WorldWideScience

Sample records for two-electrode voltage clamp

  1. Application of active electrode compensation to perform continuous voltage-clamp recordings with sharp microelectrodes.

    Science.gov (United States)

    Gómez-González, J F; Destexhe, A; Bal, T

    2014-10-01

    Electrophysiological recordings of single neurons in brain tissues are very common in neuroscience. Glass microelectrodes filled with an electrolyte are used to impale the cell membrane in order to record the membrane potential or to inject current. Their high resistance induces a high voltage drop when passing current and it is essential to correct the voltage measurements. In particular, for voltage clamping, the traditional alternatives are two-electrode voltage-clamp technique or discontinuous single electrode voltage-clamp (dSEVC). Nevertheless, it is generally difficult to impale two electrodes in a same neuron and the switching frequency is limited to low frequencies in the case of dSEVC. We present a novel fully computer-implemented alternative to perform continuous voltage-clamp recordings with a single sharp-electrode. To reach such voltage-clamp recordings, we combine an active electrode compensation algorithm (AEC) with a digital controller (AECVC). We applied two types of control-systems: a linear controller (proportional plus integrative controller) and a model-based controller (optimal control). We compared the performance of the two methods to dSEVC using a dynamic model cell and experiments in brain slices. The AECVC method provides an entirely digital method to perform continuous recording and smooth switching between voltage-clamp, current clamp or dynamic-clamp configurations without introducing artifacts.

  2. An equivalent network representation of a clamped bimorph piezoelectric micromachined ultrasonic transducer with circular and annular electrodes using matrix manipulation techniques.

    Science.gov (United States)

    Sammoura, Firas; Smyth, Katherine; Kim, Sang-Gook

    2013-09-01

    An electric circuit model for a clamped circular bimorph piezoelectric micromachined ultrasonic transducer (pMUT) was developed for the first time. The pMUT consisted of two piezoelectric layers sandwiched between three thin electrodes. The top and bottom electrodes were separated into central and annular electrodes by a small gap. While the middle electrode was grounded, the central and annular electrodes were biased with two independent voltage sources. The strain mismatch between the piezoelectric layers caused the plate to vibrate and transmit a pressure wave, whereas the received echo generated electric charges resulting from plate deformation. The clamped pMUT plate was separated into a circular and an annular plate, and the respective electromechanical transformation matrices were derived. The force and velocity vectors were properly selected using Hamilton's principle and the necessary boundary conditions were invoked. The electromechanical transformation matrix for the clamped circular pMUT was deduced using simple matrix manipulation techniques. The pMUT performance under three biasing schemes was elaborated: 1) central electrode only, 2) central and annular electrodes with voltages of the same magnitude and polarity, and 3) central and annular electrodes with voltages of the same magnitude and opposite polarity. The circuit parameters of the pMUT were extracted for each biasing scheme, including the transformer ratio, the clamped electric impedance, and the open-circuit mechanical impedance. Each pMUT scheme was characterized under different acoustic loadings using the theoretically developed model, which was verified with finite element modeling (FEM) simulation. The electrode size was optimized to maximize the electromechanical transformer ratio. As such, the developed model could provide more insight into the design, optimization, and characterization of pMUTs and allow for performance comparison with their cMUT counterparts.

  3. A low-voltage sense amplifier with two-stage operational amplifier clamping for flash memory

    Science.gov (United States)

    Guo, Jiarong

    2017-04-01

    A low-voltage sense amplifier with reference current generator utilizing two-stage operational amplifier clamp structure for flash memory is presented in this paper, capable of operating with minimum supply voltage at 1 V. A new reference current generation circuit composed of a reference cell and a two-stage operational amplifier clamping the drain pole of the reference cell is used to generate the reference current, which avoids the threshold limitation caused by current mirror transistor in the traditional sense amplifier. A novel reference voltage generation circuit using dummy bit-line structure without pull-down current is also adopted, which not only improves the sense window enhancing read precision but also saves power consumption. The sense amplifier was implemented in a flash realized in 90 nm flash technology. Experimental results show the access time is 14.7 ns with power supply of 1.2 V and slow corner at 125 °C. Project supported by the National Natural Science Fundation of China (No. 61376028).

  4. Voltage Balancing Control of Diode-Clamped Multilevel Inverter

    Directory of Open Access Journals (Sweden)

    ŞCHIOP Adrian

    2013-10-01

    Full Text Available In this paper is developed a control scheme for mono-phase diode clamped inverter to achieve balancing voltages on inverter capacitors. First, it develops a control scheme without taking into account the need to balance voltage on two capacitors. It examines the effects on the output voltage inverter, and then it realizes two control schemes that will balance the voltages. The simulations of control schemes were performed in OrCAD Pspice.

  5. Artifactual voltage response recorded from hair cells with patch-clamp amplifiers.

    Science.gov (United States)

    Masetto, S; Weng, T; Valli, P; Correia, M J

    1999-06-23

    Patch-clamp amplifiers (PCAs) are commonly used to characterize voltage- and current-clamp responses in the same cell. However, the cell membrane voltage response can be severely distorted by PCAs working in the current-clamp mode. Here we compare the voltage response of pigeon semicircular canal hair cells in situ, recorded with two different PCAs, and with a classic microelectrode bridge amplifier (BA). We found that the voltage response of hair cells recorded with PCAs differed significantly from that recorded with the BA. The true hair cell membrane voltage response to positive current steps was characterized by a strongly damped oscillation, whose frequency and duration depended on hair cell location in the sensory crista ampullaris.

  6. Characterization of heterologously expressed transporter genes by patch- and voltage-clamp methods: Application to cyclic nucleotide-dependent responses

    KAUST Repository

    Lemtiri-Chlieh, Fouad

    2013-09-03

    The application of patch- and voltage-clamp methods to study ion transport can be limited by many hurdles: the size of the cells to be patched and/or stabbed, the subcellular localization of the molecule of interest, and its density of expression that could be too low even in their own native environment. Functional expression of genes using recombinant DNA technology not only overcomes those hurdles but also affords additional and elegant investigations such as single-point mutation studies and subunit associations/regulations. In this chapter, we give a step-by-step description of two electrophysiological methods, patch clamp and two-electrode voltage clamp (TEVC), that are routinely used in combination with heterologous gene expression to assist researchers interested in the identification and characterization of ion transporters. We describe how to (1) obtain and maintain the cells suitable for the use with each of the above-mentioned methods (i.e., HEK-293 cells and yeast spheroplasts to use with the patch-clamp methodology and Xenopus laevis oocytes with TEVC), (2) transfect/inject them with the gene of interest, and (3) record ion transport activities. © Springer Science+Business Media New York 2013.

  7. Characterization of heterologously expressed transporter genes by patch- and voltage-clamp methods: Application to cyclic nucleotide-dependent responses

    KAUST Repository

    Lemtiri-Chlieh, Fouad; Ali, Rashid Ayesha

    2013-01-01

    The application of patch- and voltage-clamp methods to study ion transport can be limited by many hurdles: the size of the cells to be patched and/or stabbed, the subcellular localization of the molecule of interest, and its density of expression that could be too low even in their own native environment. Functional expression of genes using recombinant DNA technology not only overcomes those hurdles but also affords additional and elegant investigations such as single-point mutation studies and subunit associations/regulations. In this chapter, we give a step-by-step description of two electrophysiological methods, patch clamp and two-electrode voltage clamp (TEVC), that are routinely used in combination with heterologous gene expression to assist researchers interested in the identification and characterization of ion transporters. We describe how to (1) obtain and maintain the cells suitable for the use with each of the above-mentioned methods (i.e., HEK-293 cells and yeast spheroplasts to use with the patch-clamp methodology and Xenopus laevis oocytes with TEVC), (2) transfect/inject them with the gene of interest, and (3) record ion transport activities. © Springer Science+Business Media New York 2013.

  8. Suppression of Spiral Waves by Voltage Clamp Techniques in a Conductance-Based Cardiac Tissue Model

    International Nuclear Information System (INIS)

    Lian-Chun, Yu; Guo-Yong, Zhang; Yong, Chen; Jun, Ma

    2008-01-01

    A new control method is proposed to control the spatio-temporal dynamics in excitable media, which is described by the Morris–Lecar cells model. It is confirmed that successful suppression of spiral waves can be obtained by spatially clamping the membrane voltage of the excitable cells. The low voltage clamping induces breakup of spiral waves and the fragments are soon absorbed by low voltage obstacles, whereas the high voltage clamping generates travel waves that annihilate spiral waves through collision with them. However, each method has its shortcomings. Furthermore, a two-step method that combines both low and high voltage clamp techniques is then presented as a possible way of out this predicament. (cross-disciplinary physics and related areas of science and technology)

  9. Common voltage eliminating of SVM diode clamping three-level inverter connected to grid

    DEFF Research Database (Denmark)

    Guo, Yougui; Zeng, Ping; Zhu, Jieqiong

    2011-01-01

    A novel method of common voltage eliminating is put forward for SVM diode clamping three-level inverter connected to grid by calculation of common voltage of its various switching states. PLECS is used to model this three-level inverter connected to grid and good results are obtained. First...... analysis of common mode voltage for switching states of diode clamping 3-level inverter is given in detail. Second the common mode voltage eliminating control strategy of SVM is described for diode clamping three-level inverter. Third, PLECS is briefly introduced. Fourth, the modeling of diode clamping...... three-level inverter is presented with PLECS. Finally, a series of simulations are carried out. The simulation results tell us PLECS is a very powerful tool to real power circuits modeling. They have also verified that proposed common mode voltage eliminating control strategy of SVM is feasible...

  10. Effects of trimethoprim-sulfadiazine and detomidine on the function of equine Kv 11.1 channels in a two-electrode voltage-clamp (TEVC) oocyte model.

