WorldWideScience

Sample records for two-electrode voltage-clamp method

  1. Application of active electrode compensation to perform continuous voltage-clamp recordings with sharp microelectrodes.

    Science.gov (United States)

    Gómez-González, J F; Destexhe, A; Bal, T

    2014-10-01

    Electrophysiological recordings of single neurons in brain tissues are very common in neuroscience. Glass microelectrodes filled with an electrolyte are used to impale the cell membrane in order to record the membrane potential or to inject current. Their high resistance induces a high voltage drop when passing current and it is essential to correct the voltage measurements. In particular, for voltage clamping, the traditional alternatives are two-electrode voltage-clamp technique or discontinuous single electrode voltage-clamp (dSEVC). Nevertheless, it is generally difficult to impale two electrodes in a same neuron and the switching frequency is limited to low frequencies in the case of dSEVC. We present a novel fully computer-implemented alternative to perform continuous voltage-clamp recordings with a single sharp-electrode. To reach such voltage-clamp recordings, we combine an active electrode compensation algorithm (AEC) with a digital controller (AECVC). We applied two types of control-systems: a linear controller (proportional plus integrative controller) and a model-based controller (optimal control). We compared the performance of the two methods to dSEVC using a dynamic model cell and experiments in brain slices. The AECVC method provides an entirely digital method to perform continuous recording and smooth switching between voltage-clamp, current clamp or dynamic-clamp configurations without introducing artifacts.

  2. Characterization of heterologously expressed transporter genes by patch- and voltage-clamp methods: Application to cyclic nucleotide-dependent responses

    KAUST Repository

    Lemtiri-Chlieh, Fouad

    2013-09-03

    The application of patch- and voltage-clamp methods to study ion transport can be limited by many hurdles: the size of the cells to be patched and/or stabbed, the subcellular localization of the molecule of interest, and its density of expression that could be too low even in their own native environment. Functional expression of genes using recombinant DNA technology not only overcomes those hurdles but also affords additional and elegant investigations such as single-point mutation studies and subunit associations/regulations. In this chapter, we give a step-by-step description of two electrophysiological methods, patch clamp and two-electrode voltage clamp (TEVC), that are routinely used in combination with heterologous gene expression to assist researchers interested in the identification and characterization of ion transporters. We describe how to (1) obtain and maintain the cells suitable for the use with each of the above-mentioned methods (i.e., HEK-293 cells and yeast spheroplasts to use with the patch-clamp methodology and Xenopus laevis oocytes with TEVC), (2) transfect/inject them with the gene of interest, and (3) record ion transport activities. © Springer Science+Business Media New York 2013.

  3. Characterization of heterologously expressed transporter genes by patch- and voltage-clamp methods: Application to cyclic nucleotide-dependent responses

    KAUST Repository

    Lemtiri-Chlieh, Fouad; Ali, Rashid Ayesha

    2013-01-01

    The application of patch- and voltage-clamp methods to study ion transport can be limited by many hurdles: the size of the cells to be patched and/or stabbed, the subcellular localization of the molecule of interest, and its density of expression that could be too low even in their own native environment. Functional expression of genes using recombinant DNA technology not only overcomes those hurdles but also affords additional and elegant investigations such as single-point mutation studies and subunit associations/regulations. In this chapter, we give a step-by-step description of two electrophysiological methods, patch clamp and two-electrode voltage clamp (TEVC), that are routinely used in combination with heterologous gene expression to assist researchers interested in the identification and characterization of ion transporters. We describe how to (1) obtain and maintain the cells suitable for the use with each of the above-mentioned methods (i.e., HEK-293 cells and yeast spheroplasts to use with the patch-clamp methodology and Xenopus laevis oocytes with TEVC), (2) transfect/inject them with the gene of interest, and (3) record ion transport activities. © Springer Science+Business Media New York 2013.

  4. Suppression of Spiral Waves by Voltage Clamp Techniques in a Conductance-Based Cardiac Tissue Model

    International Nuclear Information System (INIS)

    Lian-Chun, Yu; Guo-Yong, Zhang; Yong, Chen; Jun, Ma

    2008-01-01

    A new control method is proposed to control the spatio-temporal dynamics in excitable media, which is described by the Morris–Lecar cells model. It is confirmed that successful suppression of spiral waves can be obtained by spatially clamping the membrane voltage of the excitable cells. The low voltage clamping induces breakup of spiral waves and the fragments are soon absorbed by low voltage obstacles, whereas the high voltage clamping generates travel waves that annihilate spiral waves through collision with them. However, each method has its shortcomings. Furthermore, a two-step method that combines both low and high voltage clamp techniques is then presented as a possible way of out this predicament. (cross-disciplinary physics and related areas of science and technology)

  5. An equivalent network representation of a clamped bimorph piezoelectric micromachined ultrasonic transducer with circular and annular electrodes using matrix manipulation techniques.

    Science.gov (United States)

    Sammoura, Firas; Smyth, Katherine; Kim, Sang-Gook

    2013-09-01

    An electric circuit model for a clamped circular bimorph piezoelectric micromachined ultrasonic transducer (pMUT) was developed for the first time. The pMUT consisted of two piezoelectric layers sandwiched between three thin electrodes. The top and bottom electrodes were separated into central and annular electrodes by a small gap. While the middle electrode was grounded, the central and annular electrodes were biased with two independent voltage sources. The strain mismatch between the piezoelectric layers caused the plate to vibrate and transmit a pressure wave, whereas the received echo generated electric charges resulting from plate deformation. The clamped pMUT plate was separated into a circular and an annular plate, and the respective electromechanical transformation matrices were derived. The force and velocity vectors were properly selected using Hamilton's principle and the necessary boundary conditions were invoked. The electromechanical transformation matrix for the clamped circular pMUT was deduced using simple matrix manipulation techniques. The pMUT performance under three biasing schemes was elaborated: 1) central electrode only, 2) central and annular electrodes with voltages of the same magnitude and polarity, and 3) central and annular electrodes with voltages of the same magnitude and opposite polarity. The circuit parameters of the pMUT were extracted for each biasing scheme, including the transformer ratio, the clamped electric impedance, and the open-circuit mechanical impedance. Each pMUT scheme was characterized under different acoustic loadings using the theoretically developed model, which was verified with finite element modeling (FEM) simulation. The electrode size was optimized to maximize the electromechanical transformer ratio. As such, the developed model could provide more insight into the design, optimization, and characterization of pMUTs and allow for performance comparison with their cMUT counterparts.

  6. A low-voltage sense amplifier with two-stage operational amplifier clamping for flash memory

    Science.gov (United States)

    Guo, Jiarong

    2017-04-01

    A low-voltage sense amplifier with reference current generator utilizing two-stage operational amplifier clamp structure for flash memory is presented in this paper, capable of operating with minimum supply voltage at 1 V. A new reference current generation circuit composed of a reference cell and a two-stage operational amplifier clamping the drain pole of the reference cell is used to generate the reference current, which avoids the threshold limitation caused by current mirror transistor in the traditional sense amplifier. A novel reference voltage generation circuit using dummy bit-line structure without pull-down current is also adopted, which not only improves the sense window enhancing read precision but also saves power consumption. The sense amplifier was implemented in a flash realized in 90 nm flash technology. Experimental results show the access time is 14.7 ns with power supply of 1.2 V and slow corner at 125 °C. Project supported by the National Natural Science Fundation of China (No. 61376028).

  7. Voltage Balancing Control of Diode-Clamped Multilevel Inverter

    Directory of Open Access Journals (Sweden)

    ŞCHIOP Adrian

    2013-10-01

    Full Text Available In this paper is developed a control scheme for mono-phase diode clamped inverter to achieve balancing voltages on inverter capacitors. First, it develops a control scheme without taking into account the need to balance voltage on two capacitors. It examines the effects on the output voltage inverter, and then it realizes two control schemes that will balance the voltages. The simulations of control schemes were performed in OrCAD Pspice.

  8. Artifactual voltage response recorded from hair cells with patch-clamp amplifiers.

    Science.gov (United States)

    Masetto, S; Weng, T; Valli, P; Correia, M J

    1999-06-23

    Patch-clamp amplifiers (PCAs) are commonly used to characterize voltage- and current-clamp responses in the same cell. However, the cell membrane voltage response can be severely distorted by PCAs working in the current-clamp mode. Here we compare the voltage response of pigeon semicircular canal hair cells in situ, recorded with two different PCAs, and with a classic microelectrode bridge amplifier (BA). We found that the voltage response of hair cells recorded with PCAs differed significantly from that recorded with the BA. The true hair cell membrane voltage response to positive current steps was characterized by a strongly damped oscillation, whose frequency and duration depended on hair cell location in the sensory crista ampullaris.

  9. Limitations of the dual voltage clamp method in assaying conductance and kinetics of gap junction channels

    NARCIS (Netherlands)

    Wilders, R.; Jongsma, H. J.

    1992-01-01

    The electrical properties of gap junctions in cell pairs are usually studied by means of the dual voltage clamp method. The voltage across the junctional channels, however, cannot be controlled adequately due to an artificial resistance and a natural resistance, both connected in series with the gap

  10. Common voltage eliminating of SVM diode clamping three-level inverter connected to grid

    DEFF Research Database (Denmark)

    Guo, Yougui; Zeng, Ping; Zhu, Jieqiong

    2011-01-01

    A novel method of common voltage eliminating is put forward for SVM diode clamping three-level inverter connected to grid by calculation of common voltage of its various switching states. PLECS is used to model this three-level inverter connected to grid and good results are obtained. First...... analysis of common mode voltage for switching states of diode clamping 3-level inverter is given in detail. Second the common mode voltage eliminating control strategy of SVM is described for diode clamping three-level inverter. Third, PLECS is briefly introduced. Fourth, the modeling of diode clamping...... three-level inverter is presented with PLECS. Finally, a series of simulations are carried out. The simulation results tell us PLECS is a very powerful tool to real power circuits modeling. They have also verified that proposed common mode voltage eliminating control strategy of SVM is feasible...

  11. Voltage clamp methods for the study of membrane currents and SR Ca2+ release in adult skeletal muscle fibres

    Science.gov (United States)

    Hernández-Ochoa, Erick O.; Schneider, Martin F.

    2012-01-01

    Skeletal muscle excitation-contraction (E-C)1 coupling is a process composed of multiple sequential stages, by which an action potential triggers sarcoplasmic reticulum (SR)2 Ca2+ release and subsequent contractile activation. The various steps in the E-C coupling process in skeletal muscle can be studied using different techniques. The simultaneous recordings of sarcolemmal electrical signals and the accompanying elevation in myoplasmic Ca2+, due to depolarization-initiated SR Ca2+ release in skeletal muscle fibres, have been useful to obtain a better understanding of muscle function. In studying the origin and mechanism of voltage dependency of E-C coupling a variety of different techniques have been used to control the voltage in adult skeletal fibres. Pioneering work in muscles isolated from amphibians or crustaceans used microelectrodes or ‘high resistance gap’ techniques to manipulate the voltage in the muscle fibres. The development of the patch clamp technique and its variant, the whole-cell clamp configuration that facilitates the manipulation of the intracellular environment, allowed the use of the voltage clamp techniques in different cell types, including skeletal muscle fibres. The aim of this article is to present an historical perspective of the voltage clamp methods used to study skeletal muscle E-C coupling as well as to describe the current status of using the whole-cell patch clamp technique in studies in which the electrical and Ca2+ signalling properties of mouse skeletal muscle membranes are being investigated. PMID:22306655

  12. Investigation of the Dynamics of a Clamped-Clamped Microbeam Near the Third Mode Using a Partial Electrode

    KAUST Repository

    Masri, Karim M.

    2014-08-17

    We present an investigation of the dynamics of a clamped-clamped microbeam excited electrostatically near its third mode. To maximize the response at the third mode, a partial electrode configuration is utilized. A multi-mode Galerkin method is used to develop a reduced order model (ROM) of the beam. A shooting method to find the periodic motion is utilized to generate frequency response curves. The curves show hardenining behavior and dynamic pull-in. We show that the dynamic amplitude of the partial configuration is higher than that of a full electrode configuration. These results are promising for the use of higher-order modes for mass detection and for ultra sensitive resonant sensors.

  13. Investigation of the Dynamics of a Clamped-Clamped Microbeam Near the Third Mode Using a Partial Electrode

    KAUST Repository

    Masri, Karim M.; Younis, Mohammad I.

    2014-01-01

    We present an investigation of the dynamics of a clamped-clamped microbeam excited electrostatically near its third mode. To maximize the response at the third mode, a partial electrode configuration is utilized. A multi-mode Galerkin method is used to develop a reduced order model (ROM) of the beam. A shooting method to find the periodic motion is utilized to generate frequency response curves. The curves show hardenining behavior and dynamic pull-in. We show that the dynamic amplitude of the partial configuration is higher than that of a full electrode configuration. These results are promising for the use of higher-order modes for mass detection and for ultra sensitive resonant sensors.

  14. Limitations of the dual voltage clamp method in assaying conductance and kinetics of gap junction channels

    OpenAIRE

    Wilders, R.; Jongsma, H.J.

    1992-01-01

    The electrical properties of gap junctions in cell pairs are usually studied by means of the dual voltage clamp method. The voltage across the junctional channels, however, cannot be controlled adequately due to an artificial resistance and a natural resistance, both connected in series with the gap junction. The access resistances to the cell interior of the recording pipettes make up the artificial resistance. The natural resistance consists of the cytoplasmic access resistances to the tigh...

  15. An accurate online calibration system based on combined clamp-shape coil for high voltage electronic current transformers

    International Nuclear Information System (INIS)

    Li, Zhen-hua; Li, Hong-bin; Zhang, Zhi

    2013-01-01

    Electronic transformers are widely used in power systems because of their wide bandwidth and good transient performance. However, as an emerging technology, the failure rate of electronic transformers is higher than that of traditional transformers. As a result, the calibration period needs to be shortened. Traditional calibration methods require the power of transmission line be cut off, which results in complicated operation and power off loss. This paper proposes an online calibration system which can calibrate electronic current transformers without power off. In this work, the high accuracy standard current transformer and online operation method are the key techniques. Based on the clamp-shape iron-core coil and clamp-shape air-core coil, a combined clamp-shape coil is designed as the standard current transformer. By analyzing the output characteristics of the two coils, the combined clamp-shape coil can achieve verification of the accuracy. So the accuracy of the online calibration system can be guaranteed. Moreover, by employing the earth potential working method and using two insulating rods to connect the combined clamp-shape coil to the high voltage bus, the operation becomes simple and safe. Tests in China National Center for High Voltage Measurement and field experiments show that the proposed system has a high accuracy of up to 0.05 class

  16. An accurate online calibration system based on combined clamp-shape coil for high voltage electronic current transformers.

    Science.gov (United States)

    Li, Zhen-hua; Li, Hong-bin; Zhang, Zhi

    2013-07-01

    Electronic transformers are widely used in power systems because of their wide bandwidth and good transient performance. However, as an emerging technology, the failure rate of electronic transformers is higher than that of traditional transformers. As a result, the calibration period needs to be shortened. Traditional calibration methods require the power of transmission line be cut off, which results in complicated operation and power off loss. This paper proposes an online calibration system which can calibrate electronic current transformers without power off. In this work, the high accuracy standard current transformer and online operation method are the key techniques. Based on the clamp-shape iron-core coil and clamp-shape air-core coil, a combined clamp-shape coil is designed as the standard current transformer. By analyzing the output characteristics of the two coils, the combined clamp-shape coil can achieve verification of the accuracy. So the accuracy of the online calibration system can be guaranteed. Moreover, by employing the earth potential working method and using two insulating rods to connect the combined clamp-shape coil to the high voltage bus, the operation becomes simple and safe. Tests in China National Center for High Voltage Measurement and field experiments show that the proposed system has a high accuracy of up to 0.05 class.

  17. Effects of trimethoprim-sulfadiazine and detomidine on the function of equine Kv 11.1 channels in a two-electrode voltage-clamp (TEVC) oocyte model.

    Science.gov (United States)

    Trachsel, D S; Tejada, M A; Groesfjeld Christensen, V; Pedersen, P J; Kanters, J K; Buhl, R; Calloe, K; Klaerke, D A

    2018-03-22

    The long QT syndrome (LQTS) is a channelopathy that can lead to severe arrhythmia and sudden cardiac death. Pharmacologically induced LQTS is caused by interaction between drugs and potassium channels, especially the K v 11.1 channel. Due to such interactions, numerous drugs have been withdrawn from the market or are administered with precautions in human medicine. However, some compounds, such as trimethoprim-sulfonamide combinations are still widely used in veterinarian medicine. Therefore, we investigate the effect of trimethoprim-sulfadiazine (TMS), trimethoprim, sulfadiazine, and detomidine on equine-specific K v 11.1 channels. K v 11.1 channels cloned from equine hearts were heterologously expressed in Xenopus laevis oocytes, and whole cell currents were measured by two-electrode voltage-clamp before and after drug application. TMS blocked equine K v 11.1 current with an IC 50 of 3.74 mm (95% CI: 2.95-4.73 mm) and affected the kinetics of activation and inactivation. Similar was found for trimethoprim but not for sulfadiazine, suggesting the effect is due to trimethoprim. Detomidine did not affect equine K v 11.1 current. Thus, equine K v 11.1 channels are also susceptible to pharmacological block, indicating that some drugs may have the potential to affect repolarization in horse. However, in vivo studies are needed to assess the potential risk of these drugs to induce equine LQTS. © 2018 The Authors. Journal of Veterinary Pharmacology and Therapeutics Published by John Wiley & Sons Ltd.

  18. A DC-Link Voltage Self-Balance Method for a Diode-Clamped Modular Multilevel Converter With Minimum Number of Voltage Sensors

    DEFF Research Database (Denmark)

    Gao, Congzhe; Jiang, Xinjian; Li, Yongdong

    2013-01-01

    Voltage balance issue of dc-link capacitors is very important for applications of a cascade multilevel converter or a modular multilevel converter. In this paper, a novel diode-clamped modular multilevel converter (DCM2C) topology is proposed and a power feedback control method is developed...... used traditional method; therefore, the system performance improvement and cost reduction are expected. Based on the proposed DCM2C, a novel N +1-level cascade multilevel topology is proposed for a cascade active power filter (CS-APF). The simulation and experimental results from the CS-APF have...

  19. A new method for analyzing and design of guard electrodes of high voltage insulators chain

    International Nuclear Information System (INIS)

    Vahidi, B.; Mohammad Zadeh, A.

    2002-01-01

    The main aim of this paper is analyzing design of guard electrodes of high voltage insulators chain. These electrodes are used for making the distribution of uniform potential across the insulators chain, reducing leakage current and preventing the degradation of insulators. If the design is not correct or in the case of insulators chain without guard electrodes, the potential distribution will not uniform. Thus the voltage drops on the insulators adjacent to conductors will be more than maximum voltage that can be tolerated by the insulators. Therefore these voltage drops can damage the insulators. In this paper A new method is introduced for analyzing and design of ga urad electrodes of high voltage insulators chain

  20. Finite element analysis on factors influencing the clamping force in an electrostatic chuck

    International Nuclear Information System (INIS)

    Wang Xingkuo; Yang Yiyong; Cheng Jia; Wang Kesheng; Sun Yuchun; Cao Minglu; Ji Linhong

    2014-01-01

    As one of the core components of IC manufacturing equipment, the electrostatic chuck (ESC) has been widely applied in semiconductor processing such as etching, PVD and CVD. The clamping force of the ESC is one of the most important technical indicators. A multi-physics simulation software COMSOL is used to analyze the factors influencing the clamping force. The curves between the clamping force and the main parameters such as DC voltage, electrode thickness, electrode radius, dielectric thickness and helium gap are obtained. Moreover, the effects of these factors on the clamping force are investigated by means of orthogonal experiments. The results show that the factors can be ranked in order of voltage, electrode radius, helium gap and dielectric thickness according to their importance, which may offer certain reference for the design of ESCs. (semiconductor devices)

  1. Accurate measurement of junctional conductance between electrically coupled cells with dual whole-cell voltage-clamp under conditions of high series resistance.

    Science.gov (United States)

    Hartveit, Espen; Veruki, Margaret Lin

    2010-03-15

    Accurate measurement of the junctional conductance (G(j)) between electrically coupled cells can provide important information about the functional properties of coupling. With the development of tight-seal, whole-cell recording, it became possible to use dual, single-electrode voltage-clamp recording from pairs of small cells to measure G(j). Experiments that require reduced perturbation of the intracellular environment can be performed with high-resistance pipettes or the perforated-patch technique, but an accompanying increase in series resistance (R(s)) compromises voltage-clamp control and reduces the accuracy of G(j) measurements. Here, we present a detailed analysis of methodologies available for accurate determination of steady-state G(j) and related parameters under conditions of high R(s), using continuous or discontinuous single-electrode voltage-clamp (CSEVC or DSEVC) amplifiers to quantify the parameters of different equivalent electrical circuit model cells. Both types of amplifiers can provide accurate measurements of G(j), with errors less than 5% for a wide range of R(s) and G(j) values. However, CSEVC amplifiers need to be combined with R(s)-compensation or mathematical correction for the effects of nonzero R(s) and finite membrane resistance (R(m)). R(s)-compensation is difficult for higher values of R(s) and leads to instability that can damage the recorded cells. Mathematical correction for R(s) and R(m) yields highly accurate results, but depends on accurate estimates of R(s) throughout an experiment. DSEVC amplifiers display very accurate measurements over a larger range of R(s) values than CSEVC amplifiers and have the advantage that knowledge of R(s) is unnecessary, suggesting that they are preferable for long-duration experiments and/or recordings with high R(s). Copyright (c) 2009 Elsevier B.V. All rights reserved.

  2. Potassium Chloride Versus Voltage Clamp Contractures in Ventricular Muscle

    Science.gov (United States)

    Morad, M.; Reeck, S.; Rao, M.

    1981-01-01

    In frog ventricle, developed tension was markedly larger in response to depolarization caused by a voltage clamp step than to depolarization induced by high concentrations of potassium chloride. Measurement of extracellular potassium activity at the surface and at the depth of muscle during the development of contractures showed that the diffusion of potassium is much slower than the spread of depolarization through the cross section of muscle. These two observations suggest that competition between the depolarizing and the negative inotropic effects of an increase in the extracellular potassium ion concentration may determine the time course and magnitude of contractile tension in heart muscle.

  3. New Modulation Strategy to Balance the Neutral-Point Voltage for Three-Level Neutral-Clamped Inverter Systems

    DEFF Research Database (Denmark)

    Choi, Uimin; Lee, June-Seok; Lee, Kyo-Beum

    2014-01-01

    This paper proposes a new modulation strategy that balances the neutral-point voltage for three-level neutral-clamped inverter systems. The proposed modulation replaces the P-type or N-type small switching states with other switching states that do not affect the neutral-point voltage. The zero...... and medium switching states are employed to help the neutral-point voltage balancing. This method little bit increases the switching events and output total harmonic distortion. However, this method has a strong balancing ability at all regions. Further, it is very simple to implement in both space vector...

  4. A Microbeam Resonator with Partial Electrodes for Logic and Memory Elements

    KAUST Repository

    Hafiz, Md Abdullah Al

    2017-11-10

    We demonstrate logic and memory elements based on an in-plane clamped-clamped microbeam resonator. The micro-resonator is electrostatically actuated through a drive electrode and the motional signal is capacitively sensed at a sense electrode, while the resonance characteristics are modulated by DC voltage pulses provided at two separate partial electrodes, independent of the drive/sense electrodes. For the logic applications, we use two separate electrodes to provide DC voltages defined as the logic inputs. The high (low) motional signal at on-resonance (off-resonance) state is defined as the logic output state “1” (“0”). For the memory operation, two stable vibrational states, high and low, within the hysteretic regime are defined as the memory states, “1” and “0”, respectively. We take advantage of the split electrode configuration to provide positive and negative DC voltage pulses selectively to set/reset the memory states (“1”/“0”) without affecting the driving and sensing terminals. Excluding the energy cost for supporting electronics, these devices consume energy in 10’s of picojoules per logic/memory operations. Furthermore, the devices are fabricated using silicon on insulator (SOI) wafers, have the potential for on-chip integration, and operate at moderate pressure (~1 Torr) and room temperature.

  5. A Microbeam Resonator with Partial Electrodes for Logic and Memory Elements

    KAUST Repository

    Hafiz, Md Abdullah Al; Ilyas, Saad; Ahmed, Sally; Younis, Mohammad I.; Fariborzi, Hossein

    2017-01-01

    We demonstrate logic and memory elements based on an in-plane clamped-clamped microbeam resonator. The micro-resonator is electrostatically actuated through a drive electrode and the motional signal is capacitively sensed at a sense electrode, while the resonance characteristics are modulated by DC voltage pulses provided at two separate partial electrodes, independent of the drive/sense electrodes. For the logic applications, we use two separate electrodes to provide DC voltages defined as the logic inputs. The high (low) motional signal at on-resonance (off-resonance) state is defined as the logic output state “1” (“0”). For the memory operation, two stable vibrational states, high and low, within the hysteretic regime are defined as the memory states, “1” and “0”, respectively. We take advantage of the split electrode configuration to provide positive and negative DC voltage pulses selectively to set/reset the memory states (“1”/“0”) without affecting the driving and sensing terminals. Excluding the energy cost for supporting electronics, these devices consume energy in 10’s of picojoules per logic/memory operations. Furthermore, the devices are fabricated using silicon on insulator (SOI) wafers, have the potential for on-chip integration, and operate at moderate pressure (~1 Torr) and room temperature.

  6. Evaluation of Niobium as Candidate Electrode Material for DC High Voltage Photoelectron Guns

    Science.gov (United States)

    BastaniNejad, M.; Mohamed, Abdullah; Elmustafa, A. A.; Adderley, P.; Clark, J.; Covert, S.; Hansknecht, J.; Hernandez-Garcia, C.; Poelker, M.; Mammei, R.; hide

    2012-01-01

    The field emission characteristics of niobium electrodes were compared to those of stainless steel electrodes using a DC high voltage field emission test apparatus. A total of eight electrodes were evaluated: two 304 stainless steel electrodes polished to mirror-like finish with diamond grit and six niobium electrodes (two single-crystal, two large-grain, and two fine-grain) that were chemically polished using a buffered-chemical acid solution. Upon the first application of high voltage, the best large-grain and single-crystal niobium electrodes performed better than the best stainless steel electrodes, exhibiting less field emission at comparable voltage and field strength. In all cases, field emission from electrodes (stainless steel and/or niobium) could be significantly reduced and sometimes completely eliminated, by introducing krypton gas into the vacuum chamber while the electrode was biased at high voltage. Of all the electrodes tested, a large-grain niobium electrode performed the best, exhibiting no measurable field emission (< 10 pA) at 225 kV with 20 mm cathode/anode gap, corresponding to a field strength of 18:7 MV/m.

  7. High Operating Voltage Supercapacitor Using PPy/AC Composite Electrode Based on Simple Dipping Method

    Directory of Open Access Journals (Sweden)

    Kyoungho Kim

    2015-01-01

    Full Text Available As various wearable devices are emerging, self-generated power sources, such as piezoelectric generators, triboelectric generators, and thermoelectric generators, are of interest. To adapt self-generated power sources for application devices, a supercapacitor is necessary because of the short generation times (1–10 ms and low generated power (1–100 μW of self-generated power sources. However, to date, supercapacitors are too large to be adapted for wearable devices. There have been many efforts to reduce the size of supercapacitors by using polypyrrole (PPy for high energy supercapacitor electrodes. However, these supercapacitors have several disadvantages, such as a low operating voltage due to the use of an aqueous electrolyte, and complex manufacturing methods, such as the hydrogel and aerosol methods. In particular, the low operating voltage (~1.0 V is a significant issue because most electronic components operate above 3.0 V. In this study, we successfully demonstrated the high operating voltage (3.0 V of a supercapacitor using a PPy/activated carbon (AC composite electrode based on the chemical polymerization of the PPy by simple dipping. In addition, a twofold enhancement of its energy density was achieved compared with conventional supercapacitors using AC electrodes.

  8. Dual patch voltage clamp study of low membrane resistance astrocytes in situ.

    Science.gov (United States)

    Ma, Baofeng; Xu, Guangjin; Wang, Wei; Enyeart, John J; Zhou, Min

    2014-03-17

    Whole-cell patch clamp recording has been successfully used in identifying the voltage-dependent gating and conductance properties of ion channels in a variety of cells. However, this powerful technique is of limited value in studying low membrane resistance cells, such as astrocytes in situ, because of the inability to control or accurately measure the real amplitude of command voltages. To facilitate the study of ionic conductances of astrocytes, we have developed a dual patch recording method which permits membrane current and membrane potential to be simultaneously recorded from astrocytes in spite of their extraordinarily low membrane resistance. The utility of this technique is demonstrated by measuring the voltage-dependent activation of the inwardly rectifying K+ current abundantly expressed in astrocytes and multiple ionic events associated with astrocytic GABAA receptor activation. This protocol can be performed routinely in the study of astrocytes. This method will be valuable for identifying and characterizing the individual ion channels that orchestrate the electrical activity of low membrane resistance cells.

  9. Simple hardware implementation of voltage balancing in capacitor-clamped inverter

    Czech Academy of Sciences Publication Activity Database

    Kokeš, Petr; Semerád, Radko

    2009-01-01

    Roč. 54, č. 4 (2009), s. 325-341 ISSN 0001-7043 R&D Projects: GA MPO FT-TA4/077 Institutional research plan: CEZ:AV0Z20570509 Keywords : capacitor -clamped multilevel inverter * flying capacitor voltage balancing * pulse width modulation (PWM) Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering

  10. Evaluation of niobium as candidate electrode material for dc high voltage photoelectron guns

    Directory of Open Access Journals (Sweden)

    M. BastaniNejad

    2012-08-01

    Full Text Available The field emission characteristics of niobium electrodes were compared to those of stainless steel electrodes using a DC high voltage field emission test apparatus. A total of eight electrodes were evaluated: two 304 stainless steel electrodes polished to mirrorlike finish with diamond grit and six niobium electrodes (two single-crystal, two large-grain, and two fine-grain that were chemically polished using a buffered-chemical acid solution. Upon the first application of high voltage, the best large-grain and single-crystal niobium electrodes performed better than the best stainless steel electrodes, exhibiting less field emission at comparable voltage and field strength. In all cases, field emission from electrodes (stainless steel and/or niobium could be significantly reduced and sometimes completely eliminated, by introducing krypton gas into the vacuum chamber while the electrode was biased at high voltage. Of all the electrodes tested, a large-grain niobium electrode performed the best, exhibiting no measurable field emission (<10  pA at 225 kV with 20 mm cathode/anode gap, corresponding to a field strength of 18.7  MV/m.

  11. Effects of Electrode Material on the Voltage of a Tree-Based Energy Generator.

    Science.gov (United States)

    Hao, Zhibin; Wang, Guozhu; Li, Wenbin; Zhang, Junguo; Kan, Jiangming

    2015-01-01

    The voltage between a standing tree and its surrounding soil is regarded as an innovative renewable energy source. This source is expected to provide a new power generation system for the low-power electrical equipment used in forestry. However, the voltage is weak, which has caused great difficulty in application. Consequently, the development of a method to increase the voltage is a key issue that must be addressed in this area of applied research. As the front-end component for energy harvesting, a metal electrode has a material effect on the level and stability of the voltage obtained. This study aimed to preliminarily ascertain the rules and mechanisms that underlie the effects of electrode material on voltage. Electrodes of different materials were used to measure the tree-source voltage, and the data were employed in a comparative analysis. The results indicate that the conductivity of the metal electrode significantly affects the contact resistance of the electrode-soil and electrode-trunk contact surfaces, thereby influencing the voltage level. The metal reactivity of the electrode has no significant effect on the voltage. However, passivation of the electrode materials markedly reduces the voltage. Suitable electrode materials are demonstrated and recommended.

  12. Effects of Electrode Material on the Voltage of a Tree-Based Energy Generator.

    Directory of Open Access Journals (Sweden)

    Zhibin Hao

    Full Text Available The voltage between a standing tree and its surrounding soil is regarded as an innovative renewable energy source. This source is expected to provide a new power generation system for the low-power electrical equipment used in forestry. However, the voltage is weak, which has caused great difficulty in application. Consequently, the development of a method to increase the voltage is a key issue that must be addressed in this area of applied research. As the front-end component for energy harvesting, a metal electrode has a material effect on the level and stability of the voltage obtained. This study aimed to preliminarily ascertain the rules and mechanisms that underlie the effects of electrode material on voltage. Electrodes of different materials were used to measure the tree-source voltage, and the data were employed in a comparative analysis. The results indicate that the conductivity of the metal electrode significantly affects the contact resistance of the electrode-soil and electrode-trunk contact surfaces, thereby influencing the voltage level. The metal reactivity of the electrode has no significant effect on the voltage. However, passivation of the electrode materials markedly reduces the voltage. Suitable electrode materials are demonstrated and recommended.

  13. The Anion Paradox in Sodium Taste Reception: Resolution by Voltage-Clamp Studies

    Science.gov (United States)

    Ye, Qing; Heck, Gerard L.; Desimone, John A.

    1991-11-01

    Sodium salts are potent taste stimuli, but their effectiveness is markedly dependent on the anion, with chloride yielding the greatest response. The cellular mechanisms that mediate this phenomenon are not known. This "anion paradox" has been resolved by considering the field potential that is generated by restricted electrodiffusion of the anion through paracellular shunts between taste-bud cells. Neural responses to sodium chloride, sodium acetate, and sodium gluconate were studied while the field potential was voltage-clamped. Clamping at electronegative values eliminated the anion effect, whereas clamping at electropositive potentials exaggerated it. Thus, field potentials across the lingual epithelium modulate taste reception, indicating that the functional unit of taste reception includes the taste cell and its paracellular microenvironment.

  14. Cell voltage versus electrode potential range in aqueous supercapacitors

    Science.gov (United States)

    Dai, Zengxin; Peng, Chuang; Chae, Jung Hoon; Ng, Kok Chiang; Chen, George Z.

    2015-01-01

    Supercapacitors with aqueous electrolytes and nanostructured composite electrodes are attractive because of their high charging-discharging speed, long cycle life, low environmental impact and wide commercial affordability. However, the energy capacity of aqueous supercapacitors is limited by the electrochemical window of water. In this paper, a recently reported engineering strategy is further developed and demonstrated to correlate the maximum charging voltage of a supercapacitor with the capacitive potential ranges and the capacitance ratio of the two electrodes. Beyond the maximum charging voltage, a supercapacitor may still operate, but at the expense of a reduced cycle life. In addition, it is shown that the supercapacitor performance is strongly affected by the initial and zero charge potentials of the electrodes. Further, the differences are highlighted and elaborated between freshly prepared, aged under open circuit conditions, and cycled electrodes of composites of conducting polymers and carbon nanotubes. The first voltammetric charging-discharging cycle has an electrode conditioning effect to change the electrodes from their initial potentials to the potential of zero voltage, and reduce the irreversibility. PMID:25897670

  15. Five-Level Active-Neutral-Point-Clamped DC/DC Converter for Medium-Voltage DC Grids

    DEFF Research Database (Denmark)

    Liu, Dong; Deng, Fujin; Chen, Zhe

    2017-01-01

    This paper proposes a five-level active-neutralpoint- clamped (5L-ANPC) dc/dc converter for applications in medium voltage dc (MVDC) grids. A modulation strategy is proposed for the 5L-ANPC dc/dc converter to generate multilevel voltage waveforms, which can effectively reduce voltage change rate dv...... effectively eliminate high voltage leaps caused by the dead time effect. In addition, a capacitor voltage control strategy is proposed for the 5L-ANPC dc/dc converter to ensure the balanced flying capacitor voltage and desired five-level voltage waveforms. Finally, simulation and experimental studies...

  16. Balance control strategy of two-amplitude actively clamped resonant DC-Link inverter clamping voltage%双幅有源箝位谐振直流环节逆变器箝位电压平衡控制策略

    Institute of Scientific and Technical Information of China (English)

    陈沁野; 张德华; 侯尧杰

    2012-01-01

    Aiming at the big loss of the traditional clamping voltage balance control strategies, in two-amplitude actively clamped resonant DC-LINK inverter, the work process of DC link was analyzed. In order to keep the clamp capacitor voltage balance the value set in DC-link work, no short-circuit control was proposed.The DC-link of inverter was calculated by Mathcad. The loss of two modes of short-circuit control and no short-circuit control were compared.Under the no short-circuit control and voltage ripple is not be greater than twenty percent, the parameters of the clamp capacitor were calculated. The results indicate that, the micro-power ACRDCLI clamping voltage balance use no short-circuit control,that can reduce the loss of the DC link and can use thin-film capacitor as a clamp capacitor to achieve the micro-power ACRDCLI low loss and iong life requirements.%针对微型功率双幅有源箝位谐振直流环节逆变器在正常工作过程中,传统箝位电压平衡母线短路控制策略带来损耗大的问题,开展了直流环节工作过程的分析,针对直流环节正常工作的情况下,箝位电容电压必须能平衡在设定值,提出了箝位电压平衡母线无短路控制策略,根据给出的损耗估算方法,通过Mathcad计算,对比了母线短路控制和无短路控制两种方式下的损耗,同时计算出了母线无短路控制箝位电容电压纹波不大于20%下的箝位电容参数.研究结果表明:微型功率ACRDCLI箝位电压平衡采用母线无短线控制,不但可以减少双幅有源箝位谐振直流环节逆变器的损耗,并且可以使用薄膜电容作为箝位电容,以达到微型功率ACRDCLI损耗低、寿命长的要求.

  17. Isolated PWM DC-AC SICAM with an active capacitive voltage clamp[Pulse Density Modulated; Pulse Width Modulation

    Energy Technology Data Exchange (ETDEWEB)

    Ljusev, P.

    2004-03-15

    In this report an isolated PWM DC-AC SICAM with an active capacitive voltage clamp is presented. AC-DC power supply is implemented in its simplest form: diode rectifier followed by a medium-size charge-storage capacitors and possibly with an EMC filter on the mains entrance. Isolation from the AC mains is achieved using a high frequency (HF) transformer, whose voltages are not audio-modulated. The latter simplifies the design and is expected to have many advantages over the approach where the transformer voltages are modulated in regards to the audio signal reference. Input stage is built as a DC-AC inverter (push-pull, half-bridge or a full-bridge) and operated with 50% duty cycle, with all the challenges to avoid transformer saturation and obtain symmetrical operation. On the secondary side the output section is implemented as rectifier+inverter AC-AC stage, i.e. a true bidirectional bridge, which operation is aimed towards amplification of the audio signal. In order to solve the problem with the commutation of the load current, a dead time between the incoming and outgoing bidirectional switch is implemented, while a capacitive voltage clamp is used to keep the induced overvoltage to reasonable levels. The energy stored in the clamping capacitor is not wasted as in the dissipative clamps, but is rather transferred back to the primary side for further processing using an auxiliary isolated single-switch converter, i.e. an active clamping technique is used. (au)

  18. Investigating ion channel conformational changes using voltage clamp fluorometry.

    Science.gov (United States)

    Talwar, Sahil; Lynch, Joseph W

    2015-11-01

    Ion channels are membrane proteins whose functions are governed by conformational changes. The widespread distribution of ion channels, coupled with their involvement in most physiological and pathological processes and their importance as therapeutic targets, renders the elucidation of these conformational mechanisms highly compelling from a drug discovery perspective. Thanks to recent advances in structural biology techniques, we now have high-resolution static molecular structures for members of the major ion channel families. However, major questions remain to be resolved about the conformational states that ion channels adopt during activation, drug modulation and desensitization. Patch-clamp electrophysiology has long been used to define ion channel conformational states based on functional criteria. It achieves this by monitoring conformational changes at the channel gate and cannot detect conformational changes occurring in regions distant from the gate. Voltage clamp fluorometry involves labelling cysteines introduced into domains of interest with environmentally sensitive fluorophores and inferring structural rearrangements from voltage or ligand-induced fluorescence changes. Ion channel currents are monitored simultaneously to verify the conformational status. By defining real time conformational changes in domains distant from the gate, this technique provides unexpected new insights into ion channel structure and function. This review aims to summarise the methodology and highlight recent innovative applications of this powerful technique. This article is part of the Special Issue entitled 'Fluorescent Tools in Neuropharmacology'. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Novel high-voltage power lateral MOSFET with adaptive buried electrodes

    International Nuclear Information System (INIS)

    Zhang Wen-Tong; Wu Li-Juan; Qiao Ming; Luo Xiao-Rong; Zhang Bo; Li Zhao-Ji

    2012-01-01

    A new high-voltage and low-specific on-resistance (R on,sp ) adaptive buried electrode (ABE) silicon-on-insulator (SOI) power lateral MOSFET and its analytical model of the electric fields are proposed. The MOSFET features are that the electrodes are in the buried oxide (BOX) layer, the negative drain voltage V d is divided into many partial voltages and the output to the electrodes is in the buried oxide layer and the potentials on the electrodes change linearly from the drain to the source. Because the interface silicon layer potentials are lower than the neighboring electrode potentials, the electronic potential wells are formed above the electrode regions, and the hole potential wells are formed in the spacing of two neighbouring electrode regions. The interface hole concentration is much higher than the electron concentration through designing the buried layer electrode potentials. Based on the interface charge enhanced dielectric layer field theory, the electric field strength in the buried layer is enhanced. The vertical electric field E I and the breakdown voltage (BV) of ABE SOI are 545 V/μm and −587 V in the 50 μm long drift region and the 1 μm thick dielectric layer, and a low R on,sp is obtained. Furthermore, the structure also alleviates the self-heating effect (SHE). The analytical model matches the simulation results. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  20. High voltage and high specific capacity dual intercalating electrode Li-ion batteries

    Science.gov (United States)

    West, William C. (Inventor); Blanco, Mario (Inventor)

    2010-01-01

    The present invention provides high capacity and high voltage Li-ion batteries that have a carbonaceous cathode and a nonaqueous electrolyte solution comprising LiF salt and an anion receptor that binds the fluoride ion. The batteries can comprise dual intercalating electrode Li ion batteries. Methods of the present invention use a cathode and electrode pair, wherein each of the electrodes reversibly intercalate ions provided by a LiF salt to make a high voltage and high specific capacity dual intercalating electrode Li-ion battery. The present methods and systems provide high-capacity batteries particularly useful in powering devices where minimizing battery mass is important.

  1. Monitoring voltage-sensitive membrane impedance change using radio frequency interrogation.

    Science.gov (United States)

    Dharia, Sameera; Rabbitt, Richard D

    2010-01-01

    Here we present a new technique to monitor dynamic conformational changes in voltage-sensitive membrane-bound proteins using radio frequency (RF) impedance measurements. Xenopus oocytes were transfected to express ShakerB-IR K(+) ion channels, and step changes in membrane potential were applied using two-electrode voltage clamp (TEVC). Simultaneously, bipolar extracellular electrodes were used to measure the RF electrical impedance across the cell (300 kHz - 1 MHz). RF current will either pass through the media, around the cell, or displace charge across the cell membrane. The change in displacement current in the cell membrane during voltage clamp resulted in measurable RF impedance change. RF impedance change during DC membrane depolarization was significantly greater in ShakerB-IR expressing oocytes than in endogenous controls at 300 kHz, 500 kHz and, to a lesser extent, 1 MHz. Since the RF were too high to modulate ShakerB-IR protein conformational state (e.g. open channel probability), impedance changes are interpreted as reflections of voltage-dependent protein conformation and associated biophysics such as ion-channel dipole interactions, fluctuations in bound water, or charged lipid head-group rotations.

  2. Quantitative analysis of dual whole-cell voltage-clamp determination of gap junctional conductance

    NARCIS (Netherlands)

    van Rijen, H. V.; Wilders, R.; van Ginneken, A. C.; Jongsma, H. J.

    1998-01-01

    The dual whole-cell voltage-clamp technique is used widely for determination of kinetics and conductance of gap junctions. The use of this technique may, however, occasion to considerable errors. We have analysed the errors in steady state junctional conductance measurements under different

  3. Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

    Science.gov (United States)

    White, William E.

    2013-01-01

    Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

  4. Cold-electrode voltage fall for impulse arcs in argon between copper electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Diaz, O; Cooray, V, E-mail: oscar.diaz@angstrom.uu.se [Lightning Research Group, Division for Electricity, Uppsala University Angstroemlaboratoriet Box 5234, 751 20, Uppsala (Sweden)

    2011-06-23

    The full electric arc discharge in gases for short gaps in homogeneous electric field and pressure{center_dot}distance (pd) below 150 Torr{center_dot}cm, can be described as a transition between different discharge mechanisms such as: Townsend, glow, and arc. Once the arc is achieved the measured voltage drops to some volts and the current density increases several orders of magnitude. Depending upon the type of gas used, the electrode surface characteristics and type of electrical excitation, the cathode and anode voltage fall might change. The present work is directed to study the electrode fall (sum of anode and cathode falls) during a current impulse arc discharge between copper electrodes in ceramic tubes filled with argon between 0.01 and 6.5 Torr{center_dot}cm. The copper electrodes were cleaned, degassed and hydrogen reduced. The arc voltages were measured with fast/slow rise times and short/long duration current impulses produced by a RLC circuit. An increasing variation of the electrode fall was found at the pressure{center_dot}distance range analyzed.

  5. Overmodulation of n-level three-leg DC-AC diode-clamped converters with comprehensive capacitor voltage balance

    DEFF Research Database (Denmark)

    Busquets-Monge, S.; Maheshwari, Ram Krishan; Munk-Nielsen, Stig

    2013-01-01

    This paper presents a novel PWM strategy for nlevel three-leg semiconductor-clamped dc-ac converters in the overmodulation region, with dc-link capacitor voltage balance in every switching cycle. The strategy is based on the virtual-vector concept. Suitable reference vector trajectories are selec......This paper presents a novel PWM strategy for nlevel three-leg semiconductor-clamped dc-ac converters in the overmodulation region, with dc-link capacitor voltage balance in every switching cycle. The strategy is based on the virtual-vector concept. Suitable reference vector trajectories...

  6. A self-strain feedback tuning-fork-shaped ionic polymer metal composite clamping actuator with soft matter elasticity-detecting capability for biomedical applications.

    Science.gov (United States)

    Feng, Guo-Hua; Huang, Wei-Lun

    2014-12-01

    This paper presents a smart tuning-fork-shaped ionic polymer metal composite (IPMC) clamping actuator for biomedical applications. The two fingers of the actuator, which perform the clamping motion, can be electrically controlled through a unique electrode design on the IPMC material. The generated displacement or strain of the fingers can be sensed using an integrated soft strain-gage sensor. The IPMC actuator and associated soft strain gage were fabricated using a micromachining technique. A 13.5×4×2 mm(3) actuator was shaped from Nafion solution and a selectively grown metal electrode formed the active region. The strain gage consisted of patterned copper foil and polyethylene as a substrate. The relationship between the strain gage voltage output and the displacement at the front end of the actuator's fingers was characterized. The equivalent Young's modulus, 13.65 MPa, of the soft-strain-gage-integrated IPMC finger was analyzed. The produced clamping force exhibited a linear increasing rate of 1.07 mN/s, based on a dc driving voltage of 7 V. Using the developed actuator to clamp soft matter and simultaneously acquire its Young's modulus was achieved. This demonstrated the feasibility of the palpation function and the potential use of the actuator in minimally invasive surgery. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Observation of electrostatically released DNA from gold electrodes with controlled threshold voltages.

    Science.gov (United States)

    Takeishi, Shunsaku; Rant, Ulrich; Fujiwara, Tsuyoshi; Buchholz, Karin; Usuki, Tatsuya; Arinaga, Kenji; Takemoto, Kazuya; Yamaguchi, Yoshitaka; Tornow, Marc; Fujita, Shozo; Abstreiter, Gerhard; Yokoyama, Naoki

    2004-03-22

    DNA oligo-nucleotides, localized at Au metal electrodes in aqueous solution, are found to be released when applying a negative bias voltage to the electrode. The release was confirmed by monitoring the intensity of the fluorescence of cyanine dyes (Cy3) linked to the 5' end of the DNA. The threshold voltage of the release changes depending on the kind of linker added to the DNA 3'-terminal. The amount of released DNA depends on the duration of the voltage pulse. Using this technique, we can retain DNA at Au electrodes or Au needles, and release the desired amount of DNA at a precise location in a target. The results suggest that DNA injection into living cells is possible with this method. (c) 2004 American Institute of Physics

  8. Methods for Specific Electrode Resistance Measurement during Transcranial Direct Current Stimulation

    Science.gov (United States)

    Khadka, Niranjan; Rahman, Asif; Sarantos, Chris; Truong, Dennis Q.; Bikson, Marom

    2014-01-01

    Background Transcranial Direct Current Stimulation (tDCS) is investigated to treat a wide range of neuropsychiatric disorders, for rehabilitation, and for enhancing cognitive performance. The monitoring of electrode resistance before and during tDCS is considered important for tolerability and safety, where an unusually high resistance is indicative of undesired electrode or poor skin contact conditions. Conventional resistance measurement methods do not isolate individual electrode resistance but rather measures overall voltage. Moreover, for HD-tDCS devices, cross talk across electrodes makes concurrent resistance monitoring unreliable. Objective We propose a novel method for monitoring of the individual electrode resistance during tDCS, using a super-position of direct current with a test-signal (low-intensity and low-frequency sinusoids with electrode– specific frequencies) and a single sentinel electrode (not used for DC). Methods To validate this methodology, we developed lumped-parameter models of two and multi-electrode tDCS. Approaches with and without a sentinel electrode were solved and underlying assumptions identified. Assumptions were tested and parameterized in healthy participants using forearm stimulation combining tDCS (2 mA) and sinusoidal test-signals (38 μA and 76 μA peak to peak at 1 Hz, 10 Hz, and 100 Hz) and an in vitro test (where varied electrode failure modes were created). DC and AC component voltages across the electrodes were compared and participants were asked to rate subjective pain. Results A sentinel electrode is required to isolate electrode resistance in a two-electrode tDCS system. For multi-electrode resistance tracking, cross talk was aggravated with electrode proximity and current/resistance mismatches, but could be corrected using proposed approaches. Average voltage and average pain scores were not significantly different across test current intensities and frequencies (two-way repeated measures ANOVA) indicating the

  9. Comparison between symmetrical and asymmetrical single phase multilevel inverter with diode-clamped topology

    DEFF Research Database (Denmark)

    Blaabjerg, Frede; Nami, A.; Zare, F.

    2008-01-01

    In this paper, a different configuration based on different DC bus voltage for a diode-clamped multilevel inverter has been presented. Two different symmetrical and asymmetrical arrangements of a four-level diode clamped inverters have been compared, in order to find an optimum arrangement...... compared with the conventional four-level inverter and this will lead to the reduction of harmonic content of output voltage. A predictive current control technique has been carried out to verify the viability of new configuration. The advantages of this control method are simplicity and applicability...

  10. Equivalent circuit of frog atrial tissue as determined by voltage clamp-unclamp experiments.

    Science.gov (United States)

    Tarr, M; Trank, J

    1971-11-01

    The equivalent circuit that has been used in the analysis of nerve voltage-clamp data is that of the membrane capacity in parallel with the membrane resistance. Voltage-clamp experiments on frog atrial tissue indicate that this circuit will not suffice for this cardiac tissue. The change in membrane current associated with a step change in membrane potential does not show a rapid spike of capacitive current as would be expected for the simple parallel resistance-capacitance network. Rather, there is a step change in current followed by an exponential decay in current with a time constant of about 1 msec. This relatively slow capacitive charging current suggests that there is a resistance in series with the membrane capacity. A possible equivalent circuit is that of a series resistance external to the parallel resistance-capacitance network of the cell membranes. Another possible circuit assumes that the series resistance is an integral part of the cell membrane. The data presented in this paper demonstrate that the equivalent circuit of a bundle of frog atrial muscle is that of an external resistance in series with the cell membranes.

  11. TiN coated aluminum electrodes for DC high voltage electron guns

    International Nuclear Information System (INIS)

    Mamun, Md Abdullah A.; Elmustafa, Abdelmageed A.; Taus, Rhys; Forman, Eric; Poelker, Matthew

    2015-01-01

    Preparing electrodes made of metals like stainless steel, for use inside DC high voltage electron guns, is a labor-intensive and time-consuming process. In this paper, the authors report the exceptional high voltage performance of aluminum electrodes coated with hard titanium nitride (TiN). The aluminum electrodes were comparatively easy to manufacture and required only hours of mechanical polishing using silicon carbide paper, prior to coating with TiN by a commercial vendor. The high voltage performance of three TiN-coated aluminum electrodes, before and after gas conditioning with helium, was compared to that of bare aluminum electrodes, and electrodes manufactured from titanium alloy (Ti-6Al-4V). Following gas conditioning, each TiN-coated aluminum electrode reached −225 kV bias voltage while generating less than 100 pA of field emission (<10 pA) using a 40 mm cathode/anode gap, corresponding to field strength of 13.7 MV/m. Smaller gaps were studied to evaluate electrode performance at higher field strength with the best performing TiN-coated aluminum electrode reaching ∼22.5 MV/m with field emission less than 100 pA. These results were comparable to those obtained from our best-performing electrodes manufactured from stainless steel, titanium alloy and niobium, as reported in references cited below. The TiN coating provided a very smooth surface and with mechanical properties of the coating (hardness and modulus) superior to those of stainless steel, titanium-alloy, and niobium electrodes. These features likely contributed to the improved high voltage performance of the TiN-coated aluminum electrodes

  12. Voltage-Sharing Converter to Supply Single-Phase Asymmetrical Four-Level Diode-Clamped Inverter With High Power Factor Loads

    DEFF Research Database (Denmark)

    Boora, Arash A.; Nami, Alireza; Zare, Firuz

    2010-01-01

    The output voltage quality of some of the single-phase multilevel inverters can be improved when their dc-link voltages are regulated asymmetrically. Symmetrical and asymmetrical multilevel diode-clamped inverters have the problem of dc-link capacitor voltage balancing, especially when power factor...... that the proposed combination of introduced multioutput dc–dc converter and single-phase ADCI is a good candidate for power conversion in residential photovoltaic (PV) utilization....

  13. A Component-Reduced Zero-Voltage Switching Three-Level DC-DC Converter

    DEFF Research Database (Denmark)

    Qin, Zian; Pang, Ying; Wang, Huai

    2016-01-01

    The basic Zero-Voltage Switching (ZVS) three-level DC-DC converter has one clamping capacitor to realize the ZVS of the switches, and two clamping diodes to clamp the voltage of the clamping capacitor. In order to reduce the reverse recovery loss of the diode as well as its cost, this paper...... proposes to remove one of the clamping diodes in basic ZVS three-level DC-DC converter. With less components, the proposed converter can still have a stable clamping capacitor voltage, which is clamped at half of the dc link voltage. Moreover, the ZVS performance will be influenced by removing the clamping...

  14. Direct-conversion switching-mode audio power amplifier with active capacitive voltage clamp

    Energy Technology Data Exchange (ETDEWEB)

    Ljusev, P.; Andersen, Michael A.E.

    2005-07-01

    This paper discusses the advantages and problems when implementing direct energy conversion switching-mode audio power amplifiers. It is shown that the total integration of the power supply and Class D audio power amplifier into one compact direct converter can simplify design, increase efficiency and integration level, reduce product volume and lower its cost. As an example, the principle of operation and the measurements made on a direct-conversion switching-mode audio power amplifier with active capacitive voltage clamp are presented. (au)

  15. Direct-conversion switching-mode audio power amplifier with active capacitive voltage clamp

    DEFF Research Database (Denmark)

    Ljusev, Petar; Andersen, Michael Andreas E.

    2005-01-01

    This paper discusses the advantages and problems when implementing direct energy conversion switching-mode audio power amplifiers. It is shown that the total integration of the power supply and Class D audio power amplifier into one compact direct converter can simplify the design, increase...... efficiency, reduce the product volume and lower its cost. As an example, the principle of operation and the measurements made on a direct-conversion switching-mode audio power amplifier with active capacitive voltage clamp are presented....

  16. Pulsed voltage electrospray ion source and method for preventing analyte electrolysis

    Science.gov (United States)

    Kertesz, Vilmos [Knoxville, TN; Van Berkel, Gary [Clinton, TN

    2011-12-27

    An electrospray ion source and method of operation includes the application of pulsed voltage to prevent electrolysis of analytes with a low electrochemical potential. The electrospray ion source can include an emitter, a counter electrode, and a power supply. The emitter can include a liquid conduit, a primary working electrode having a liquid contacting surface, and a spray tip, where the liquid conduit and the working electrode are in liquid communication. The counter electrode can be proximate to, but separated from, the spray tip. The power system can supply voltage to the working electrode in the form of a pulse wave, where the pulse wave oscillates between at least an energized voltage and a relaxation voltage. The relaxation duration of the relaxation voltage can range from 1 millisecond to 35 milliseconds. The pulse duration of the energized voltage can be less than 1 millisecond and the frequency of the pulse wave can range from 30 to 800 Hz.

  17. Control Strategy of Two Capacitor Voltages for Separate MPPTs in Photovoltaic Systems Using Neutral-Point-Clamped Inverters

    DEFF Research Database (Denmark)

    Choi, Ui-Min; Blaabjerg, Frede; Lee, Kyo-Beum

    2015-01-01

    The centralized topology with three-level inverters are widely used in photovoltaic (PV) systems due to their less installation costs and complexity. However, the common maximum power point tracking (MPPT) is a disadvantage of the centralized topology particularly under the partial shading...... and panel mismatch conditions. In this system, if PV modules are separately connected to the split capacitor voltage, the MPPT efficiency can be improved by the proposed control strategy. By the proposed method, the two capacitor voltages can be controlled asymmetrically to perform the separate MPPTs...... of each PV module connected to separate capacitors. The outputs can be generated without distortion even if two capacitors are asymmetrically regulated. Simulation and experimental results verify the validity and feasibility of the proposed methods....

  18. Implementation of a fast 16-Bit dynamic clamp using LabVIEW-RT.

    Science.gov (United States)

    Kullmann, Paul H M; Wheeler, Diek W; Beacom, Joshua; Horn, John P

    2004-01-01

    The dynamic-clamp method provides a powerful electrophysiological tool for creating virtual ionic conductances in living cells and studying their influence on membrane potential. Here we describe G-clamp, a new way to implement a dynamic clamp using the real-time version of the Lab-VIEW programming environment together with a Windows host, an embedded microprocessor that runs a real-time operating system and a multifunction data-acquisition board. The software includes descriptions of a fast voltage-dependent sodium conductance, delayed rectifier, M-type and A-type potassium conductances, and a leak conductance. The system can also read synaptic conductance waveforms from preassembled data files. These virtual conductances can be reliably implemented at speeds < or =43 kHz while simultaneously saving two channels of data with 16-bit precision. G-clamp also includes utilities for measuring current-voltage relations, synaptic strength, and synaptic gain. Taking an approach built on a commercially available software/hardware platform has resulted in a system that is easy to assemble and upgrade. In addition, the graphical programming structure of LabVIEW should make it relatively easy for others to adapt G-clamp for new experimental applications.

  19. Closed-form solution for static pull-in voltage of electrostatically actuated clamped-clamped micro/nano beams under the effect of fringing field and van der Waals force

    Science.gov (United States)

    Bhojawala, V. M.; Vakharia, D. P.

    2017-12-01

    This investigation provides an accurate prediction of static pull-in voltage for clamped-clamped micro/nano beams based on distributed model. The Euler-Bernoulli beam theory is used adapting geometric non-linearity of beam, internal (residual) stress, van der Waals force, distributed electrostatic force and fringing field effects for deriving governing differential equation. The Galerkin discretisation method is used to make reduced-order model of the governing differential equation. A regime plot is presented in the current work for determining the number of modes required in reduced-order model to obtain completely converged pull-in voltage for micro/nano beams. A closed-form relation is developed based on the relationship obtained from curve fitting of pull-in instability plots and subsequent non-linear regression for the proposed relation. The output of regression analysis provides Chi-square (χ 2) tolerance value equals to 1  ×  10-9, adjusted R-square value equals to 0.999 29 and P-value equals to zero, these statistical parameters indicate the convergence of non-linear fit, accuracy of fitted data and significance of the proposed model respectively. The closed-form equation is validated using available data of experimental and numerical results. The relative maximum error of 4.08% in comparison to several available experimental and numerical data proves the reliability of the proposed closed-form equation.

  20. Monitoring Voltage-Dependent Charge Displacement of Shaker B-IR K+ Ion Channels Using Radio Frequency Interrogation

    OpenAIRE

    Dharia, Sameera; Rabbitt, Richard D.

    2011-01-01

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...

  1. Frequency-domain analysis of intrinsic neuronal properties using high-resistant electrodes

    Directory of Open Access Journals (Sweden)

    Christian Rössert

    2009-08-01

    Full Text Available Intrinsic cellular properties of neurons in culture or slices are usually studied by the whole cell clamp method using low-resistant patch pipettes. These electrodes allow detailed analyses with standard electrophysiological methods such as current- or voltage-clamp. However, in these preparations large parts of the network and dendritic structures may be removed, thus preventing an adequate study of synaptic signal processing. Therefore, intact in vivo preparations or isolated in vitro whole brains have been used in which intracellular recordings are usually made with sharp, high-resistant electrodes to optimize the impalement of neurons. The general non-linear resistance properties of these electrodes, however, severely limit accurate quantitative studies of membrane dynamics especially needed for precise modelling. Therefore, we have developed a frequency-domain analysis of membrane properties that uses a Piece-wise Non-linear Electrode Compensation (PNEC method. The technique was tested in second-order vestibular neurons and abducens motoneurons of isolated frog whole brain preparations using sharp potassium chloride- or potassium acetate-filled electrodes. All recordings were performed without online electrode compensation. The properties of each electrode were determined separately after the neuronal recordings and were used in the frequency-domain analysis of the combined measurement of electrode and cell. This allowed detailed analysis of membrane properties in the frequency-domain with high-resistant electrodes and provided quantitative data that can be further used to model channel kinetics. Thus, sharp electrodes can be used for the characterization of intrinsic properties and synaptic inputs of neurons in intact brains.

  2. Technique eliminates high voltage arcing at electrode-insulator contact area

    Science.gov (United States)

    Mealy, G.

    1967-01-01

    Coating the electrode-insulator contact area with silver epoxy conductive paint and forcing the electrode and insulator tightly together into a permanent connection, eliminates electrical arcing in high-voltage electrodes supplying electrical power to vacuum facilities.

  3. High-voltage electrode optimization towards uniform surface treatment by a pulsed volume discharge

    International Nuclear Information System (INIS)

    Ponomarev, A V; Pedos, M S; Scherbinin, S V; Mamontov, Y I; Ponomarev, S V

    2015-01-01

    In this study, the shape and material of the high-voltage electrode of an atmospheric pressure plasma generation system were optimised. The research was performed with the goal of achieving maximum uniformity of plasma treatment of the surface of the low-voltage electrode with a diameter of 100 mm. In order to generate low-temperature plasma with the volume of roughly 1 cubic decimetre, a pulsed volume discharge was used initiated with a corona discharge. The uniformity of the plasma in the region of the low-voltage electrode was assessed using a system for measuring the distribution of discharge current density. The system's low-voltage electrode - collector - was a disc of 100 mm in diameter, the conducting surface of which was divided into 64 radially located segments of equal surface area. The current at each segment was registered by a high-speed measuring system controlled by an ARM™-based 32-bit microcontroller. To facilitate the interpretation of results obtained, a computer program was developed to visualise the results. The program provides a 3D image of the current density distribution on the surface of the low-voltage electrode. Based on the results obtained an optimum shape for a high-voltage electrode was determined. Uniformity of the distribution of discharge current density in relation to distance between electrodes was studied. It was proven that the level of non-uniformity of current density distribution depends on the size of the gap between electrodes. Experiments indicated that it is advantageous to use graphite felt VGN-6 (Russian abbreviation) as the material of the high-voltage electrode's emitting surface. (paper)

  4. Ion peak narrowing by applying additional AC voltage (ripple voltage) to FAIMS extractor electrode.

    Science.gov (United States)

    Pervukhin, Viktor V; Sheven, Dmitriy G

    2010-01-01

    The use of a non-uniform electric field in a high-field asymmetric waveform ion mobility spectrometry (FAIMS) analyzer increases sensitivity but decreases resolution. The application of an additional AC voltage to the extractor electrode ("ripple" voltage, U(ripple)) can overcome this effect, which decreases the FAIMS peak width. In this approach, the diffusion ion loss remains minimal in the non-uniform electric field in the cylindrical part of the device, and all ion losses under U(ripple) occur in a short portion of their path. Application of the ripple voltage to the extractor electrode is twice as efficient as the applying of U(ripple) along the total length of the device. 2010 American Society for Mass Spectrometry. Published by Elsevier Inc. All rights reserved.

