntactic,and discourse levels based on Leech's Politeness Principle and Brown and Levinson's Face-saving Theory.
Giaschi, D; Regan, D
1997-09-01
Three-month-old infants can discriminate motion-defined (MD) form, but we do not know the age at which this ability reaches adult levels. Previous psychophysical evidence suggests that different neural mechanisms are involved in the processing of luminance-defined (LD) and MD spatial form in adults. This difference may be reflected in the development of LD versus MD form identification in children. We measured speed threshold for identifying MD letters, letter-chart (i.e, Snellen) acuity for high-contrast LD letters and single-letter acuity for high- and low-contrast LD letters. Forty-seven children between 3 and 12 years of age and 20 adult subjects were tested. Development to the adult level was observed as follows: low-contrast single-letter acuity before 3 years; high-contrast single-letter acuity by 5 to 6 years; the ability to identify MD letters by 7 to 8 years; letter-chart acuity by 9 to 10 years. MD form identification continues to mature in preschool children. LD form identification also matures in this age group but with a different time course. MD letters are not equivalent to low-contrast letters developmentally. Our findings provide further support for the hypothesis that the spatial aspects of MD and LD form are processed separately to some extent.
Directory of Open Access Journals (Sweden)
Matthew W. Blair
2011-11-01
Full Text Available Expressed sequence tags (ESTs have proven useful for gene discovery in many crops. In this work, our objective was to construct complementary DNA (cDNA libraries from root tissues of common beans ( L. grown under low and high P hydroponic conditions and to conduct EST sequencing and comparative analyses of the libraries. Expressed sequence tag analysis of 3648 clones identified 2372 unigenes, of which 1591 were annotated as known genes while a total of 465 unigenes were not associated with any known gene. Unigenes with hits were categorized according to biological processes, molecular function, and cellular compartmentalization. Given the young tissue used to make the root libraries, genes for catalytic activity and binding were highly expressed. Comparisons with previous root EST sequencing and between the two libraries made here resulted in a set of genes to study further for differential gene expression and adaptation to low P, such as a 14 kDa praline-rich protein, a metallopeptidase, tonoplast intrinsic protein, adenosine triphosphate (ATP citrate synthase, and cell proliferation genes expressed in the low P treated plants. Given that common beans are often grown on acid soils of the tropics and subtropics that are usually low in P these genes and the two parallel libraries will be useful for selection for better uptake of this essential macronutrient. The importance of EST generation for common bean root tissues under low P and other abiotic soil stresses is also discussed.
Y2K affiliation, immediate pedestrian density, and helping responses to lost letters.
Bridges, F S; Thompson, P C
2001-06-01
Of 75 letters "lost" in Florida, 41 were returned in the mail (the helpful response). Immediate pedestrian density was significantly related to nonhelping responses. The greater the number of subjects passing by a lost letter, the less likely any one of them would respond to it. The rates of return did vary with the addressees' affiliations. Returned responses for the affiliates, Y2K Arkbuilders and the Believers of God's Judgement Against Homosexuals: Y2K Millennium Bug, were substantially lower than for the affiliate, Y2K Computer Repair & Programming, Inc. Returns for the Believers of God's Judgement Against Homosexuals: Y2K Millennium Bug affiliate were significantly lower than for the Y2K Arkbuilders affiliate. Variables such as sex, race, and estimated age of subjects were not associated with helping to return a lost letter. The rate of return of lost letters is not the only important measure to be examined in studies using lost letters.
Letters from a Nightingale nurse.
Denny, E
1996-01-01
Mary Cadbury was one of six daughters in a wealthy Birmingham family, all of whom took up professional or unpaid philanthropic work. In 1873 Mary began nurse training at the Nightingale School, St Thomas's Hospital, and regularly sent letters to family and friends, which provide a graphic account of the experience of a nurse in the latter half of the nineteenth century.
Magnocellular involvement in flanked-letter identification relates to the allocation of attention
Omtzigt, D.; Hendriks, A.W.C.J.
2004-01-01
To verify the hypothesis that the magnocellular system is important to flanked-letter identification [Neuropsychologia 40 (2002) 1881] because it subserves attention allocation, we conducted three letter-naming experiments in which we manipulated magnocellular involvement (colour vs. luminance
Developing a bone mineral density test result letter to send to patients: a mixed-methods study
Directory of Open Access Journals (Sweden)
Edmonds SW
2014-06-01
Full Text Available Stephanie W Edmonds,1,2 Samantha L Solimeo,3 Xin Lu,1 Douglas W Roblin,4,8 Kenneth G Saag,5 Peter Cram6,7 1Department of Internal Medicine, 2College of Nursing, University of Iowa, Iowa City, IA, USA; 3Center for Comprehensive Access and Delivery Research and Evaluation, Iowa City Veterans Affairs Health Care System, Iowa City, IA, USA; 4Kaiser Permanente of Atlanta, Atlanta, GA, USA; 5Department of Rheumatology, University of Alabama at Birmingham, Birmingham, AL, USA; 6Faculty of Medicine, University of Toronto, Toronto, ON, Canada; 7University Health Network and Mount Sinai Hospital, Toronto, ON, Canada; 8School of Public Health, Georgia State University, Atlanta, GA, USA Purpose: To use a mixed-methods approach to develop a letter that can be used to notify patients of their bone mineral density (BMD results by mail that may activate patients in their bone-related health care. Patients and methods: A multidisciplinary team developed three versions of a letter for reporting BMD results to patients. Trained interviewers presented these letters in a random order to a convenience sample of adults, aged 50 years and older, at two different health care systems. We conducted structured interviews to examine the respondents’ preferences and comprehension among the various letters. Results: A total of 142 participants completed the interview. A majority of the participants were female (64.1% and white (76.1%. A plurality of the participants identified a specific version of the three letters as both their preferred version (45.2%; P<0.001 and as the easiest to understand (44.6%; P<0.01. A majority of participants preferred that the letters include specific next steps for improving their bone health. Conclusion: Using a mixed-methods approach, we were able to develop and optimize a printed letter for communicating a complex test result (BMD to patients. Our results may offer guidance to clinicians, administrators, and researchers who are
Re-Audit of the Contents of GP Referral letters to General Adult Community Psychiatrists.
Odelola, Catherine; Jabbar, Farid
2017-09-01
The quality of information provided by referring general practitioners to secondary care mental health services are crucial elements in the effective management of patients. In order to establish effective communication, both primary and secondary care health professionals should contribute to planning and organising this process taking into account their different opinions and views. Anonymous questionnaire was designed to collect information on items that GPs and psychiatrist rated as most important items in GP referral letters to psychiatrists. The questionnaires were sent out electronically. Each item was scored using a rating scale where 0 was least important and 10 was most important. Items that scored 8 and above were agreed by all as the most important items. 76 GP letters were audited using a devised checklist of the identified most important items. Data was collected and analysed using a devised data collection tool. A re-audit was done 6months later. A response rate of 70% was obtained for both psychiatrists and GPs. Reasons for referral were described in almost all GP referral letters (95%). Only 24% referral letters had details about current physical health which improved to 59%. Concerns about risk were described in only 47% of letters and treatment provided by GP in 50% of letters. These improved in 79% and 71% of letters respectively in the re-audit. The involvement of professionals in devising a standardised approach for referral letters has improved communication in this re-audit between GPs and Psychiatrists. This is evident in the improvement in key aspects of the referral letters: past medical history, past psychiatric history, current physical health, treatment provided by GP. Efficient communication between GPs and psychiatrists improves the quality of health care for patients.
Xu, Yao; Jiang, Yu; Shi, Tao; Cai, Hanfang; Lan, Xianyong; Zhao, Xin; Plath, Martin; Chen, Hong
2017-01-01
Whole-genome sequencing provides a powerful tool to obtain more genetic variability that could produce a range of benefits for cattle breeding industry. Nanyang (Bos indicus) and Qinchuan (Bos taurus) are two important Chinese indigenous cattle breeds with distinct phenotypes. To identify the genetic characteristics responsible for variation in phenotypes between the two breeds, in the present study, we for the first time sequenced the genomes of four Nanyang and four Qinchuan cattle with 10 ...
42 CFR 93.202 - Charge letter.
2010-10-01
... 42 Public Health 1 2010-10-01 2010-10-01 false Charge letter. 93.202 Section 93.202 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES HEALTH ASSESSMENTS AND HEALTH EFFECTS STUDIES OF HAZARDOUS SUBSTANCES RELEASES AND FACILITIES PUBLIC HEALTH SERVICE POLICIES ON RESEARCH...
International Nuclear Information System (INIS)
2000-01-01
The present collection of letters from JINR, Dubna, contains six separate records on the DELPHI experiment at LEP, the Fermi-surface dynamics of rotating nuclei, production of large samples of the silica dioxide aerogel in the 37-litre autoclave and test of its optical properties, preliminary radiation resource results on scintillating fibers, a new algorithm for the direct transformation method of time to digital with the high time resolution and development and design of analogue read-out electronics for HADES drift chamber system
Michael Maier--nine newly discovered letters.
Lenke, Nils; Roudet, Nicolas; Tilton, Hereward
2014-02-01
The authors provide a transcription, translation, and evaluation of nine newly discovered letters from the alchemist Michael Maier (1568-1622) to Gebhardt Johann von Alvensleben (1576-1631), a noble landholder in the vicinity of Magdeburg. Stemming from the final year of his life, this correspondence casts new light on Maier's biography, detailing his efforts to secure patronage amid the financial crisis of the early Thirty Years' War. While his ill-fated quest to perfect potable gold continued to form the central focus of his patronage suits, Maier also offered his services in several arts that he had condemned in his printed works, namely astrology and "supernatural" magic. Remarks concerning his previously unknown acquaintance with Heinrich Khunrath call for a re-evaluation of Maier's negotiation of the discursive boundaries between Lutheran orthodoxy and Paracelsianism. The letters also reveal Maier's substantial contribution to a work previously ascribed solely to the English alchemist Francis Anthony.