    Science.gov (United States)

    Trachsel, D S; Tejada, M A; Groesfjeld Christensen, V; Pedersen, P J; Kanters, J K; Buhl, R; Calloe, K; Klaerke, D A

    2018-03-22

    The long QT syndrome (LQTS) is a channelopathy that can lead to severe arrhythmia and sudden cardiac death. Pharmacologically induced LQTS is caused by interaction between drugs and potassium channels, especially the K v 11.1 channel. Due to such interactions, numerous drugs have been withdrawn from the market or are administered with precautions in human medicine. However, some compounds, such as trimethoprim-sulfonamide combinations are still widely used in veterinarian medicine. Therefore, we investigate the effect of trimethoprim-sulfadiazine (TMS), trimethoprim, sulfadiazine, and detomidine on equine-specific K v 11.1 channels. K v 11.1 channels cloned from equine hearts were heterologously expressed in Xenopus laevis oocytes, and whole cell currents were measured by two-electrode voltage-clamp before and after drug application. TMS blocked equine K v 11.1 current with an IC 50 of 3.74 mm (95% CI: 2.95-4.73 mm) and affected the kinetics of activation and inactivation. Similar was found for trimethoprim but not for sulfadiazine, suggesting the effect is due to trimethoprim. Detomidine did not affect equine K v 11.1 current. Thus, equine K v 11.1 channels are also susceptible to pharmacological block, indicating that some drugs may have the potential to affect repolarization in horse. However, in vivo studies are needed to assess the potential risk of these drugs to induce equine LQTS. © 2018 The Authors. Journal of Veterinary Pharmacology and Therapeutics Published by John Wiley & Sons Ltd.

  11. Finite element analysis on factors influencing the clamping force in an electrostatic chuck

    International Nuclear Information System (INIS)

    Wang Xingkuo; Yang Yiyong; Cheng Jia; Wang Kesheng; Sun Yuchun; Cao Minglu; Ji Linhong

    2014-01-01

    As one of the core components of IC manufacturing equipment, the electrostatic chuck (ESC) has been widely applied in semiconductor processing such as etching, PVD and CVD. The clamping force of the ESC is one of the most important technical indicators. A multi-physics simulation software COMSOL is used to analyze the factors influencing the clamping force. The curves between the clamping force and the main parameters such as DC voltage, electrode thickness, electrode radius, dielectric thickness and helium gap are obtained. Moreover, the effects of these factors on the clamping force are investigated by means of orthogonal experiments. The results show that the factors can be ranked in order of voltage, electrode radius, helium gap and dielectric thickness according to their importance, which may offer certain reference for the design of ESCs. (semiconductor devices)

  12. Investigation of the Dynamics of a Clamped-Clamped Microbeam Near the Third Mode Using a Partial Electrode

    KAUST Repository

    Masri, Karim M.

    2014-08-17

    We present an investigation of the dynamics of a clamped-clamped microbeam excited electrostatically near its third mode. To maximize the response at the third mode, a partial electrode configuration is utilized. A multi-mode Galerkin method is used to develop a reduced order model (ROM) of the beam. A shooting method to find the periodic motion is utilized to generate frequency response curves. The curves show hardenining behavior and dynamic pull-in. We show that the dynamic amplitude of the partial configuration is higher than that of a full electrode configuration. These results are promising for the use of higher-order modes for mass detection and for ultra sensitive resonant sensors.

  13. Investigation of the Dynamics of a Clamped-Clamped Microbeam Near the Third Mode Using a Partial Electrode

    KAUST Repository

    Masri, Karim M.; Younis, Mohammad I.

    2014-01-01

    We present an investigation of the dynamics of a clamped-clamped microbeam excited electrostatically near its third mode. To maximize the response at the third mode, a partial electrode configuration is utilized. A multi-mode Galerkin method is used to develop a reduced order model (ROM) of the beam. A shooting method to find the periodic motion is utilized to generate frequency response curves. The curves show hardenining behavior and dynamic pull-in. We show that the dynamic amplitude of the partial configuration is higher than that of a full electrode configuration. These results are promising for the use of higher-order modes for mass detection and for ultra sensitive resonant sensors.

  14. Accurate measurement of junctional conductance between electrically coupled cells with dual whole-cell voltage-clamp under conditions of high series resistance.

    Science.gov (United States)

    Hartveit, Espen; Veruki, Margaret Lin

    2010-03-15

    Accurate measurement of the junctional conductance (G(j)) between electrically coupled cells can provide important information about the functional properties of coupling. With the development of tight-seal, whole-cell recording, it became possible to use dual, single-electrode voltage-clamp recording from pairs of small cells to measure G(j). Experiments that require reduced perturbation of the intracellular environment can be performed with high-resistance pipettes or the perforated-patch technique, but an accompanying increase in series resistance (R(s)) compromises voltage-clamp control and reduces the accuracy of G(j) measurements. Here, we present a detailed analysis of methodologies available for accurate determination of steady-state G(j) and related parameters under conditions of high R(s), using continuous or discontinuous single-electrode voltage-clamp (CSEVC or DSEVC) amplifiers to quantify the parameters of different equivalent electrical circuit model cells. Both types of amplifiers can provide accurate measurements of G(j), with errors less than 5% for a wide range of R(s) and G(j) values. However, CSEVC amplifiers need to be combined with R(s)-compensation or mathematical correction for the effects of nonzero R(s) and finite membrane resistance (R(m)). R(s)-compensation is difficult for higher values of R(s) and leads to instability that can damage the recorded cells. Mathematical correction for R(s) and R(m) yields highly accurate results, but depends on accurate estimates of R(s) throughout an experiment. DSEVC amplifiers display very accurate measurements over a larger range of R(s) values than CSEVC amplifiers and have the advantage that knowledge of R(s) is unnecessary, suggesting that they are preferable for long-duration experiments and/or recordings with high R(s). Copyright (c) 2009 Elsevier B.V. All rights reserved.

  15. An accurate online calibration system based on combined clamp-shape coil for high voltage electronic current transformers

    International Nuclear Information System (INIS)

    Li, Zhen-hua; Li, Hong-bin; Zhang, Zhi

    2013-01-01

    Electronic transformers are widely used in power systems because of their wide bandwidth and good transient performance. However, as an emerging technology, the failure rate of electronic transformers is higher than that of traditional transformers. As a result, the calibration period needs to be shortened. Traditional calibration methods require the power of transmission line be cut off, which results in complicated operation and power off loss. This paper proposes an online calibration system which can calibrate electronic current transformers without power off. In this work, the high accuracy standard current transformer and online operation method are the key techniques. Based on the clamp-shape iron-core coil and clamp-shape air-core coil, a combined clamp-shape coil is designed as the standard current transformer. By analyzing the output characteristics of the two coils, the combined clamp-shape coil can achieve verification of the accuracy. So the accuracy of the online calibration system can be guaranteed. Moreover, by employing the earth potential working method and using two insulating rods to connect the combined clamp-shape coil to the high voltage bus, the operation becomes simple and safe. Tests in China National Center for High Voltage Measurement and field experiments show that the proposed system has a high accuracy of up to 0.05 class

  16. An accurate online calibration system based on combined clamp-shape coil for high voltage electronic current transformers.

    Science.gov (United States)

    Li, Zhen-hua; Li, Hong-bin; Zhang, Zhi

    2013-07-01

    Electronic transformers are widely used in power systems because of their wide bandwidth and good transient performance. However, as an emerging technology, the failure rate of electronic transformers is higher than that of traditional transformers. As a result, the calibration period needs to be shortened. Traditional calibration methods require the power of transmission line be cut off, which results in complicated operation and power off loss. This paper proposes an online calibration system which can calibrate electronic current transformers without power off. In this work, the high accuracy standard current transformer and online operation method are the key techniques. Based on the clamp-shape iron-core coil and clamp-shape air-core coil, a combined clamp-shape coil is designed as the standard current transformer. By analyzing the output characteristics of the two coils, the combined clamp-shape coil can achieve verification of the accuracy. So the accuracy of the online calibration system can be guaranteed. Moreover, by employing the earth potential working method and using two insulating rods to connect the combined clamp-shape coil to the high voltage bus, the operation becomes simple and safe. Tests in China National Center for High Voltage Measurement and field experiments show that the proposed system has a high accuracy of up to 0.05 class.

  17. Potassium Chloride Versus Voltage Clamp Contractures in Ventricular Muscle

    Science.gov (United States)

    Morad, M.; Reeck, S.; Rao, M.

    1981-01-01

    In frog ventricle, developed tension was markedly larger in response to depolarization caused by a voltage clamp step than to depolarization induced by high concentrations of potassium chloride. Measurement of extracellular potassium activity at the surface and at the depth of muscle during the development of contractures showed that the diffusion of potassium is much slower than the spread of depolarization through the cross section of muscle. These two observations suggest that competition between the depolarizing and the negative inotropic effects of an increase in the extracellular potassium ion concentration may determine the time course and magnitude of contractile tension in heart muscle.

  18. A Microbeam Resonator with Partial Electrodes for Logic and Memory Elements

    KAUST Repository

    Hafiz, Md Abdullah Al

    2017-11-10

    We demonstrate logic and memory elements based on an in-plane clamped-clamped microbeam resonator. The micro-resonator is electrostatically actuated through a drive electrode and the motional signal is capacitively sensed at a sense electrode, while the resonance characteristics are modulated by DC voltage pulses provided at two separate partial electrodes, independent of the drive/sense electrodes. For the logic applications, we use two separate electrodes to provide DC voltages defined as the logic inputs. The high (low) motional signal at on-resonance (off-resonance) state is defined as the logic output state “1” (“0”). For the memory operation, two stable vibrational states, high and low, within the hysteretic regime are defined as the memory states, “1” and “0”, respectively. We take advantage of the split electrode configuration to provide positive and negative DC voltage pulses selectively to set/reset the memory states (“1”/“0”) without affecting the driving and sensing terminals. Excluding the energy cost for supporting electronics, these devices consume energy in 10’s of picojoules per logic/memory operations. Furthermore, the devices are fabricated using silicon on insulator (SOI) wafers, have the potential for on-chip integration, and operate at moderate pressure (~1 Torr) and room temperature.

  19. A Microbeam Resonator with Partial Electrodes for Logic and Memory Elements

    KAUST Repository

    Hafiz, Md Abdullah Al; Ilyas, Saad; Ahmed, Sally; Younis, Mohammad I.; Fariborzi, Hossein

    2017-01-01

    We demonstrate logic and memory elements based on an in-plane clamped-clamped microbeam resonator. The micro-resonator is electrostatically actuated through a drive electrode and the motional signal is capacitively sensed at a sense electrode, while the resonance characteristics are modulated by DC voltage pulses provided at two separate partial electrodes, independent of the drive/sense electrodes. For the logic applications, we use two separate electrodes to provide DC voltages defined as the logic inputs. The high (low) motional signal at on-resonance (off-resonance) state is defined as the logic output state “1” (“0”). For the memory operation, two stable vibrational states, high and low, within the hysteretic regime are defined as the memory states, “1” and “0”, respectively. We take advantage of the split electrode configuration to provide positive and negative DC voltage pulses selectively to set/reset the memory states (“1”/“0”) without affecting the driving and sensing terminals. Excluding the energy cost for supporting electronics, these devices consume energy in 10’s of picojoules per logic/memory operations. Furthermore, the devices are fabricated using silicon on insulator (SOI) wafers, have the potential for on-chip integration, and operate at moderate pressure (~1 Torr) and room temperature.