  5. High voltage performance of a dc photoemission electron gun with centrifugal barrel-polished electrodes

    Science.gov (United States)

    Hernandez-Garcia, C.; Bullard, D.; Hannon, F.; Wang, Y.; Poelker, M.

    2017-09-01

    The design and fabrication of electrodes for direct current (dc) high voltage photoemission electron guns can significantly influence their performance, most notably in terms of maximum achievable bias voltage. Proper electrostatic design of the triple-point junction shield electrode minimizes the risk of electrical breakdown (arcing) along the insulator-cable plug interface, while the electrode shape is designed to maintain work, we describe a centrifugal barrel-polishing technique commonly used for polishing the interior surface of superconducting radio frequency cavities but implemented here for the first time to polish electrodes for dc high voltage photoguns. The technique reduced polishing time from weeks to hours while providing surface roughness comparable to that obtained with diamond-paste polishing and with unprecedented consistency between different electrode samples. We present electrode design considerations and high voltage conditioning results to 360 kV (˜11 MV/m), comparing barrel-polished electrode performance to that of diamond-paste polished electrodes. Tests were performed using a dc high voltage photogun with an inverted-geometry ceramic insulator design.

  6. Clamping characteristics study on different types of clamping unit

    Energy Technology Data Exchange (ETDEWEB)

    Jiao, Zhiwei; Liu, Haichao; Xie, Pengcheng [College of Mechanical and Electrical Engineering, Beijing University of Chemical Technology, Beijing China 100029 (China); Yang, Weimin [College of Mechanical and Electrical Engineering, Beijing University of Chemical Technology, Beijing China 100029 (China); State Key Laboratory of Organic-Inorganic Composites, Beijing University of Chemical Technology, Beijing China 100029 (China)

    2015-05-22

    Plastic products are becoming more and more widely used in aerospace, IT, digital electronics and many other fields. With the development of technology, the requirement of product precision is getting higher and higher. However, type and working performance of clamping unit play a decisive role in product precision. Clamping characteristics of different types of clamping unit are discussed in this article, which use finite element numerical analysis method through the software ABAQUS to study the clamping uniformity, and detect the clamping force repeatability precision. The result shows that compared with toggled three-platen clamping unit, clamping characteristics of internal circulation two-platen clamping unit are better, for instance, its mold cavity deformation and force that bars and mold parting surface suffered are more uniform, and its clamping uniformity and repeatability precision is also better.

  7. Three Level Diode Clamped Inverter Fed Induction Motor with Dtc-Svm

    OpenAIRE

    V. Ranjith Kumar

    2013-01-01

    This project presents a three-level diode-clamped inverter feeding an asynchronous motor drive with direct torque control (DTC). The control method is based on DTC operating principles. The stator voltage vector reference is computed from the stator flux and torque errors imposed by the flux and torque controllers. This voltage reference is then generated using a diode-clamped inverter, where each phase of the inverter can be implemented using a dc source, which would be available from fuel c...

  8. IMPORTANT: Fluke is recalling Digital Clamp Meters

    CERN Multimedia

    2013-01-01

    Fluke is voluntarily recalling four models of Digital Clamp Meters: Fluke 373, 374, 375 and 376. If you own one of these clamp meters, please stop using it and send it back to Fluke for repair even if you have not experienced problems.   Description of the problem: "The printed circuit assembly may not be properly fastened to the test lead input jack. This may result in inaccurate voltage readings, including a low or no-voltage reading on a circuit energised with a hazardous voltage, presenting a shock, electrocution or thermal burn hazard." To determine if your clamp meter is affected by this recall notice, and for more information, click here.

  9. Higher order modes excitation of electrostatically actuated clamped–clamped microbeams: experimental and analytical investigation

    KAUST Repository

    Jaber, Nizar

    2016-01-06

    © 2016 IOP Publishing Ltd. In this study, we demonstrate analytically and experimentally the excitations of the higher order modes of vibrations in electrostatically actuated clamped-clamped microbeam resonators. The concept is based on using partial electrodes with shapes that induce strong excitation of the mode of interest. The devices are fabricated using polyimide as a structural layer coated with nickel from the top and chrome and gold layers from the bottom. Experimentally, frequency sweeps with different electro-dynamical loading conditions are shown to demonstrate the excitation of the higher order modes of vibration. Using a half electrode, the second mode is excited with high amplitude of vibration compared with almost zero response using the full electrode. Also, using a two-third electrode configuration is shown to amplify the third mode resonance amplitude compared with the full electrode under the same electrical loading conditions. An analytical model is developed based on the Euler-Bernollui beam model and the Galerkin method to simulate the device response. Good agreement between the simulation results and the experimental data is reported.

  10. Characterization of chaotic electroconvection near flat electrodes under oscillatory voltages

    Science.gov (United States)

    Kim, Jeonglae; Davidson, Scott; Mani, Ali

    2017-11-01

    Onset of hydrodynamic instability and chaotic electroconvection in aqueous systems are studied by directly solving the two-dimensional coupled Poisson-Nernst-Planck and Navier-Stokes equations. An aqueous binary electrolyte is bounded by two planar electrodes where time-harmonic voltage is applied at a constant oscillation frequency. The governing equations are solved using a fully-conservative second-order-accurate finite volume discretization and a second-order implicit Euler time advancement. At a sufficiently high amplitude of applied voltage, the system exhibits chaotic behaviors involving strong hydrodynamic mixing and enhanced electroconvection. The system responses are characterized as a function of oscillation frequency, voltage magnitude, and the ratio of diffusivities of two ion species. Our results indicate that electroconvection is most enhanced for frequencies on the order of inverse system RC time scale. We will discuss the dependence of this optimal frequency on the asymmetry of the diffusion coefficients of ionic species. Supported by the Stanford's Precourt Institute.

  11. General Voltage Feedback Circuit Model in the Two-Dimensional Networked Resistive Sensor Array

    Directory of Open Access Journals (Sweden)

    JianFeng Wu

    2015-01-01

    Full Text Available To analyze the feature of the two-dimensional networked resistive sensor array, we firstly proposed a general model of voltage feedback circuits (VFCs such as the voltage feedback non-scanned-electrode circuit, the voltage feedback non-scanned-sampling-electrode circuit, and the voltage feedback non-scanned-sampling-electrode circuit. By analyzing the general model, we then gave a general mathematical expression of the effective equivalent resistor of the element being tested in VFCs. Finally, we evaluated the features of VFCs with simulation and test experiment. The results show that the expression is applicable to analyze the VFCs’ performance of parameters such as the multiplexers’ switch resistors, the nonscanned elements, and array size.

  12. Transformer-based asymmetrical embedded Z-source neutral point clamped inverters with continuous input current and enhanced voltage boost capability

    DEFF Research Database (Denmark)

    Mo, W.; Loh, Poh Chiang; Blaabjerg, Frede

    2013-01-01

    Z-source Neutral Point Clamped (NPC) inverters were introduced to integrate both the advantages of Z-source inverters and NPC inverters. However, traditional Z-source inverters suffer from high voltage stress and chopping input current. This paper proposes six types transformer-based impedance-so......-source NPC inverters which have enhanced voltage boost capability and continuous input current by utilizing of transformer and embedded dc source configuration. Experimental results are presented to verify the theory validation....

  13. Electrical crosstalk in two-port piezoelectric resonators and compensation solutions

    International Nuclear Information System (INIS)

    Qiu, H C; Schwarz, P; Völlm, H; Feili, D; Seidel, H; Wu, X Z

    2013-01-01

    Crosstalk is an impediment to electrically interfaced two-port resonators. The overall output function of two-port piezoelectric resonator is a superposition of the mechanical resonance behavior and electrical crosstalk, the latter coming mainly from the coupling feedthrough capacitance. In this paper, two crosstalk compensation solutions have been developed for an aluminum nitride-based doubly clamped beam resonator. The first solution demonstrates an on-chip self-cancellation technique of the feedthrough capacitance by using a compensation electrode and applying a complementary voltage to it, while the second solution applies an adjustable compensation voltage to the common bottom electrode. A specifically designed compensation-readout circuit is presented. Experimental investigations of the output signal have proved the efficiency of both crosstalk compensation solutions. (paper)

  14. A method and an electrode for excitation of a plasma

    International Nuclear Information System (INIS)

    Glejboel, K.

    1998-01-01

    The method for excitation of a plasma comprises the step of subjecting a gas to an electric field generated by an electrode system. Each of 3 to 30 electrodes are connected to one of three specified AC voltages. The frequency is preferably between 50 and 60 Hz. The invention also concerns an electrode system for carrying out the method. 3 figs

  15. Electrode configuration effects on the electrification and voltage variation in an electrostatic inkjet printing head

    International Nuclear Information System (INIS)

    Choi, Kyung Hyun; Ali, Adnan; Rahman, Ahsan; Malik Mohammad, Nauman; Rahman, Khalid; Khan, Arshad; Khan, Saleem; Kim, D S

    2010-01-01

    The electrode configuration of an electrostatic inkjet printing head is under study. This paper introduces the development of a new electrostatic inkjet head with an improved electrode configuration as compared to the conventional configuration. Two tungsten electrodes, connected in parallel, are inserted into the electrostatic print head at a certain angle from opposite sides. The aim of this double-side inserted angular electrodes (DSIAEs) head is to intensify the electrification of the fluid inside the head at minimum suitable exposure of the electrode, which results in maximizing surface charge density. The main advantage of the DSIAEs head is to get a very stable meniscus at low applied voltage for printing. This stable meniscus is transformed to a very stable jet by increasing the applied voltage. Therefore, printed patterns obtained with this DSIAEs head are more uniform because of a more stable meniscus and jet as compared to a conventional electrostatic vertically inserted single electrode head. Also, with this DSIAEs configuration, the life of the electrostatic inkjet printing head is increased.

  16. A new clamp method for firing bricks | Obeng | Journal of Applied ...

    African Journals Online (AJOL)

    A new clamp method for firing bricks. ... Journal of Applied Science and Technology ... To overcome this operational deficiencies, a new method of firing bricks that uses brick clamp technique that incorporates a clamp wall of 60 cm thickness, a six tier approach of sealing the top of the clamp (by combination of green bricks) ...

  17. Excitation contraction uncoupling by high intracellular [Ca2+] in frog skeletal muscle: a voltage clamp study.

    Science.gov (United States)

    Olivera, J Fernando; Pizarro, Gonzalo

    2016-10-01

    Raising the intracellular [Ca 2+ ] ([Ca 2+ ] i ) was previously found to produce uncoupling between the electrical depolarization of the transverse tubules and contraction in skinned muscle fibers. Here we study the effect of elevated [Ca 2+ ] i in voltage clamped cut fibers of frog skeletal muscle to establish how the charge movement, a measure of the activation of the dihydropyridine receptors (DHPR)-voltage sensors, and Ca 2+ release, a consequence of the opening of the ryanodine receptor (RyR)-release channels, were affected. [Ca 2+ ] i was raised by various procedures (pharmacological release from the sarcoplasmic reticulum, application of high [Ca 2+ ] i intracellular solution, permeabilization of the plasma membrane by a Ca 2+ ionophore) all of which produced impairment of excitation-contraction coupling. The charge movement was reduced from 20.2 ± 1.24 to 9.9 ± 0.94 nC/μF meanwhile the Ca 2+ release flux was reduced from 13.5 + 0.7 to 2.2 ± 0.3 μM/ms (n = 33). This suggests that a significant fraction of the DHPRs that remained functional, could not activate RyRs, and were therefore presumably disconnected. These results are broadly consistent with the original reports in skinned fibers. Uncoupling was prevented by the addition to the intracellular solution of the protease inhibitor leupeptin. In approximately 40 % of the uncoupled cells we observed that the [Ca 2+ ] i transient continued to rise after the voltage clamp pulse was turned off. This loss of control by membrane voltage suggests that the uncoupled release channels might have another mechanism of activation, likely by Ca 2+ .

  18. Five-level Z-source diode-clamped inverter

    DEFF Research Database (Denmark)

    Gao, F.; Loh, Poh Chiang; Blaabjerg, Frede

    2010-01-01

    This study proposes a five-level Z-source diode-clamped inverter designed with two intermediate Z-source networks connected between the dc input sources and rear-end inverter circuitry. By partially shorting the Z-source networks, new operating states not previously reported for two-level Z......-source inverter are introduced here for operating the proposed inverter with voltage buck–boost energy conversion ability and five-level phase voltage switching. These characteristic features are in fact always ensured at the inverter terminal output by simply adopting a properly designed carrier modulation...

  19. Achievable peak electrode voltage reduction by neurostimulators using descending staircase currents to deliver charge.

    Science.gov (United States)

    Halpern, Mark

    2011-01-01

    This paper considers the achievable reduction in peak voltage across two driving terminals of an RC circuit when delivering charge using a stepped current waveform, comprising a chosen number of steps of equal duration, compared with using a constant current over the total duration. This work has application to the design of neurostimulators giving reduced peak electrode voltage when delivering a given electric charge over a given time duration. Exact solutions for the greatest possible peak voltage reduction using two and three steps are given. Furthermore, it is shown that the achievable peak voltage reduction, for any given number of steps is identical for simple series RC circuits and parallel RC circuits, for appropriate different values of RC. It is conjectured that the maximum peak voltage reduction cannot be improved using a more complicated RC circuit.

  20. A curved electrode electrostatic actuator designed for large displacement and force in an underwater environment

    International Nuclear Information System (INIS)

    Preetham, B S; Lake, Melinda A; Hoelzle, David J

    2017-01-01

    There is a need for the development of large displacement ( O (10 −6 ) m) and force ( O (10 −6 ) N) electrostatic actuators with low actuation voltages (<  ±8 V) for underwater bio- MEMS applications. In this paper, we present the design, fabrication, and characterization of a curved electrode electrostatic actuator in a clamped–clamped beam configuration meant to operate in an underwater environment. Our curved electrode actuator is unique in that it operates in a stable manner past the pull-in instability. Models based on the Rayleigh–Ritz method accurately predict the onset of static instability and the displacement versus voltage function, as validated by quasistatic experiments. We demonstrate that the actuator is capable of achieving a large peak-to-peak displacement of 19.5 µ m and force of 43 µ N for a low actuation voltage of less than  ±8 V and is thus appropriate for underwater bio -MEMS applications. (paper)

  1. Enhanced Buck-Boost Three-Level Neutral-Point-Clamped Inverters

    DEFF Research Database (Denmark)

    Tan, K. K.; Gao, F.; Chiang Loh, Poh

    2009-01-01

    In traditional three-level neutral-point-clamped (NPC) inverters, a major issue is capacitor voltage imbalance, which results in low order harmonics. The compensation of the capacitor voltages often require additional control complexity, which cannot be conveniently implemented. The "alternative...... phase opposition disposition" (APOD) modulation method used in traditional NPC topologies also has lower harmonics performance as compared to the "phase disposition" (PD) modulation method.In this paper, we introduce a new three-level NPC topology that utilises the harmonically superior PD modulation...... method, with the ability to easily adjust for capacitor voltage imbalances. To further improve the boost capability of the three-level NPC inverters, another new topology introduces 2 additional diodes,achieving higher boost performance while totally eliminating thepossibility of capacitor voltage...

  2. Pulsewidth-modulated 2-source neutral-point-clamped inverter

    DEFF Research Database (Denmark)

    Blaabjerg, Frede; Loh, Poh Chang; Gao, Feng

    2007-01-01

    This paper presents the careful integration of a newly proposed Z-source topological concept to the basic neutral-point-clamped (NPC) inverter topology for designing a three-level inverter with both voltage-buck and voltage-boost capabilities. The designed Z-source NPC inverter uses two unique X......-shaped inductance-capacitance (LC) impedance networks that are connected between two isolated dc input power sources and its inverter circuitry for boosting its AC output voltage. Through the design of an appropriate pulsewidth-modulation (PWM) algorithm, the two impedance networks can be short......-circuited sequentially (without shooting through the inverter full DC link) for implementing the ldquonearest-three-vectorrdquo modulation principle with minimized harmonic distortion and device commutations per half carrier cycle while performing voltage boosting. With only a slight modification to the inverter PWM...

  3. The Dynamics of a Doubly Clamped Microbeam Near the Primary Resonance: Experimental and Analytical Investigation

    KAUST Repository

    Masri, Karim M.

    2016-01-20

    We present experimental and analytical investigation of the dynamics of a doubly clamped microbeam near its primary resonance. The microbeam is excited electrostatically by an electrode on the first half of the beam. These microbeams are fabricated using polyimide as structural layer coated with nickel from top and chromium and gold layers from bottom. A noise signal is applied to experimentally detect the natural frequencies. Then, frequency sweep tests are generated for various values of DC bias revealing hardening, transition, and softening behavior of the microbeam. We report for the first time the transition from lower stable state, to unstable state, and then to large stable state experimentally. A multi-mode Galerkin method is used to develop a reduced order model (ROM) of the beam. Shooting method is used to find the periodic motion and is utilized to generate frequency response curves. The curves show good agreement with the experimental results with hardening behavior at lower DC voltage then softening at higher voltage loads and dynamic pull-in. © Copyright 2015 by ASME.

  4. High voltage load resistor array

    Science.gov (United States)

    Lehmann, Monty Ray [Smithfield, VA

    2005-01-18

    A high voltage resistor comprising an array of a plurality of parallel electrically connected resistor elements each containing a resistive solution, attached at each end thereof to an end plate, and about the circumference of each of the end plates, a corona reduction ring. Each of the resistor elements comprises an insulating tube having an electrode inserted into each end thereof and held in position by one or more hose clamps about the outer periphery of the insulating tube. According to a preferred embodiment, the electrode is fabricated from stainless steel and has a mushroom shape at one end, that inserted into the tube, and a flat end for engagement with the end plates that provides connection of the resistor array and with a load.

  5. A High Step-Down Interleaved Buck Converter with Active-Clamp Circuits for Wind Turbines

    Directory of Open Access Journals (Sweden)

    Chih-Lung Shen

    2012-12-01

    Full Text Available In this paper, a high step-down interleaved buck coupled-inductor converter (IBCC with active-clamp circuits for wind energy conversion has been studied. In high step-down voltage applications, an IBCC can extend duty ratio and reduce voltage stresses on active switches. In order to reduce switching losses of active switches to improve conversion efficiency, a IBCC with soft-switching techniques is usually required. Compared with passive-clamp circuits, the IBCC with active-clamp circuits have lower switching losses and minimum ringing voltage of the active switches. Thus, the proposed IBCC with active-clamp circuits for wind energy conversion can significantly increase conversion efficiency. Finally, a 240 W prototype of the proposed IBCC with active-clamp circuits was built and implemented. Experimental results have shown that efficiency can reach as high as 91%. The proposed IBCC with active-clamp circuits is presented in high step-down voltage applications to verify the performance and the feasibility for energy conversion of wind turbines.

  6. Systems and methods for the magnetic insulation of accelerator electrodes in electrostatic accelerators

    Science.gov (United States)

    Grisham, Larry R

    2013-12-17

    The present invention provides systems and methods for the magnetic insulation of accelerator electrodes in electrostatic accelerators. Advantageously, the systems and methods of the present invention improve the practically obtainable performance of these electrostatic accelerators by addressing, among other things, voltage holding problems and conditioning issues. The problems and issues are addressed by flowing electric currents along these accelerator electrodes to produce magnetic fields that envelope the accelerator electrodes and their support structures, so as to prevent very low energy electrons from leaving the surfaces of the accelerator electrodes and subsequently picking up energy from the surrounding electric field. In various applications, this magnetic insulation must only produce modest gains in voltage holding capability to represent a significant achievement.

  7. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  8. A Self-diagnostic Method for the Electrode Adhesion of an Electromagnetic Flow-meter

    Directory of Open Access Journals (Sweden)

    Wen-Hua Cui

    2014-07-01

    Full Text Available Electrodes of electromagnetic flow-meter are subject to contamination in sewage measurement. In this paper, the relationship between the internal resistance of the flow-induced voltage and the electrode contamination is analyzed on the basis of numerical analysis. A new self- diagnostic method for electrode adhesion with additional excitation based on photovoltaic cell is proposed, in which magnetic excitation for flow-rate measurement and electric excitation for electrode self-diagnosis is divided in both time domain and frequency domain. A dual-excited electromagnetic flow-meter with electrode self-diagnosis was designed and validated. Simulation experiments based on the change of the internal resistance of the flow-induced voltage were carried out. And the experimental results fully show that this new method is feasible and promising.

  9. Independent control strategy of two DC-link voltages for separate MPPTs in transformerless photovoltaic systems using neutral-point-clamped inverters

    DEFF Research Database (Denmark)

    Choi, Uimin; Blaabjerg, Frede; Lee, Kyo-Beum

    2014-01-01

    To improve the efficiency of the photovoltaic (PV) system, the centralized topology using three-level inverters are widely used. In this system, PV modules are separately connected to the split DC-links. This causes a decrease of maximum power point tracking (MPPT) efficiency under the partial...... shading condition. This paper proposes an independent control of two DC-link voltages for separate MPPT of each PV module in three-level inverters. The proposed method is simply implemented by adding or subtracting the time-offset to the three-phase turn-on times and modifying the reference voltages...

  10. Method to Minimize the Low-Frequency Neutral-Point Voltage Oscillations With Time-Offset Injection for Neutral-Point-Clamped Inverters

    DEFF Research Database (Denmark)

    Choi, Ui-Min; Blaabjerg, Frede; Lee, Kyo-Beum

    2015-01-01

    time of small- and medium-voltage vectors. However, if the power factor is lower, there is a limitation to eliminate neutral-point oscillations. In this case, the proposed method can be improved by changing the switching sequence properly. Additionally, a method for neutral-point voltage balancing......This paper proposes a method to reduce the low-frequency neutral-point voltage oscillations. The neutral-point voltage oscillations are considerably reduced by adding a time offset to the three-phase turn-on times. The proper time offset is simply calculated considering the phase currents and dwell...

  11. THREE-ELECTRODE AIR SWITCHBOARD WITH THE GRAPHITE ELECTRODES OF KATG-50 ON VOLTAGE TO ±50 KV AND IMPULSE CURRENT BY AMPLITUDE TO ±220 KA

    Directory of Open Access Journals (Sweden)

    M. I. Baranov

    2015-04-01

    Full Text Available Purpose. Development and creation of the simplified construction of a high-voltage heavy-current air three-electrode switchboard with graphite electrodes, intended for operation in composition the powerful generator of large impulsive current of artificial of linear lightning. Methodology. Electrophysics bases of technique of high-voltage and scientific and technical bases of planning of devices of high-voltage impulsive technique. Results. Developed and made a new construction of a high-voltage heavy-current air three-electrode switchboard with the graphite electrodes of KATG-50 on nominal voltage ±50 kV. This construction of switchboard KATG-50 has been passed experimental approbation in composition the heavy-current bit chain of powerful high-voltage generator of the аperiodic impulses of current of artificial linear lightning rationed on operating foreign standards with amplitude of Im=±(200±20 кА at their duration τP=(350±35 μs at level 0,5∙Im. Originality. First in domestic practice of development and creation of high-voltage heavy-current switchboards for the generators of large impulse currents of artificial lightning the ground of necessity of the use for their basic and managing electrodes of electrical engineering graphite is carried out. Practical value. The developed and made high-voltage heavy-current switchboard of cascade-tray KATG-50 from application in its composition of graphite electrodes possesses an enhanceable working resource and enhanceable stability of wearing-out at the use of similar switchboard in the bit chain of powerful pulsed current of the imitated linear lightning.

  12. Molecular motions that shape the cardiac action potential: Insights from voltage clamp fluorometry.

    Science.gov (United States)

    Zhu, Wandi; Varga, Zoltan; Silva, Jonathan R

    2016-01-01

    Very recently, voltage-clamp fluorometry (VCF) protocols have been developed to observe the membrane proteins responsible for carrying the ventricular ionic currents that form the action potential (AP), including those carried by the cardiac Na(+) channel, NaV1.5, the L-type Ca(2+) channel, CaV1.2, the Na(+)/K(+) ATPase, and the rapid and slow components of the delayed rectifier, KV11.1 and KV7.1. This development is significant, because VCF enables simultaneous observation of ionic current kinetics with conformational changes occurring within specific channel domains. The ability gained from VCF, to connect nanoscale molecular movement to ion channel function has revealed how the voltage-sensing domains (VSDs) control ion flux through channel pores, mechanisms of post-translational regulation and the molecular pathology of inherited mutations. In the future, we expect that this data will be of great use for the creation of multi-scale computational AP models that explicitly represent ion channel conformations, connecting molecular, cell and tissue electrophysiology. Here, we review the VCF protocol, recent results, and discuss potential future developments, including potential use of these experimental findings to create novel computational models. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Harmonic elimination in diode-clamped multilevel inverter using evolutionary algorithms

    Energy Technology Data Exchange (ETDEWEB)

    Barkati, Said [Laboratoire d' analyse des Signaux et Systemes (LASS), Universite de M' sila, BP. 166, rue Ichbilia 28000 M' sila (Algeria); Baghli, Lotfi [Groupe de Recherche en Electrotechnique et Electronique de Nancy (GREEN), CNRS UMR 7030, Universite Henri Poincare Nancy 1, BP. 239, 54506 Vandoeuvre-les-Nancy (France); Berkouk, El Madjid; Boucherit, Mohamed-Seghir [Laboratoire de Commande des Processus (LCP), Ecole Nationale Polytechnique, BP. 182, 10 Avenue Hassen Badi, 16200 El Harrach, Alger (Algeria)

    2008-10-15

    This paper describes two evolutionary algorithms for the optimized harmonic stepped-waveform technique. Genetic algorithms and particle swarm optimization are applied to compute the switching angles in a three-phase seven-level inverter to produce the required fundamental voltage while, at the same time, specified harmonics are eliminated. Furthermore, these algorithms are also used to solve the starting point problem of the Newton-Raphson conventional method. This combination provides a very effective method for the harmonic elimination technique. This strategy is useful for different structures of seven-level inverters. The diode-clamped topology is considered in this study. (author)

  14. Piezoresistive cantilever force-clamp system

    Energy Technology Data Exchange (ETDEWEB)

    Park, Sung-Jin; Petzold, Bryan C.; Pruitt, Beth L. [Department of Mechanical Engineering, Stanford University, Stanford, California 94305 (United States); Goodman, Miriam B. [Department of Molecular and Cellular Physiology, Stanford University, Stanford, California 94305 (United States)

    2011-04-15

    We present a microelectromechanical device-based tool, namely, a force-clamp system that sets or ''clamps'' the scaled force and can apply designed loading profiles (e.g., constant, sinusoidal) of a desired magnitude. The system implements a piezoresistive cantilever as a force sensor and the built-in capacitive sensor of a piezoelectric actuator as a displacement sensor, such that sample indentation depth can be directly calculated from the force and displacement signals. A programmable real-time controller operating at 100 kHz feedback calculates the driving voltage of the actuator. The system has two distinct modes: a force-clamp mode that controls the force applied to a sample and a displacement-clamp mode that controls the moving distance of the actuator. We demonstrate that the system has a large dynamic range (sub-nN up to tens of {mu}N force and nm up to tens of {mu}m displacement) in both air and water, and excellent dynamic response (fast response time, <2 ms and large bandwidth, 1 Hz up to 1 kHz). In addition, the system has been specifically designed to be integrated with other instruments such as a microscope with patch-clamp electronics. We demonstrate the capabilities of the system by using it to calibrate the stiffness and sensitivity of an electrostatic actuator and to measure the mechanics of a living, freely moving Caenorhabditis elegans nematode.

  15. The second sodium site in the dopamine transporter controls cation permeability and is regulated by chloride

    DEFF Research Database (Denmark)

    Borre, Lars; Andreassen, Thorvald F; Shi, Lei

    2014-01-01

    The dopamine transporter (DAT) belongs to the family of neurotransmitter:sodium symporters (NSSs) and controls dopamine (DA) homeostasis by mediating Na(+)- and Cl(-)-dependent reuptake of DA. Here we used two-electrode voltage clamp measurements in Xenopus oocytes together with targeted mutagene......The dopamine transporter (DAT) belongs to the family of neurotransmitter:sodium symporters (NSSs) and controls dopamine (DA) homeostasis by mediating Na(+)- and Cl(-)-dependent reuptake of DA. Here we used two-electrode voltage clamp measurements in Xenopus oocytes together with targeted...

  16. Modeling of SVM Diode Clamping Three-Level Inverter Connected to Grid

    DEFF Research Database (Denmark)

    Guo, Yougui; Zeng, Ping; Zhu, Jieqiong

    2011-01-01

    PLECS is used to model the diode clamping three-level inverter connected to grid and good results are obtained. First the output voltage SVM is described for diode clamping three-level inverter with loads connected to Y. Then the output voltage SVM of diode clamping three-level inverter is simply...... analyzed with loads connected to △. But it will be further researched in the future. Third, PLECS is briefly introduced. Fourth, the modeling of diode clamping three-level inverter is briefly presented with PLECS. Finally, a series of simulations are carried out. The simulation results tell us PLECS...... is very powerful tool to real power circuits and it is very easy to simulate them. They have also verified that SVM control strategy is feasible to control the diode clamping three-level inverter....

  17. Force-controlled patch clamp of beating cardiac cells.

    Science.gov (United States)

    Ossola, Dario; Amarouch, Mohamed-Yassine; Behr, Pascal; Vörös, János; Abriel, Hugues; Zambelli, Tomaso

    2015-03-11

    From its invention in the 1970s, the patch clamp technique is the gold standard in electrophysiology research and drug screening because it is the only tool enabling accurate investigation of voltage-gated ion channels, which are responsible for action potentials. Because of its key role in drug screening, innovation efforts are being made to reduce its complexity toward more automated systems. While some of these new approaches are being adopted in pharmaceutical companies, conventional patch-clamp remains unmatched in fundamental research due to its versatility. Here, we merged the patch clamp and atomic force microscope (AFM) techniques, thus equipping the patch-clamp with the sensitive AFM force control. This was possible using the FluidFM, a force-controlled nanopipette based on microchanneled AFM cantilevers. First, the compatibility of the system with patch-clamp electronics and its ability to record the activity of voltage-gated ion channels in whole-cell configuration was demonstrated with sodium (NaV1.5) channels. Second, we showed the feasibility of simultaneous recording of membrane current and force development during contraction of isolated cardiomyocytes. Force feedback allowed for a gentle and stable contact between AFM tip and cell membrane enabling serial patch clamping and injection without apparent cell damage.

  18. Transition voltages of vacuum-spaced and molecular junctions with Ag and Pt electrodes

    KAUST Repository

    Wu, Kunlin

    2014-07-07

    The transition voltage of vacuum-spaced and molecular junctions constructed with Ag and Pt electrodes is investigated by non-equilibrium Green\\'s function formalism combined with density functional theory. Our calculations show that, similarly to the case of Au-vacuum-Au previously studied, the transition voltages of Ag and Pt metal-vacuum-metal junctions with atomic protrusions on the electrode surface are determined by the local density of states of the p-type atomic orbitals of the protrusion. Since the energy position of the Pt 6p atomic orbitals is higher than that of the 5p/6p of Ag and Au, the transition voltage of Pt-vacuum-Pt junctions is larger than that of both Ag-vacuum-Ag and Au-vacuum-Au junctions. When one moves to analyzing asymmetric molecular junctions constructed with biphenyl thiol as central molecule, then the transition voltage is found to depend on the specific bonding site for the sulfur atom in the thiol group. In particular agreement with experiments, where the largest transition voltage is found for Ag and the smallest for Pt, is obtained when one assumes S binding at the hollow-bridge site on the Ag/Au(111) surface and at the adatom site on the Pt(111) one. This demonstrates the critical role played by the linker-electrode binding geometry in determining the transition voltage of devices made of conjugated thiol molecules. © 2014 AIP Publishing LLC.

  19. Zoom system without moving element by using two liquid crystal lenses with spherical electrode

    Science.gov (United States)

    Yang, Ren-Kai; Lin, Chia-Ping; Su, Guo-Dung J.

    2017-08-01

    A traditional zoom system is composed of several elements moving relatively toward other components to achieve zooming. Unlike tradition system, an electrically control zoom system with liquid crystal (LC) lenses is demonstrated in this paper. To achieve zooming, we apply two LC lenses whose optical power is controlled by voltage to replace two moving lenses in traditional zoom system. The mechanism of zoom system is to use two LC lenses to form a simple zoom system. We found that with such spherical electrodes, we could operate LC lens at voltage range from 31V to 53 V for 3X tunability in optical power. For each LC lens, we use concave spherical electrode which provide lower operating voltage and great tunability in optical power, respectively. For such operating voltage and compact size, this zoom system with zoom ratio approximate 3:1 could be applied to mobile phone, camera and other applications.

  20. PWM Regulation of Grid-Tied PV System on the Base of Photovoltaic-Fed Diode-Clamped Inverters

    Directory of Open Access Journals (Sweden)

    Oleschuk V.I.

    2015-12-01

    Full Text Available Investigation of grid-tied photovoltaic system on the base of two diode-clamped inverters, controlled by specific algorithms of pulse-width modulation (PWM, has been done. This system includes two strings of photovoltaic panels feeding two diode-clamped inverters. The outputs of inverters are connected with the corresponding windings on the primary side of three-phase transformer, connected with a grid. In order to reduce phase voltage distortion and to increase efficiency of operation of the system, special scheme of control and modulation of inverters has been used, providing minimization of common-mode voltages and voltage waveforms symmetries under different operating conditions. Detailed simulation of processes in this photovoltaic-fed power conversion system has been executed. The results of simulations verify good performance of photovoltaic system regulated in accordance with specific strategy of control and modulation.

  1. An 11 μ w, two-electrode transimpedance biosignal amplifier with active current feedback stabilization.

    Science.gov (United States)

    Inan, O T; Kovacs, G T A

    2010-04-01

    A novel two-electrode biosignal amplifier circuit is demonstrated by using a composite transimpedance amplifier input stage with active current feedback. Micropower, low gain-bandwidth product operational amplifiers can be used, leading to the lowest reported overall power consumption in the literature for a design implemented with off-the-shelf commercial integrated circuits (11 μW). Active current feedback forces the common-mode input voltage to stay within the supply rails, reducing baseline drift and amplifier saturation problems that can be present in two-electrode systems. The bandwidth of the amplifier extends from 0.05-200 Hz and the midband voltage gain (assuming an electrode-to-skin resistance of 100 kΩ) is 48 dB. The measured output noise level is 1.2 mV pp, corresponding to a voltage signal-to-noise ratio approaching 50 dB for a typical electrocardiogram (ECG) level input of 1 mVpp. Recordings were taken from a subject by using the proposed two-electrode circuit and, simultaneously, a three-electrode standard ECG circuit. The residual of the normalized ensemble averages for both measurements was computed, and the power of this residual was 0.54% of the power of the standard ECG measurement output. While this paper primarily focuses on ECG applications, the circuit can also be used for amplifying other biosignals, such as the electroencephalogram.

  2. Impedances of electrochemically impregnated nickel electrodes as functions of potential, KOH concentration, and impregnation method

    Science.gov (United States)

    Reid, Margaret A.

    1989-01-01

    Impedances of fifteen electrodes form each of the four U.S. manufactures were measured at 0.200 V vs. the Hg/HgO reference electrode. This corresponds to a voltage of 1.145 for a Ni/H2 cell. Measurements were also made of a representative sample of these at 0.44 V. At the higher voltage, the impedances were small and very similar, but at the lower voltage there were major differences between manufacturers. Electrodes from the same manufacturers showed only small differences. The impedances of electrodes from two manufacturers were considerably different in 26 percent KOH from those in 31 percent KOH. These preliminary results seen to correlate with the limited data from earlier life testing of cells from these manufacturers. The impedances of cells being tested for Space Station Freedom are being followed, and more impendance measurements of electrodes are being performed as functions of manufacturer, voltage, electrolyte concentration, and cycle history in hopes of finding better correlations of impedance with life.

  3. LED-Based High-Voltage Lines Warning System

    Directory of Open Access Journals (Sweden)

    Eldar MUSA

    2013-04-01

    Full Text Available LED-based system, running with the current of high-voltage lines and converting the current flowing through the line into the light by using a toroid transformer, has been developed. The transformer’s primary winding is constituted by the high voltage power line. Toroidal core consists of two equal parts and the secondary windings are evenly placed on these two parts. The system is mounted on the high-voltage lines as a clamp. The secondary winding ends are connected in series by the connector on the clamp. LEDs are supplied by the voltage at the ends of secondary. Current flowing through highvoltage transmission lines is converted to voltage by the toroidal transformer and the light emitting LEDs are supplied with this voltage. The theory of the conversion of the current flowing through the line into the light is given. The system, running with the current of the line and converting the current into the light, has been developed. System has many application areas such as warning high voltage lines (warning winches to not hinder the high-voltage lines when working under the lines, warning planes to not touch the high-voltage lines, remote measurement of high-voltage line currents, and local illumination of the line area

  4. Analysis of low-pressure dc breakdown in nitrogen between two spherical iron electrodes

    International Nuclear Information System (INIS)

    Pejovic, Momcilo M.; Nesic, Nikola T.; Pejovic, Milic M.

    2006-01-01

    The influence of afterglow period τ, voltage increase rate k, and electrode gap d on breakdown voltage U b for a nitrogen-filled tube with spherical electrodes of diameter D>>d and p=6.5 mbar has been investigated. The data for the breakdown voltage were obtained for the case when there is a presence of N( 4 S) atoms, which release secondary electrons via recombination on the cathode. By fitting the experimental data of breakdown voltage mean values as a function of the voltage increase rate, the static breakdown voltages for afterglow periods of 15 and 100 s were estimated. The electrical field as a function of the electrode gap using breakdown voltage mean values was also determined. It is shown that experimental results of the breakdown voltage mean value as a function of pd in the interval of d from 0.82 to 1.62 mm can be very well described with Paschen's law, valid for the case of parallel-plate electrodes

  5. Modeling CICR in rat ventricular myocytes: voltage clamp studies

    Directory of Open Access Journals (Sweden)

    Palade Philip T

    2010-11-01

    Full Text Available Abstract Background The past thirty-five years have seen an intense search for the molecular mechanisms underlying calcium-induced calcium-release (CICR in cardiac myocytes, with voltage clamp (VC studies being the leading tool employed. Several VC protocols including lowering of extracellular calcium to affect Ca2+ loading of the sarcoplasmic reticulum (SR, and administration of blockers caffeine and thapsigargin have been utilized to probe the phenomena surrounding SR Ca2+ release. Here, we develop a deterministic mathematical model of a rat ventricular myocyte under VC conditions, to better understand mechanisms underlying the response of an isolated cell to calcium perturbation. Motivation for the study was to pinpoint key control variables influencing CICR and examine the role of CICR in the context of a physiological control system regulating cytosolic Ca2+ concentration ([Ca2+]myo. Methods The cell model consists of an electrical-equivalent model for the cell membrane and a fluid-compartment model describing the flux of ionic species between the extracellular and several intracellular compartments (cell cytosol, SR and the dyadic coupling unit (DCU, in which resides the mechanistic basis of CICR. The DCU is described as a controller-actuator mechanism, internally stabilized by negative feedback control of the unit's two diametrically-opposed Ca2+ channels (trigger-channel and release-channel. It releases Ca2+ flux into the cyto-plasm and is in turn enclosed within a negative feedback loop involving the SERCA pump, regulating[Ca2+]myo. Results Our model reproduces measured VC data published by several laboratories, and generates graded Ca2+ release at high Ca2+ gain in a homeostatically-controlled environment where [Ca2+]myo is precisely regulated. We elucidate the importance of the DCU elements in this process, particularly the role of the ryanodine receptor in controlling SR Ca2+ release, its activation by trigger Ca2+, and its

  6. Multilevel Converter by Cascading Two-Level Three-Phase Voltage Source Converter

    Directory of Open Access Journals (Sweden)

    Abdullrahman A. Al-Shamma’a

    2018-04-01

    Full Text Available This paper proposes a topology using isolated, cascaded multilevel voltage source converters (VSCs and employing two-winding magnetic elements for high-power applications. The proposed topology synthesizes 6 two-level, three-phase VSCs, so the power capability of the presented converter is six times the capability of each VSC module. The characteristics of the proposed topology are demonstrated through analyzing its current relationships, voltage relationships and power capability in detail. The power rating is equally shared among the VSC modules without the need for a sharing algorithm; thus, the converter operates as a single three-phase VSC. The comparative analysis with classical neutral-point clamped, flying capacitor and cascaded H-bridge exhibits the superior features of fewer insulated gate bipolar transistors (IGBTs, capacitor requirement and fewer diodes. To validate the theoretical performance of the proposed converter, it is simulated in a MATLAB/Simulink environment and the results are experimentally demonstrated using a laboratory prototype.

  7. Large gap plasma display cell with auxiliary electrodes: macro-cell experiments and two-dimensional modelling

    International Nuclear Information System (INIS)

    Ouyang, J T; Callegari, Th; Caillier, B; Boeuf, J-P

    2003-01-01

    In this paper we use a two-dimensional fluid model and a 'macroscopic' PDP cell to investigate the possibility of using large gap configurations with auxiliary electrodes to improve the efficiency of PDP discharge cells. The large gap allows operation in a transient positive column regime where energy is more efficiently deposited into xenon excitation, while the auxiliary electrodes are used to keep reasonable values of the operating voltage. Two types of auxiliary electrode configurations (floating and powered) are considered. The discharge characteristics and the discharge efficiency in exciting xenon are studied with simulations and by measuring the intensity of infrared emission from xenon and visible emission from neon in a macroscopic PDP cell. The results show that an efficient positive column regime can be achieved at reasonably low operating voltages when the auxiliary electrode configuration is carefully designed

  8. A Hybrid Cascade Converter Topology With Series-Connected Symmetrical and Asymmetrical Diode-Clamped H-Bridge Cells

    DEFF Research Database (Denmark)

    Nami, Alireza; Zare, Firuz; Ghosh, Arindam

    2011-01-01

    to approach a very low total harmonic distortion of voltage and current, which leads to the possible elimination of the output filter. Regarding the proposed configuration, a new cascade inverter is verified by cascading an asymmetrical diode-clamped inverter, in which 19 levels can be synthesized in output......A novel H-bridge multilevel pulsewidth modulation converter topology based on a series connection of a high-voltage diode-clamped inverter and a low-voltage conventional inverter is proposed in this paper. A dc link voltage arrangement for the new hybrid and asymmetric solution is presented to have...... voltage with the same number of components. To balance the dc link capacitor voltages for the maximum output voltage resolution as well as synthesize asymmetrical dc link combination, a new multi-output boost converter is utilized at the dc link voltage of a seven-level H-bridge diode-clamped inverter...

  9. Robotic multi-well planar patch-clamp for native and primary mammalian cells

    Science.gov (United States)

    Milligan, Carol J; Li, Jing; Sukumar, Piruthivi; Majeed, Yasser; Dallas, Mark L; English, Anne; Emery, Paul; Porter, Karen E; Smith, Andrew M; McFadzean, Ian; Beccano-Kelly, Dayne; Bahnasi, Yahya; Cheong, Alex; Naylor, Jacqueline; Zeng, Fanning; Liu, Xing; Gamper, Nikita; Jiang, Lin-Hua; Pearson, Hugh A; Peers, Chris; Robertson, Brian; Beech, David J

    2009-01-01

    Multi-well robotic planar patch-clamp has become common in drug development and safety programmes because it enables efficient and systematic testing of compounds against ion channels during voltage-clamp. It has not, however, been adopted significantly in other important areas of ion channel research, where conventional patch-clamp remains the favoured method. Here we show the wider potential of the multi-well approach with the capability for efficient intracellular solution exchange, describing protocols and success rates for recording from a range of native and primary mammalian cells derived from blood vessels, arthritic joints, and the immune and central nervous systems. The protocol involves preparing a suspension of single cells to be dispensed robotically into 4-8 microfluidic chambers each containing a glass chip with a small aperture. Under automated control, giga-seals and whole-cell access are achieved followed by pre-programmed routines of voltage paradigms and fast extracellular or intracellular solution exchange. Recording from 48 chambers usually takes 1-6 hr depending on the experimental design and yields 16-33 cell recordings. PMID:19197268

  10. Inertial piezoelectric linear motor driven by a single-phase harmonic wave with automatic clamping mechanism

    Science.gov (United States)

    He, Liangguo; Chu, Yuheng; Hao, Sai; Zhao, Xiaoyong; Dong, Yuge; Wang, Yong

    2018-05-01

    A novel, single-phase, harmonic-driven, inertial piezoelectric linear motor using an automatic clamping mechanism was designed, fabricated, and tested to reduce the sliding friction and simplify the drive mechanism and power supply control of the inertial motor. A piezoelectric bimorph and a flexible hinge were connected in series to form the automatic clamping mechanism. The automatic clamping mechanism was used as the driving and clamping elements. A dynamic simulation by Simulink was performed to prove the feasibility of the motor. The finite element method software COMSOL was used to design the structure of the motor. An experimental setup was built to validate the working principle and evaluate the performance of the motor. The prototype motor outputted a no-load velocity of 3.178 mm/s at a voltage of 220 Vp-p and a maximum traction force of 4.25 N under a preload force of 8 N. The minimum resolution of 1.14 μm was achieved at a driving frequency of 74 Hz, a driving voltage of 50 Vp-p, and a preload force of 0 N.

  11. A Novel Neutral Point Clamped Full-Bridge Topology for Transformerless Photovoltaic Grid-Connected Inverters

    Directory of Open Access Journals (Sweden)

    M. Pakdel

    2017-04-01

    Full Text Available This paper presents a novel neutral point clamped full-bridge topology for transformerless photovoltaic grid-tied inverters. Transformerless grid-connected inverters have been used widely in recent years since they offer higher efficiency and lower costs. Ground leakage current suppression is the main issue which should be considered carefully in transformerless photovoltaic grid-connected inverters. Among different methods used to decline ground leakage current, neutral point clamped (NPC topologies are considered more useful and effective. In NPC topologies, the short-circuited output voltage at the freewheeling period is clamped to the middle of the DC bus voltage. Therefore, the common-mode voltage (CM will be constant at the whole switching period. Various NPC topologies such as H6 [1], HB-ZVR [2], oH5 [3], and PN-NPC [4] have been proposed. In this paper, a novel NPC topology is proposed which has lower power losses and higher efficiency over previous topologies. Furthermore, the proposed NPC topology exhibits a similar ground leakage current with the PN-NPC topology. The proposed NPC topology is analyzed theoretically using simulation studies and an experimental prototype is provided to verify theoretical analysis and simulation studies.

  12. Multi-Electrode Impedance Method for Detection of Regional Ventilation

    International Nuclear Information System (INIS)

    Furuya, Norio; Sakamoto, Katsuyuki

    2013-01-01

    By means of computer simulation and experiment, we investigated the feasibility of simultaneously measuring the transfer impedance changes in the right apex, left apex, right base and left base of the lungs using the multi-electrode impedance method. To obtain the transfer impedance in each region, while suppressing the effects of other regions, changing the amplitude and polarity of the applied current must localize the high sensitivity areas in the interest region. Twelve current and eight voltage electrodes were equidistantly arranged on the anterior and posterior chest walls. The amplitudes and polarities of the currents that were simultaneously applied to the current electrodes, and which provided the appropriate sensitivity distribution, were theoretically obtained. The effects of the localized sensitivity distribution were verified by comparing the simulation results of the investigated method with the results of the conventional four-electrode method. From the results of the computer simulation, we developed a multi-electrode impedance pneumography and applied it to healthy adult volunteers who were both in sitting position and in left decubitus. We found that the measurement results were physiologically reasonable.

  13. The relation of electrode voltages to charge position in SLC arc and final focus beam position monitors

    International Nuclear Information System (INIS)

    Fordham, C.

    1989-01-01

    The position of a charged particle beam can be measured with a Beam Position Monitor (BPM) by converting the voltages induced on its array of electrodes into a position offset from the array's center. Most of the BPMs in the Arcs and Final Focus of the SLC use four stripline electrodes arranged symmetrically around the beam; normalized voltage differences are calculated as the difference divided by the sum of voltages on opposite electrode pairs. The resulting number is multiplied by a conversion factor, denoted in this paper as S b , to give the offset (in millimeters) of the charge from the center of the BPM. Prior to installation in the beam line, the BPMs were calibrated with a charge pulse on a rod. Owing to geometric effects which will be discussed later, a different conversion factor had to be used for calibration. It will be denoted here by S r . This paper gives the results of calculations and measurements of S r and S b for Arc and Final Focus BPMs. This paper also describes the relevant physical properties of the several types of BPMs and calculations of the expected scale factors, the measurement methods used, and gives the results of measurements, which are compared with the theoretical expectations. 2 refs., 18 figs., 7 tabs

  14. Modulation Methods for Three-level Neutral-Point-Clamped Inverter Achieving Stress Redistribution under Moderate Modulation Index

    DEFF Research Database (Denmark)

    Ma, Ke; Blaabjerg, Frede

    2016-01-01

    This letter investigates the loss and thermal behaviors of a three-level neutral-point-clamped (3L-NPC) inverter undergoing moderate modulation index, which is typically presented during minor voltage sags of the power grid or speed changes of the electric machines. A series of new space vector m...

  15. Ionization detector, electrode configuration and single polarity charge detection method

    Science.gov (United States)

    He, Z.

    1998-07-07

    An ionization detector, an electrode configuration and a single polarity charge detection method each utilize a boundary electrode which symmetrically surrounds first and second central interlaced and symmetrical electrodes. All of the electrodes are held at a voltage potential of a first polarity type. The first central electrode is held at a higher potential than the second central or boundary electrodes. By forming the first and second central electrodes in a substantially interlaced and symmetrical pattern and forming the boundary electrode symmetrically about the first and second central electrodes, signals generated by charge carriers are substantially of equal strength with respect to both of the central electrodes. The only significant difference in measured signal strength occurs when the charge carriers move to within close proximity of the first central electrode and are received at the first central electrode. The measured signals are then subtracted and compared to quantitatively measure the magnitude of the charge. 10 figs.

  16. Methods for calculating the electrode position Jacobian for impedance imaging.

    Science.gov (United States)

    Boyle, A; Crabb, M G; Jehl, M; Lionheart, W R B; Adler, A

    2017-03-01

    Electrical impedance tomography (EIT) or electrical resistivity tomography (ERT) current and measure voltages at the boundary of a domain through electrodes. The movement or incorrect placement of electrodes may lead to modelling errors that result in significant reconstructed image artifacts. These errors may be accounted for by allowing for electrode position estimates in the model. Movement may be reconstructed through a first-order approximation, the electrode position Jacobian. A reconstruction that incorporates electrode position estimates and conductivity can significantly reduce image artifacts. Conversely, if electrode position is ignored it can be difficult to distinguish true conductivity changes from reconstruction artifacts which may increase the risk of a flawed interpretation. In this work, we aim to determine the fastest, most accurate approach for estimating the electrode position Jacobian. Four methods of calculating the electrode position Jacobian were evaluated on a homogeneous halfspace. Results show that Fréchet derivative and rank-one update methods are competitive in computational efficiency but achieve different solutions for certain values of contact impedance and mesh density.

  17. Origin of the transition voltage in gold–vacuum–gold atomic junctions

    International Nuclear Information System (INIS)

    Wu Kunlin; Bai Meilin; Hou Shimin; Sanvito, Stefano

    2013-01-01

    The origin and the distance dependence of the transition voltage of gold–vacuum–gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold–vacuum–gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold–vacuum–gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. (paper)

  18. Cell voltage versus electrode potential range in aqueous supercapacitors

    OpenAIRE

    Dai, Zengxin; Peng, Chuang; Chae, Jung Hoon; Ng, Kok Chiang; Chen, George Z.

    2015-01-01

    Supercapacitors with aqueous electrolytes and nanostructured composite electrodes are attractive because of their high charging-discharging speed, long cycle life, low environmental impact and wide commercial affordability. However, the energy capacity of aqueous supercapacitors is limited by the electrochemical window of water. In this paper, a recently reported engineering strategy is further developed and demonstrated to correlate the maximum charging voltage of a supercapacitor with the c...

  19. Different methods of hilar clamping during partial nephrectomy: Impact on renal function.

    Science.gov (United States)

    Lee, Jeong Woo; Kim, Hwanik; Choo, Minsoo; Park, Yong Hyun; Ku, Ja Hyeon; Kim, Hyeon Hoe; Kwak, Cheol

    2014-03-01

    To evaluate the impact of different hilar clamping methods on changes in renal function after partial nephrectomy. We analyzed the clinical data of 369 patients who underwent partial nephrectomy for a single renal tumor of size ≤4.0 cm and a normal contralateral kidney. Patients were separated into three groups depending on hilar clamping method: non-clamping, cold ischemia and warm ischemia. Estimated glomerular filtration rate was examined at preoperative, nadir and 1 year postoperatively. Percent change in estimated glomerular filtration rate was used as the parameter to assess the renal functional outcome. Percent change in nadir estimated glomerular filtration rate in the non-clamping group was significantly less compared with the cold ischemia and warm ischemia groups (P hilar clamping (both warm ischemia and cold ischemia) were significantly associated with percent change in nadir estimated glomerular filtration rate, but not in 1-year estimated glomerular filtration rate. Non-clamping partial nephrectomy results in a lower percent change in nadir estimated glomerular filtration rate, whereas it carries an estimated glomerular filtration rate change at 1 year that is similar to partial nephrectomy with cold ischemia and warm ischemia. Cold ischemia and warm ischemia provide a similar effect on renal function. Therefore, when hilar clamping is required, minimization of ischemia time is necessary. © 2013 The Japanese Urological Association.

  20. Impact of cell-voltage on energy and power performance of supercapacitors with single-walled carbon nanotube electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Izadi-Najafabadi, Ali; Yamada, Takeo; Futaba, Don N.; Iijima, Sumio [Nanotube Research Center, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hatori, Hiroaki [Project Headquarters, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hata, Kenji [Japan Science and Technology Agency JST, Kawaguchi (Japan)

    2010-12-15

    We report the energy and power voltage-dependencies of supercapacitors using single-walled carbon nanotube electrodes. The energy density was dependent on the cell-voltage cubed (up to 4 V: E = 1.43 x V{sup 3}). The cubic relationship was attributed to the linear increase of the capacitance as a function of voltage, enabled by electrochemical doping. Furthermore, while up to 3.5 V, the maximum power rating of the nanotube electrodes increased as a function of the cell-voltage squared, beyond 3.5 V, a decline in power was observed as a result of depletion of the electrolyte's ions. (author)

  1. Size-dependent dynamic stability analysis of microbeams actuated by piezoelectric voltage based on strain gradient elasticity theory

    Energy Technology Data Exchange (ETDEWEB)

    Sahmani, Saeid; Bahrami, Mohsen [Amirkabir University of Technology, Tehran (Iran, Islamic Republic of)

    2015-01-15

    In the current paper, dynamic stability analysis of microbeams subjected to piezoelectric voltage is presented in which the microbeam is integrated with piezoelectric layers on the lower and upper surfaces. Both of the flutter and divergence instabilities of microbeams with clamped-clamped and clamped-free boundary conditions are predicted corresponding to various values of applied voltage. To take size effect into account, the classical Timoshenko beam theory in conjunction with strain gradient elasticity theory is utilized to develop nonclassical beam model containing three additional internal length scale parameters. By using Hamilton's principle, the higher-order governing differential equations and associated boundary conditions are derived. Afterward, generalized differential quadrature method is employed to discretize the size-dependent governing differential equations along with clamped-clamped and clamped-free end supports. The critical piezoelectric voltages corresponding to various values dimensionless length scale parameter are evaluated and compared with those predicted by the classical beam theory. It is revealed that in the case of clamped-free boundary conditions, the both of flutter and divergence instabilities occur. However, for the clamped-clamped microbeams, only divergence instability takes place.

  2. Origin of the transition voltage in gold–vacuum–gold atomic junctions

    KAUST Repository

    Wu, Kunlin

    2012-12-13

    The origin and the distance dependence of the transition voltage of gold-vacuum-gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold-vacuum-gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold-vacuum-gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. © 2013 IOP Publishing Ltd.

  3. Method to minimize the low-frequency neutral-point voltage oscillations with time-offset injection for neutral-point-clamped inverters

    DEFF Research Database (Denmark)

    Choi, Uimin; Lee, Kyo-Beum; Blaabjerg, Frede

    2013-01-01

    This paper proposes a method to reduce the low-frequency neutral-point voltage oscillations. The neutral-point voltage oscillations are considerably reduced by adding a time-offset to the three phase turn-on times. The proper time-offset is simply calculated considering the phase currents and dwell...

  4. DC dynamic pull-in predictions for a generalized clamped–clamped micro-beam based on a continuous model and bifurcation analysis

    International Nuclear Information System (INIS)

    Chao, Paul C-P; Chiu, C W; Liu, Tsu-Hsien

    2008-01-01

    This study is devoted to providing precise predictions of the dc dynamic pull-in voltages of a clamped–clamped micro-beam based on a continuous model. A pull-in phenomenon occurs when the electrostatic force on the micro-beam exceeds the elastic restoring force exerted by beam deformation, leading to contact between the actuated beam and bottom electrode. DC dynamic pull-in means that an instantaneous application of the voltage (a step function such as voltage) is applied. To derive the pull-in voltage, a dynamic model in partial differential equations is established based on the equilibrium among beam flexibility, inertia, residual stress, squeeze film, distributed electrostatic forces and its electrical field fringing effects. The method of Galerkin decomposition is then employed to convert the established system equations into reduced discrete modal equations. Considering lower-order modes and approximating the beam deflection by a different order series, bifurcation based on phase portraits is conducted to derive static and dynamic pull-in voltages. It is found that the static pull-in phenomenon follows dynamic instabilities, and the dc dynamic pull-in voltage is around 91–92% of the static counterpart. However, the derived dynamic pull-in voltage is found to be dependent on the varied beam parameters, different from a fixed predicted value derived in past works, where only lumped models are assumed. Furthermore, accurate closed-form predictions are provided for non-narrow beams. The predictions are finally validated by finite element analysis and available experimental data

  5. Effect of non-uniform Hall parameter on the electrode voltage drop in Faraday-type combustion MHD generators

    International Nuclear Information System (INIS)

    Gupta, G.P.; Rohatgi, V.K.

    1982-01-01

    Following a simplified approach, an expression is derived for the gas-dynamic voltage drop in a finitely segmented Faraday-type combustion MHD generator, taking into account the non-uniform Hall parameter across the channel. Combining the electrical sheath voltage drop, discussed briefly, with the gas-dynamic voltage drop, the effect of a non-uniform Hall parameter on the electrode voltage drop is studied using the theoretical and experimental input parameters of the Indian MHD channel test. The condition for the validity of the usual assumption of uniform Hall parameter across the channel is pointed out. Analysis of the measured electrode voltage drop predicts the real gas conductivity in the core to be in the range of 60 to 75 per cent of the theoretically calculated core conductivity. (author)

  6. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Directory of Open Access Journals (Sweden)

    Sameera Dharia

    2011-02-01

    Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  7. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Science.gov (United States)

    Dharia, Sameera; Rabbitt, Richard D

    2011-02-28

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  8. Multi-mode excitation of a clamped–clamped microbeam resonator

    KAUST Repository

    Younis, Mohammad I.

    2015-02-18

    We present modeling and simulation of the nonlinear dynamics of a microresonator subjected to two-source electrostatic excitation. The resonator is composed of a clamped–clamped beam excited by a DC voltage load superimposed to two AC voltage loads of different frequencies. One frequency is tuned close to the first natural frequency of the beam and the other is close to the third (second symmetric) natural frequency. A multi-mode Galerkin procedure is applied to extract a reduced-order model, which forms the basis of the numerical simulations. Time history response, Poincare’ sections, Fast Fourier Transforms FFT, and bifurcation diagrams are used to reveal the dynamics of the system. The results indicate complex nonlinear phenomena, which include quasiperiodic motion, torus bifurcations, and modulated chaotic attractors.

  9. Transition voltages of vacuum-spaced and molecular junctions with Ag and Pt electrodes

    KAUST Repository

    Wu, Kunlin; Bai, Meilin; Sanvito, Stefano; Hou, Shimin

    2014-01-01

    The transition voltage of vacuum-spaced and molecular junctions constructed with Ag and Pt electrodes is investigated by non-equilibrium Green's function formalism combined with density functional theory. Our calculations show that, similarly

  10. Two-dimensional threshold voltage model and design considerations for gate electrode work function engineered recessed channel nanoscale MOSFET: I

    International Nuclear Information System (INIS)

    Chaujar, Rishu; Kaur, Ravneet; Gupta, Mridula; Gupta, R S; Saxena, Manoj

    2009-01-01

    This paper discusses a threshold voltage model for novel device structure: gate electrode work function engineered recessed channel (GEWE-RC) nanoscale MOSFET, which combines the advantages of both RC and GEWE structures. In part I, the model accurately predicts (a) surface potential, (b) threshold voltage and (c) sub-threshold slope for single material gate recessed channel (SMG-RC) and GEWE-RC structures. Part II focuses on the development of compact analytical drain current model taking into account the transition regimes from sub-threshold to saturation. Furthermore, the drain conductance evaluation has also been obtained, reflecting relevance of the proposed device for analogue design. The analysis takes into account the effect of gate length and groove depth in order to develop a compact model suitable for device design. The analytical results predicted by the model confirm well with the simulated results. Results in part I also provide valuable design insights in the performance of nanoscale GEWE-RC MOSFET with optimum threshold voltage and negative junction depth (NJD), and hence serves as a tool to optimize important device and technological parameters for 40 nm technology

  11. High voltage distributions in RPCs

    International Nuclear Information System (INIS)

    Inoue, Y.; Muranishi, Y.; Nakamura, M.; Nakano, E.; Takahashi, T.; Teramoto, Y.

    1996-01-01

    High voltage distributions on the inner surfaces of RPCs electrodes were calculated by using a two-dimensional resistor network model. The calculated result shows that the surface resistivity of the electrodes should be high, compared to their volume resistivity, to get a uniform high voltage over the surface. Our model predicts that the rate capabilities of RPCs should be inversely proportional to the thickness of the electrodes if the ratio of surface-to-volume resistivity is low. (orig.)

  12. Low Energy Desalination Using Battery Electrode Deionization

    KAUST Repository

    Kim, Taeyoung

    2017-09-21

    New electrochemical technologies that use capacitive or battery electrodes are being developed to minimize energy requirements for desalinating brackish waters. When a pair of electrodes is charged in capacitive deionization (CDI) systems, cations bind to the cathode and anions bind to the anode, but high applied voltages (>1.2 V) result in parasitic reactions and irreversible electrode oxidation. In the battery electrode deionization (BDI) system developed here, two identical copper hexacyanoferrate (CuHCF) battery electrodes were used that release and bind cations, with anion separation occurring via an anion exchange membrane. The system used an applied voltage of 0.6 V, which avoided parasitic reactions, achieved high electrode desalination capacities (up to 100 mg-NaCl/g-electrode, 50 mM NaCl influent), and consumed less energy than CDI. Simultaneous production of desalinated and concentrated solutions in two channels avoided a two-cycle approach needed for CDI. Stacking additional membranes between CuHCF electrodes (up to three anion and two cation exchange membranes) reduced energy consumption to only 0.02 kWh/m3 (approximately an order of magnitude lower than values reported for CDI), for an influent desalination similar to CDI (25 mM decreased to 17 mM). These results show that BDI could be effective as a very low energy method for brackish water desalination.

  13. Duo-Active-Neutral-Point-Clamped Multilevel Converter: An Exploration of the Fundamental Topology and Experimental Verification

    DEFF Research Database (Denmark)

    Dargahi, Vahid; Corzine, Keith A.; Enslin, Johan H.

    2018-01-01

    For medium-voltage (MV) industrial applications such as the HVDC and adjustable-speed ac-motor drives, the multilevel voltage-source converters are deemed the predominant topologies. One of the promising derived-topologies from the neutral-point-clamped (NPC) configuration is the active NPC (ANPC......) structure with an improved balanced lossdistribution performance. This paper introduces duo-ANPC (D-ANPC) converter topology, which is controlled with a new modulation technique. The suggested control method regulates the flying capacitor (FC) voltages naturally at their reference values and preserves...