Daffner, Kirk R; Alperin, Brittany R; Mott, Katherine K; Holcomb, Phillip J
2014-01-22
Older adults exhibit diminished ability to inhibit the processing of visual stimuli that are supposed to be ignored. The extent to which age-related changes in early visual processing contribute to impairments in selective attention remains to be determined. Here, 103 adults, 18-85 years of age, completed a color selective attention task in which they were asked to attend to a specified color and respond to designated target letters. An optimal approach would be to initially filter according to color and then process letter forms in the attend color to identify targets. An asymmetric N170 ERP component (larger amplitude over left posterior hemisphere sites) was used as a marker of the early automatic processing of letter forms. Young and middle-aged adults did not generate an asymmetric N170 component. In contrast, young-old and old-old adults produced a larger N170 over the left hemisphere. Furthermore, older adults generated a larger N170 to letter than nonletter stimuli over the left, but not right hemisphere. More asymmetric N170 responses predicted greater allocation of late selection resources to target letters in the ignore color, as indexed by P3b amplitude. These results suggest that unlike their younger counterparts, older adults automatically process stimuli as letters early in the selection process, when it would be more efficient to attend to color only. The inability to ignore letters early in the processing stream helps explain the age-related increase in subsequent processing of target letter forms presented in the ignore color.
Directory of Open Access Journals (Sweden)
Chatterjee S
2012-12-01
Full Text Available Objective: To evaluate the number and type of warning letters issued by the US Food and Drug Administration (FDA to pharmaceutical manufacturers for promotional violations.Methods: Two reviewers downloaded, printed and independently evaluated warning letters issued by the FDA to pharmaceutical manufacturers from years 2003-2008. Misleading claims were broadly classified as clinical, Quality-of-Life (QoL, and economic claims. Clinical claims included claims regarding unsubstantiated efficacy, safety and tolerability, superiority, broadening of indication and/or omission of risk information. QoL claims included unsubstantiated quality of life and/or health-related quality of life claims. Economic claims included any form of claim made on behalf of the pharmaceutical companies related to cost superiority of or cost savings from the drug compared to other drugs in the market.Results: In the 6-year study period, 65 warning letters were issued by FDA, which contained 144 clinical, three QoL, and one economic claim. On an average, 11 warning letters were issued per year. Omission of risk information was the most frequently violated claim (30.6% followed by unsubstantiated efficacy claims (18.6%. Warning letters were primarily directed to manufacturers of cardiovascular (14.6%, anti-microbial (14.6%, and CNS (12.5% drugs. Majority of the claims referenced in warning letters contained promotional materials directed to physicians (57%. Conclusion: The study found that misleading clinical outcome claims formed the majority of the promotional violations, and majority of the claims were directed to physicians. Since inadequate promotion of medications may lead to irrational prescribing, the study emphasizes the importance of disseminating reliable, credible, and scientific information to patients, and more importantly, physicians to protect public health.
Justification and authority in institutional review board decision letters.
Clapp, Justin T; Gleason, Katharine A; Joffe, Steven
2017-12-01
While ethnographic study has described the discussions that occur during human subjects research ethics review, investigators have minimal access to the interactions of ethics oversight committees. They instead receive letters stipulating changes to their proposed studies. Ethics committee letters are central to the practice of research ethics: they change the nature of research, alter the knowledge it produces, and in doing so construct what ethical research is and how it is pursued. However, these letters have rarely been objects of analysis. Accordingly, we conducted a qualitative analysis of letters written by American institutional review boards (IRBs) overseeing biomedical and health behavioral research. We sought to clarify how IRBs exercise their authority by assessing the frequency with which they provided reasons for their stipulations as well as the nature of these reasons. We found that IRBs frequently do not justify their stipulations; rather, they often leave ethical or regulatory concerns implicit or frame their comments as boilerplate language replacements, procedural instructions, or demands for missing information. When they do provide justifications, their rationales exhibit substantial variability in explicitness and clarity. These rhetorical tendencies indicate that the authority of IRBs is grounded primarily in their role as bureaucratic gatekeepers. We conclude by suggesting that greater attention to justification could help shift the basis of the IRB-researcher relationship from compliance to mutual accountability. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Lete, Bernard; Fayol, Michel
2013-01-01
The aim of the study was to undertake a behavioral investigation of the development of automatic orthographic processing during reading acquisition in French. Following Castles and colleagues' 2007 study ("Journal of Experimental Child Psychology, 97," 165-182) and their lexical tuning hypothesis framework, substituted-letter and…
Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân
2009-11-25
Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.
[Letters to the editor published in Peruvian biomedical journals indexed in SciELO-Peru 2006-2013].
Montenegro-Idrogo, Juan José; Mejía-Dolores, Jhon William; Chalco-Huamán, Joel L
2015-01-01
This bibliometric study describes the characteristics of letters to the editor published between 2006-2013 in biomedical journals indexed in SciELO-Peru.253 letters (10.3% of total publications) were collected. Most letters (139) were in the Peruvian Journal of Experimental Medicine and Public Health, with marked increase throughout those years. 25% of letters submitted included medical student participation. 14% of authors presented with international affiliations and 27% with endogenous affiliation - common in university journals (Anales de la Facultad de Medicina, Revista Médica Herediana).The usual criteria justifying the publication of letters were: opinion of medical fact or public domain (35.6%) and discussion of results, methodological flaws or interpretation (22.9%). In biomedical journals indexed in SciELO Peru the letters to the editor comprise a percentage of publications that has increased in recent years, with low publication of letters of findings or primary data, compared with opinion or criticism.
“YOUR P.C.W.” THE UNPUBLISHED LETTERS OF PAUL SCHEERBART TO ERICH MÜHSAM
Directory of Open Access Journals (Sweden)
Alexander N. Belarev
2016-12-01
Full Text Available The archive of a German writer and anarchist Erich Mühsam (1878– 1934 is a significant but “unexplored” part of the manuscript collection of the A. M. Gorky Institute of World Literature of the Russian Academy of Sciences. I publish three letters of a German science fiction writer Paul Scheerbart (1863– 1915 to Mühsam and a postcard that Scheerbart sent to a German writer Hans Heinz Ewers. The letters to Mühsam record negotiations with publishing houses in Munich and Berlin about the publication of Scheerbart’s manuscripts (1909. In the postcard to Ewers, Sheerbart writes about the progress in his work on the perpetual motion machine that he tried to construct in 1908–1909. The letters are published in German with Russian translation and commentary. The introductory article gives an overview of Scheerbart’s life and career, the specificity of his works, their problematics and poetics and especially focuses on Scheerbart’s epistolary heritage. These letters are the token of friendship and professional collaboration of the two writers that is reflected in their mutual work on the unrealized project of publishing a satirical newspaper “Vaterland.” The IWL archives contain the unpublished manuscripts of Scheerbart and Mühsam related to this project as well. The history and the structure of the Mühsam archive is another aspect covered in the introductory article. Both Erich and Zenzl Mühsam were victims of totalitarian regimes. Erich was killed by the Nazis and his spouse Zenzl spent many years in Soviet labor camps. The history of the Mühsam manuscripts became intertwined with Zenzl’s life. That is why the article devotes space to Zenzl’s biography and attempts to answer the following questions connected to the archive: how did the manuscripts get to the Soviet Union? Why is the archive uncomplete? Finally, I discuss the publication history of Scheerbart letters from the IWL collection. Keywords: Paul Scheerbart, Erich
Google matrix analysis of DNA sequences.
Kandiah, Vivek; Shepelyansky, Dima L
2013-01-01
For DNA sequences of various species we construct the Google matrix [Formula: see text] of Markov transitions between nearby words composed of several letters. The statistical distribution of matrix elements of this matrix is shown to be described by a power law with the exponent being close to those of outgoing links in such scale-free networks as the World Wide Web (WWW). At the same time the sum of ingoing matrix elements is characterized by the exponent being significantly larger than those typical for WWW networks. This results in a slow algebraic decay of the PageRank probability determined by the distribution of ingoing elements. The spectrum of [Formula: see text] is characterized by a large gap leading to a rapid relaxation process on the DNA sequence networks. We introduce the PageRank proximity correlator between different species which determines their statistical similarity from the view point of Markov chains. The properties of other eigenstates of the Google matrix are also discussed. Our results establish scale-free features of DNA sequence networks showing their similarities and distinctions with the WWW and linguistic networks.
Google matrix analysis of DNA sequences.
Directory of Open Access Journals (Sweden)
Vivek Kandiah
Full Text Available For DNA sequences of various species we construct the Google matrix [Formula: see text] of Markov transitions between nearby words composed of several letters. The statistical distribution of matrix elements of this matrix is shown to be described by a power law with the exponent being close to those of outgoing links in such scale-free networks as the World Wide Web (WWW. At the same time the sum of ingoing matrix elements is characterized by the exponent being significantly larger than those typical for WWW networks. This results in a slow algebraic decay of the PageRank probability determined by the distribution of ingoing elements. The spectrum of [Formula: see text] is characterized by a large gap leading to a rapid relaxation process on the DNA sequence networks. We introduce the PageRank proximity correlator between different species which determines their statistical similarity from the view point of Markov chains. The properties of other eigenstates of the Google matrix are also discussed. Our results establish scale-free features of DNA sequence networks showing their similarities and distinctions with the WWW and linguistic networks.
Gilet, Estelle; Diard, Julien; Bessière, Pierre
2011-01-01
In this paper, we study the collaboration of perception and action representations involved in cursive letter recognition and production. We propose a mathematical formulation for the whole perception–action loop, based on probabilistic modeling and Bayesian inference, which we call the Bayesian Action–Perception (BAP) model. Being a model of both perception and action processes, the purpose of this model is to study the interaction of these processes. More precisely, the model includes a feedback loop from motor production, which implements an internal simulation of movement. Motor knowledge can therefore be involved during perception tasks. In this paper, we formally define the BAP model and show how it solves the following six varied cognitive tasks using Bayesian inference: i) letter recognition (purely sensory), ii) writer recognition, iii) letter production (with different effectors), iv) copying of trajectories, v) copying of letters, and vi) letter recognition (with internal simulation of movements). We present computer simulations of each of these cognitive tasks, and discuss experimental predictions and theoretical developments. PMID:21674043
CodonLogo: a sequence logo-based viewer for codon patterns.