  20. Evaluation of Niobium as Candidate Electrode Material for DC High Voltage Photoelectron Guns

    Science.gov (United States)

    BastaniNejad, M.; Mohamed, Abdullah; Elmustafa, A. A.; Adderley, P.; Clark, J.; Covert, S.; Hansknecht, J.; Hernandez-Garcia, C.; Poelker, M.; Mammei, R.; hide

    2012-01-01

    The field emission characteristics of niobium electrodes were compared to those of stainless steel electrodes using a DC high voltage field emission test apparatus. A total of eight electrodes were evaluated: two 304 stainless steel electrodes polished to mirror-like finish with diamond grit and six niobium electrodes (two single-crystal, two large-grain, and two fine-grain) that were chemically polished using a buffered-chemical acid solution. Upon the first application of high voltage, the best large-grain and single-crystal niobium electrodes performed better than the best stainless steel electrodes, exhibiting less field emission at comparable voltage and field strength. In all cases, field emission from electrodes (stainless steel and/or niobium) could be significantly reduced and sometimes completely eliminated, by introducing krypton gas into the vacuum chamber while the electrode was biased at high voltage. Of all the electrodes tested, a large-grain niobium electrode performed the best, exhibiting no measurable field emission (< 10 pA) at 225 kV with 20 mm cathode/anode gap, corresponding to a field strength of 18:7 MV/m.

  1. Simple hardware implementation of voltage balancing in capacitor-clamped inverter

    Czech Academy of Sciences Publication Activity Database

    Kokeš, Petr; Semerád, Radko

    2009-01-01

    Roč. 54, č. 4 (2009), s. 325-341 ISSN 0001-7043 R&D Projects: GA MPO FT-TA4/077 Institutional research plan: CEZ:AV0Z20570509 Keywords : capacitor -clamped multilevel inverter * flying capacitor voltage balancing * pulse width modulation (PWM) Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering

  2. Evaluation of niobium as candidate electrode material for dc high voltage photoelectron guns

    Directory of Open Access Journals (Sweden)

    M. BastaniNejad

    2012-08-01

    Full Text Available The field emission characteristics of niobium electrodes were compared to those of stainless steel electrodes using a DC high voltage field emission test apparatus. A total of eight electrodes were evaluated: two 304 stainless steel electrodes polished to mirrorlike finish with diamond grit and six niobium electrodes (two single-crystal, two large-grain, and two fine-grain that were chemically polished using a buffered-chemical acid solution. Upon the first application of high voltage, the best large-grain and single-crystal niobium electrodes performed better than the best stainless steel electrodes, exhibiting less field emission at comparable voltage and field strength. In all cases, field emission from electrodes (stainless steel and/or niobium could be significantly reduced and sometimes completely eliminated, by introducing krypton gas into the vacuum chamber while the electrode was biased at high voltage. Of all the electrodes tested, a large-grain niobium electrode performed the best, exhibiting no measurable field emission (<10  pA at 225 kV with 20 mm cathode/anode gap, corresponding to a field strength of 18.7  MV/m.

  3. The Anion Paradox in Sodium Taste Reception: Resolution by Voltage-Clamp Studies

    Science.gov (United States)

    Ye, Qing; Heck, Gerard L.; Desimone, John A.

    1991-11-01

    Sodium salts are potent taste stimuli, but their effectiveness is markedly dependent on the anion, with chloride yielding the greatest response. The cellular mechanisms that mediate this phenomenon are not known. This "anion paradox" has been resolved by considering the field potential that is generated by restricted electrodiffusion of the anion through paracellular shunts between taste-bud cells. Neural responses to sodium chloride, sodium acetate, and sodium gluconate were studied while the field potential was voltage-clamped. Clamping at electronegative values eliminated the anion effect, whereas clamping at electropositive potentials exaggerated it. Thus, field potentials across the lingual epithelium modulate taste reception, indicating that the functional unit of taste reception includes the taste cell and its paracellular microenvironment.

  4. Cell voltage versus electrode potential range in aqueous supercapacitors

    Science.gov (United States)

    Dai, Zengxin; Peng, Chuang; Chae, Jung Hoon; Ng, Kok Chiang; Chen, George Z.

    2015-01-01

    Supercapacitors with aqueous electrolytes and nanostructured composite electrodes are attractive because of their high charging-discharging speed, long cycle life, low environmental impact and wide commercial affordability. However, the energy capacity of aqueous supercapacitors is limited by the electrochemical window of water. In this paper, a recently reported engineering strategy is further developed and demonstrated to correlate the maximum charging voltage of a supercapacitor with the capacitive potential ranges and the capacitance ratio of the two electrodes. Beyond the maximum charging voltage, a supercapacitor may still operate, but at the expense of a reduced cycle life. In addition, it is shown that the supercapacitor performance is strongly affected by the initial and zero charge potentials of the electrodes. Further, the differences are highlighted and elaborated between freshly prepared, aged under open circuit conditions, and cycled electrodes of composites of conducting polymers and carbon nanotubes. The first voltammetric charging-discharging cycle has an electrode conditioning effect to change the electrodes from their initial potentials to the potential of zero voltage, and reduce the irreversibility. PMID:25897670

  5. Five-Level Active-Neutral-Point-Clamped DC/DC Converter for Medium-Voltage DC Grids

    DEFF Research Database (Denmark)

    Liu, Dong; Deng, Fujin; Chen, Zhe

    2017-01-01

    This paper proposes a five-level active-neutralpoint- clamped (5L-ANPC) dc/dc converter for applications in medium voltage dc (MVDC) grids. A modulation strategy is proposed for the 5L-ANPC dc/dc converter to generate multilevel voltage waveforms, which can effectively reduce voltage change rate dv...... effectively eliminate high voltage leaps caused by the dead time effect. In addition, a capacitor voltage control strategy is proposed for the 5L-ANPC dc/dc converter to ensure the balanced flying capacitor voltage and desired five-level voltage waveforms. Finally, simulation and experimental studies...

  6. Balance control strategy of two-amplitude actively clamped resonant DC-Link inverter clamping voltage%双幅有源箝位谐振直流环节逆变器箝位电压平衡控制策略

    Institute of Scientific and Technical Information of China (English)

    陈沁野; 张德华; 侯尧杰

    2012-01-01

    Aiming at the big loss of the traditional clamping voltage balance control strategies, in two-amplitude actively clamped resonant DC-LINK inverter, the work process of DC link was analyzed. In order to keep the clamp capacitor voltage balance the value set in DC-link work, no short-circuit control was proposed.The DC-link of inverter was calculated by Mathcad. The loss of two modes of short-circuit control and no short-circuit control were compared.Under the no short-circuit control and voltage ripple is not be greater than twenty percent, the parameters of the clamp capacitor were calculated. The results indicate that, the micro-power ACRDCLI clamping voltage balance use no short-circuit control,that can reduce the loss of the DC link and can use thin-film capacitor as a clamp capacitor to achieve the micro-power ACRDCLI low loss and iong life requirements.%针对微型功率双幅有源箝位谐振直流环节逆变器在正常工作过程中,传统箝位电压平衡母线短路控制策略带来损耗大的问题,开展了直流环节工作过程的分析,针对直流环节正常工作的情况下,箝位电容电压必须能平衡在设定值,提出了箝位电压平衡母线无短路控制策略,根据给出的损耗估算方法,通过Mathcad计算,对比了母线短路控制和无短路控制两种方式下的损耗,同时计算出了母线无短路控制箝位电容电压纹波不大于20%下的箝位电容参数.研究结果表明:微型功率ACRDCLI箝位电压平衡采用母线无短线控制,不但可以减少双幅有源箝位谐振直流环节逆变器的损耗,并且可以使用薄膜电容作为箝位电容,以达到微型功率ACRDCLI损耗低、寿命长的要求.

  7. Isolated PWM DC-AC SICAM with an active capacitive voltage clamp[Pulse Density Modulated; Pulse Width Modulation

    Energy Technology Data Exchange (ETDEWEB)

    Ljusev, P.

    2004-03-15

    In this report an isolated PWM DC-AC SICAM with an active capacitive voltage clamp is presented. AC-DC power supply is implemented in its simplest form: diode rectifier followed by a medium-size charge-storage capacitors and possibly with an EMC filter on the mains entrance. Isolation from the AC mains is achieved using a high frequency (HF) transformer, whose voltages are not audio-modulated. The latter simplifies the design and is expected to have many advantages over the approach where the transformer voltages are modulated in regards to the audio signal reference. Input stage is built as a DC-AC inverter (push-pull, half-bridge or a full-bridge) and operated with 50% duty cycle, with all the challenges to avoid transformer saturation and obtain symmetrical operation. On the secondary side the output section is implemented as rectifier+inverter AC-AC stage, i.e. a true bidirectional bridge, which operation is aimed towards amplification of the audio signal. In order to solve the problem with the commutation of the load current, a dead time between the incoming and outgoing bidirectional switch is implemented, while a capacitive voltage clamp is used to keep the induced overvoltage to reasonable levels. The energy stored in the clamping capacitor is not wasted as in the dissipative clamps, but is rather transferred back to the primary side for further processing using an auxiliary isolated single-switch converter, i.e. an active clamping technique is used. (au)

  8. Investigating ion channel conformational changes using voltage clamp fluorometry.

    Science.gov (United States)

    Talwar, Sahil; Lynch, Joseph W

    2015-11-01

    Ion channels are membrane proteins whose functions are governed by conformational changes. The widespread distribution of ion channels, coupled with their involvement in most physiological and pathological processes and their importance as therapeutic targets, renders the elucidation of these conformational mechanisms highly compelling from a drug discovery perspective. Thanks to recent advances in structural biology techniques, we now have high-resolution static molecular structures for members of the major ion channel families. However, major questions remain to be resolved about the conformational states that ion channels adopt during activation, drug modulation and desensitization. Patch-clamp electrophysiology has long been used to define ion channel conformational states based on functional criteria. It achieves this by monitoring conformational changes at the channel gate and cannot detect conformational changes occurring in regions distant from the gate. Voltage clamp fluorometry involves labelling cysteines introduced into domains of interest with environmentally sensitive fluorophores and inferring structural rearrangements from voltage or ligand-induced fluorescence changes. Ion channel currents are monitored simultaneously to verify the conformational status. By defining real time conformational changes in domains distant from the gate, this technique provides unexpected new insights into ion channel structure and function. This review aims to summarise the methodology and highlight recent innovative applications of this powerful technique. This article is part of the Special Issue entitled 'Fluorescent Tools in Neuropharmacology'. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Voltage clamp methods for the study of membrane currents and SR Ca2+ release in adult skeletal muscle fibres

    Science.gov (United States)

    Hernández-Ochoa, Erick O.; Schneider, Martin F.