  14. Modulation Methods for Neutral-Point-Clamped Wind Power Converter Achieving Loss and Thermal Redistribution Under Low-Voltage Ride-Through

    DEFF Research Database (Denmark)

    Ma, Ke; Blaabjerg, Frede

    2014-01-01

    The three-level neutral-point (NP)-clamped (3L-NPC) converter is a promising multilevel topology in the application of megawatt wind power generation systems. However, the growing requirements by grid codes may impose high stress and even give reliability problem to this converter topology......, with the proposed modulation methods, the thermal distribution in the 3L-NPC wind power inverter undergoing LVRT becomes more equal, and the junction temperature of the most stressed devices can be also relieved. Also, the control ability of the dc-bus NP potential, which is one of the crucial considerations...

  15. A multi-electrode and pre-deformed bilayer spring structure electrostatic attractive MEMS actuator with large stroke at low actuation voltage

    International Nuclear Information System (INIS)

    Hu, Fangrong; Li, Zhi; Xiong, Xianming; Niu, Junhao; Peng, Zhiyong; Qian, Yixian; Yao, Jun

    2012-01-01

    This paper presents a multi-electrode and pre-deformed bilayer spring structure electrostatic attractive microelectromechanical systems (MEMS) actuator; it has large stroke at relatively low actuation voltage. Generally, electrostatic-attractive-force-based actuators have small stroke due to the instability resulted from the electrostatic ‘pull-in’ phenomenon. However, in many applications, the electrostatic micro-actuator with large stroke at low voltage is more preferred. By introducing a multi-electrode and a pre-deformed bilayer spring structure, an electrostatic attractive MEMS actuator with large stroke at very low actuation voltage has been successfully demonstrated in this paper. The actuator contains a central plate with a size of 300 µm × 300 µm × 1.5 µm and it is supported by four L-shaped bilayer springs which are pre-deformed due to residual stresses. Each bilayer spring is simultaneously attracted by three adjacent fixed electrodes, and the factors affecting the electrostatic attractive force are analyzed by a finite element analysis method. The prototype of the actuator is fabricated by poly-multi-user-MEMS-process (PolyMUMP) and the static performance is tested using a white light interferometer. The measured stroke of the actuator reaches 2 µm at 13 V dc, and it shows a good agreement with the simulation. (paper)

  16. Pulsed voltage deposited lead selenide thin film as efficient counter electrode for quantum-dot-sensitized solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Bin Bin [Key Laboratory of Macromolecular Science of Shaanxi Province & School of Materials Science and Engineering, Shaanxi Normal University, Xi’an 710062 (China); Department of Chemical Engineering, Institute of Chemical Industry, Shaanxi Institute of Technology, Xi’an 710300 (China); Wang, Ye Feng [Key Laboratory of Macromolecular Science of Shaanxi Province & School of Materials Science and Engineering, Shaanxi Normal University, Xi’an 710062 (China); Wang, Xue Qing [Faculty of Chemical, Environmental and Biological Science and Technology, Dalian University of Technology, Dalian 116024 (China); Zeng, Jing Hui, E-mail: jhzeng@ustc.edu [Key Laboratory of Macromolecular Science of Shaanxi Province & School of Materials Science and Engineering, Shaanxi Normal University, Xi’an 710062 (China)

    2016-04-30

    Highlights: • PbSe thin film is deposited on FTO glass by a pulse voltage electrodeposition method. • The thin film is used as counter electrode (CE) in quantum dot-sensitized solar cell. • Superior electrocatalytic activity and stability in the polysulfide electrolyte is received. • The narrow band gap characteristics and p-type conductivity enhances the cell efficiency. • An efficiency of 4.67% is received for the CdS/CdSe co-sensitized solar cells. - Abstract: Lead selenide (PbSe) thin films were deposited on fluorine doped tin oxide (FTO) glass by a facile one-step pulse voltage electrodeposition method, and used as counter electrode (CE) in CdS/CdSe quantum dot-sensitized solar cells (QDSSCs). A power conversion efficiency of 4.67% is received for the CdS/CdSe co-sensitized solar cells, which is much better than that of 2.39% received using Pt CEs. The enhanced performance is attributed to the extended absorption in the near infrared region, superior electrocatalytic activity and p-type conductivity with a reflection of the incident light at the back electrode in addition. The physical and chemical properties were characterized by X-ray diffraction (XRD), scanning electron microscope (SEM), transmission electron microscopy (TEM), energy-dispersive spectroscopy (EDS), reflectance spectra, electrochemical impedance spectroscopy (EIS) and Tafel polarization measurements. The present work provides a facile pathway to an efficient CE in the QDSSCs.

  17. Niflumic acid alters gating of HCN2 pacemaker channels by interaction with the outer region of S4 voltage sensing domains.

    Science.gov (United States)

    Cheng, Lan; Sanguinetti, Michael C

    2009-05-01

    Niflumic acid, 2-[[3-(trifluoromethyl)phenyl]amino]pyridine-3-carboxylic acid (NFA), is a nonsteroidal anti-inflammatory drug that also blocks or modifies the gating of many ion channels. Here, we investigated the effects of NFA on hyperpolarization-activated cyclic nucleotide-gated cation (HCN) pacemaker channels expressed in X. laevis oocytes using site-directed mutagenesis and the two-electrode voltage-clamp technique. Extracellular NFA acted rapidly and caused a slowing of activation and deactivation and a hyperpolarizing shift in the voltage dependence of HCN2 channel activation (-24.5 +/- 1.2 mV at 1 mM). Slowed channel gating and reduction of current magnitude was marked in oocytes treated with NFA, while clamped at 0 mV but minimal in oocytes clamped at -100 mV, indicating the drug preferentially interacts with channels in the closed state. NFA at 0.1 to 3 mM shifted the half-point for channel activation in a concentration-dependent manner, with an EC(50) of 0.54 +/- 0.068 mM and a predicted maximum shift of -38 mV. NFA at 1 mM also reduced maximum HCN2 conductance by approximately 20%, presumably by direct block of the pore. The rapid onset and state-dependence of NFA-induced changes in channel gating suggests an interaction with the extracellular region of the S4 transmembrane helix, the primary voltage-sensing domain of HCN2. Neutralization (by mutation to Gln) of any three of the outer four basic charged residues in S4, but not single mutations, abrogated the NFA-induced shift in channel activation. We conclude that NFA alters HCN2 gating by interacting with the extracellular end of the S4 voltage sensor domains.

  18. Robotic Automation of In Vivo Two-Photon Targeted Whole-Cell Patch-Clamp Electrophysiology.

    Science.gov (United States)

    Annecchino, Luca A; Morris, Alexander R; Copeland, Caroline S; Agabi, Oshiorenoya E; Chadderton, Paul; Schultz, Simon R

    2017-08-30

    Whole-cell patch-clamp electrophysiological recording is a powerful technique for studying cellular function. While in vivo patch-clamp recording has recently benefited from automation, it is normally performed "blind," meaning that throughput for sampling some genetically or morphologically defined cell types is unacceptably low. One solution to this problem is to use two-photon microscopy to target fluorescently labeled neurons. Combining this with robotic automation is difficult, however, as micropipette penetration induces tissue deformation, moving target cells from their initial location. Here we describe a platform for automated two-photon targeted patch-clamp recording, which solves this problem by making use of a closed loop visual servo algorithm. Our system keeps the target cell in focus while iteratively adjusting the pipette approach trajectory to compensate for tissue motion. We demonstrate platform validation with patch-clamp recordings from a variety of cells in the mouse neocortex and cerebellum. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  19. A Novel High-Frequency Voltage Standing-Wave Ratio-Based Grounding Electrode Line Fault Supervision in Ultra-High Voltage DC Transmission Systems

    Directory of Open Access Journals (Sweden)

    Yufei Teng

    2017-03-01

    Full Text Available In order to improve the fault monitoring performance of grounding electrode lines in ultra-high voltage DC (UHVDC transmission systems, a novel fault monitoring approach based on the high-frequency voltage standing-wave ratio (VSWR is proposed in this paper. The VSWR is defined considering a lossless transmission line, and the characteristics of the VSWR under different conditions are analyzed. It is shown that the VSWR equals 1 when the terminal resistance completely matches the characteristic impedance of the line, and when a short circuit fault occurs on the grounding electrode line, the VSWR will be greater than 1. The VSWR will approach positive infinity under metallic earth fault conditions, whereas the VSWR in non-metallic earth faults will be smaller. Based on these analytical results, a fault supervision criterion is formulated. The effectiveness of the proposed VSWR-based fault supervision technique is verified with a typical UHVDC project established in Power Systems Computer Aided Design/Electromagnetic Transients including DC(PSCAD/EMTDC. Simulation results indicate that the proposed strategy can reliably identify the grounding electrode line fault and has strong anti-fault resistance capability.

  20. Single-Carrier Modulation for Neutral-Point-Clamped Inverters in Three-Phase Transformerless Photovoltaic Systems

    DEFF Research Database (Denmark)

    Guo, Xiaoqiang; Cavalcanti, Marcelo C.; Farias, Alexandre M.

    2013-01-01

    Modulation strategy is one of the most important issues for three-level neutral-point-clamped inverters in three-phase transformerless photovoltaic systems. A challenge for modulation is how to keep the common-mode voltages constant to reduce the leakage currents. A single-carrier modulation...... strategy is proposed. It has a very simple structure, and the common-mode voltages can be kept constant with no need of complex space-vector modulation or multicarrier pulsewidth modulation. Experimental results verify the theoretical analysis and the effectiveness of the presented method....

  1. Voltage stability, bifurcation parameters and continuation methods

    Energy Technology Data Exchange (ETDEWEB)

    Alvarado, F L [Wisconsin Univ., Madison, WI (United States)

    1994-12-31

    This paper considers the importance of the choice of bifurcation parameter in the determination of the voltage stability limit and the maximum power load ability of a system. When the bifurcation parameter is power demand, the two limits are equivalent. However, when other types of load models and bifurcation parameters are considered, the two concepts differ. The continuation method is considered as a method for determination of voltage stability margins. Three variants of the continuation method are described: the continuation parameter is the bifurcation parameter the continuation parameter is initially the bifurcation parameter, but is free to change, and the continuation parameter is a new `arc length` parameter. Implementations of voltage stability software using continuation methods are described. (author) 23 refs., 9 figs.

  2. Electrode Conduction Processes Segmented Electrode-Insulator Ratio Effects in MHD Power Generation Experiments

    Energy Technology Data Exchange (ETDEWEB)

    Pain, H. J.; Fearn, D. G.; Distefano, E. [Imperial College. London (United Kingdom)

    1966-10-15

    (a) Electrode conduction processes have been investigated using a plasma produced in an electromagnetic shock tube operating with argon at 70 {mu}mHg pressure. Complete voltage-current characteristics were obtained by the variation of load and applied voltage. These indicated the existence of two conduction regimes with a complex transition region. In the first regime the current, controlled by ion mobility, rose linearly with voltage to saturate between 10 mA and 1 A depending on conditions. Electrode contamination was significant. The second regime involved large currents controlled by electron mobility and emission from the cathode. The current again increased linearly with voltage and reached 200 A. Observation of induced voltages in transverse magnetic fields and of plasma deceleration in non-uniform fields showed that in the electromagnetic shock tube the plasma was heated predominantly by the driver discharge. Its conductivity was calculated using properties measured by a Langmuir double probe. In both regimes the plasma conductivity was also found from the gradient of the voltage current characteristics using experimental electric field fringing factors and the experimental values were compared with theory. (b) Larger-scale experiments used a combustion-driven shock tube where argon plasma flow, magnetic field and induced current flow were mutually orthogonal. The supersonic flow velocity and thermodynamic parameters of the plasma were accurately known. The electrode channel consisted of a segmented system of 12 electrode pairs with an electrode insulator ratio ranging from 1 to 21, with electrode plus insulator length remaining constant, and with maximum Hall parameter values of unity. Different electrode load combinations (Faraday and Hall generators) have been studied in measuring the power generated and the flow of longitudinal currents between adjacent electrodes. A maximum power of 0,8 MW was obtained, the power output decreasing inversely with the

  3. Electrode Conduction Processes Segmented Electrode-Insulator Ratio Effects in MHD Power Generation Experiments

    International Nuclear Information System (INIS)

    Pain, H.J.; Fearn, D.G.; Distefano, E.

    1966-01-01

    (a) Electrode conduction processes have been investigated using a plasma produced in an electromagnetic shock tube operating with argon at 70 μmHg pressure. Complete voltage-current characteristics were obtained by the variation of load and applied voltage. These indicated the existence of two conduction regimes with a complex transition region. In the first regime the current, controlled by ion mobility, rose linearly with voltage to saturate between 10 mA and 1 A depending on conditions. Electrode contamination was significant. The second regime involved large currents controlled by electron mobility and emission from the cathode. The current again increased linearly with voltage and reached 200 A. Observation of induced voltages in transverse magnetic fields and of plasma deceleration in non-uniform fields showed that in the electromagnetic shock tube the plasma was heated predominantly by the driver discharge. Its conductivity was calculated using properties measured by a Langmuir double probe. In both regimes the plasma conductivity was also found from the gradient of the voltage current characteristics using experimental electric field fringing factors and the experimental values were compared with theory. (b) Larger-scale experiments used a combustion-driven shock tube where argon plasma flow, magnetic field and induced current flow were mutually orthogonal. The supersonic flow velocity and thermodynamic parameters of the plasma were accurately known. The electrode channel consisted of a segmented system of 12 electrode pairs with an electrode insulator ratio ranging from 1 to 21, with electrode plus insulator length remaining constant, and with maximum Hall parameter values of unity. Different electrode load combinations (Faraday and Hall generators) have been studied in measuring the power generated and the flow of longitudinal currents between adjacent electrodes. A maximum power of 0,8 MW was obtained, the power output decreasing inversely with the

  4. Contributions of counter-charge in a potassium channel voltage-sensor domain

    DEFF Research Database (Denmark)

    Pless, Stephan Alexander; Galpin, Jason D; Niciforovic, Ana P

    2011-01-01

    Voltage-sensor domains couple membrane potential to conformational changes in voltage-gated ion channels and phosphatases. Highly coevolved acidic and aromatic side chains assist the transfer of cationic side chains across the transmembrane electric field during voltage sensing. We investigated...... the functional contribution of negative electrostatic potentials from these residues to channel gating and voltage sensing with unnatural amino acid mutagenesis, electrophysiology, voltage-clamp fluorometry and ab initio calculations. The data show that neutralization of two conserved acidic side chains...

  5. Single stage buck-boost DC-AC neutral point clamped inverter

    DEFF Research Database (Denmark)

    Mo, Wei; Loh, Poh Chiang; Andrew, A.

    2012-01-01

    This paper proposes a new single stage buck-boost DC-AC neutral point clamped inverter topology which integrates the cascaded configurations of recently introduced inductor-capacitor-capacitor-transformer impedance source network (by Adamowicz) and classic NPC configuration. As a consequence......, it has enhanced buck-boost functionality and low output voltage distortions compared to the traditional Z-source inverter; it has continuous input current which reduces the source stress and inverter noise; it also contains two built-in capacitors which can block the DC current in the transformer...... windings thus preventing the core from saturation; lowers the voltage stresses and power losses of inverter switches and reduces the sizes of filtering devices and as well as obtains better output performance compared to the original two-level Z-source inverters. A phase disposition pulse width modulation...

  6. Sinusoidal voltage protocols for rapid characterisation of ion channel kinetics.

    Science.gov (United States)

    Beattie, Kylie A; Hill, Adam P; Bardenet, Rémi; Cui, Yi; Vandenberg, Jamie I; Gavaghan, David J; de Boer, Teun P; Mirams, Gary R

    2018-03-24

    Ion current kinetics are commonly represented by current-voltage relationships, time constant-voltage relationships and subsequently mathematical models fitted to these. These experiments take substantial time, which means they are rarely performed in the same cell. Rather than traditional square-wave voltage clamps, we fitted a model to the current evoked by a novel sum-of-sinusoids voltage clamp that was only 8 s long. Short protocols that can be performed multiple times within a single cell will offer many new opportunities to measure how ion current kinetics are affected by changing conditions. The new model predicts the current under traditional square-wave protocols well, with better predictions of underlying currents than literature models. The current under a novel physiologically relevant series of action potential clamps is predicted extremely well. The short sinusoidal protocols allow a model to be fully fitted to individual cells, allowing us to examine cell-cell variability in current kinetics for the first time. Understanding the roles of ion currents is crucial to predict the action of pharmaceuticals and mutations in different scenarios, and thereby to guide clinical interventions in the heart, brain and other electrophysiological systems. Our ability to predict how ion currents contribute to cellular electrophysiology is in turn critically dependent on our characterisation of ion channel kinetics - the voltage-dependent rates of transition between open, closed and inactivated channel states. We present a new method for rapidly exploring and characterising ion channel kinetics, applying it to the hERG potassium channel as an example, with the aim of generating a quantitatively predictive representation of the ion current. We fitted a mathematical model to currents evoked by a novel 8 second sinusoidal voltage clamp in CHO cells overexpressing hERG1a. The model was then used to predict over 5 minutes of recordings in the same cell in response to

  7. Enhanced Buck–Boost Neutral-Point-Clamped Inverters With Simple Capacitive-Voltage Balancing

    DEFF Research Database (Denmark)

    Tan, Kuan Khoon; Gao, Feng; Loh, Poh Chiang

    2010-01-01

    introduced for extending the inverters’ variation range to include voltageboost operation, but they generally require the inclusion of large passive components or have not yet been optimized in terms of waveform quality. The balancing of their capacitive voltages using a simple technique has also not yet...... simultaneously, two new buck–boost NPC inverters with simple capacitive-voltage-balancing capability are proposed. Both inverters are demonstrated to exhibit a doubling of voltage gain, with one of them also shown to produce a better output waveform quality. Simulation and experimental results are provided...

  8. Insulated pipe clamp design

    International Nuclear Information System (INIS)

    Anderson, M.J.; Hyde, L.L.; Wagner, S.E.; Severud, L.K.

    1980-01-01

    Thin wall large diameter piping for breeder reactor plants can be subjected to significant thermal shocks during reactor scrams and other upset events. On the Fast Flux Test Facility, the addition of thick clamps directly on the piping was undesired because the differential metal temperatures between the pipe wall and the clamp could have significantly reduced the pipe thermal fatigue life cycle capabilities. Accordingly, an insulated pipe clamp design concept was developed. The design considerations and methods along with the development tests are presented. Special considerations to guard against adverse cracking of the insulation material, to maintain the clamp-pipe stiffness desired during a seismic event, to minimize clamp restraint on the pipe during normal pipe heatup, and to resist clamp rotation or spinning on the pipe are emphasized

  9. Loss and thermal redistributed modulation methods for three-level neutral-point-clamped wind power inverter undergoing Low Voltage Ride Through

    DEFF Research Database (Denmark)

    Ma, Ke; Blaabjerg, Frede

    2012-01-01

    The three-level neutral-point-clamped (3L-NPC) converter is a promising multilevel topology in the application of mega-watts wind power generation system. However, the growing requirements by grid codes may impose high stress and even give reliability problem to this converter topology. This paper...... modulation methods, the thermal distribution in the 3L-NPC wind power inverter undergoing LVRT becomes more equal, and the junction temperature of the most stressed devices can be also relieved. Also the control ability of DC-bus neutral point potential, which is one of the crucial considerations for the 3L...

  10. Determination of the cathode fall voltage in fluorescent lamps by measurement of the operating voltage

    International Nuclear Information System (INIS)

    Hilscher, A.

    2002-01-01

    A new method for the determination of the cathode fall voltage of fluorescent lamps is shown. The cathode fall voltage can be determined by measurement of the lamp operating voltage at constant lamp wall temperature, constant discharge current and variation of the electrode heating current. Commercial lamps, which do not need to be specially prepared, can be used for the measurement. The results show good correlation to other measurements of the cathode fall voltage at various discharge currents by means of capacitive coupling. The measured values of the cathode fall voltage are used for determining the minimum, target and maximum setting of the sum of the squares of the pin currents of one electrode (the so-called SOS value) as a function of the discharge current in fluorescent lamp dimming. (author)

  11. Battery charger with a capacitor-diode clamped LLC resonant converter

    OpenAIRE

    Tsang, C.; Bingham, C.; Foster, M. P.; Stone, D.; Leech, J.

    2016-01-01

    The paper proposes a novel battery charger through use of\\ud two serially-connected LLC resonant converters. The first\\ud stage utilises a capacitor-diode clamped LLC resonant\\ud converter which allows operation in both constant voltage\\ud (CV) and constant current (CC) modes, as found in most\\ud battery chargers, to be realised, whilst the second stage\\ud provides the necessary gain and line and load regulation. A\\ud design example is included that demonstrates the resulting\\ud converter top...

  12. Real-time management of faulty electrodes in electrical impedance tomography.

    Science.gov (United States)

    Hartinger, Alzbeta E; Guardo, Robert; Adler, Andy; Gagnon, Hervé

    2009-02-01

    Completely or partially disconnected electrodes are a fairly common occurrence in many electrical impedance tomography (EIT) clinical applications. Several factors can contribute to electrode disconnection: patient movement, perspiration, manipulations by clinical staff, and defective electrode leads or electronics. By corrupting several measurements, faulty electrodes introduce significant image artifacts. In order to properly manage faulty electrodes, it is necessary to: 1) account for invalid data in image reconstruction algorithms and 2) automatically detect faulty electrodes. This paper presents a two-part approach for real-time management of faulty electrodes based on the principle of voltage-current reciprocity. The first part allows accounting for faulty electrodes in EIT image reconstruction without a priori knowledge of which electrodes are at fault. The method properly weights each measurement according to its compliance with the principle of voltage-current reciprocity. Results show that the algorithm is able to automatically determine the valid portion of the data and use it to calculate high-quality images. The second part of the approach allows automatic real-time detection of at least one faulty electrode with 100% sensitivity and two faulty electrodes with 80% sensitivity enabling the clinical staff to fix the problem as soon as possible to minimize data loss.

  13. Calculation of Onset Voltage of Sliding Discharge over a Dielectric Barrier

    Directory of Open Access Journals (Sweden)

    Abdel-Salam Mazen

    2016-01-01

    Full Text Available This paper is aimed at calculating the onset voltage of a sliding discharge established between two electrodes at the upper and bottom surfaces of a dielectric barrier plate; named sliding dielectric barrier discharge (SDBD driven by AC voltage during negative half cycle. The onset voltage is based on the condition of self-sustenance of avalanche growth in the vicinity of the stressed electrode. This calls at first for calculation of the electric field in the vicinity of stressed electrode. The dependency of onset voltage on the thickness and permittivity of the dielectric barrier as well as the thickness of the stressed electrode and the inter-electrode spacing between the stressed and ground electrodes is investigated. The obtained results are discussed in the light of gas discharge physics.

  14. Stable operation of a high-power piezoelectric transformer comprising two identical bolt-clamped Langevin-type transducers and a stepped horn

    Science.gov (United States)

    Adachi, Kazunari; Suzuki, Kohei; Shibamata, Yuki

    2018-06-01

    We previously developed a 100 W piezoelectric transformer comprising two identical bolt-clamped Langevin-type transducers (BLTs) and a stepped horn whose cross-sectional area ratio determines the specified step-up voltage transformation ratio. Unlike conventional piezoelectric transformers, this transformer is driven at a frequency quite near its mechanical resonance, and thus can be mechanically held firmly at its clearly identified vibratory node without mechanical energy loss. However, it has been revealed that the high-power operation of the transformer often becomes very unstable owing to the “jumping and dropping” phenomena first found by Takahashi and Hirose [Jpn. J. Appl. Phys. 31, 3055 (1992)]. To avoid this instability, we have investigated the peculiar phenomena, and found that they can be attributed to a heavily distorted electric field inside the piezoelectric ceramic disks of the BLT on the primary side of the transformer being driven by a low-impedance voltage source near the mechanical resonance. The resultant concentration of the electric field leads to the local reversal of piezoelectric polarization in every half period of the vibration, viz., the instability. Consequently, we have developed a scheme for the steady high-power operation of this type of piezoelectric transformer and examined its validity experimentally. The method has eventually improved the linearity and power transfer efficiency of the transformer significantly.

  15. Radial wedge flange clamp

    Science.gov (United States)

    Smith, Karl H.

    2002-01-01

    A radial wedge flange clamp comprising a pair of flanges each comprising a plurality of peripheral flat wedge facets having flat wedge surfaces and opposed and mating flat surfaces attached to or otherwise engaged with two elements to be joined and including a series of generally U-shaped wedge clamps each having flat wedge interior surfaces and engaging one pair of said peripheral flat wedge facets. Each of said generally U-shaped wedge clamps has in its opposing extremities apertures for the tangential insertion of bolts to apply uniform radial force to said wedge clamps when assembled about said wedge segments.

  16. Two distinct voltage-sensing domains control voltage sensitivity and kinetics of current activation in CaV1.1 calcium channels.

    Science.gov (United States)

    Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E

    2016-06-01

    Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms

  17. Charge-pump voltage converter

    Science.gov (United States)

    Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM

    2009-11-03

    A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.

  18. DNA-FET using carbon nanotube electrodes

    International Nuclear Information System (INIS)

    Sasaki, T K; Ikegami, A; Aoki, N; Ochiai, Y

    2006-01-01

    We demonstrate DNA field effect transistor (DNA-FET) using multiwalled carbon nanotube (MWNT) as nano-structural source and drain electrodes. The MWNT electrodes have been fabricated by focused ion-beam bombardment (FIBB). A very short channel, approximately 50 nm, was easily formed between the severed MWNT. The current-voltage (I-V) characteristics of DNA molecules between the MWNT electrodes showed hopping transport property. We have also measured the gate-voltage dependence in the I-V characteristics and found that poly DNA molecules exhibits p-type conduction. The transport of DNA-FET can be explained by two hopping lengths which depend on the range of the source-drain bias voltages

  19. S1 constrains S4 in the voltage sensor domain of Kv7.1 K+ channels.

    Directory of Open Access Journals (Sweden)

    Yoni Haitin

    Full Text Available Voltage-gated K(+ channels comprise a central pore enclosed by four voltage-sensing domains (VSDs. While movement of the S4 helix is known to couple to channel gate opening and closing, the nature of S4 motion is unclear. Here, we substituted S4 residues of Kv7.1 channels by cysteine and recorded whole-cell mutant channel currents in Xenopus oocytes using the two-electrode voltage-clamp technique. In the closed state, disulfide and metal bridges constrain residue S225 (S4 nearby C136 (S1 within the same VSD. In the open state, two neighboring I227 (S4 are constrained at proximity while residue R228 (S4 is confined close to C136 (S1 of an adjacent VSD. Structural modeling predicts that in the closed to open transition, an axial rotation (approximately 190 degrees and outward translation of S4 (approximately 12 A is accompanied by VSD rocking. This large sensor motion changes the intra-VSD S1-S4 interaction to an inter-VSD S1-S4 interaction. These constraints provide a ground for cooperative subunit interactions and suggest a key role of the S1 segment in steering S4 motion during Kv7.1 gating.

  20. Use of the Satinsky clamp for hilar clamping during robotic partial nephrectomy: indications, technique, and multi-center outcomes.

    Science.gov (United States)

    Abdullah, Newaj; Rahbar, Haider; Barod, Ravi; Dalela, Deepansh; Larson, Jeff; Johnson, Michael; Mass, Alon; Zargar, Homayoun; Kaouk, Jihad; Allaf, Mohamad; Bhayani, Sam; Stifelman, Michael; Rogers, Craig

    2017-03-01

    A Satinsky clamp may be a backup option for hilar clamping during robotic partial nephrectomy (RPN) if there are challenges with application of bulldog clamps, but there are potential safety concerns. We evaluate outcomes of RPN using Satinsky vs. bulldog clamps, and provide tips for safe use of the Satinsky as a backup option. Using a multi-center database, we identified 1073 patients who underwent RPN between 2006 and 2013, and had information available about method of hilar clamping (bulldog clamp vs. Satinsky clamp). Patient baseline characteristics, tumor features, and perioperative outcomes were compared between the Satinsky and bulldog clamp groups. A Satinsky clamp was used for hilar clamping in 94 (8.8 %) RPN cases, and bulldog clamps were used in 979 (91.2 %) cases. The use of a Satinsky clamp was associated with greater operative time (198 vs. 175 min, p hilar clamping during challenging RPN cases, but requires careful technique, and was rarely necessary.

  1. Modelling the clamping force distribution among chips in press-pack IGBTs using the finite element method

    DEFF Research Database (Denmark)

    Hasmasan, Adrian Augustin; Busca, Christian; Teodorescu, Remus

    2012-01-01

    In this paper, a FEM (finite element method) based mechanical model for PP (press-pack) IGBTs (insulated gate bipolar transistors) is presented, which can be used to calculate the clamping force distribution among chips under various clamping conditions. The clamping force is an important parameter...... for the chip, because it influences contact electrical resistance, contact thermal resistance and power cycling capability. Ideally, the clamping force should be equally distributed among chips, in order to maximize the reliability of the PP IGBT. The model is built around a hypothetical PP IGBT with 9 chips......, and it has numerous simplifications in order to reduce the simulation time as much as possible. The developed model is used to analyze the clamping force distribution among chips, in various study cases, where uniform and non-uniform clamping pressures are applied on the studied PP IGBT....

  2. Cell-Detection Technique for Automated Patch Clamping

    Science.gov (United States)

    McDowell, Mark; Gray, Elizabeth

    2008-01-01

    A unique and customizable machinevision and image-data-processing technique has been developed for use in automated identification of cells that are optimal for patch clamping. [Patch clamping (in which patch electrodes are pressed against cell membranes) is an electrophysiological technique widely applied for the study of ion channels, and of membrane proteins that regulate the flow of ions across the membranes. Patch clamping is used in many biological research fields such as neurobiology, pharmacology, and molecular biology.] While there exist several hardware techniques for automated patch clamping of cells, very few of those techniques incorporate machine vision for locating cells that are ideal subjects for patch clamping. In contrast, the present technique is embodied in a machine-vision algorithm that, in practical application, enables the user to identify good and bad cells for patch clamping in an image captured by a charge-coupled-device (CCD) camera attached to a microscope, within a processing time of one second. Hence, the present technique can save time, thereby increasing efficiency and reducing cost. The present technique involves the utilization of cell-feature metrics to accurately make decisions on the degree to which individual cells are "good" or "bad" candidates for patch clamping. These metrics include position coordinates (x,y) in the image plane, major-axis length, minor-axis length, area, elongation, roundness, smoothness, angle of orientation, and degree of inclusion in the field of view. The present technique does not require any special hardware beyond commercially available, off-the-shelf patch-clamping hardware: A standard patchclamping microscope system with an attached CCD camera, a personal computer with an imagedata- processing board, and some experience in utilizing imagedata- processing software are all that are needed. A cell image is first captured by the microscope CCD camera and image-data-processing board, then the image

  3. The LMF triaxial MITL voltage adder system

    International Nuclear Information System (INIS)

    Mazarakis, M.G.; Smith, D.L.; Bennett, L.F.; Lockner, T.R.; Olson, R.E.; Poukey, J.W.

    1992-01-01

    The light-ion microfusion driver design consists of multiple accelerating modules fired in coincidence and sequentially in order to provide the desired ion energy, power pulse shape and energy deposition uniformity on an Inertial Confinement Fusion (ICF) target. The basic energy source is a number of Marx generators which, through the appropriate pulse power conditioning, provide the necessary voltage pulse wave form to the accelerating gaps or feeds of each module. The cavity gaps are inductively isolated, and the voltage addition occurs in the center conductor of the voltage adder which is the positive electrode while the electrons of the sheath flow closer to the outer cylinder which is the magnetically insulated cathode electrode. Each module powers a separate two-stage extraction diode which provides a low divergence ion beam. In order to provide the two separate voltage pulses required by the diode, a triaxial adder system is designed for each module. The voltage addition occurs in two separate MITLs. The center hollow cylinder (anode) of the second MITL also serves as the outer cathode electrode for the extension of the first voltage adder MITL. The voltage of the second stage is about twice that of the first stage. The cavities are connected in series to form the outer cylinder of each module. The accelerating modules are positioned radially in a symmetrical way around the fusion chamber. A preliminary conceptual design of the LMF modules with emphasis on the voltage adders and extension MITLs will be presented and discussed

  4. Understanding capacity fade in silicon based electrodes for lithium-ion batteries using three electrode cells and upper cut-off voltage studies

    Science.gov (United States)

    Beattie, Shane D.; Loveridge, M. J.; Lain, Michael J.; Ferrari, Stefania; Polzin, Bryant J.; Bhagat, Rohit; Dashwood, Richard

    2016-01-01

    Commercial Li-ion batteries are typically cycled between 3.0 and 4.2 V. These voltages limits are chosen based on the characteristics of the cathode (e.g. lithium cobalt oxide) and anode (e.g. graphite). When alternative anode/cathode chemistries are studied the same cut-off voltages are often, mistakenly, used. Silicon (Si) based anodes are widely studied as a high capacity alternative to graphite for Lithium-ion batteries. When silicon-based anodes are paired with high capacity cathodes (e.g. Lithium Nickel Cobalt Aluminium Oxide; NCA) the cell typically suffers from rapid capacity fade. The purpose of this communication is to understand how the choice of upper cut-off voltage affects cell performance in Si/NCA cells. A careful study of three-electrode cell data will show that capacity fade in Si/NCA cells is due to an ever-evolving silicon voltage profile that pushes the upper voltage at the cathode to >4.4 V (vs. Li/Li+). This behaviour initially improves cycle efficiency, due to liberation of new lithium, but ultimately reduces cycling efficiency, resulting in rapid capacity fade.

  5. Faradic resistance of the electrode/electrolyte interface.

    Science.gov (United States)

    Mayer, S; Geddes, L A; Bourland, J D; Ogborn, L

    1992-09-01

    A new method is used to measure the direct-current (Faradic) resistance of a single electrode/electrolyte interface. The method employs a constant-current pulse and a potential-sensing electrode. By choosing a sufficiently long pulse duration, the voltage between the test and potential-sensing electrode exhibits a three-phase response. In the steady-state phase, the voltage measured is equal to the current flowing through the electrode Faradic resistance and the resistance of the electrolyte between the test and potential-sensing electrode. By measuring this latter resistance with a high-frequency sinusoidal alternating current, the voltage drop in the electrolyte is calculated and subtracted from the voltage measured between the test and potential-sensing electrode, thereby allowing calculation of the Faradic resistance. By plotting the reciprocal of the Faradic resistance against current density and fitting the data points to a third-order polynomial, it is possible to determine the zero-current density (Faradic) resistance. This technique was used to determine the Faradic resistance of electrodes (0.1 cm2) of stainless-steel, platinum, platinum-iridium and rhodium in 0.9 per cent NaCl at 25 degrees. The zero current Faradic resistance is lowest for platinum (30.3 k omega), slightly higher for platinum-iridium (47.6k omega), much higher for rhodium (111k omega) and highest for type 316 stainless-steel (345k omega). In all cases, the Faradic resistance decreases dramatically with increasing current density.

  6. SGK3 Sensitivity of Voltage Gated K+ Channel Kv1.5 (KCNA5

    Directory of Open Access Journals (Sweden)

    Musaab Ahmed

    2016-01-01

    Full Text Available Background: The serum & glucocorticoid inducible kinase isoform SGK3 is a powerful regulator of several transporters, ion channels and the Na+/K+ ATPase. Targets of SGK3 include the ubiquitin ligase Nedd4-2, which is in turn a known regulator of the voltage gated K+ channel Kv1.5 (KCNA5. The present study thus explored whether SGK3 modifies the activity of the voltage gated K+ channel KCNA5, which participates in the regulation of diverse functions including atrial cardiac action potential, activity of vascular smooth muscle cells, insulin release and tumour cell proliferation. Methods: cRNA encoding KCNA5 was injected into Xenopus oocytes with and without additional injection of cRNA encoding wild-type SGK3, constitutively active S419DSGK3, inactive K191NSGK3 and/or wild type Nedd4-2. Voltage gated K+ channel activity was quantified utilizing dual electrode voltage clamp. Results: Voltage gated current in KCNA5 expressing Xenopus oocytes was significantly enhanced by wild-type SGK3 and S419DSGK3, but not by K191NSGK3. SGK3 was effective in the presence of ouabain (1 mM and thus did not require Na+/K+ ATPase activity. Coexpression of Nedd4-2 decreased the voltage gated current in KCNA5 expressing Xenopus oocytes, an effect largely reversed by additional coexpression of SGK3. Conclusion: SGK3 is a positive regulator of KCNA5, which is at least partially effective by abrogating the effect of Nedd4-2.

  7. Gating of the two-pore cation channel AtTPC1 in the plant vacuole is based on a single voltage-sensing domain.

    Science.gov (United States)

    Jaślan, D; Mueller, T D; Becker, D; Schultz, J; Cuin, T A; Marten, I; Dreyer, I; Schönknecht, G; Hedrich, R

    2016-09-01

    The two-pore cation channel TPC1 operates as a dimeric channel in animal and plant endomembranes. Each subunit consists of two homologous Shaker-like halves, with 12 transmembrane domains in total (S1-S6, S7-S12). In plants, TPC1 channels reside in the vacuolar membrane, and upon voltage stimulation, give rise to the well-known slow-activating SV currents. Here, we combined bioinformatics, structure modelling, site-directed mutagenesis, and in planta patch clamp studies to elucidate the molecular mechanisms of voltage-dependent channel gating in TPC1 in its native plant background. Structure-function analysis of the Arabidopsis TPC1 channel in planta confirmed that helix S10 operates as the major voltage-sensing site, with Glu450 and Glu478 identified as possible ion-pair partners for voltage-sensing Arg537. The contribution of helix S4 to voltage sensing was found to be negligible. Several conserved negative residues on the luminal site contribute to calcium binding, stabilizing the closed channel. During evolution of plant TPC1s from two separate Shaker-like domains, the voltage-sensing function in the N-terminal Shaker-unit (S1-S4) vanished. © 2016 German Botanical Society and The Royal Botanical Society of the Netherlands.

  8. Is early cord clamping, delayed cord clamping or cord milking best?

    Science.gov (United States)

    Vatansever, Binay; Demirel, Gamze; Ciler Eren, Elif; Erel, Ozcan; Neselioglu, Salim; Karavar, Hande Nur; Gundogdu, Semra; Ulfer, Gozde; Bahadir, Selcen; Tastekin, Ayhan

    2018-04-01

    To compare the antioxidant status of three cord clamping procedures (early clamping, delayed clamping and milking) by analyzing the thiol-disulfide balance. This randomized controlled study enrolled 189 term infants who were divided into three groups according to the cord clamping procedure: early clamping, delayed clamping and milking. Blood samples were collected from the umbilical arteries immediately after clamping, and the thiol/disulfide homeostasis was analyzed. The native and total thiol levels were significantly (p total thiol ratio was significantly (p = .026) lower in the delayed cord clamping and milking groups compared with the early clamping groups. Early cord clamping causes the production of more disulfide bonds and lower thiol levels, indicating that oxidation reactions are increased in the early cord clamping procedure compared with the delayed cord clamping and milking procedures. The oxidant capacity is greater with early cord clamping than with delayed clamping or cord milking. Delayed cord clamping or milking are beneficial in neonatal care, and we suggest that they be performed routinely in all deliveries.

  9. Water Electrolysis at Different Current - Voltage Regimes

    International Nuclear Information System (INIS)

    Kleperis, J.; Blums, J.; Vanags, M.

    2007-01-01

    Full text: Electrochemical impedance and volt-amperic methods were used to compare an efficiency of water electrolysis for different materials and different electrode configurations. Two and three electrode measurements were made, using standard calomel reference electrode. Non-standard capacitative electrolysis was analyzed in special cell made from cylindrical steel electrodes. Volt-amperic measurements from - 15V to +15V DC didn't indicated the presence of oxidation - reduction reactions when distilled water was used as electrolyte. Impedance measurements showed unusual frequency behavior when the AC voltage increased till 0.5V. Different nickel and carbon electrodes (plate, porous and textile - type) were used to learn classical Faraday electrolysis in strong alkali solutions. Flying increase of current was indicator of the presence of electrolysis, and characteristic potential was used differ between materials accordingly they effectiveness for usage in an electrolyser device. (Aithors)

  10. Gain-clamping techniques in two-stage double-pass L-band EDFA

    Indian Academy of Sciences (India)

    Two designs of long-wavelength band erbium-doped fiber amplifier (L-band. EDFA) for gain clamping in double-pass systems are demonstrated and compared. The first design is based on ring laser technique where a backward amplified spontaneous emis- sion (ASE) from the second stage is routed into the feedback loop ...

  11. Nanofiber electrode and method of forming same

    Energy Technology Data Exchange (ETDEWEB)

    Pintauro, Peter N.; Zhang, Wenjing

    2018-02-27

    In one aspect, a method of forming an electrode for an electrochemical device is disclosed. In one embodiment, the method includes the steps of mixing at least a first amount of a catalyst and a second amount of an ionomer or uncharged polymer to form a solution and delivering the solution into a metallic needle having a needle tip. The method further includes the steps of applying a voltage between the needle tip and a collector substrate positioned at a distance from the needle tip, and extruding the solution from the needle tip at a flow rate such as to generate electrospun fibers and deposit the generated fibers on the collector substrate to form a mat with a porous network of fibers. Each fiber in the porous network of the mat has distributed particles of the catalyst. The method also includes the step of pressing the mat onto a membrane.

  12. Programming voltage reduction in phase change memory cells with tungsten trioxide bottom heating layer/electrode

    International Nuclear Information System (INIS)

    Rao Feng; Song Zhitang; Gong Yuefeng; Wu Liangcai; Feng Songlin; Chen, Bomy

    2008-01-01

    A phase change memory cell with tungsten trioxide bottom heating layer/electrode is investigated. The crystalline tungsten trioxide heating layer promotes the temperature rise in the Ge 2 Sb 2 Te 5 layer which causes the reduction in the reset voltage compared to a conventional phase change memory cell. Theoretical thermal simulation and calculation for the reset process are applied to understand the thermal effect of the tungsten trioxide heating layer/electrode. The improvement in thermal efficiency of the PCM cell mainly originates from the low thermal conductivity of the crystalline tungsten trioxide material.

  13. Statistical Analysis of Partial Discharge Characteristics in Transformer Oil at the “Point-Plane” Electrode at Alternating Voltage

    Directory of Open Access Journals (Sweden)

    Korobeynikov S.M.

    2017-08-01

    Full Text Available In this paper, we consider the problems related to measuring and analyzing the characteristics of partial discharges which are the main instrument for oil-filled high-voltage electrical equipment diagnosing. The experiments on recording of partial discharges in transformer oil have been carried out in the “point-plane” electrode system at alternating current. The instantaneous voltage and the apparent charge have been measured depending on the root-mean-square voltage and the phase angle of partial discharges. This paper aimes at carrying out a statistical analysis of the obtained experimental results, in particular, the construction of a parametric probabilistic model of the dependence of the partial discharge inception voltage distribution on the value of the root-mean-square voltage. It differs from usual discharges which occur in liquid dielectric materials in case of sharp inhomogeneous electrode system. It has been suggested that discharges of a different type are the discharges in gas bubbles that occur when partial discharges in a liquid emerge. This assumption is confirmed by the fact that the number of such discharges increases with increasing the root-mean-square voltage value. It is the main novelty of this paper. This corresponds to the nature of the occurrence of such discharges. After rejecting the observations corresponding to discharges in gas bubbles, a parametric probabilistic model has been constructed. The model obtained makes it possible to determine the probability of partial discharge occurrence in a liquid at a given value of the instantaneous voltage depending on the root-mean-square voltage.

  14. New method for characterizing electron mediators in microbial systems using a thin-layer twin-working electrode cell.

    Science.gov (United States)

    Hassan, Md Mahamudul; Cheng, Ka Yu; Ho, Goen; Cord-Ruwisch, Ralf

    2017-01-15

    Microbial biofilms are significant ecosystems where the existence of redox gradients drive electron transfer often via soluble electron mediators. This study describes the use of two interfacing working electrodes (WEs) to simulate redox gradients within close proximity (250µm) for the detection and quantification of electron mediators. By using a common counter and reference electrode, the potentials of the two WEs were independently controlled to maintain a suitable "voltage window", which enabled simultaneous oxidation and reduction of electron mediators as evidenced by the concurrent anodic and cathodic currents, respectively. To validate the method, the electrochemical properties of different mediators (hexacyanoferrate, HCF, riboflavin, RF) were characterized by stepwise shifting the "voltage window" (ranging between 25 and 200mV) within a range of potentials after steady equilibrium current of both WEs was established. The resulting differences in electrical currents between the two WEs were recorded across a defined potential spectrum (between -1V and +0.5V vs. Ag/AgCl). Results indicated that the technique enabled identification (by the distinct peak locations at the potential scale) and quantification (by the peak of current) of the mediators for individual species as well as in an aqueous mixture. It enabled a precise determination of mid-potentials of the externally added mediators (HCF, RF) and mediators produced by pyocyanin-producing Pseudomonas aeruginosa (WACC 91) culture. The twin working electrode described is particularly suitable for studying mediator-dependent microbial electron transfer processes or simulating redox gradients as they exist in microbial biofilms. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Vivitron 1995, transient voltage simulation, high voltage insulator tests, electric field calculation

    International Nuclear Information System (INIS)

    Frick, G.; Osswald, F.; Heusch, B.

    1996-01-01

    Preliminary investigations showed clearly that, because of the discrete electrode structure of the Vivitron, important overvoltage leading to insulator damage can appear in case of a spark. The first high voltage tests showed damage connected with such events. This fact leads to a severe voltage limitation. This work describes, at first, studies made to understand the effects of transients and the associated over-voltage appearing in the Vivitron. Then we present the high voltage tests made with full size Vivitron components using the CN 6 MV machine as a pilot machine. Extensive field calculations were made. These involve simulations of static stresses and transient overvoltages, on insulating boards and electrodes. This work gave us the solutions for arrangements and modifications in the machine. After application, the Vivitron runs now without any sparks and damage at 20 MV. In the same manner, we tested column insulators of a new design and so we will find out how to get to higher voltages. Electric field calculation around the tie bars connecting the discrete electrodes together showed field enhancements when the voltages applied on the discrete electrodes are not equally distributed. This fact is one of the sources of discharges and voltage limitations. A scenario of a spark event is described and indications are given how to proceed towards higher voltages, in the 30 MV range. (orig.)

  16. The Effect of an Added Mass on the Frequency Shifts of a Clamped-Clamped Microbeam for Bio-Mass Detection

    KAUST Repository

    Bouchaala, Adam M.

    2016-12-05

    We present analytical formulations to calculate the induced resonance frequency shifts of electrically actuated clamped-clamped microbeams due to an added mass. Based on the Euler-Bernoulli beam theory, we investigate the linear dynamic responses of the beams added masses, which are modeled as discrete point masses. Analytical expressions based on perturbation techniques and a one-mode Galerkin approximation are developed to calculate accurately the frequency shifts under a DC voltage as a function of the added mass and position. The analytical results are compared to numerical solution of the eigenvalue problem. Results are shown for the fundamental as well as the higher-order modes of the beams. The results indicate a significant increase in the frequency shift, and hence the sensitivity of detection, when scaling down to nano scale and using higher-order modes.

  17. The Effect of an Added Mass on the Frequency Shifts of a Clamped-Clamped Microbeam for Bio-Mass Detection

    KAUST Repository

    Bouchaala, Adam M.; Nayfeh, Ali H.; Younis, Mohammad I.

    2016-01-01

    We present analytical formulations to calculate the induced resonance frequency shifts of electrically actuated clamped-clamped microbeams due to an added mass. Based on the Euler-Bernoulli beam theory, we investigate the linear dynamic responses of the beams added masses, which are modeled as discrete point masses. Analytical expressions based on perturbation techniques and a one-mode Galerkin approximation are developed to calculate accurately the frequency shifts under a DC voltage as a function of the added mass and position. The analytical results are compared to numerical solution of the eigenvalue problem. Results are shown for the fundamental as well as the higher-order modes of the beams. The results indicate a significant increase in the frequency shift, and hence the sensitivity of detection, when scaling down to nano scale and using higher-order modes.

  18. High performance cermet electrodes

    Science.gov (United States)

    Isenberg, Arnold O.; Zymboly, Gregory E.

    1986-01-01

    Disclosed is a method of increasing the operating cell voltage of a solid oxide electrochemical cell having metal electrode particles in contact with an oxygen-transporting ceramic electrolyte. The metal electrode is heated with the cell, and oxygen is passed through the oxygen-transporting ceramic electrolyte to the surface of the metal electrode particles so that the metal electrode particles are oxidized to form a metal oxide layer between the metal electrode particles and the electrolyte. The metal oxide layer is then reduced to form porous metal between the metal electrode particles and the ceramic electrolyte.

  19. A thermoelectric voltage effect in polyethylene oxide

    International Nuclear Information System (INIS)

    Martin, Bjoern; Wagner, Achim; Kliem, Herbert

    2003-01-01

    The conductivity of polyethylene oxide (PEO) is described with a three-dimensional hopping model considering electrostatic interactions between the ions. Ions fluctuate over energy-barriers in a multi-well potential. To decide whether positive or negative charges are responsible for this conductivity, the thermoelectric voltage is measured. The samples are embedded between two aluminium-electrodes. The oxide on the interface between the electrodes and the PEO serves as a blocking layer. The temperature of each electrode is controlled by a Peltier element. A temperature step is applied to one electrode by changing the temperature of one of the Peltier elements. Due to this temperature gradient, the mobile charges fluctuate thermally activated from the warmer side to the colder side of the sample. The direction of the measured thermoelectric voltage indicates the type of mobile charges. It is found that positive charges are mobile. Further, it is shown that the absolute value of the thermoelectric voltage depends on the energy-barrier heights in the multi-well potential

  20. A thermoelectric voltage effect in polyethylene oxide

    CERN Document Server

    Martin, B; Kliem, H

    2003-01-01

    The conductivity of polyethylene oxide (PEO) is described with a three-dimensional hopping model considering electrostatic interactions between the ions. Ions fluctuate over energy-barriers in a multi-well potential. To decide whether positive or negative charges are responsible for this conductivity, the thermoelectric voltage is measured. The samples are embedded between two aluminium-electrodes. The oxide on the interface between the electrodes and the PEO serves as a blocking layer. The temperature of each electrode is controlled by a Peltier element. A temperature step is applied to one electrode by changing the temperature of one of the Peltier elements. Due to this temperature gradient, the mobile charges fluctuate thermally activated from the warmer side to the colder side of the sample. The direction of the measured thermoelectric voltage indicates the type of mobile charges. It is found that positive charges are mobile. Further, it is shown that the absolute value of the thermoelectric voltage depen...

  1. Influence of squeeze film damping on the higher-order modes of clamped–clamped microbeams

    KAUST Repository

    Alcheikh, Nouha

    2016-05-06

    This paper presents an experimental study and a finite-element analysis of the effect of squeeze film damping on the resonance frequency and quality factor of the higher-order flexure vibrations modes of clamped-clamped microbeams. Viscoelastic and silicon nitride microbeams are fabricated and are electrostatically actuated by various electrode configurations to trigger the first, second, and third modes. The damping characteristic and the resonance frequency of these modes are examined for a wide range of gas pressure and electrostatic voltage loads. The results of the silicon nitride beams and viscoelastic beams are compared. It is found that the intrinsic material loss is the major dissipation mechanism at low pressure for the viscoelastic microbeams, significantly limiting their quality factor. It is also found that while the silicon nitride beams show higher quality factors at the intrinsic and molecular regimes of pressure, due to their low intrinsic loss, their quality factors near atmospheric pressure are lower than those of the viscoelastic microbeams. Further, the higher-order modes of all the beams show much higher quality factors at atmospheric pressure compared to the first mode, which could be promising for operating such resonators in air. Experimental results and finite element model simulations show good agreement for resonance frequency and quality factor for the three studied modes. © 2016 IOP Publishing Ltd.

  2. Two-dimensional Cu2Si sheet: a promising electrode material for nanoscale electronics

    Science.gov (United States)

    Meng Yam, Kah; Guo, Na; Zhang, Chun

    2018-06-01

    Building electronic devices on top of two-dimensional (2D) materials has recently become one of most interesting topics in nanoelectronics. Finding high-performance 2D electrode materials is one central issue in 2D nanoelectronics. In the current study, based on first-principles calculations, we compare the electronic and transport properties of two nanoscale devices. One device consists of two single-atom-thick planar Cu2Si electrodes, and a nickel phthalocyanine (NiPc) molecule in the middle. The other device is made of often-used graphene electrodes and a NiPc molecule. Planer Cu2Si is a new type of 2D material that was recently predicted to exist and be stable under room temperature [11]. We found that at low bias voltages, the electric current through the Cu2Si–NiPc–Cu2Si junction is about three orders higher than that through graphene–NiPc–graphene. Detailed analysis shows that the surprisingly high conductivity of Cu2Si–NiPc–Cu2Si originates from the mixing of the Cu2Si state near Fermi energy and the highest occupied molecular orbital of NiPc. These results suggest that 2D Cu2Si may be an excellent candidate for electrode materials for future nanoscale devices.

  3. Highly selective water channel activity measured by voltage clamp: analysis of planar lipid bilayers reconstituted with purified AqpZ.

    Science.gov (United States)

    Pohl, P; Saparov, S M; Borgnia, M J; Agre, P

    2001-08-14

    Aquaporins are membrane channels selectively permeated by water or water plus glycerol. Conflicting reports have described ion conductance associated with some water channels, raising the question of whether ion conductance is a general property of the aquaporin family. To clarify this question, a defined system was developed to simultaneously measure water permeability and ion conductance. The Escherichia coli water channel aquaporin-Z (AqpZ) was studied, because it is a highly stable tetramer. Planar lipid bilayers were formed from unilamellar vesicles containing purified AqpZ. The hydraulic conductivity of bilayers made from the total extract of E. coli lipids increased 3-fold if reconstituted with AqpZ, but electric conductance was unchanged. No channel activity was detected under voltage-clamp conditions, indicating that less than one in 10(9) transport events is electrogenic. Microelectrode measurements were simultaneously undertaken adjacent to the membrane. Changes in sodium concentration profiles accompanying transmembrane water flow permitted calculation of the activation energies: 14 kcal/mol for protein-free lipid bilayers and 4 kcal/mol for lipid bilayers containing AqpZ. Neither the water permeability nor the electric conductivity exhibited voltage dependence. This sensitive system demonstrated that AqpZ is permeated by water but not charged ions and should permit direct analyses of putative electrogenic properties of other aquaporins.

  4. Trans-Z-source and Γ-Z-source neutral-point-clamped inverters

    DEFF Research Database (Denmark)

    Wei, Mo; Loh, Poh Chiang; Blaabjerg, Frede

    2015-01-01

    Z-source neutral-point-clamped (NPC) inverters are earlier proposed for obtaining voltage buck-boost and three-level switching simultaneously. Their performances are, however, constrained by a trade-off between their input-to-output gain and modulation ratio. This trade-off can lead to high...

  5. Important parameters affecting the cell voltage of aqueous electrical double-layer capacitors

    Science.gov (United States)

    Wu, Tzu-Ho; Hsu, Chun-Tsung; Hu, Chi-Chang; Hardwick, Laurence J.

    2013-11-01

    This study discusses and demonstrates how the open-circuit potential and charges stored in the working potential window on positive and negative electrodes affect the cell voltage of carbon-based electrical double-layer capacitors (EDLCs) in aqueous electrolytes. An EDLC consisting of two activated carbon electrodes is employed as the model system for identifying these key parameters although the potential window of water decomposition can be simply determined by voltammetric methods. First, the capacitive performances of an EDLC with the same charge on positive and negative electrodes are evaluated by cyclic voltammetric, charge-discharge, electrochemical impedance spectroscopic (EIS) analyses, and inductance-capacitance-resistance meter (LCR meter). The principles for obtaining the highest acceptable cell voltage of such symmetric ECs with excellent reversibility and capacitor-like behaviour are proposed. Aqueous charge-balanced EDLCs can be operated as high as 2.0 V with high energy efficiency (about 90%) and only 4% capacitance loss after the 600-cycle stability checking. The necessity of charge balance (but not capacitance balance) for positive and negative electrodes is substantiated from the lower acceptable cell voltage of charge-unbalanced EDLCs.

  6. Dynamic Pull-In Investigation of a Clamped-Clamped Nanoelectromechanical Beam under Ramp-Input Voltage and the Casimir Force

    Directory of Open Access Journals (Sweden)

    Amir R. Askari

    2014-01-01

    Full Text Available The influence of the Casimir excitation on dynamic pull-in instability of a nanoelectromechanical beam under ramp-input voltage is studied. The ramp-input actuation has applications in frequency sweeping of RF-N/MEMS. The presented model is nonlinear due to the inherent nonlinearity of electrostatics and the Casimir excitations as well as the geometric nonlinearity of midplane stretching. A Galerkin based reduced order modeling is utilized. It is found that the calculated dynamic pull-in ramp input voltage leads to dynamic pull-in step input voltage by increasing the slope of voltage-time diagram. This fact is utilized to verify the results of present study.

  7. Pipe clamp effects on thin-walled pipe design

    International Nuclear Information System (INIS)

    Lindquist, M.R.

    1980-01-01

    Clamp induced stresses in FFTF piping are sufficiently large to require structural assessment. The basic principles and procedures used in analyzing FFTF piping at clamp support locations for compliance with ASME Code rules are given. Typical results from a three-dimensional shell finite element pipe model with clamp loads applied over the clamp/pipe contact area are shown. Analyses performed to categorize clamp induced piping loads as primary or secondary in nature are described. The ELCLAMP Computer Code, which performs analyses at clamp locations combining clamp induced stresses with stresses from overall piping system loads, is discussed. Grouping and enveloping methods to reduce the number of individual clamp locations requiring analysis are described

  8. Breast EIT using a new projected image reconstruction method with multi-frequency measurements.

    Science.gov (United States)

    Lee, Eunjung; Ts, Munkh-Erdene; Seo, Jin Keun; Woo, Eung Je

    2012-05-01

    We propose a new method to produce admittivity images of the breast for the diagnosis of breast cancer using electrical impedance tomography(EIT). Considering the anatomical structure of the breast, we designed an electrode configuration where current-injection and voltage-sensing electrodes are separated in such a way that internal current pathways are approximately along the tangential direction of an array of voltage-sensing electrodes. Unlike conventional EIT imaging methods where the number of injected currents is maximized to increase the total amount of measured data, current is injected only twice between two pairs of current-injection electrodes attached along the circumferential side of the breast. For each current injection, the induced voltages are measured from the front surface of the breast using as many voltage-sensing electrodes as possible. Although this electrode configurational lows us to measure induced voltages only on the front surface of the breast,they are more sensitive to an anomaly inside the breast since such an injected current tends to produce a more uniform internal current density distribution. Furthermore, the sensitivity of a measured boundary voltage between two equipotential lines on the front surface of the breast is improved since those equipotential lines are perpendicular to the primary direction of internal current streamlines. One should note that this novel data collection method is different from those of other frontal plane techniques such as the x-ray projection and T-scan imaging methods because we do not get any data on the plane that is perpendicular to the current flow. To reconstruct admittivity images using two measured voltage data sets, a new projected image reconstruction algorithm is developed. Numerical simulations demonstrate the frequency-difference EIT imaging of the breast. The results show that the new method is promising to accurately detect and localize small anomalies inside the breast.

  9. Breast EIT using a new projected image reconstruction method with multi-frequency measurements

    International Nuclear Information System (INIS)

    Lee, Eunjung; Ts, Munkh-Erdene; Seo, Jin Keun; Woo, Eung Je

    2012-01-01

    We propose a new method to produce admittivity images of the breast for the diagnosis of breast cancer using electrical impedance tomography (EIT). Considering the anatomical structure of the breast, we designed an electrode configuration where current-injection and voltage-sensing electrodes are separated in such a way that internal current pathways are approximately along the tangential direction of an array of voltage-sensing electrodes. Unlike conventional EIT imaging methods where the number of injected currents is maximized to increase the total amount of measured data, current is injected only twice between two pairs of current-injection electrodes attached along the circumferential side of the breast. For each current injection, the induced voltages are measured from the front surface of the breast using as many voltage-sensing electrodes as possible. Although this electrode configuration allows us to measure induced voltages only on the front surface of the breast, they are more sensitive to an anomaly inside the breast since such an injected current tends to produce a more uniform internal current density distribution. Furthermore, the sensitivity of a measured boundary voltage between two equipotential lines on the front surface of the breast is improved since those equipotential lines are perpendicular to the primary direction of internal current streamlines. One should note that this novel data collection method is different from those of other frontal plane techniques such as the x-ray projection and T-scan imaging methods because we do not get any data on the plane that is perpendicular to the current flow. To reconstruct admittivity images using two measured voltage data sets, a new projected image reconstruction algorithm is developed. Numerical simulations demonstrate the frequency-difference EIT imaging of the breast. The results show that the new method is promising to accurately detect and localize small anomalies inside the breast. (paper)

  10. Triple voltage dc-to-dc converter and method

    Science.gov (United States)

    Su, Gui-Jia

    2008-08-05

    A circuit and method of providing three dc voltage buses and transforming power between a low voltage dc converter and a high voltage dc converter, by coupling a primary dc power circuit and a secondary dc power circuit through an isolation transformer; providing the gating signals to power semiconductor switches in the primary and secondary circuits to control power flow between the primary and secondary circuits and by controlling a phase shift between the primary voltage and the secondary voltage. The primary dc power circuit and the secondary dc power circuit each further comprising at least two tank capacitances arranged in series as a tank leg, at least two resonant switching devices arranged in series with each other and arranged in parallel with the tank leg, and at least one voltage source arranged in parallel with the tank leg and the resonant switching devices, said resonant switching devices including power semiconductor switches that are operated by gating signals. Additional embodiments having a center-tapped battery on the low voltage side and a plurality of modules on both the low voltage side and the high voltage side are also disclosed for the purpose of reducing ripple current and for reducing the size of the components.

  11. Multifrequency excitation of a clamped–clamped microbeam: Analytical and experimental investigation

    KAUST Repository

    Jaber, Nizar

    2016-03-14

    Using partial electrodes and a multifrequency electrical source, we present a large-bandwidth, large-amplitude clamped–clamped microbeam resonator excited near the higher order modes of vibration. We analytically and experimentally investigate the nonlinear dynamics of the microbeam under a two-source harmonic excitation. The first-frequency source is swept around the first three modes of vibration, whereas the second source frequency remains fixed. New additive and subtractive resonances are demonstrated. We illustrated that by properly tuning the frequency and amplitude of the excitation force, the frequency bandwidth of the resonator is controlled. The microbeam is fabricated using polyimide as a structural layer coated with nickel from the top and chromium and gold layers from the bottom. Using the Galerkin method, a reduced order model is derived to simulate the static and dynamic response of the device. A good agreement between the theoretical and experimental data are reported.

  12. Multifrequency excitation of a clamped–clamped microbeam: Analytical and experimental investigation

    KAUST Repository

    Jaber, Nizar; Ramini, Abdallah; Younis, Mohammad I.

    2016-01-01

    Using partial electrodes and a multifrequency electrical source, we present a large-bandwidth, large-amplitude clamped–clamped microbeam resonator excited near the higher order modes of vibration. We analytically and experimentally investigate the nonlinear dynamics of the microbeam under a two-source harmonic excitation. The first-frequency source is swept around the first three modes of vibration, whereas the second source frequency remains fixed. New additive and subtractive resonances are demonstrated. We illustrated that by properly tuning the frequency and amplitude of the excitation force, the frequency bandwidth of the resonator is controlled. The microbeam is fabricated using polyimide as a structural layer coated with nickel from the top and chromium and gold layers from the bottom. Using the Galerkin method, a reduced order model is derived to simulate the static and dynamic response of the device. A good agreement between the theoretical and experimental data are reported.