Sharma, Virag; Murphy, David P; Provan, Gregory; Baranov, Pavel V
2012-07-15
Conserved patterns across a multiple sequence alignment can be visualized by generating sequence logos. Sequence logos show each column in the alignment as stacks of symbol(s) where the height of a stack is proportional to its informational content, whereas the height of each symbol within the stack is proportional to its frequency in the column. Sequence logos use symbols of either nucleotide or amino acid alphabets. However, certain regulatory signals in messenger RNA (mRNA) act as combinations of codons. Yet no tool is available for visualization of conserved codon patterns. We present the first application which allows visualization of conserved regions in a multiple sequence alignment in the context of codons. CodonLogo is based on WebLogo3 and uses the same heuristics but treats codons as inseparable units of a 64-letter alphabet. CodonLogo can discriminate patterns of codon conservation from patterns of nucleotide conservation that appear indistinguishable in standard sequence logos. The CodonLogo source code and its implementation (in a local version of the Galaxy Browser) are available at http://recode.ucc.ie/CodonLogo and through the Galaxy Tool Shed at http://toolshed.g2.bx.psu.edu/.
Woelders, H.
2006-01-01
In response to the letter by Dr. Amir Arav I would like to mention the following. The application of the principle of directional solidification to cryopreservation of living cells was, as far as I am aware, not the invention of Dr. Arav. It was first published and patented by Rubinsky (Berkeley,
Open Letter to the European Commission
DEFF Research Database (Denmark)
Savin, Andrej; Schwemer, Sebastian Felix
2016-01-01
to the information society. A key component of this acquis is the prohibition of general monitoring obligations to the benefit of providers of intermediary services. It is a means to achieve at least two central objectives: the encouragement of innovation as well as the protection of fundamental rights of all...... Internet users, namely the rights protected by Articles 8 and 11 of the European Convention of Human Rights. Yet, the proposed Copyright Directive, in particular, seems to negatively affect both the domain and effect of Article 15 of the E-commerce Directive. The signatories of this open letter therefore...... urge the European Commission to take into account the human rights dimension of Article 15 of the E-commerce Directive, as made explicit by the Court of the Justice of the European Union, and to make sure its implications are carefully examined across sectors. Authors: Sophie Stalla-Bourdillon Eleonora...
Human liver phosphatase 2A: cDNA and amino acid sequence of two catalytic subunit isotypes
International Nuclear Information System (INIS)
Arino, J.; Woon, Chee Wai; Brautigan, D.L.; Miller, T.B. Jr.; Johnson, G.L.
1988-01-01
Two cDNA clones were isolated from a human liver library that encode two phosphatase 2A catalytic subunits. The two cDNAs differed in eight amino acids (97% identity) with three nonconservative substitutions. All of the amino acid substitutions were clustered in the amino-terminal domain of the protein. Amino acid sequence of one human liver clone (HL-14) was identical to the rabbit skeletal muscle phosphatase 2A cDNA (with 97% nucleotide identity). The second human liver clone (HL-1) is encoded by a separate gene, and RNA gel blot analysis indicates that both mRNAs are expressed similarly in several human clonal cell lines. Sequence comparison with phosphatase 1 and 2A indicates highly divergent amino acid sequences at the amino and carboxyl termini of the proteins and identifies six highly conserved regions between the two proteins that are predicted to be important for phosphatase enzymatic activity
31 CFR 500.406 - Drafts under irrevocable letters of credit; documentary drafts.
2010-07-01
... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Drafts under irrevocable letters of credit; documentary drafts. 500.406 Section 500.406 Money and Finance: Treasury Regulations Relating to... ASSETS CONTROL REGULATIONS Interpretations § 500.406 Drafts under irrevocable letters of credit...
31 CFR 515.406 - Drafts under irrevocable letters of credit; documentary drafts.
2010-07-01
... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Drafts under irrevocable letters of credit; documentary drafts. 515.406 Section 515.406 Money and Finance: Treasury Regulations Relating to... CONTROL REGULATIONS Interpretations § 515.406 Drafts under irrevocable letters of credit; documentary...
Why doctors do not answer referral letters
African Journals Online (AJOL)
Referral letters act as permission slips to allow patients easy access to ... Methods: A qualitative study method was used, as the purpose of this study was to .... The total list of topics ..... Research design: qualitative and quantitative approaches.
Classification of the Correct Quranic Letters Pronunciation of Male and Female Reciters
Khairuddin, Safiah; Ahmad, Salmiah; Embong, Abdul Halim; Nur Wahidah Nik Hashim, Nik; Altamas, Tareq M. K.; Nuratikah Syd Badaruddin, Syarifah; Shahbudin Hassan, Surul
2017-11-01
Recitation of the Holy Quran with the correct Tajweed is essential for every Muslim. Islam has encouraged Quranic education since early age as the recitation of the Quran correctly will represent the correct meaning of the words of Allah. It is important to recite the Quranic verses according to its characteristics (sifaat) and from its point of articulations (makhraj). This paper presents the identification and classification analysis of Quranic letters pronunciation for both male and female reciters, to obtain the unique representation of each letter by male as compared to female expert reciters. Linear Discriminant Analysis (LDA) was used as the classifier to classify the data with Formants and Power Spectral Density (PSD) as the acoustic features. The result shows that linear classifier of PSD with band 1 and band 2 power spectral combinations gives a high percentage of classification accuracy for most of the Quranic letters. It is also shown that the pronunciation by male reciters gives better result in the classification of the Quranic letters.
46 CFR 28.60 - Exemption letter.
2010-10-01
... VESSELS General Provisions § 28.60 Exemption letter. (a) Types of exemptions. (1) Specific exemption means... for an exemption of either type must be in writing, have specific reasons for the request, and be sent... vessel to which any exemption applies. (e) Right of appeal. Any person directly affected by a decision or...
Decoding English Alphabet Letters Using EEG Phase Information
Directory of Open Access Journals (Sweden)
YiYan Wang
2018-02-01
Full Text Available Increasing evidence indicates that the phase pattern and power of the low frequency oscillations of brain electroencephalograms (EEG contain significant information during the human cognition of sensory signals such as auditory and visual stimuli. Here, we investigate whether and how the letters of the alphabet can be directly decoded from EEG phase and power data. In addition, we investigate how different band oscillations contribute to the classification and determine the critical time periods. An English letter recognition task was assigned, and statistical analyses were conducted to decode the EEG signal corresponding to each letter visualized on a computer screen. We applied support vector machine (SVM with gradient descent method to learn the potential features for classification. It was observed that the EEG phase signals have a higher decoding accuracy than the oscillation power information. Low-frequency theta and alpha oscillations have phase information with higher accuracy than do other bands. The decoding performance was best when the analysis period began from 180 to 380 ms after stimulus presentation, especially in the lateral occipital and posterior temporal scalp regions (PO7 and PO8. These results may provide a new approach for brain-computer interface techniques (BCI and may deepen our understanding of EEG oscillations in cognition.
International Nuclear Information System (INIS)
2001-01-01
The present collection of letters from JINR, Dubna, contains seven separate records on physics from extra dimensions, new physics in the new millennium with GENIUS: double beta decay, dark matter, solar neutrinos, the (μ - , e + ) conversion in nuclei mediated by light Majorana neutrinos, exotic muon-to-positron conversion in nuclei: partial transition sum evaluation by using shell model, solar neutrino problem accounting for self consistent magnetohydrodynamics solution for solar magnetic fields, first neutrino observations from the Sudbury neutrino observatory and status report on BOREXINO and results of the muon-background measurements at CERN
International Nuclear Information System (INIS)
2002-01-01
The present collection of letters from JINR, Dubna, contains seven separate records on kinematic separation and mass analysis of heavy recoiling nuclei, dynamical effects prior to heavy ion fusion, VACTIV-DELPHI graphical dialog based program for the analysis of gamma-ray spectra, irradiation of nuclear emulsions in relativistic beams of 6 He and 3 H nuclei, optical and structural investigations of PLZT x/65/35 (x = 4, 8 %) ferroelectric ceramics irradiated by a high-current pulsed electron beam, the oscillating charge and first evidence for neutrinoless double beta decay
Directory of Open Access Journals (Sweden)
M.I. Baranov
2016-03-01
Full Text Available Purpose. Experimental researches of electro-thermal resistibility of cable-explorer products, applied in the power electric circuits of objects of electric-power industry, to action on its copper and aluminum parts bearings a current rationed on the International Standard of IEC 62305-1-2010 aperiodic impulse 10/350 μs of current of artificial lightning. Methodology. Electrophysics bases of technique of high tensions and high pulsed currents (HPC, and also scientific and technical bases of planning of devices of high-voltage impulsive technique and measuring HPC in them. Results. Experimental a way the quantitative levels of maximal values maximum of possible and critical closenesses of aperiodic impulse 10/350 μs of current of artificial lightning with rationed on the international standard of IEC 62305-1-2010 peak-temporal parameters and admittances on them in copper (aluminum parts bearings a current of send-offs and cables with a polyethylene (PET and polyvinylchloride (PVCH isolation. Originality. First in world practice on the unique powerful high-voltage generator of HPC of artificial lightning experimental researches of resistibility to lightning of pre-production models of send-offs (cables are conducted with copper (aluminum tendons, PET and PVCH by an isolation, in-use in power electric circuits of electric-power industry objects. Practical value. The use in practice of protecting from lightning of the got results will allow substantially to promote functional and fire-prevention safety of engineering communications of objects of industrial electroenergy in the conditions of action on them of short shots of linear lightning.
DEFF Research Database (Denmark)
Fahnøe, Ulrik; Pedersen, Anders Gorm; Höper, Dirk
2013-01-01
to the consensus sequence. Additionally, we got an average sequence depth for the genome of 4000 for the Iontorrent PGM and 400 for the FLX platform making the mapping suitable for single nucleotide variant (SNV) detection. The analysis revealed a single non-silent SNV A10665G leading to the amino acid change D......Next Generation Sequencing (NGS) is becoming more adopted into viral research and will be the preferred technology in the years to come. We have recently sequenced several strains of Classical Swine Fever Virus (CSFV) by NGS on both Genome Sequencer FLX (GS FLX) and Iontorrent PGM platforms...