    2012-01-01

    Skeletal muscle excitation-contraction (E-C)1 coupling is a process composed of multiple sequential stages, by which an action potential triggers sarcoplasmic reticulum (SR)2 Ca2+ release and subsequent contractile activation. The various steps in the E-C coupling process in skeletal muscle can be studied using different techniques. The simultaneous recordings of sarcolemmal electrical signals and the accompanying elevation in myoplasmic Ca2+, due to depolarization-initiated SR Ca2+ release in skeletal muscle fibres, have been useful to obtain a better understanding of muscle function. In studying the origin and mechanism of voltage dependency of E-C coupling a variety of different techniques have been used to control the voltage in adult skeletal fibres. Pioneering work in muscles isolated from amphibians or crustaceans used microelectrodes or ‘high resistance gap’ techniques to manipulate the voltage in the muscle fibres. The development of the patch clamp technique and its variant, the whole-cell clamp configuration that facilitates the manipulation of the intracellular environment, allowed the use of the voltage clamp techniques in different cell types, including skeletal muscle fibres. The aim of this article is to present an historical perspective of the voltage clamp methods used to study skeletal muscle E-C coupling as well as to describe the current status of using the whole-cell patch clamp technique in studies in which the electrical and Ca2+ signalling properties of mouse skeletal muscle membranes are being investigated. PMID:22306655

  10. Novel high-voltage power lateral MOSFET with adaptive buried electrodes

    International Nuclear Information System (INIS)

    Zhang Wen-Tong; Wu Li-Juan; Qiao Ming; Luo Xiao-Rong; Zhang Bo; Li Zhao-Ji

    2012-01-01

    A new high-voltage and low-specific on-resistance (R on,sp ) adaptive buried electrode (ABE) silicon-on-insulator (SOI) power lateral MOSFET and its analytical model of the electric fields are proposed. The MOSFET features are that the electrodes are in the buried oxide (BOX) layer, the negative drain voltage V d is divided into many partial voltages and the output to the electrodes is in the buried oxide layer and the potentials on the electrodes change linearly from the drain to the source. Because the interface silicon layer potentials are lower than the neighboring electrode potentials, the electronic potential wells are formed above the electrode regions, and the hole potential wells are formed in the spacing of two neighbouring electrode regions. The interface hole concentration is much higher than the electron concentration through designing the buried layer electrode potentials. Based on the interface charge enhanced dielectric layer field theory, the electric field strength in the buried layer is enhanced. The vertical electric field E I and the breakdown voltage (BV) of ABE SOI are 545 V/μm and −587 V in the 50 μm long drift region and the 1 μm thick dielectric layer, and a low R on,sp is obtained. Furthermore, the structure also alleviates the self-heating effect (SHE). The analytical model matches the simulation results. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  11. Monitoring voltage-sensitive membrane impedance change using radio frequency interrogation.

    Science.gov (United States)

    Dharia, Sameera; Rabbitt, Richard D

    2010-01-01

    Here we present a new technique to monitor dynamic conformational changes in voltage-sensitive membrane-bound proteins using radio frequency (RF) impedance measurements. Xenopus oocytes were transfected to express ShakerB-IR K(+) ion channels, and step changes in membrane potential were applied using two-electrode voltage clamp (TEVC). Simultaneously, bipolar extracellular electrodes were used to measure the RF electrical impedance across the cell (300 kHz - 1 MHz). RF current will either pass through the media, around the cell, or displace charge across the cell membrane. The change in displacement current in the cell membrane during voltage clamp resulted in measurable RF impedance change. RF impedance change during DC membrane depolarization was significantly greater in ShakerB-IR expressing oocytes than in endogenous controls at 300 kHz, 500 kHz and, to a lesser extent, 1 MHz. Since the RF were too high to modulate ShakerB-IR protein conformational state (e.g. open channel probability), impedance changes are interpreted as reflections of voltage-dependent protein conformation and associated biophysics such as ion-channel dipole interactions, fluctuations in bound water, or charged lipid head-group rotations.

  12. Quantitative analysis of dual whole-cell voltage-clamp determination of gap junctional conductance

    NARCIS (Netherlands)

    van Rijen, H. V.; Wilders, R.; van Ginneken, A. C.; Jongsma, H. J.

    1998-01-01

    The dual whole-cell voltage-clamp technique is used widely for determination of kinetics and conductance of gap junctions. The use of this technique may, however, occasion to considerable errors. We have analysed the errors in steady state junctional conductance measurements under different

  13. Limitations of the dual voltage clamp method in assaying conductance and kinetics of gap junction channels

    NARCIS (Netherlands)

    Wilders, R.; Jongsma, H. J.

    1992-01-01

    The electrical properties of gap junctions in cell pairs are usually studied by means of the dual voltage clamp method. The voltage across the junctional channels, however, cannot be controlled adequately due to an artificial resistance and a natural resistance, both connected in series with the gap

  14. Cold-electrode voltage fall for impulse arcs in argon between copper electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Diaz, O; Cooray, V, E-mail: oscar.diaz@angstrom.uu.se [Lightning Research Group, Division for Electricity, Uppsala University Angstroemlaboratoriet Box 5234, 751 20, Uppsala (Sweden)

    2011-06-23

    The full electric arc discharge in gases for short gaps in homogeneous electric field and pressure{center_dot}distance (pd) below 150 Torr{center_dot}cm, can be described as a transition between different discharge mechanisms such as: Townsend, glow, and arc. Once the arc is achieved the measured voltage drops to some volts and the current density increases several orders of magnitude. Depending upon the type of gas used, the electrode surface characteristics and type of electrical excitation, the cathode and anode voltage fall might change. The present work is directed to study the electrode fall (sum of anode and cathode falls) during a current impulse arc discharge between copper electrodes in ceramic tubes filled with argon between 0.01 and 6.5 Torr{center_dot}cm. The copper electrodes were cleaned, degassed and hydrogen reduced. The arc voltages were measured with fast/slow rise times and short/long duration current impulses produced by a RLC circuit. An increasing variation of the electrode fall was found at the pressure{center_dot}distance range analyzed.

  15. Overmodulation of n-level three-leg DC-AC diode-clamped converters with comprehensive capacitor voltage balance

    DEFF Research Database (Denmark)

    Busquets-Monge, S.; Maheshwari, Ram Krishan; Munk-Nielsen, Stig

    2013-01-01

    This paper presents a novel PWM strategy for nlevel three-leg semiconductor-clamped dc-ac converters in the overmodulation region, with dc-link capacitor voltage balance in every switching cycle. The strategy is based on the virtual-vector concept. Suitable reference vector trajectories are selec......This paper presents a novel PWM strategy for nlevel three-leg semiconductor-clamped dc-ac converters in the overmodulation region, with dc-link capacitor voltage balance in every switching cycle. The strategy is based on the virtual-vector concept. Suitable reference vector trajectories...

  16. A self-strain feedback tuning-fork-shaped ionic polymer metal composite clamping actuator with soft matter elasticity-detecting capability for biomedical applications.

    Science.gov (United States)

    Feng, Guo-Hua; Huang, Wei-Lun

    2014-12-01

    This paper presents a smart tuning-fork-shaped ionic polymer metal composite (IPMC) clamping actuator for biomedical applications. The two fingers of the actuator, which perform the clamping motion, can be electrically controlled through a unique electrode design on the IPMC material. The generated displacement or strain of the fingers can be sensed using an integrated soft strain-gage sensor. The IPMC actuator and associated soft strain gage were fabricated using a micromachining technique. A 13.5×4×2 mm(3) actuator was shaped from Nafion solution and a selectively grown metal electrode formed the active region. The strain gage consisted of patterned copper foil and polyethylene as a substrate. The relationship between the strain gage voltage output and the displacement at the front end of the actuator's fingers was characterized. The equivalent Young's modulus, 13.65 MPa, of the soft-strain-gage-integrated IPMC finger was analyzed. The produced clamping force exhibited a linear increasing rate of 1.07 mN/s, based on a dc driving voltage of 7 V. Using the developed actuator to clamp soft matter and simultaneously acquire its Young's modulus was achieved. This demonstrated the feasibility of the palpation function and the potential use of the actuator in minimally invasive surgery. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Effects of Electrode Material on the Voltage of a Tree-Based Energy Generator.

    Science.gov (United States)

    Hao, Zhibin; Wang, Guozhu; Li, Wenbin; Zhang, Junguo; Kan, Jiangming

    2015-01-01

    The voltage between a standing tree and its surrounding soil is regarded as an innovative renewable energy source. This source is expected to provide a new power generation system for the low-power electrical equipment used in forestry. However, the voltage is weak, which has caused great difficulty in application. Consequently, the development of a method to increase the voltage is a key issue that must be addressed in this area of applied research. As the front-end component for energy harvesting, a metal electrode has a material effect on the level and stability of the voltage obtained. This study aimed to preliminarily ascertain the rules and mechanisms that underlie the effects of electrode material on voltage. Electrodes of different materials were used to measure the tree-source voltage, and the data were employed in a comparative analysis. The results indicate that the conductivity of the metal electrode significantly affects the contact resistance of the electrode-soil and electrode-trunk contact surfaces, thereby influencing the voltage level. The metal reactivity of the electrode has no significant effect on the voltage. However, passivation of the electrode materials markedly reduces the voltage. Suitable electrode materials are demonstrated and recommended.

  18. Effects of Electrode Material on the Voltage of a Tree-Based Energy Generator.

    Directory of Open Access Journals (Sweden)

    Zhibin Hao

    Full Text Available The voltage between a standing tree and its surrounding soil is regarded as an innovative renewable energy source. This source is expected to provide a new power generation system for the low-power electrical equipment used in forestry. However, the voltage is weak, which has caused great difficulty in application. Consequently, the development of a method to increase the voltage is a key issue that must be addressed in this area of applied research. As the front-end component for energy harvesting, a metal electrode has a material effect on the level and stability of the voltage obtained. This study aimed to preliminarily ascertain the rules and mechanisms that underlie the effects of electrode material on voltage. Electrodes of different materials were used to measure the tree-source voltage, and the data were employed in a comparative analysis. The results indicate that the conductivity of the metal electrode significantly affects the contact resistance of the electrode-soil and electrode-trunk contact surfaces, thereby influencing the voltage level. The metal reactivity of the electrode has no significant effect on the voltage. However, passivation of the electrode materials markedly reduces the voltage. Suitable electrode materials are demonstrated and recommended.