  13. In-situ experimental characterization of the clamping pressure effects on low temperature polymer electrolyte membrane electrolysis

    DEFF Research Database (Denmark)

    Al Shakhshir, Saher; Cui, Xiaoti; Frensch, Steffen Henrik

    2017-01-01

    as a gas with the circulating water. The effects of clamping pressure (Pc) on the LT-PEME cell performance, polarization resistances, and hydrogen and water crossover through the membrane, and hydrogen and oxygen production rate are studied. A 50 cm2 active area LT-PEME cell designed and manufactured......-PEME splits water into hydrogen and oxygen when the voltage is applied between anode and cathode. Electrical current forces the positively charged ions to migrate to negatively charged cathode through PEM, where hydrogen is produced. Meanwhile, oxygen is produced at the anode side electrode and escapes...... in house is utilized in this work. Higher Pc has shown higher cell performance this refers to lower ohmic and activation resistances. Water crossover from anode to cathode is slightly decreased at higher Pc resulting in a slight decrease in hydrogen crossover from cathode to anode. Also, the percentage...

  14. Four- year thyroidectomy procedures: Ligasure Vs. clamp & tie

    Directory of Open Access Journals (Sweden)

    Pazoki AR

    2010-01-01

    Full Text Available "n Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:Arial; mso-bidi-theme-font:minor-bidi;} Background: The electrothermal bipolar vessel sealing system is an adjunct to the hemostatic technique, which has been successfully used in many abdominal operation, recently made available to thyroid surgery. The purpose of this was compare the outcomes of new hemostatic technique with traditional method of clamp and tie."n"nMethods: In this retrospective cross-sectional study has been done in surgery's wards of Milad & Rasul- Akram hospitals in Tehran, Iran. During three- year period between 2005-2008 all patients with different kind of pathology that need operation were assessed. Time duration of surgery and hospital stay and post surgery complication in two group, ligasure (n=45 and clamp & tie (n=145 were compared with each others."n"nResults: No difference was seen between two groups in time duration of surgery. Significant difference was seen in hospital stay and complications of surgery. Time of operation in Ligasure group was 132/22 minute and in clamp and tie group was 130/10 minute. There was found significant difference in duration of hospital stay and postoperative complication. Hypocalcemia were seen in two and 24 cases in Ligasure and Clamp & Tie group, respectively (p<0.05. Hospital stay was 2

  15. Gate voltage and drain current stress instabilities in amorphous In–Ga–Zn–O thin-film transistors with an asymmetric graphene electrode

    Directory of Open Access Journals (Sweden)

    Joonwoo Kim

    2015-09-01

    Full Text Available The gate voltage and drain current stress instabilities in amorphous In–Ga–Zn–O thin-film transistors (a-IGZO TFTs having an asymmetric graphene electrode structure are studied. A large positive shift in the threshold voltage, which is well fitted to a stretched-exponential equation, and an increase in the subthreshold slope are observed when drain current stress is applied. This is due to an increase in temperature caused by power dissipation in the graphene/a-IGZO contact region, in addition to the channel region, which is different from the behavior in a-IGZO TFTs with a conventional transparent electrode.

  16. Allosteric substrate switching in a voltage-sensing lipid phosphatase.

    Science.gov (United States)

    Grimm, Sasha S; Isacoff, Ehud Y

    2016-04-01

    Allostery provides a critical control over enzyme activity, biasing the catalytic site between inactive and active states. We found that the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP), which modifies phosphoinositide signaling lipids (PIPs), has not one but two sequential active states with distinct substrate specificities, whose occupancy is allosterically controlled by sequential conformations of the voltage-sensing domain (VSD). Using fast fluorescence resonance energy transfer (FRET) reporters of PIPs to monitor enzyme activity and voltage-clamp fluorometry to monitor conformational changes in the VSD, we found that Ci-VSP switches from inactive to a PIP3-preferring active state when the VSD undergoes an initial voltage-sensing motion and then into a second PIP2-preferring active state when the VSD activates fully. This two-step allosteric control over a dual-specificity enzyme enables voltage to shape PIP concentrations in time, and provides a mechanism for the complex modulation of PIP-regulated ion channels, transporters, cell motility, endocytosis and exocytosis.

  17. Prediction of breakdown voltages in novel gases for high voltage insulation

    International Nuclear Information System (INIS)

    Koch, M.

    2015-01-01

    This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF_6) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF_6 is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF_6 in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF_6 based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media

  18. Driving Pressure Influence in Voltage Maps Measurement Process Using Advanced Pneumatic Mapping Probe

    Directory of Open Access Journals (Sweden)

    Marek Kukucka

    2016-01-01

    Full Text Available Our paper deals with the method of the voltage-impedance map measurement process as a method useful for the electric mapping of human skin. The area of research extends from the basic research to its practical application in acupuncture skin mapping and acupuncture point localization and visualization. The problem of sufficient skin coverage and electrical contact with measuring electrodes is solved by the conventional mechanical telescopic electrodes and by the pneumatic matrix electrode probe. A 2D or 3D voltage-impedance map of skin is an output of the measuring, interpretation and evaluation process. New pneumatic construction of measuring probe was implemented to achieve a better coverage of specified skin area and get a reduced force range of the touching electrodes allowing the steady contact of the skin-electrode. A skin contact is related to the driving pressure of touching electrodes. Our paper offers experimentally measured results, voltage maps of skin on specific areas, selected measured and described acupuncture points and their applications in electro-acupuncture.

  19. Current-voltage characteristics of single-molecule diarylethene junctions measured with adjustable gold electrodes in solution.

    Science.gov (United States)

    Briechle, Bernd M; Kim, Youngsang; Ehrenreich, Philipp; Erbe, Artur; Sysoiev, Dmytro; Huhn, Thomas; Groth, Ulrich; Scheer, Elke

    2012-01-01

    We report on an experimental analysis of the charge transport through sulfur-free photochromic molecular junctions. The conductance of individual molecules contacted with gold electrodes and the current-voltage characteristics of these junctions are measured in a mechanically controlled break-junction system at room temperature and in liquid environment. We compare the transport properties of a series of molecules, labeled TSC, MN, and 4Py, with the same switching core but varying side-arms and end-groups designed for providing the mechanical and electrical contact to the gold electrodes. We perform a detailed analysis of the transport properties of TSC in its open and closed states. We find rather broad distributions of conductance values in both states. The analysis, based on the assumption that the current is carried by a single dominating molecular orbital, reveals distinct differences between both states. We discuss the appearance of diode-like behavior for the particular species 4Py that features end-groups, which preferentially couple to the metal electrode by physisorption. We show that the energetic position of the molecular orbital varies as a function of the transmission. Finally, we show for the species MN that the use of two cyano end-groups on each side considerably enhances the coupling strength compared to the typical behavior of a single cyano group.

  20. Current–voltage characteristics of single-molecule diarylethene junctions measured with adjustable gold electrodes in solution

    Directory of Open Access Journals (Sweden)

    Bernd M. Briechle

    2012-11-01

    Full Text Available We report on an experimental analysis of the charge transport through sulfur-free photochromic molecular junctions. The conductance of individual molecules contacted with gold electrodes and the current–voltage characteristics of these junctions are measured in a mechanically controlled break-junction system at room temperature and in liquid environment. We compare the transport properties of a series of molecules, labeled TSC, MN, and 4Py, with the same switching core but varying side-arms and end-groups designed for providing the mechanical and electrical contact to the gold electrodes. We perform a detailed analysis of the transport properties of TSC in its open and closed states. We find rather broad distributions of conductance values in both states. The analysis, based on the assumption that the current is carried by a single dominating molecular orbital, reveals distinct differences between both states. We discuss the appearance of diode-like behavior for the particular species 4Py that features end-groups, which preferentially couple to the metal electrode by physisorption. We show that the energetic position of the molecular orbital varies as a function of the transmission. Finally, we show for the species MN that the use of two cyano end-groups on each side considerably enhances the coupling strength compared to the typical behavior of a single cyano group.

  1. A Voltage Quality Detection Method

    DEFF Research Database (Denmark)

    Chen, Zhe; Wei, Mu

    2008-01-01

    This paper presents a voltage quality detection method based on a phase-locked loop (PLL) technique. The technique can detect the voltage magnitude and phase angle of each individual phase under both normal and fault power system conditions. The proposed method has the potential to evaluate various...

  2. Multifrequency Excitation of a Clamped-Clamped Microbeam

    KAUST Repository

    Jaber, Nizar R.

    2016-01-20

    We present analytical and experimental investigation of an electrically actuated clamped-clamped microbeam under a twosource harmonic excitation. The first frequency is swept around the first mode of vibration where the second one is fixed. These microbeams are fabricated using polyimide as structural layer coated with nickel form top and chromium and gold layers from bottom. We demonstrate the excitation of additive and subtractive type resonance. We show that by properly tuning the frequency and the amplitude of the excitation force, the frequency bandwidth of the resonator is increased. Theoretically, we solved the eigenvalue problem for different axial forces to find the natural frequencies ratio that match the experimental values. Using Galerkin method, a reduced order model is derived to simulate the static and dynamic response of the device where using three symmetric mode shapes provided a good agreement with experimental data. © Copyright 2015 by ASME.

  3. Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

    Science.gov (United States)

    Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

    1988-08-01

    Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

  4. Photovoltaic panel clamp

    Science.gov (United States)

    Mittan, Margaret Birmingham [Oakland, CA; Miros, Robert H. J. [Fairfax, CA; Brown, Malcolm P [San Francisco, CA; Stancel, Robert [Loss Altos Hills, CA

    2012-06-05

    A photovoltaic panel clamp includes an upper and lower section. The interface between the assembled clamp halves and the module edge is filled by a flexible gasket material, such as EPDM rubber. The gasket preferably has small, finger like protrusions that allow for easy insertion onto the module edge while being reversed makes it more difficult to remove them from the module once installed. The clamp includes mounting posts or an integral axle to engage a bracket. The clamp also may include a locking tongue to secure the clamp to a bracket.

  5. Selective Arterial Clamping Versus Hilar Clamping for Minimally Invasive Partial Nephrectomy.

    Science.gov (United States)

    Yezdani, Mona; Yu, Sue-Jean; Lee, David I

    2016-05-01

    Partial nephrectomy has become an accepted treatment of cT1 renal masses as it provides improved long-term renal function compared to radical nephrectomy (Campbell et al. J Urol. 182:1271-9, 2009). Hilar clamping is utilized to help reduce bleeding and improve visibility during tumor resection. However, concern over risk of kidney injury with hilar clamping has led to new techniques to reduce length of warm ischemia time (WIT) during partial nephrectomy. These techniques have progressed over the years starting with early hilar unclamping, controlled hypotension during tumor resection, selective arterial clamping, minimal margin techniques, and off-clamp procedures. Selective arterial clamping has progressed significantly over the years. The main question is what are the exact short- and long-term renal effects from increasing clamp time. Moreover, does it make sense to perform these more time-consuming or more complex procedures if there is no long-term preservation of kidney function? More recent studies have shown no difference in renal function 6 months from surgery when selective arterial clamping or even hilar clamping is employed, although there is short-term improved decline in estimated glomerular filtration rate (eGFR) with selective clamping and off-clamp techniques (Komninos et al. BJU Int. 115:921-8, 2015; Shah et al. 117:293-9, 2015; Kallingal et al. BJU Int. doi: 10.1111/bju.13192, 2015). This paper reviews the progression of total hilar clamping to selective arterial clamping (SAC) and the possible difference its use makes on long-term renal function. SAC may be attempted based on surgeon's decision-making, but may be best used for more complex, larger, more central or hilar tumors and in patients who have renal insufficiency at baseline or a solitary kidney.

  6. The Significance of Breakdown Voltages for Quality Assurance of Low-Voltage BME Ceramic Capacitors

    Science.gov (United States)

    Teverovsky, Alexander A.

    2014-01-01

    Application of thin dielectric, base metal electrode (BME) ceramic capacitors for high-reliability applications requires development of testing procedures that can assure high quality and reliability of the parts. In this work, distributions of breakdown voltages (VBR) in variety of low-voltage BME multilayer ceramic capacitors (MLCCs) have been measured and analyzed. It has been shown that analysis of the distributions can indicate the proportion of defective parts in the lot and significance of the defects. Variations of the distributions after solder dip testing allow for an assessment of the robustness of capacitors to soldering-related stresses. The drawbacks of the existing screening and qualification methods to reveal defects in high-value, low-voltage MLCCs and the importance of VBR measurements are discussed. Analysis has shown that due to a larger concentration of oxygen vacancies, defect-related degradation of the insulation resistance (IR) and failures are more likely in BME compared to the precious metal electrode (PME) capacitors.

  7. Prediction of breakdown voltages in novel gases for high voltage insulation

    Energy Technology Data Exchange (ETDEWEB)

    Koch, M.

    2015-07-01

    This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF{sub 6}) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF{sub 6} is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF{sub 6} in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF{sub 6} based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media.

  8. Alkaline anion exchange membrane water electrolysis: Effects of electrolyte feed method and electrode binder content

    Science.gov (United States)

    Cho, Min Kyung; Park, Hee-Young; Lee, Hye Jin; Kim, Hyoung-Juhn; Lim, Ahyoun; Henkensmeier, Dirk; Yoo, Sung Jong; Kim, Jin Young; Lee, So Young; Park, Hyun S.; Jang, Jong Hyun

    2018-04-01

    Herein, we investigate the effects of catholyte feed method and anode binder content on the characteristics of anion exchange membrane water electrolysis (AEMWE) to construct a high-performance electrolyzer, revealing that the initial AEMWE performance is significantly improved by pre-feeding 0.5 M aqueous KOH to the cathode. The highest long-term activity during repeated voltage cycling is observed for AEMWE operation in the dry cathode mode, for which the best long-term performance among membrane electrode assemblies (MEAs) featuring polytetrafluoroethylene (PTFE) binder-impregnated (5-20 wt%) anodes is detected for a PTFE content of 20 wt%. MEAs with low PTFE content (5 and 9 wt%) demonstrate high initial performance, rapid performance decay, and significant catalyst loss from the electrode during long-term operation, whereas the MEA with 20 wt% PTFE allows stable water electrolysis for over 1600 voltage cycles. Optimization of cell operating conditions (i.e., operation in dry cathode mode at an optimum anode binder content following an initial solution feed) achieves an enhanced water splitting current density (1.07 A cm-2 at 1.8 V) and stable long-term AEMWE performance (0.01% current density reduction per voltage cycle).

  9. Exploiting Stretchable Metallic Springs as Compliant Electrodes for Cylindrical Dielectric Elastomer Actuators (DEAs

    Directory of Open Access Journals (Sweden)

    Chien-Hao Liu

    2017-11-01

    Full Text Available In recent years, dielectric elastomer actuators (DEAs have been widely used in soft robots and artificial bio-medical applications. Most DEAs are composed of a thin dielectric elastomer layer sandwiched between two compliant electrodes. DEAs vary in their design to provide bending, torsional, and stretch/contraction motions under the application of high external voltages. Most compliant electrodes are made of carbon powders or thin metallic films. In situations involving large deformations or improper fabrication, the electrodes are susceptible to breakage and increased resistivity. The worst cases result in a loss of conductivity and functional failure. In this study, we developed a method by which to exploit stretchable metallic springs as compliant electrodes for cylindrical DEAs. This design was inspired by the extensibility of mechanical springs. The main advantage of this approach is the fact that the metallic spring-like compliant electrodes remain conductive and do not increase the stiffness as the tube-like DEAs elongate in the axial direction. This can be attributed to a reduction in thickness in the radial direction. The proposed cylindrical structure is composed of highly-stretchable VHB 4905 film folded within a hollow tube and then sandwiched between copper springs (inside and outside to allow for stretching and contraction in the axial direction under the application of high DC voltages. We fabricated a prototype and evaluated the mechanical and electromechanical properties of the device experimentally using a high-voltage source of 9.9 kV. This device demonstrated a non-linear increase in axial stretching with an increase in applied voltage, reaching a maximum extension of 0.63 mm (axial strain of 2.35% at applied voltage of 9.9 kV. Further miniaturization and the incorporation of compressive springs are expected to allow the implementation of the proposed method in soft micro-robots and bio-mimetic applications.

  10. High Performance ZVT with Bus Clamping Modulation Technique for Single Phase Full Bridge Inverters

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Yinglai; Ayyanar, Raja

    2016-03-20

    This paper proposes a topology based on bus clamping modulation and zero-voltage-transition (ZVT) technique to realize zero-voltage-switching (ZVS) for all the main switches of the full bridge inverters, and inherent ZVS and/or ZCS for the auxiliary switches. The advantages of the strategy include significant reduction in the turn-on loss of the ZVT auxiliary switches which typically account for a major part of the total loss in other ZVT circuits, and reduction in the voltage ratings of auxiliary switches. The modulation scheme and the commutation stages are analyzed in detail. Finally, a 1kW, 500 kHz switching frequency inverter of the proposed topology using SiC MOSFETs has been built to validate the theoretical analysis. The ZVT with bus clamping modulation technique of fixed timing and adaptive timing schemes are implemented in DSP TMS320F28335 resulting in full ZVS for the main switches in the full bridge inverter. The proposed scheme can save up to 33 % of the switching loss compared with no ZVT case.

  11. Design and development of electrical impedance tomography system with 32 electrodes and microcontroller

    Science.gov (United States)

    Ansory, Achmad; Prajitno, Prawito; Wijaya, Sastra Kusuma

    2018-02-01

    Electrical Impedance Tomography (EIT) is an imaging method that is able to estimate electrical impedance distribution inside an object. This EIT system is developed by using 32 electrodes and microcontroller based module. From a pair of electrodes, sinusoidal current of 3 mA is injected and the voltage differences between other pairs of electrodes are measured. Voltage measurement data are then sent to MATLAB and EIDORS software; the data are used to reconstruct two dimensions image. The system can detect and determine the position of a phantom in the tank. The object's position is accurately reconstructed and determined with the average shifting of 0.69 cm but object's area cannot be accurately reconstructed. The object's image is more accurately reconstructed when the object is located near to electrodes, has a larger size, and when the current injected to the system has a frequency of 100 kHz or 200kHz.

  12. Evaluation of clamp effects on LMFBR piping systems

    International Nuclear Information System (INIS)

    Jones, G.L.

    1980-01-01

    Loop-type liquid metal breeder reactor plants utilize thin-wall piping to mitigate through-wall thermal gradients due to rapid thermal transients. These piping loops require a support system to carry the combined weight of the pipe, coolant and insulation and to provide attachments for seismic restraints. The support system examined here utilizes an insulated pipe clamp designed to minimize the stresses induced in the piping. To determine the effect of these clamps on the pipe wall a non-linear, two-dimensional, finite element model of the clamp, insulation and pipe wall was used to determine the clamp/pipe interface load distributions which were then applied to a three-dimensional, finite element model of the pipe. The two-dimensional interaction model was also utilized to estimate the combined clamp/pipe stiffness

  13. Functionality and stability data of detergent purified nAChR from Torpedo using lipidic matrixes and macroscopic electrophysiology

    Directory of Open Access Journals (Sweden)

    Luis F. Padilla-Morales

    2016-03-01

    Full Text Available The presented data provides additional information about the assessment of affinity purified nicotinic acetylcholine receptor (nAChR rich membrane solubilized with long chain (16 saturated carbons lysophospholipid with glycerol headgroup (LFG-16. The assessment of stability and functionality of solubilized membrane protein is a critical step prior to further crystallization trails. One of the key factors for this task is the appropriate choice of a detergent that can support nAChR activity and stability comparable to the crude membranes. The stability of the nAChR-LFG-16 complex incorporated into lipid cubic phase (LCP was monitored for a period of 30 days by means of fluorescence recovery after photobleaching (FRAP and the functionality was evaluated after its incorporation into Xenopus oocyte by means of the two electrode voltage clamp technique. Keywords: Detergents, Fluorescence recovery after photobleaching, Lipidic Cubic Phase, nAChR, Planar lipid bilayer, Two-electrode voltage clamp

  14. Neuroprotective effect of interleukin-6 regulation of voltage-gated Na+ channels of cortical neurons is time- and dose-dependent

    Directory of Open Access Journals (Sweden)

    Wei Xia

    2015-01-01

    Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.

  15. Receivers for processing electron beam pick-up electrode signals

    International Nuclear Information System (INIS)

    Anon.

    1991-01-01

    There are several methods of determining the transverse position of the electron beam, based upon sensing either the electric field, the magnetic field, or both. At the NSLS the transverse beam position monitors each consist of a set of four circular electrodes. There are 48 sets of pick-up electrodes in the X-ray ring and 24 in the VUV storage ring for determining the electron orbit, and a few extra sets installed for specialized purposes. When the beam passes between the four electrodes, charge is induced on each electrode, the amount depending upon the distance of the beam from that electrode. If V a , V b , V c and V d given by a difference between pairs of electrodes normalized for variations in beam current by dividing by the sum of electrode voltages. The method of processing these signals depends upon their time structure. The electrons circulating around the vacuum chamber are concentrated in short bunches within stability buckets produced by the accelerating voltage in the RF cavities. The charges induced on the pickup electrodes then are narrow pulses, a fraction of a nanosecond long, and would result in a monopolar voltage pulses if it were not for the impedance of the cable connecting the electrode to the processing apparatus. The capacitance between each electrode and the chamber wall is only a few picofarads and is effectively in parallel with the cable impedance (50 ohms). Thus an appreciable amount of the charge flows off the electrode while the bunch is between the electrodes, resulting in potential of opposite sign as the bunch is leaving the vicinity of the electrode. The resulting signal consists of a series of bipolar pulses, each of less than one nanosecond duration

  16. Tetrazolyl isoxazole amino acids as ionotropic glutamate receptor antagonists: synthesis, modelling and molecular pharmacology

    DEFF Research Database (Denmark)

    Frølund, Bente; Greenwood, Jeremy R; Holm, Mai Marie

    2005-01-01

    and 1b were pharmacologically characterized in receptor binding assays, and electrophysiologically on homomeric AMPA receptors (GluR1-4), homomeric (GluR5 and GluR6) and heteromeric (GluR6/KA2) kainic acid receptors, using two-electrode voltage-clamped Xenopus laevis oocytes expressing these receptors...

  17. Specific Localization of High-Voltage Discharge in Vicinity of Two Gases

    Science.gov (United States)

    Leonov, Sergey; Shurupov, Michail; Shneider, Michail; Napartovich, Anatoly; Kochetov, Igor

    2011-10-01

    A subject of paper is the appearance and dynamics of sub-microsecond long filamentary high-voltage discharge generated in atmosphere, and in non-homogeneous gaseous media. Typical discharge parameters are: maximal current 1-3kA, breakdown voltage >100 kV, duration 30-100 ns, gap distance 50-100mm. The effect of discharge specific localization within mixing layer of two gases is particularly discussed. The second discussed idea is the filamentary discharge movement within a region with concentration gradient of different components. For the short-pulse discharge the physical mechanism appears as the following. The first stage of the spark breakdown is the multiple streamers propagation from the high-voltage electrode toward the grounded one. In case of high-power electrical source those streamers occupy a huge volume of the gas, covering all possible paths for the further development. The next phase consists of the real selection of the discharge path among the multiple channels with non-zero conductivity. Experiments and calculations are presented for Air-CO2 and Air-C2H4 pairs. The effects found are supposed to be applied for lightning prediction/protection, and for high-speed mixing acceleration. The work was funded through EOARD-ISTC project #3793p. Some part of this work was supported by RFBR grant #10-08-00952.

  18. ß-adrenergic regulation of ion transport in pancreatic ducts: Patch-clamp study of isolated rat pancreatic ducts

    DEFF Research Database (Denmark)

    Novak, I

    1998-01-01

    BACKGROUND & AIMS: In the intact pancreas, bicarbonate secretion is thought to be controlled by a number of regulators, including adrenergic agonists. The aim of this study was to investigate the effects of adrenergic agonists on pancreatic ducts, which are the site of bicarbonate secretion....... METHODS: Small intralobular ducts were isolated from rat pancreas and studied in vitro by the whole-cell patch clamp technique. Cell membrane voltages and currents were indicators of cellular ion transport. In some ducts, intracellular Ca2+ activity was measured by fluorescence optical methods. RESULTS...

  19. Applicability of fiber model in seismic response analysis for center-clamp type bushings on transformers

    International Nuclear Information System (INIS)

    Miyagawa, Yoshinori; Sato, Hiroaki

    2015-01-01

    A bushing is a device for insulation and support of a conductor. Especially it is called center-clamp type when it is connected with a metal holder through clamping force. As a consequence of damage of center-clamp type bushings in Tohoku Earthquake in 2011, refinement of the response analysis method and review of the seismic design procedure became necessary. In the present report, the fiber model, which can evaluate non-linear behavior in the section subjected to axial force and bending moment, was implemented to the CRIEPI's finite element analysis program 'Mastrd' considering following characteristics of center-clamp type bushings. a) The gasket section between a porcelain tube and a metal holder has a torus shape. b) Springs around the top of the bushing give clamping force, but they lock in excessive base rotation. c) The gasket does not resist against tension. d) Local resistance against compression due to bending increases in use of very thin gaskets. The developed program was verified through comparison with the shaking table test result for real bushings whose voltage classes were 154 kV and 275 kV. Deformation indices as rotation angle and base opening due to bending were influenced by damping conditions. Though there was not the condition which brought about remarkable underestimation, reduction of damping for a fiber model element was preferable for safety. On the other hand, bending moment was consistent with experimental results because it tended not to fluctuate in the non-linear region. (author)

  20. Treatment of graphite felt by modified Hummers method for the positive electrode of vanadium redox flow battery

    International Nuclear Information System (INIS)

    Wu, Xiaoxin; Xu, Hongfeng; Shen, Yang; Xu, Pengcheng; Lu, Lu; Fu, Jie; Zhao, Hong

    2014-01-01

    A novel and highly effective treatment based on modified Hummers method was firstly used to improve the electrochemical activity of graphite felt as the positive electrode in all-vanadium redox flow battery (VRFB). The graphite felt was treated by the modified Hummers method and characterized by Fourier transform infrared spectroscopy and scanning electron microscopy. The electrochemical performance of the prepared electrode was evaluated through cyclic voltammetry and electrochemical impedance spectroscopy. Results show that graphite felt treated by modified Hummers method exhibits excellent electrocatalytic activity and reaction rate to vanadium redox couples. In our research, the hydrogen electrode and H 2 replaced the graphite felt and V 2+ /V 3+ couple in the negative side in the VRFB performance test. The coulombic, voltage, and energy efficiencies of the VRFB with the as-prepared electrodes at 50 mA cm −2 are 95.0%, 81.3%, and 77.2%, respectively. These values are much higher than those of the cell-assembled graphite felt electrodes that were conventionally and thermally treated. The graphite felt treated by the modified Hummers method carries more hydrophilic groups, such as–OH, on its defects, which is advantageous in facilitating the redox reaction of vanadium ions, thereby improving the operation efficiency of the vanadium redox flow battery

  1. Active gate driver for dv/dt control and active voltage clamping in an IGBT stack

    DEFF Research Database (Denmark)

    Rasmussen, Tonny Wederberg

    2005-01-01

    For high voltages converters stacks of IGBTs can be used if the static and dynamic voltage sharing among the IGBTs can be applied. dVCE/dt should also be controlled in order not to damage insulation material. This paper describes theory and measurements of an active gate driver for stacking IGBTs....... For the measurements two series connected standard IGBTs made for hard switching applications are used. Problems are shown and proposals for improvements are given....

  2. Voltage uniformity study in large-area reactors for RF plasma deposition

    Energy Technology Data Exchange (ETDEWEB)

    Sansonnens, L.; Pletzer, A.; Magni, D.; Howling, A.A.; Hollenstein, C. [Ecole Polytechnique Federale, Lausanne (Switzerland). Centre de Recherche en Physique des Plasma (CRPP); Schmitt, J.P.M. [Balzers Process Systems, Palaiseau (France)

    1996-09-01

    Non-uniform voltage distribution across the electrode area results in inhomogeneous thin-film RF plasma deposition in large area reactors. In this work, a two-dimensional analytic model for the calculation of the voltage distribution across the electrode area is presented. The results of this model are in good agreement with measurements performed without plasma at 13.56 MHz and 70 MHz in a large area reactor. The principal voltage inhomogeneities are caused by logarithmic singularities in the vicinity of RF connections and not by standing waves. These singularities are only described by a two-dimensional model and cannot be intuitively predicted by analogy to a one-dimensional case. Plasma light emission measurements and thickness homogeneity studies of a-Si:H films show that the plasma reproduces these voltage inhomogeneities. Improvement of the voltage uniformity is investigated by changing the number and position of the RF connections. (author) 13 figs., 20 refs.

  3. Asymmetric Electrodes Constructed with PAN-Based Activated Carbon Fiber in Capacitive Deionization

    Directory of Open Access Journals (Sweden)

    Mingzhe Li

    2014-01-01

    Full Text Available Capacitive deionization (CDI method has drawn much attention for its low energy consumption, low pollution, and convenient manipulation. Activated carbon fibers (ACFs possess high adsorption ability and can be used as CDI electrode material. Herein, two kinds of PAN-based ACFs with different specific surface area (SSA were used for the CDI electrodes. The CDI performance was investigated; especially asymmetric electrodes’ effect was evaluated. The results demonstrated that PAN-based ACFs showed a high electrosorption rate (complete electrosorption in less than half an hour and moderate electrosorption capacity (up to 0.2 mmol/g. CDI experiments with asymmetric electrodes displayed a variation in electrosorption capacity between forward voltage and reverse voltage. It can be attributed to the electrical double layer (EDL overlap effect and inner pore potential; thus the ions with smaller hydrated ionic radius can be adsorbed more easily.

  4. Electrochemical disinfection of coliform and Escherichia coli for drinking water treatment by electrolysis method using carbon as an electrode

    Science.gov (United States)

    Riyanto; Agustiningsih, W. A.

    2018-04-01

    Disinfection of coliform and E. Coli in water has been performed by electrolysis using carbon electrodes. Carbon electrodes were used as an anode and cathode with a purity of 98.31% based on SEM-EDS analysis. This study was conducted using electrolysis powered by electric field using carbon electrode as the anode and cathode. Electrolysis method was carried out using variations of time (30, 60, 90, 120 minutes at a voltage of 5 V) and voltage (5, 10, 15, 20 V for 30 minutes) to determine the effect of the disinfection of the bacteria. The results showed the number of coliform and E. coli in water before and after electrolysis was 190 and 22 MPN/100 mL, respectively. The standards quality of drinking water No. 492/Menkes/Per/IV/2010 requires the zero content of coliform and E. Coli. Electrolysis with the variation of time and potential can reduce the number of coliforms and E. Coli but was not in accordance with the standards. The effect of hydrogen peroxide (H2O2) to the electrochemical disinfection was determined using UV-Vis spectrophotometer. The levels of H2O2 formed increased as soon after the duration of electrolysis voltage but was not a significant influence to the mortality of coliform and E.coli.

  5. High voltage switches having one or more floating conductor layers

    Science.gov (United States)

    Werne, Roger W.; Sampayan, Stephen; Harris, John Richardson

    2015-11-24

    This patent document discloses high voltage switches that include one or more electrically floating conductor layers that are isolated from one another in the dielectric medium between the top and bottom switch electrodes. The presence of the one or more electrically floating conductor layers between the top and bottom switch electrodes allow the dielectric medium between the top and bottom switch electrodes to exhibit a higher breakdown voltage than the breakdown voltage when the one or more electrically floating conductor layers are not present between the top and bottom switch electrodes. This increased breakdown voltage in the presence of one or more electrically floating conductor layers in a dielectric medium enables the switch to supply a higher voltage for various high voltage circuits and electric systems.

  6. Allosteric substrate switching in a voltage sensing lipid phosphatase

    Science.gov (United States)

    Grimm, Sasha S.; Isacoff, Ehud Y.

    2016-01-01

    Allostery provides a critical control over enzyme activity, biasing the catalytic site between inactive and active states. We find the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP), which modifies phosphoinositide signaling lipids (PIPs), to have not one but two sequential active states with distinct substrate specificities, whose occupancy is allosterically controlled by sequential conformations of the voltage sensing domain (VSD). Using fast FRET reporters of PIPs to monitor enzyme activity and voltage clamp fluorometry to monitor conformational changes in the VSD, we find that Ci-VSP switches from inactive to a PIP3-preferring active state when the VSD undergoes an initial voltage sensing motion and then into a second PIP2-preferring active state when the VSD activates fully. This novel 2-step allosteric control over a dual specificity enzyme enables voltage to shape PIP concentrations in time, and provides a mechanism for the complex modulation of PIP-regulated ion channels, transporters, cell motility and endo/exocytosis. PMID:26878552

  7. A new method for measuring the wall charge waveforms of AC PDP

    International Nuclear Information System (INIS)

    Liang Zhihu; Liu Zujun; Liu Chunliang

    2004-01-01

    A new method is developed to measure the wall charge waveforms in coplanar alternating current plasma display panel (AC PDP). In the method, two groups of display electrodes are selected from a coplanar AC PDP and two capacitors are respectively connected with these two groups of display electrodes in series, and a measuring circuit and a reference circuit are thus constructed. With the help of special processing, discharge takes place in the cells included in the measuring circuit under a normal drive voltage but no discharge takes place in the cells included in the reference circuit under a normal drive voltage. The wall charge waveforms are obtained from the voltage difference between the two capacitors. Using the method, the wall charge waveforms are measured during resetting period, addressing period and sustaining period for the 304.8 mm (12-inch) test PDP panel. The result shows that the wall voltage is about 96 V during the sustaining period. (authors)

  8. High voltage dc-dc converter with dynamic voltage regulation and decoupling during load-generated arcs

    Science.gov (United States)

    Shimer, Daniel W.; Lange, Arnold C.

    1995-01-01

    A high-power power supply produces a controllable, constant high voltage output under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules.

  9. High voltage dc--dc converter with dynamic voltage regulation and decoupling during load-generated arcs

    Science.gov (United States)

    Shimer, D.W.; Lange, A.C.

    1995-05-23

    A high-power power supply produces a controllable, constant high voltage output under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules. 5 Figs.

  10. Study of surface atmospheric pressure glow discharge plasma based on ultrathin laminated electrodes in air

    Science.gov (United States)

    Zhao, Luxiang; Liu, Wenzheng; Li, Zhiyi; Ma, Chuanlong

    2018-05-01

    A method to generate large-area surface plasma in air by micro-discharge is proposed. Two ultrathin laminated electrode structures of non-insulating and insulating types were formed by using the nanoscale ITO conductive layer. The surface glow discharge in atmospheric air is realized in low discharge voltage by constructing the special electric field of two-dimensional unidirectional attenuation. In particular, the insulating electrode structure can avoid the loss of ITO electrodes so that the discharge stability can be increased, and the treated objects can be prevented from metal ion pollution caused by the electrode in the discharge. It has broad application prospects in the fields of aerodynamics and material surface treatment.

  11. Fluctuation-Coupling of Cathode Cavity Pressure and Arc Voltage in a dc Plasma Torch with a Long Inter-Electrode Channel at Reduced Pressure

    International Nuclear Information System (INIS)

    Cao Jin-Wen; Huang He-Ji; Pan Wen-Xia

    2014-01-01

    Fluctuations of cathode cavity pressure and arc voltage are observed experimentally in a dc plasma torch with a long inter-electrode channel. The results show that they have the same frequency of around 4 kHz under typical experimental conditions. The observed phase difference between the pressure and the voltage, which is influenced by the path length between the pressure sensor and the cathode cavity, varies with different input powers. Combined with numerical simulation, the position of the pressure perturbation origin is estimated, and the results show that it is located at 0.01–0.05 m upstream of the inter-electrode channel outlet

  12. Gambierol, a toxin produced by the dinoflagellate Gambierdiscus toxicus, is a potent blocker of voltage-gated potassium channels☆

    Science.gov (United States)

    Cuypers, Eva; Abdel-Mottaleb, Yousra; Kopljar, Ivan; Rainier, Jon D.; Raes, Adam L.; Snyders, Dirk J.; Tytgat, Jan

    2008-01-01

    In this study, we pharmacologically characterized gambierol, a marine polycyclic ether toxin which is produced by the dinoflagellate Gambierdiscus toxicus. Besides several other polycyclic ether toxins like ciguatoxins, this scarcely studied toxin is one of the compounds that may be responsible for ciguatera fish poisoning (CFP). Unfortunately, the biological target(s) that underlies CFP is still partly unknown. Today, ciguatoxins are described to specifically activate voltage-gated sodium channels by interacting with their receptor site 5. But some dispute about the role of gambierol in the CFP story shows up: some describe voltage-gated sodium channels as the target, while others pinpoint voltage-gated potassium channels as targets. Since gambierol was never tested on isolated ion channels before, it was subjected in this work to extensive screening on a panel of 17 ion channels: nine cloned voltage-gated ion channels (mammalian Nav1.1–Nav1.8 and insect Para) and eight cloned voltage-gated potassium channels (mammalian Kv1.1–Kv1.6, hERG and insect ShakerIR) expressed in Xenopus laevis oocytes using two-electrode voltage-clamp technique. All tested sodium channel subtypes are insensitive to gambierol concentrations up to 10 μM. In contrast, Kv1.2 is the most sensitive voltage-gated potassium channel subtype with almost full block (>97%) and an half maximal inhibitory concentration (IC50) of 34.5 nM. To the best of our knowledge, this is the first study where the selectivity of gambierol is tested on isolated voltage-gated ion channels. Therefore, these results lead to a better understanding of gambierol and its possible role in CFP and they may also be useful in the development of more effective treatments. PMID:18313714

  13. Treatment of emulsified oils by electrocoagulation: pulsed voltage applications.

    Science.gov (United States)

    Genc, Ayten; Bakirci, Busra

    2015-01-01

    The effect of pulsed voltage application on energy consumption during electrocoagulation was investigated. Three voltage profiles having the same arithmetic average with respect to time were applied to the electrodes. The specific energy consumption for these profiles were evaluated and analyzed together with oil removal efficiencies. The effects of applied voltages, electrode materials, electrode configurations, and pH on oil removal efficiency were determined. Electrocoagulation experiments were performed by using synthetic and real wastewater samples. The pulsed voltages saved energy during the electrocoagulation process. In continuous operation, energy saving was as high as 48%. Aluminum electrodes used for the treatment of emulsified oils resulted in higher oil removal efficiencies in comparison with stainless steel and iron electrodes. When the electrodes gap was less than 1 cm, higher oil removal efficiencies were obtained. The highest oil removal efficiencies were 95% and 35% for the batch and continuous operating modes, respectively.

  14. Applications of Dynamic Clamp to Cardiac Arrhythmia Research: Role in Drug Target Discovery and Safety Pharmacology Testing

    Directory of Open Access Journals (Sweden)

    Francis A. Ortega

    2018-01-01

    Full Text Available Dynamic clamp, a hybrid-computational-experimental technique that has been used to elucidate ionic mechanisms underlying cardiac electrophysiology, is emerging as a promising tool in the discovery of potential anti-arrhythmic targets and in pharmacological safety testing. Through the injection of computationally simulated conductances into isolated cardiomyocytes in a real-time continuous loop, dynamic clamp has greatly expanded the capabilities of patch clamp outside traditional static voltage and current protocols. Recent applications include fine manipulation of injected artificial conductances to identify promising drug targets in the prevention of arrhythmia and the direct testing of model-based hypotheses. Furthermore, dynamic clamp has been used to enhance existing experimental models by addressing their intrinsic limitations, which increased predictive power in identifying pro-arrhythmic pharmacological compounds. Here, we review the recent advances of the dynamic clamp technique in cardiac electrophysiology with a focus on its future role in the development of safety testing and discovery of anti-arrhythmic drugs.

  15. Correlation of open cell-attached and excised patch clamp techniques.

    Science.gov (United States)

    Filipovic, D; Hayslett, J P

    1995-11-01

    The excised patch clamp configuration provides a unique technique for some types of single channel analyses, but maintenance of stable, long-lasting preparations may be confounded by rundown and/or rapid loss of seal. Studies were performed on the amiloride-sensitive Na+ channel, located on the apical surface of A6 cells, to determine whether the nystatin-induced open cell-attached patch could serve as an alternative configuration. Compared to excised inside-out patches, stable preparations were achieved more readily with the open cell-attached patch (9% vs. 56% of attempts). In both preparations, the current voltage (I-V) relation was linear, current amplitudes were equal at opposite equivalent clamped voltages, and Erev was zero in symmetrical Na+ solutions, indicating similar Na+ activities on the cytosolic and external surfaces of the patch. Moreover, there was no evidence that nystatin altered channel activity in the patch because slope conductance (3-4pS) and Erev (75 mV), when the bath was perfused with a high K:low Na solution (ENa = 80 mV), were nearly equal in both patch configurations. Our results therefore indicate that the nystatin-induced open cell-attached patch can serve as an alternative approach to the excised inside-out patch when experiments require modulation of univalent ions in the cytosol.

  16. Water Desalination Using Capacitive Deionization with Microporous Carbon Electrodes

    NARCIS (Netherlands)

    Porada, S.; Weinstein, L.; Dash, R.; Wal, van der A.F.; Bryjak, M.; Gogotsi, Y.; Biesheuvel, P.M.

    2012-01-01

    Capacitive deionization (CDI) is a water desalination technology in which salt ions are removed from brackish water by flowing through a spacer channel with porous electrodes on each side. Upon applying a voltage difference between the two electrodes, cations move to and are accumulated in

  17. A patch-clamp ASIC for nanopore-based DNA analysis.

    Science.gov (United States)

    Kim, Jungsuk; Maitra, Raj; Pedrotti, Kenneth D; Dunbar, William B

    2013-06-01

    In this paper, a fully integrated high-sensitivity patch-clamp system is proposed for single-molecule deoxyribonucleic acid (DNA) analysis using a nanopore sensor. This system is composed of two main blocks for amplification and compensation. The amplification block is composed of three stages: 1) a headstage, 2) a voltage-gain difference amplifier, and 3) a track-and-hold circuit, that amplify a minute ionic current variation sensed by the nanopore while the compensation block avoids the headstage saturation caused by the input parasitic capacitances during sensing. By employing design techniques novel for this application, such as an instrumentation--amplifier topology and a compensation switch, we minimize the deleterious effects of the input-offset voltage and the input parasitic capacitances while attaining hardware simplicity. This system is fabricated in a 0.35 μm 4M2P CMOS process and is demonstrated using an α-hemolysin protein nanopore for detection of individual molecules of single-stranded DNA that pass through the 1.5 nm-diameter pore. In future work, the refined system will functionalize single and multiple solid-state nanopores formed in integrated microfluidic devices for advanced DNA analysis, in scientific and diagnostic applications.

  18. Development of a Piezoelectric Vacuum Sensing Component for a Wide Pressure Range

    Directory of Open Access Journals (Sweden)

    Bing-Yu Wang

    2014-11-01

    Full Text Available In this study, we develop a clamped–clamped beam-type piezoelectric vacuum pressure sensing element. The clamped–clamped piezoelectric beam is composed of a PZT layer and a copper substrate. A pair of electrodes is set near each end. An input voltage is applied to a pair of electrodes to vibrate the piezoelectric beam, and the output voltage is measured at the other pair. Because the viscous forces on the piezoelectric beam vary at different air pressures, the vibration of the beam depends on the vacuum pressure. The developed pressure sensor can sense a wide range of pressure, from 6.5 × 10−6 to 760 Torr. The experimental results showed that the output voltage is inversely proportional to the gas damping ratio, and thus, the vacuum pressure was estimated from the output voltage.

  19. Nickel hydrogen bipolar battery electrode design

    Science.gov (United States)

    Puglisi, V. J.; Russell, P.; Verrier, D.; Hall, A.

    1985-01-01

    The preferred approach of the NASA development effort in nickel hydrogen battery design utilizes a bipolar plate stacking arrangement to obtain the required voltage-capacity configuration. In a bipolar stack, component designs must take into account not only the typical design considerations such as voltage, capacity and gas management, but also conductivity to the bipolar (i.e., intercell) plate. The nickel and hydrogen electrode development specifically relevant to bipolar cell operation is discussed. Nickel oxide electrodes, having variable type grids and in thicknesses up to .085 inch are being fabricated and characterized to provide a data base. A selection will be made based upon a system level tradeoff. Negative (hydrpogen) electrodes are being screened to select a high performance electrode which can function as a bipolar electrode. Present nickel hydrogen negative electrodes are not capable of conducting current through their cross-section. An electrode was tested which exhibits low charge and discharge polarization voltages and at the same time is conductive. Test data is presented.

  20. Alternating voltage-induced electrochemical synthesis of colloidal Au nanoicosahedra

    Energy Technology Data Exchange (ETDEWEB)

    McCann, Kevin; Cloud, Jacqueline E.; Yang, Yongan, E-mail: yonyang@mines.edu [Colorado School of Mines, Department of Chemistry and Geochemistry (United States)

    2013-11-15

    A simple method of alternating voltage-induced electrochemical synthesis has been developed to synthesize highly dispersed colloidal Au nanoicosahedra of 14 ± 3 nm in size. This simple and effective method uses a common transformer to apply a zero-offset alternating voltage to a pair of identical Au electrodes that are immersed in an electrolyte solution containing ligands. The obtained Au nanoicosahedra in this work are among the smallest Au icosahedra synthesized in aqueous solutions. A series of experimental conditions have been studied, such as voltage, the electrolyte identity and concentration, stabilizer identity and concentration, and reaction temperature. The mechanistic study indicates that Au nanoicosahedra are produced on electrode surfaces through an intermediate state of AuO{sub x}. The kinetic rate constant of these Au icosahedra in catalyzing the reduction of 4-nitrophenol with sodium borohydride is found much larger than the literature values of similar Au nanocrystals. In addition, the synthesis of Au–Pd-alloyed NCs has also been attempted.Graphical Abstract.

  1. Mechanics of wafer bonding: Effect of clamping

    Science.gov (United States)

    Turner, K. T.; Thouless, M. D.; Spearing, S. M.

    2004-01-01

    A mechanics-based model is developed to examine the effects of clamping during wafer bonding processes. The model provides closed-form expressions that relate the initial geometry and elastic properties of the wafers to the final shape of the bonded pair and the strain energy release rate at the interface for two different clamping configurations. The results demonstrate that the curvature of bonded pairs may be controlled through the use of specific clamping arrangements during the bonding process. Furthermore, it is demonstrated that the strain energy release rate depends on the clamping configuration and that using applied loads usually leads to an undesirable increase in the strain energy release rate. The results are discussed in detail and implications for process development and bonding tool design are highlighted.

  2. Enhanced DC-Link Capacitor Voltage Balancing Control of DC–AC Multilevel Multileg Converters

    DEFF Research Database (Denmark)

    Busquets-Monge, Sergio; Maheshwari, Ram Krishan; Nicolas-Apruzzese, Joan

    2015-01-01

    This paper presents a capacitor voltage balancing control applicable to any multilevel dc–ac converter formed by a single set of series-connected capacitors implementing the dc link and semiconductor devices, such as the diode-clamped topology. The control is defined for any number of dc-link vol......This paper presents a capacitor voltage balancing control applicable to any multilevel dc–ac converter formed by a single set of series-connected capacitors implementing the dc link and semiconductor devices, such as the diode-clamped topology. The control is defined for any number of dc...

  3. Reducing blood loss during laparoscopic myomectomy by temporary uterine artery clamping using bulldog clamp

    Directory of Open Access Journals (Sweden)

    Kai-Jo Chiang

    2014-01-01

    Full Text Available Uterine myoma is the most common benign gynecologic tumor worldwide. Mini-invasive surgery has become popular for myomectomy, with advantages over laparotomy. However, reducing blood loss during laparoscopic myomectomy is a major concern for the surgeon because of the limitation in making a quick control bleeding during the operation. Several methods have proved to decrease blood flow, but are not always effective or available. We present a case of uterine myoma with the uterine arteries clamped by bulldog clamps during laparoscopic myomectomy. The myoma was removed successfully with minimal blood loss (<50 ml during the operation. This is an effective, safe, and reliable method for reducing bleeding during laparoscopic myomectomy that does not require ligation of the uterine artery.

  4. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-07-05

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

  5. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-01-01

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

  6. Flexible and stretchable electrodes for dielectric elastomer actuators

    Science.gov (United States)

    Rosset, Samuel; Shea, Herbert R.

    2013-02-01

    Dielectric elastomer actuators (DEAs) are flexible lightweight actuators that can generate strains of over 100 %. They are used in applications ranging from haptic feedback (mm-sized devices), to cm-scale soft robots, to meter-long blimps. DEAs consist of an electrode-elastomer-electrode stack, placed on a frame. Applying a voltage between the electrodes electrostatically compresses the elastomer, which deforms in-plane or out-of plane depending on design. Since the electrodes are bonded to the elastomer, they must reliably sustain repeated very large deformations while remaining conductive, and without significantly adding to the stiffness of the soft elastomer. The electrodes are required for electrostatic actuation, but also enable resistive and capacitive sensing of the strain, leading to self-sensing actuators. This review compares the different technologies used to make compliant electrodes for DEAs in terms of: impact on DEA device performance (speed, efficiency, maximum strain), manufacturability, miniaturization, the integration of self-sensing and self-switching, and compatibility with low-voltage operation. While graphite and carbon black have been the most widely used technique in research environments, alternative methods are emerging which combine compliance, conduction at over 100 % strain with better conductivity and/or ease of patternability, including microfabrication-based approaches for compliant metal thin-films, metal-polymer nano-composites, nanoparticle implantation, and reel-to-reel production of μm-scale patterned thin films on elastomers. Such electrodes are key to miniaturization, low-voltage operation, and widespread commercialization of DEAs.

  7. Dimerization of the voltage-sensing phosphatase controls its voltage-sensing and catalytic activity.

    Science.gov (United States)

    Rayaprolu, Vamseedhar; Royal, Perrine; Stengel, Karen; Sandoz, Guillaume; Kohout, Susy C

    2018-05-07

    Multimerization is a key characteristic of most voltage-sensing proteins. The main exception was thought to be the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP). In this study, we show that multimerization is also critical for Ci-VSP function. Using coimmunoprecipitation and single-molecule pull-down, we find that Ci-VSP stoichiometry is flexible. It exists as both monomers and dimers, with dimers favored at higher concentrations. We show strong dimerization via the voltage-sensing domain (VSD) and weak dimerization via the phosphatase domain. Using voltage-clamp fluorometry, we also find that VSDs cooperate to lower the voltage dependence of activation, thus favoring the activation of Ci-VSP. Finally, using activity assays, we find that dimerization alters Ci-VSP substrate specificity such that only dimeric Ci-VSP is able to dephosphorylate the 3-phosphate from PI(3,4,5)P 3 or PI(3,4)P 2 Our results indicate that dimerization plays a significant role in Ci-VSP function. © 2018 Rayaprolu et al.

  8. Grid Filter Design for a Multi-Megawatt Medium-Voltage Voltage Source Inverter

    DEFF Research Database (Denmark)

    Rockhill, A.A.; Liserre, Marco; Teodorescu, Remus

    2011-01-01

    This paper describes the design procedure and performance of an LCL grid filter for a medium-voltage neutral point clamped (NPC) converter to be adopted for a multimegawatt wind turbine. The unique filter design challenges in this application are driven by a combination of the medium voltage...... converter, a limited allowable switching frequency, component physical size and weight concerns, and the stringent limits for allowable injected current harmonics. Traditional design procedures of grid filters for lower power and higher switching frequency converters are not valid for a multi......-megawatt filter connecting a medium-voltage converter switching at low frequency to the electric grid. This paper demonstrates a frequency domain model based approach to determine the optimum filter parameters that provide the necessary performance under all operating conditions given the necessary design...

  9. Environmental and biotechnological applications of high-voltage pulsed discharges in water

    International Nuclear Information System (INIS)

    Sato, Masayuki

    2008-01-01

    A high-voltage pulse has wide application in fields such as chemistry, physics and biology and their combinations. The high-voltage pulse forms two kinds of physical processes in water, namely (a) a pulsed electric field (PEF) in the parallel electrode configuration and (b) plasma generation by a pulsed discharge in the water phase with a concentrated electric field. The PEF can be used for inactivation of bacteria in liquid foods as a non-thermal process, and the underwater plasma is applicable not only for the decomposition of organic materials in water but also for biological treatment of wastewater. These discharge states are controlled mainly by the applied pulse voltage and the electrode shape. Some examples of environmental and biotechnological applications of a high-voltage pulse are reviewed.

  10. In-situ experimental characterization of the clamping pressure effects on low temperature polymer electrolyte membrane electrolysis International Journal of Hydrogen Energy

    DEFF Research Database (Denmark)

    Al Shakhshir, Saher; Cui, Xiaoti; Frensch, Steffen Henrik

    2017-01-01

    as a gas with the circulating water. The effects of clamping pressure (Pc) on the LT-PEME cell performance, polarization resistances, and hydrogen and water crossover through the membrane, and hydrogen and oxygen production rate are studied. A 50 cm2 active area LT-PEME cell designed and manufactured......-PEME splits water into hydrogen and oxygen when the voltage is applied between anode and cathode. Electrical current forces the positively charged ions to migrate to negatively charged cathode through PEM, where hydrogen is produced. Meanwhile, oxygen is produced at the anode side electrode and escapes...... in house is utilized in this work. Higher Pc has shown higher cell performance this refers to lower ohmic and activation resistances. Water crossover from anode to cathode is slightly decreased at higher Pc resulting in a slight decrease in hydrogen crossover from cathode to anode. Also, the percentage...

  11. A current-excited triple-time-voltage oversampling method for bio-impedance model for cost-efficient circuit system.

    Science.gov (United States)

    Yan Hong; Yong Wang; Wang Ling Goh; Yuan Gao; Lei Yao

    2015-08-01

    This paper presents a mathematic method and a cost-efficient circuit to measure the value of each component of the bio-impedance model at electrode-electrolyte interface. The proposed current excited triple-time-voltage oversampling (TTVO) method deduces the component values by solving triple simultaneous electric equation (TSEE) at different time nodes during a current excitation, which are the voltage functions of time. The proposed triple simultaneous electric equations (TSEEs) allows random selections of the time nodes, hence numerous solutions can be obtained during a single current excitation. Following that, the oversampling approach is engaged by averaging all solutions of multiple TSEEs acquired after a single current excitation, which increases the practical measurement accuracy through the improvement of the signal-to-noise ratio (SNR). In addition, a print circuit board (PCB) that consists a switched current exciter and an analog-to-digital converter (ADC) is designed for signal acquisition. This presents a great cost reduction when compared against other instrument-based measurement data reported [1]. Through testing, the measured values of this work is proven to be in superb agreements on the true component values of the electrode-electrolyte interface model. This work is most suited and also useful for biological and biomedical applications, to perform tasks such as stimulations, recordings, impedance characterizations, etc.

  12. Baking of tandem accelerator tube by low voltage arc discharge

    International Nuclear Information System (INIS)

    Nakajima, Yutaka

    1982-01-01

    In designing the accelerating tube for a static tandem accelerator in Kyushu University, the basic policy was as described below: individual unit composing the accelerating tube should fully withstand the electric field of 2 MV/m, and electric discharge must not be propagated from one unit to the adjacent unit when these are assembled to the accelerating tube. The accelerating tube units are each 25 cm in length, and both high and low energy sides are composed of 20 units, respectively. Although about 10 -9 Torr vacuum was obtained at the both ends of the accelerating tube by baking the tube at 300 to 350 deg C with electric heaters wound outside the tube in the conventional method, vast outgas was generated, which decreased vacuum by two or three figures if breakdown occurred through the intermediary of outgas. As a method of positively outgassing and cleaning the electrodes inside the accelerating tube, it was attempted to directly bake all the electrodes in the accelerating tube by causing strong arc discharge flowing H 2 gas in the tube. As a result of considering the conditions for this method, the low voltage arc discharge was employed using oxide cathodes. Thus, after implementing 10A arc discharge for several hours, the voltage was able to be raised to 10 MV almost immediately after the vacuum recovery, and further, after another conditioning for several hours, it was successful to raise voltage up to 11 MV. (Wakatsuki, Y.)

  13. Dielectric-wall linear accelerator with a high voltage fast rise time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators

    Science.gov (United States)

    Caporaso, George J.; Sampayan, Stephen E.; Kirbie, Hugh C.

    1998-01-01

    A dielectric-wall linear accelerator is improved by a high-voltage, fast rise-time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators. A high voltage is placed between the electrodes sufficient to stress the voltage breakdown of the insulator on command. A light trigger, such as a laser, is focused along at least one line along the edge surface of the laminated alternating layers of isolated conductors and insulators extending between the electrodes. The laser is energized to initiate a surface breakdown by a fluence of photons, thus causing the electrical switch to close very promptly. Such insulators and lasers are incorporated in a dielectric wall linear accelerator with Blumlein modules, and phasing is controlled by adjusting the length of fiber optic cables that carry the laser light to the insulator surface.

  14. Luminous flux improvement of xenon fluorescent lamps by applying synchronized high-voltage pulse to the auxiliary external electrode

    Energy Technology Data Exchange (ETDEWEB)

    Motomura, Hideki; Oka, Kojiro; Sogabe, Toru; Jinno, Masafumi, E-mail: hmoto@mayu.ee.ehime-u.ac.jp [Department of Electrical and Electronic Engineering, Ehime University 3 Bunkyo-cho, Matsuyama, Ehime 790-8577 (Japan)

    2011-06-08

    As the environmental awareness of people becomes stronger, the demand for mercury-free light sources also becomes stronger. The authors have been developing cold cathode fluorescent lamps in which xenon gas is filled as an ultraviolet radiator instead of mercury. Previously the authors reported the luminous flux enhancement method using a grounded auxiliary external electrode (AEE). In this paper, in order to improve the luminous flux much more, a positive voltage pulse which was synchronized to the main driving negative voltage pulse was applied to the AEE. As a result, the maximum input power increased under which the positive column did not constrict and the luminous flux improved by 70% at the xenon filling pressure of 6.7 kPa. It is proved that the positive voltage pulse application to the AEE with the amplitude of more than 2 kV expands the positive column in the radial direction. It is attributed to the phenomenon that the residual ions and electrons, which are generated by dielectric barrier discharge between the AEE and the anode during the falling edge of the negative pulse to the cathode, spread the discharge path from the anode towards the AEE during the cold cathode discharge mode. By increasing the xenon filling pressure, luminous efficacy was improved to 25 lm W{sup -1}.

  15. A HIGH CURRENT, HIGH VOLTAGE SOLID-STATE PULSE GENERATOR FOR THE NIF PLASMA ELECTRODE POCKELS CELL

    International Nuclear Information System (INIS)

    Arnold, P A; Barbosa, F; Cook, E G; Hickman, B C; Akana, G L; Brooksby, C A

    2007-01-01

    A high current, high voltage, all solid-state pulse modulator has been developed for use in the Plasma Electrode Pockels Cell (PEPC) subsystem in the National Ignition Facility. The MOSFET-switched pulse generator, designed to be a more capable plug-in replacement for the thyratron-switched units currently deployed in NIF, offers unprecedented capabilities including burst-mode operation, pulse width agility and a steady-state pulse repetition frequency exceeding 1 Hz. Capable of delivering requisite fast risetime, 17 kV flattop pulses into a 6 (Omega) load, the pulser employs a modular architecture characteristic of the inductive adder technology, pioneered at LLNL for use in acceleration applications, which keeps primary voltages low (and well within the capabilities of existing FET technology), reduces fabrication costs and is amenable to rapid assembly and quick field repairs

  16. Electrode assemblies, plasma apparatuses and systems including electrode assemblies, and methods for generating plasma

    Science.gov (United States)

    Kong, Peter C; Grandy, Jon D; Detering, Brent A; Zuck, Larry D

    2013-09-17

    Electrode assemblies for plasma reactors include a structure or device for constraining an arc endpoint to a selected area or region on an electrode. In some embodiments, the structure or device may comprise one or more insulating members covering a portion of an electrode. In additional embodiments, the structure or device may provide a magnetic field configured to control a location of an arc endpoint on the electrode. Plasma generating modules, apparatus, and systems include such electrode assemblies. Methods for generating a plasma include covering at least a portion of a surface of an electrode with an electrically insulating member to constrain a location of an arc endpoint on the electrode. Additional methods for generating a plasma include generating a magnetic field to constrain a location of an arc endpoint on an electrode.

  17. On-chip graphene electrode, methods of making, and methods of use

    KAUST Repository

    Nayak, Pranati

    2018-01-25

    Embodiments of the present disclosure provide a device including an on-chip electrode platform including one or more three dimensional laser scribed graphene electrodes, methods of making the on-chip electrode platform, methods of analyzing (e.g., detecting, quantifying, and the like) chemicals and biochemicals, and the like.

  18. Influence of a pulse duration of high-voltage supply on the efficiency of ozone synthesis in the 'needle-plane' electrode system

    International Nuclear Information System (INIS)

    Golota, V.I.; Zavada, L.M.; Karas, V.I.; Kotjukov, O.V.; Poliakov, O.V.; Pugach, S.G.

    2007-01-01

    We present the results of studies of the electrodynamic characteristics of a barrier less discharge with electrodes of the 'needle-plane' type and a high-voltage pulse of positive polarity, being applied to the edge electrode. The efficiency of ozone synthesis is determined as a function of the pulse duration and repetition rate. It is shown that the electrodynamic characteristics of the discharge and the effectiveness of ozone synthesis in oxygen-containing gas mixtures essentially depend on the parameters of the pulse supply

  19. Prediction of picosecond voltage collapse and electromagnetic wave generation in gas avalanche switches

    International Nuclear Information System (INIS)

    Mayhall, D.J.; Yee, J.H.; Duong-Van, M.; Villa, F.

    1988-01-01

    A picosecond speed switch, the Gas Avalanche Switch (GAS), has been proposed for GeV linear accelerators. The medium is gas at high pressure (100 - 700 atm). An avalanche discharge is induced between pulse-charged high voltage electrodes by electron deposition from a fast laser pulse. Avalanche electrons move to the positive electrode, causing the applied voltage to collapse in picoseconds. A two-dimensional (2D) electromagnetic electron fluid computer code calculates the avalanche evolution and voltage collapse in air for an infinite parallel plate capacitor with a 0.1 mm spacing. Calculations are done for an accelerator switch geometry consisting of a 0.7 mm wide by 0.8 mm high, rectangular, high voltage center electrode (CE) between the grounded plates of a parallel plate line of 2 mm spacing. Several variations of CE elevation and initial electron deposition are investigated The 2D character of the outgoing TEM waves is shown

  20. Chromatic aberrations of two-electrode transaxial mirrors

    International Nuclear Information System (INIS)

    Bejzina, L.G.; Karetskaya, S.P.

    1991-01-01

    Second order chromatic aberrations of electrostatic two-electrode transaxial mirrors in case the beam axial trajectory of charged particles is curvilinear are considered. Interrelations between coefficients of linear and angular chromatic aberrations are determined. Values of these coefficients for concave and convex transaxial mirrors with plane electrodes in dependence on potential ratio on electrodes by different onnular clearance radii are presented

  1. Improved non-dimensional dynamic influence function method for vibration analysis of arbitrarily shaped plates with clamped edges

    Directory of Open Access Journals (Sweden)

    Sang-Wook Kang

    2016-03-01

    Full Text Available A new formulation for the non-dimensional dynamic influence function method, which was developed by the authors, is proposed to efficiently extract eigenvalues and mode shapes of clamped plates with arbitrary shapes. Compared with the finite element and boundary element methods, the non-dimensional dynamic influence function method yields highly accurate solutions in eigenvalue analysis problems of plates and membranes including acoustic cavities. However, the non-dimensional dynamic influence function method requires the uneconomic procedure of calculating the singularity of a system matrix in the frequency range of interest for extracting eigenvalues because it produces a non-algebraic eigenvalue problem. This article describes a new approach that reduces the problem of free vibrations of clamped plates to an algebraic eigenvalue problem, the solution of which is straightforward. The validity and efficiency of the proposed method are illustrated through several numerical examples.

  2. Design of Neutral-Point Voltage Controller of a Three-level NPC Inverter with Small DC-Link Capacitors

    DEFF Research Database (Denmark)

    Maheshwari, Ram Krishan; Munk-Nielsen, Stig; Busquets-Monge, S.

    2013-01-01

    A Neutral-Point-Clamped (NPC) three-level inverter with small dc-link capacitors is presented in this paper. The inverter requires zero average neutral-point current for stable neutral-point voltage. The small dc-link capacitors may not maintain capacitor voltage balance, even with zero neutral......-point voltage control on the basis of the continuous model. The design method for optimum performance is discussed. The implementation of the proposed modulation strategy and the controller is very simple. The controller is implemented in a 7.5 kW induction machine based drive with only 14 ìF dc-link capacitors...