African Journals Online: Browse Alphabetically -- letter T
African Journals Online (AJOL)
Items 1 - 19 of 19 ... African Journals Online: Browse Alphabetically -- letter T ... and economic aspects of management and conservation of tropical flora and fauna. ... Les principaux thèmes qui y sont abordés recouvrent les axes de recherche ...
Marinus, Eva; de Jong, Peter; van der Leij, Aryan
2012-01-01
The present study examined whether explicit training of letter-clusters leads to more gains in word-reading speed than training of the separate letters of the same clusters. Ninety-nine poor reading second-grade children were randomly assigned to a cluster-training, a parallel letter-training, or a no-training condition. The cluster-training…
The New Scarlet Letter: Student Perceptions of the Accounting Profession after Enron
Coleman, Mimi; Kreuze, Jerry; Langsam, Sheldon
2004-01-01
Recent scandals have tarnished the integrity of the accounting profession, marking it with a modern version of the scarlet letter "A," which represented disgrace in Nathaniel Hawthorne's "The Scarlet Letter." In this study, the authors surveyed college business students on their perceptions of the accounting profession and examined how it can…
Continuous Online Sequence Learning with an Unsupervised Neural Network Model.
Cui, Yuwei; Ahmad, Subutar; Hawkins, Jeff
2016-09-14
The ability to recognize and predict temporal sequences of sensory inputs is vital for survival in natural environments. Based on many known properties of cortical neurons, hierarchical temporal memory (HTM) sequence memory recently has been proposed as a theoretical framework for sequence learning in the cortex. In this letter, we analyze properties of HTM sequence memory and apply it to sequence learning and prediction problems with streaming data. We show the model is able to continuously learn a large number of variableorder temporal sequences using an unsupervised Hebbian-like learning rule. The sparse temporal codes formed by the model can robustly handle branching temporal sequences by maintaining multiple predictions until there is sufficient disambiguating evidence. We compare the HTM sequence memory with other sequence learning algorithms, including statistical methods: autoregressive integrated moving average; feedforward neural networks-time delay neural network and online sequential extreme learning machine; and recurrent neural networks-long short-term memory and echo-state networks on sequence prediction problems with both artificial and real-world data. The HTM model achieves comparable accuracy to other state-of-the-art algorithms. The model also exhibits properties that are critical for sequence learning, including continuous online learning, the ability to handle multiple predictions and branching sequences with high-order statistics, robustness to sensor noise and fault tolerance, and good performance without task-specific hyperparameter tuning. Therefore, the HTM sequence memory not only advances our understanding of how the brain may solve the sequence learning problem but is also applicable to real-world sequence learning problems from continuous data streams.
Should intellectual property be disseminated by "forwarding" rejected letters without permission?
Gupta, V K
1996-01-01
Substantive scientific letter writing is a cost-effective mode of complementing observational and experimental research. The value of such philosophically uncommitted and unsponsored well-balanced scientific activity has been relegated. Critical letter writing entails the abilities to: maintain rational scepticism; refuse to conform in order to explain data; persist in keeping common sense centre-stage; exercise logic to evaluate the biological significance of mathematical figures, including ...
Letter-case information and the identification of brand names.
Perea, Manuel; Jiménez, María; Talero, Fernanda; López-Cañada, Soraya
2015-02-01
A central tenet of most current models of visual-word recognition is that lexical units are activated on the basis of case-invariant abstract letter representations. Here, we examined this assumption by using a unique type of words: brand names. The rationale of the experiments is that brand names are archetypically printed either in lowercase (e.g., adidas) or uppercase (e.g., IKEA). This allows us to present the brand names in their standard or non-standard case configuration (e.g., adidas, IKEA vs. ADIDAS, ikea, respectively). We conducted two experiments with a brand-decision task ('is it a brand name?'): a single-presentation experiment and a masked priming experiment. Results in the single-presentation experiment revealed faster identification times of brand names in their standard case configuration than in their non-standard case configuration (i.e., adidas faster than ADIDAS; IKEA faster than ikea). In the masked priming experiment, we found faster identification times of brand names when they were preceded by an identity prime that matched its standard case configuration than when it did not (i.e., faster response times to adidas-adidas than to ADIDAS-adidas). Taken together, the present findings strongly suggest that letter-case information forms part of a brand name's graphemic information, thus posing some limits to current models of visual-word recognition. © 2014 The British Psychological Society.
Lexical semantic access and letter access are involved in different aspects of reading
DEFF Research Database (Denmark)
Poulsen, Mads
). In this subset sample, both letter access and lexical access accounted for unique variance in reading fluency. The pattern of effects for lexical access did not change by controlling for serial rapid naming (RAN). Conclusions: The results suggest that letter access and lexical access are important for different......Purpose: This study investigated the effects of lexical access speed and letter access speed on reading fluency and reading comprehension. We hypothesized that 1) letter access speed would correlate with reading fluency but not comprehension, while 2) lexical access speed would influence reading...... comprehension. For readers who are struggling with recoding, most of the reading effort is probably tied up with recoding, leaving little to be explained by lexical access. Therefore we expected that 3) lexical access speed would primarily predict reading fluency for readers who were no longer struggling...
“Letter to the King” By Jules Destry: from Separatism to Unitarism in Belgium
Directory of Open Access Journals (Sweden)
Ella V. Ermakova
2016-01-01
are still shaken by Belgium. He reflects on the fact that the central government should be doing to reduce the national tensions that unites two people, and that the shares, which should be a system of education that future generations were able to overcome the historical alienation of such geographically close and ideologically distant peoples. Although Jules Destree firmly defends separatism idea for Wallonia as the only solution to the problem, however, by the end of his letter, reasoning it takes a more balanced position. The idea of a unitary state was not denied completely, but Destree emphasizes the importance of a balanced central government policy in relation to the regions in order to reduce internal tensions between the two nations. The ideas embodied in his "Letter to the King", formed the basis of the principles of peaceful co-existence of further autonomous regions as part of the union, which was manifested in the future during the First World War, when the Walloons and Flemings alongside confronted a common enemy.
Todd, Angela L; Porter, Maree; Williamson, Jennifer L; Patterson, Jillian A; Roberts, Christine L
2015-12-01
Surveys are commonly used in health research to assess patient satisfaction with hospital care. Achieving an adequate response rate, in the face of declining trends over time, threatens the quality and reliability of survey results. This paper evaluates a strategy to increase the response rate in a postal satisfaction survey with women who had recently given birth. A sample of 2048 Australian women who had recently given birth at seven maternity units in New South Wales were invited to participate in a postal survey about their recent experiences with maternity care. The study design included a randomised controlled trial that tested two types of pre-notification letter (with or without the option of opting out of the survey). The study also explored the acceptability of a request for consent to link survey data with existing routinely collected health data (omitting the latter data items from the survey reduced survey length and participant burden). This consent was requested of all women. The survey had an overall response rate of 46% (913 completed surveys returned, total sample 1989). Women receiving the pre-notification letter with the option of opting out of the survey were more likely to actively decline to participate than women receiving the letter without this option, although the overall numbers of women declining were small (27 versus 12). Letter type was not significantly associated with the return of a completed survey. Among women who completed the survey, 97% gave consent to link their survey data with existing health data. The two types of pre-notification letters used in our study did not influence the survey response rate. However, seeking consent for record linkage was highly acceptable to women who completed the survey, and represents an important strategy to add to the arsenal for designing and implementing effective surveys. In addition to aspects of survey design, future research should explore how to more effectively influence personal
"Physical Review Letters" in the Classroom
Angiolillo, Paul J.; Lynch, Jonathan
2010-01-01
Ask any physicist what the preeminent journal in the field is, and I think the almost unanimous answer will be "Physical Review Letters" ("PRL"). This weekly journal of the American Physical Society publishes high-impact research from all the major subdisciplines of physics. This journal is not the one you would think is the first place a high…
Suspending Damage: A Letter to Communities
Tuck, Eve
2009-01-01
In this open letter, Eve Tuck calls on communities, researchers, and educators to reconsider the long-term impact of "damage-centered" research--research that intends to document peoples' pain and brokenness to hold those in power accountable for their oppression. This kind of research operates with a flawed theory of change: it is often used to…
Language Arts/Arts: Adopt-a-Letter
Soloway, Rhoda K.
1978-01-01
Describes a five-week project in which elementary students chose a favorite letter as the main character of a 25- to 30-page book for practice in language skills. The book each child made was composed of more than 20 learning activities that stimulated students to review and practice skills, parts of speech, synonyms, antonyms and alliteration as…
An Analysis of English Business Letters from the Perspective of Interpersonal Function
Xu, Bo
2012-01-01
The purpose of the present study is to find out the features of English business letters. Halliday's systemic functional linguistics is used as the theoretical framework, mainly, interpersonal fucntion. The English business letter (EBL) is an important written text used for international business communication and it has its own features of text.…
Atom and archetype the Pauli/Jung letters, 1932-1958
2001-01-01
Wolfgang Pauli, world-renowned physicist, turned to Carl Jung for help, setting a standing appointment for Mondays at noon. Thus bloomed an extraordinary intellectual conjunction. Eighty letters, written over twenty-six years, record that friendship, and are published here in English for the first time.Through the association of these two pioneering thinkers, developments in physics profoundly influenced the evolution of Jungian psychology. And many of Jung's abiding themes shaped how Pauli - and, through him, other physicists - understood the physical world. Atom and Archetype will appeal not only to those interested in the life of Pauli or Jung, but also to the educated general reader.
medication history documentation in referral letters of children
African Journals Online (AJOL)
CHILDREN PRESENTING AT THE EMERGENCY UNIT OF A TEACHING. HOSPITAL IN LAGOS ... infrequently reported in referral letters to a tertiary care hospital in Lagos,. Nigeria. .... researcher, a pharmacist and clinical pharmacologist.
The Presentation of Self in Letters of Application: A Mixed-Method Approach
Soroko, Emilia
2012-01-01
The application letter, as the first phase of employment-seeking, is an opportunity for a job applicant to make a favorable impression on a potential employer. In the current study, the author used a mixed-method approach to empirically explore strategies for self-presentation in job application letters and determine the methods used in the…
12 CFR 614.4720 - Letters of credit.
2010-01-01
... Banks and Banking FARM CREDIT ADMINISTRATION FARM CREDIT SYSTEM LOAN POLICIES AND OPERATIONS Banks for Cooperatives and Agricultural Credit Banks Financing International Trade § 614.4720 Letters of credit. Banks for cooperatives and agricultural credit banks, under policies adopted by their boards of directors...