  19. Equivalent circuit of frog atrial tissue as determined by voltage clamp-unclamp experiments.

    Science.gov (United States)

    Tarr, M; Trank, J

    1971-11-01

    The equivalent circuit that has been used in the analysis of nerve voltage-clamp data is that of the membrane capacity in parallel with the membrane resistance. Voltage-clamp experiments on frog atrial tissue indicate that this circuit will not suffice for this cardiac tissue. The change in membrane current associated with a step change in membrane potential does not show a rapid spike of capacitive current as would be expected for the simple parallel resistance-capacitance network. Rather, there is a step change in current followed by an exponential decay in current with a time constant of about 1 msec. This relatively slow capacitive charging current suggests that there is a resistance in series with the membrane capacity. A possible equivalent circuit is that of a series resistance external to the parallel resistance-capacitance network of the cell membranes. Another possible circuit assumes that the series resistance is an integral part of the cell membrane. The data presented in this paper demonstrate that the equivalent circuit of a bundle of frog atrial muscle is that of an external resistance in series with the cell membranes.

  20. TiN coated aluminum electrodes for DC high voltage electron guns

    International Nuclear Information System (INIS)

    Mamun, Md Abdullah A.; Elmustafa, Abdelmageed A.; Taus, Rhys; Forman, Eric; Poelker, Matthew

    2015-01-01

    Preparing electrodes made of metals like stainless steel, for use inside DC high voltage electron guns, is a labor-intensive and time-consuming process. In this paper, the authors report the exceptional high voltage performance of aluminum electrodes coated with hard titanium nitride (TiN). The aluminum electrodes were comparatively easy to manufacture and required only hours of mechanical polishing using silicon carbide paper, prior to coating with TiN by a commercial vendor. The high voltage performance of three TiN-coated aluminum electrodes, before and after gas conditioning with helium, was compared to that of bare aluminum electrodes, and electrodes manufactured from titanium alloy (Ti-6Al-4V). Following gas conditioning, each TiN-coated aluminum electrode reached −225 kV bias voltage while generating less than 100 pA of field emission (<10 pA) using a 40 mm cathode/anode gap, corresponding to field strength of 13.7 MV/m. Smaller gaps were studied to evaluate electrode performance at higher field strength with the best performing TiN-coated aluminum electrode reaching ∼22.5 MV/m with field emission less than 100 pA. These results were comparable to those obtained from our best-performing electrodes manufactured from stainless steel, titanium alloy and niobium, as reported in references cited below. The TiN coating provided a very smooth surface and with mechanical properties of the coating (hardness and modulus) superior to those of stainless steel, titanium-alloy, and niobium electrodes. These features likely contributed to the improved high voltage performance of the TiN-coated aluminum electrodes

  1. New Modulation Strategy to Balance the Neutral-Point Voltage for Three-Level Neutral-Clamped Inverter Systems

    DEFF Research Database (Denmark)

    Choi, Uimin; Lee, June-Seok; Lee, Kyo-Beum

    2014-01-01

    This paper proposes a new modulation strategy that balances the neutral-point voltage for three-level neutral-clamped inverter systems. The proposed modulation replaces the P-type or N-type small switching states with other switching states that do not affect the neutral-point voltage. The zero...... and medium switching states are employed to help the neutral-point voltage balancing. This method little bit increases the switching events and output total harmonic distortion. However, this method has a strong balancing ability at all regions. Further, it is very simple to implement in both space vector...

  2. Voltage-Sharing Converter to Supply Single-Phase Asymmetrical Four-Level Diode-Clamped Inverter With High Power Factor Loads

    DEFF Research Database (Denmark)

    Boora, Arash A.; Nami, Alireza; Zare, Firuz

    2010-01-01

    The output voltage quality of some of the single-phase multilevel inverters can be improved when their dc-link voltages are regulated asymmetrically. Symmetrical and asymmetrical multilevel diode-clamped inverters have the problem of dc-link capacitor voltage balancing, especially when power factor...... that the proposed combination of introduced multioutput dc–dc converter and single-phase ADCI is a good candidate for power conversion in residential photovoltaic (PV) utilization....

  3. A Component-Reduced Zero-Voltage Switching Three-Level DC-DC Converter

    DEFF Research Database (Denmark)

    Qin, Zian; Pang, Ying; Wang, Huai

    2016-01-01

    The basic Zero-Voltage Switching (ZVS) three-level DC-DC converter has one clamping capacitor to realize the ZVS of the switches, and two clamping diodes to clamp the voltage of the clamping capacitor. In order to reduce the reverse recovery loss of the diode as well as its cost, this paper...... proposes to remove one of the clamping diodes in basic ZVS three-level DC-DC converter. With less components, the proposed converter can still have a stable clamping capacitor voltage, which is clamped at half of the dc link voltage. Moreover, the ZVS performance will be influenced by removing the clamping...

  4. Dual patch voltage clamp study of low membrane resistance astrocytes in situ.

    Science.gov (United States)

    Ma, Baofeng; Xu, Guangjin; Wang, Wei; Enyeart, John J; Zhou, Min

    2014-03-17

    Whole-cell patch clamp recording has been successfully used in identifying the voltage-dependent gating and conductance properties of ion channels in a variety of cells. However, this powerful technique is of limited value in studying low membrane resistance cells, such as astrocytes in situ, because of the inability to control or accurately measure the real amplitude of command voltages. To facilitate the study of ionic conductances of astrocytes, we have developed a dual patch recording method which permits membrane current and membrane potential to be simultaneously recorded from astrocytes in spite of their extraordinarily low membrane resistance. The utility of this technique is demonstrated by measuring the voltage-dependent activation of the inwardly rectifying K+ current abundantly expressed in astrocytes and multiple ionic events associated with astrocytic GABAA receptor activation. This protocol can be performed routinely in the study of astrocytes. This method will be valuable for identifying and characterizing the individual ion channels that orchestrate the electrical activity of low membrane resistance cells.

  5. Direct-conversion switching-mode audio power amplifier with active capacitive voltage clamp

    Energy Technology Data Exchange (ETDEWEB)

    Ljusev, P.; Andersen, Michael A.E.

    2005-07-01

    This paper discusses the advantages and problems when implementing direct energy conversion switching-mode audio power amplifiers. It is shown that the total integration of the power supply and Class D audio power amplifier into one compact direct converter can simplify design, increase efficiency and integration level, reduce product volume and lower its cost. As an example, the principle of operation and the measurements made on a direct-conversion switching-mode audio power amplifier with active capacitive voltage clamp are presented. (au)

  6. Direct-conversion switching-mode audio power amplifier with active capacitive voltage clamp

    DEFF Research Database (Denmark)

    Ljusev, Petar; Andersen, Michael Andreas E.

    2005-01-01

    This paper discusses the advantages and problems when implementing direct energy conversion switching-mode audio power amplifiers. It is shown that the total integration of the power supply and Class D audio power amplifier into one compact direct converter can simplify the design, increase...... efficiency, reduce the product volume and lower its cost. As an example, the principle of operation and the measurements made on a direct-conversion switching-mode audio power amplifier with active capacitive voltage clamp are presented....

  7. Limitations of the dual voltage clamp method in assaying conductance and kinetics of gap junction channels

    OpenAIRE

    Wilders, R.; Jongsma, H.J.

    1992-01-01

    The electrical properties of gap junctions in cell pairs are usually studied by means of the dual voltage clamp method. The voltage across the junctional channels, however, cannot be controlled adequately due to an artificial resistance and a natural resistance, both connected in series with the gap junction. The access resistances to the cell interior of the recording pipettes make up the artificial resistance. The natural resistance consists of the cytoplasmic access resistances to the tigh...

  8. Monitoring Voltage-Dependent Charge Displacement of Shaker B-IR K+ Ion Channels Using Radio Frequency Interrogation

    OpenAIRE

    Dharia, Sameera; Rabbitt, Richard D.

    2011-01-01

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...

  9. Technique eliminates high voltage arcing at electrode-insulator contact area

    Science.gov (United States)

    Mealy, G.

    1967-01-01

    Coating the electrode-insulator contact area with silver epoxy conductive paint and forcing the electrode and insulator tightly together into a permanent connection, eliminates electrical arcing in high-voltage electrodes supplying electrical power to vacuum facilities.

  10. High-voltage electrode optimization towards uniform surface treatment by a pulsed volume discharge

    International Nuclear Information System (INIS)

    Ponomarev, A V; Pedos, M S; Scherbinin, S V; Mamontov, Y I; Ponomarev, S V

    2015-01-01

    In this study, the shape and material of the high-voltage electrode of an atmospheric pressure plasma generation system were optimised. The research was performed with the goal of achieving maximum uniformity of plasma treatment of the surface of the low-voltage electrode with a diameter of 100 mm. In order to generate low-temperature plasma with the volume of roughly 1 cubic decimetre, a pulsed volume discharge was used initiated with a corona discharge. The uniformity of the plasma in the region of the low-voltage electrode was assessed using a system for measuring the distribution of discharge current density. The system's low-voltage electrode - collector - was a disc of 100 mm in diameter, the conducting surface of which was divided into 64 radially located segments of equal surface area. The current at each segment was registered by a high-speed measuring system controlled by an ARM™-based 32-bit microcontroller. To facilitate the interpretation of results obtained, a computer program was developed to visualise the results. The program provides a 3D image of the current density distribution on the surface of the low-voltage electrode. Based on the results obtained an optimum shape for a high-voltage electrode was determined. Uniformity of the distribution of discharge current density in relation to distance between electrodes was studied. It was proven that the level of non-uniformity of current density distribution depends on the size of the gap between electrodes. Experiments indicated that it is advantageous to use graphite felt VGN-6 (Russian abbreviation) as the material of the high-voltage electrode's emitting surface. (paper)

  11. Ion peak narrowing by applying additional AC voltage (ripple voltage) to FAIMS extractor electrode.

    Science.gov (United States)

    Pervukhin, Viktor V; Sheven, Dmitriy G

    2010-01-01

    The use of a non-uniform electric field in a high-field asymmetric waveform ion mobility spectrometry (FAIMS) analyzer increases sensitivity but decreases resolution. The application of an additional AC voltage to the extractor electrode ("ripple" voltage, U(ripple)) can overcome this effect, which decreases the FAIMS peak width. In this approach, the diffusion ion loss remains minimal in the non-uniform electric field in the cylindrical part of the device, and all ion losses under U(ripple) occur in a short portion of their path. Application of the ripple voltage to the extractor electrode is twice as efficient as the applying of U(ripple) along the total length of the device. 2010 American Society for Mass Spectrometry. Published by Elsevier Inc. All rights reserved.