  3. Textile Wastewater Treatment by Electrocoagulation Process using Aluminum Electrodes

    Directory of Open Access Journals (Sweden)

    Edris Bazrafshan

    2014-03-01

    Full Text Available Background and purpose: Textile industries are among the most polluting industries regarding the volume and the complexity of treatment of its effluents discharge. This study investigated the efficiency of electrocoagulation process using aluminum electrodes in basic red 18 dye removal from aqueous solutions. Materials and Methods: This study was performed in a bipolar batch reactor with six aluminum electrodes connected in parallel. Several important parameters, such as initial pH of solution, initial dye concentration, applied voltage; conductivity and reaction time were studied in an attempt to achieve higher removal efficiency. Results: The electrochemical technique showed satisfactory dye removal efficiency and reliable performance in treating of basic red 18. The maximum efficiency of dye removal which was obtained in voltage of 50 V, reaction time of 60 min, initial concentration 50 mg/L, conductivity 3000 μS/cm and pH 7 was equal to 97.7%. Dye removal efficiency was increased accordance to increase of applied voltage and in contrast electrode and energy consumption was increased simultaneously. Conclusion: As a conclusion, the method was found to be highly efficient and relatively fast compared to conventional existing techniques for dye removal from aqueous solutions.

  4. The plastic instability of clamped-clamped conical thin-walled pipe reducers

    International Nuclear Information System (INIS)

    Awad, Ibrahim; Saleh, Ch.A.R.; Ragab, A.R.

    2016-01-01

    The analytical study for plastic deformation of clamped–clamped conical reducer pipe under internal pressure does not deduce a closed form expression for the pressure at plastic instability. The presented study employs finite element analysis (FEA) to estimate the internal pressure at instability for conical reducers made of different materials and having different dimensional configurations. Forty dimensional configurations, classified as medium type, and five types of materials have been included in the analysis using ABAQUS package. A correlation expression is derived by nonlinear regression to predict the instability pressure. The proposed expression is verified for other dimensional configurations out of the above used forty models and for other materials. Experiments have been conducted by pressurizing conical clamped-clamped reducers until bursting in order to verify the finite element models. Comparison of instability pressures, strains and deflections at specific points along the conical surface shows satisfactory agreement between analysis and experiments. - Highlights: • This study offers a parametric study of the plastic instability pressure of clamped-clamped conical reducers. • A closed form analytical expression for the instability pressure is derived by using nonlinear regression. • The finite element analysis is validated by conducting bursting tests.

  5. Sealed two-electrode photoelectrochemical cell based on nanocrystalline TiO2 analyzed as a UV sensor

    International Nuclear Information System (INIS)

    Forcade, Fresnel; Gonzalez, Bernardo; Maqueda, Ma. de la Luz; Curbelo, Larisa; Vigil, Elena; Jennings, James R.; Dunn, Halina; Wang, Hongxia; PeteR, Lauri M.

    2008-01-01

    Potentialities as UV sensor of a sealed two-electrode photoelectrochemical cell (PEC) based on nanocrystalline TiO 2 are analyzed. Ultraviolet component of solar light is responsible for a number of skin disorders and diseases. An inexpensive and simple UV sensor would be convenient to measure the UV intensity been exposed to. Nanocrystalline TiO 2 is a rather inexpensive material, innocuous and very stable which is intensively studied at the present moment because of its possible applications in dye-sensitized solar cells, photocatalysis, electrochromics, etc. The method for obtaining the sensor and its structure are described. Different TiO 2 layer structures for the photoelectrode are studied. Important parameters, such as, spectral response, external quantum efficiency, current vs light intensity and current-voltage curve are presented. Results show prospective for the implementation of this type of sensor. (Full text)

  6. High performance control strategy for single-phase three-level neutral-point-clamped traction four-quadrant converters

    DEFF Research Database (Denmark)

    Kejian, Song; Konstantinou, Georgios; Jing, Li

    2017-01-01

    Operational data from Chinese railways indicate a number of challenges for traction four-quadrant converter (4QC) control including low-order voltage and current harmonics and reference tracking. A control strategy for a single-phase three-level neutral-point-clamped 4QC employed in the electric...

  7. Giant rectification in graphene nanoflake molecular devices with asymmetric graphene nanoribbon electrodes

    International Nuclear Information System (INIS)

    Ji, Xiao-Li; Xie, Zhen; Zuo, Xi; Zhang, Guang-Ping; Li, Zong-Liang; Wang, Chuan-Kui

    2016-01-01

    By applying density functional theory based nonequilibrium Green's function method, we theoretically investigate the electron transport properties of a zigzag-edged trigonal graphene nanoflake (ZTGNF) sandwiched between two asymmetric zigzag graphene nanoribbon (zGNR) and armchair graphene nanoribbon (aGNR) electrodes with carbon atomic chains (CACs) as the anchoring groups. Significant rectifying effects have been observed for these molecular devices in low bias voltage regions. Interestingly, the rectifying performance of molecular devices can be optimized by changing the width of the aGNR electrode and the number of anchoring CACs. Especially, the molecular device displays giant rectification ratios up to the order of 10"4 when two CACs are used as the anchoring group between the ZTGNF and the right aGNR electrode. Further analysis indicates that the asymmetric shift of the perturbed molecular energy levels and the spatial parity of the electron wavefunctions in the electrodes around the Fermi level play key roles in determining the rectification performance. And the spatial distributions of tunneling electron wavefunctions under negative bias voltages can be modified to be very localized by changing the number of anchoring CACs, which is found to be the origin of the giant rectification ratios. - Highlights: • The rectification properties of triangular Graphene nanoflakes are investigated. • The rectifying performance can be optimized by changing the width of the right arm-chaired GNR electrode. • The rectifying performance can also be tuned by varying the number of anchoring carbon atomic chains.

  8. High frequency breakdown voltage

    International Nuclear Information System (INIS)

    Chu, Thanh Duy.

    1992-03-01

    This report contains information about the effect of frequency on the breakdown voltage of an air gap at standard pressure and temperature, 76 mm Hg and O degrees C, respectively. The frequencies of interest are 47 MHz and 60 MHz. Additionally, the breakdown in vacuum is briefly considered. The breakdown mechanism is explained on the basis of collision and ionization. The presence of the positive ions produced by ionization enhances the field in the gap, and thus determines the breakdown. When a low-frequency voltage is applied across the gap, the breakdown mechanism is the same as that caused by the DC or static voltage. However, when the frequency exceeds the first critical value f c , the positive ions are trapped in the gap, increasing the field considerably. This makes the breakdown occur earlier; in other words, the breakdown voltage is lowered. As the frequency increases two decades or more, the second critical frequency, f ce , is reached. This time the electrons start being trapped in the gap. Those electrons that travel multiple times across the gap before reaching the positive electrode result in an enormous number of electrons and positive ions being present in the gap. The result is a further decrease of the breakdown voltage. However, increasing the frequency does not decrease the breakdown voltage correspondingly. In fact, the associated breakdown field intensity is almost constant (about 29 kV/cm).The reason is that the recombination rate increases and counterbalances the production rate, thus reducing the effect of the positive ions' concentration in the gap. The theory of collision and ionization does not apply to the breakdown in vacuum. It seems that the breakdown in vacuum is primarily determined by the irregularities on the surfaces of the electrodes. Therefore, the effect of frequency on the breakdown, if any, is of secondary importance

  9. Gabapentin Modulates HCN4 Channel Voltage-Dependence

    Directory of Open Access Journals (Sweden)

    Han-Shen Tae

    2017-08-01

    Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

  10. A LabVIEW based experiment system for the efficient collection and analysis of cyclic voltametry and electrode charge capacity measurements.

    Science.gov (United States)

    Detlefsen, D; Hu, Z; Troyk, P R

    2006-01-01

    Cyclic voltametry and recording of stimulation electrode voltage excursions are two critical methods of measurement for understanding the performance of implantable electrodes. Because implanted electrodes cannot easily be replaced, it is necessary to have an a-priori understanding of an electrode's implanted performance and capabilities. In-vitro exhaustive tests are often needed to quantify an electrodes performance. Using commonly available equipment, the human labor cost to conduct this work is immense. Presented is an automated experiment system that is highly configurable that can efficiently conduct a battery of repeatable CV and stimulation recording measurements. Results of preparing 96 electrodes prior to an animal implantation are also discussed.

  11. Indirect Electrochemical Oxidation with Multi Carbon Electrodes for Restaurant Wastewater Treatment

    Directory of Open Access Journals (Sweden)

    I Dewa Ketut Sastrawidana

    2018-01-01

    Full Text Available The removal of organic matter from the restaurant wastewater was investigated using the electrochemical oxida-tion method with multi carbon electrodes in a parallel construction. The degradation process was monitored by the measurement of COD concentration as a function of electrolysis time. The effectof operating parameter conditions on COD removal were investigated including initial pH, distance between electrodes, and the applied voltage difference.The results showed that the treatment of restaurant wastewater containing 2 g/L chloride ion using the electrochemical oxidation technique at the operation conditions characterized by: pH 5, distance between electrode of 10 cm and applied voltage of 12 V, enabled to obtained COD removal of 92.84% within 90 min electrolysis time. It is can be concluded that the indirect electrochemical oxidation method with multi carbon electrodes can be used effectivelyas an alternative technology for reducing COD and may be potentially applied for removal organic pollutants from wastewater at the industrial scale.

  12. Wearable Solid-State Supercapacitors Operating at High Working Voltage with a Flexible Nanocomposite Electrode.

    Science.gov (United States)

    Li, Xiaoyan; Wang, Jun; Zhao, Yaping; Ge, Fengyan; Komarneni, Sridhar; Cai, Zaisheng

    2016-10-05

    The proposed approach for fabricating ultralight self-sustained electrodes facilitates the structural integration of highly flexible carbon nanofibers, amino-modified multiwalled carbon nanotubes (AM-MWNT), and MnO 2 nanoflakes for potential use in wearable supercapacitors. Because of the higher orientation of AM-MWNT and the sublimation of terephthalic acid (PTA) in the carbonization process, freestanding electrodes could be realized with high porosity and flexibility and could possess remarkable electrochemical properties without using polymer substrates. Wearable symmetric solid-state supercapacitors were further assembled using a LiCl/PVA gel electrolyte, which exhibit a maximum energy density of 44.57 Wh/kg (at a power density of 337.1 W/kg) and a power density of 13330 W/kg (at an energy density of 19.64 Wh/kg) with a working voltage as high as 1.8 V. Due to the combination of several favorable traits such as flexibility, high energy density, and excellent electrochemical cyclability, the presently developed wearable supercapacitors with wide potential windows are expected to be useful for new kinds of portable electric devices.

  13. Aging of electrochemical double layer capacitors with acetonitrile-based electrolyte at elevated voltages

    International Nuclear Information System (INIS)

    Ruch, P.W.; Cericola, D.; Foelske-Schmitz, A.; Koetz, R.; Wokaun, A.

    2010-01-01

    Laboratory-scale electrochemical capacitor cells with bound activated carbon electrodes and acetonitrile-based electrolyte were aged at various elevated constant cell voltages between 2.75 V and 4.0 V. During the constant voltage tests, the cell capacitance as well as the capacitance and resistance of each electrode was determined. Following each aging experiment, the cells were analyzed by means of electrochemical impedance spectroscopy, and the individual electrodes were characterized by gas adsorption and X-ray photoelectron spectroscopy. At cell voltages above 3.0 V, the positive electrode ages much faster than the negative. Both the capacitance loss and resistance increase of the cell could be totally attributed to the positive electrode. At cell voltages above 3.5 V also the negative electrode aged significantly. X-ray photoelectron spectroscopy indicated the presence of degradation products on the electrode surface with a much thicker layer on the positive electrode. Simultaneously, a significant decrease in electrode porosity could be detected by gas adsorption.

  14. Ion collection from laser-induced plasma by applying radio-frequency voltage

    International Nuclear Information System (INIS)

    Shibata, Takemasa; Ogura, Koichi

    1995-01-01

    Ions were collected on the electrodes from a laser resonance photoionized plasma by applying 1.8MHz radio-frequency voltage to the electrode. It was demonstrated that the ions are collected in a shorter time at the same kinetic energy of the collected ions compared with ion collection by applying DC voltage to the electrode. A simple one-dimensional model was extended for prediction of ion collection times in the cases of applications of not only the DC voltage but also the radio-frequency voltage. The ion collection times estimated using the simple one-dimensional model agreed with experimental values in both cases of DC and radio-frequency voltages. (author)

  15. Electrochemical surface plasmon resonance sensor based on two-electrode configuration

    International Nuclear Information System (INIS)

    Zhang, Bing; Dong, Wei; Wen, Yizhang; Pang, Kai; Wang, Xiaoping; Li, Yazhuo; Zhan, Shuyue

    2016-01-01

    To obtain detailed information about electrochemistry reactions, a two-electrode electrochemical surface plasmon resonance (EC-SPR) sensor has been proposed. We describe the theory of potential modulation for this novel sensor and determine the factors that can change the SPR resonance angle. The reference electrode in three-electrode configuration was eliminated, and comparing with several other electrode materials, activated carbon (AC) is employed as the suitable counter electrode for its potential stability. Just like three-electrode configuration, the simpler AC two-electrode system can also obtain detailed information about the electrochemical reactions. (paper)

  16. High-voltage leak detection of a parenteral proteinaceous solution product packaged in form-fill-seal plastic laminate bags. Part 1. Method development and validation.

    Science.gov (United States)

    Damgaard, Rasmus; Rasmussen, Mats; Buus, Peter; Mulhall, Brian; Guazzo, Dana Morton

    2013-01-01

    In Part 1 of this three-part research series, a leak test performed using high-voltage leak detection (HVLD) technology, also referred to as an electrical conductivity and capacitance leak test, was developed and validated for container-closure integrity verification of a small-volume laminate plastic bag containing an aqueous solution for injection. The sterile parenteral product is the rapid-acting insulin analogue, insulin aspart (NovoRapid®/NovoLog®, by Novo Nordisk A/S, Bagsværd, Denmark). The aseptically filled and sealed package is designed to preserve product sterility through expiry. Method development and validation work incorporated positive control packages with a single hole laser-drilled through the laminate film of each bag. A unique HVLD method characterized by specific high-voltage and potentiometer set points was established for testing bags positioned in each of three possible orientations as they are conveyed through the instrument's test zone in each of two possible directions-resulting in a total of six different test method options. Validation study results successfully demonstrated the ability of all six methods to accurately and reliably detect those packages with laser-drilled holes from 2.5-11.2 μm in nominal diameter. Part 2 of this series will further explore HVLD test results as a function of package seal and product storage variables. The final Part 3 will report the impact of HVLD exposure on product physico-chemical stability. In this Part 1 of a three-part research series, a leak test method based on electrical conductivity and capacitance, called high voltage leak detection (HVLD), was used to find leaks in small plastic bags filled with an insulin pharmaceutical solution for human injection by Novo Nordisk A/S (Bagsværd, Denmark). To perform the test, the package is electrically grounded while being conveyed past an electrode linked to a high-voltage, low-amperage transformer. The instrument measures the current that passes

  17. Minimum-Voltage Vector Injection Method for Sensorless Control of PMSM for Low-Speed Operations

    DEFF Research Database (Denmark)

    Xie, Ge; Lu, Kaiyuan; Kumar, Dwivedi Sanjeet

    2016-01-01

    In this paper, a simple signal injection method is proposed for sensorless control of PMSM at low speed, which ideally requires one voltage vector only for position estimation. The proposed method is easy to implement resulting in low computation burden. No filters are needed for extracting...... may also be further developed to inject two opposite voltage vectors to reduce the effects of inverter voltage error on the position estimation accuracy. The effectiveness of the proposed method is demonstrated by comparing with other sensorless control method. Theoretical analysis and experimental...

  18. Electrokinetic Stabilisation Method of Soft Clay in Pure System using Electrokinetic Geosynthetic Electrode

    Science.gov (United States)

    Azhar, A. T. S.; Jefferson, I.; Madun, A.; Abidin, M. H. Z.; Rogers, C. D. F.

    2018-04-01

    Electrokinetic stabilisation (EKS) method has the ability to solve the problems of soft highly compressibility soil. This study will present the results from an experimental study of EKS on soft soils using inactive kaolinite clay, inert electrode and distilled water (DW) as a pure system mechanism before any chemical stabilisers being used in this research. Therefore, this will provide a baseline study to improve the efficiency of EKS approach. The test model was using inert electrode of Electrokinetic Geosythentic (EKG) developed at the Newcastle University to apply a constant voltage gradient of 50 V/m across a soil sample approximately 400 mm. Distilled water was used at the pore electrolyte fluid compartments supplied under zero hydraulic gradient conditions for the periods of 3, 7 and 14 days. Throughout the monitoring, physical and chemical characteristics were measured. Results from the monitoring data, physical and chemical properties of the pure system showed the development of pH gradient, the changes of electrical conductivity and chemical concentrations with regards to the distance from anode and treatment periods due to the electrochemical effects even though there was no chemical stabilisers were introduced or released from the degradation of electrodes.

  19. Oscillation of Critical Current by Gate Voltage in Cooper Pair Transistor

    International Nuclear Information System (INIS)

    Kim, N.; Cheong, Y.; Song, W.

    2010-01-01

    We measured the critical current of a Cooper pair transistor consisting of two Josephson junctions and a gate electrode. The Cooper pair transistors were fabricated by using electron-beam lithography and double-angle evaporation technique. The Gate voltage dependence of critical current was measured by observing voltage jumps at various gate voltages while sweeping bias current. The observed oscillation was 2e-periodic, which shows the Cooper pair transistor had low level of quasiparticle poisoning.

  20. Supercapacitive transport of pharmacologic agents using nanoporous gold electrodes.

    Science.gov (United States)

    Gittard, Shaun D; Pierson, Bonnie E; Ha, Cindy M; Wu, Chung-An Max; Narayan, Roger J; Robinson, David B

    2010-02-01

    In this study, nanoporous gold supercapacitors were produced by electrochemical dealloying of gold-silver alloy. Scanning electron microscopy and energy dispersive X-ray spectroscopy confirmed completion of the dealloying process and generation of a porous gold material with approximately 10 nm diameter pores. Cyclic voltammetry and chronoamperometry of the nanoporous gold electrodes indicated that these materials exhibited supercapacitor behavior. The storage capacity of the electrodes measured by chronoamperometry was approximately 3 mC at 200 mV. Electrochemical storage and voltage-controlled delivery of two model pharmacologic agents, benzylammonium and salicylic acid, was demonstrated. These results suggest that capacitance-based storage and delivery of pharmacologic agents may serve as an alternative to conventional drug delivery methods.

  1. Simulation and optimization of a polymer directional coupler electro-optic switch with push pull electrodes

    Science.gov (United States)

    Zheng, Chuan-Tao; Ma, Chun-Sheng; Yan, Xin; Wang, Xian-Yin; Zhang, Da-Ming

    2008-07-01

    Structural model and design technique are proposed for a polymer directional coupler electro-optic switch with rib waveguides and push-pull electrodes, of which the electric field distribution is analyzed by the conformal transforming method and image method. In order to get the minimum mode loss and the minimum switching voltage, the parameters of the waveguide and electrode are optimized, such as the core with, core thickness, buffer layer between the core and the electrode, coupling gap between the waveguides, electrode thickness, electrode width and electrode gap. Switching Characteristics are analyzed, which include the output power, insertion loss, and crosstalk. To realize normal switching function, the fabrication error, spectrum shift, and coupling loss between a single mode fiber (SMF) and the waveguide are discussed. Simulation results show that the coupling length is 3082 μm, push-pull switching voltage is 2.14 V, insertion loss is less than 1.17 dB, and crosstalk is less than -30 dB for the designed device.

  2. Flexible electrode belt for EIT using nanofiber web dry electrodes.

    Science.gov (United States)

    Oh, Tong In; Kim, Tae Eui; Yoon, Sun; Kim, Kap Jin; Woo, Eung Je; Sadleir, Rosalind J

    2012-10-01

    Efficient connection of multiple electrodes to the body for impedance measurement and voltage monitoring applications is of critical importance to measurement quality and practicality. Electrical impedance tomography (EIT) experiments have generally required a cumbersome procedure to attach the multiple electrodes needed in EIT. Once placed, these electrodes must then maintain good contact with the skin during measurements that may last several hours. There is usually also the need to manage the wires that run between the electrodes and the EIT system. These problems become more severe as the number of electrodes increases, and may limit the practicality and portability of this imaging method. There have been several trials describing human-electrode interfaces using configurations such as electrode belts, helmets or rings. In this paper, we describe an electrode belt we developed for long-term EIT monitoring of human lung ventilation. The belt included 16 embossed electrodes that were designed to make good contact with the skin. The electrodes were fabricated using an Ag-plated PVDF nanofiber web and metallic threads. A large contact area and padding were used behind each electrode to improve subject comfort and reduce contact impedances. The electrodes were incorporated, equally spaced, into an elasticated fabric belt. We tested the electrode belt in conjunction with the KHU Mark1 multi-frequency EIT system, and demonstrate time-difference images of phantoms and human subjects during normal breathing and running. We found that the Ag-plated PVDF nanofiber web electrodes were suitable for long-term measurement because of their flexibility and durability. Moreover, the contact impedance and stability of the Ag-plated PVDF nanofiber web electrodes were found to be comparable to similarly tested Ag/AgCl electrodes.

  3. Design and Comparison of Cascaded H-Bridge, Modular Multilevel Converter, and 5-L Active Neutral Point Clamped Topologies for Motor Drive Applications

    Energy Technology Data Exchange (ETDEWEB)

    Marzoughi, Alinaghi [Virginia Tech, Blacksburg, VA (United States). Center for Power Electronics Systems; Burgos, Rolando [Virginia Tech, Blacksburg, VA (United States). Bradley Dept. of Electrical and Computer Engineering; Boroyevich, Dushan [Virginia Tech, Blacksburg, VA (United States). Bradley Dept. of Electrical and Computer Engineering; Xue, Yaosuo [Siemens Corporate Research, Princeton, NJ (United States). Power Electronics Dept.

    2018-03-01

    This paper presents the design procedure and comparison of converters currently used in medium-voltage high-power motor drive applications. For this purpose, the cascaded H-bridge (CHB), modular multilevel converter (MMC), and five-level active neutral point clamped (5-L ANPC) topologies are targeted. The design is performed using 1.7-kV insulated gate bipolar transistors (IGBTs) for CHB and MMC converters, and utilizing 3.3- and 4.5-kV IGBTs for 5-L ANPC topology as normally done in industry. The comparison is done between the designed converter topologies at three different voltage levels (4.16, 6.9, and 13.8 kV, with only the first two voltage levels in case of the 5-L ANPC) and two different power levels (3 and 5 MVA), in order to elucidate the dependence of different parameters on voltage and power rating. Finally, the comparison is done from several points of view such as efficiency, capacitive energy storage, semiconductor utilization, parts count (for measure of reliability), and power density.

  4. Neutral-point voltage dynamic model of three-level NPC inverter for reactive load

    DEFF Research Database (Denmark)

    Maheshwari, Ram Krishan; Munk-Nielsen, Stig; Busquets-Monge, Sergio

    2012-01-01

    A three-level neutral-point-clamped inverter needs a controller for the neutral-point voltage. Typically, the controller design is based on a dynamic model. The dynamic model of the neutral-point voltage depends on the pulse width modulation technique used for the inverter. A pulse width modulati...

  5. Method for fabricating carbon/lithium-ion electrode for rechargeable lithium cell

    Science.gov (United States)

    Huang, Chen-Kuo (Inventor); Surampudi, Subbarao (Inventor); Attia, Alan I. (Inventor); Halpert, Gerald (Inventor)

    1995-01-01

    The method includes steps for forming a carbon electrode composed of graphitic carbon particles adhered by an ethylene propylene diene monomer binder. An effective binder composition is disclosed for achieving a carbon electrode capable of subsequent intercalation by lithium ions. The method also includes steps for reacting the carbon electrode with lithium ions to incorporate lithium ions into graphitic carbon particles of the electrode. An electrical current is repeatedly applied to the carbon electrode to initially cause a surface reaction between the lithium ions and to the carbon and subsequently cause intercalation of the lithium ions into crystalline layers of the graphitic carbon particles. With repeated application of the electrical current, intercalation is achieved to near a theoretical maximum. Two differing multi-stage intercalation processes are disclosed. In the first, a fixed current is reapplied. In the second, a high current is initially applied, followed by a single subsequent lower current stage. Resulting carbon/lithium-ion electrodes are well suited for use as an anode in a reversible, ambient temperature, lithium cell.

  6. Insulated pipe clamp design

    International Nuclear Information System (INIS)

    Anderson, M.J.; Hyde, L.L.; Wagner, S.E.; Severud, L.K.

    1980-01-01

    Thin wall large diameter piping for breeder reactor plants can be subjected to significant thermal shocks during reactor scrams and other upset events. On the Fast Flux Test Facility, the addition of thick clamps directly on the piping was undesired because the differential metal temperatures between the pipe wall and the clamp could have significantly reduced the pipe thermal fatigue life cycle capabilities. Accordingly, an insulated pipe clamp design concept was developed. 5 refs

  7. A 3D-Space Vector Modulation Algorithm for Three Phase Four Wire Neutral Point Clamped Inverter Systems as Power Quality Compensator

    Directory of Open Access Journals (Sweden)

    Palanisamy Ramasamy

    2017-11-01

    Full Text Available A Unified Power Quality Conditioner (UPQC is designed using a Neutral Point Clamped (NPC multilevel inverter to improve the power quality. When designed for high/medium voltage and power applications, the voltage stress across the switches and harmonic content in the output voltage are increased. A 3-phase 4-wire NPC inverter system is developed as Power Quality Conditioner using an effectual three dimensional Space Vector Modulation (3D-SVM technique. The proposed system behaves like a UPQC with shunt and series active filter under balanced and unbalanced loading conditions. In addition to the improvement of the power quality issues, it also balances the neutral point voltage and voltage balancing across the capacitors under unbalanced condition. The hardware and simulation results of proposed system are compared with 2D-SVM and 3D-SVM. The proposed system is stimulated using MATLAB and the hardware is designed using FPGA. From the results it is evident that effectual 3D-SVM technique gives better performance compared to other control methods.

  8. Analytical and experimental investigation on transmission loss of clamped double panels: implication of boundary effects.

    Science.gov (United States)

    Xin, F X; Lu, T J

    2009-03-01

    The air-borne sound insulation performance of a rectangular double-panel partition clamp mounted on an infinite acoustic rigid baffle is investigated both analytically and experimentally and compared with that of a simply supported one. With the clamped (or simply supported) boundary accounted for by using the method of modal function, a double series solution for the sound transmission loss (STL) of the structure is obtained by employing the weighted residual (Galerkin) method. Experimental measurements with Al double-panel partitions having air cavity are subsequently carried out to validate the theoretical model for both types of the boundary condition, and good overall agreement is achieved. A consistency check of the two different models (based separately on clamped modal function and simply supported modal function) is performed by extending the panel dimensions to infinite where no boundaries exist. The significant discrepancies between the two different boundary conditions are demonstrated in terms of the STL versus frequency plots as well as the panel deflection mode shapes.

  9. Theoretical and experimental nonlinear dynamics of a clamped-clamped beam MEMS resonator

    NARCIS (Netherlands)

    Mestrom, R.M.C.; Fey, R.H.B.; Nijmeijer, H.

    2008-01-01

    Microelectromechanical resonators feature nonlineardynamic responses. A first-principles based modeling approach is proposed for a clamped-clamped beam resonator. Starting from the partial differential equation for the beam including geometric and electrostatic nonlinear effects, a reduced-order

  10. Optimization of Contact Force and Pull-in Voltage for Series based MEMS Switch

    Directory of Open Access Journals (Sweden)

    Abhijeet KSHIRSAGAR

    2010-04-01

    Full Text Available Cantilever based metal-to-metal contact type MEMS series switch has many applications namely in RF MEMS, Power MEMS etc. A typical MEMS switch consists of a cantilever as actuating element to make the contact between the two metal terminals of the switch. The cantilever is pulled down by applying a pull-in voltage to the control electrode that is located below the middle portion of the cantilever while only the tip portion of the cantilever makes contact between the two terminals. Detailed analysis of bending of the cantilever for different pull-in voltages reveals some interesting facts. At low pull-in voltage the cantilever tip barely touches the two terminals, thus resulting in very less contact area. To increase contact area a very high pull-in voltage is applied, but it lifts the tip from the free end due to concave curving of the cantilever in the middle region of the cantilever where the electrode is located. Again it results in less contact area. Furthermore, the high pull-in voltage produces large stress at the base of the cantilever close to the anchor. Therefore, an optimum, pull-in voltage must exist at which the concave curving is eliminated and contact area is maximum. In this paper authors report the finding of optimum contact force and pull-in voltage.

  11. Ion manipulation method and device

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, Gordon A.; Baker, Erin M.; Smith, Richard D.; Ibrahim, Yehia M.

    2017-11-07

    An ion manipulation method and device is disclosed. The device includes a pair of substantially parallel surfaces. An array of inner electrodes is contained within, and extends substantially along the length of, each parallel surface. The device includes a first outer array of electrodes and a second outer array of electrodes. Each outer array of electrodes is positioned on either side of the inner electrodes, and is contained within and extends substantially along the length of each parallel surface. A DC voltage is applied to the first and second outer array of electrodes. A RF voltage, with a superimposed electric field, is applied to the inner electrodes by applying the DC voltages to each electrode. Ions either move between the parallel surfaces within an ion confinement area or along paths in the direction of the electric field, or can be trapped in the ion confinement area.

  12. π-Clamp-mediated cysteine conjugation

    Science.gov (United States)

    Zhang, Chi; Welborn, Matthew; Zhu, Tianyu; Yang, Nicole J.; Santos, Michael S.; van Voorhis, Troy; Pentelute, Bradley L.

    2016-02-01

    Site-selective functionalization of complex molecules is one of the most significant challenges in chemistry. Typically, protecting groups or catalysts must be used to enable the selective modification of one site among many that are similarly reactive, and general strategies that selectively tune the local chemical environment around a target site are rare. Here, we show a four-amino-acid sequence (Phe-Cys-Pro-Phe), which we call the ‘π-clamp’, that tunes the reactivity of its cysteine thiol for site-selective conjugation with perfluoroaromatic reagents. We use the π-clamp to selectively modify one cysteine site in proteins containing multiple endogenous cysteine residues. These examples include antibodies and cysteine-based enzymes that would be difficult to modify selectively using standard cysteine-based methods. Antibodies modified using the π-clamp retained binding affinity to their targets, enabling the synthesis of site-specific antibody-drug conjugates for selective killing of HER2-positive breast cancer cells. The π-clamp is an unexpected approach to mediate site-selective chemistry and provides new avenues to modify biomolecules for research and therapeutics.

  13. Field tests of electric survey using capacitive electrodes; Kyapashita denkyoku wo mochiita denki tansarei

    Energy Technology Data Exchange (ETDEWEB)

    Miyazaki, I; Iseki, S; Kobayashi, T [OYO Corp., Tokyo (Japan)

    1997-10-22

    This paper describes field test results of electric survey using capacitive electrodes. When two metal plates are approached without contacting with the ground and voltage is applied between the plates, current flows in the ground. The metal plates and the ground work as a capacitor. Charges are stored between them. These metal plates having insulation with the ground are called capacitive electrodes. When ac voltage is applied between a pair of capacitors, current flows continuously in the ground without saturating the capacitors. Resistivity of the ground can be determined by measuring the level of current flowing in the ground and the level of potential. As a result of the field tests, it was found that the present method is superior to the conventional method in around ten times. However, to obtain high quality data, water spraying, reduced towing speed at the low resistivity ground such as clay and soil, and grass mowing are required. 3 refs., 5 figs., 1 tab.

  14. Evaluation of methods for increasing vacuum breakdown strength

    International Nuclear Information System (INIS)

    Evans, R.D.; Cooke, C.M.; Berman, E.R.

    1977-01-01

    Research to determine the effectiveness of coated and gas shielded cathodes as a means of increasing vacuum breakdown strength under short pulse conditions is reported. A technique for rapidly evaluating large numbers of coatings on small electrodes at relatively low pulse voltage (120 kV or less) and methods for testing larger electrodes and fewer coatings at higher total voltage were developed. Experiments with gas shielded cathodes were also conducted. Results suggest that it may be possible to eliminate prebreakdown current and to double breakdown strength by applying a suitable coating to the cathode. Breakdown stresses in excess of 2 MV/cm were obtained in a 0.5 mm gap with sputtered coatings of alumina, Cr 2 O 3 , and several readily available epoxies. Electrodes two orders of magnitude greater in area were tested, and stresses approaching 1 MV/cm were measured in 5 mm gaps for several epoxies and for alumina. It has further been shown that, because similar trends occurred in the data from large and small experiments, it should be possible to screen potential coatings rapidly and effectively with minimum expenditure using a method similar to that employed for small electrodes at low pulse voltage

  15. Silicon/copper dome-patterned electrodes for high-performance hybrid supercapacitors

    Science.gov (United States)

    Liu, Xuyan; Jung, Hun-Gi; Kim, Sang-Ok; Choi, Ho-Suk; Lee, Sangwha; Moon, Jun Hyuk; Lee, Joong Kee

    2013-12-01

    This study proposes a method for manufacturing high-performance electrode materials in which controlling the shape of the current collector and electrode material for a Li-ion capacitor (LIC). In particular, the proposed LIC manufacturing method maintains the high voltage of a cell by using a microdome-patterned electrode material, allowing for reversible reactions between the Li-ion and the active material for an extended period of time. As a result, the LICs exhibit initial capacities of approximately 42 F g-1, even at 60 A g-1. The LICs also exhibit good cycle performance up to approximately 15,000 cycles. In addition, these advancements allow for a considerably higher energy density than other existing capacitor systems. The energy density of the proposed LICs is approximately nine, two, and 1.5 times higher than those of the electrochemical double layer capacitor (EDLC), AC/LiMn2O4 hybrid capacitor, and intrinsic Si/AC LIC, respectively.

  16. A High-Voltage SOI CMOS Exciter Chip for a Programmable Fluidic Processor System.

    Science.gov (United States)

    Current, K W; Yuk, K; McConaghy, C; Gascoyne, P R C; Schwartz, J A; Vykoukal, J V; Andrews, C

    2007-06-01

    A high-voltage (HV) integrated circuit has been demonstrated to transport fluidic droplet samples on programmable paths across the array of driving electrodes on its hydrophobically coated surface. This exciter chip is the engine for dielectrophoresis (DEP)-based micro-fluidic lab-on-a-chip systems, creating field excitations that inject and move fluidic droplets onto and about the manipulation surface. The architecture of this chip is expandable to arrays of N X N identical HV electrode driver circuits and electrodes. The exciter chip is programmable in several senses. The routes of multiple droplets may be set arbitrarily within the bounds of the electrode array. The electrode excitation waveform voltage amplitude, phase, and frequency may be adjusted based on the system configuration and the signal required to manipulate a particular fluid droplet composition. The voltage amplitude of the electrode excitation waveform can be set from the minimum logic level up to the maximum limit of the breakdown voltage of the fabrication technology. The frequency of the electrode excitation waveform can also be set independently of its voltage, up to a maximum depending upon the type of droplets that must be driven. The exciter chip can be coated and its oxide surface used as the droplet manipulation surface or it can be used with a top-mounted, enclosed fluidic chamber consisting of a variety of materials. The HV capability of the exciter chip allows the generated DEP forces to penetrate into the enclosed chamber region and an adjustable voltage amplitude can accommodate a variety of chamber floor thicknesses. This demonstration exciter chip has a 32 x 32 array of nominally 100 V electrode drivers that are individually programmable at each time point in the procedure to either of two phases: 0deg and 180deg with respect to the reference clock. For this demonstration chip, while operating the electrodes with a 100-V peak-to-peak periodic waveform, the maximum HV electrode

  17. A novel voltage clamp circuit for the measurement of transistor dynamic on-resistance

    NARCIS (Netherlands)

    Gelagaev, R.; Jacqmaer, P.; Everts, J.; Driesen, Johan

    2012-01-01

    For determining the dynamic on-resistance Rdyn,on of a power transistor, the voltage and current waveforms have to be measured during the switching operation. In measurements of voltage waveforms, using an oscilloscope, the characteristics of an amplifier inside the oscilloscope are distorted when

  18. DETERMINATION OF ANALYTICAL CALCULATION ERROR OF MAGNETIC FIELD OF HIGH-VOLTAGE CABLE LINES WITH TWO-POINT BONDED CABLE SHIELDS CAUSED BY NON-UNIFORM CURRENT DISTRIBUTION IN THE SHIELDS

    Directory of Open Access Journals (Sweden)

    M. I. Baranov

    2017-06-01

    Full Text Available Purpose. To obtain new calculation correlations, determining approximate energy dissipation and electric erosion of massive basic metallic electrodes in the high-voltage high-current air switchboard (HVCAS of atmospheric pressure, in-use in the bit chain of the high-voltage electrophysics setting (HVES with the powerful capacity store of energy (CSE. Methodology. Electrophysics bases of technique of high-voltage and large impulsive currents (LIC, scientific and technical bases of development and planning of high-voltage heavy-current impulsive electro-devices, including HVES and powerful CSE, and also methods of measuring in their bit chains of LIC of the microsecond temporal range. Results. On the basis of new engineering approach the results of calculation estimation of excretions energy and electric erosion of massive basic metallic electrodes are resulted in probed HVCAS. New correlations are obtained for the approximate calculation of thermal energy, selected in an impulsive air spark and on the workings surfaces of anode and cathode of HVCAS. It is entered and a new electrophysics concept, touching equivalent active resistance of impulsive air spark, is mathematically certain. New formulas are obtained for the approximate calculation of most depth of single round crater of destruction on the workings surfaces of basic metallic electrodes of HVCAS, and also mass of metal, thrown out magnetic pressure from this crater of destruction on the electrodes of switch for one electric discharge through them powerful CSE HVES. It is shown that the radius of the indicated single crater of destruction is approximately equal to the maximal radius of plasma channel of a spark discharge between a cathode and anode of HVCAS. The executed high-current experiments in the bit chain of HVES with powerful CSE validated row of the got and in-use calculation correlations for the estimation of energy dissipation and electric erosion of metallic electrodes in

  19. A new configuration for multilevel converters with diode clamped topology

    DEFF Research Database (Denmark)

    Nami, A.; Zare, F.; Ledwich, G.

    2008-01-01

    Due to the increased use of renewable energy and power elctronic applications, more multilevel converters (MLC) are developed. A Neutral Point Clamped (NPC) inverter is one of the most used multilevel topologies for wind turbine (WT) and photovoltaic (PV) applications. One of the most crucial...... of load changes which can avoid neutral point balancing problem in such converters. In addition, the presented topology is suitable for renewable energy systems to boost the low rectified output-voltage. In order to verify the proposed topology, steady state analysis, modelling and simulations are carried...

  20. Cermet insert high voltage holdoff for ceramic/metal vacuum devices

    Science.gov (United States)

    Ierna, William F.

    1987-01-01

    An improved metal-to-ceramic seal is provided wherein the ceramic body of the seal contains an integral region of cermet material in electrical contact with the metallic member, e.g., an electrode, of the seal. The seal is useful in high voltage vacuum devices, e.g., vacuum switches, and increases the high-voltage holdoff capabilities of such devices. A method of fabricating such seals is also provided.

  1. Nanosecond electric pulses differentially affect inward and outward currents in patch clamped adrenal chromaffin cells.

    Directory of Open Access Journals (Sweden)

    Lisha Yang

    Full Text Available This study examined the effect of 5 ns electric pulses on macroscopic ionic currents in whole-cell voltage-clamped adrenal chromaffin cells. Current-voltage (I-V relationships first established that the early peak inward current was primarily composed of a fast voltage-dependent Na+ current (INa, whereas the late outward current was composed of at least three ionic currents: a voltage-gated Ca2+ current (ICa, a Ca2+-activated K+ current (IK(Ca, and a sustained voltage-dependent delayed rectifier K+ current (IKV. A constant-voltage step protocol was next used to monitor peak inward and late outward currents before and after cell exposure to a 5 ns pulse. A single pulse applied at an electric (E-field amplitude of 5 MV/m resulted in an instantaneous decrease of ~4% in peak INa that then declined exponentially to a level that was ~85% of the initial level after 10 min. Increasing the E-field amplitude to 8 or 10 MV/m caused a twofold greater inhibitory effect on peak INa. The decrease in INa was not due to a change in either the steady-state inactivation or activation of the Na+ channel but instead was associated with a decrease in maximal Na+ conductance. Late outward current was not affected by a pulse applied at 5 MV/m. However, for a pulse applied at the higher E-field amplitudes of 8 and 10 MV/m, late outward current in some cells underwent a progressive ~22% decline over the course of the first 20 s following pulse exposure, with no further decline. The effect was most likely concentrated on ICa and IK(Ca as IKV was not affected. The results of this study indicate that in whole-cell patch clamped adrenal chromaffin cells, a 5 ns pulse differentially inhibits specific voltage-gated ionic currents in a manner that can be manipulated by tuning E-field amplitude.

  2. Negligible substrate clamping effect on piezoelectric response in (111)-epitaxial tetragonal Pb(Zr, Ti)O3 films

    International Nuclear Information System (INIS)

    Yamada, Tomoaki; Yasumoto, Jun; Ito, Daisuke; Yoshino, Masahito; Nagasaki, Takanori; Sakata, Osami; Imai, Yasuhiko; Kiguchi, Takanori; Shiraishi, Takahisa; Shimizu, Takao; Funakubo, Hiroshi

    2015-01-01

    The converse piezoelectric responses of (111)- and (001)-epitaxial tetragonal Pb(Zr 0.35 Ti 0.65 )O 3 [PZT] films were compared to investigate the orientation dependence of the substrate clamping effect. Synchrotron X-ray diffraction (XRD) and piezoelectric force microscopy revealed that the as-grown (111)-PZT film has a polydomain structure with normal twin boundaries that are changed by the poling process to inclined boundaries, as predicted by Romanov et al. [Phys. Status Solidi A 172, 225 (1999)]. Time-resolved synchrotron XRD under bias voltage showed the negligible impact of substrate clamping on the piezoelectric response in the (111)-PZT film, unlike the case for (001)-PZT film. The origin of the negligible clamping effect in the (111)-PZT film is discussed from the viewpoint of the elastic properties and the compensation of lattice distortion between neighboring domains

  3. New strategy for eliminating zero-sequence circulating current between parallel operating three-level NPC voltage source inverters

    DEFF Research Database (Denmark)

    Li, Kai; Dong, Zhenhua; Wang, Xiaodong

    2018-01-01

    A novel strategy based on a zero common mode voltage pulse-width modulation (ZCMV-PWM) technique and zero-sequence circulating current (ZSCC) feedback control is proposed in this study to eliminate ZSCCs between three-level neutral point clamped (NPC) voltage source inverters, with common AC and DC......, the ZCMV-PWM method is presented to reduce CMVs, and a simple electric circuit is adopted to control ZSCCs and neutral point potential. Finally, simulation and experiment are conducted to illustrate effectiveness of the proposed strategy. Results show that ZSCCs between paralleled inverters can...

  4. Membrane voltage changes in passive dendritic trees: a tapering equivalent cylinder model.

    Science.gov (United States)

    Poznański, R R

    1988-01-01

    An exponentially tapering equivalent cylinder model is employed in order to approximate the loss of the dendritic trunk parameter observed from anatomical data on apical and basilar dendrites of CA1 and CA3 hippocampal pyramidal neurons. This model allows dendritic trees with a relative paucity of branching to be treated. In particular, terminal branches are not required to end at the same electrotonic distance. The Laplace transform method is used to obtain analytic expressions for the Green's function corresponding to an instantaneous pulse of current injected at a single point along a tapering equivalent cylinder with sealed ends. The time course of the voltage in response to an arbitrary input is computed using the Green's function in a convolution integral. Examples of current input considered are (1) an infinitesimally brief (Dirac delta function) pulse and (2) a step pulse. It is demonstrated that inputs located on a tapering equivalent cylinder are more effective at the soma than identically placed inputs on a nontapering equivalent cylinder. Asymptotic solutions are derived to enable the voltage response behaviour over both relatively short and long time periods to be analysed. Semilogarithmic plots of these solutions provide a basis for estimating the membrane time constant tau m from experimental transients. Transient voltage decrement from a clamped soma reveals that tapering tends to reduce the error associated with inadequate voltage clamping of the dendritic membrane. A formula is derived which shows that tapering tends to increase the estimate of the electrotonic length parameter L.

  5. Patch clamp study of mouse glomus cells using a whole carotid body.

    Science.gov (United States)

    Yamaguchi, Shigeki; Lande, Boris; Kitajima, Toshimitsu; Hori, Yuichi; Shirahata, Machiko

    2004-03-04

    Some electrophysiological characteristics of mouse glomus cells (DBA/2J strain) were investigated using an undissociated carotid body. The carotid body with major carotid arteries was placed in a recording chamber, and glomus cells were visualized with a water immersion lens combined with an infrared differential interference video camera. Patch clamp experiments revealed that voltage-gated outward current, but not inward current, was easily observed in glomus cells. Pharmacological experiments and the kinetics of the current suggest that outward current is via delayed rectifier, A type, and large conductance calcium-activated K channels. Furthermore, K current was reversibly attenuated by mild hypoxia. The results suggest electrophysiological similarities of glomus cells among the cat, the rat, and the DBA/2J mouse. The method appears useful for physiological experiments.

  6. The quaternary lidocaine derivative, QX-314, exerts biphasic effects on transient receptor potential vanilloid subtype 1 channels in vitro

    DEFF Research Database (Denmark)

    Rivera-Acevedo, Ricardo E; Pless, Stephan Alexander; Ahern, Christopher A

    2011-01-01

    concentrations (less than 1 mM), QX-314 potently inhibited capsaicin-evoked TRPV1 currents with an IC₅₀ of 8.0 ± 0.6 μM. CONCLUSIONS: The results of this study show that the quaternary lidocaine derivative QX-314 exerts biphasic effects on TRPV1 channels, inhibiting capsaicin-evoked TRPV1 currents at lower...... channels. METHODS: The authors conducted an in vitro laboratory study in which they expressed TRPV1 and TRPV4 channels in Xenopus laevis oocytes and recorded cation currents with the two-electrode voltage clamp method. They used confocal microscopy for Ca²⁺ imaging in TRPV1 transient transfected tsA201...

  7. Nanofiber membrane-electrode-assembly and method of fabricating same

    Energy Technology Data Exchange (ETDEWEB)

    Pintauro, Peter N.; Ballengee, Jason; Brodt, Matthew

    2018-01-23

    In one aspect of the present invention, a method of fabricating a fuel cell membrane-electrode-assembly (MEA) having an anode electrode, a cathode electrode, and a membrane disposed between the anode electrode and the cathode electrode, includes fabricating each of the anode electrode, the cathode electrode, and the membrane separately by electrospinning; and placing the membrane between the anode electrode and the cathode electrode, and pressing then together to form the fuel cell MEA.

  8. Study of electric discharges between moving electrodes in air

    International Nuclear Information System (INIS)

    Andreev, V. V.; Pichugin, Yu. P.; Telegin, V. G.; Telegin, G. G.

    2011-01-01

    A barrier electric discharge excited between a fixed electrode and a rotating electrode covered with a dielectric layer in atmospheric-pressure air is studied experimentally. A distinctive feature of this type of discharge is that it operates at a constant voltage between the electrodes. An advantage of the proposed method for plasma generation in the boundary layer of the rotating electrode (e.g., for studying the influence of plasma on air flows) is the variety of forms of the discharge and conditions for its initiation, simplicity of the design of the discharge system, and ease of its practical implementation

  9. Study of electric discharges between moving electrodes in air

    Energy Technology Data Exchange (ETDEWEB)

    Andreev, V. V.; Pichugin, Yu. P.; Telegin, V. G.; Telegin, G. G. [Chuvash State University (Russian Federation)

    2011-12-15

    A barrier electric discharge excited between a fixed electrode and a rotating electrode covered with a dielectric layer in atmospheric-pressure air is studied experimentally. A distinctive feature of this type of discharge is that it operates at a constant voltage between the electrodes. An advantage of the proposed method for plasma generation in the boundary layer of the rotating electrode (e.g., for studying the influence of plasma on air flows) is the variety of forms of the discharge and conditions for its initiation, simplicity of the design of the discharge system, and ease of its practical implementation.

  10. Loading dynamics of a sliding DNA clamp.

    KAUST Repository

    Cho, Won-Ki

    2014-05-22

    Sliding DNA clamps are loaded at a ss/dsDNA junction by a clamp loader that depends on ATP binding for clamp opening. Sequential ATP hydrolysis results in closure of the clamp so that it completely encircles and diffuses on dsDNA. We followed events during loading of an E. coli β clamp in real time by using single-molecule FRET (smFRET). Three successive FRET states were retained for 0.3 s, 0.7 s, and 9 min: Hydrolysis of the first ATP molecule by the γ clamp loader resulted in closure of the clamp in 0.3 s, and after 0.7 s in the closed conformation, the clamp was released to diffuse on the dsDNA for at least 9 min. An additional single-molecule polarization study revealed that the interfacial domain of the clamp rotated in plane by approximately 8° during clamp closure. The single-molecule polarization and FRET studies thus revealed the real-time dynamics of the ATP-hydrolysis-dependent 3D conformational change of the β clamp during loading at a ss/dsDNA junction.

  11. Hybrid capacitor with activated carbon electrode, Ni(OH) 2 electrode and polymer hydrogel electrolyte

    Science.gov (United States)

    Nohara, Shinji; Asahina, Toshihide; Wada, Hajime; Furukawa, Naoji; Inoue, Hiroshi; Sugoh, Nozomu; Iwasaki, Hideharu; Iwakura, Chiaki

    A new hybrid capacitor (HC) cell was assembled using an activated carbon (AC) negative electrode, an Ni(OH) 2 positive electrode and a polymer hydrogel electrolyte prepared from crosslinked potassium poly(acrylate) (PAAK) and KOH aqueous solution. The HC cell was characterized compared with an electric double layer capacitor (EDLC) using two AC electrodes and the polymer hydrogel electrolyte. It was found that the HC cell successfully worked in the larger voltage range and exhibited ca. 2.4 times higher capacitance than the EDLC cell. High-rate dischargeability of the HC cell was also superior to that of the EDLC cell. These improved characteristics strongly suggest that the HC cell can be a promising system of capacitors with high energy and power densities.

  12. Crystal structure of DNA polymerase III β sliding clamp from Mycobacterium tuberculosis.

    Science.gov (United States)

    Gui, Wen-Jun; Lin, Shi-Qiang; Chen, Yuan-Yuan; Zhang, Xian-En; Bi, Li-Jun; Jiang, Tao

    2011-02-11

    The sliding clamp is a key component of DNA polymerase III (Pol III) required for genome replication. It is known to function with diverse DNA repair proteins and cell cycle-control proteins, making it a potential drug target. To extend our understanding of the structure/function relationship of the sliding clamp, we solved the crystal structure of the sliding clamp from Mycobacterium tuberculosis (M. tuberculosis), a human pathogen that causes most cases of tuberculosis (TB). The sliding clamp from M. tuberculosis forms a ring-shaped head-to-tail dimer with three domains per subunit. Each domain contains two α helices in the inner ring that lie against two β sheets in the outer ring. Previous studies have indicated that many Escherichia coli clamp-binding proteins have a conserved LF sequence, which is critical for binding to the hydrophobic region of the sliding clamp. Here, we analyzed the binding affinities of the M. tuberculosis sliding clamp and peptides derived from the α and δ subunits of Pol III, which indicated that the LF motif also plays an important role in the binding of the α and δ subunits to the sliding clamp of M. tuberculosis. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. Measurement and statistical analysis of single-molecule current-voltage characteristics, transition voltage spectroscopy, and tunneling barrier height.

    Science.gov (United States)

    Guo, Shaoyin; Hihath, Joshua; Díez-Pérez, Ismael; Tao, Nongjian

    2011-11-30

    We report on the measurement and statistical study of thousands of current-voltage characteristics and transition voltage spectra (TVS) of single-molecule junctions with different contact geometries that are rapidly acquired using a new break junction method at room temperature. This capability allows one to obtain current-voltage, conductance voltage, and transition voltage histograms, thus adding a new dimension to the previous conductance histogram analysis at a fixed low-bias voltage for single molecules. This method confirms the low-bias conductance values of alkanedithiols and biphenyldithiol reported in literature. However, at high biases the current shows large nonlinearity and asymmetry, and TVS allows for the determination of a critically important parameter, the tunneling barrier height or energy level alignment between the molecule and the electrodes of single-molecule junctions. The energy level alignment is found to depend on the molecule and also on the contact geometry, revealing the role of contact geometry in both the contact resistance and energy level alignment of a molecular junction. Detailed statistical analysis further reveals that, despite the dependence of the energy level alignment on contact geometry, the variation in single-molecule conductance is primarily due to contact resistance rather than variations in the energy level alignment.

  14. A missing factor in chip-based patch clamp assay: gigaseal

    International Nuclear Information System (INIS)

    Ong, W-L; Yobas, L; Ong, W-Y

    2006-01-01

    The 'gold' standard in the study of ionic currents across biological membranes is the Patch Clamp method. However, this is a slow, labor and skill intensive process. High throughput patch clamp devices are mainly chip-based. A major challenge in these miniaturized devices is the low rate of 'Gigaseal' formation which is critical in the study of Single Channel effect. In a conventional patch clamp, a pipette moves and patches a fixed cell (cell-adhered patch) which is grown on the bottom of a Petri dish. In the chip-based case, the cells are in suspension and move towards the fixed patch clamp sites (cell-suspended patch). In this study, using the proven conventional patch clamp setup, we investigated the effect of the differences in the cell configurations between the convention patch clamp and cell-based patch clamp. It is shown that adhered cells (as used in the conventional setup) have a much higher rate of gigaseal formation as compared to the cells in suspension (as used in chip-based devices). We postulate that the arrangement of the cytoskeleton within the cell plays a major part in the formation of the gigaseal

  15. Systems and methods for producing low work function electrodes

    Science.gov (United States)

    Kippelen, Bernard; Fuentes-Hernandez, Canek; Zhou, Yinhua; Kahn, Antoine; Meyer, Jens; Shim, Jae Won; Marder, Seth R.

    2015-07-07

    According to an exemplary embodiment of the invention, systems and methods are provided for producing low work function electrodes. According to an exemplary embodiment, a method is provided for reducing a work function of an electrode. The method includes applying, to at least a portion of the electrode, a solution comprising a Lewis basic oligomer or polymer; and based at least in part on applying the solution, forming an ultra-thin layer on a surface of the electrode, wherein the ultra-thin layer reduces the work function associated with the electrode by greater than 0.5 eV. According to another exemplary embodiment of the invention, a device is provided. The device includes a semiconductor; at least one electrode disposed adjacent to the semiconductor and configured to transport electrons in or out of the semiconductor.

  16. Fast two-photon imaging of subcellular voltage dynamics in neuronal tissue with genetically encoded indicators.

    Science.gov (United States)

    Chamberland, Simon; Yang, Helen H; Pan, Michael M; Evans, Stephen W; Guan, Sihui; Chavarha, Mariya; Yang, Ying; Salesse, Charleen; Wu, Haodi; Wu, Joseph C; Clandinin, Thomas R; Toth, Katalin; Lin, Michael Z; St-Pierre, François

    2017-07-27

    Monitoring voltage dynamics in defined neurons deep in the brain is critical for unraveling the function of neuronal circuits but is challenging due to the limited performance of existing tools. In particular, while genetically encoded voltage indicators have shown promise for optical detection of voltage transients, many indicators exhibit low sensitivity when imaged under two-photon illumination. Previous studies thus fell short of visualizing voltage dynamics in individual neurons in single trials. Here, we report ASAP2s, a novel voltage indicator with improved sensitivity. By imaging ASAP2s using random-access multi-photon microscopy, we demonstrate robust single-trial detection of action potentials in organotypic slice cultures. We also show that ASAP2s enables two-photon imaging of graded potentials in organotypic slice cultures and in Drosophila . These results demonstrate that the combination of ASAP2s and fast two-photon imaging methods enables detection of neural electrical activity with subcellular spatial resolution and millisecond-timescale precision.

  17. Two coupled Josephson junctions: dc voltage controlled by biharmonic current

    International Nuclear Information System (INIS)

    Machura, L; Spiechowicz, J; Kostur, M; Łuczka, J

    2012-01-01

    We study transport properties of two Josephson junctions coupled by an external shunt resistance. One of the junctions (say, the first) is driven by an unbiased ac current consisting of two harmonics. The device can rectify the ac current yielding a dc voltage across the first junction. For some values of coupling strength, controlled by an external shunt resistance, a dc voltage across the second junction can be generated. By variation of system parameters such as the relative phase or frequency of two harmonics, one can conveniently manipulate both voltages with high efficiency, e.g. changing the dc voltages across the first and second junctions from positive to negative values and vice versa. (paper)

  18. A new method for compensation of the effect of charging transformer's leakage inductance on PFN voltage regulation in Klystron pulse modulators

    Energy Technology Data Exchange (ETDEWEB)

    Patel, Akhil, E-mail: akhilpatel@rrcat.gov.in; Kale, Umesh; Shrivastava, Purushottam

    2017-04-21

    The Line type modulators have been widely used to generate high voltage rectangular pulses to power the klystron for high power RF generation. In Line type modulator, the Pulse Forming Network (PFN) which is a cascade combination of lumped capacitors and inductors is used to store the electrical energy. The charged PFN is then discharged into a klystron by firing a high voltage Thyratron switch. This discharge generates a high voltage rectangular pulse across the klystron electrodes. The amplitude and phase of Klystron's RF output is governed by the high voltage pulse amplitude. The undesired RF amplitude and phase stability issues arises at the klystron's output due to inter-pulse and during the pulse amplitude variations. To reduce inter-pulse voltage variations, the PFN is required to be charged at the same voltage after every discharge cycle. At present, the combination of widely used resonant charging and deQing method is used to regulate the pulse to pulse PFN voltage variations but the charging transformer's leakage inductance puts an upper bound on the regulation achievable by this method. Here we have developed few insights of the deQing process and devised a new compensation method to compensate this undesired effect of charging transformer's leakage inductance on the pulse to pulse PFN voltage stability. This compensation is accomplished by the controlled partial discharging of the split PFN capacitor using a low voltage MOSFET switch. Theoretically, very high values of pulse to pulse voltage stability may be achieved using this method. This method may be used in deQing based existing modulators or in new modulators, to increase the pulse to pulse voltage stability, without having a very tight bound on charging transformer's leakage inductance. Given a stable charging power supply, this method may be used to further enhance the inter-pulse voltage stability of modulators which employ the direct charging, after replacing the

  19. A model for electrode effects using percolation theory

    International Nuclear Information System (INIS)

    Wuethrich, R.; Bleuler, H.

    2004-01-01

    Electrode effects are known for more than 150 years. These effects, with undesirable consequences in industrial aluminium electrolysis, can be used to micro-machine glass with Spark Assisted Chemical Engraving (SACE). In this paper, a novel approach for theoretical analysis of the phenomenon is proposed by considering the bubble growth and bubble departure from electrodes as a stochastic process. The critical conditions (critical voltage and current density) are predicted in function of electrode geometry and electrolyte concentration as well as the static mean current-voltage characteristics prior to the onset of the effects. The different regions of the current-voltage characteristics, as identified by previous authors, are described and explained. It is shown that all relevant processes for the onset of the electrodes effects happen in the adherence region of the bubble layer. The model is applied for vertical cylindrical electrodes and compared with experimental data

  20. A complete dc characterization of a constant-frequency, clamped-mode, series-resonant converter

    Science.gov (United States)

    Tsai, Fu-Sheng; Lee, Fred C.

    1988-01-01

    The dc behavior of a clamped-mode series-resonant converter is characterized systematically. Given a circuit operating condition, the converter's mode of operation is determined and various circuit parameters are calculated, such as average inductor current (load current), rms inductor current, peak capacitor voltage, rms switch currents, average diode currents, switch turn-on currents, and switch turn-off currents. Regions of operation are defined, and various circuit characteristics are derived to facilitate the converter design.

  1. On the mechanism of high-voltage discharge initiation in high-voltage accelerator accelerating tubes

    International Nuclear Information System (INIS)

    Zheleznikov, F.G.

    1983-01-01

    Experimental investigation into physical natupe of discharge processes in high-voltage accelerator accelerating tubes in the absence of the accelerated particle beam are conducted. The installation for the study of the mechanism of initiating vacuum isolation conductivity is used in the experiments. The vacuum chamber of the installation is made of steel and sealed with rubber packings. Electrodes 300-360 mm in diameter are made of stainless steel. Two variants of cleaning technology were used before electrode assembling: 1) degreasing by organic solvents; 2) cleaning by fine grinding cloth with successive washing by rectificated alcohol. Analysis of the obtained data shows that forma. tion of background flux of charged particles in interelectrode gap is caused by external photoelectric effect, excited by X radiation, which initiates the formation of intensive internal field in microfilms of non-conducting impurities on the electrode surfaces. The secondary electron emission plays the minor role at that

  2. Cermet insert high voltage holdoff improvement for ceramic/metal vacuum devices

    Science.gov (United States)

    Ierna, W.F.

    1986-03-11

    An improved metal-to-ceramic seal is provided wherein the ceramic body of the seal contains an integral region of cermet material in electrical contact with the metallic member, e.g., an electrode, of the seal. The seal is useful in high voltage vacuum devices, e.g., vacuum switches, and increases the high-voltage holdoff capabilities of such devices. A method of fabricating such seals is also provided.

  3. Hybrid capacitor with activated carbon electrode, Ni(OH){sub 2} electrode and polymer hydrogel electrolyte

    Energy Technology Data Exchange (ETDEWEB)

    Nohara, Shinji; Asahina, Toshihide; Wada, Hajime; Furukawa, Naoji; Inoue, Hiroshi; Iwakura, Chiaki [Department of Applied Chemistry, Graduate School of Engineering, Osaka Prefecture University, 1-1 Gakuen-cho, Sakai, Osaka 599-8531 (Japan); Sugoh, Nozomu; Iwasaki, Hideharu [Kurashiki Research Laboratory, Kuraray Co., Ltd., 2045-1 Sakazu, Kurashiki, Okayama 710-8691 (Japan)

    2006-06-19

    A new hybrid capacitor (HC) cell was assembled using an activated carbon (AC) negative electrode, an Ni(OH){sub 2} positive electrode and a polymer hydrogel electrolyte prepared from crosslinked potassium poly(acrylate) (PAAK) and KOH aqueous solution. The HC cell was characterized compared with an electric double layer capacitor (EDLC) using two AC electrodes and the polymer hydrogel electrolyte. It was found that the HC cell successfully worked in the larger voltage range and exhibited ca. 2.4 times higher capacitance than the EDLC cell. High-rate dischargeability of the HC cell was also superior to that of the EDLC cell. These improved characteristics strongly suggest that the HC cell can be a promising system of capacitors with high energy and power densities. (author)

  4. Fluoride Removal From Drinking Water by Electrocoagulation Using Iron and Aluminum Electrodes

    OpenAIRE

    Takdastan; Emami Tabar; Neisi; Eslami

    2014-01-01

    Background Existence of fluoride in drinking water above the permissible level causes human skeletal fluorosis. Objectives Electrocoagulation by iron and aluminum electrodes was proposed for removing fluoride from drinking water. Materials and Methods Effects of different operating conditions such as treatment time, initial pH, applied voltage, type and number of electrodes, the sp...

  5. Time scales of bias voltage effects in FE/MgO-based magnetic tunnel junctions with voltage-dependent perpendicular anisotropy

    International Nuclear Information System (INIS)

    Lytvynenko, Ia.M.; Hauet, T.; Montaigne, F.; Bibyk, V.V.; Andrieu, S.