Comparison of pause predictions of two sequence-dependent transcription models
International Nuclear Information System (INIS)
Bai, Lu; Wang, Michelle D
2010-01-01
Two recent theoretical models, Bai et al (2004, 2007) and Tadigotla et al (2006), formulated thermodynamic explanations of sequence-dependent transcription pausing by RNA polymerase (RNAP). The two models differ in some basic assumptions and therefore make different yet overlapping predictions for pause locations, and different predictions on pause kinetics and mechanisms. Here we present a comprehensive comparison of the two models. We show that while they have comparable predictive power of pause locations at low NTP concentrations, the Bai et al model is more accurate than Tadigotla et al at higher NTP concentrations. The pausing kinetics predicted by Bai et al is also consistent with time-course transcription reactions, while Tadigotla et al is unsuited for this type of kinetic prediction. More importantly, the two models in general predict different pausing mechanisms even for the same pausing sites, and the Bai et al model provides an explanation more consistent with recent single molecule observations
International Nuclear Information System (INIS)
2002-01-01
The present collection of letters from JINR, Dubna, contains eight separate records on the role of the complanar emission of particles in nuclear interaction for E 0 >10 16 eV detected in the stratosphere, 10 B nucleus fragment yields, nuclear teleportation (proposal for an experiment), invisible 'glue' bosons in model field theory, calculation of the ionization differential effective cross sections in fast ion-atom collisions, interactions of ultracold neutrons near surface of solids, g factors as a probe for high-spin structure of neutron-rich Dy isotopes, search for periodicities in experimental data by the autoregressive model methods
International Nuclear Information System (INIS)
2000-01-01
The present collection of letters from JINR, Dubna, contains eight separate records on quantum field theory and symmetries in nuclear physics, multifractal analysis of AFM images of Nb thin film surfaces, the fast-acting memory for multichannel converters of time to digital, an analysis of the anomalous Cherenkov radiation obtained in the relativistic lead ion beam at CERN SPS, the problem of consistency of the thermal-spike model with experimentally determined electron temperature, ATLAS calorimeter performance for charged pion as well as on collective flow in multifragmentation induced by relativistic helium and carbon ions variation of the coulomb repulsion in multifragmentation
DEFF Research Database (Denmark)
Gammeltoft, Peder
2017-01-01
The resolve of the naming dispute between Denmark, Norway and Sweden over the sea name Skagerrak has always been hailed as a prime example of how a naming dispute between countries over joint geographical name features should be handled and solved. This is a search into the story behind the scenes...... by the national mapping agencies. Practical Implications: Useful for institutions seeking name dispute resolution. Building on the extensive correspondence of almost fifty letters in the Danish Place-Name Commission’s journal archive, this naming dispute is shown to be of a rather different nature and resolve...
A Comparison of the First Two Sequenced Chloroplast Genomes in Asteraceae: Lettuce and Sunflower
Energy Technology Data Exchange (ETDEWEB)
Timme, Ruth E.; Kuehl, Jennifer V.; Boore, Jeffrey L.; Jansen, Robert K.
2006-01-20
Asteraceae is the second largest family of plants, with over 20,000 species. For the past few decades, numerous phylogenetic studies have contributed to our understanding of the evolutionary relationships within this family, including comparisons of the fast evolving chloroplast gene, ndhF, rbcL, as well as non-coding DNA from the trnL intron plus the trnLtrnF intergenic spacer, matK, and, with lesser resolution, psbA-trnH. This culminated in a study by Panero and Funk in 2002 that used over 13,000 bp per taxon for the largest taxonomic revision of Asteraceae in over a hundred years. Still, some uncertainties remain, and it would be very useful to have more information on the relative rates of sequence evolution among various genes and on genome structure as a potential set of phylogenetic characters to help guide future phylogenetic structures. By way of contributing to this, we report the first two complete chloroplast genome sequences from members of the Asteraceae, those of Helianthus annuus and Lactuca sativa. These plants belong to two distantly related subfamilies, Asteroideae and Cichorioideae, respectively. In addition to these, there is only one other published chloroplast genome sequence for any plant within the larger group called Eusterids II, that of Panax ginseng (Araliaceae, 156,318 bps, AY582139). Early chloroplast genome mapping studies demonstrated that H. annuus and L. sativa share a 22 kb inversion relative to members of the subfamily Barnadesioideae. By comparison to outgroups, this inversion was shown to be derived, indicating that the Asteroideae and Cichorioideae are more closely related than either is to the Barnadesioideae. Later sequencing study found that taxa that share this 22 kb inversion also contain within this region a second, smaller, 3.3 kb inversion. These sequences also enable an analysis of patterns of shared repeats in the genomes at fine level and of RNA editing by comparison to available EST sequences. In addition, since
Kazlacheva, Z. I.
2017-10-01
The Golden ratio and Fibonacci sequence are used as proportions in design as symbols of beauty and harmony. That symbolism is a result of the strong connections in their mathematical nature. The Golden section is a number, introduced with Greek letter φ, which is found by dividing a line into two parts as the longer part divided by the smaller part is equal as the whole length of longer and smaller parts divided by the longer part. Fibonacci sequence is a series of numbers where every number is equal to the two numbers before it. An investigation of application of proportions based on the Golden ratio and Fibonacci sequence in the fashion design and pattern making of ladies’ clothing is the main aim of the paper. Based on the study it may be concluded that in fashion design and pattern making the Golden ratio and Fibonacci sequence can be used in creation of beautiful and harmonic forms directly or with the help of geometrical figures as: In directly use the Golden and Fibonacci numbers proportions can be in one and the same or different directions. In the application with the help of geometrical shapes the Golden and Fibonacci figures combine proportioning and form creation. The Golden and Fibonacci shapes can be used directly as forms or as frames of forms creation of elements and pieces. Its application can be in different directions and location according the bodice. The Golden section and Fibonacci sequence can combine proportions with other principles of design as symmetry, rhythm, etc.
Lemos, Leandro Nascimento; de Souza, Rosineide Cardoso; de Souza Cannavan, Fabiana; Patricio, André; Pylro, Victor Satler; Hanada, Rogério Eiji; Mui, Tsai Siu
2016-12-01
The Anthropogenic Amazon Dark Earth soil is considered one of the world's most fertile soils. These soils differs from conventional Amazon soils because its higher organic content concentration. Here we describe the metagenome sequencing of microbial communities of two sites of Anthropogenic Amazon Dark Earth soils from Amazon Rainforest, Brazil. The raw sequence data are stored under Short Read Accession number: PRJNA344917.
75 FR 75453 - Proposed Information Collection; Comment Request; Technical Data Letter of Explanation
2010-12-03
... Request; Technical Data Letter of Explanation AGENCY: Bureau of Industry and Security. ACTION: Notice....gov . SUPPLEMENTARY INFORMATION: I. Abstract These technical data letters of explanation will assure the Bureau of Industry and Security that U.S.-origin technical data will be exported only for...
Who Learns More? Cultural Differences in Implicit Sequence Learning
Fu, Qiufang; Dienes, Zoltan; Shang, Junchen; Fu, Xiaolan
2013-01-01
Background It is well documented that East Asians differ from Westerners in conscious perception and attention. However, few studies have explored cultural differences in unconscious processes such as implicit learning. Methodology/Principal Findings The global-local Navon letters were adopted in the serial reaction time (SRT) task, during which Chinese and British participants were instructed to respond to global or local letters, to investigate whether culture influences what people acquire in implicit sequence learning. Our results showed that from the beginning British expressed a greater local bias in perception than Chinese, confirming a cultural difference in perception. Further, over extended exposure, the Chinese learned the target regularity better than the British when the targets were global, indicating a global advantage for Chinese in implicit learning. Moreover, Chinese participants acquired greater unconscious knowledge of an irrelevant regularity than British participants, indicating that the Chinese were more sensitive to contextual regularities than the British. Conclusions/Significance The results suggest that cultural biases can profoundly influence both what people consciously perceive and unconsciously learn. PMID:23940773
Blindness and the age of enlightenment: Diderot's letter on the blind.
Margo, Curtis E; Harman, Lynn E; Smith, Don B
2013-01-01
Several months after anonymously publishing an essay in 1749 with the title "Letter on the Blind for the Use of Those Who Can See," the chief editor of the French Encyclopédie was arrested and taken to the prison fortress of Vincennes just east of Paris, France. The correctly assumed author, Denis Diderot, was 35 years old and had not yet left his imprint on the Age of Enlightenment. His letter, which recounted the life of Nicolas Saunderson, a blind mathematician, was intended to advance secular empiricism and disparage the religiously tinged rationalism put forward by Rene Descartes. The letter's discussion of sensory perception in men born blind dismissed the supposed primacy of visual imagery in abstract thinking. The essay did little to resolve any philosophical controversy, but it marked a turning point in Western attitudes toward visual disability.
African Journals Online: Browse Alphabetically -- letter D
African Journals Online (AJOL)
Dar Es Salaam Medical Students' Journal. The journal publishes original research, case report/case series, letter to the editor, reviews of health related issues in medicine, pharmacy, dentistry, nursing, public and allied health sciences. Furthermore the DMSJ endeavours to disseminate research findings mainly of medical ...
50 CFR 216.218 - Letters of Authorization.
2010-10-01
... ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE MAMMALS REGULATIONS GOVERNING THE TAKING AND IMPORTING OF MARINE MAMMALS Taking of Marine Mammals Incidental to Explosive Severance Activities Conducted During Offshore Structure Removal Operations on the Outer Continental Shelf in the U.S. Gulf of Mexico § 216.218 Letters of...
15 CFR 700.63 - Letters of Understanding.
2010-01-01
... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Letters of Understanding. 700.63 Section 700.63 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade (Continued) BUREAU OF INDUSTRY AND SECURITY, DEPARTMENT OF COMMERCE NATIONAL SECURITY INDUSTRIAL BASE REGULATIONS...