  12. High voltage performance of a dc photoemission electron gun with centrifugal barrel-polished electrodes

    Science.gov (United States)

    Hernandez-Garcia, C.; Bullard, D.; Hannon, F.; Wang, Y.; Poelker, M.

    2017-09-01

    The design and fabrication of electrodes for direct current (dc) high voltage photoemission electron guns can significantly influence their performance, most notably in terms of maximum achievable bias voltage. Proper electrostatic design of the triple-point junction shield electrode minimizes the risk of electrical breakdown (arcing) along the insulator-cable plug interface, while the electrode shape is designed to maintain work, we describe a centrifugal barrel-polishing technique commonly used for polishing the interior surface of superconducting radio frequency cavities but implemented here for the first time to polish electrodes for dc high voltage photoguns. The technique reduced polishing time from weeks to hours while providing surface roughness comparable to that obtained with diamond-paste polishing and with unprecedented consistency between different electrode samples. We present electrode design considerations and high voltage conditioning results to 360 kV (˜11 MV/m), comparing barrel-polished electrode performance to that of diamond-paste polished electrodes. Tests were performed using a dc high voltage photogun with an inverted-geometry ceramic insulator design.

  13. IMPORTANT: Fluke is recalling Digital Clamp Meters

    CERN Multimedia

    2013-01-01

    Fluke is voluntarily recalling four models of Digital Clamp Meters: Fluke 373, 374, 375 and 376. If you own one of these clamp meters, please stop using it and send it back to Fluke for repair even if you have not experienced problems.   Description of the problem: "The printed circuit assembly may not be properly fastened to the test lead input jack. This may result in inaccurate voltage readings, including a low or no-voltage reading on a circuit energised with a hazardous voltage, presenting a shock, electrocution or thermal burn hazard." To determine if your clamp meter is affected by this recall notice, and for more information, click here.

  14. Characterization of chaotic electroconvection near flat electrodes under oscillatory voltages

    Science.gov (United States)

    Kim, Jeonglae; Davidson, Scott; Mani, Ali

    2017-11-01

    Onset of hydrodynamic instability and chaotic electroconvection in aqueous systems are studied by directly solving the two-dimensional coupled Poisson-Nernst-Planck and Navier-Stokes equations. An aqueous binary electrolyte is bounded by two planar electrodes where time-harmonic voltage is applied at a constant oscillation frequency. The governing equations are solved using a fully-conservative second-order-accurate finite volume discretization and a second-order implicit Euler time advancement. At a sufficiently high amplitude of applied voltage, the system exhibits chaotic behaviors involving strong hydrodynamic mixing and enhanced electroconvection. The system responses are characterized as a function of oscillation frequency, voltage magnitude, and the ratio of diffusivities of two ion species. Our results indicate that electroconvection is most enhanced for frequencies on the order of inverse system RC time scale. We will discuss the dependence of this optimal frequency on the asymmetry of the diffusion coefficients of ionic species. Supported by the Stanford's Precourt Institute.

  15. General Voltage Feedback Circuit Model in the Two-Dimensional Networked Resistive Sensor Array

    Directory of Open Access Journals (Sweden)

    JianFeng Wu

    2015-01-01

    Full Text Available To analyze the feature of the two-dimensional networked resistive sensor array, we firstly proposed a general model of voltage feedback circuits (VFCs such as the voltage feedback non-scanned-electrode circuit, the voltage feedback non-scanned-sampling-electrode circuit, and the voltage feedback non-scanned-sampling-electrode circuit. By analyzing the general model, we then gave a general mathematical expression of the effective equivalent resistor of the element being tested in VFCs. Finally, we evaluated the features of VFCs with simulation and test experiment. The results show that the expression is applicable to analyze the VFCs’ performance of parameters such as the multiplexers’ switch resistors, the nonscanned elements, and array size.

  16. A new method for analyzing and design of guard electrodes of high voltage insulators chain

    International Nuclear Information System (INIS)

    Vahidi, B.; Mohammad Zadeh, A.

    2002-01-01

    The main aim of this paper is analyzing design of guard electrodes of high voltage insulators chain. These electrodes are used for making the distribution of uniform potential across the insulators chain, reducing leakage current and preventing the degradation of insulators. If the design is not correct or in the case of insulators chain without guard electrodes, the potential distribution will not uniform. Thus the voltage drops on the insulators adjacent to conductors will be more than maximum voltage that can be tolerated by the insulators. Therefore these voltage drops can damage the insulators. In this paper A new method is introduced for analyzing and design of ga urad electrodes of high voltage insulators chain

  17. Transformer-based asymmetrical embedded Z-source neutral point clamped inverters with continuous input current and enhanced voltage boost capability

    DEFF Research Database (Denmark)

    Mo, W.; Loh, Poh Chiang; Blaabjerg, Frede

    2013-01-01

    Z-source Neutral Point Clamped (NPC) inverters were introduced to integrate both the advantages of Z-source inverters and NPC inverters. However, traditional Z-source inverters suffer from high voltage stress and chopping input current. This paper proposes six types transformer-based impedance-so......-source NPC inverters which have enhanced voltage boost capability and continuous input current by utilizing of transformer and embedded dc source configuration. Experimental results are presented to verify the theory validation....

  18. A DC-Link Voltage Self-Balance Method for a Diode-Clamped Modular Multilevel Converter With Minimum Number of Voltage Sensors

    DEFF Research Database (Denmark)

    Gao, Congzhe; Jiang, Xinjian; Li, Yongdong

    2013-01-01

    Voltage balance issue of dc-link capacitors is very important for applications of a cascade multilevel converter or a modular multilevel converter. In this paper, a novel diode-clamped modular multilevel converter (DCM2C) topology is proposed and a power feedback control method is developed...... used traditional method; therefore, the system performance improvement and cost reduction are expected. Based on the proposed DCM2C, a novel N +1-level cascade multilevel topology is proposed for a cascade active power filter (CS-APF). The simulation and experimental results from the CS-APF have...

  19. High voltage and high specific capacity dual intercalating electrode Li-ion batteries

    Science.gov (United States)

    West, William C. (Inventor); Blanco, Mario (Inventor)

    2010-01-01

    The present invention provides high capacity and high voltage Li-ion batteries that have a carbonaceous cathode and a nonaqueous electrolyte solution comprising LiF salt and an anion receptor that binds the fluoride ion. The batteries can comprise dual intercalating electrode Li ion batteries. Methods of the present invention use a cathode and electrode pair, wherein each of the electrodes reversibly intercalate ions provided by a LiF salt to make a high voltage and high specific capacity dual intercalating electrode Li-ion battery. The present methods and systems provide high-capacity batteries particularly useful in powering devices where minimizing battery mass is important.

  20. Electrical crosstalk in two-port piezoelectric resonators and compensation solutions

    International Nuclear Information System (INIS)

    Qiu, H C; Schwarz, P; Völlm, H; Feili, D; Seidel, H; Wu, X Z

    2013-01-01

    Crosstalk is an impediment to electrically interfaced two-port resonators. The overall output function of two-port piezoelectric resonator is a superposition of the mechanical resonance behavior and electrical crosstalk, the latter coming mainly from the coupling feedthrough capacitance. In this paper, two crosstalk compensation solutions have been developed for an aluminum nitride-based doubly clamped beam resonator. The first solution demonstrates an on-chip self-cancellation technique of the feedthrough capacitance by using a compensation electrode and applying a complementary voltage to it, while the second solution applies an adjustable compensation voltage to the common bottom electrode. A specifically designed compensation-readout circuit is presented. Experimental investigations of the output signal have proved the efficiency of both crosstalk compensation solutions. (paper)

  1. Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

    Science.gov (United States)

    White, William E.

    2013-01-01

    Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

  2. Electrode configuration effects on the electrification and voltage variation in an electrostatic inkjet printing head

    International Nuclear Information System (INIS)

    Choi, Kyung Hyun; Ali, Adnan; Rahman, Ahsan; Malik Mohammad, Nauman; Rahman, Khalid; Khan, Arshad; Khan, Saleem; Kim, D S

    2010-01-01

    The electrode configuration of an electrostatic inkjet printing head is under study. This paper introduces the development of a new electrostatic inkjet head with an improved electrode configuration as compared to the conventional configuration. Two tungsten electrodes, connected in parallel, are inserted into the electrostatic print head at a certain angle from opposite sides. The aim of this double-side inserted angular electrodes (DSIAEs) head is to intensify the electrification of the fluid inside the head at minimum suitable exposure of the electrode, which results in maximizing surface charge density. The main advantage of the DSIAEs head is to get a very stable meniscus at low applied voltage for printing. This stable meniscus is transformed to a very stable jet by increasing the applied voltage. Therefore, printed patterns obtained with this DSIAEs head are more uniform because of a more stable meniscus and jet as compared to a conventional electrostatic vertically inserted single electrode head. Also, with this DSIAEs configuration, the life of the electrostatic inkjet printing head is increased.

  3. Excitation contraction uncoupling by high intracellular [Ca2+] in frog skeletal muscle: a voltage clamp study.

    Science.gov (United States)

    Olivera, J Fernando; Pizarro, Gonzalo

    2016-10-01

    Raising the intracellular [Ca 2+ ] ([Ca 2+ ] i ) was previously found to produce uncoupling between the electrical depolarization of the transverse tubules and contraction in skinned muscle fibers. Here we study the effect of elevated [Ca 2+ ] i in voltage clamped cut fibers of frog skeletal muscle to establish how the charge movement, a measure of the activation of the dihydropyridine receptors (DHPR)-voltage sensors, and Ca 2+ release, a consequence of the opening of the ryanodine receptor (RyR)-release channels, were affected. [Ca 2+ ] i was raised by various procedures (pharmacological release from the sarcoplasmic reticulum, application of high [Ca 2+ ] i intracellular solution, permeabilization of the plasma membrane by a Ca 2+ ionophore) all of which produced impairment of excitation-contraction coupling. The charge movement was reduced from 20.2 ± 1.24 to 9.9 ± 0.94 nC/μF meanwhile the Ca 2+ release flux was reduced from 13.5 + 0.7 to 2.2 ± 0.3 μM/ms (n = 33). This suggests that a significant fraction of the DHPRs that remained functional, could not activate RyRs, and were therefore presumably disconnected. These results are broadly consistent with the original reports in skinned fibers. Uncoupling was prevented by the addition to the intracellular solution of the protease inhibitor leupeptin. In approximately 40 % of the uncoupled cells we observed that the [Ca 2+ ] i transient continued to rise after the voltage clamp pulse was turned off. This loss of control by membrane voltage suggests that the uncoupled release channels might have another mechanism of activation, likely by Ca 2+ .