    2015-01-01

    Interplay between voltage-induced magnetic anisotropy transition and voltage-induced atomic diffusion is studied in epitaxial V/Fe (0.7 nm)/ MgO/ Fe(5 nm)/Co/Au magnetic tunnel junction where thin Fe soft electrode has in-plane or out-of-plane anisotropy depending on the sign of the bias voltage. We investigate the origin of the slow resistance variation occurring when switching bias voltage in opposite polarity. We demonstrate that the time to reach resistance stability after voltage switching is reduced when increasing the voltage amplitude or the temperature. A single energy barrier of about 0.2 eV height is deduced from temperature dependence. Finally, we demonstrate that the resistance change is not correlated to a change in soft electrode anisotropy. This conclusion contrasts with observations recently reported on analogous systems. - Highlights: • Voltage-induced time dependence of resistance is studied in epitaxial Fe/MgO/Fe. • Resistance change is not related to the bottom Fe/MgO interface. • The effect is thermally activated with an energy barrier of the order of 0.2 eV height

  6. High voltage holding in the negative ion sources with cesium deposition

    Energy Technology Data Exchange (ETDEWEB)

    Belchenko, Yu.; Abdrashitov, G.; Ivanov, A.; Sanin, A.; Sotnikov, O., E-mail: O.Z.Sotnikov@inp.nsk.su [Budker Institute of Nuclear Physics, Siberian Branch of Russian Academy of Sciences, Novosibirsk (Russian Federation)

    2016-02-15

    High voltage holding of the large surface-plasma negative ion source with cesium deposition was studied. It was found that heating of ion-optical system electrodes to temperature >100 °C facilitates the source conditioning by high voltage pulses in vacuum and by beam shots. The procedure of electrode conditioning and the data on high-voltage holding in the negative ion source with small cesium seed are described. The mechanism of high voltage holding improvement by depletion of cesium coverage is discussed.

  7. Electrode effects of a cellulose-based electro-active paper energy harvester

    International Nuclear Information System (INIS)

    Abas, Zafar; Kim, Heung Soo; Zhai, Lindong; Kim, Jaehwan; Kim, Joo-Hyung

    2014-01-01

    The possibility of cellulose-based electro-active paper (EAPap) as a vibrational energy transducer was investigated in this paper. Thin cellulose EAPap film specimens were prepared by the regenerating process. Three different metal electrodes of gold, silver and aluminum were deposited on a 50 × 50 mm 2 cellulose film using a thermal evaporator. An aluminum cantilever beam was used as a vibrational bender and EAPap was attached close to the root of the cantilever beam. The voltage output of the EAPap was measured under harmonic base excitation of the cantilever beam. The EAPap with aluminum electrode provided the largest open circuit voltage output compared to those with gold or silver electrodes. The output voltages of the EAPap increased linearly with increase of the area of the electrodes. The output voltages also increased with increasing input acceleration but became saturated at a certain magnitude. From the experimental results, we conclude that EAPap with metal electrodes can be used as a flexible energy harvesting transducer by external mechanical stress, and the output voltage is related to the electrode material due to its work function. (paper)

  8. The optimal protocol to reduce blood loss and blood transfusion after unilateral total knee replacement: Low-dose IA-TXA plus 30-min drain clamping versus drainage clamping for the first 3 h without IA-TXA.

    Science.gov (United States)

    Park, Joo Hyun; Choi, Sung Wook; Shin, Eun Ho; Park, Myung Hoon; Kim, Myung Ku

    2017-01-01

    Although intraarticular tranexamic acid (IA-TXA) administration or drainage clamping are popular methods used to reduce blood loss after total knee replacement (TKR), the protocol remains controversial. We aimed (1) to establish new protocols through investigating whether two methods, that is, low-dose (500 mg) IA-TXA plus 30-min drain clamping and drainage clamping for the first 3 h without IA-TXA, can reduce blood loss and blood transfusion after unilateral TKR and (2) to make recommendations related to clinical application. This study, conducted from September 2014 to June 2016 related to enrolled 95 patients with primary osteoarthritis who were to have a unilateral cemented TKR, was nonrandomized and retrospective. In group A, the drain was released following tourniquet deflation. In group B, 500-mg TXA was injected into the knee joint via a drain tube after fascia closure and the drain was clamped for the first 30 min to prevent leakage. In group C, the drain was clamped for the first 3-h postoperation. Demographic characteristics and clinical data were collected, including the levels of hematocrit (Hct), the total blood loss (TBL), drained blood volume (BV), the amount of blood transfused, and any complications that developed. We found a significantly lower postoperative TBL, drained BV, decreasing Hct level, and less transfused BV in the IA-TXA injection group (group B) and the 3-h drainage clamping group (group C) compared to the conventional negative drainage group (group A; p optimal than drainage clamping in patients with high bleeding tendency or lateral retinacular release during TKR, who would be concerned about postoperative wound complication.

  9. New Insights into the Operating Voltage of Aqueous Supercapacitors.

    Science.gov (United States)

    Yu, Minghao; Lu, Yongzhuang; Zheng, Haibing; Lu, Xihong

    2018-03-12

    The main limitation of aqueous supercapacitors (SCs) lies in their narrow operating voltages, especially when compared with organic SCs. Fundamental understanding of factors relevant to the operating voltage helps providing guidance for the assembly of high-voltage aqueous SCs. In this regard, this concept analyzes the deciding factors for the operating voltage of aqueous SCs. Strategies applied to expand the operating voltage are summarized and discussed from the aspects of electrolyte, electrode, and asymmetric structure. Dynamic factors associated with water electrolysis and maximally using the available potential ranges of electrodes are particularly emphasized. Finally, other promising approaches that have not been explored and their challenges are also elaborated, hoping to provide more insights for the design of high-voltage aqueous SCs. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Nonlinear Impedance of Whole Cells Near an Electrode as a Probe of Mitochondrial Activity

    Directory of Open Access Journals (Sweden)

    John H. Miller Jr.

    2011-04-01

    Full Text Available By simultaneously measuring the bulk media and electrode interface voltages of a yeast (Saccharomyces cerevisiae suspension subjected to an AC voltage, a yeast-dependent nonlinear response was found only near the current injection electrodes. Computer simulation of yeast near a current injection electrode found an enhanced voltage drop across the yeast near the electrode due to slowed charging of the electrode interfacial capacitance. This voltage drop is sufficient to induce conformation change in membrane proteins. Disruption of the mitochondrial electron transport chain is found to significantly change the measured nonlinear current response, suggesting nonlinear impedance can be used as a non-invasive probe of cellular metabolic activity.

  11. Preparation of Electrospun Polymer Fibers Using a Copper Wire Electrode in a Capillary Tube

    Science.gov (United States)

    Shinbo, Kazunari; Onozuka, Shintaro; Hoshino, Rikiya; Mizuno, Yoshinori; Ohdaira, Yasuo; Baba, Akira; Kato, Keizo; Kaneko, Futao

    2010-04-01

    Polymer fibers were prepared by an electrospinning method utilizing a copper wire electrode in a capillary tube. The morphology of electrospun poly(vinyl alcohol) (PVA) fibers was observed, and was found to be dependent on the wire electrode tip position in the capillary tube, the concentration of the polymer solution, the distance between the electrodes, and the applied voltage. By using the wire electrode, the experimental setup is simple and the distance between the electrodes and the applied voltage can be easily reduced. Furthermore, the preparation of poly(3-hexylthiophene) (P3HT) fibers was carried out. P3HT fibers were successfully prepared by mixing poly(ethylene oxide) (PEO) in P3HT solution. Orientation control was also carried out by depositing the fibers on a rotating collector electrode, and the alignment of the P3HT:PEO fibers was confirmed. Anisotropy of the optical absorption spectra was also observed for the aligned fibers.

  12. Ozone production by an atmospheric pulsed discharge with pre-ionization electrodes and partly covered electrode

    International Nuclear Information System (INIS)

    Kaneda, S.; Shimosaki, M.; Hayashi, N.; Ihara, S.; Satoh, S.; Yamabe, C.

    2002-01-01

    In this paper, results on ozone production by atmospheric pulsed discharge, are reported. In the research, two types of ozonizer (Type I and Type II) have been used to investigate improvements of ozone concentration and production efficiency. The ozonizer has plane-to-plane metal electrodes structure, and pre-ionization electrodes are placed on the high voltage electrodes (Type I). In Type II, the surface of grounded electrode with 20 mm of width is covered partly by dielectric (thin rubber) with 11 mm of width, while the geometry of both metal electrodes is same to Type I. In the case of Type I, maximum concentration of about 100 ppm and maximum yield of 70 g/kWh were obtained at input power of 0.3 W. On the other hands, in the case of Type II, 800 ppm and 100 g/kWh were obtained at input power of 1.5 W. It was found that the ozone concentration and production yield were improved by using electrode covered by dielectric. (author)

  13. Solid electrolyte gas sensors based on cyclic voltammetry with one active electrode

    Energy Technology Data Exchange (ETDEWEB)

    Jasinski, G; Jasinski, P, E-mail: gregor@biomed.eti.pg.gda.pl [Gdansk University of Technology, Faculty of Electronics, Telecommunication and Informatics, Narutowicza 11/12, 80-233 Gdansk (Poland)

    2011-10-29

    Solid state gas sensors are cost effective, small, rugged and reliable. Typically electrochemical solid state sensors operate in either potentiometric or amperometric mode. However, a lack of selectivity is sometimes a shortcoming of such sensors. It seems that improvements of selectivity can be obtained in case of the electrocatalytic sensors, which operate in cyclic voltammetry mode. Their working principle is based on acquisition of an electric current, while voltage ramp is applied to the sensor. The current-voltage response depends in a unique way on the type and concentration of ambient gas. Most electrocatalytic sensors have symmetrical structure. They are in a form of pellets with two electrodes placed on their opposite sides. Electrochemical reactions occur simultaneously on both electrodes. In this paper results for sensors with only one active electrode exposed to ambient gas are presented. The other electrode was isolated from ambient gas with dielectric sealing. This sensor construction allows application of advanced measuring procedures, which permit sensor regeneration acceleration. Experiments were conducted on Nasicon sensors. Properties of two sensors, one with one active electrode and second with symmetrical structure, used for the detection of mixtures of NO{sub 2} and synthetic air are compared.

  14. Fluoride Removal From Drinking Water by Electrocoagulation Using Iron and Aluminum Electrodes

    Directory of Open Access Journals (Sweden)

    Takdastan

    2014-07-01

    Full Text Available Background Existence of fluoride in drinking water above the permissible level causes human skeletal fluorosis. Objectives Electrocoagulation by iron and aluminum electrodes was proposed for removing fluoride from drinking water. Materials and Methods Effects of different operating conditions such as treatment time, initial pH, applied voltage, type and number of electrodes, the spaces between aluminum and iron electrodes, and energy consumption during electrocoagulation were investigated in the batch reactor. Variable concentrations of fluoride solution were prepared by mixing proper amounts of sodium fluoride with deionized water. Results Experimental results showed that aluminum electrode is more effective in fluoride removal than iron, as in 40 minutes and initial pH of 7.5 at 20 V, the fluoride removal process reached to 97.86%. The final recommendable limit of fluoride (1.5 mg/L was obtained in 10 minutes at 20 V with the aluminum electrode. Conclusions In electrocoagulation with iron and aluminum electrodes, increase of voltage, number of electrodes and reaction time as well as decrease of the spaces between electrodes, enhanced the fluoride removal efficiency from drinking water. In addition the effect of pH and initial concentration of fluoride varied with types of electrodes.

  15. Method and device for ion mobility separations

    Science.gov (United States)

    Ibrahim, Yehia M.; Garimella, Sandilya V. B.; Smith, Richard D.

    2017-07-11

    Methods and devices for ion separations or manipulations in gas phase are disclosed. The device includes a single non-planar surface. Arrays of electrodes are coupled to the surface. A combination of RF and DC voltages are applied to the arrays of electrodes to create confining and driving fields that move ions through the device. The DC voltages are static DC voltages or time-dependent DC potentials or waveforms.

  16. Perovskite electrodes and method of making the same

    Science.gov (United States)

    Seabaugh, Matthew M.; Swartz, Scott L.

    2005-09-20

    The invention relates to perovskite oxide electrode materials in which one or more of the elements Mg, Ni, Cu, and Zn are present as minority components that enhance electrochemical performance, as well as electrode products with these compositions and methods of making the electrode materials. Such electrodes are useful in electrochemical system applications such as solid oxide fuel cells, ceramic oxygen generation systems, gas sensors, ceramic membrane reactors, and ceramic electrochemical gas separation systems.

  17. Method and device for measuring the smoke concentration in air

    International Nuclear Information System (INIS)

    Rennemo, B.

    1994-01-01

    The patent deals with a method and a device for measuring the smoke concentration in air. In a smoke chamber are located two electrodes, connected to a voltage source for forming a circuit in which a DC current flows. A radioactive radiation source to ionize the air molecules is located in the vicinity of the smoke chamber, so that the number of ionized air molecules which are formed is dependent upon the radiation intensity of the ion source and the concentration of smoke particles in the smoke chamber. The charging voltage will further imply that a cloud of high ion concentration is built up close to the surface of the electrodes. The ion cloud will be discharged capacitively upon a plurality of short voltages pulses applied to the electrodes to thereby result in current pulses substantially greater than the DC current flowing through the chamber. 8 figs

  18. Insulation Coordination of Arcing Horns on HVDC Electrode Lines: Protection Performance Evaluation, Influence Factors and Improvement Method

    Directory of Open Access Journals (Sweden)

    Xiandong Li

    2018-02-01

    Full Text Available Arcing horns are widely used in high voltage overhead lines to protect insulator strings from being destroyed by the free burning arcs caused by lightening faults. In this paper, we focus on the insulation coordination of arcing horns on the electrode lines of a 5000 MW, ±800 kV high voltage direct current (HVDC system. The protection performance of arcing horns are determined by the characteristics of not only the external system but also the fault arc. Therefore, the behaviors and characteristics of long free burning arcs are investigated by the experiments at first. In order to evaluate the protection performance of arcing horns, the static stability criterion U-I characteristic method is introduced. The influence factors on the protection performance of arcing horns are analyzed theoretically. Finally, the improvement methods for the protection performance of arcing horns are proposed, and the diversified configuration strategy of arcing horns is recommended for cost saving.

  19. Comparative Evaluation of Pulsewidth Modulation Strategies for Z-Source Neutral-Point-Clamped Inverter

    DEFF Research Database (Denmark)

    Loh, P.C.; Blaabjerg, Frede; Wong, C.P.

    2007-01-01

    modulation (PWM) strategies for controlling the Z-source NPC inverter. While developing the PWM techniques, attention has been devoted to carefully derive them from a common generic basis for improved portability, easier implementation, and most importantly, assisting readers in understanding all concepts......Z-source neutral-point-clamped (NPC) inverter has recently been proposed as an alternative three-level buck-boost power conversion solution with an improved output waveform quality. In principle, the designed Z-source inverter functions by selectively "shooting through" its power sources, coupled...... to the inverter using two unique Z-source impedance networks, to boost the inverter three-level output waveform. Proper modulation of the new inverter would therefore require careful integration of the selective shoot-through process to the basic switching concepts to achieve maximal voltage-boost, minimal...

  20. Analysis of Voltage Forming Methods for Multiphase Inverters

    Directory of Open Access Journals (Sweden)

    Tadas Lipinskis

    2013-05-01

    Full Text Available The article discusses advantages of the multiphase AC induction motor over three or less phase motors. It presents possible stator winding configurations for a multiphase induction motor. Various fault control strategies were reviewed for phases feeding the motor. The authors propose a method for quality evaluation of voltage forming algorithm in the inverter. Simulation of a six-phase voltage source inverter, voltage in which is formed using a simple SPWM control algorithm, was performed in Matlab Simulink. Simulation results were evaluated using the proposed method. Inverter’s power stage was powered by 400 V DC source. The spectrum of output currents was analysed and the magnitude of the main frequency component was at least 12 times greater than the next biggest-magnitude component. The value of rectified inverter voltage was 373 V.Article in Lithuanian

  1. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  2. Negligible substrate clamping effect on piezoelectric response in (111)-epitaxial tetragonal Pb(Zr, Ti)O{sub 3} films

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Tomoaki, E-mail: t-yamada@nucl.nagoya-u.ac.jp [Department of Materials, Physics and Energy Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan); PRESTO, Japan Science and Technology Agency, 4-1-8 Honcho, Kawaguchi, Saitama 332-0012 (Japan); Yasumoto, Jun; Ito, Daisuke; Yoshino, Masahito; Nagasaki, Takanori [Department of Materials, Physics and Energy Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan); Sakata, Osami [Synchrotron X-ray Station at SPring-8 and Synchrotron X-ray Group, National Institute for Materials Science, Sayo-cho, Sayo-gun, Hyogo 679-5148 (Japan); Department of Innovative and Engineered Material, Tokyo Institute of Technology, Yokohama 226-8503 (Japan); Imai, Yasuhiko [Japan Synchrotron Radiation Research Institute, SPring-8, Sayo-cho, Sayo-gun, Hyogo 679-5198 (Japan); Kiguchi, Takanori [Institute for Materials Research, Tohoku University, Sendai, Miyagi 980-8577 (Japan); Shiraishi, Takahisa; Shimizu, Takao; Funakubo, Hiroshi [Department of Innovative and Engineered Material, Tokyo Institute of Technology, Yokohama 226-8503 (Japan)

    2015-08-21

    The converse piezoelectric responses of (111)- and (001)-epitaxial tetragonal Pb(Zr{sub 0.35}Ti{sub 0.65})O{sub 3} [PZT] films were compared to investigate the orientation dependence of the substrate clamping effect. Synchrotron X-ray diffraction (XRD) and piezoelectric force microscopy revealed that the as-grown (111)-PZT film has a polydomain structure with normal twin boundaries that are changed by the poling process to inclined boundaries, as predicted by Romanov et al. [Phys. Status Solidi A 172, 225 (1999)]. Time-resolved synchrotron XRD under bias voltage showed the negligible impact of substrate clamping on the piezoelectric response in the (111)-PZT film, unlike the case for (001)-PZT film. The origin of the negligible clamping effect in the (111)-PZT film is discussed from the viewpoint of the elastic properties and the compensation of lattice distortion between neighboring domains.

  3. Effect of voltage waveform on dielectric barrier discharge ozone production efficiency

    Science.gov (United States)

    Mericam-Bourdet, N.; Kirkpatrick, M. J.; Tuvache, F.; Frochot, D.; Odic, E.

    2012-03-01

    Dielectric barrier discharges (DBDs) are commonly used for gas effluent cleanup and ozone generation. For these applications, the energy efficiency of the discharge is a major concern. This paper reports on investigations carried out on the voltage shape applied to DBD reactor electrodes, aiming to evaluate a possible energy efficiency improvement for ozone production. Two DBD reactor geometries were used: pin-to-pin and cylinder-to-cylinder, both driven either by a bi-directional power supply (voltage rise rate 1 kV/μs) or by a pulsed power supply (voltage rise rate 1 kV/ns). Ozone formed in dry air was measured at the reactor outlet. Special attention was paid to discharge input power evaluation using different methods including instantaneous current-voltage product and transferred charge-applied voltage figures. The charge transferred by the discharges was also correlated to the ozone production. It is shown that, in the case of the DBD reactors under investigation, the applied voltage shape has no influence on the ozone production efficiency. For the considered voltage rise rate, the charge deposit on the dielectric inserted inside the discharge gap is the important factor (as opposed to the voltage shape) governing the efficiency of the discharge - it does this by tailoring the duration of the current peak into the tens of nanosecond range.

  4. Carbon electrode for desalination purpose in capacitive deionization

    International Nuclear Information System (INIS)

    Endarko,; Fadilah, Nurul; Anggoro, Diky

    2016-01-01

    Carbon electrodes for desalination purpose have been successfully synthesized using activated carbon powder (BET surface area=700 – 1400 m 2 /g), carbon black and polyvinyl alcohol (PVA) binder by cross-linking method with glutaric acid (GA) at 120 °C. The electrochemical properties of the carbon electrodes were analyzed using electrical impedance spectroscopy (EIS) and cyclic voltammetry (CV) whilst the physical properties were observed with scanning electron microscopy with energy dispersive X-ray spectroscopy (SEM/EDX). In order to assess the desalting performance, salt removal experiments were performed by constructing a capacitive deionization unit cell with five pairs of carbon electrodes. For each pair consisted of two parallel carbon electrodes separated by a spacer. Desalination and regeneration processes were also observed in the salt-removal experiments. The salt-removal experiments were carried out in single-pass mode using a solution with 0.1 M NaCl at a flow rate of 10 mL/min. A voltage of 3 V was applied to the cell for 60 minutes for both processes in desalination and regeneration. The result showed that the percentage value of the salt-removal was achieved at 20%.

  5. Carbon electrode for desalination purpose in capacitive deionization

    Energy Technology Data Exchange (ETDEWEB)

    Endarko,, E-mail: endarko@physics.its.ac.id; Fadilah, Nurul; Anggoro, Diky [Physics Department, Institut Teknologi Sepuluh Nopember (ITS) Kampus ITS, Sukolilo Surabaya 60111, Jawa Timur (Indonesia)

    2016-03-11

    Carbon electrodes for desalination purpose have been successfully synthesized using activated carbon powder (BET surface area=700 – 1400 m{sup 2}/g), carbon black and polyvinyl alcohol (PVA) binder by cross-linking method with glutaric acid (GA) at 120 °C. The electrochemical properties of the carbon electrodes were analyzed using electrical impedance spectroscopy (EIS) and cyclic voltammetry (CV) whilst the physical properties were observed with scanning electron microscopy with energy dispersive X-ray spectroscopy (SEM/EDX). In order to assess the desalting performance, salt removal experiments were performed by constructing a capacitive deionization unit cell with five pairs of carbon electrodes. For each pair consisted of two parallel carbon electrodes separated by a spacer. Desalination and regeneration processes were also observed in the salt-removal experiments. The salt-removal experiments were carried out in single-pass mode using a solution with 0.1 M NaCl at a flow rate of 10 mL/min. A voltage of 3 V was applied to the cell for 60 minutes for both processes in desalination and regeneration. The result showed that the percentage value of the salt-removal was achieved at 20%.

  6. Technological Aspects: High Voltage

    CERN Document Server

    Faircloth, D.C.

    2013-12-16

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.

  7. Variable wide range of lens power and its improvement in a liquid-crystal lens using highly resistive films divided into two regions with different diameters

    Science.gov (United States)

    Kawamura, Marenori; Sato, Susumu

    2018-05-01

    The variable range of lens power of a liquid-crystal (LC) lens driven by two voltages is discussed on the basis of calculated and experimental results. The LC lens has two electrodes, which are a circularly hole-patterned electrode and a circular electrode, in addition to a common electrode, and highly resistive transparent films. The variable range of lens power increases with increasing driving voltage applied across the circularly hole-patterned electrode and the common electrode, and with decreasing diameter of highly resistive films. However, the optical-phase retardation profile tends to deviate from a parabolic curve in these cases. As a method to improve the trade-off properties, the highly resistive film is divided into two regions with different diameters, where the sheet resistance of an outer film is larger than that of an inner one. The improved LC lens has a lens power that varies in a wide range, and it exhibits a good parabolic phase retardation profile.

  8. Patch Clamp: A Powerful Technique for Studying the Mechanism of Acupuncture

    Directory of Open Access Journals (Sweden)

    D. Zhang

    2012-01-01

    Full Text Available Cellular and molecular events can be investigated using electrophysiological techniques. In particular, the patch-clamp method provides detailed information. In addition, the patch-clamp technique has become a powerful method for investigating the mechanisms underlying the effects of acupuncture. In this paper, recent researches on how acupuncture might modulate electrophysiological responses in the central nervous system (CNS and affect peripheral structures are reviewed.

  9. Voltage Balancing Method on Expert System for 51-Level MMC in High Voltage Direct Current Transmission

    Directory of Open Access Journals (Sweden)

    Yong Chen

    2016-01-01

    Full Text Available The Modular Multilevel Converters (MMC have been a spotlight for the high voltage and high power transmission systems. In the VSC-HVDC (High Voltage Direct Current based on Voltage Source Converter transmission system, the energy of DC link is stored in the distributed capacitors, and the difference of capacitors in parameters and charge rates causes capacitor voltage balance which affects the safety and stability of HVDC system. A method of MMC based on the expert system for reducing the frequency of the submodules (SMs of the IGBT switching frequency is proposed. Firstly, MMC with 51 levels for HVDC is designed. Secondly, the nearest level control (NLC for 51-level MMC is introduced. Thirdly, a modified capacitor voltage balancing method based on expert system for MMC-based HVDC transmission system is proposed. Finally, a simulation platform for 51-level Modular Multilevel Converter is constructed by using MATLAB/SIMULINK. The results indicate that the strategy proposed reduces the switching frequency on the premise of keeping submodule voltage basically identical, which greatly reduces the power losses for MMC-HVDC system.

  10. Modulation of voltage-gated Na+ and K+ channels by pumiliotoxin 251D: a "joint venture" alkaloid from arthropods and amphibians.

    Science.gov (United States)

    Vandendriessche, Thomas; Abdel-Mottaleb, Yousra; Maertens, Chantal; Cuypers, Eva; Sudau, Alexander; Nubbemeyer, Udo; Mebs, Dietrich; Tytgat, Jan

    2008-03-01

    Certain amphibians provide themselves with a chemical defense by accumulating lipophilic alkaloids into skin glands from dietary arthropods. Examples of such alkaloids are pumiliotoxins (PTXs). In general, PTXs are known as positive modulators of voltage-gated sodium channels (VGSCs). Unlike other PTXs, PTX 251D does not share this characteristic. However, mice and insect studies showed that PTX 251D is highly toxic and to date the basis of its toxicity remains unknown. In this work, we searched for the possible target of PTX 251D. The toxin was therefore made synthetically and tested on four VGSCs (mammalian rNa(v)1.2/beta(1), rNa(v)1.4/beta(1), hNa(v)1.5/beta(1) and insect Para/tipE) and five voltage-gated potassium channels (VGPCs) (mammalian rK(v)1.1-1.2, hK(v)1.3, hK(v)11.1 (hERG) and insect Shaker IR) expressed heterologously in Xenopus laevis oocytes, using the two-electrode voltage clamp technique. PTX 251D not only inhibited the Na(+) influx through the mammalian VGSCs but also affected the steady-state activation and inactivation. Interestingly, in the insect ortholog, the inactivation process was dramatically affected. Additionally, PTX 251D inhibited the K(+) efflux through all five tested VGPCs and slowed down the deactivation kinetics of the mammalian VGPCs. hK(v)1.3 was the most sensitive channel, with an IC(50) value 10.8+/-0.5 microM. To the best of our knowledge this is the first report of a PTX affecting VGPCs.

  11. Ion channel electrophysiology via integrated planar patch-clamp chip with on-demand drug exchange.

    Science.gov (United States)

    Chen, Chang-Yu; Tu, Ting-Yuan; Jong, De-Shien; Wo, Andrew M

    2011-06-01

    Planar patch clamp has revolutionized characterization of ion channel behavior in drug discovery primarily via advancement in high throughput. Lab use of planar technology, however, addresses different requirements and suffers from inflexibility to enable wide range of interrogation via a single cell. This work presents integration of planar patch clamp with microfluidics, achieving multiple solution exchanges for tailor-specific measurement and allowing rapid replacement of the cell-contacting aperture. Studies via endogenously expressed ion channels in HEK 293T cells were commenced to characterize the device. Results reveal the microfluidic concentration generator produces distinct solution/drug combination/concentrations on-demand. Volume-regulated chloride channel and voltage-gated potassium channels in HEK 293T cells immersed in generated solutions under various osmolarities or drug concentrations show unique channel signature under specific condition. Excitation and blockage of ion channels in a single cell was demonstrated via serial solution exchange. Robustness of the reversible bonding and ease of glass substrate replacement were proven via repeated usage of the integrated device. The present approach reveals the capability and flexibility of integrated microfluidic planar patch-clamp system for ion channel assays. Copyright © 2011 Wiley Periodicals, Inc.

  12. The dynamic current-voltage characteristic as a powerful tool to analyze fast phenomena in plasma

    International Nuclear Information System (INIS)

    Ivan, L. M.; Mihai-Plugaru, M.; Amarandei, G.; Aflori, M.; Dimitriu, D. G.

    2006-01-01

    The static current-voltage characteristic of an electrode immersed in plasma is obtained by slowly increasing and subsequently decreasing the potential on the electrode with respect to the plasma potential or the ground. This characteristic can give us important information about the phenomena that take place in front of the electrode. Current jumps can be evidenced which were often associated with an hysteresis effect, regions with S-type or N-type negative differential resistance, etc. The method is always used when we investigate the appearance of complex space charge configurations (CSCC) in front of an electrode immersed in plasma. However, to investigate the dynamics of such structures or other fast phenomena (like instabilities) which take place in plasma devices with frequencies of tenth, hundred kHz or more, complex investigation techniques must be used. One of the most efficient methods to investigate fast phenomena in plasma devices is the dynamic current-voltage characteristic. This is obtained by recording the time series of the current collected by the electrode when the voltage applied on it is very fast modified (most likely increased) by using a signal generator. In this way, very fast oscillations of the current can be recorded and new phenomena can be evidenced. We used this technique to study the phenomena which take place at the onset of electrostatic instabilities in Q-machine plasma, namely the potential relaxation instability (PRI) and the electrostatic ion-cyclotron instability (EICI). The obtained experimental results prove that the negative differential resistance region in the static current-voltage characteristic is the result of a nonlinear dynamics of a CSCC in form of a double layer (DL) which takes place just before the onset of the instabilities. In the case of the PRI we emphasized current jumps related with the DL appearance, which are not present in the static current-voltage characteristic at high plasma density. (authors)

  13. The high voltage system for the novel MPGD-based photon detectors of COMPASS RICH-1

    CERN Document Server

    Dalla Torre, S.; Birsa, R.; Bradamante, F.; Bressan, A.; Chatterjee, C.; Ciliberti, P.; Dasgupta, S.; Gobbo, B.; Gregori, M.; Hamar, G.; Levorato, S.; Martin, A.; Menon, G.; Tessarotto, F.; Zhao, Y.

    2018-01-01

    The architecture of the novel MPGD-based photon detectors of COMPASS RICH-1 consists in a large-size hybrid MPGD multilayer layout combining two layers of Thick-GEMs and a bulk resistive MICROMEGAS. Concerning biasing voltage, the Thick-GEMs are segmented in order to reduce the energy released in case of occasional discharges, while the MICROMEGAS anode is segmented in pads individually biased at positive voltage, while the micromesh is grounded. In total, there are ten different electrode types and more than 20000 electrodes supplied by more than 100 HV channels. Commercial power supply units are used. The original elements of the power supply system are the architecture of the voltage distribution net, the compensation, by voltage adjustment, of the effects of pressure and temperature variation affecting the detector gain and a sophisticated control software, which allows to protect the detectors against errors by the operator, to monitor and log voltages and current at 1 Hz rate and to automatically react ...

  14. Is "Delayed Umbilical Cord Clamping" Beneficial for Premature Newborns?

    Directory of Open Access Journals (Sweden)

    Amir-Mohammad Armanian

    2017-05-01

    Full Text Available Background: The appropriate moment for clamping the umbilical cord is controversial. Immediate cord clamping (ICC is an item of active management of the third stage of labor (AMTSL. Unclamped umbilical cord may cause inconvenience in preterm neonates because they commonly need some levels of emergent services. Some studies revealed delayed cord clamping (DCC of preterm neonates results in better health conditions like lower rates of respiratory distress syndrome (RDS, less morbidities in labor room and lower risk of postpartum hemorrhage. The aim of the present study was to determine the effect of delayed umbilical cord clamping on premature neonatal outcomes. Materials and Methods: In this single‑center randomized control trial study, sixty premature neonates (gestational age ≤ 34 weeks were randomly assigned to ICC (cord clamped at 5–10 seconds or DCC (30–45 seconds groups and followed up in neonatal intensive care unit (NICU. Primary outcomes were 1st and 5th minute Apgar score, average of level of hematocrit after birth, intra ventricle hemorrhage and need some levels of resuscitation. Results: Differences in demographic characteristics were not statistically significant. After birth, neonates who had delayed clamping had significantly higher mean hematocrit after at 4-hour of birth (49.58+5.15gr/dl vs. 46.58+5.40gr/dlin DCC vs. ICC groups, respectively (P=0.031. Delayed cord clamping reduced the duration of need to nasal continues positive airway pressure (NCPAP (86.7% and 60.0% in ICC and DCC groups, respectively, P= 0.039. Attractively, the results showed lower incidence of clinical sepsis in delayed cord clamping neonates (53.3% vs. 23.3% in ICC and DCC groups, respectively, P=0.033. Conclusion: Prematurity complications might decrease by delay umbilical cord clamping which improve the hematocrit, duration of need to NCPAP and incidence of clinical sepsis. Furthermore, DCC may have no negative impact on neonatal resuscitation.

  15. Prediction of clamp-derived insulin sensitivity from the oral glucose insulin sensitivity index

    DEFF Research Database (Denmark)

    Tura, Andrea; Chemello, Gaetano; Szendroedi, Julia

    2018-01-01

    that underwent both a clamp and an OGTT or meal test, thereby allowing calculation of both the M value and OGIS. The population was divided into a training and a validation cohort (n = 359 and n = 154, respectively). After a stepwise selection approach, the best model for M value prediction was applied......AIMS/HYPOTHESIS: The euglycaemic-hyperinsulinaemic clamp is the gold-standard method for measuring insulin sensitivity, but is less suitable for large clinical trials. Thus, several indices have been developed for evaluating insulin sensitivity from the oral glucose tolerance test (OGTT). However......, most of them yield values different from those obtained by the clamp method. The aim of this study was to develop a new index to predict clamp-derived insulin sensitivity (M value) from the OGTT-derived oral glucose insulin sensitivity index (OGIS). METHODS: We analysed datasets of people...

  16. Introduction to solid supported membrane based electrophysiology.

    Science.gov (United States)

    Bazzone, Andre; Costa, Wagner Steuer; Braner, Markus; Călinescu, Octavian; Hatahet, Lina; Fendler, Klaus

    2013-05-11

    The electrophysiological method we present is based on a solid supported membrane (SSM) composed of an octadecanethiol layer chemisorbed on a gold coated sensor chip and a phosphatidylcholine monolayer on top. This assembly is mounted into a cuvette system containing the reference electrode, a chlorinated silver wire. After adsorption of membrane fragments or proteoliposomes containing the membrane protein of interest, a fast solution exchange is used to induce the transport activity of the membrane protein. In the single solution exchange protocol two solutions, one non-activating and one activating solution, are needed. The flow is controlled by pressurized air and a valve and tubing system within a faraday cage. The kinetics of the electrogenic transport activity is obtained via capacitive coupling between the SSM and the proteoliposomes or membrane fragments. The method, therefore, yields only transient currents. The peak current represents the stationary transport activity. The time dependent transporter currents can be reconstructed by circuit analysis. This method is especially suited for prokaryotic transporters or eukaryotic transporters from intracellular membranes, which cannot be investigated by patch clamp or voltage clamp methods.

  17. Analysis and Experiments on Sea Load and Fastened Mechanics on Pipe Clamps

    Directory of Open Access Journals (Sweden)

    Wang Zhuo

    2017-08-01

    Full Text Available When an offshore oil field completed and put into production, new subsea pipelines and the new cable need to be established. Cable protection pipe clamp is used to fix cable protection pipe on the jacket. In order to avoid the problem of traditional steel structure clamp splice, counterpoint, fastening difficulty when installed cable protection pipe under water, reduce the risk and workload of under water, This paper develop a new type of portable connecting riser clamp -“backpack clamp” which solve the riser cable protection pipe difficult underwater installation problem. The main structure of backpack clamp used three valves type structure. The load characteristic of a clamping device was determined by the Morison equation which was a classical theory. Clamp device underwater mechanics analysis model was established. The minimum tension pre-tightening force was determined. The results show that the strength of the base meets the requirements after strength analysis with finite element analysis method, stability and strength experiments, which means the clamp based on resin matrix composite is feasible.

  18. Photosensitive-polyimide based method for fabricating various neural electrode architectures

    Directory of Open Access Journals (Sweden)

    Yasuhiro X Kato

    2012-06-01

    Full Text Available An extensive photosensitive polyimide (PSPI-based method for designing and fabricating various neural electrode architectures was developed. The method aims to broaden the design flexibility and expand the fabrication capability for neural electrodes to improve the quality of recorded signals and integrate other functions. After characterizing PSPI’s properties for micromachining processes, we successfully designed and fabricated various neural electrodes even on a non-flat substrate using only one PSPI as an insulation material and without the time-consuming dry etching processes. The fabricated neural electrodes were an electrocorticogram electrode, a mesh intracortical electrode with a unique lattice-like mesh structure to fixate neural tissue, and a guide cannula electrode with recording microelectrodes placed on the curved surface of a guide cannula as a microdialysis probe. In vivo neural recordings using anesthetized rats demonstrated that these electrodes can be used to record neural activities repeatedly without any breakage and mechanical failures, which potentially promises stable recordings for long periods of time. These successes make us believe that this PSPI-based fabrication is a powerful method, permitting flexible design and easy optimization of electrode architectures for a variety of electrophysiological experimental research with improved neural recording performance.

  19. On the Effect of Clamping Pressure and Method on the Current Mapping of Proton Exchange Membrane Water Electrolysis

    DEFF Research Database (Denmark)

    Al Shakhshir, Saher; Zhou, Fan; Kær, Søren Knudsen

    The degradation of the electrochemical reaction of the proton exchange membrane water electrolysis (PEMWE) can be characterized using in-situ current mapping measurements (CMM). CMM is significantly affected by the amount of clamping pressure and method. In this work the current is mapped...

  20. An ionization chamber with magnetic levitated electrodes

    CERN Document Server

    Kawaguchi, T

    1999-01-01

    A new type of ionization chamber which has magnetically levitated electrodes has been developed. The electrodes are supplied voltages for the repelling of ions by a battery which is also levitated with the electrodes. The characteristics of this ionization chamber are investigated in this paper.

  1. Method of making electrodes for electrochemical cell. [Li-Al alloy

    Science.gov (United States)

    Kaun, T.D.; Kilsdonk, D.J.

    1981-07-29

    A method is described for making an electrode for an electrochemical cell in which particulate electrode-active material is mixed with a liquid organic carrier chemically inert with respect to the electrode-active material, mixing the liquid carrier to form an extrudable slurry. The liquid carrier is present in an amount of from about 10 to about 50% by volume of the slurry, and then the carrier is removed from the slurry leaving the electrode-active material. The method is particularly suited for making a lithium-aluminum alloy negative electrode for a high-temperature cell.

  2. Graphene device and method of using graphene device

    Science.gov (United States)

    Bouchiat, Vincent; Girit, Caglar; Kessler, Brian; Zettl, Alexander K.

    2015-08-11

    An embodiment of a graphene device includes a layered structure, first and second electrodes, and a dopant island. The layered structure includes a conductive layer, an insulating layer, and a graphene layer. The electrodes are coupled to the graphene layer. The dopant island is coupled to an exposed surface of the graphene layer between the electrodes. An embodiment of a method of using a graphene device includes providing the graphene device. A voltage is applied to the conductive layer of the graphene device. Another embodiment of a method of using a graphene device includes providing the graphene device without the dopant island. A dopant island is placed on an exposed surface of the graphene layer between the electrodes. A voltage is applied to the conductive layer of the graphene device. A response of the dopant island to the voltage is observed.

  3. Structural consideration for hot and cold pipe clamps in LMFBR applications

    International Nuclear Information System (INIS)

    Anderson, M.J.; Huang, S.N.; Kappauf, H.; Wagner, S.E.; Wirtz, K.H.

    1983-01-01

    A series of analytical studies are described which evaluate stress levels induced in a 600 mm high temperature, thin-wall sodium pipeline by two alternate clamp designs. The first design consists of a band mounted directly on the pipe and is called the hot clamp. The second design consists of a band mounted using insulation standoffs and is called the cold clamp. Pipe stress levels induced by transient thermal dead weight and seismic loads are discussed. Pipe stress levels and system dynamic spring rates are presented. Procedures utilized to combine clamp induced pipe stress with other short and long term pipe system stresses are detailed. Recommendations for practical application in LMFBR pipe systems are made

  4. Structural considerations for hot and cold pipe clamps in LMFBR applications

    International Nuclear Information System (INIS)

    Anderson, M.J.; Huang, S.N.; Wagner, S.E.; Kappauf, H.; Wirtz, K.H.

    1983-01-01

    A series of analytical studies are described which evaluate stress levels induced in a 600 mm high temperature, thin-wall sodium pipeline by two alternate clamp designs. The first design consists of a band mounted directly on the pipe and is called the hot clamp. The second design consists of a band mounted using insulation standoffs and is called the cold clamp. Pipe stress levels induced by transient thermal dead weight and seismic loads are discussed. Pipe stress levels and system dynamic spring rates are presented. Procedures utilized to combine clamp induced pipe stress with other short and long term pipe system stresses are detailed. Recommendations for practical application in LMFBR pipe systems are made

  5. The two-pore domain potassium channel, TWIK-1, has a role in the regulation of heart rate and atrial size

    DEFF Research Database (Denmark)

    Christensen, Alex Hørby; Chatelain, Franck C; Huttner, Inken G

    2016-01-01

    distribution with predominant localization in the endosomal compartment. Two-electrode voltage-clamp experiments using Xenopus oocytes showed that both zebrafish and wild-type human TWIK-1 channels produced K(+) currents that are sensitive to external K(+) concentration as well as acidic pH. There were......The two-pore domain potassium (K(+)) channel TWIK-1 (or K2P1.1) contributes to background K(+) conductance in diverse cell types. TWIK-1, encoded by the KCNK1 gene, is present in the human heart with robust expression in the atria, however its physiological significance is unknown. To evaluate......-coding regions in two independent cohorts of patients (373 subjects) and identified three non-synonymous variants, p.R171H, p.I198M and p.G236S, that were all located in highly conserved amino acid residues. In transfected mammalian cells, zebrafish and wild-type human TWIK-1 channels had a similar cellular...

  6. Numerical analysis of the heat source characteristics of a two-electrode TIG arc

    International Nuclear Information System (INIS)

    Ogino, Y; Hirata, Y; Nomura, K

    2011-01-01

    Various kinds of multi-electrode welding processes are used to ensure high productivity in industrial fields such as shipbuilding, automotive manufacturing and pipe fabrication. However, it is difficult to obtain the optimum welding conditions for a specific product, because there are many operating parameters, and because welding phenomena are very complicated. In the present research, the heat source characteristics of a two-electrode TIG arc were numerically investigated using a 3D arc plasma model with a focus on the distance between the two electrodes. The arc plasma shape changed significantly, depending on the electrode spacing. The heat source characteristics, such as the heat input density and the arc pressure distribution, changed significantly when the electrode separation was varied. The maximum arc pressure of the two-electrode TIG arc was much lower than that of a single-electrode TIG. However, the total heat input of the two-electrode TIG arc was nearly constant and was independent of the electrode spacing. These heat source characteristics of the two-electrode TIG arc are useful for controlling the heat input distribution at a low arc pressure. Therefore, these results indicate the possibility of a heat source based on a two-electrode TIG arc that is capable of high heat input at low pressures.

  7. Trans-Z-source Neutral Point Clamped inverter

    DEFF Research Database (Denmark)

    Mo, W.; Loh, P. C.; Li, D.

    2012-01-01

    Transformer based Z-source (trans-Z-source) inverters are recently proposed by extending the traditional Z-source inverter with higher buck-boost capability as well as reducing the passive components at the same time. Multi-Level Z-source inverters are single-stage topological solutions used...... for buck-boost energy conversion with all the favourable advantages of multi-level switching retained. This paper presents three-level trans-Z-source Neutral Point Clamped (NPC) inverter topology, which achieves both the advantages of trans-Z-source and three-level NPC inverter configuration. With proper...... modulation scheme, the three-level trans-Z-source inverter can function with minimum of six device commutations per half carrier cycle (same as the traditional buck NPC inverter), while maintaining to produce the designed volt-sec average and inductive voltage boosting at ac output terminals. The designed...

  8. Technological Aspects: High Voltage

    International Nuclear Information System (INIS)

    Faircloth, D C

    2013-01-01

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)

  9. Effect of Anode Floating Voltage and its Applications in Characterizing Silicon Drift Detectors

    International Nuclear Information System (INIS)

    Guang-Guo, Wu; Hong-Ri, Li; Kun, Liang; Ru, Yang; De-Jun, Han; Xue-Lei, Cao; Huan-Yu, Wang; Jun-Ming, An; Xiong-Wei, Hu

    2009-01-01

    Anode Boating voltage is predicted and investigated for silicon drift detectors (SDDs) with an active area of 5 mm 2 fabricated by a double-side parallel technology. It is demonstrated that the anode Boating voltage increases with the increasing inner ring voltage, and is almost unchanged with the external ring voltage. The anode Boating voltage will not be affected by the back electrode biased voltage until it reaches the full-depleted voltage (−50 V) of the SDD. Theoretical analysis and experimental results show that the anode Boating voltage is equal to the sum of the inner ring voltage and the built-in potential between the p + inner ring and the n + anode. A fast checking method before detector encapsulation is proposed by employing the anode Boating voltage along with checking the leakage current, potential distribution and drift properties

  10. Design of a microscopic electrical impedance tomography system using two current injections

    International Nuclear Information System (INIS)

    Liu, Qin; Oh, Tong In; Wi, Hun; Woo, Eung Je; Lee, Eun Jung; Seo, Jin Keun

    2011-01-01

    We describe a novel design of a microscopic electrical impedance tomography (micro-EIT) system for long-term noninvasive monitoring of cell or tissue cultures. The core of the micro-EIT system is a sample container including two pairs of current-injection electrodes and 360 voltage-sensing electrodes. In designing the container, we took advantage of a hexagonal structure with fixed dimensions and electrode configuration. This eliminated technical difficulties related to the unknown irregular boundary geometry of an imaging object in conventional medical EIT. Attaching a pair of large current-injection electrodes fully covering the left and right sides of the hexagonal container, we generated uniform parallel current density inside the container filled with saline. The 360 voltage-sensing electrodes were placed on the front, bottom and back sides of the hexagonal container in three sets of 8 × 15 arrays with equal gaps between them. We measured voltage differences between all neighboring pairs along the direction of the parallel current pathway. For the homogeneous container, all measured voltages must be the same since the voltage changes linearly along that direction. Any anomaly in the container perturbed the current pathways and therefore equipotential lines to produce different differential voltage data. For conductivity image reconstructions, we adopted a lately developed image reconstruction algorithm for this electrode configuration to first produce projected conductivity images on the front, bottom and back sides. Using a backprojection method, we reconstructed three-dimensional conductivity images from those projection images. To improve the image quality and also to meet the mathematical requirement on the uniqueness of a reconstructed image, we used a second pair of thin and long current-injection electrodes located at the middle of the front and back sides. This paper describes the design and construction of such a micro-EIT system with experimental

  11. High voltage bus and auxiliary heater control system for an electric or hybrid vehicle

    Science.gov (United States)

    Murty, Balarama Vempaty

    2000-01-01

    A control system for an electric or hybrid electric vehicle includes a vehicle system controller and a control circuit having an electric immersion heater. The heater is electrically connected to the vehicle's high voltage bus and is thermally coupled to a coolant loop containing a heater core for the vehicle's climate control system. The system controller responds to cabin heat requests from the climate control system by generating a pulse width modulated signal that is used by the control circuit to operate the heater at a duty cycle appropriate for the amount of cabin heating requested. The control system also uses the heater to dissipate excess energy produced by an auxiliary power unit and to provide electric braking when regenerative braking is not desirable and manual braking is not necessary. The control system further utilizes the heater to provide a safe discharge of a bank of energy storage capacitors following disconnection of the battery or one of the high voltage connectors used to transmit high voltage operating power to the various vehicle systems. The control circuit includes a high voltage clamping circuit that monitors the voltage on the bus and operates the heater to clamp down the bus voltage when it exceeds a pre-selected maximum voltage. The control system can also be used to phase in operation of the heater when the bus voltage exceeds a lower threshold voltage and can be used to phase out the auxiliary power unit charging and regenerative braking when the battery becomes fully charged.

  12. Long Life Nickel Electrodes for Nickel-Hydrogen Cells: Fiber Substrates Nickel Electrodes

    Science.gov (United States)

    Rogers, Howard H.

    2000-01-01

    Samples of nickel fiber mat electrodes were investigated over a wide range of fiber diameters, electrode thickness, porosity and active material loading levels. Thickness' were 0.040, 0.060 and 0.080 inches for the plaque: fiber diameters were primarily 2, 4, and 8 micron and porosity was 85, 90, and 95%. Capacities of 3.5 in. diameter electrodes were determined in the flooded condition with both 26 and 31% potassium hydroxide solution. These capacity tests indicated that the highest capacities per unit weight were obtained at the 90% porosity level with a 4 micron diameter fiber plaque. It appeared that the thinner electrodes had somewhat better performance, consistent with sintered electrode history. Limited testing with two-positive-electrode boiler plate cells was also carried out. Considerable difficulty with constructing the cells was encountered with short circuits the major problem. Nevertheless, four cells were tested. The cell with 95% porosity electrodes failed during conditioning cycling due to high voltage during charge. Discharge showed that this cell had lost nearly all of its capacity. The other three cells after 20 conditioning cycles showed capacities consistent with the flooded capacities of the electrodes. Positive electrodes made from fiber substrates may well show a weight advantage of standard sintered electrodes, but need considerably more work to prove this statement. A major problem to be investigated is the lower strength of the substrate compared to standard sintered electrodes. Problems with welding of leads were significant and implications that the electrodes would expand more than sintered electrodes need to be investigated. Loading levels were lower than had been expected based on sintered electrode experiences and the lower loading led to lower capacity values. However, lower loading causes less expansion and contraction during cycling so that stress on the substrate is reduced.

  13. A New High Frequency Injection Method Based on Duty Cycle Shifting without Maximum Voltage Magnitude Loss

    DEFF Research Database (Denmark)

    Wang, Dong; Lu, Kaiyuan; Rasmussen, Peter Omand

    2015-01-01

    The conventional high frequency signal injection method is to superimpose a high frequency voltage signal to the commanded stator voltage before space vector modulation. Therefore, the magnitude of the voltage used for machine torque production is limited. In this paper, a new high frequency...... amplitude. This may be utilized to develop new position estimation algorithm without involving the inductance in the medium to high speed range. As an application example, a developed inductance independent position estimation algorithm using the proposed high frequency injection method is applied to drive...... injection method, in which high frequency signal is generated by shifting the duty cycle between two neighboring switching periods, is proposed. This method allows injecting a high frequency signal at half of the switching frequency without the necessity to sacrifice the machine fundamental voltage...

  14. Heat dissipation computations of a HVDC ground electrode using a supercomputer

    International Nuclear Information System (INIS)

    Greiss, H.; Mukhedkar, D.; Lagace, P.J.

    1990-01-01

    This paper reports on the temperature, of soil surrounding a High Voltage Direct Current (HVDC) toroidal ground electrode of practical dimensions, in both homogeneous and non-homogeneous soils that was computed at incremental points in time using finite difference methods on a supercomputer. Curves of the response were computed and plotted at several locations within the soil in the vicinity of the ground electrode for various values of the soil parameters

  15. Clamp wins pipe repair prize

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    2001-04-01

    This paper describes the permanent pipeline repair system, developed by Tekmar, which is powered by seawater hydraulics and is easily installed and tested by any workclass remotely operated vehicle (rov). Details are given of the two main components of the system, namely, the diverless high pressure split repair clamp and the rov-operated tool to install it.

  16. Calendering effect on the electrochemical performances of the thick Li-ion battery electrodes using a three dimensional Ni alloy foam current collector

    International Nuclear Information System (INIS)

    Yang, Gui-Fu; Joo, Seung-Ki

    2015-01-01

    High surface area and a three dimensional NiCrAl alloy foam current collector was used for two kinds of thick lithium iron phosphate electrodes. One kind of electrodes were compressed after the slurry of active material in the metal foam was dried and then annealed at 140 °C for half a day whereas the other kind of electrodes were prepared without pressing. When the addition of carbon black was 4 wt% for the two kinds of electrodes, a charge-discharge test revealed that the capacity of the cell using the pressed electrode faded much more although the voltage-drop was much smaller at the plateau region. For example, the capacity of the pressed electrode exhibited 85 mA h g −1 , while it was 135 mA h g −1 for the unpressed electrode although the voltage-drop at the plateau region was 250 mV higher at 0.5C-rate for the unpressed electrode. The AC impedance analysis showed that the charge transfer resistance of the pressed electrode was only 15 Ω whereas it was 4 times higher for the unpressed electrode. The results illustrated that the effective redox area was much larger for the unpressed electrode since the cell using the unpressed electrode exhibited much higher capacity even at the condition of poor electronic conductivity. To solve the low electronic conductivity issue for the unpressed electrode, the addition of carbon black was further increased to 14 wt% and as a result, there was almost no difference in voltage drop at plateau region or charge transfer resistance between the two kinds of electrodes. Obviously, the capacity of unpressed electrode exhibited much higher at higher current rate due to the larger effective redox area

  17. Generation of localized strain in a thin film piezoelectric to control individual magnetoelectric heterostructures

    Energy Technology Data Exchange (ETDEWEB)

    Cui, Jizhai; Liang, Cheng-Yen; Sepulveda, Abdon; Carman, Gregory P.; Lynch, Christopher S., E-mail: cslynch@seas.ucla.edu [Department of Mechanical and Aerospace Engineering, University of California, Los Angeles, California 90095 (United States); Paisley, Elizabeth A.; Ihlefeld, Jon F. [Electronic, Optical, and Nano Materials Department, Sandia National Laboratories, Albuquerque, New Mexico 87185 (United States)

    2015-08-31

    Experimental results demonstrate the ability of a surface electrode pattern to produce sufficient in-plane strain in a PbZr{sub 0.52}Ti{sub 0.48}O{sub 3} (PZT) thin film clamped by a Si substrate to control magnetism in a 1000 nm diameter Ni ring. The electrode pattern and the Ni ring/PZT thin film heterostructure were designed using a finite element based micromagnetics code. The magnetoelectric heterostructures were fabricated on the PZT film using e-beam lithography and characterized using magnetic force microscopy. Application of voltage to the electrodes moved one of the “onion” state domain walls. This method enables the development of complex architectures incorporating strain-mediated multiferroic devices.

  18. System and method for liquid extraction electrospray-assisted sample transfer to solution for chemical analysis

    Science.gov (United States)

    Kertesz, Vilmos; Van Berkel, Gary J.

    2016-07-12

    A system for sampling a surface includes a surface sampling probe comprising a solvent liquid supply conduit and a distal end, and a sample collector for suspending a sample collection liquid adjacent to the distal end of the probe. A first electrode provides a first voltage to solvent liquid at the distal end of the probe. The first voltage produces a field sufficient to generate electrospray plume at the distal end of the probe. A second electrode provides a second voltage and is positioned to produce a plume-directing field sufficient to direct the electrospray droplets and ions to the suspended sample collection liquid. The second voltage is less than the first voltage in absolute value. A voltage supply system supplies the voltages to the first electrode and the second electrode. The first electrode can apply the first voltage directly to the solvent liquid. A method for sampling for a surface is also disclosed.

  19. High Bandwidth Zero Voltage Injection Method for Sensorless Control of PMSM

    DEFF Research Database (Denmark)

    Ge, Xie; Lu, Kaiyuan; Kumar, Dwivedi Sanjeet

    2014-01-01

    High frequency signal injection is widely used in PMSM sensorless control system for low speed operations. The conventional voltage injection method often needs filters to obtain particular harmonic component in order to estimate the rotor position; or it requires several voltage pulses to be inj......High frequency signal injection is widely used in PMSM sensorless control system for low speed operations. The conventional voltage injection method often needs filters to obtain particular harmonic component in order to estimate the rotor position; or it requires several voltage pulses...... in a fast current regulation performance. Injection of zero voltage also minimizes the inverter voltage error effects caused by the dead-time....

  20. Fabrication of nano-electrode arrays of free-standing carbon nanotubes on nano-patterned substrate by imprint method

    Energy Technology Data Exchange (ETDEWEB)

    Chang, W.S., E-mail: paul@kimm.re.kr [Department of Nano Mechanics, Korea Institute of Machinery and Materials, 104 Sinseongno, Yuseong-gu Daejeon 305-343 (Korea, Republic of); Kim, J.W. [Gyeongbuk Hybrid Technology Institute, 36 Goeyeon-dong, Yeongcheon, Gyeongbuk 770-170 (Korea, Republic of); Choi, D.G. [Department of Nano Mechanics, Korea Institute of Machinery and Materials, 104 Sinseongno, Yuseong-gu Daejeon 305-343 (Korea, Republic of); Han, C.S. [Gyeongbuk Hybrid Technology Institute, 36 Goeyeon-dong, Yeongcheon, Gyeongbuk 770-170 (Korea, Republic of)

    2011-01-15

    The synthesis of isolated carbon nanotubes with uniform outer diameters and ordered spacing over wafer-scale areas was investigated for fabrication of nano-electrode arrays on silicon wafers for field emission and sensor devices. Multi-walled carbon nanotubes (MWCNTs) were grown on TiN electrode layer with iron catalyst patterned by nano-imprint lithography (NIL), which allows the precise placement of individual CNTs on a substrate. The proposed techniques, including plasma-enhanced chemical vapor deposition (PECVD) and NIL, are simple, inexpensive, and reproducible methods for fabrication of nano-scale devices in large areas. The catalyst patterns were defined by an array of circles with 200 nm in diameter, and variable lengths of pitch. The nano-patterned master and Fe catalyst were observed with good pattern fidelity over a large area by atomic force microscope (AFM) and scanning electron microscopy (SEM). Nano-electrodes of MWCNTs had diameters ranging from 50 nm to 100 nm and lengths of about 300 nm. Field emission tests showed the reducing ignition voltage as the geometry of nanotube arrays was controlled by catalyst patterning. These results showed a wafer-scale approach to the control of the size, pitch, and position of nano-electrodes of nanotubes for various applications including electron field-emission sources, electrochemical probes, functionalized sensor elements, and so on.

  1. Classification of methods for measuring current-voltage characteristics of semiconductor devices

    Directory of Open Access Journals (Sweden)

    Iermolenko Ia. O.

    2014-06-01

    Full Text Available It is shown that computer systems for measuring current-voltage characteristics are very important for semiconductor devices production. The main criteria of efficiency of such systems are defined. It is shown that efficiency of such systems significantly depends on the methods for measuring current-voltage characteristics of semiconductor devices. The aim of this work is to analyze existing methods for measuring current-voltage characteristics of semiconductor devices and to create the classification of these methods in order to specify the most effective solutions in terms of defined criteria. To achieve this aim, the most common classifications of methods for measuring current-voltage characteristics of semiconductor devices and their main disadvantages are considered. Automated and manual, continuous, pulse, mixed, isothermal and isodynamic methods for measuring current-voltage characteristics are analyzed. As a result of the analysis and generalization of existing methods the next classification criteria are defined: the level of automation, the form of measurement signals, the condition of semiconductor device during the measurements, and the use of mathematical processing of the measurement results. With the use of these criteria the classification scheme of methods for measuring current-voltage characteristics of semiconductor devices is composed and the most effective methods are specified.

  2. Clamped end conditions and cross section deformation in the finite element absolute nodal coordinate formulation

    International Nuclear Information System (INIS)

    Hussein, Bassam A.; Weed, David; Shabana, Ahmed A.

    2009-01-01

    In the finite element absolute nodal coordinate formulation (ANCF), the elimination of the relative translations and rotations at a point does not necessarily define a fully clamped joint, particularly in the case of fully parameterized ANCF finite elements that allow for the deformation of the cross section. In this investigation, the formulations and results of two different sets of clamped end conditions that define two different joints are compared. The first joint, called the partially clamped joint, eliminates only the translations and rotations at a point on the cross section. The second joint, called the fully clamped joint, eliminates all the translation, rotation and deformation degrees of freedom at a point on the cross section. The kinematic equations that define the partially and fully clamped joints are developed, and the dynamic equations used in the comparative numerical study presented in this paper are shown. As discussed in this investigation, the fully clamped joint does not allow for the deformation of the cross section at the joint node since the gradient vectors remain orthogonal unit vectors. The partially clamped joint, on the other hand, allows for the deformation of the cross section. Nanson's formula is used as a measure of the deformation of the cross section in the case of the partially clamped joint. A very flexible pendulum that has a rigid body attached to its free end is used to compare the results of the partially and fully clamped joints. The numerical results obtained using this very flexible pendulum example show that, while the type of joint (partially or fully clamped) does not significantly affect the gross reference motion of the system, there are fundamental differences between the two joints since the partially clamped joint allows for the cross section deformations at the joint node

  3. Effects of Voltage-Gated K+ Channel on Cell Proliferation in Multiple Myeloma

    Directory of Open Access Journals (Sweden)

    Wei Wang

    2014-01-01

    Full Text Available Objective. To study the effects and underlying mechanisms of voltage-gated K+ channels on the proliferation of multiple myeloma cells. Methods. RPMI-8226 MM cell line was used for the experiments. Voltage-gated K+ currents and the resting potential were recorded by whole-cell patch-clamp technique. RT-PCR detected Kv channel mRNA expression. Cell viability was analyzed with MTT assay. Cell counting system was employed to monitor cell proliferation. DNA contents and cell volume were analyzed by flow cytometry. Results. Currents recorded in RPMI-8226 cells were confirmed to be voltage-gated K+ channels. A high level of Kv1.3 mRNA was detected but no Kv3.1 mRNA was detected in RPMI-8226 cells. Voltage-gated K+ channel blocker 4-aminopyridine (4-AP (2 mM depolarized the resting potential from −42 ± 1.7 mV to −31.8 ± 2.8 mV (P0.05. Conclusions. In RPMI-8226, voltage-gated K+ channels are involved in proliferation and cell cycle progression its influence on the resting potential and cell volume may be responsible for this process; the inhibitory effect of the voltage-gated K+ channel blocker on RPMI-8226 cell proliferation is a phase-specific event.

  4. Optimization of the Electrocoagulation Process for Removal of Cr(VI Using Taguchi Method

    Directory of Open Access Journals (Sweden)

    Masoud Asadi Habib

    2012-01-01

    Full Text Available The aim of this study was to optimize electrocoagulation process for removal of chromium (VI using Taguchi method. An elecrtrocoagulation reactor with six parallel electrodes was used in this study. For this purpose, effects of 7 parameters such as electrode material, electric current, time of reactions, initial pH, initial voltage, initial chromium concentration and rpm of impeller (agitation intensity in two different levels were studied. Model of "OA_32" of Taguchi experimental design method was used. Among the above-mentioned parameters, electric current and electrode material had highest effects and rpm of impeller had the lowest effect on the electrocoagulation performance. According to the obtained results, highest chromium removal (168.33 mg/L observed in the following conditions: electric current=3A, time of reaction=20min, initial pH=4, initial voltage=6v, initial chromium concentration=400mg/L, rpm of impeller=0rpm and iron as electrode material

  5. Liquid-crystal microlens array with swing and adjusting focus and constructed by dual patterned ITO-electrodes

    Science.gov (United States)

    Dai, Wanwan; Xie, Xingwang; Li, Dapeng; Han, Xinjie; Liu, Zhonglun; Wei, Dong; Xin, Zhaowei; Zhang, Xinyu; Wang, Haiwei; Xie, Changsheng

    2018-02-01

    Under the condition of existing intense turbulence, the object's wavefront may be severely distorted. So, the wavefront sensors based on the traditional microlens array (MLA) with a fixed focal length can not be used to measure the wavefront effectively. In order to obtain a larger measurement range and higher measurement accuracy, we propose a liquid-crystal microlens array (LCMLA) with needed ability of swing focus over the focal plane and further adjusting focal length, which is constructed by a dual patterned ITO electrodes. The main structure of the LCMLA is divided into two layers, which are made of glass substrate with ITO transparent electrodes. The top layer of each liquid-crystal microlens consists of four rectangular electrodes, and the bottom layer is a circular electrode. In common optical measurements performed, the operations are carried out such as adding the same signal voltage over four electrodes of each microlens to adjust the focal length of the lens cell and adding a signal voltage with different RMS amplitude to adjust the focus position on the focal plane. Experiments show that the LCMLA developed by us demonstrate a desired focal length adjustable function and dynamic swing ability, so as to indicate that the method can be used not only to measure wavefront but also correct the wavefront with strong distortion.