Una lettera a Sylos Labini. (A letter to Sylos Labini
Directory of Open Access Journals (Sweden)
Franco Modigliani
2014-10-01
Full Text Available The letter, dated 14 September 1956, starts a decade long correspondence between Franco Modigliani and Paolo Sylos Labini. Here Modigliani discusses at length a first draft of Sylos Labini’s book on oligopoly theory. Differently from Modigliani’s well known 1958 review of the book, Modigliani focuses here not mainly on the structure of oligopoly industries, but especially on the macroeconomic implications of Sylos Labini’s model. The letter is reproduced with Sylos Labini’s annotated comments on Modigliani’s remarks. JEL codes: B31, D43, E13
Teaching braille letters, numerals, punctuation, and contractions to sighted individuals.
Putnam, Brittany C; Tiger, Jeffrey H
2015-01-01
Braille-character recognition is one of the foundational skills required for teachers of braille. Prior research has evaluated computer programming for teaching braille-to-print letter relations (e.g., Scheithauer & Tiger, 2012). In the current study, we developed a program (the Visual Braille Trainer) to teach not only letters but also numerals, punctuation, symbols, and contractions; we evaluated this program with 4 sighted undergraduate participants. Exposure to this program resulted in mastery of all braille-to-print relations for each participant. © Society for the Experimental Analysis of Behavior.
A letter signed: the very beginnings of Dalton's atomic theory.
Pratt, Herbert T
2010-11-01
This paper explores the provenance and content of a previously unknown personal letter by John Dalton (1766-1844), which is dated 12 April 1803. It relates to a startling breakthrough in Dalton's research, which pre-dates by five months the earliest date in his laboratory notebook, namely, 6 September 1803. The author acquired the letter about thirty years ago, and now offers it to the public. He makes no attempt to explain how it contributes to--or even changes--our understanding of Dalton, but leaves that privilege to Dalton scholars.
The Neural Substrates for Letter String Readings in The Normal and Reverse Directions: An fMRI Study
Ge, Sheng; Saito, Takashi; Wu, Jing-Long; Ogasawara, Jun-Ichi; Yamauchi, Shuichi; Matsunaga, Naofumi; Iramina, Keiji
In order to investigate the difference in cortical activations between reading letter strings in the normal direction and the reverse direction, an fMRI study was conducted. In this study, the cortical activations elicited by Japanese letter string reading and Chinese letter string reading were investigated. The subjects performed the normal direction reading task (read letter strings from left to right), and the reverse direction reading task (read letter strings from right to left). According to the experimental results, the activated brain regions during the normal and the reverse direction reading tasks were compared. It was found that visuospatial transformation was involved in the reverse direction reading task, while this function was not significant during the normal direction reading task. Furthermore, we found that there was no significant difference in cortical activation between Japanese and Chinese letter string readings.
39 CFR 320.4 - Suspension for certain letters of college and university organizations.
2010-07-01
... universities to carry in their internal mail systems the letters of their bona fide student or faculty... university. Colleges and universities choosing to provide their student or faculty organizations access to their internal mail systems are responsible for assuring that only letters of bona fide student or...
Revell, Kevin D.
2011-01-01
A new laboratory experiment is described in which students compare two benchtop separation methods to isolate the three active components of the commercial analgesic Excedrin. In the two-week sequence, aspirin, acetaminophen, and caffeine are separated using either a two-base liquid-liquid extraction or silica column chromatography. Students then…
Referral letter with an attached structured reply form: Is it a solution for not getting replies
Directory of Open Access Journals (Sweden)
R. P. J. C. Ramanayake
2013-01-01
Full Text Available Background: Communication between primary care doctors and specialists/hospital doctors is vital for smooth functioning of a health care system. In many instances referral and reply letters are the sole means of communication between general practitioners and hospital doctors/specialists. Despite the obvious benefits to patient care, answers to referral letters are the exception worldwide. In Sri Lanka hand written conventional letters are used to refer patients and replies are scarce. Materials and Methods: This interventional study was designed to assess if attaching a structured reply form with the referral letter would increase the rate of replies/back-referrals. It was conducted at the Family Medicine Clinic of the Faculty of Medicine, University of Kelaniya. A structured referral letter (form was designed based on guide lines and literature and it was used for referral of patients for a period of six months. Similarly a structured reply form was also designed and both the referral letter and the reply letter were printed on A4 papers side by side and these were used for the next six months for referrals. Both letters had headings and space underneath to write details pertaining to the patient. A register was maintained to document the number of referrals and replies received during both phases. Patents were asked to return the reply letters if specialists/hospital doctors obliged to reply. Results: Total of 90 patients were referred using the structured referral form during 1st phase. 80 letters (with reply form attached were issued during the next six months. Patients were referred to eight different specialties. Not a single reply during the 1 st phase and there were six 6 (7.5% replies during the 2 nd phase. Discussion: This was an attempt to improve communication between specialists/hospital doctors and primary care doctors. Even though there was some improvement it was not satisfactory. A multicenter island wide study should be
Directory of Open Access Journals (Sweden)
Alyssa J Kersey
2013-09-01
Full Text Available Although previous literature suggests that writing practice facilitates neural specialization for letters, it is unclear if this facilitation is driven by the perceptual feedback from the act of writing or the actual execution of the motor act. The present study addresses this issue by measuring the change in BOLD signal in response to hand-printed letters, unlearned cursive letters, and cursive letters that 7 year-old children learned actively, by writing, and passively, by observing an experimenter write. Brain activation was assessed using fMRI while perceiving letters – in both cursive and manuscript forms. Results showed that active training led to increased recruitment of the sensori-motor network associated with letter perception as well as the insula and claustrum, but passive observation did not. This suggests that perceptual networks for newly learned cursive letters are driven by motor execution rather than by perceptual feedback.
DEFF Research Database (Denmark)
Pedersen, Thomas Bæk; Kot, Witold Piotr; Hansen, L.H.
2014-01-01
The lactic acid bacterium Leuconostoc pseudomesenteroides can be found in mesophilic cheese starters, where it produces aromatic compounds from, e.g., citrate. Here, we present the draft genome sequences of two L. pseudomesenteroides strains isolated from traditional Danish cheese starters....
Source terms associated with two severe accident sequences in a 900 MWe PWR
International Nuclear Information System (INIS)
Fermandjian, J.; Evrard, J.M.; Berthion, Y.; Lhiaubet, G.; Lucas, M.
1983-12-01
Hypothetical accidents taken into account in PWR risk assessment result in fission product release from the fuel, transfer through the primary circuit, transfer into the reactor containment building (RCB) and finally release to the environment. The objective of this paper is to define the characteristics of the source term (noble gases, particles and volatile iodine forms) released from the reactor containment building during two dominant core-melt accident sequences: S 2 CD and TLB according to the ''Reactor Safety Study'' terminology. The reactor chosen for this study is a French 900 MWe PWR unit. The reactor building is a prestressed concrete containment with an internal liner. The first core-melt accident sequence is a 2-break loss-of-coolant accident on the cold leg, with failure of both system and the containment spray system. The second one is a transient initiated by a loss of offsite and onsite power supply and auxiliary feedwater system. These two sequences have been chosen because they are representative of risk dominant scenarios. Source terms associated with hypothetical core-melt accidents S 2 CD and TLB in a French PWR -900 MWe- have been performed using French computer codes (in particular, JERICHO Code for containment response analysis and AEROSOLS/31 for aerosol behavior in the containment)
From Notebook to Novel and from Diary to Dante: Reading Robert Dessaix’s Night Letters
Directory of Open Access Journals (Sweden)
Roberta Trapè
2009-06-01
Full Text Available This paper has developed out of a larger work in progress, which focuses on representations of Italy in contemporary Australian fiction and non-fiction prose. This larger project aims to add to an established body of work on travel writing by considering Australian texts that describe Australian travel in Italy, Italian people and Italian places. In this paper, I will specifically focus on the representations of Italy in Robert Dessaix’s novel Night Letters (1996. My paper will explore the relationship between the writer’s actual journey in Italy and that of the creative work’s main character. The novel offers the protagonist’s account in the form of letters, which describe his travel from Switzerland across Northern Italy to Venice. I will begin by briefly outlining the Italian itinerary followed by Dessaix that would eventually inspire the novel. I will then explore the relationship between Dessaix’s notebooks recording his two journeys in Italy and the literary accomplishment of Night Letters. My aim is to show ways in which an itinerary becomes a story, a complex narrative. Reference will be made to factual accounts and descriptions in the author’s own diaries with an analysis of their generative role as key sources for the fictional work. This will be done through a close reading of particular passages, in the diaries and in the novel, concerning the same event. A comparative analysis of the notebooks and Night Letters can show that Dessaix’s diary entries relating to Italian places are woven into the fictional fabric of the ‘night letters’ according to a unifying principle.
Izadi, Maryam; Gill, Daljit S; Naini, Farhad B
2010-04-01
To assess the quality of information included in referral letters sent to the orthodontic department at Kingston Hospital, Surrey, UK. Referral letters sent by both general dental practitioners (GDPs) and specialist orthodontists were analysed retrospectively in order to ascertain the percentage meeting the inclusion criteria as suggested by Mossey (2006) and the British Orthodontic Society (2008) for the quality of information included in an ideal orthodontic referral letter. Thirty-five consecutive letters sent between May and September 2005 and 206 letters sent in the same period in 2008 were collected by hand and analysed against the inclusion criteria. The numbers of referral letters received from GDPs, specialist orthodontists, and others sources were also determined. Most of the referrals sent in 2005 and 2008 included 40-50% of the referral inclusion points. This was despite an almost twofold increase in the number of referral letters received from specialist orthodontic practitioners in 2008. The majority of the letters, from both GDPs and specialists, did not include details of the oral hygiene or caries status of the patient, or an indication of their motivation towards treatment. None of the referral letters included a plaque score. The main weaknesses in the quality of information provided in referral letters were that in more than 80% of the letters there was no mention of the patient's medical history and no comment on caries status, the standard of oral hygiene, patient motivation for treatment, or an Index of Orthodontic Treatment Need score. The quality of information included in referral letters sent to Kingston Hospital orthodontic department needs to be improved.