  4. Five-level Z-source diode-clamped inverter

    DEFF Research Database (Denmark)

    Gao, F.; Loh, Poh Chiang; Blaabjerg, Frede

    2010-01-01

    This study proposes a five-level Z-source diode-clamped inverter designed with two intermediate Z-source networks connected between the dc input sources and rear-end inverter circuitry. By partially shorting the Z-source networks, new operating states not previously reported for two-level Z......-source inverter are introduced here for operating the proposed inverter with voltage buck–boost energy conversion ability and five-level phase voltage switching. These characteristic features are in fact always ensured at the inverter terminal output by simply adopting a properly designed carrier modulation...

  5. Observation of electrostatically released DNA from gold electrodes with controlled threshold voltages.

    Science.gov (United States)

    Takeishi, Shunsaku; Rant, Ulrich; Fujiwara, Tsuyoshi; Buchholz, Karin; Usuki, Tatsuya; Arinaga, Kenji; Takemoto, Kazuya; Yamaguchi, Yoshitaka; Tornow, Marc; Fujita, Shozo; Abstreiter, Gerhard; Yokoyama, Naoki

    2004-03-22

    DNA oligo-nucleotides, localized at Au metal electrodes in aqueous solution, are found to be released when applying a negative bias voltage to the electrode. The release was confirmed by monitoring the intensity of the fluorescence of cyanine dyes (Cy3) linked to the 5' end of the DNA. The threshold voltage of the release changes depending on the kind of linker added to the DNA 3'-terminal. The amount of released DNA depends on the duration of the voltage pulse. Using this technique, we can retain DNA at Au electrodes or Au needles, and release the desired amount of DNA at a precise location in a target. The results suggest that DNA injection into living cells is possible with this method. (c) 2004 American Institute of Physics

  6. Achievable peak electrode voltage reduction by neurostimulators using descending staircase currents to deliver charge.

    Science.gov (United States)

    Halpern, Mark

    2011-01-01

    This paper considers the achievable reduction in peak voltage across two driving terminals of an RC circuit when delivering charge using a stepped current waveform, comprising a chosen number of steps of equal duration, compared with using a constant current over the total duration. This work has application to the design of neurostimulators giving reduced peak electrode voltage when delivering a given electric charge over a given time duration. Exact solutions for the greatest possible peak voltage reduction using two and three steps are given. Furthermore, it is shown that the achievable peak voltage reduction, for any given number of steps is identical for simple series RC circuits and parallel RC circuits, for appropriate different values of RC. It is conjectured that the maximum peak voltage reduction cannot be improved using a more complicated RC circuit.

  7. Pulsewidth-modulated 2-source neutral-point-clamped inverter

    DEFF Research Database (Denmark)

    Blaabjerg, Frede; Loh, Poh Chang; Gao, Feng

    2007-01-01

    This paper presents the careful integration of a newly proposed Z-source topological concept to the basic neutral-point-clamped (NPC) inverter topology for designing a three-level inverter with both voltage-buck and voltage-boost capabilities. The designed Z-source NPC inverter uses two unique X......-shaped inductance-capacitance (LC) impedance networks that are connected between two isolated dc input power sources and its inverter circuitry for boosting its AC output voltage. Through the design of an appropriate pulsewidth-modulation (PWM) algorithm, the two impedance networks can be short......-circuited sequentially (without shooting through the inverter full DC link) for implementing the ldquonearest-three-vectorrdquo modulation principle with minimized harmonic distortion and device commutations per half carrier cycle while performing voltage boosting. With only a slight modification to the inverter PWM...

  8. Comparison between symmetrical and asymmetrical single phase multilevel inverter with diode-clamped topology

    DEFF Research Database (Denmark)

    Blaabjerg, Frede; Nami, A.; Zare, F.

    2008-01-01

    In this paper, a different configuration based on different DC bus voltage for a diode-clamped multilevel inverter has been presented. Two different symmetrical and asymmetrical arrangements of a four-level diode clamped inverters have been compared, in order to find an optimum arrangement...... compared with the conventional four-level inverter and this will lead to the reduction of harmonic content of output voltage. A predictive current control technique has been carried out to verify the viability of new configuration. The advantages of this control method are simplicity and applicability...

  9. High voltage load resistor array

    Science.gov (United States)

    Lehmann, Monty Ray [Smithfield, VA

    2005-01-18

    A high voltage resistor comprising an array of a plurality of parallel electrically connected resistor elements each containing a resistive solution, attached at each end thereof to an end plate, and about the circumference of each of the end plates, a corona reduction ring. Each of the resistor elements comprises an insulating tube having an electrode inserted into each end thereof and held in position by one or more hose clamps about the outer periphery of the insulating tube. According to a preferred embodiment, the electrode is fabricated from stainless steel and has a mushroom shape at one end, that inserted into the tube, and a flat end for engagement with the end plates that provides connection of the resistor array and with a load.

  10. A High Step-Down Interleaved Buck Converter with Active-Clamp Circuits for Wind Turbines

    Directory of Open Access Journals (Sweden)

    Chih-Lung Shen

    2012-12-01

    Full Text Available In this paper, a high step-down interleaved buck coupled-inductor converter (IBCC with active-clamp circuits for wind energy conversion has been studied. In high step-down voltage applications, an IBCC can extend duty ratio and reduce voltage stresses on active switches. In order to reduce switching losses of active switches to improve conversion efficiency, a IBCC with soft-switching techniques is usually required. Compared with passive-clamp circuits, the IBCC with active-clamp circuits have lower switching losses and minimum ringing voltage of the active switches. Thus, the proposed IBCC with active-clamp circuits for wind energy conversion can significantly increase conversion efficiency. Finally, a 240 W prototype of the proposed IBCC with active-clamp circuits was built and implemented. Experimental results have shown that efficiency can reach as high as 91%. The proposed IBCC with active-clamp circuits is presented in high step-down voltage applications to verify the performance and the feasibility for energy conversion of wind turbines.

  11. Closed-form solution for static pull-in voltage of electrostatically actuated clamped-clamped micro/nano beams under the effect of fringing field and van der Waals force

    Science.gov (United States)

    Bhojawala, V. M.; Vakharia, D. P.

    2017-12-01

    This investigation provides an accurate prediction of static pull-in voltage for clamped-clamped micro/nano beams based on distributed model. The Euler-Bernoulli beam theory is used adapting geometric non-linearity of beam, internal (residual) stress, van der Waals force, distributed electrostatic force and fringing field effects for deriving governing differential equation. The Galerkin discretisation method is used to make reduced-order model of the governing differential equation. A regime plot is presented in the current work for determining the number of modes required in reduced-order model to obtain completely converged pull-in voltage for micro/nano beams. A closed-form relation is developed based on the relationship obtained from curve fitting of pull-in instability plots and subsequent non-linear regression for the proposed relation. The output of regression analysis provides Chi-square (χ 2) tolerance value equals to 1  ×  10-9, adjusted R-square value equals to 0.999 29 and P-value equals to zero, these statistical parameters indicate the convergence of non-linear fit, accuracy of fitted data and significance of the proposed model respectively. The closed-form equation is validated using available data of experimental and numerical results. The relative maximum error of 4.08% in comparison to several available experimental and numerical data proves the reliability of the proposed closed-form equation.

  12. Implementation of a fast 16-Bit dynamic clamp using LabVIEW-RT.

    Science.gov (United States)

    Kullmann, Paul H M; Wheeler, Diek W; Beacom, Joshua; Horn, John P

    2004-01-01

    The dynamic-clamp method provides a powerful electrophysiological tool for creating virtual ionic conductances in living cells and studying their influence on membrane potential. Here we describe G-clamp, a new way to implement a dynamic clamp using the real-time version of the Lab-VIEW programming environment together with a Windows host, an embedded microprocessor that runs a real-time operating system and a multifunction data-acquisition board. The software includes descriptions of a fast voltage-dependent sodium conductance, delayed rectifier, M-type and A-type potassium conductances, and a leak conductance. The system can also read synaptic conductance waveforms from preassembled data files. These virtual conductances can be reliably implemented at speeds < or =43 kHz while simultaneously saving two channels of data with 16-bit precision. G-clamp also includes utilities for measuring current-voltage relations, synaptic strength, and synaptic gain. Taking an approach built on a commercially available software/hardware platform has resulted in a system that is easy to assemble and upgrade. In addition, the graphical programming structure of LabVIEW should make it relatively easy for others to adapt G-clamp for new experimental applications.

  13. THREE-ELECTRODE AIR SWITCHBOARD WITH THE GRAPHITE ELECTRODES OF KATG-50 ON VOLTAGE TO ±50 KV AND IMPULSE CURRENT BY AMPLITUDE TO ±220 KA

    Directory of Open Access Journals (Sweden)

    M. I. Baranov

    2015-04-01

    Full Text Available Purpose. Development and creation of the simplified construction of a high-voltage heavy-current air three-electrode switchboard with graphite electrodes, intended for operation in composition the powerful generator of large impulsive current of artificial of linear lightning. Methodology. Electrophysics bases of technique of high-voltage and scientific and technical bases of planning of devices of high-voltage impulsive technique. Results. Developed and made a new construction of a high-voltage heavy-current air three-electrode switchboard with the graphite electrodes of KATG-50 on nominal voltage ±50 kV. This construction of switchboard KATG-50 has been passed experimental approbation in composition the heavy-current bit chain of powerful high-voltage generator of the аperiodic impulses of current of artificial linear lightning rationed on operating foreign standards with amplitude of Im=±(200±20 кА at their duration τP=(350±35 μs at level 0,5∙Im. Originality. First in domestic practice of development and creation of high-voltage heavy-current switchboards for the generators of large impulse currents of artificial lightning the ground of necessity of the use for their basic and managing electrodes of electrical engineering graphite is carried out. Practical value. The developed and made high-voltage heavy-current switchboard of cascade-tray KATG-50 from application in its composition of graphite electrodes possesses an enhanceable working resource and enhanceable stability of wearing-out at the use of similar switchboard in the bit chain of powerful pulsed current of the imitated linear lightning.