  6. Design and Implementation of a High Efficiency, Low Component Voltage Stress, Single-Switch High Step-Up Voltage Converter for Vehicular Green Energy Systems

    Directory of Open Access Journals (Sweden)

    Yu-En Wu

    2016-09-01

    Full Text Available In this study, a novel, non-isolated, cascade-type, single-switch, high step-up DC/DC converter was developed for green energy systems. An integrated coupled inductor and voltage lift circuit were applied to simplify the converter structure and satisfy the requirements of high efficiency and high voltage gain ratios. In addition, the proposed structure is controllable with a single switch, which effectively reduces the circuit cost and simplifies the control circuit. With the leakage inductor energy recovery function and active voltage clamp characteristics being present, the circuit yields optimizable conversion efficiency and low component voltage stress. After the operating principles of the proposed structure and characteristics of a steady-state circuit were analyzed, a converter prototype with 450 W, 40 V of input voltage, 400 V of output voltage, and 95% operating efficiency was fabricated. The Renesas MCU RX62T was employed to control the circuits. Experimental results were analyzed to validate the feasibility and effectiveness of the proposed system.

  7. High performance current and spin diode of atomic carbon chain between transversely symmetric ribbon electrodes.

    Science.gov (United States)

    Dong, Yao-Jun; Wang, Xue-Feng; Yang, Shuo-Wang; Wu, Xue-Mei

    2014-08-21

    We demonstrate that giant current and high spin rectification ratios can be achieved in atomic carbon chain devices connected between two symmetric ferromagnetic zigzag-graphene-nanoribbon electrodes. The spin dependent transport simulation is carried out by density functional theory combined with the non-equilibrium Green's function method. It is found that the transverse symmetries of the electronic wave functions in the nanoribbons and the carbon chain are critical to the spin transport modes. In the parallel magnetization configuration of two electrodes, pure spin current is observed in both linear and nonlinear regions. However, in the antiparallel configuration, the spin-up (down) current is prohibited under the positive (negative) voltage bias, which results in a spin rectification ratio of order 10(4). When edge carbon atoms are substituted with boron atoms to suppress the edge magnetization in one of the electrodes, we obtain a diode with current rectification ratio over 10(6).

  8. Dynamic assembly of Hda and the sliding clamp in the regulation of replication licensing.

    Science.gov (United States)

    Kim, Jin S; Nanfara, Michael T; Chodavarapu, Sundari; Jin, Kyeong S; Babu, Vignesh M P; Ghazy, Mohamed A; Chung, Scisung; Kaguni, Jon M; Sutton, Mark D; Cho, Yunje

    2017-04-20

    Regulatory inactivation of DnaA (RIDA) is one of the major regulatory mechanisms of prokaryotic replication licensing. In RIDA, the Hda-sliding clamp complex loaded onto DNA directly interacts with adenosine triphosphate (ATP)-bound DnaA and stimulates the hydrolysis of ATP to inactivate DnaA. A prediction is that the activity of Hda is tightly controlled to ensure that replication initiation occurs only once per cell cycle. Here, we determined the crystal structure of the Hda-β clamp complex. This complex contains two pairs of Hda dimers sandwiched between two β clamp rings to form an octamer that is stabilized by three discrete interfaces. Two separate surfaces of Hda make contact with the β clamp, which is essential for Hda function in RIDA. The third interface between Hda monomers occludes the active site arginine finger, blocking its access to DnaA. Taken together, our structural and mutational analyses of the Hda-β clamp complex indicate that the interaction of the β clamp with Hda controls the ability of Hda to interact with DnaA. In the octameric Hda-β clamp complex, the inability of Hda to interact with DnaA is a novel mechanism that may regulate Hda function. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Surface potential distribution and airflow performance of different air-exposed electrode plasma actuators at different alternating current/direct current voltages

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Liang; Yan, Hui-Jie; Qi, Xiao-Hua; Hua, Yue; Ren, Chun-Sheng, E-mail: rchsh@dlut.edu.cn [School of Physics and Optoelectronic Technology, Key laboratory of Materials Modification by Laser, Ion and Electron Beams, Ministry of Education, Dalian University of Technology, Dalian 116023 (China)

    2015-04-15

    Asymmetric surface dielectric barrier discharge (SDBD) plasma actuators have been intensely studied for a number of years due to their potential applications for aerodynamic control. In this paper, four types of actuators with different configurations of exposed electrode are proposed. The SDBD actuators investigated are driven by dual-power supply, referred to as a fixed AC high voltage and an adjustable DC bias. The effects of the electrode structures on the dielectric surface potential distribution, the electric wind velocity, and the mean thrust production are studied, and the dominative factors of airflow acceleration behavior are revealed. The results have shown that the actions of the SDBD actuator are mainly dependent on the geometry of the exposed electrode. Besides, the surface potential distribution can effectively affect the airflow acceleration behavior. With the application of an appropriate additional DC bias, the surface potential will be modified. As a result, the performance of the electric wind produced by a single SDBD can be significantly improved. In addition, the work also illustrates that the actuators with more negative surface potential present better mechanical performance.

  10. Surface potential distribution and airflow performance of different air-exposed electrode plasma actuators at different alternating current/direct current voltages

    International Nuclear Information System (INIS)

    Yang, Liang; Yan, Hui-Jie; Qi, Xiao-Hua; Hua, Yue; Ren, Chun-Sheng

    2015-01-01

    Asymmetric surface dielectric barrier discharge (SDBD) plasma actuators have been intensely studied for a number of years due to their potential applications for aerodynamic control. In this paper, four types of actuators with different configurations of exposed electrode are proposed. The SDBD actuators investigated are driven by dual-power supply, referred to as a fixed AC high voltage and an adjustable DC bias. The effects of the electrode structures on the dielectric surface potential distribution, the electric wind velocity, and the mean thrust production are studied, and the dominative factors of airflow acceleration behavior are revealed. The results have shown that the actions of the SDBD actuator are mainly dependent on the geometry of the exposed electrode. Besides, the surface potential distribution can effectively affect the airflow acceleration behavior. With the application of an appropriate additional DC bias, the surface potential will be modified. As a result, the performance of the electric wind produced by a single SDBD can be significantly improved. In addition, the work also illustrates that the actuators with more negative surface potential present better mechanical performance

  11. Elimination of voltage reversal in multiple membrane electrode assembly installed microbial fuel cells (mMEA-MFCs) stacking system by resistor control.

    Science.gov (United States)

    Kim, Bongkyu; Chang, In Seop

    2018-08-01

    Voltage reversal (VR) in series connection of multiple membrane electrode assembly installed microbial fuel cells (mMEA-MFC) is eliminated by manipulating the resistor control. Discharge test results collected from two mMEA-MFCs initially operated (designated as P1 and P2) confirm that the performance of P2 exceeds that of P1. Thus, driving P1 and P2 as serially stacked MFCs generate the VR in P1. Controlling the inserted resistor adjust the current production of P2 to maintain balance with P1, and the VR in P1 is eliminated in the operation of stacking mode. Thus, manipulating the internal resistance provide an applicable approach to suppress VR in the stacking of mMEA-MFCs system. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. Analysis list: Clamp [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Clamp Cell line + dm3 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/target/Clamp.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/target/Clam...p.5.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/target/Clam...p.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/colo/Clamp.Cell_line.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/colo/Cell_line.gml ...

  13. Time varying voltage combustion control and diagnostics sensor

    Science.gov (United States)

    Chorpening, Benjamin T [Morgantown, WV; Thornton, Jimmy D [Morgantown, WV; Huckaby, E David [Morgantown, WV; Fincham, William [Fairmont, WV

    2011-04-19

    A time-varying voltage is applied to an electrode, or a pair of electrodes, of a sensor installed in a fuel nozzle disposed adjacent the combustion zone of a continuous combustion system, such as of the gas turbine engine type. The time-varying voltage induces a time-varying current in the flame which is measured and used to determine flame capacitance using AC electrical circuit analysis. Flame capacitance is used to accurately determine the position of the flame from the sensor and the fuel/air ratio. The fuel and/or air flow rate (s) is/are then adjusted to provide reduced flame instability problems such as flashback, combustion dynamics and lean blowout, as well as reduced emissions. The time-varying voltage may be an alternating voltage and the time-varying current may be an alternating current.

  14. Improved DNA clamps by stacking to adjacent nucleobases

    DEFF Research Database (Denmark)

    Fatthalla, M.I.; Pedersen, Erik Bjerregaard

    2012-01-01

    Three or four aromatic rings interconnected by acetylene bridges form a stiff conjugated system with sufficient conformational freedom to make it useful to link together the two strands of a DNA clamp. Upon targeting a ssDNA, the conformational flexibility allows better stacking of the linker...... to the underlying non-planar base triplet in the formed triplex. This type of triplexes has a substantially higher thermal melting temperature which can be further improved by inserting locked nucleic acids (LNAs) in the Hoogsteen part of the clamp. An extremely high sensitivity to mismatches is observed...

  15. Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

    Directory of Open Access Journals (Sweden)

    Seok-Yong Lee

    2009-03-01

    Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

  16. Voltage-Step Transient on Circular Electrodes

    Czech Academy of Sciences Publication Activity Database

    Wein, Ondřej; Tovčigrečko, Valentin

    2011-01-01

    Roč. 41, č. 9 (2011), s. 1065-1075 ISSN 0021-891X R&D Projects: GA ČR GA104/08/0428; GA ČR GA104/09/0972 Institutional research plan: CEZ:AV0Z40720504 Keywords : ohmic loss * voltage-step transient * cottrell asymptote Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 1.745, year: 2011

  17. Dependence of hydrogen arcjet operation on electrode geometry

    Science.gov (United States)

    Pencil, Eric J.; Sankovic, John M.; Sarmiento, Charles J.; Hamley, John A.

    1992-01-01

    The dependence of 2kW hydrogen arcjet performance on cathode to anode electrode spacing was evaluated at specific impulses of 900 and 1000 s. Less than 2 absolute percent change in efficiency was measured for the spacings tested which did not repeat the 14 absolute percent variation reported in earlier work with similar electrode designs. A different nozzle configuration was used to quantify the variation in hydrogen arcjet performance over an extended range of electrode spacing. Electrode gap variation resulted in less than 3 absolute percent change in efficiency. These null results suggested that electrode spacing is decoupled from hydrogen arcjet ignition. The dependence of breakdown voltage on mass flow rate and electrode agreed with Paschen curves for hydrogen. Preliminary characterization of the dependence of hydrogen arcjet ignition on rates of pulse repetition and pulse voltage rise were also included for comparison with previous results obtained using simulated hydrazine.

  18. Development of DBD plasma actuators: The double encapsulated electrode

    Science.gov (United States)

    Erfani, Rasool; Zare-Behtash, Hossein; Hale, Craig; Kontis, Konstantinos

    2015-04-01

    Plasma actuators are electrical devices that generate a wall bounded jet without the use of any moving parts. For aerodynamic applications they can be used as flow control devices to delay separation and augment lift on a wing. The standard plasma actuator consists of a single encapsulated (ground) electrode. The aim of this project is to investigate the effect of varying the number and distribution of encapsulated electrodes in the dielectric layer. Utilising a transformer cascade, a variety of input voltages are studied for their effect. In the quiescent environment of a Faraday cage the velocity flow field is recorded using particle image velocimetry. Through understanding of the mechanisms involved in producing the wall jet and the importance of the encapsulated electrode a novel actuator design is proposed. The actuator design distributes the encapsulated electrode throughout the dielectric layer. The experiments have shown that actuators with a shallow initial encapsulated electrode induce velocities greater than the baseline case at the same voltage. Actuators with a deep initial encapsulated electrode are able to induce the highest velocities as they can operate at higher voltages without breakdown of the dielectric.

  19. Research on uncertainty evaluation measure and method of voltage sag severity

    Science.gov (United States)

    Liu, X. N.; Wei, J.; Ye, S. Y.; Chen, B.; Long, C.

    2018-01-01

    Voltage sag is an inevitable serious problem of power quality in power system. This paper focuses on a general summarization and reviews on the concepts, indices and evaluation methods about voltage sag severity. Considering the complexity and uncertainty of influencing factors, damage degree, the characteristics and requirements of voltage sag severity in the power source-network-load sides, the measure concepts and their existing conditions, evaluation indices and methods of voltage sag severity have been analyzed. Current evaluation techniques, such as stochastic theory, fuzzy logic, as well as their fusion, are reviewed in detail. An index system about voltage sag severity is provided for comprehensive study. The main aim of this paper is to propose thought and method of severity research based on advanced uncertainty theory and uncertainty measure. This study may be considered as a valuable guide for researchers who are interested in the domain of voltage sag severity.

  20. Method for analysis the complex grounding cables system

    International Nuclear Information System (INIS)

    Ackovski, R.; Acevski, N.

    2002-01-01

    A new iterative method for the analysis of the performances of the complex grounding systems (GS) in underground cable power networks with coated and/or uncoated metal sheathed cables is proposed in this paper. The analyzed grounding system consists of the grounding grid of a high voltage (HV) supplying transformer station (TS), middle voltage/low voltage (MV/LV) consumer TSs and arbitrary number of power cables, connecting them. The derived method takes into consideration the drops of voltage in the cable sheets and the mutual influence among all earthing electrodes, due to the resistive coupling through the soil. By means of the presented method it is possible to calculate the main grounding system performances, such as earth electrode potentials under short circuit fault to ground conditions, earth fault current distribution in the whole complex grounding system, step and touch voltages in the nearness of the earthing electrodes dissipating the fault current in the earth, impedances (resistances) to ground of all possible fault locations, apparent shield impedances to ground of all power cables, e.t.c. The proposed method is based on the admittance summation method [1] and is appropriately extended, so that it takes into account resistive coupling between the elements that the GS. (Author)

  1. The Using of Used Battery as Alternative Electrode for Emission Spectrograph

    International Nuclear Information System (INIS)

    Arif Artadi; Sudaryo; Aryadi

    2007-01-01

    Analysis of boron (B) and cadmium (Cd) in U 3 O 8 has been carried out by using used battery electrode at emission spectrograph method. Analysis was done with the DC-Arc method, 10 Ampere current, 220 voltage, 25 second exposure time, and 2 mm electrode apart. The sample was extracted using TBP-Kerosine with the ratio of 70 : 30 volume of 200 ml. Water phase as the extraction result was dripped on electrode and excited. Intensity of the samples were compared to its standard, then it was obtained boron and cadmium concentration in sample were 0.07 ppm and 0.15 ppm respectively. The analysis result of boron and cadmium concentration in the sample using battery electrode were 0.21 ppm and 0.14 ppm respectively. (author)

  2. Research on micromanipulator’s clamping force sensing based on static wirerope tension of a surgical robot

    Directory of Open Access Journals (Sweden)

    Lingtao Yu

    2015-04-01

    Full Text Available The micromanipulator’s force feedback is one of the key research contents of minimally invasive surgical robotic system. Because the micromanipulator is a kind of compact construction which is suitable for valve installation with small space in surgery, especially for the influence of disinfection method, there are major difficulties and limitations to integrate compact sensors in the end of micromanipulator. This article focuses on the 3-degree-of-freedom micromanipulator’s clamping force sensing, and these three joints are actuated by wirerope driving. A clamping force sensing method is proposed based on static tension of wirerope driving, and a static model between the clamping force and wirerope’s static tension is established considering the influence of real friction resistance in the mechanical system. Finally, an equivalent experimental test platform for 3-degree-of-freedom micromanipulator’s clamping force sensing is set up, and then a series of experiments of the clamping force are studied. The frictional resistances of wirerope between the guide plate and guide pulley mechanism are tested, and a calibration and correction method of the experimental clamping force is proposed. The final experiment results show that the total average accuracy of experimental clamping force is about 78.3%, and it can be the basic measurement force to realize micromanipulator’s clamping force feedback of a minimally invasive surgical robot.

  3. The voltage optimization of a four-element lens used on a hemispherical spectrograph with virtual entry for highest energy resolution

    International Nuclear Information System (INIS)

    Sise, O.; Martínez, G.; Madesis, I.; Laoutaris, A.; Dimitriou, A.; Fernández-Martín, M.; Zouros, T.J.M.

    2016-01-01

    Highlights: • We investigate the voltage settings for the four-element injection lens of an HDA. • The two well-known approaches, BEM and FDM, in charged particle optics were used. • We tested optimal lens voltages from simulation on the actual experimental setup. • The measured FWHM were well modeled using realistic source parameters. • The results are helpful to experimenters. - Abstract: The methodology and results of a detailed four-element lens optimization analysis based on electron trajectory numerical simulations are presented for a hemispherical deflector analyzer (HDA), whose entry aperture size is determined by the injection lens itself and is therefore virtual. Trajectory calculations were performed using both the boundary-element method (BEM) and the finite-difference method (FDM) and results from these two different approaches were benchmarked against each other, to probe and confirm the accuracy of our results. Since the first and last electrode are held at fixed potentials, the two intermediate adjustable lens electrode voltages were varied over the entire available voltage space in a direct, systematic, brute-force approach, while minima in beam spot size on the 2-D position sensitive detector (PSD) at the exit of the HDA were investigated using a beam shaping approach. Lens voltages demonstrating improved energy resolution for the combined lens/HDA/PSD spectrograph system were sought with and without pre-retardation. The optimal voltages were then tested experimentally on the modeled HDA system using a hot-wire electron gun. The measured energy resolution was found to be in good overall agreement with our simulations, particularly at the highest resolution (∼0.05%) working conditions. These simulations also provide a detailed insight to the distinctive trajectory optics and positions of the first and second image planes, when the PSD has to be placed some distance away from the HDA exit plane, and is therefore not at the ideal optics

  4. The voltage optimization of a four-element lens used on a hemispherical spectrograph with virtual entry for highest energy resolution

    Energy Technology Data Exchange (ETDEWEB)

    Sise, O., E-mail: omersise@sdu.edu.tr [Department of Science Education, Faculty of Education, Suleyman Demirel University, 32260 Isparta (Turkey); Martínez, G. [Departamento de Física Aplicada III, Facultad de Física, UCM, 28040 Madrid (Spain); Madesis, I. [Department of Physics, University of Crete, P.O. Box 2208, GR, 71003 Heraklion (Greece); Tandem Accelerator Laboratory, INPP, NCSR Demokritos, GR, 15310 Ag Paraskevi (Greece); Laoutaris, A. [Tandem Accelerator Laboratory, INPP, NCSR Demokritos, GR, 15310 Ag Paraskevi (Greece); Department of Applied Physics, National Technical University of Athens, GR, 15780 Athens (Greece); Dimitriou, A. [Department of Physics, University of Crete, P.O. Box 2208, GR, 71003 Heraklion (Greece); Tandem Accelerator Laboratory, INPP, NCSR Demokritos, GR, 15310 Ag Paraskevi (Greece); Fernández-Martín, M. [Departamento de Física Aplicada III, Facultad de Física, UCM, 28040 Madrid (Spain); Zouros, T.J.M. [Department of Physics, University of Crete, P.O. Box 2208, GR, 71003 Heraklion (Greece); Tandem Accelerator Laboratory, INPP, NCSR Demokritos, GR, 15310 Ag Paraskevi (Greece)

    2016-08-15

    Highlights: • We investigate the voltage settings for the four-element injection lens of an HDA. • The two well-known approaches, BEM and FDM, in charged particle optics were used. • We tested optimal lens voltages from simulation on the actual experimental setup. • The measured FWHM were well modeled using realistic source parameters. • The results are helpful to experimenters. - Abstract: The methodology and results of a detailed four-element lens optimization analysis based on electron trajectory numerical simulations are presented for a hemispherical deflector analyzer (HDA), whose entry aperture size is determined by the injection lens itself and is therefore virtual. Trajectory calculations were performed using both the boundary-element method (BEM) and the finite-difference method (FDM) and results from these two different approaches were benchmarked against each other, to probe and confirm the accuracy of our results. Since the first and last electrode are held at fixed potentials, the two intermediate adjustable lens electrode voltages were varied over the entire available voltage space in a direct, systematic, brute-force approach, while minima in beam spot size on the 2-D position sensitive detector (PSD) at the exit of the HDA were investigated using a beam shaping approach. Lens voltages demonstrating improved energy resolution for the combined lens/HDA/PSD spectrograph system were sought with and without pre-retardation. The optimal voltages were then tested experimentally on the modeled HDA system using a hot-wire electron gun. The measured energy resolution was found to be in good overall agreement with our simulations, particularly at the highest resolution (∼0.05%) working conditions. These simulations also provide a detailed insight to the distinctive trajectory optics and positions of the first and second image planes, when the PSD has to be placed some distance away from the HDA exit plane, and is therefore not at the ideal optics

  5. Suspension and simple optical characterization of two-dimensional membranes

    Science.gov (United States)

    Northeast, David B.; Knobel, Robert G.

    2018-03-01

    We report on a method for suspending two-dimensional crystal materials in an electronic circuit using an only photoresists and solvents. Graphene and NbSe2 are suspended tens of nanometers above metal electrodes with clamping diameters of several microns. The optical cavity formed from the membrane/air/metal structures enables a quick method to measure the number of layers and the gap separation using comparisons between the expected colour and optical microscope images. This characterization technique can be used with just an illuminated microscope with a digital camera which makes it adaptable to environments where other means of characterization are not possible, such as inside nitrogen glove boxes used in handling oxygen-sensitive materials.

  6. The enhancement of heavy metal removal from polluted river water treatment by integrated carbon-aluminium electrodes using electrochemical method

    Science.gov (United States)

    Yussuf, N. M.; Embong, Z.; Abdullah, S.; Masirin, M. I. M.; Tajudin, S. A. A.; Ahmad, S.; Sahari, S. K.; Anuar, A. A.; Maxwell, O.

    2018-01-01

    The heavy metal removal enhancement from polluted river water was investigated using two types of electrodes consist of integrated carbon-aluminium and a conventional aluminium plate electrode at laboratory-scale experiments. In the integrated electrode systems, the aluminium electrode surface was coated with carbon using mixed slurry containing carbon black, polyvinyl acetate and methanol. The electrochemical treatment was conducted on the parameter condition of 90V applied voltage, 3cm of electrode distance and 60 minutes of electrolysis operational time. Surface of both electrodes was investigated for pre and post electrolysis treatment by using SEM-EDX analytical technique. Comparison between both of the electrode configuration exhibits that more metals were accumulated on carbon integrated electrode surfaces for both anode and cathode, and more heavy metals were detected on the cathode. The atomic percentage of metals distributed on the cathode conventional electrode surface consist of Al (94.62%), Zn (1.19%), Mn (0.73%), Fe (2.81%) and Cu (0.64%), while on the anode contained O (12.08%), Al (87.63%) and Zn (0.29%). Meanwhile, cathode surface of integrated electrode was accumulated with more metals; O (75.40%), Al (21.06%), Zn (0.45%), Mn (0.22), Fe (0.29%), Cu (0.84%), Pb (0.47%), Na (0.94%), Cr (0.08%), Ni (0.02%) and Ag (0.22%), while on anode contain Al (3.48%), Fe (0.49 %), C (95.77%), and Pb (0.26%). According to this experiment, it was found that integrated carbon-aluminium electrodes have a great potential to accumulate more heavy metal species from polluted water compare to the conventional aluminium electrode. Here, heavy metal accumulation process obviously very significant on the cathode surface.

  7. Voltage quantization by ballistic vortices in two-dimensional superconductors

    International Nuclear Information System (INIS)

    Orlando, T.P.; Delin, K.A.

    1991-01-01

    The voltage generated by moving ballistic vortices with a mass m ν in a two-dimensional superconducting ring is quantized, and this quantization depends on the amount of charge enclosed by the ring. The quantization of the voltage is the dual to flux quantization in a superconductor, and is a manifestation of the Aharonov-Casher effect. The quantization is obtained by applying the Bohr-Sommerfeld criterion to the canonical momentum of the ballistic vortices. The results of this quantization condition can also be used to understand the persistent voltage predicted by van Wees for an array of Josephson junctions

  8. Enhanced Open-Circuit Voltage in Visible Quantum Dot Photovoltaics by Engineering of Carrier-Collecting Electrodes

    KAUST Repository

    Wang, Xihua

    2011-10-26

    Colloidal quantum dots (CQDs) enable multijunction solar cells using a single material programmed using the quantum size effect. Here we report the systematic engineering of 1.6 eV PbS CQD solar cells, optimal as the front cell responsible for visible-wavelength harvesting in tandem photovoltaics. We rationally optimize each of the device\\'s collecting electrodes-the heterointerface with electron-accepting TiO2 and the deep-work-function hole-collecting MoO3 for ohmic contact-for maximum efficiency. We report an open-circuit voltage of 0.70 V, the highest observed in a colloidal quantum dot solar cell operating at room temperature. We report an AM1.5 solar power conversion efficiency of 3.5%, the highest observed in >1.5 eV bandgap CQD PV device. © 2011 American Chemical Society.

  9. Natural Vibration Analysis of Clamped Rectangular Orthotropic Plates

    Science.gov (United States)

    dalaei, m.; kerr, a. d.

    The natural vibrations of clamped rectangular orthotropic plates are analyzed using the extended Kantorovich method. The developed iterative scheme converges very rapidly to the final result. The obtained natural frequencies are evaluated for a square plate made of Kevlar 49 Epoxy and the obtained results are compared with those published by Kanazawa and Kawai, and by Leissa. The agreement was found to be very close. As there are no exact analytical solutions for clamped rectangular plates, the generated closed form expression for the natural modes, and the corresponding natural frequencies, are very suitable for use in engineering analyses.

  10. Dynamic impedance model of the skin-electrode interface for transcutaneous electrical stimulation.

    Directory of Open Access Journals (Sweden)

    José Luis Vargas Luna

    Full Text Available Transcutaneous electrical stimulation can depolarize nerve or muscle cells applying impulses through electrodes attached on the skin. For these applications, the electrode-skin impedance is an important factor which influences effectiveness. Various models describe the interface using constant or current-depending resistive-capacitive equivalent circuit. Here, we develop a dynamic impedance model valid for a wide range stimulation intensities. The model considers electroporation and charge-dependent effects to describe the impedance variation, which allows to describe high-charge pulses. The parameters were adjusted based on rectangular, biphasic stimulation pulses generated by a stimulator, providing optionally current or voltage-controlled impulses, and applied through electrodes of different sizes. Both control methods deliver a different electrical field to the tissue, which is constant throughout the impulse duration for current-controlled mode or have a very current peak for voltage-controlled. The results show a predominant dependence in the current intensity in the case of both stimulation techniques that allows to keep a simple model. A verification simulation using the proposed dynamic model shows coefficient of determination of around 0.99 in both stimulation types. The presented method for fitting electrode-skin impedance can be simple extended to other stimulation waveforms and electrode configuration. Therefore, it can be embedded in optimization algorithms for designing electrical stimulation applications even for pulses with high charges and high current spikes.

  11. Study on temperature dependence of output voltage of electrochemical detector for environmental neutrinos

    International Nuclear Information System (INIS)

    Halim, Md Abdul; Ishibashi, Kenji; Arima, Hidehiko; Terao, Norichika

    2006-01-01

    An electrochemical detector with biological material has been applied for the detection of neutrinos on the basis of a new hypothesis. The detector consisted of two electrodes with raw silk and purified water, and gave an appreciable output voltage. The reproducibility of the experimental results was as good as 99.4% at temperature of 300 K. The temperature dependence of the voltage of the detector was studied at 280, 290, 300 and 310 K. Among them, the detector at 310 K produced the highest output voltage and reached 104 mV in 16 days, whereas that at 280 K generated the lowest voltage and it was as low as 1.2 mV in 16 days. The detectors working at 290 and 300 K produced the voltages 18 and 57 mV in 16 days, respectively. The output voltages of the detector increased with temperature and were in good agreement in spite of the history of temperature. The internal resistance and electromotive force (internal voltage) of the experimental detector were obtained at each temperature by individual analysis and least square fitting method. It was found that the electromotive force was almost constant for these temperatures while the internal resistance showed a large dependence on temperature. The reduction of the output voltage with temperature is dominated by this behavior of internal resistance. (author)

  12. Increasing break-down strength of the support colomn of high-voltage accelerators

    International Nuclear Information System (INIS)

    Rezvykh, K.A.; Romanov, V.A.

    1981-01-01

    Calculation results of strength of electric field of the EG-2.5 electrostatic accelerator for the support colomn with electrodes of circular and elliptical transverse cross sections are presented. Conducted is the choice of constructing the column under the condition that the dimensions of the tank, high-voltage electrode, step between the sections and internal diameter of the colomn electrodes are not changed. The potential at the high-voltage electrode equals 2.5 MV while the average longitudinal gradient of the colomn field equals 1.25 MV/m. The support insulation colomn of the high-voltage accelerator screened by rings with transverse cross section in the form of orientation oval in some accelerators promotes obtaining higher operating voltage and at the same time increase of operation reliability at the rest unchanged dimensions of the plant because the probability of break-down between the support colomn and the tank wall decreases. The latter is especially significant for most high-energy accelerators as well as for accelerators used in national economy [ru

  13. Multilevel-clamped multilevel converters (MLC2)

    DEFF Research Database (Denmark)

    Rodriguez, Pedro; Bellar, Maria Dias; Muñoz-Aguliar, Raúl Santiago

    2012-01-01

    clamping scheme is the ML clamping cell, which is composed of a pair of dc sources associated with one single-pole/triple-throw type of switch arrangement. The number of series-connected ML-clamping cells will set the number of levels of the synthesized waveform. By depending on the MCU arrangements......, different converter configurations can be derived, namely, the common clamping and the modular types. Both approaches can be accomplished by employing classical three-level neutral-point-clamped (NPC) technology. Thus, the overall structure of the resultant converter is kept simple, wherein the number...

  14. Structure of Voltage-gated Two-pore Channel TPC1 from Arabidopsis thaliana

    Science.gov (United States)

    Guo, Jiangtao; Zeng, Weizhong; Chen, Qingfeng; Lee, Changkeun; Chen, Liping; Yang, Yi; Cang, Chunlei; Ren, Dejian; Jiang, Youxing

    2015-01-01

    Two-pore channels (TPCs) contain two copies of a Shaker-like six-transmembrane (6-TM) domain in each subunit and are ubiquitously expressed in both animals and plants as organellar cation channels. Here, we present the first crystal structure of a vacuolar two-pore channel from Arabidopsis thaliana, AtTPC1, which functions as a homodimer. AtTPC1 activation requires both voltage and cytosolic Ca2+. Ca2+ binding to the cytosolic EF-hand domain triggers conformational changes coupled to the pair of pore-lining inner helices (IS6 helices) from the first 6-TM domains, whereas membrane potential only activates the second voltage-sensing domain (VSD2) whose conformational changes are coupled to the pair of inner helices (IIS6 helices) from the second 6-TM domains. Luminal Ca2+ or Ba2+ can modulate voltage activation by stabilizing VSD2 in the resting state and shifts voltage activation towards more positive potentials. Our Ba2+ bound AtTPC1 structure reveals a voltage sensor in the resting state, providing hitherto unseen structural insight into the general voltage-gating mechanism among voltage-gated channels. PMID:26689363

  15. Effects of atmospheric pressure plasma jet with floating electrode on murine melanoma and fibroblast cells

    Science.gov (United States)

    Xu, G.; Liu, J.; Yao, C.; Chen, S.; Lin, F.; Li, P.; Shi, X.; Zhang, Guan-Jun

    2017-08-01

    Atmospheric pressure cold plasma jets have been recently shown as a highly promising tool in certain cancer therapies. In this paper, an atmospheric pressure plasma jet (APPJ) with a one inner floating and two outer electrode configuration using helium gas for medical applications is developed. Subjected to a range of applied voltages with a frequency of 19.8 kHz at a fixed rate of gas flow (i.e., 3 l/min), electrical and optical characteristics of the APPJ are investigated. Compared with the device only with two outer electrodes, higher discharge current, longer jet, and more active species in the plasma plume at the same applied voltage together with the lower gas breakdown voltage can be achieved through embedding a floating inner electrode. Employing the APPJ with a floating electrode, the effects of identical plasma treatment time durations on murine melanoma cancer and normal fibroblast cells cultured in vitro are evaluated. The results of cell viability, cell apoptosis, and DNA damage detection show that the plasma can inactivate melanoma cells in a time-dependent manner from 10 s to 60 s compared with the control group (p cells compared with their control group, the plasma with treatment time from 30 s to 60 s can induce significant changes (p cells at the same treatment time. The different basal reactive oxygen species level and antioxidant superoxide dismutase level of two kinds of cells may account for their different responses towards the identical plasma exposure.

  16. Functional diversity of voltage-sensing phosphatases in two urodele amphibians.

    Science.gov (United States)

    Mutua, Joshua; Jinno, Yuka; Sakata, Souhei; Okochi, Yoshifumi; Ueno, Shuichi; Tsutsui, Hidekazu; Kawai, Takafumi; Iwao, Yasuhiro; Okamura, Yasushi

    2014-07-16

    Voltage-sensing phosphatases (VSPs) share the molecular architecture of the voltage sensor domain (VSD) with voltage-gated ion channels and the phosphoinositide phosphatase region with the phosphatase and tensin homolog (PTEN), respectively. VSPs enzymatic activities are regulated by the motions of VSD upon depolarization. The physiological role of these proteins has remained elusive, and insights may be gained by investigating biological variations in different animal species. Urodele amphibians are vertebrates with potent activities of regeneration and also show diverse mechanisms of polyspermy prevention. We cloned cDNAs of VSPs from the testes of two urodeles; Hynobius nebulosus and Cynops pyrrhogaster, and compared their expression and voltage-dependent activation. Their molecular architecture is highly conserved in both Hynobius VSP (Hn-VSP) and Cynops VSP (Cp-VSP), including the positively-charged arginine residues in the S4 segment of the VSD and the enzymatic active site for substrate binding, yet the C-terminal C2 domain of Hn-VSP is significantly shorter than that of Cp-VSP and other VSP orthologs. RT-PCR analysis showed that gene expression pattern was distinct between two VSPs. The voltage sensor motions and voltage-dependent phosphatase activities were investigated electrophysiologically by expression in Xenopus oocytes. Both VSPs showed "sensing" currents, indicating that their voltage sensor domains are functional. The phosphatase activity of Cp-VSP was found to be voltage dependent, as shown by its ability to regulate the conductance of coexpressed GIRK2 channels, but Hn-VSP lacked such phosphatase activity due to the truncation of its C2 domain. © 2014 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  17. Experimental investigation of cathode spots and plasma jets behavior subjected to two kinds of axial magnetic field electrodes

    International Nuclear Information System (INIS)

    Wang, Lijun; Deng, Jie; Zhou, Xin; Jia, Shenli; Qian, Zhonghao; Shi, Zongqian

    2016-01-01

    In this paper, cathode spot plasma jet (CSPJ) rotation and cathode spots behavior subjected to two kinds of large diameter axial magnetic field (AMF) electrode (cup-shaped and coil-shaped) are studied and analyzed based on experiments. The influence of gap distances on the CSPJ rotational behavior is analyzed. Experimental results show that CSPJ rotational phenomena extensively exist in the vacuum interrupters, and CSPJ rotational direction is along the direction of composite magnetic field (mainly the combination of the axial and azimuthal components). For coil-shaped and cup-shaped AMF electrodes, the rotational or inclination phenomena before the current peak value are much more significant than that after current peak value (for the same arc current), which is related to the larger ratio of azimuthal magnetic field B_t and AMF B_z (B_t/B_z). With the increase of the gap distance, the AMF strength decreases, when the arc current is kept as constant, the azimuthal magnetic field is kept invariable, the ratio between azimuthal magnetic field and AMF is increased, which results in the increase of rotational effect. For cathode spots motion, compared with cup-shaped electrode, coil-shaped electrode has the inverse AMF direction. The Robson drift direction of cathode spots of coil-shaped electrode is opposite to that of cup-shaped electrode. With the increase of gap distance, the Robson angle is decreased, which is associated with the reduced AMF strength. Erosion imprints of anode and cathode are also related to the CSPJ rotational phenomena and cathode spots behavior. The noise of arc voltage in the initial arcing stage is related to the weaker AMF.

  18. Experimental investigation of cathode spots and plasma jets behavior subjected to two kinds of axial magnetic field electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Lijun; Deng, Jie; Zhou, Xin; Jia, Shenli; Qian, Zhonghao; Shi, Zongqian [State Key Laboratory of Electrical Insulation and Power Equipment, Xi' an Jiaotong University, Xi' an 710049 (China)

    2016-04-15

    In this paper, cathode spot plasma jet (CSPJ) rotation and cathode spots behavior subjected to two kinds of large diameter axial magnetic field (AMF) electrode (cup-shaped and coil-shaped) are studied and analyzed based on experiments. The influence of gap distances on the CSPJ rotational behavior is analyzed. Experimental results show that CSPJ rotational phenomena extensively exist in the vacuum interrupters, and CSPJ rotational direction is along the direction of composite magnetic field (mainly the combination of the axial and azimuthal components). For coil-shaped and cup-shaped AMF electrodes, the rotational or inclination phenomena before the current peak value are much more significant than that after current peak value (for the same arc current), which is related to the larger ratio of azimuthal magnetic field B{sub t} and AMF B{sub z} (B{sub t}/B{sub z}). With the increase of the gap distance, the AMF strength decreases, when the arc current is kept as constant, the azimuthal magnetic field is kept invariable, the ratio between azimuthal magnetic field and AMF is increased, which results in the increase of rotational effect. For cathode spots motion, compared with cup-shaped electrode, coil-shaped electrode has the inverse AMF direction. The Robson drift direction of cathode spots of coil-shaped electrode is opposite to that of cup-shaped electrode. With the increase of gap distance, the Robson angle is decreased, which is associated with the reduced AMF strength. Erosion imprints of anode and cathode are also related to the CSPJ rotational phenomena and cathode spots behavior. The noise of arc voltage in the initial arcing stage is related to the weaker AMF.

  19. Two unique ligand-binding clamps of Rhizopus oryzae starch binding domain for helical structure disruption of amylose.

    Directory of Open Access Journals (Sweden)

    Ting-Ying Jiang

    Full Text Available The N-terminal starch binding domain of Rhizopus oryzae glucoamylase (RoSBD has a high binding affinity for raw starch. RoSBD has two ligand-binding sites, each containing a ligand-binding clamp: a polyN clamp residing near binding site I is unique in that it is expressed in only three members of carbohydrate binding module family 21 (CBM21 members, and a Y32/F58 clamp located at binding site II is conserved in several CBMs. Here we characterized different roles of these sites in the binding of insoluble and soluble starches using an amylose-iodine complex assay, atomic force microscopy, isothermal titration calorimetry, site-directed mutagenesis, and structural bioinformatics. RoSBD induced the release of iodine from the amylose helical cavity and disrupted the helical structure of amylose type III, thereby significantly diminishing the thickness and length of the amylose type III fibrils. A point mutation in the critical ligand-binding residues of sites I and II, however, reduced both the binding affinity and amylose helix disruption. This is the first molecular model for structure disruption of the amylose helix by a non-hydrolytic CBM21 member. RoSBD apparently twists the helical amylose strands apart to expose more ligand surface for further SBD binding. Repeating the process triggers the relaxation and unwinding of amylose helices to generate thinner and shorter amylose fibrils, which are more susceptible to hydrolysis by glucoamylase. This model aids in understanding the natural roles of CBMs in protein-glycan interactions and contributes to potential molecular engineering of CBMs.

  20. Method for making carbon super capacitor electrode materials

    Science.gov (United States)

    Firsich, David W.; Ingersoll, David; Delnick, Frank M.

    1998-01-01

    A method for making near-net-shape, monolithic carbon electrodes for energy storage devices. The method includes the controlled pyrolysis and activation of a pressed shape of methyl cellulose powder with pyrolysis being carried out in two stages; pre-oxidation, preferably in air at a temperature between 200.degree.-250.degree. C., followed by carbonization under an inert atmosphere. An activation step to adjust the surface area of the carbon shape to a value desirable for the application being considered, including heating the carbon shape in an oxidizing atmosphere to a temperature of at least 300.degree. C., follows carbonization.

  1. Integrated Three-Voltage-Booster DC-DC Converter to Achieve High Voltage Gain with Leakage-Energy Recycling for PV or Fuel-Cell Power Systems

    Directory of Open Access Journals (Sweden)

    Chih-Lung Shen

    2015-09-01

    Full Text Available In this paper, an integrated three-voltage-booster DC-DC (direct current to direct current converter is proposed to achieve high voltage gain for renewable-energy generation systems. The proposed converter integrates three voltage-boosters into one power stage, which is composed of an active switch, a coupled-inductor, five diodes, and five capacitors. As compared with conventional high step-up converters, it has a lower component count. In addition, the features of leakage-energy recycling and switching loss reduction can be accomplished for conversion efficiency improvement. While the active switch is turned off, the converter can inherently clamp the voltage across power switch and suppress voltage spikes. Moreover, the reverse-recovery currents of all diodes can be alleviated by leakage inductance. A 200 W prototype operating at 100 kHz switching frequency with 36 V input and 400 V output is implemented to verify the theoretical analysis and to demonstrate the feasibility of the proposed high step-up DC-DC converter.

  2. Graphene-gold supercapacitor as a voltage controlled saturable absorber for femtosecond pulse generation.

    Science.gov (United States)

    Baylam, Isinsu; Balci, Osman; Kakenov, Nurbek; Kocabas, Coskun; Sennaroglu, Alphan

    2016-03-01

    We report, for the first time to the best of our knowledge, use of a graphene-gold supercapacitor as a voltage controlled fast saturable absorber for femtosecond pulse generation. The unique design involving only one graphene electrode lowers the insertion loss of the device, in comparison with capacitor designs with two graphene electrodes. Furthermore, use of the high-dielectric electrolyte allows reversible, adjustable control of the absorption level up to the visible region with low bias voltages of only a few volts (0-2 V). The fast saturable absorber action of the graphene-gold supercapacitor was demonstrated inside a multipass-cavity Cr:forsterite laser to generate nearly transform-limited, sub-100 fs pulses at a pulse repetition rate of 4.51 MHz at 1.24 μm.

  3. Electrochemical Deposition of CdTe Semiconductor Thin Films for Solar Cell Application Using Two-Electrode and Three-Electrode Configurations: A Comparative Study

    Directory of Open Access Journals (Sweden)

    O. K. Echendu

    2016-01-01

    Full Text Available Thin films of CdTe semiconductor were electrochemically deposited using two-electrode and three-electrode configurations in potentiostatic mode for comparison. Cadmium sulphate and tellurium dioxide were used as cadmium and tellurium sources, respectively. The layers obtained using both configurations exhibit similar structural, optical, and electrical properties with no specific dependence on any particular electrode configuration used. These results indicate that electrochemical deposition (electrodeposition of CdTe and semiconductors in general can equally be carried out using two-electrode system as well as the conventional three-electrode system without compromising the essential qualities of the materials produced. The results also highlight the advantages of the two-electrode configuration in process simplification, cost reduction, and removal of a possible impurity source in the growth system, especially as the reference electrode ages.

  4. Analysis of the Pallet Clamping Conditions in Work Positioning

    Directory of Open Access Journals (Sweden)

    L. A. Kolesnikov

    2016-01-01

    Full Text Available Pallets of automatic transfer lines serve as the technological and work-transfer equipment. However, their design is based on the general principles of designing machine accessories. Calculation of the basic design parameters of work based on their functioning features is fairly relevant.In pallet transfer movement over work positioning there is a mismatch between axes of the basic bushing of a pallet and the clamping locks of positioning. The paper identifies the factors influencing it, and defines the conditions to ensure the trouble-free clamping lock. The circular and rhombic clamping of pallet is simultaneous. Further, a clamping load is calculated from the pallet mass (together with the work-piece and the geometric parameters of the pallet clamping.The paper reveals three movement stages of the clamping lock in a vertical plane when setting the pallet in work positioning:- a clamping lock free play till it encounters with the location bushing;- a clamping lock play length when the lead-in chamfer contacts the bushing chamfer;- a clamping lock play length over the circular surface of bushing.The study of this process has allowed us to calculate the time of pallet clamping and dynamic loads acting on the clamping lock. These calculations made it possible to calculate the required diameter of the clamping lock. The presented calculations allow a reasonable assigning the main design parameters of work positioning for the pallet automatic lines.

  5. Dispersion of breakdown voltage of liquid helium

    International Nuclear Information System (INIS)

    Ishii, Itaru; Noguchi, Takuya

    1978-01-01

    As for the electrical insulation characteristics of liquid helium, the discrepancy among the measured values by each person is very large even in the fundamental DC breakdown voltage in uniform electric field. The dispersion of experimental values obtained in the experiments by the same person is also large. Hereafter, the difference among the mean values obtained by each experimenter will be referred to as ''deviation of mean values'', and the dispersion of measured values around the mean value obtained by the same person as ''deviation around the man value''. The authors have mainly investigated on the latter experimentally. The cryostat was made of stainless steel, and the innermost helium chamber was of 500 mm I.D. and approximately 1200 mm deep. The high voltage electrode was of brass sphere of 25 mm diameter, and the low voltage electrode was of brass plate. The experiment was conducted for liquid helium boiling at 4.2 K and 1 atm, and the breakdown voltage and time lag were measured by applying the approximately square wave impulses of fast rise and long tail, ramp and DC voltages. The cause of the deviation of mean values may be the presence of impurity particles or the effect of electrode shape. As for the deviation around the mean value, the dispersion is large, and its standard deviation may amount to 10 to 20% of the man value. The dispersion is not due to the statistical time lag, but is due to parameters that vary with breakdown. (Wakatsuki, Y.)

  6. Γ-source Neutral Point Clamped Inverter

    DEFF Research Database (Denmark)

    Mo, Wei; Loh, Poh Chiang; Blaabjerg, Frede

    Transformer based Z-source inverters are recently proposed to achieve promising buck-boost capability. They have improved higher buck-boost capability, smaller size and less components count over Z-source inverters. On the other hand, neutral point clamped inverters have less switching stress...... and better output performance comparing with traditional two-level inverters. Integrating these two types of configurations can help neutral point inverters achieve enhanced votlage buck-boost capability....

  7. Role of clamping tube thoracostomy prior to removal in non-cardiac thoracic trauma

    International Nuclear Information System (INIS)

    Rasheed, M.A.; Majeed, F.A.; Naz, A.

    2016-01-01

    The frequently encountered thoracic trauma in surgical emergencies is a major cause of mortality and morbidity. Eighty percent of thoracic trauma can be managed by simple insertion of tube thoracostomy. Though guidelines for insertion are comprehensively explained in literature, an ideal algorithm for discontinuation is not available. A standard and safe defined protocol would eliminate hesitancy in confident removal among general surgeons. The objective of this study was to determine role of clamping trial prior to removal in terms of frequency of recurrent pneumothorax. Methods: This study was conducted in department of Surgery Combined military hospital/Military Hospital Rawalpindi from April 2013 to March 2014. Total 180 patients with blunt or penetrating thoracic trauma were included in the study. Chest tube (28-36 Fr) was inserted in Trauma centre under strict asepsis. Tubes were then connected to under water seal for minimum six hours. Patients were randomly divided in two equal groups (90 in each). In Group A, Clamping trial was given before attempting removal while in Group B, tube was removed immediately without clamping trial. Patients of both groups were observed two hourly for development of recurrent pneumothorax. Data was analysed using SPSS-18. Results: The comparison of frequency of recurrent pneumothorax in Group A (9 patients, 10%) and in Group B (4 patients, 4.5%) was not found to be statistically significant. (p-value 2.073). Conclusion: Clamping trial is unnecessary prior to removal of tube thoracostomy in blunt and penetrating non-cardiac thoracic trauma in terms of recurrent pneumothorax. (author)

  8. Electrochemical characterisation of solid oxide cell electrodes for hydrogen production

    DEFF Research Database (Denmark)

    Bernuy-Lopez, Carlos; Knibbe, Ruth; He, Zeming

    2011-01-01

    Oxygen electrodes and steam electrodes are designed and tested to develop improved solid oxide electrolysis cells for H2 production with the cell support on the oxygen electrode. The electrode performance is evaluated by impedance spectroscopy testing of symmetric cells at open circuit voltage (OCV...

  9. Low voltage initiation of damaging arcs between electrical contacts

    International Nuclear Information System (INIS)

    Cuthrell, R.E.

    1975-07-01

    Metallic arcs were found to precede the firm contacting of electrical contacts which were closed without bounce. When the open-circuit voltages were below the ionization potential, the initiation of these arcs was found to depend on the presence of asperities on the surfaces and on asperity contracting, melting, and pinching off by magnetic forces. The arc is thought to be initiated inductively when the molten metallic asperity contact is pinched off, and the electrode damage is similar to that produced by the arcing of opening contacts. Arcing could not be produced for exceptionally smooth surfaces, or, for rough surfaces when the open-circuit potential was below the melting voltages of the electrode metals. In order to prevent damage to contact surfaces by melting or arcing, it is suggested that test potentials be limited to below the melting voltages, that the current be limited, the test circuits be designed to prevent inductively generated high voltage transients, and the contact surfaces be very smooth. In order to facilitate arc initiation in arc welding applications, it is suggested that the surfaces of electrodes and work pieces be roughened. (U.S.)

  10. Ventilation onset prior to umbilical cord clamping (physiological-based cord clamping improves systemic and cerebral oxygenation in preterm lambs.

    Directory of Open Access Journals (Sweden)

    Graeme R Polglase

    Full Text Available As measurement of arterial oxygen saturation (SpO2 is common in the delivery room, target SpO2 ranges allow clinicians to titrate oxygen therapy for preterm infants in order to achieve saturation levels similar to those seen in normal term infants in the first minutes of life. However, the influence of the onset of ventilation and the timing of cord clamping on systemic and cerebral oxygenation is not known.We investigated whether the initiation of ventilation, prior to, or after umbilical cord clamping, altered systemic and cerebral oxygenation in preterm lambs.Systemic and cerebral blood-flows, pressures and peripheral SpO2 and regional cerebral tissue oxygenation (SctO2 were measured continuously in apnoeic preterm lambs (126±1 day gestation. Positive pressure ventilation was initiated either 1 prior to umbilical cord clamping, or 2 after umbilical cord clamping. Lambs were monitored intensively prior to intervention, and for 10 minutes following umbilical cord clamping.Clamping the umbilical cord prior to ventilation resulted in a rapid decrease in SpO2 and SctO2, and an increase in arterial pressure, cerebral blood flow and cerebral oxygen extraction. Ventilation restored oxygenation and haemodynamics by 5-6 minutes. No such disturbances in peripheral or cerebral oxygenation and haemodynamics were observed when ventilation was initiated prior to cord clamping.The establishment of ventilation prior to umbilical cord clamping facilitated a smooth transition to systemic and cerebral oxygenation following birth. SpO2 nomograms may need to be re-evaluated to reflect physiological management of preterm infants in the delivery room.

  11. An Implantable Versatile Electrode-Driving ASIC for Chronic Epidural Stimulation in Rats.

    Science.gov (United States)

    Giagka, Vasiliki; Eder, Clemens; Donaldson, Nick; Demosthenous, Andreas

    2015-06-01

    This paper presents the design and testing of an electrode driving application specific integrated circuit (ASIC) intended for epidural spinal cord electrical stimulation in rats. The ASIC can deliver up to 1 mA fully programmable monophasic or biphasic stimulus current pulses, to 13 electrodes selected in any possible configuration. It also supports interleaved stimulation. Communication is achieved via only 3 wires. The current source and the control of the stimulation timing were kept off-chip to reduce the heat dissipation close to the spinal cord. The ASIC was designed in a 0.18- μm high voltage CMOS process. Its output voltage compliance can be up to 25 V. It features a small core area (ASIC was developed to be suitable for integration on the epidural electrode array, and two different versions were fabricated and electrically tested. Results from both versions were almost indistinguishable. The performance of the system was verified for different loads and stimulation parameters. Its suitability to drive a passive epidural 12-electrode array in saline has also been demonstrated.

  12. Dependence of hydrogen arcjet operation on electrode geometry

    Science.gov (United States)

    Pencil, Eric J.; Sankovic, John M.; Sarmiento, Charles J.; Hamley, John A.

    1992-01-01

    The dependence of 2 kW hydrogen arcjet performance on cathode to anode electrode spacing was evaluated at specific impulses of 900 and 1000 s. Less than 2 absolute percent change in efficiency was measured for the spacings tested which did not repeat the 14 absolute percent variation reported in earlier work with similar electrode designs. A different nozzle configuration was used to quantify the variation in hydrogen arcjet performance over an extended range of electrode spacing. Electrode gap variation resulted in less than 3 absolute percent change in efficiency. These null results suggested that electrode spacing is decoupled from hydrogen arcjet performance considerations over the ranges tested. Initial studies were conducted on hydrogen arcjet ignition. The dependence of breakdown voltage on mass flow rate and hydrogen arcjet ignition on rates of pulse repetition and pulse voltage rise were also included for comparison with previous results obtained using simulated hydrazine.

  13. The cardiovascular effects of aortic clamping and unclamping

    African Journals Online (AJOL)

    aortic clamping is that afterload and blood pressure increase, and ... individually, albeit they interact with each other. The degree of ... position of the aortic clamp, the greater the increase ... the increase in preload in response to aortic clamping.

  14. Improving Impedance of Implantable Microwire Multi-Electrode Arrays by Ultrasonic Electroplating of Durable Platinum Black

    Science.gov (United States)

    Desai, Sharanya Arcot; Rolston, John D.; Guo, Liang; Potter, Steve M.

    2010-01-01

    Implantable microelectrode arrays (MEAs) have been a boon for neural stimulation and recording experiments. Commercially available MEAs have high impedances, due to their low surface area and small tip diameters, which are suitable for recording single unit activity. Lowering the electrode impedance, but preserving the small diameter, would provide a number of advantages, including reduced stimulation voltages, reduced stimulation artifacts and improved signal-to-noise ratio. Impedance reductions can be achieved by electroplating the MEAs with platinum (Pt) black, which increases the surface area but has little effect on the physical extent of the electrodes. However, because of the low durability of Pt black plating, this method has not been popular for chronic use. Sonicoplating (i.e. electroplating under ultrasonic agitation) has been shown to improve the durability of Pt black on the base metals of macro-electrodes used for cyclic voltammetry. This method has not previously been characterized for MEAs used in chronic neural implants. We show here that sonicoplating can lower the impedances of microwire multi-electrode arrays (MMEA) by an order of magnitude or more (depending on the time and voltage of electroplating), with better durability compared to pulsed plating or traditional DC methods. We also show the improved stimulation and recording performance that can be achieved in an in vivo implantation study with the sonicoplated low-impedance MMEAs, compared to high-impedance unplated electrodes. PMID:20485478

  15. Single guard cell recordings in intact plants : light-induced hyperpolarization of the plasma membrane

    NARCIS (Netherlands)

    Roelfsema, MRG; Steinmeyer, R; Staal, M; Hedrich, R

    Guard cells are electrically isolated from other plant cells and therefore offer the unique possibility to conduct current- and voltage-clamp recordings on single cells in an intact plant. Guard cells in their natural environment were impaled with double-barreled electrodes and found to exhibit

  16. A study of the electrochemical behaviour of electrodes in operating solid-state supercapacitors

    International Nuclear Information System (INIS)

    Staiti, P.; Lufrano, F.

    2007-01-01

    The electrochemical behaviour of electrodes and of complete solid-state supercapacitors has been studied by cyclic voltammetry (CV) and galvanostatic charge/discharge (CD) measurements using two independent electrochemical equipments. The first one controlled the execution of the test and recorded the voltage and current values of the complete supercapacitor while the other one recorded the potential changes of the single electrodes. In this work, two different types of capacitors were studied: (a) a symmetric supercapacitor using carbon electrodes, and (b) a hybrid (asymmetric) supercapacitor with ruthenium oxide/carbon in the positive electrode and carbon in the negative electrode. The studies evidenced that in the symmetric capacitors the positive electrode controlled the capacitive performance and an optimal mass ratio from 1.2:1 to 1.3:1 between the positive and the negative electrodes was found in the investigated conditions. For the hybrid supercapacitor it was observed that the ruthenium-based positive electrode influenced the capacitive performance of carbon-based negative electrode and that an accurate balance of carbon loading in the negative electrode was necessary

  17. Improvement in Electrode Performance of Novel SWCNT Loaded Three-Dimensional Porous RVC Composite Electrodes by Electrochemical Deposition Method

    Science.gov (United States)

    Almoigli, Mohammed; Meriey, Al Yahya; Alharbi, Khalid N.

    2018-01-01

    The three-dimensional (3D) composite electrodes were prepared by depositing different amounts of acid-functionalized single-walled carbon nanotubes (a-SWCNTs) on porous reticulated vitreous carbon (RVC) through the electrochemical deposition method. The SWCNT was functionalized by the reflux method in nitric acid and was proven by Raman and visible spectra. The optimum time for sonication to disperse the functionalized SWCNT (a-SWCNT) in dimethyl formamide (DMF) well was determined by UV spectra. The average pore size of RVC electrodes was calculated from scanning electron microscopy (SEM) images. Moreover, the surface morphology of composite electrodes was also examined by SEM study. All 3D electrodes were evaluated for their electrochemical properties by cyclic voltammetry. The result showed that the value of specific capacitance of the electrode increases with the increase in the amount of a-SWCNT in geometric volume. However, the value of specific capacitance per gram decreases with the increase in scan rate as well as the amount of a-SWCNT. The stability of the electrodes was also tested. This revealed that all the electrodes were stable; however, lower a-SWCNT-loaded electrodes had excellent cyclic stability. These results suggest that the a-SWCNT-coated RVC electrodes have promise as an effective technology for desalination. PMID:29301258

  18. An In Vivo Study of Low-Dose Intra-Articular Tranexamic Acid Application with Prolonged Clamping Drain Method in Total Knee Replacement: Clinical Efficacy and Safety

    Directory of Open Access Journals (Sweden)

    Paphon Sa-ngasoongsong

    2015-01-01

    Full Text Available Background. Recently, combined intra-articular tranexamic acid (IA-TXA injection with clamping drain method showed efficacy for blood loss and transfusion reduction in total knee replacement (TKR. However, until now, none of previous studies revealed the effect of this technique on pharmacokinetics, coagulation, and fibrinolysis. Materials and Methods. An experimental study was conducted, during 2011-2012, in 30 patients undergoing unilateral TKR. Patients received IA-TXA application and then were allocated into six groups regarding clamping drain duration (2-, 4-, 6-, 8-, 10-, and 12-hours. Blood and drainage fluid were collected to measure tranexamic acid (TXA level and related coagulation and fibrinolytic markers. Postoperative complication was followed for one year. Results. There was no significant difference of serum TXA level at 2 hour and 24 hour among groups (p<0.05. Serum TXA level at time of clamp release was significantly different among groups with the highest level at 2 hour (p<0.0001. There was no significant difference of TXA level in drainage fluid, postoperative blood loss, blood transfusion, and postoperative complications (p<0.05.  Conclusions. Low-dose IA-TXA application in TKR with prolonged clamping drain method is a safe and effective blood conservative technique with only minimal systemic absorption and without significant increase in systemic absorption over time.

  19. Current voltage perspective of an organic electronic device

    Science.gov (United States)

    Mukherjee, Ayash K.; Kumari, Nikita

    2018-05-01

    Nonlinearity in current (I) - voltage (V) measurement is a well-known attribute of two-terminal organic device, irrespective of the geometrical or structural arrangement of the device. Most of the existing theories that are developed for interpretation of I-V data, either focus current-voltage relationship of charge injection mechanism across the electrode-organic material interface or charge transport mechanism through the organic active material. On the contrary, both the mechanisms work in tandem charge conduction through the device. The transport mechanism is further complicated by incoherent scattering from scattering centres/charge traps that are located at the electrode-organic material interface and in the bulk of organic material. In the present communication, a collective expression has been formulated that comprises of all the transport mechanisms that are occurring at various locations of a planar organic device. The model has been fitted to experimental I-V data of Au/P3HT/Au device with excellent degree of agreement. Certain physical parameters such as the effective area of cross-section and resistance due to charge traps have been extracted from the fit.

  20. Water Treatment Using Plasma Discharge with Variation of Electrode Materials

    Science.gov (United States)

    Chanan, N.; Kusumandari; Saraswati, T. E.

    2018-03-01

    This research studied water treatment using plasma discharge. Plasma generated in this study produced active species that played a role in organic compound decomposition. The plasma reactor consisted of two needle electrodes made from stainless steel, tungsten, aluminium and grafit. It placed approximately 2 mm above the solution and connected with high-AC voltage. A solution of methylene blue used as an organic solution model. Plasma treatment times were 2, 4, 6, 8 and 10 min. The absorbance, temperature and pH of the solution were measured before and after treatment using various electrodes. The best electrode used in plasma discharging for methylene blue absorbance reduction was the graphite electrode, which provided the highest degradation efficiency of 98% at 6 min of treatment time.

  1. A comparison of two patient friendly ERG electrodes

    International Nuclear Information System (INIS)

    Hidajat, R.; McLay, J.; Elder, M.; Burley, C.; Goode, D.; Morton, J.

    2000-01-01

    Full text: The ideal electroretinography (ERG) electrode should provide reproducible waveforms, maximal amplitudes and minimal irritation of the patient's eyes. Contact lens electrodes (e.g. Burian-Allen, ERG jet) generate large amplitudes but are very uncomfortable and quite intimidating for the patient. Two other types, the gold foil and the H-K loop, provide a much more patient friendly alternative at the cost of somewhat reduced amplitudes. With the purchase of a new Nicolet Bravo electrodiagnostic system we had to select a suitable type of ERG electrode and establish the normal range for each ERG test with that electrode. It was decided to trial two electrodes, the gold foil (CH Electronics, UK) and the H-K loop (Avanta, Slovenia) before making the final choice. Seventeen normal volunteers, ranging in age from 14 to 56 years, were subjected to three standard measurements namely the flash photopic, white flash scotopic and transient pattern (PERG) ERG. Each test followed the guidelines set by the International Society for Clinical Electrophysiology of Vision (ISCEV). Before starting the measurements both eyes were anaesthetised with Ophthetic and for the flash ERG's the pupils were dilated with 1% Tropicamide. Immediately after the measurements each subject was asked which electrode was most comfortable. As specified by ISCEV the amplitudes were measured between adjacent troughs and peaks. The mean and standard deviation of the flash ERG b wave and the PERG P 50 amplitudes for each electrode are shown m the accompanying table together with the mean and standard deviation of the ratios of the amplitudes (gold foil/H-K loop) from each subject. It can be seen that the amplitudes measured with the gold foil electrodes are approximately twice those from the H-K loop and that the fractional variation (standard deviation/mean) of the gold foil amplitudes is also lower. In addition nearly all the subjects (13/17) felt less discomfort with the gold foil electrodes, only

  2. The Investigation of the Corrosion Resistance of the Tension Clamps Skl14

    Directory of Open Access Journals (Sweden)

    Marek Pětioký

    2015-05-01

    Full Text Available At the level crossings it is possible to find the problems with the corrosion of the parts of the fastening system. These problems are especially at the rubber level crossings and in the tunnels. As a part of the thesis the problem of the corrosion of the tension clamp Skl14 of the producer Vossloh at the rubber level crossings is examined. For the purposes of the comparison the tension clamps without the corrosion protection and the tension clamps with the corrosion protection KTL were examined. As a first step the corrosion features of the tension clamps Skl14 were solved. The examination was divided into two parts. First part it was the examination according to ČSN EN ISO 9227. The samples of the tension clamps were putted into the corrosion chamber. After 1728 h the results of the corrosion impacts were not satisfied. It was decided for the second step of the examination. It was the immersion in an electrolyte solution. As a result of the paper the corrosion features of the tension clamps without the corrosion protection and with the corrosion protection are compared.

  3. Co-axial electrodes gun characteristics

    International Nuclear Information System (INIS)

    Masoud, M.M.; Soliman, H.M.