Rene Descartes’ letter to abbot Mersenne. November, 20, 1629. Translation from English
Directory of Open Access Journals (Sweden)
Goncharova Alina Alekseevna
2015-04-01
Full Text Available This letter is of value for lingua-philosophical and linguistic researches. Rene Descartes’ remarks about the first proposal for the universal language are expounded in it. Descartes was considered as a pioneer in linguistic constructions due to these remarks. This letter contains philosopher’s conclusions about the universal language’s grammar and use, as well as project’s implementation obstacles.
Kim, Kyungil; Lee, Chang H; Lee, Yoonhyoung
2012-10-01
We suggest that the linguistic characteristics of letters also need to be considered to fully understand how a reader processes printed words. For example, studies in Korean showed that unambiguity in the assignment of letters to their appropriate onset, vowel, or coda slot is one of the main sources of the letter-transposition effect. Indeed, the cognitive system that processes Korean is tuned to the structure of the Korean writing system.
48 CFR 49.601-2 - Letter notice.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Letter notice. 49.601-2 Section 49.601-2 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION CONTRACT MANAGEMENT... immediate complete spoilage of work-in-process having a definite commercial value, or (D) to prevent any...
Kindsvatter, Aaron; Nelson, Jill R.; Desmond, Kimberly J.
2009-01-01
Therapeutic letters (i.e., brief therapeutic messages that are sent to clients between counseling sessions) have been used since the days of Freud and have been shown to have beneficial therapeutic impacts. This article describes the use of therapeutic letters in couples and family counseling. The use of three types of therapeutic letter (letters…
Guldenoglu, Birkan; Miller, Paul; Kargin, Tevhide
2014-01-01
The present study aimed to examine the relationship between letter processing and word processing skills in deaf and hearing readers. The participants were 105 students (51 of them hearing, 54 of them deaf) who were evenly and randomly recruited from two levels of education (primary = 3rd-4th graders; middle = 6th-7th graders). The students were…
Scientific Letter: Self-inflicted bilateral orchidectomy precipitated by ...
African Journals Online (AJOL)
Scientific Letter: Self-inflicted bilateral orchidectomy precipitated by erotic bizarre delusions: a case report. ... African Journal of Psychiatry. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home ...
14 CFR 21.617 - Issue of letters of TSO design approval: import appliances.
2010-01-01
...: import appliances. 21.617 Section 21.617 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION... Order Authorizations § 21.617 Issue of letters of TSO design approval: import appliances. (a) A letter of TSO design approval may be issued for an appliance that is manufactured in a foreign country with...
Resource Letter MP-2: The Manhattan project and related nuclear research
Reed, B. Cameron
2011-02-01
This Resource Letter is a supplement to my earlier Resource Letter MP-1 and provides further sources on the Manhattan Project and related nuclear research. Books and journal articles are cited for the following topics: General works, technical works, biographical and autobiographical works, foreign wartime programs and allied intelligence, technical papers of historical interest, and postwar policy and technical developments. I also give a list of videos and websites dealing with the Manhattan Project, nuclear weapons, and nuclear issues.
Rash, Arjun H; Sheldon, Robert; Donald, Maoliosa; Eronmwon, Cindy; Kuriachan, Vikas P
2018-03-05
Effective communication between the consultants and physicians form an integral foundation of effective and expert patient care. A broad review of the literature has not been undertaken to determine the components of a consultant's letter of most value to the referring physician. We aimed to identify the components of a consultant's letter preferred by referring physicians. We searched Embase and MEDLINE (OVID) Medicine (EBM) Reviews and Cochrane Database of Systematic Reviews for English articles with no restriction on initial date to January 6, 2017. Articles containing letters from specialists to referring physicians regarding outpatient assessments with either an observational or experimental design were included. Studies were excluded if they pertained to communications from referring physicians to consultant specialists, or pertained to allied health professionals, inpatient documents, or opinion articles. We enumerated the frequencies with which three common themes were addressed, and the positive or negative nature of the comments. The three themes were the structure of consultant letters, their contents, and whether referring physicians and consultants shared a common opinion about the items. Eighteen articles were included in our synthesis. In 11 reports, 91% of respondents preferred structured formats. Other preferred structural features were problem lists and brevity (four reports each). The most preferred contents were oriented to insight: diagnosis, prognosis, and management plan (16/21 mentions in the top tertile). Data items such as history, physical examination, and medication lists were less important (1/23 mentions in the top tertile). Reports varied as to whether referring physicians and consultants shared common opinions about letter features. Referring physicians prefer brief, structured letters from consultants that feature diagnostic and prognostic opinions and management plans over unstructured letters that emphasize data elements such as
Bridges, F Stephen; Anzalone, Debra A; Ryan, Stuart W; Anzalone, Fanancy L
2002-04-01
Two field studies using 1,004 "lost letters" were designed to test the hypotheses that returned responses would be greater in small towns than from a city, that addressees' affiliation with a group either (1) opposed to physical education in schools, (2) supporting gay and lesbian teachers, or (3) advocating Creationism or Darwinism would reduce the return rate. Of 504 letters "lost" in Study A, 163 (32.3%) were returned in the mail from residents of southeast Louisiana and indicated across 3 addressees and 2 sizes of community, addressees' affiLiations were not associated with returned responses. Community size and addressees' affiliations were associated with significantly different rates of return in the city. Return rates from sites within a city were lower when letters were addressed to an organization which opposed (teaching) health education in the schools than to one supporting daily health education. Of 500 letters "lost" in Study B, 95 (19.0%) were returned from residents of northwest Florida and indicated across 5 addressees and 2 sizes of community, addressees' affiliations were significantly associated with returned responses overall (5 addressees) and in small towns (control, Creationism, Darwinism addressees), but not with community size. Community size and addressees' affiliations were associated with significantly different rates of return in small towns, with returns greater than or equal to those in the city (except for the addressee advocating teaching Darwinism in public schools). The present findings appear to show that applications of the lost letter technique to other divisive social issues are useful in assessing public opinion.
Hamlet and Japanese Men of Letters
Directory of Open Access Journals (Sweden)
Kawachi Yoshiko
2016-12-01
Full Text Available Shakespeare has exerted a powerful influence on Japanese literature since he was accepted in the second half of the nineteenth century. Particularly Hamlet has had a strong impact on Japanese men of letters and provided them with the impetus to revive the play in contemporary literature. In this paper I discuss how they have utilized Hamlet for their creative activity and enriched Japanese literature.
"Letter-Space": Typographic Translations of Urban Place
Naismith, Jacqueline; O'Sullivan, Annette
2011-01-01
This article discusses a Bachelor of Design honours year typography project in the medium of letterpress. The "Letter-space" project positioned letterpress as a textual, spatial and structural visual language, through which the experiences and meanings of a local urban place were translated, mapped and given form through typographic design. We…
Readerly and Writerly "Letters from the Park."
Conde, Susana
1993-01-01
Discusses in depth the film "Cartas del parque" ("Letters from the Park"), the first of six films in the "Amores Dificiles" series. Notes that the film is pervaded by the traditional overdetermination of gender roles. Suggests that an intrusive and authoritative narrator makes of this both a "readerly" and a…
Documentary Letters of Credit, Legal Nature and Sources of Law
Directory of Open Access Journals (Sweden)
Alavi Hamed
2016-06-01
Full Text Available There is no doubt about risky nature of international trade. Such risk can be conceptualized as country risk, transportation risk, customer risk and etc. Documentary Letters of Credit (LC are used as a method of payment in international business for many centuries in order to reduce risk of trade specially when parties are located in different countries and do not have precise information from financial standing of each other. In such occasion LC will reduce the risk of trade by shifting payment obligation from buyer as an individual to a payment guarantee of a bank as a legal entity in return for presentation of complying documents with terms of credit by seller. Familiarity with legal nature and different legal frameworks which govern the international operation of documentary letters of credit can facilitate the process of international trade for businessmen and boost national economies. However, lack of knowledge about them can impose huge losses on international traders. Situation will be more complicated when we understand that there are many internationally recognized legal frameworks which can affect the operation of LC and they get frequently updated in order to address technological and economic developments in global market. In this paper, author tries to answer questions regarding (i what are international legal frameworks governing operation of documentary letters of credit? (ii which areas of LC operation has been covered by them and (iii how do they address the legal questions regarding international operation of documentary letters of credit?
Two different groups of signal sequence in M-superfamily conotoxins.
Wang, Qi; Jiang, Hui; Han, Yu-Hong; Yuan, Duo-Duo; Chi, Cheng-Wu
2008-04-01
M-superfamily conotoxins can be divided into four branches (M-1, M-2, M-3 and M-4) according to the number of amino acid residues in the third Cys loop. In general, it is widely accepted that the conotoxin signal peptides of each superfamily are strictly conserved. Recently, we cloned six cDNAs of novel M-superfamily conotoxins from Conus leopardus, Conus marmoreus and Conus quercinus, belonging to either M-1 or M-3 branch. These conotoxins, judging from the putative peptide sequences deducted from cDNAs, are rich in acidic residues and share highly conserved signal and pro-peptide region. However, they are quite different from the reported conotoxins of M-2 and M-4 branches even in their signal peptides, which in general are considered highly conserved for each superfamily of conotoxins. The signal sequences of M-1 and M-3 conotoxins composed of 24 residues start with MLKMGVVL-, while those of M-2 and M-4 conotoxins composed of 25 residues start with MMSKLGVL-. It is another example that different types of signal peptides can exist within a superfamily besides the I-conotoxin superfamily. In addition to the different disulfide connectivity of M-1 conotoxins from that of M-4 or M-2 conotoxins, the sequence alignment, preferential Cys codon usage and phylogenetic tree analysis suggest that M-1 and M-3 conotoxins have much closer relationship, being different from the conotoxins of other two branches (M-4 and M-2) of M-superfamily.
International Nuclear Information System (INIS)
2001-01-01
The present collection of letters from JINR, Dubna, contains eight separate records on the interaction of high energy Λ 6 He hypernuclear beams with atomic nuclei, the position-sensitive detector of a high spatial resolution on the basis of a multiwire gas electron multiplier, pseudorapidity hadron density at the LHC energy, high precision laser control of the ATLAS tile-calorimeter module mass production at JINR, a new approach to ECG's features recognition involving neural network, subcriticity of a uranium target enriched in 235 U, beam space charge effects in high-current cyclotron injector CI-5, a homogeneous static gravitational field and the principle of equivalence
Directory of Open Access Journals (Sweden)
Vicente Jara Vera
2017-07-01
Full Text Available The wooden carving of Our Lady of Candelaria, discovered in the municipality of the same name on the island of Tenerife (Canary Islands during the first half of the fifteenth century, had nearly two hundred letters of the Latin alphabet inscribed on her garments. Unfortunately the original carving disappeared after the storm that took place in 1826. Once the original letters on the first image were discovered by means of analysing both textual and artistic documentation and sources, we conclude that the text is archaic-Berber language used by the islanders, Insular-Amazigh, which no longer exists in the present day. Having discussed lexical, morphological, syntactic and phonetic aspects of this archaic language, as well as conducted a semantic analysis of the carving both from the native aboriginal perspective and the Christian one, we expound here our proposal of the meaning of the letters engraved on the Marian carving of Candelaria from its lexical voices and roots of their Berber and Insular-Amazigh languages, with the previous proposed solutions.
Adoption of Telecommuting in Two California State Agencies
Mokhtarian, Patricia L.; Salomon, Ilan; Saxena, Somitra; Sampath, Srikanth; Cheung, Peter; Le, Kate; Bagley, Michael
1996-01-01
This paper presents results from the field test of a survey designed to collect data on the individual decision to telecommute. The field test was conducted primarily to assess whether a cover letter from the employer would induce a response bias. The survey was administered with two cover letters to the Sacramento-based Franchise Tax Board (FTB) and the San Francisco-based Public Utilities Commission (PUC). The cover letter type had a small (insignificant) impact on the response rate, but...
Letters from Augustin Hallerstein, an eighteenth century Jesuit astronomer in Beijing
Juznic, Stanislav
2008-11-01
Augustin Hallerstein (1703-1774) was the last astronomer sent to Beijing by the Society of Jesus. He left Europe for China in his mid-thirties, and continued to send letters back home until he died thirty-five years later. These letters and reports contained important information on Chinese astronomy, and were read in the courts of Europe; many were also published. Hallerstein was one of the most important European astronomers in Beijing, his European publications surpassing those of his predecessors.
Directory of Open Access Journals (Sweden)
Gojko Žarić
Full Text Available The acquisition of letter-speech sound associations is one of the basic requirements for fluent reading acquisition and its failure may contribute to reading difficulties in developmental dyslexia. Here we investigated event-related potential (ERP measures of letter-speech sound integration in 9-year-old typical and dyslexic readers and specifically test their relation to individual differences in reading fluency. We employed an audiovisual oddball paradigm in typical readers (n = 20, dysfluent (n = 18 and severely dysfluent (n = 18 dyslexic children. In one auditory and two audiovisual conditions the Dutch spoken vowels/a/and/o/were presented as standard and deviant stimuli. In audiovisual blocks, the letter 'a' was presented either simultaneously (AV0, or 200 ms before (AV200 vowel sound onset. Across the three children groups, vowel deviancy in auditory blocks elicited comparable mismatch negativity (MMN and late negativity (LN responses. In typical readers, both audiovisual conditions (AV0 and AV200 led to enhanced MMN and LN amplitudes. In both dyslexic groups, the audiovisual LN effects were mildly reduced. Most interestingly, individual differences in reading fluency were correlated with MMN latency in the AV0 condition. A further analysis revealed that this effect was driven by a short-lived MMN effect encompassing only the N1 window in severely dysfluent dyslexics versus a longer MMN effect encompassing both the N1 and P2 windows in the other two groups. Our results confirm and extend previous findings in dyslexic children by demonstrating a deficient pattern of letter-speech sound integration depending on the level of reading dysfluency. These findings underscore the importance of considering individual differences across the entire spectrum of reading skills in addition to group differences between typical and dyslexic readers.
Two sequence motifs from HIF-1α bind to the DNA-binding site of p53
Hansson, Lars O.; Friedler, Assaf; Freund, Stefan; Rüdiger, Stefan; Fersht, Alan R.
2002-01-01
There is evidence that hypoxia-inducible factor-1α (HIF-1α) interacts with the tumor suppressor p53. To characterize the putative interaction, we mapped the binding of the core domain of p53 (p53c) to an array of immobilized HIF-1α-derived peptides and found two peptide-sequence motifs that bound to p53c with micromolar affinity in solution. One sequence was adjacent to and the other coincided with the two proline residues of the oxygen-dependent degradation domain (P402 and P564) that act as...
Directory of Open Access Journals (Sweden)
Danilo Licastro
Full Text Available Usher syndrome (USH is a clinically and genetically heterogeneous disorder characterized by visual and hearing impairments. Clinically, it is subdivided into three subclasses with nine genes identified so far. In the present study, we investigated whether the currently available Next Generation Sequencing (NGS technologies are already suitable for molecular diagnostics of USH. We analyzed a total of 12 patients, most of which were negative for previously described mutations in known USH genes upon primer extension-based microarray genotyping. We enriched the NGS template either by whole exome capture or by Long-PCR of the known USH genes. The main NGS sequencing platforms were used: SOLiD for whole exome sequencing, Illumina (Genome Analyzer II and Roche 454 (GS FLX for the Long-PCR sequencing. Long-PCR targeting was more efficient with up to 94% of USH gene regions displaying an overall coverage higher than 25×, whereas whole exome sequencing yielded a similar coverage for only 50% of those regions. Overall this integrated analysis led to the identification of 11 novel sequence variations in USH genes (2 homozygous and 9 heterozygous out of 18 detected. However, at least two cases were not genetically solved. Our result highlights the current limitations in the diagnostic use of NGS for USH patients. The limit for whole exome sequencing is linked to the need of a strong coverage and to the correct interpretation of sequence variations with a non obvious, pathogenic role, whereas the targeted approach suffers from the high genetic heterogeneity of USH that may be also caused by the presence of additional causative genes yet to be identified.
Licastro, Danilo; Mutarelli, Margherita; Peluso, Ivana; Neveling, Kornelia; Wieskamp, Nienke; Rispoli, Rossella; Vozzi, Diego; Athanasakis, Emmanouil; D'Eustacchio, Angela; Pizzo, Mariateresa; D'Amico, Francesca; Ziviello, Carmela; Simonelli, Francesca; Fabretto, Antonella; Scheffer, Hans; Gasparini, Paolo; Banfi, Sandro; Nigro, Vincenzo
2012-01-01
Usher syndrome (USH) is a clinically and genetically heterogeneous disorder characterized by visual and hearing impairments. Clinically, it is subdivided into three subclasses with nine genes identified so far. In the present study, we investigated whether the currently available Next Generation Sequencing (NGS) technologies are already suitable for molecular diagnostics of USH. We analyzed a total of 12 patients, most of which were negative for previously described mutations in known USH genes upon primer extension-based microarray genotyping. We enriched the NGS template either by whole exome capture or by Long-PCR of the known USH genes. The main NGS sequencing platforms were used: SOLiD for whole exome sequencing, Illumina (Genome Analyzer II) and Roche 454 (GS FLX) for the Long-PCR sequencing. Long-PCR targeting was more efficient with up to 94% of USH gene regions displaying an overall coverage higher than 25×, whereas whole exome sequencing yielded a similar coverage for only 50% of those regions. Overall this integrated analysis led to the identification of 11 novel sequence variations in USH genes (2 homozygous and 9 heterozygous) out of 18 detected. However, at least two cases were not genetically solved. Our result highlights the current limitations in the diagnostic use of NGS for USH patients. The limit for whole exome sequencing is linked to the need of a strong coverage and to the correct interpretation of sequence variations with a non obvious, pathogenic role, whereas the targeted approach suffers from the high genetic heterogeneity of USH that may be also caused by the presence of additional causative genes yet to be identified. PMID:22952768
The Quasi-Business Letter: Passport to Foreign Culture.
Lalande, John F.
1979-01-01
Suggests having foreign language students write business letters to stimulate interest in developing writing skills. This project gives the students the opportunity of travelling abroad vicariously and to collect souvenirs while improving their communication skills in the foreign language. (CFM)
Boulter, Rhonda
2009-06-01
The primary objective of the Australia Post eLetter project 1 was to determine the feasibility of using the eLetter service with the Patient Administration System Appointment Scheduling Module to provide a fully automated mailing function that would eliminate the need for manual processing of mail delivery. Issues with timely delivery of letters throughout all outpatient sites at the Royal Hobart Hospital (RHH) have been identified as being mainly due to limited human resources being available to perform mailing duties and the like. This new desktop service enables staff to transmit data electronically in conjunction with the appointment software for large quantity mail postings to Australia Post via a secure line. Australia Post then validates the address, appends a barcode, prints the letter, envelopes it and inserts it into the mail distribution network in the state of the recipient. This article depicts the process that has eliminated the manual processing of a letter via the traditional Microsoft application, Wordmate, a system at RHH that was always difficult to use. With the introduction of eLetter, the RHH's Specialist Clinics have significantly improved the timeliness and quality of communication with patients as well as reducing administration tasks for staff.
What can we learn from learning models about sensitivity to letter-order in visual word recognition?
Lerner, Itamar; Armstrong, Blair C.; Frost, Ram
2014-01-01
Recent research on the effects of letter transposition in Indo-European Languages has shown that readers are surprisingly tolerant of these manipulations in a range of tasks. This evidence has motivated the development of new computational models of reading that regard flexibility in positional coding to be a core and universal principle of the reading process. Here we argue that such approach does not capture cross-linguistic differences in transposed-letter effects, nor do they explain them. To address this issue, we investigated how a simple domain-general connectionist architecture performs in tasks such as letter-transposition and letter substitution when it had learned to process words in the context of different linguistic environments. The results show that in spite of of the neurobiological noise involved in registering letter-position in all languages, flexibility and inflexibility in coding letter order is also shaped by the statistical orthographic properties of words in a language, such as the relative prevalence of anagrams. Our learning model also generated novel predictions for targeted empirical research, demonstrating a clear advantage of learning models for studying visual word recognition. PMID:25431521