    1981-01-01

    A coaxial electrodes gun is constructed with inner electrode diameter of 3.2 cm; outer electrode diameter of 6.6 cm and length of 25 cm it is connected to a condenser bank which delivers 4 K joule stored energy. The maximum power of the discharge is equal to 4.5x10 4 K watt; for 5 KV charging voltage. The inductance showed two main peak values of 0.257μH and 0.27μH. Theoretical calculations using one-dimension-single fluid model is μ sed, which shows that the maximum acceleration is at 0.5 sec, and the gas breakdown takes place at the gun breech; at the start of the discharge, will leave the gun after 1.625μ sec, also the drift velocity, the force and the magnetic field are given. The measured results show quite reasonable agreement with the calculations for most of the results, and the position of the plasma sheath inside the gun slightly deviated from the theoretical calculations due to viscosity and wall interaction, as well as other parameters which did not be take into consideration. The plasma current density of the sheath has its maximum value at Z=18 cm, the plasma will leave the coaxial source after 1.5μ sec, from the start of the discharge, which conferms with the theoretical model. Resistance of the gas between the electrodes, changes with time according to the particle injected from this source, and the maximum efficiency of the installation for charging voltage 5kV and pressure 80μ Hg is at approx.=10μ sec and 20.5μ sec

  4. Dioxythiophene-based polymer electrodes for supercapacitor modules.

    Science.gov (United States)

    Liu, David Y; Reynolds, John R

    2010-12-01

    We report on the electrochemical and capacitive behaviors of poly(2,2-dimethyl-3,4-propylene-dioxythipohene) (PProDOT-Me2) films as polymeric electrodes in Type I electrochemical supercapacitors. The supercapacitor device displays robust capacitive charging/discharging behaviors with specific capacitance of 55 F/g, based on 60 μg of PProDOT-Me2 per electrode, that retains over 85% of its storage capacity after 32 000 redox cycles at 78% depth of discharge. Moreover, an appreciable average energy density of 6 Wh/kg has been calculated for the device, along with well-behaved and rapid capacitive responses to 1.0 V between 5 to 500 mV s(-1). Tandem electrochemical supercapacitors were assembled in series, in parallel, and in combinations of the two to widen the operating voltage window and to increase the capacitive currents. Four supercapacitors coupled in series exhibited a 4.0 V charging/discharging window, whereas assembly in parallel displayed a 4-fold increase in capacitance. Combinations of both serial and parallel assembly with six supercapacitors resulted in the extension of voltage to 3 V and a 2-fold increase in capacitive currents. Utilization of bipolar electrodes facilitated the encapsulation of tandem supercapacitors as individual, flexible, and lightweight supercapacitor modules.

  5. Role of Ti and Pt electrodes on resistance switching variability of HfO2-based Resistive Random Access Memory

    International Nuclear Information System (INIS)

    Cabout, T.; Buckley, J.; Cagli, C.; Jousseaume, V.; Nodin, J.-F.; Salvo, B. de; Bocquet, M.; Muller, Ch.

    2013-01-01

    This paper deals with the role of platinum or titanium–titanium nitride electrodes on variability of resistive switching characteristics and electrical performances of HfO 2 -based memory elements. Capacitor-like Pt/HfO 2 (10 nm)/Pt and Ti/HfO 2 (10 nm)/TiN structures were fabricated on top of a tungsten pillar bottom electrode and integrated in-between two interconnect metal lines. First, quasi-static measurements were performed to apprehend the role of electrodes on electroforming, set and reset operations and their corresponding switching parameters. Memory elements with Pt as top and bottom electrodes exhibited a non-polar behavior with sharp decrease of current during reset operation while Ti/HfO 2 /TiN capacitors showed a bipolar switching behavior, with a gradual reset. In a second step, statistical distributions of switching parameters (voltage and resistance) were extracted from data obtained on few hundreds of capacitors. Even if the resistance in low resistive state and reset voltage was found to be comparable for both types of electrodes, the progressive reset operation observed on samples with Ti/TiN electrodes led to a lower variability of resistance in high resistive state and concomitantly of set voltage. In addition Ti–TiN electrodes enabled gaining: (i) lower forming and set voltages with significantly narrower capacitor-to-capacitor distributions; (ii) a better data retention capability (10 years at 65 °C instead of 10 years at 50 °C for Pt electrodes); (iii) satisfactory dynamic performances with lower set and reset voltages for ramp speed ranging from 10 −2 to 10 7 V/s. The significant improvement of switching behavior with Ti–TiN electrodes is mainly attributed to the formation of a native interface layer between HfO 2 oxide and Ti top electrode. - Highlights: ► HfO2 based capacitor-like structures were fabricated with Pt and Ti based electrodes. ► Influence of electrode materials on switching parameter variability is assessed.

  6. A High-Voltage Integrated Circuit Engine for a Dielectrophoresis-based Programmable Micro-Fluidic Processor

    Science.gov (United States)

    Current, K. Wayne; Yuk, Kelvin; McConaghy, Charles; Gascoyne, Peter R. C.; Schwartz, Jon A.; Vykoukal, Jody V.; Andrews, Craig

    2010-01-01

    A high-voltage (HV) integrated circuit has been demonstrated to transport droplets on programmable paths across its coated surface. This chip is the engine for a dielectrophoresis (DEP)-based micro-fluidic lab-on-a-chip system. This chip creates DEP forces that move and help inject droplets. Electrode excitation voltage and frequency are variable. With the electrodes driven with a 100V peak-to-peak periodic waveform, the maximum high-voltage electrode waveform frequency is about 200Hz. Data communication rate is variable up to 250kHz. This demonstration chip has a 32×32 array of nominally 100V electrode drivers. It is fabricated in a 130V SOI CMOS fabrication technology, dissipates a maximum of 1.87W, and is about 10.4 mm × 8.2 mm. PMID:23989241

  7. Dual-layer electrode-driven liquid crystal lens with electrically tunable focal length and focal plane

    Science.gov (United States)

    Zhang, Y. A.; Lin, C. F.; Lin, J. P.; Zeng, X. Y.; Yan, Q.; Zhou, X. T.; Guo, T. L.

    2018-04-01

    Electric-field-driven liquid crystal (ELC) lens with tunable focal length and their depth of field has been extensively applied in 3D display and imaging systems. In this work, a dual-layer electrode-driven liquid crystal (DELC) lens with electrically tunable focal length and controllable focal plane is demonstrated. ITO-SiO2-AZO electrodes with the dual-layer staggered structure on the top substrate are used as driven electrodes within a LC cell, which permits the establishment of an alternative controllability. The focal length of the DELC lens can be adjusted from 1.41 cm to 0.29 cm when the operating voltage changes from 15 V to 40 V. Furthermore, the focal plane of the DELC lens can selectively move by changing the driving method of the applied voltage to the next driven electrodes. This work demonstrates that the DELC lens has potential applications in imaging systems because of electrically tunable focal length and controllable focal plane.

  8. Advanced Control of the Dynamic Voltage Restorer for Mitigating Voltage Sags in Power Systems

    Directory of Open Access Journals (Sweden)

    Dung Vo Tien

    2018-01-01

    Full Text Available The paper presents a vector control with two cascaded loops to improve the properties of Dynamic Voltage Restorer (DVR to minimize Voltage Sags on the grid. Thereby, a vector controlled structure was built on the rotating dq-coordinate system with the combination of voltage control and the current control. The proposed DVR control method is modelled using MATLAB-Simulink. It is tested using balanced/unbalanced voltage sags as well as fluctuant and distorted voltages. As a result, by using this controlling method, the dynamic characteristics of the system have been improved significantly. The system performed with higher accuracy, faster response and lower distortion in the voltage sags compensation. The paper presents real time experimental results to verify the performance of the proposed method in real environments.

  9. Direct model-based predictive control scheme without cost function for voltage source inverters with reduced common-mode voltage

    Science.gov (United States)

    Kim, Jae-Chang; Moon, Sung-Ki; Kwak, Sangshin

    2018-04-01

    This paper presents a direct model-based predictive control scheme for voltage source inverters (VSIs) with reduced common-mode voltages (CMVs). The developed method directly finds optimal vectors without using repetitive calculation of a cost function. To adjust output currents with the CMVs in the range of -Vdc/6 to +Vdc/6, the developed method uses voltage vectors, as finite control resources, excluding zero voltage vectors which produce the CMVs in the VSI within ±Vdc/2. In a model-based predictive control (MPC), not using zero voltage vectors increases the output current ripples and the current errors. To alleviate these problems, the developed method uses two non-zero voltage vectors in one sampling step. In addition, the voltage vectors scheduled to be used are directly selected at every sampling step once the developed method calculates the future reference voltage vector, saving the efforts of repeatedly calculating the cost function. And the two non-zero voltage vectors are optimally allocated to make the output current approach the reference current as close as possible. Thus, low CMV, rapid current-following capability and sufficient output current ripple performance are attained by the developed method. The results of a simulation and an experiment verify the effectiveness of the developed method.

  10. An automatic method to analyze the Capacity-Voltage and Current-Voltage curves of a sensor

    CERN Document Server

    AUTHOR|(CDS)2261553

    2017-01-01

    An automatic method to perform Capacity versus voltage analysis for all kind of silicon sensor is provided. It successfully calculates the depletion voltage to unirradiated and irradiated sensors, and with measurements with outliers or reaching breakdown. It is built using C++ and using ROOT trees with an analogous skeleton as TRICS, where the data as well as the results of the ts are saved, to make further analysis.

  11. Floating electrode microelectromechanical system capacitive switches: A different actuation mechanism

    Science.gov (United States)

    Papaioannou, G.; Giacomozzi, F.; Papandreou, E.; Margesin, B.

    2011-08-01

    The paper investigates the actuation mechanism in floating electrode microelectromechanical system capacitive switches. It is demonstrated that in the pull-in state, the device operation turns from voltage to current controlled actuation. The current arises from Poole-Frenkel mechanism in the dielectric film and Fowler-Nordheim in the bridge-floating electrode air gap. The pull-out voltage seems to arise from the abrupt decrease of Fowler-Nordheim electric field intensity. This mechanism seems to be responsible for the very small difference with respect to the pull-in voltage.

  12. Negligible degradation upon in situ voltage cycling of a PEMFC using an electrospun niobium-doped tin oxide supported Pt cathode.

    Science.gov (United States)

    Savych, Iuliia; Subianto, Surya; Nabil, Yannick; Cavaliere, Sara; Jones, Deborah; Rozière, Jacques

    2015-07-14

    Novel platinum-catalysed, corrosion-resistant, loose-tube-structured electrocatalysts for proton exchange membrane fuel cells have been obtained using single-needle electrospinning associated with a microwave-assisted polyol method. Monodisperse platinum particles supported on Nb-SnO2 demonstrated higher electrochemical stability than conventional Pt/C electrodes during ex situ potential cycling and comparable activity in the oxygen reduction reaction. In situ fuel cell operation under accelerated stress test conditions of a membrane electrode assembly elaborated using a Pt/C anode and Pt/Nb-SnO2 cathode confirmed that the voltage loss is significantly lower for the novel cathode than for an MEA prepared using conventional Pt/C supported electrocatalysts. Furthermore, the Nb-SnO2 stabilised the supported platinum nanoparticles against dissolution, migration and reprecipitation in the membrane. Pt/Nb-SnO2 loose-tubes constitute a mitigation strategy for two known degradation mechanisms in PEMFC: corrosion of the carbon support at the cathode, and dissolution of Pt at high cell voltages.

  13. 21 CFR 882.4460 - Neurosurgical head holder (skull clamp).

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Neurosurgical head holder (skull clamp). 882.4460... holder (skull clamp). (a) Identification. A neurosurgical head holder (skull clamp) is a device used to clamp the patient's skull to hold head and neck in a particular position during surgical procedures. (b...

  14. Effect of pulsed corona discharge voltage and feed gas flow rate on dissolved ozone concentration

    International Nuclear Information System (INIS)

    Prasetyaningrum, A.; Ratnawati,; Jos, B.

    2015-01-01

    Ozonization is one of the methods extensively used for water purification and degradation of organic materials. Ozone (O 3 ) is recognized as a powerful oxidizing agent. Due to its strong oxidability and better environmental friendless, ozone increasing being used in domestic and industrial applications. Current technology in ozone production utilizes several techniques (corona discharge, ultra violet radiation and electrolysis). This experiment aimed to evaluating effect of voltage and gas flow rate on ozone production with corona discharge. The system consists of two net-type stainless steel electrode placed in a dielectric barrier. Three pulsed voltage (20, 30, 40 KV) and flow rate (5, 10, 15 L/min) were prepare for operation variable at high frequency (3.7 kHz) with AC pulsed power supply. The dissolved ozone concentration depends on the applied high-voltage level, gas flow rate and the discharge exposure duration. The ozone concentration increases with decreasing gas flow rate. Dissolved ozone concentrations greater than 200 ppm can be obtained with a minimum voltage 40 kV

  15. Effect of pulsed corona discharge voltage and feed gas flow rate on dissolved ozone concentration

    Science.gov (United States)

    Prasetyaningrum, A.; Ratnawati, Jos, B.

    2015-12-01

    Ozonization is one of the methods extensively used for water purification and degradation of organic materials. Ozone (O3) is recognized as a powerful oxidizing agent. Due to its strong oxidability and better environmental friendless, ozone increasing being used in domestic and industrial applications. Current technology in ozone production utilizes several techniques (corona discharge, ultra violet radiation and electrolysis). This experiment aimed to evaluating effect of voltage and gas flow rate on ozone production with corona discharge. The system consists of two net-type stainless steel electrode placed in a dielectric barrier. Three pulsed voltage (20, 30, 40 KV) and flow rate (5, 10, 15 L/min) were prepare for operation variable at high frequency (3.7 kHz) with AC pulsed power supply. The dissolved ozone concentration depends on the applied high-voltage level, gas flow rate and the discharge exposure duration. The ozone concentration increases with decreasing gas flow rate. Dissolved ozone concentrations greater than 200 ppm can be obtained with a minimum voltage 40 kV.

  16. Effect of pulsed corona discharge voltage and feed gas flow rate on dissolved ozone concentration

    Energy Technology Data Exchange (ETDEWEB)

    Prasetyaningrum, A., E-mail: ajiprasetyaningrum@gmail.com; Ratnawati,; Jos, B. [Department of Chemical Engineering, Faculty of Engineering, Diponegoro University Jl. Prof. H. Soedarto Tembalang, Semarang, Central Java, Indonesia, 50276 (Indonesia)

    2015-12-29

    Ozonization is one of the methods extensively used for water purification and degradation of organic materials. Ozone (O{sub 3}) is recognized as a powerful oxidizing agent. Due to its strong oxidability and better environmental friendless, ozone increasing being used in domestic and industrial applications. Current technology in ozone production utilizes several techniques (corona discharge, ultra violet radiation and electrolysis). This experiment aimed to evaluating effect of voltage and gas flow rate on ozone production with corona discharge. The system consists of two net-type stainless steel electrode placed in a dielectric barrier. Three pulsed voltage (20, 30, 40 KV) and flow rate (5, 10, 15 L/min) were prepare for operation variable at high frequency (3.7 kHz) with AC pulsed power supply. The dissolved ozone concentration depends on the applied high-voltage level, gas flow rate and the discharge exposure duration. The ozone concentration increases with decreasing gas flow rate. Dissolved ozone concentrations greater than 200 ppm can be obtained with a minimum voltage 40 kV.

  17. High-Efficiency Isolated Boost DCDC Converter for High-Power Low-Voltage Fuel-Cell Applications

    DEFF Research Database (Denmark)

    Nymand, Morten; Andersen, Michael A. E.

    2010-01-01

    high winding losses. The analysis of transformer leakage inductance reveals that extremely low leakage inductance can be achieved, allowing stored energy to be dissipated. Power MOSFETs fully rated for repetitive avalanches allow primary-side voltage clamp circuits to be eliminated. The oversizing...

  18. Method of preparation of carbon materials for use as electrodes in rechargeable batteries

    Science.gov (United States)

    Doddapaneni, Narayan; Wang, James C. F.; Crocker, Robert W.; Ingersoll, David; Firsich, David W.

    1999-01-01

    A method of producing carbon materials for use as electrodes in rechargeable batteries. Electrodes prepared from these carbon materials exhibit intercalation efficiencies of .apprxeq.80% for lithium, low irreversible loss of lithium, long cycle life, are capable of sustaining a high rates of discharge and are cheap and easy to manufacture. The method comprises a novel two-step stabilization process in which polymeric precursor materials are stabilized by first heating in an inert atmosphere and subsequently heating in air. During the stabilization process, the polymeric precursor material can be agitated to reduce particle fusion and promote mass transfer of oxygen and water vapor. The stabilized, polymeric precursor materials can then be converted to a synthetic carbon, suitable for fabricating electrodes for use in rechargeable batteries, by heating to a high temperature in a flowing inert atmosphere.

  19. A Comparative Study of Analog Voltage-mode Control Methods for Ultra-Fast Tracking Power Supplies

    DEFF Research Database (Denmark)

    Høyerby, Mikkel Christian Wendelboe; Andersen, Michael Andreas E.

    2007-01-01

    This paper presents a theoretical and experimental comparison of the standard PWM/PID voltage-mode control method for single-phase buck converters with two highperformance self-oscillating (a.k.a. sliding mode) control methods. The application considered is ultra-fast tracking power supplies...... (UFTPSs) for RF power amplifiers, where the switching converter needs to track a varying reference voltage precisely and quickly while maintaining low output impedance. The small-signal analyses performed on the different controllers show that the hysteretic-type controller can achieve the highest loop...

  20. Discharge Characteristics of the Nickel Hydroxide Electrode in 30% KOH

    International Nuclear Information System (INIS)

    Kim, Young Jin

    1989-01-01

    The discharge behavior of the nickel hydroxide electrode has been investigated in 30% KOH at 25 .deg. C. Two voltage plateaus are displayed on the discharge curve of C/20. It is shown that the impedance of the nickel hydroxide electrode increases with decrease of the discharge potential. The discharge behavior of the nickel hydroxide electrode has been investigated in 30% KOH indicating the reduction of the β-NiOOH to the β-Ni(OH) 2 by proton diffusion process and hence the electronic conductivity change of the nickel hydroxide electrode. Furthermore, the γ-NiOOH, produced by prolonged oxidation of the β-NiOOH in 30% KOH, discharges at a slightly lower potential than the β-Ni(OH) 2 that could result in the life-limiting factor of several alkaline electrolyte storage batteries using the nickel hydroxide electrode as the positive plate

  1. Methods and systems for in-situ electroplating of electrodes

    Science.gov (United States)

    Zappi, Guillermo Daniel; Zarnoch, Kenneth Paul; Huntley, Christian Andrew; Swalla, Dana Ray

    2015-06-02

    The present techniques provide electrochemical devices having enhanced electrodes with surfaces that facilitate operation, such as by formation of a porous nickel layer on an operative surface, particularly of the cathode. The porous metal layer increases the surface area of the electrode, which may result in increasing the efficiency of the electrochemical devices. The formation of the porous metal layer is performed in situ, that is, after the assembly of the electrodes into an electrochemical device. The in situ process offers a number of advantages, including the ability to protect the porous metal layer on the electrode surface from damage during assembly of the electrochemical device. The enhanced electrode and the method for its processing may be used in any number of electrochemical devices, and is particularly well suited for electrodes in an electrolyzer useful for splitting water into hydrogen and oxygen.

  2. Simulation of the build-up phase of a high voltage low pressure gas discharge using Monte-Carlo-methods

    International Nuclear Information System (INIS)

    Niessen, W.

    1990-02-01

    In this report the simulation of a Pseudospark predischarge between anode and cathode using Monte-Carlo-Methods is described. In the early phase of the discharge electric and magnetic self-fields can be neglected. The model is based on a discharge between two infinitely extended capacitor plates. Eleven different collision reactions and two electrode surface effects are taken into account. A Fortran program was developed that computes the built-up of the discharge in time and space. A specially of the code is, that not only electrons and ions are taken into account, but also fast neutral atoms and molecules. Three pairs of diode-length and voltage were investigated at different pressures: 350 kV/5.0 cm, 30 kV/10.0 cm and 6.9 kV/0.7 cm. The working gas was hydrogen. The computations included: The Paschen-curve, the time evolution of the current densities of the electrons at the anode and the ions at the cathode, the space- and time-dependent particle densities, the time-dependent energy distributions of the different particle species, the relative number of the different collision reactions. (orig./HSI) [de

  3. Supercapacitors based on two dimensional VO2 nanosheet electrodes in organic gel electrolyte

    KAUST Repository

    Rakhi, R.B.

    2016-10-16

    VO2 is a low band-gap semiconductor with relatively high conductivity among transition metal oxides, which makes it an interesting material for supercapacitor electrode applications. The performance of VO2 as supercapacitor electrode in organic electrolytes has never been reported before. Herein, two-dimensional nanosheets of VO2 are prepared by the simultaneous solution reduction and exfoliation from bulk V2O5 powder by hydrothermal method. A specific capacitance of 405 Fg−1 is achieved for VO2 based supercapacitor in an organic electrolyte, in three electrode configuration. The symmetric capacitor based on VO2 nanosheet electrodes and the liquid organic electrolyte exhibits an energy density of 46 Wh kg−1 at a power density of 1.4 kW kg−1 at a constant current density of 1 Ag−1. Furthermore, flexible solid-state supercapacitors are fabricated using same electrode material and Alumina-silica based gel electrolyte. The solid-state device delivers a specific capacitance of 145 Fg−1 and a device capacitance of 36 Fg−1 at a discharge current density of 1 Ag−1. Series combination of three solid state capacitors is capable of lighting up a red LED for more than 1 minute.

  4. Scorpion β-toxin interference with NaV channel voltage sensor gives rise to excitatory and depressant modes

    Science.gov (United States)

    Leipold, Enrico; Borges, Adolfo

    2012-01-01

    Scorpion β toxins, peptides of ∼70 residues, specifically target voltage-gated sodium (NaV) channels to cause use-dependent subthreshold channel openings via a voltage–sensor trapping mechanism. This excitatory action is often overlaid by a not yet understood depressant mode in which NaV channel activity is inhibited. Here, we analyzed these two modes of gating modification by β-toxin Tz1 from Tityus zulianus on heterologously expressed NaV1.4 and NaV1.5 channels using the whole cell patch-clamp method. Tz1 facilitated the opening of NaV1.4 in a use-dependent manner and inhibited channel opening with a reversed use dependence. In contrast, the opening of NaV1.5 was exclusively inhibited without noticeable use dependence. Using chimeras of NaV1.4 and NaV1.5 channels, we demonstrated that gating modification by Tz1 depends on the specific structure of the voltage sensor in domain 2. Although residue G658 in NaV1.4 promotes the use-dependent transitions between Tz1 modification phenotypes, the equivalent residue in NaV1.5, N803, abolishes them. Gating charge neutralizations in the NaV1.4 domain 2 voltage sensor identified arginine residues at positions 663 and 669 as crucial for the outward and inward movement of this sensor, respectively. Our data support a model in which Tz1 can stabilize two conformations of the domain 2 voltage sensor: a preactivated outward position leading to NaV channels that open at subthreshold potentials, and a deactivated inward position preventing channels from opening. The results are best explained by a two-state voltage–sensor trapping model in that bound scorpion β toxin slows the activation as well as the deactivation kinetics of the voltage sensor in domain 2. PMID:22450487

  5. Optical and Electrical Performance of MOS-Structure Silicon Solar Cells with Antireflective Transparent ITO and Plasmonic Indium Nanoparticles under Applied Bias Voltage.

    Science.gov (United States)

    Ho, Wen-Jeng; Sue, Ruei-Siang; Lin, Jian-Cheng; Syu, Hong-Jang; Lin, Ching-Fuh

    2016-08-10

    This paper reports impressive improvements in the optical and electrical performance of metal-oxide-semiconductor (MOS)-structure silicon solar cells through the incorporation of plasmonic indium nanoparticles (In-NPs) and an indium-tin-oxide (ITO) electrode with periodic holes (perforations) under applied bias voltage. Samples were prepared using a plain ITO electrode or perforated ITO electrode with and without In-NPs. The samples were characterized according to optical reflectance, dark current voltage, induced capacitance voltage, external quantum efficiency, and photovoltaic current voltage. Our results indicate that induced capacitance voltage and photovoltaic current voltage both depend on bias voltage, regardless of the type of ITO electrode. Under a bias voltage of 4.0 V, MOS cells with perforated ITO and plain ITO, respectively, presented conversion efficiencies of 17.53% and 15.80%. Under a bias voltage of 4.0 V, the inclusion of In-NPs increased the efficiency of cells with perforated ITO and plain ITO to 17.80% and 16.87%, respectively.

  6. Optical and Electrical Performance of MOS-Structure Silicon Solar Cells with Antireflective Transparent ITO and Plasmonic Indium Nanoparticles under Applied Bias Voltage

    Directory of Open Access Journals (Sweden)

    Wen-Jeng Ho

    2016-08-01

    Full Text Available This paper reports impressive improvements in the optical and electrical performance of metal-oxide-semiconductor (MOS-structure silicon solar cells through the incorporation of plasmonic indium nanoparticles (In-NPs and an indium-tin-oxide (ITO electrode with periodic holes (perforations under applied bias voltage. Samples were prepared using a plain ITO electrode or perforated ITO electrode with and without In-NPs. The samples were characterized according to optical reflectance, dark current voltage, induced capacitance voltage, external quantum efficiency, and photovoltaic current voltage. Our results indicate that induced capacitance voltage and photovoltaic current voltage both depend on bias voltage, regardless of the type of ITO electrode. Under a bias voltage of 4.0 V, MOS cells with perforated ITO and plain ITO, respectively, presented conversion efficiencies of 17.53% and 15.80%. Under a bias voltage of 4.0 V, the inclusion of In-NPs increased the efficiency of cells with perforated ITO and plain ITO to 17.80% and 16.87%, respectively.

  7. KCNQ1 channel modulation by KCNE proteins via the voltage-sensing domain.

    Science.gov (United States)

    Nakajo, Koichi; Kubo, Yoshihiro

    2015-06-15

    The gating of the KCNQ1 potassium channel is drastically regulated by auxiliary subunit KCNE proteins. KCNE1, for example, slows the activation kinetics of KCNQ1 by two orders of magnitude. Like other voltage-gated ion channels, the opening of KCNQ1 is regulated by the voltage-sensing domain (VSD; S1-S4 segments). Although it has been known that KCNE proteins interact with KCNQ1 via the pore domain, some recent reports suggest that the VSD movement may be altered by KCNE. The altered VSD movement of KCNQ1 by KCNE proteins has been examined by site-directed mutagenesis, the scanning cysteine accessibility method (SCAM), voltage clamp fluorometry (VCF) and gating charge measurements. These accumulated data support the idea that KCNE proteins interact with the VSDs of KCNQ1 and modulate the gating of the KCNQ1 channel. In this review, we will summarize recent findings and current views of the KCNQ1 modulation by KCNE via the VSD. In this context, we discuss our recent findings that KCNE1 may alter physical interactions between the S4 segment (VSD) and the S5 segment (pore domain) of KCNQ1. Based on these findings from ourselves and others, we propose a hypothetical mechanism for how KCNE1 binding alters the VSD movement and the gating of the channel. © 2015 The Authors. The Journal of Physiology © 2015 The Physiological Society.

  8. A method of accurate determination of voltage stability margin

    Energy Technology Data Exchange (ETDEWEB)

    Wiszniewski, A.; Rebizant, W. [Wroclaw Univ. of Technology, Wroclaw (Poland); Klimek, A. [AREVA Transmission and Distribution, Stafford (United Kingdom)

    2008-07-01

    In the process of developing power system disturbance, voltage instability at the receiving substations often contributes to deteriorating system stability, which eventually may lead to severe blackouts. The voltage stability margin at receiving substations may be used to determine measures to prevent voltage collapse, primarily by operating or blocking the transformer tap changing device, or by load shedding. The best measure of the stability margin is the actual load to source impedance ratio and its critical value, which is unity. This paper presented an accurate method of calculating the load to source impedance ratio, derived from the Thevenin's equivalent circuit of the system, which led to calculation of the stability margin. The paper described the calculation of the load to source impedance ratio including the supporting equations. The calculation was based on the very definition of voltage stability, which says that system stability is maintained as long as the change of power, which follows the increase of admittance is positive. The testing of the stability margin assessment method was performed in a simulative way for a number of power network structures and simulation scenarios. Results of the simulations revealed that this method is accurate and stable for all possible events occurring downstream of the device location. 3 refs., 8 figs.

  9. New perspectives in vacuum high voltage insulation. II. Gas desorption

    CERN Document Server

    Diamond, W T

    1998-01-01

    An examination has been made of gas desorption from unbaked electrodes of copper, niobium, aluminum, and titanium subjected to high voltage in vacuum. It has been shown that the gas is composed of water vapor, carbon monoxide, and carbon dioxide, the usual components of vacuum outgassing, plus an increased yield of hydrogen and light hydrocarbons. The gas desorption was driven by anode conditioning as the voltage was increased between the electrodes. The gas is often desorbed as microdischarges-pulses of a few to hundreds of microseconds-and less frequently in a more continuous manner without the obvious pulsed structure characteristic of microdischarge activity. The quantity of gas released was equivalent to many monolayers and consisted mostly of neutral molecules with an ionic component of a few percent. A very significant observation was that the gas desorption was more dependent on the total voltage between the electrodes than on the electric field. It was not triggered by field-emitted electrons but oft...

  10. New method for determining avalanche breakdown voltage of silicon photomultipliers

    International Nuclear Information System (INIS)

    Chirikov-Zorin, I.

    2017-01-01

    The avalanche breakdown and Geiger mode of the silicon p-n junction is considered. A precise physically motivated method is proposed for determining the avalanche breakdown voltage of silicon photomultipliers (SiPM). The method is based on measuring the dependence of the relative photon detection efficiency (PDE rel ) on the bias voltage when one type of carriers (electron or hole) is injected into the avalanche multiplication zone of the p-n junction. The injection of electrons or holes from the base region of the SiPM semiconductor structure is performed using short-wave or long-wave light. At a low overvoltage (1-2 V) the detection efficiency is linearly dependent on the bias voltage; therefore, extrapolation to zero PDE rel value determines the SiPM avalanche breakdown voltage with an accuracy within a few millivolts. [ru

  11. Influence of nitrogen dopants on N-doped TiO2 electrodes and their applications in dye-sensitized solar cells

    International Nuclear Information System (INIS)

    Guo Wei; Shen Yihua; Boschloo, Gerrit; Hagfeldt, Anders; Ma Tingli

    2011-01-01

    Highlights: → Three different types of nanocrystalline N-doped TiO 2 synthesized by several nitrogen dopants. → N-doped DSCs achieves a high conversion efficiency of 8.32%. → Ammonia acts as good nitrogen dopants. → Enhanced photocurrent of ca. 36% in N-doped DSCs. → Less charge are needed to get a high open-circuit voltage in N-doped films. - Abstract: Three different types of nanocrystalline, N-doped TiO 2 electrodes were synthesized using several nitrogen dopants through wet methods. The obtained nanocrystalline, N-doped TiO 2 electrodes possessed different crystallite sizes, surface areas, and N-doping amounts. Characterizations were performed to reveal the nitrogen-doping processes for the wet methods using ammonia, urea, and triethylamine as the nitrogen dopants. Additionally, a high conversion efficiency of 8.32% was achieved by the dye-sensitized solar cells, based on the N-doped TiO 2 electrodes. For instance, in comparison with the commercial P25 (5.76%) and pure anatase TiO 2 electrodes (7.14%), significant improvements (44% and 17%, respectively) in the efficiencies were obtained. The findings also indicated that the ammonia nitrogen dopant was more efficient than other two nitrogen dopants. The electron transports, electron lifetimes, and charge recombination in the dye-sensitized N-doped TiO 2 solar cells also differed from those in the pure TiO 2 -based dye-sensitized solar cells (DSCs). Specifically, an enhanced photocurrent of ca. 36% in N-doped DSCs resulted from the synergistic effects of the high dye uptake and the efficient electron transport. Moreover, the relationship between charge and voltage revealed that less charge was needed to get a high open-circuit voltage in the N-doping films.

  12. Method of making a multi-electrode double layer capacitor having single electrolyte seal and aluminum-impregnated carbon cloth electrodes

    Science.gov (United States)

    Farahmandi, C. Joseph; Dispennette, John M.; Blank, Edward; Kolb, Alan C.

    2002-09-17

    A single cell, multi-electrode high performance double layer capacitor includes first and second flat stacks of electrodes adapted to be housed in a closeable two-part capacitor case which includes only a single electrolyte seal. Each electrode stack has a plurality of electrodes connected in parallel, with the electrodes of one stack being interleaved with the electrodes of the other stack to form an interleaved stack, and with the electrodes of each stack being electrically connected to respective capacitor terminals. A porous separator is positioned against the electrodes of one stack before interleaving to prevent electrical shorts between the electrodes. The electrodes are made by folding a compressible, low resistance, aluminum-impregnated carbon cloth, made from activated carbon fibers, around a current collector foil, with a tab of the foils of each electrode of each stack being connected in parallel and connected to the respective capacitor terminal. The height of the interleaved stack is somewhat greater than the inside height of the closed capacitor case, thereby requiring compression of the interleaved electrode stack when placed inside of the case, and thereby maintaining the interleaved electrode stack under modest constant pressure. The closed capacitor case is filled with an electrolytic solution and sealed. A preferred electrolytic solution is made by dissolving an appropriate salt into acetonitrile (CH.sub.3 CN). In one embodiment, the two parts of the capacitor case are conductive and function as the capacitor terminals.

  13. Oxidation of S(IV) in Seawater by Pulsed High Voltage Discharge Plasma with TiO2/Ti Electrode as Catalyst

    Science.gov (United States)

    Gong, Jianying; Zhang, Xingwang; Wang, Xiaoping; Lei, Lecheng

    2013-12-01

    Oxidation of S(IV) to S(VI) in the effluent of a flue gas desulfurization(FGD) system is very critical for industrial applications of seawater FGD. This paper reports a pulsed corona discharge oxidation process combined with a TiO2 photocatalyst to convert S(IV) to S(VI) in artificial seawater. Experimental results show that the oxidation of S(IV) in artificial seawater is enhanced in the pulsed discharge plasma process through the application of TiO2 coating electrodes. The oxidation rate of S(IV) using Ti metal as a ground electrode is about 2.0×10-4 mol · L-1 · min-1, the oxidation rate using TiO2/Ti electrode prepared by annealing at 500°C in air is 4.5×10-4 mol · L-1 · min-1, an increase with a factor 2.25. The annealing temperature for preparing TiO2/Ti electrode has a strong effect on the oxidation of S(IV) in artificial seawater. The results of in-situ emission spectroscopic analysis show that chemically active species (i.e. hydroxyl radicals and oxygen radicals) are produced in the pulsed discharge plasma process. Compared with the traditional air oxidation process and the sole plasma-induced oxidation process, the combined application of TiO2 photocatalysts and a pulsed high-voltage electrical discharge process is useful in enhancing the energy and conversion efficiency of S(IV) for the seawater FGD system.

  14. Synthesis and characterization of DSSC by using Pt nano-counter electrode: photosensor applications

    Science.gov (United States)

    Yahia, I. S.; AlFaify, S.; Al-ghamdi, Attieh A.; Hafez, Hoda S.; EL-Bashir, S.; Al-Bassam, A.; El-Naggar, A. M.; Yakuphanoglu, F.

    2016-06-01

    Pt electrode prepared by chemical method has been employed as counter electrode in dye-sensitized solar cell. TiO2 nanomaterial was deposited on fluorine-doped tin oxide substrate to be used as photoanode. Structure of the TiO2 and Pt films was investigated by atomic force microscope. The effect of illumination intensity on the photovoltaic parameters such as open circuit voltage, short circuit current density, output power, fill factor and efficiency of these cells was investigated in the range 2.5-130 mW/cm-2. The cell efficiency is stable above 70 mW/cm2. The fill factor is almost constant all over the studied range of illumination intensity. Impedance spectroscopy of the studied device as the summary measurements of the capacitance-voltage, conductance-voltage and series resistance-voltage characteristics were investigated in a wide range of frequencies (5 kHz-1 MHz). At low frequencies, the capacitance has positive values with peak around the origin due to the interfaces. At 200 and 300 kHz, the capacitance is inverted to negative with further increasing of the positive biasing voltage. Above 400 kHz, C-V profile shows complete negative behavior. Also, the impedance-voltage and phase-voltage characteristics were investigated. This cell shows a new promising device for photosensor applications due to high sensitivity in low and high illuminations.

  15. An In Vivo Study of Low-Dose Intra-Articular Tranexamic Acid Application with Prolonged Clamping Drain Method in Total Knee Replacement: Clinical Efficacy and Safety.

    Science.gov (United States)

    Sa-ngasoongsong, Paphon; Chanplakorn, Pongsthorn; Wongsak, Siwadol; Uthadorn, Krisorn; Panpikoon, Tanapong; Jittorntam, Paisan; Aryurachai, Katcharin; Angchaisukisiri, Pantap; Kawinwonggowit, Viroj

    2015-01-01

    Recently, combined intra-articular tranexamic acid (IA-TXA) injection with clamping drain method showed efficacy for blood loss and transfusion reduction in total knee replacement (TKR). However, until now, none of previous studies revealed the effect of this technique on pharmacokinetics, coagulation, and fibrinolysis. An experimental study was conducted, during 2011-2012, in 30 patients undergoing unilateral TKR. Patients received IA-TXA application and then were allocated into six groups regarding clamping drain duration (2-, 4-, 6-, 8-, 10-, and 12-hours). Blood and drainage fluid were collected to measure tranexamic acid (TXA) level and related coagulation and fibrinolytic markers. Postoperative complication was followed for one year. There was no significant difference of serum TXA level at 2 hour and 24 hour among groups (p application in TKR with prolonged clamping drain method is a safe and effective blood conservative technique with only minimal systemic absorption and without significant increase in systemic absorption over time.

  16. Determination of the cathode and anode voltage drops in high power low-pressure amalgam lamps

    International Nuclear Information System (INIS)

    Vasilyak, L. M.; Vasiliev, A. I.; Kostyuchenko, S. V.; Sokolov, D. V.; Startsev, A. Yu.; Kudryavtsev, N. N.

    2011-01-01

    For the first time, cathode and anode drops of powerful low-pressure amalgam lamps were measured. The lamp discharge current is 3.2 A, discharge current frequency is 43 kHz, linear electric power is 2.4 W/cm. The method of determination of a cathode drop is based on the change of a lamp operating voltage at variation of the electrode filament current at constant discharge current. The total (cathode plus anode) drop of voltage was measured by other, independent ways. The maximum cathode fall is 10.8 V; the anode fall corresponding to the maximal cathode fall is 2.4 V. It is shown that in powerful low pressure amalgam lamps the anode fall makes a considerable contribution (in certain cases, the basic one) to heating of electrodes. Therefore, the anode fall cannot be neglected, at design an electrode and ballast of amalgam lamps with operating discharge current frequency of tens of kHz.

  17. Determination of the cathode and anode voltage drops in high power low-pressure amalgam lamps

    Energy Technology Data Exchange (ETDEWEB)

    Vasilyak, L. M., E-mail: vasilyak@ihed.ras.ru [Russian Academy of Sciences, Joint Institute for High Temperatures (Russian Federation); Vasiliev, A. I., E-mail: vasiliev@npo.lit.ru; Kostyuchenko, S. V.; Sokolov, D. V.; Startsev, A. Yu. [Joint Stock Company NPO LIT (Russian Federation); Kudryavtsev, N. N. [Moscow Institute of Physics and Technology (State University) (Russian Federation)

    2011-12-15

    For the first time, cathode and anode drops of powerful low-pressure amalgam lamps were measured. The lamp discharge current is 3.2 A, discharge current frequency is 43 kHz, linear electric power is 2.4 W/cm. The method of determination of a cathode drop is based on the change of a lamp operating voltage at variation of the electrode filament current at constant discharge current. The total (cathode plus anode) drop of voltage was measured by other, independent ways. The maximum cathode fall is 10.8 V; the anode fall corresponding to the maximal cathode fall is 2.4 V. It is shown that in powerful low pressure amalgam lamps the anode fall makes a considerable contribution (in certain cases, the basic one) to heating of electrodes. Therefore, the anode fall cannot be neglected, at design an electrode and ballast of amalgam lamps with operating discharge current frequency of tens of kHz.

  18. Voltage optimization of a 4-element injection lens on a hemispherical spectrograph with virtual entry aperture

    Energy Technology Data Exchange (ETDEWEB)

    Martínez, G.; Fernández-Martín, M. [Dept. Física Aplicada III, Facultad de Física, UCM, 28040 Madrid (Spain); Sise, O. [Dept. of Science Education, Faculty of Education, Suleyman Demirel University, 32260 Isparta (Turkey); Madesis, I.; Dimitriou, A. [Dept. of Physics, University of Crete, P.O. Box 2208, GR 71003 Heraklion, Crete (Greece); Tandem Accelerator Laboratory, INPP, NCSR Demokritos, GR 15310 Agia Paraskevi (Greece); Laoutaris, A. [Dept. of Applied Physics, National Technical University of Athens, GR 15780 Zografou (Greece); Zouros, T.J.M. [Dept. of Physics, University of Crete, P.O. Box 2208, GR 71003 Heraklion, Crete (Greece); Tandem Accelerator Laboratory, INPP, NCSR Demokritos, GR 15310 Agia Paraskevi (Greece)

    2016-02-15

    We present simulation results for a biased paracentric hemispherical deflector analyzer equipped with a 4-element input lens and a position sensitive detector used in our zero-degree Auger projectile spectroscopy apparatus. Calculations of electron trajectories traversing the lens and analyzer fields were performed and cross checked using both boundary-element and finite-difference methods. The two middle lens electrode voltages were varied as free parameters, while various criteria were used to select their optimal values in an effort to obtain improved energy resolution.

  19. Active voltage contrast imaging of cross-sectional surface of multilayer ceramic capacitor using helium ion microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Sakai, C., E-mail: SAKAI.Chikako@nims.go.jp; Ishida, N.; Masuda, H.; Nagano, S.; Kitahara, M.; Fujita, D. [National Institute for Materials Science, Tsukuba, Ibaraki 305-0047 (Japan); Ogata, Y. [TAIYO YUDEN CO., LTD., Takasaki-shi, Gunma 370-3347 (Japan)

    2016-08-01

    We studied active voltage contrast (AVC) imaging using helium ion microscopy (HIM). We observed secondary electron (SE) images of the cross-sectional surface of multilayer ceramic capacitors (MLCCs) with and without a voltage applied to the internal electrodes. When no voltage was applied, we obtained an image reflecting the material contrast between the Ni internal electrode region and the BaTiO{sub 3} dielectric region of the cross-sectional surface of the MLCC. When a voltage was applied, the electrical potential difference between the grounded and the positively biased internal electrodes affected the contrast (voltage contrast). Moreover, attenuation of the SE intensity from the grounded to the positively biased internal electrodes was observed in the dielectric region. Kelvin probe force microscopy (KPFM) measurements of the contact potential difference (CPD) were performed on the same sample. By using the AVC image from the HIM observation and the CPD image from the KPFM measurement, we could quantitatively evaluate the electrical potential. We think that the results of this study will lead to an expansion in the number of applications of HIM.

  20. Development of parallel-plate-based MEMS tunable capacitors with linearized capacitance–voltage response and extended tuning range

    International Nuclear Information System (INIS)

    Shavezipur, M; Nieva, P; Khajepour, A; Hashemi, S M

    2010-01-01

    This paper presents a design technique that can be used to linearize the capacitance–voltage (C–V) response and extend the tuning range of parallel-plate-based MEMS tunable capacitors beyond that of conventional designs. The proposed technique exploits the curvature of the capacitor's moving electrode which could be induced by either manipulating the stress gradients in the plate's material or using bi-layer structures. The change in curvature generates a nonlinear structural stiffness as the moving electrode undergoes out-of-plane deformation due to the actuation voltage. If the moving plate curvature is tailored such that the capacitance increment is proportional to the voltage increment, then a linear C–V response is obtained. The larger structural resistive force at higher bias voltage also delays the pull-in and increases the maximum tunability of the capacitor. Moreover, for capacitors containing an insulation layer between the two electrodes, the proposed technique completely eliminates the pull-in effect. The experimental data obtained from different capacitors fabricated using PolyMUMPs demonstrate the advantages of this design approach where highly linear C–V responses and tunabilities as high as 1050% were recorded. The design methodology introduced in this paper could be easily extended to for example, capacitive pressure and temperature sensors or infrared detectors to enhance their response characteristics.

  1. Ultrasonic cleaning of electrodes of wire chambers

    International Nuclear Information System (INIS)

    Krasnov, V.A.; Kurepin, A.B.; Razin, V.I.

    1980-01-01

    A technological process of cleaning electrodes and working volume surfaces of wire chambers from contaminations by the simultaneous mechanical action of the energy of ultrasonic oscillations and the chemical action of detergents is discussed. A device for cleaning wire electrodes of proportional chambers of 0.3x0.4 m is described. The device uses two ultrasonic generators with a total power of 0.5 kW. As a detergent use is made of a mixture of ethyl alcohol, gasoline and freon. In the process of cleaning production defects can be detected in the wire chambers which makes it possible to timely remove the defects. Measurements of the surface resistance of fiberglass laminate of printed drift chamber electrodes at a voltage of 2 kV showed that after completing the cleaning process the resistance increases 15-20%

  2. Water-activated graphite felt as a high-performance electrode for vanadium redox flow batteries

    Science.gov (United States)

    Kabtamu, Daniel Manaye; Chen, Jian-Yu; Chang, Yu-Chung; Wang, Chen-Hao

    2017-02-01

    A simple, green, novel, time-efficient, and potentially cost-effective water activation method was employed to enhance the electrochemical activity of graphite felt (GF) electrodes for vanadium redox flow batteries (VRFBs). The GF electrode prepared with a water vapor injection time of 5 min at 700 °C exhibits the highest electrochemical activity for the VO2+/VO2+ couple among all the tested electrodes. This is attributed to the small, controlled amount of water vapor that was introduced producing high contents of oxygen-containing functional groups, such as sbnd OH groups, on the surface of the GF fibers, which are known to be electrochemically active sites for vanadium redox reactions. Charge-discharge tests further confirm that only 5 min of GF water activation is required to improve the efficiency of the VRFB cell. The average coulombic efficiency, voltage efficiency, and energy efficiency are 95.06%, 87.42%, and 83.10%, respectively, at a current density of 50 mA cm-2. These voltage and energy efficiencies are determined to be considerably higher than those of VRFB cells assembled using heat-treated GF electrodes without water activation and pristine GF electrodes.

  3. Alkali metal ion battery with bimetallic electrode

    Science.gov (United States)

    Boysen, Dane A; Bradwell, David J; Jiang, Kai; Kim, Hojong; Ortiz, Luis A; Sadoway, Donald R; Tomaszowska, Alina A; Wei, Weifeng; Wang, Kangli

    2015-04-07

    Electrochemical cells having molten electrodes having an alkali metal provide receipt and delivery of power by transporting atoms of the alkali metal between electrode environments of disparate chemical potentials through an electrochemical pathway comprising a salt of the alkali metal. The chemical potential of the alkali metal is decreased when combined with one or more non-alkali metals, thus producing a voltage between an electrode comprising the molten the alkali metal and the electrode comprising the combined alkali/non-alkali metals.

  4. The Electrode Modality Development in Pulsed Electric Field Treatment Facilitates Biocellular Mechanism Study and Improves Cancer Ablation Efficacy.

    Science.gov (United States)

    Cen, Chao; Chen, Xinhua

    2017-01-01

    Pulsed electric field treatment is now widely used in diverse biological and medical applications: gene delivery, electrochemotherapy, and cancer therapy. This minimally invasive technique has several advantages over traditional ablation techniques, such as nonthermal elimination and blood vessel spare effect. Different electrodes are subsequently developed for a specific treatment purpose. Here, we provide a systematic review of electrode modality development in pulsed electric field treatment. For electrodes invented for experiment in vitro, sheet electrode and electrode cuvette, electrodes with high-speed fluorescence imaging system, electrodes with patch-clamp, and electrodes with confocal laser scanning microscopy are introduced. For electrodes invented for experiment in vivo, monopolar electrodes, five-needle array electrodes, single-needle bipolar electrode, parallel plate electrodes, and suction electrode are introduced. The pulsed electric field provides a promising treatment for cancer.

  5. Performance of two different types of anodes in membrane electrode assembly microbial fuel cells for power generation from domestic wastewater

    KAUST Repository

    Hays, Sarah

    2011-10-01

    Graphite fiber brush electrodes provide high surface areas for exoelectrogenic bacteria in microbial fuel cells (MFCs), but the cylindrical brush format limits more compact reactor designs. To enable MFC designs with closer electrode spacing, brush anodes were pressed up against a separator (placed between the electrodes) to reduce the volume occupied by the brush. Higher maximum voltages were produced using domestic wastewater (COD = 390 ± 89 mg L-1) with brush anodes (360 ± 63 mV, 1000 Ω) than woven carbon mesh anodes (200 ± 81 mV) with one or two separators. Maximum power densities were similar for brush anode reactors with one or two separators after 30 days (220 ± 1.2 and 240 ± 22 mW m-2), but with one separator the brush anode MFC power decreased to 130 ± 55 mW m-2 after 114 days. Power densities in MFCs with mesh anodes were very low (<45 mW m-2). Brush anodes MFCs had higher COD removals (80 ± 3%) than carbon mesh MFCs (58 ± 7%), but similar Coulombic efficiencies (8.6 ± 2.9% brush; 7.8 ± 7.1% mesh). These results show that compact (hemispherical) brush anodes can produce higher power and more effective domestic wastewater treatment than flat mesh anodes in MFCs. © 2011 Elsevier B.V. All rights reserved.

  6. Effect of non-ideal clamping shape on the resonance frequencies of silicon nanocantilevers

    Energy Technology Data Exchange (ETDEWEB)

    Guillon, Samuel; Saya, Daisuke; Mazenq, Laurent; Nicu, Liviu [CNRS, LAAS, 7 Avenue du Colonel Roche, F-31077 Toulouse Cedex 4 (France); Perisanu, Sorin; Vincent, Pascal [LPMCN, Universite Claude Bernard Lyon 1 et CNRS, 43 boulevard du 11 novembre 1918, 69622 Villeurbanne Cedex (France); Lazarus, Arnaud; Thomas, Olivier, E-mail: sguillon@laas.fr [Structural Mechanics and Coupled Systems Laboratory, Conservatoire National des Arts et Metiers, 2 rue Conte, 75003 Paris (France)

    2011-06-17

    In this paper, we investigate the effects of non-ideal clamping shapes on the dynamic behavior of silicon nanocantilevers. We fabricated silicon nanocantilevers using silicon on insulator (SOI) wafers by employing stepper ultraviolet (UV) lithography, which permits a resolution of under 100 nm. The nanocantilevers were driven by electrostatic force inside a scanning electron microscope (SEM). Both lateral and out-of-plane resonance frequencies were visually detected with the SEM. Next, we discuss overhanging of the cantilever support and curvature at the clamping point in the silicon nanocantilevers, which generally arises in the fabrication process. We found that the fundamental out-of-plane frequency of a realistically clamped cantilever is always lower than that for a perfectly clamped cantilever, and depends on the cantilever width and the geometry of the clamping point structure. Using simulation with the finite-elements method, we demonstrate that this discrepancy is attributed to the particular geometry of the clamping point (non-zero joining curvatures and a flexible overhanging) that is obtained in the fabrication process. The influence of the material orthotropy is also investigated and is shown to be negligible.

  7. A novel NaV1.5 voltage sensor mutation associated with severe atrial and ventricular arrhythmias.

    Science.gov (United States)

    Wang, Hong-Gang; Zhu, Wandi; Kanter, Ronald J; Silva, Jonathan R; Honeywell, Christina; Gow, Robert M; Pitt, Geoffrey S

    2016-03-01

    Inherited autosomal dominant mutations in cardiac sodium channels (NaV1.5) cause various arrhythmias, such as long QT syndrome and Brugada syndrome. Although dozens of mutations throughout the protein have been reported, there are few reported mutations within a voltage sensor S4 transmembrane segment and few that are homozygous. Here we report analysis of a novel lidocaine-sensitive recessive mutation, p.R1309H, in the NaV1.5 DIII/S4 voltage sensor in a patient with a complex arrhythmia syndrome. We expressed the wild type or mutant NaV1.5 heterologously for analysis with the patch-clamp and voltage clamp fluorometry (VCF) techniques. p.R1309H depolarized the voltage-dependence of activation, hyperpolarized the voltage-dependence of inactivation, and slowed recovery from inactivation, thereby reducing the channel availability at physiologic membrane potentials. Additionally, p.R1309H increased the "late" Na(+) current. The location of the mutation in DIIIS4 prompted testing for a gating pore current. We observed an inward current at hyperpolarizing voltages that likely exacerbates the loss-of-function defects at resting membrane potentials. Lidocaine reduced the gating pore current. The p.R1309H homozygous NaV1.5 mutation conferred both gain-of-function and loss-of-function effects on NaV1.5 channel activity. Reduction of a mutation-induced gating pore current by lidocaine suggested a therapeutic mechanism. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Characterizations of a loss-of-function mutation in the Kir3.4 channel subunit

    DEFF Research Database (Denmark)

    Calloe, Kirstine; Ravn, Lasse Steen; Schmitt, Nicole

    2007-01-01

    and two-electrode voltage-clamp revealed that Kir3.4-G247R basal current was reduced compared to wild-type Kir3.4 and co-expression with the muscarinic acetylcholine receptor type 2 showed that also the acetylcholine induced current was severely reduced in Kir3.4-G247R, indicating that the mutation...... the lack of clear clinical manifestations and further studies are necessary to elucidate if mutations in Kir3.4 are predisposing AF. Udgivelsesdato: 2007-Dec-28...

  9. Three phase voltage measurements with simple open air sensors

    NARCIS (Netherlands)

    Heesch, van E.J.M.; Caspers, R.; Gulickx, P.F.M.; Jacobs, G.A.P.; Kersten, W.F.J.; Laan, van der P.C.T.

    1991-01-01

    A low cost, easy to install high-voltage measuring system is described for open air substations and overhead lines. Based on the Differentiating/Integrating (D/I) principle, three free-standing capacitive pickup electrodes are used to sense the three phase to ground voltages. Apart from the

  10. Applying a foil queue micro-electrode in micro-EDM to fabricate a 3D micro-structure

    Science.gov (United States)

    Xu, Bin; Guo, Kang; Wu, Xiao-yu; Lei, Jian-guo; Liang, Xiong; Guo, Deng-ji; Ma, Jiang; Cheng, Rong

    2018-05-01

    Applying a 3D micro-electrode in a micro electrical discharge machining (micro-EDM) can fabricate a 3D micro-structure with an up and down reciprocating method. However, this processing method has some shortcomings, such as a low success rate and a complex process for fabrication of 3D micro-electrodes. By focusing on these shortcomings, this paper proposed a novel 3D micro-EDM process based on the foil queue micro-electrode. Firstly, a 3D micro-electrode was discretized into several foil micro-electrodes and these foil micro-electrodes constituted a foil queue micro-electrode. Then, based on the planned process path, foil micro-electrodes were applied in micro-EDM sequentially and the micro-EDM results of each foil micro-electrode were able to superimpose the 3D micro-structure. However, the step effect will occur on the 3D micro-structure surface, which has an adverse effect on the 3D micro-structure. To tackle this problem, this paper proposes to reduce this adverse effect by rounded corner wear at the end of the foil micro-electrode and studies the impact of machining parameters on rounded corner wear and the step effect on the micro-structure surface. Finally, using a wire cutting voltage of 80 V, a current of 0.5 A and a pulse width modulation ratio of 1:4, the foil queue micro-electrode was fabricated by wire electrical discharge machining. Also, using a pulse width of 100 ns, a pulse interval of 200 ns, a voltage of 100 V and workpiece material of 304# stainless steel, the foil queue micro-electrode was applied in micro-EDM for processing of a 3D micro-structure with hemispherical features, which verified the feasibility of this process.

  11. Load-deflection characteristics of small-bore insulated-pipe clamps

    International Nuclear Information System (INIS)

    Severud, L.K.; Clark, G.L.

    1981-12-01

    The special insulated clamps used on both FFTF and CRBR piping utilize a Belleville spring arrangement to compensate for pipe thermal expansion. Analysis indicates that this produces a non-linear, directionally sensitive clamp spring rate. Since these spring rates influence the seismic response of a supported piping system, it was deemed necessary to evaluate them further by test. This has been accomplished for the FFTF clamps. A more standard insulated pipe clamp, which does not incorporate Belleville springs to accommodate thermal expansion, was also tested. This type clamp is simple in design, and economically attractive. It may have wide application prospects for use in LMFBR small bore auxiliary piping operating at temperatures below 427 0 C. Load deflection tests were conducted on 2.54 CM and 7.62 CM diameter samples of these commercial clamps

  12. A low knee voltage and high breakdown voltage of 4H-SiC TSBS employing poly-Si/Ni Schottky scheme

    Science.gov (United States)

    Kim, Dong Young; Seok, Ogyun; Park, Himchan; Bahng, Wook; Kim, Hyoung Woo; Park, Ki Cheol

    2018-02-01

    We report a low knee voltage and high breakdown voltage 4H-SiC TSBS employing poly-Si/Ni dual Schottky contacts. A knee voltage was significantly improved from 0.75 to 0.48 V by utilizing an alternative low work-function material of poly-Si as an anode electrode. Also, reverse breakdown voltage was successfully improved from 901 to 1154 V due to a shrunk low-work-function Schottky region by a proposed self-align etching process between poly-Si and SiC. SiC TSBS with poly-Si/Ni dual Schottky scheme is a suitable structure for high-efficiency rectification and high-voltage blocking operation.

  13. Effects of cadmium electrode properties on nickel-cadmium cell performance

    International Nuclear Information System (INIS)

    Zimmerman, A.H.

    1986-01-01

    Tests have been conducted on a number of nickel-cadmium cells that have exhibited a variety of performance problems, ranging from high voltages and pressures during overcharge to low capacity. The performance problems that have been specifically linked to the cadmium electrode are primarily related to two areas, poor sinter and the buildup of excessive pressure during overcharge. A number of specific nickel-cadmium cell and cadmium electrode characterists have been studied in this work to determine what the effects of poor sinter are, and to determine what factors are important in causing excessive pressures during overcharge in cells that otherwise appear normal. Several of the tests appear suitable for screening cells and electrodes for such problems

  14. Method of controlling illumination device based on current-voltage model

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to an illumination device comprising a number of LEDs, means for receiving an input signal, means for generating an activation signal for at least one of the LEDs based on the input signal. The illumination device comprises further means for obtaining the voltage...... and the colorimetric properties of said light emitted by LED. The present invention relates also to a method of controlling and a meted of calibrating such illumination device....... across and current through the LED and the means for generating the activation signal is adapted to generate the activating signal based on the voltage, the current and a current- voltage model related to LED. The current-voltage model defines a relationship between the current, the voltage...

  15. Medium voltage three-level converters for the grid connection of a multi-MW wind turbine

    DEFF Research Database (Denmark)

    Senturk, Osman Selcuk; Helle, Lars; Munk-Nielsen, Stig

    2009-01-01

    Three-level (3L) neutral point clamped (NPC), flying capacitor (FC), and H-bridge (HB) voltage source converters (VSCs) as a grid-side full-scale medium voltage (MV) converter are modeled, controlled, and simulated for the grid connection of a hypothetical 6MW wind turbine. Via the converter...... topological features and the simulation results demonstrating the converter performance, these three 3L-VSCs are discussed and compared in terms of power density and reliability, which can be considered as two of the most important criteria for the converters placed in wind turbine nacelles. Given the grid...... connection circuit (without capacitive switching ripple filters), the 3L-HB-VSC is expected to be superior with respect to power density and reliability over the 3L-NPC- and -FC-VSCs....

  16. Medium Voltage Three-level Converters for the Grid Connection of aMulti-MW Wind Turbine

    DEFF Research Database (Denmark)

    Senturk, Osman Selcuk; Helle, Lars; Munk-Nielsen, Stig

    2009-01-01

    Three-level (3L) neutral point clamped (NPC), flying capacitor (FC), and H-bridge (HB) voltage source converters (VSCs) as a grid-side full-scale medium voltage (MV) converter are modeled, controlled, and simulated for the grid connection of a hypothetical 6MW wind turbine. Via the converter...... topological features and the simulation results demonstrating the converter performance, these three 3L-VSCs are discussed and compared in terms of power density and reliability, which can be considered as two of the most important criteria for the converters placed in wind turbine nacelles. Given the grid...... connection circuit (without capacitive switching ripple filters), the 3L-HB-VSC is expected to be superior with respect to power density and reliability over the 3L-NPC- and -FC-VSCs....

  17. Electrochemical pre anodization of glassy carbon electrode and application to determine chloramphenicol

    International Nuclear Information System (INIS)

    Truc, Nguyen Minh; Mortensen, John; Anh, Nguyen Ba Hoai

    2008-01-01

    This paper suggested a method to enhance the performance of carbon electrodes for the determination of chloramphenicol (CAP). The sensitivity and the reproducibility of the carbon electrodes could be enhanced easily by electrochemical pretreatment. Some kinds of carbon material were studied including glassy carbon, graphite carbon and pyrolytic carbon. Numerous kinds of supporting electrolyte have been tried. For glassy carbon electrode, the acidic solution, H 2 SO 4 5 mM, resulted in best performance at pretreated voltage of +2.1V (vs. Ag/ AgCl) in duration of 250 second. However, for graphite and pyrolytic carbon electrodes, the phosphate buffer solution pH 6.0 gave the best performance at +1.7V (vs. Ag/ AgCl) in duration of 20 seconds. The detection limit could be at very low concentration of CAP: 0.8 ng/ ml for glassy carbon electrode, 3.5 ng/ ml for graphite carbon electrode. The method was successful applied to aqua-agriculture water sample and milk sample with simple extraction as well as direct ointment sample analysis. (author)

  18. Noncovalent Pi-Pi Stacking at the Carbon-Electrolyte Interface: Controlling the Voltage Window of Electrochemical Supercapacitors.

    Science.gov (United States)

    Li, Mengya; Westover, Andrew S; Carter, Rachel; Oakes, Landon; Muralidharan, Nitin; Boire, Timothy C; Sung, Hak-Joon; Pint, Cary L

    2016-08-03

    A key parameter in the operation of an electrochemical double-layer capacitor is the voltage window, which dictates the device energy density and power density. Here we demonstrate experimental evidence that π-π stacking at a carbon-ionic liquid interface can modify the operation voltage of a supercapacitor device by up to 30%, and this can be recovered by steric hindrance at the electrode-electrolyte interface introduced by poly(ethylene oxide) polymer electrolyte additives. This observation is supported by Raman spectroscopy, electrochemical impedance spectroscopy, and differential scanning calorimetry that each independently elucidates the signature of π-π stacking between imidazole groups in the ionic liquid and the carbon surface and the role this plays to lower the energy barrier for charge transfer at the electrode-electrolyte interface. This effect is further observed universally across two separate ionic liquid electrolyte systems and is validated by control experiments showing an invariant electrochemical window in the absence of a carbon-ionic liquid electrode-electrolyte interface. As interfacial or noncovalent interactions are usually neglected in the mechanistic picture of double-layer capacitors, this work highlights the importance of understanding chemical properties at supercapacitor interfaces to engineer voltage and energy capability.

  19. Neutral-point current modeling and control for Neutral-Point Clamped three-level converter drive with small DC-link capacitors

    DEFF Research Database (Denmark)

    Maheshwari, Ram Krishan; Munk-Nielsen, Stig; Busquets-Monge, Sergio

    2011-01-01

    A Neutral-Point-Clamped (NPC) three-level inverter with small DC-link capacitors is presented in this paper. This inverter requires zero average neutral-point current for stable neutral-point potential. A simple carrier based modulation strategy is proposed for achieving zero average neutral...... drive with only 14 μF DC-link capacitors. A fast and stable performance of the neutral-point voltage controller is achieved and verified by experiments....

  20. The Influence of Materials of Electrodes of Sensitized Solar Cells on Their Capacitive and Electrical Characteristics

    Science.gov (United States)

    Lazarenko, P. I.; Kozyukhin, S. A.; Mokshina, A. I.; Sherchenkov, A. A.; Patrusheva, T. N.; Irgashev, R. A.; Lebedev, E. A.; Kozik, V. V.

    2018-05-01

    An estimation is made of the internal capacitance of sensitized solar cells (SSCs) manufactured by the method of extraction pyrolysis. The structures under study are characterized by a hysteresis in the current-voltage characteristic obtained in the direct and reverse modes of voltage variation. The investigations of SSCs demonstrate a high inertness of the parameters under connection and disconnection of the light source. The use of a transparent conductive ITO-electrode, manufactured by the extraction pyrolysis, increases the external capacitance of the cell and decelerates the processes of current decay after the light source connection compared to the commercial FTO-electrode. The values of charges, capacitances, and SSC charge conservation efficiencies are calculated and the internal resistance of the SSCs under study is estimated. According to the estimations performed, the specimen with an ITO-layer possesses a capacitance equal to C1 = 1.23·10-3 F, which is by two orders of magnitude higher than that of the specimen with a FTO-layer (C2 = 2.06·10-5 F).