  14. Molecular motions that shape the cardiac action potential: Insights from voltage clamp fluorometry.

    Science.gov (United States)

    Zhu, Wandi; Varga, Zoltan; Silva, Jonathan R

    2016-01-01

    Very recently, voltage-clamp fluorometry (VCF) protocols have been developed to observe the membrane proteins responsible for carrying the ventricular ionic currents that form the action potential (AP), including those carried by the cardiac Na(+) channel, NaV1.5, the L-type Ca(2+) channel, CaV1.2, the Na(+)/K(+) ATPase, and the rapid and slow components of the delayed rectifier, KV11.1 and KV7.1. This development is significant, because VCF enables simultaneous observation of ionic current kinetics with conformational changes occurring within specific channel domains. The ability gained from VCF, to connect nanoscale molecular movement to ion channel function has revealed how the voltage-sensing domains (VSDs) control ion flux through channel pores, mechanisms of post-translational regulation and the molecular pathology of inherited mutations. In the future, we expect that this data will be of great use for the creation of multi-scale computational AP models that explicitly represent ion channel conformations, connecting molecular, cell and tissue electrophysiology. Here, we review the VCF protocol, recent results, and discuss potential future developments, including potential use of these experimental findings to create novel computational models. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Piezoresistive cantilever force-clamp system

    Energy Technology Data Exchange (ETDEWEB)

    Park, Sung-Jin; Petzold, Bryan C.; Pruitt, Beth L. [Department of Mechanical Engineering, Stanford University, Stanford, California 94305 (United States); Goodman, Miriam B. [Department of Molecular and Cellular Physiology, Stanford University, Stanford, California 94305 (United States)

    2011-04-15

    We present a microelectromechanical device-based tool, namely, a force-clamp system that sets or ''clamps'' the scaled force and can apply designed loading profiles (e.g., constant, sinusoidal) of a desired magnitude. The system implements a piezoresistive cantilever as a force sensor and the built-in capacitive sensor of a piezoelectric actuator as a displacement sensor, such that sample indentation depth can be directly calculated from the force and displacement signals. A programmable real-time controller operating at 100 kHz feedback calculates the driving voltage of the actuator. The system has two distinct modes: a force-clamp mode that controls the force applied to a sample and a displacement-clamp mode that controls the moving distance of the actuator. We demonstrate that the system has a large dynamic range (sub-nN up to tens of {mu}N force and nm up to tens of {mu}m displacement) in both air and water, and excellent dynamic response (fast response time, <2 ms and large bandwidth, 1 Hz up to 1 kHz). In addition, the system has been specifically designed to be integrated with other instruments such as a microscope with patch-clamp electronics. We demonstrate the capabilities of the system by using it to calibrate the stiffness and sensitivity of an electrostatic actuator and to measure the mechanics of a living, freely moving Caenorhabditis elegans nematode.

  16. The second sodium site in the dopamine transporter controls cation permeability and is regulated by chloride

    DEFF Research Database (Denmark)

    Borre, Lars; Andreassen, Thorvald F; Shi, Lei

    2014-01-01

    The dopamine transporter (DAT) belongs to the family of neurotransmitter:sodium symporters (NSSs) and controls dopamine (DA) homeostasis by mediating Na(+)- and Cl(-)-dependent reuptake of DA. Here we used two-electrode voltage clamp measurements in Xenopus oocytes together with targeted mutagene......The dopamine transporter (DAT) belongs to the family of neurotransmitter:sodium symporters (NSSs) and controls dopamine (DA) homeostasis by mediating Na(+)- and Cl(-)-dependent reuptake of DA. Here we used two-electrode voltage clamp measurements in Xenopus oocytes together with targeted...

  17. Modeling of SVM Diode Clamping Three-Level Inverter Connected to Grid

    DEFF Research Database (Denmark)

    Guo, Yougui; Zeng, Ping; Zhu, Jieqiong

    2011-01-01

    PLECS is used to model the diode clamping three-level inverter connected to grid and good results are obtained. First the output voltage SVM is described for diode clamping three-level inverter with loads connected to Y. Then the output voltage SVM of diode clamping three-level inverter is simply...... analyzed with loads connected to △. But it will be further researched in the future. Third, PLECS is briefly introduced. Fourth, the modeling of diode clamping three-level inverter is briefly presented with PLECS. Finally, a series of simulations are carried out. The simulation results tell us PLECS...... is very powerful tool to real power circuits and it is very easy to simulate them. They have also verified that SVM control strategy is feasible to control the diode clamping three-level inverter....

  18. Force-controlled patch clamp of beating cardiac cells.

    Science.gov (United States)

    Ossola, Dario; Amarouch, Mohamed-Yassine; Behr, Pascal; Vörös, János; Abriel, Hugues; Zambelli, Tomaso

    2015-03-11

    From its invention in the 1970s, the patch clamp technique is the gold standard in electrophysiology research and drug screening because it is the only tool enabling accurate investigation of voltage-gated ion channels, which are responsible for action potentials. Because of its key role in drug screening, innovation efforts are being made to reduce its complexity toward more automated systems. While some of these new approaches are being adopted in pharmaceutical companies, conventional patch-clamp remains unmatched in fundamental research due to its versatility. Here, we merged the patch clamp and atomic force microscope (AFM) techniques, thus equipping the patch-clamp with the sensitive AFM force control. This was possible using the FluidFM, a force-controlled nanopipette based on microchanneled AFM cantilevers. First, the compatibility of the system with patch-clamp electronics and its ability to record the activity of voltage-gated ion channels in whole-cell configuration was demonstrated with sodium (NaV1.5) channels. Second, we showed the feasibility of simultaneous recording of membrane current and force development during contraction of isolated cardiomyocytes. Force feedback allowed for a gentle and stable contact between AFM tip and cell membrane enabling serial patch clamping and injection without apparent cell damage.

  19. Transition voltages of vacuum-spaced and molecular junctions with Ag and Pt electrodes

    KAUST Repository

    Wu, Kunlin

    2014-07-07

    The transition voltage of vacuum-spaced and molecular junctions constructed with Ag and Pt electrodes is investigated by non-equilibrium Green\\'s function formalism combined with density functional theory. Our calculations show that, similarly to the case of Au-vacuum-Au previously studied, the transition voltages of Ag and Pt metal-vacuum-metal junctions with atomic protrusions on the electrode surface are determined by the local density of states of the p-type atomic orbitals of the protrusion. Since the energy position of the Pt 6p atomic orbitals is higher than that of the 5p/6p of Ag and Au, the transition voltage of Pt-vacuum-Pt junctions is larger than that of both Ag-vacuum-Ag and Au-vacuum-Au junctions. When one moves to analyzing asymmetric molecular junctions constructed with biphenyl thiol as central molecule, then the transition voltage is found to depend on the specific bonding site for the sulfur atom in the thiol group. In particular agreement with experiments, where the largest transition voltage is found for Ag and the smallest for Pt, is obtained when one assumes S binding at the hollow-bridge site on the Ag/Au(111) surface and at the adatom site on the Pt(111) one. This demonstrates the critical role played by the linker-electrode binding geometry in determining the transition voltage of devices made of conjugated thiol molecules. © 2014 AIP Publishing LLC.

  20. Zoom system without moving element by using two liquid crystal lenses with spherical electrode

    Science.gov (United States)

    Yang, Ren-Kai; Lin, Chia-Ping; Su, Guo-Dung J.

    2017-08-01

    A traditional zoom system is composed of several elements moving relatively toward other components to achieve zooming. Unlike tradition system, an electrically control zoom system with liquid crystal (LC) lenses is demonstrated in this paper. To achieve zooming, we apply two LC lenses whose optical power is controlled by voltage to replace two moving lenses in traditional zoom system. The mechanism of zoom system is to use two LC lenses to form a simple zoom system. We found that with such spherical electrodes, we could operate LC lens at voltage range from 31V to 53 V for 3X tunability in optical power. For each LC lens, we use concave spherical electrode which provide lower operating voltage and great tunability in optical power, respectively. For such operating voltage and compact size, this zoom system with zoom ratio approximate 3:1 could be applied to mobile phone, camera and other applications.

  1. PWM Regulation of Grid-Tied PV System on the Base of Photovoltaic-Fed Diode-Clamped Inverters

    Directory of Open Access Journals (Sweden)

    Oleschuk V.I.

    2015-12-01

    Full Text Available Investigation of grid-tied photovoltaic system on the base of two diode-clamped inverters, controlled by specific algorithms of pulse-width modulation (PWM, has been done. This system includes two strings of photovoltaic panels feeding two diode-clamped inverters. The outputs of inverters are connected with the corresponding windings on the primary side of three-phase transformer, connected with a grid. In order to reduce phase voltage distortion and to increase efficiency of operation of the system, special scheme of control and modulation of inverters has been used, providing minimization of common-mode voltages and voltage waveforms symmetries under different operating conditions. Detailed simulation of processes in this photovoltaic-fed power conversion system has been executed. The results of simulations verify good performance of photovoltaic system regulated in accordance with specific strategy of control and modulation.

  2. An 11 μ w, two-electrode transimpedance biosignal amplifier with active current feedback stabilization.

    Science.gov (United States)

    Inan, O T; Kovacs, G T A

    2010-04-01

    A novel two-electrode biosignal amplifier circuit is demonstrated by using a composite transimpedance amplifier input stage with active current feedback. Micropower, low gain-bandwidth product operational amplifiers can be used, leading to the lowest reported overall power consumption in the literature for a design implemented with off-the-shelf commercial integrated circuits (11 μW). Active current feedback forces the common-mode input voltage to stay within the supply rails, reducing baseline drift and amplifier saturation problems that can be present in two-electrode systems. The bandwidth of the amplifier extends from 0.05-200 Hz and the midband voltage gain (assuming an electrode-to-skin resistance of 100 kΩ) is 48 dB. The measured output noise level is 1.2 mV pp, corresponding to a voltage signal-to-noise ratio approaching 50 dB for a typical electrocardiogram (ECG) level input of 1 mVpp. Recordings were taken from a subject by using the proposed two-electrode circuit and, simultaneously, a three-electrode standard ECG circuit. The residual of the normalized ensemble averages for both measurements was computed, and the power of this residual was 0.54% of the power of the standard ECG measurement output. While this paper primarily focuses on ECG applications, the circuit can also be used for amplifying other biosignals, such as the electroencephalogram.

  3. Clamping characteristics study on different types of clamping unit

    Energy Technology Data Exchange (ETDEWEB)

    Jiao, Zhiwei; Liu, Haichao; Xie, Pengcheng [College of Mechanical and Electrical Engineering, Beijing University of Chemical Technology, Beijing China 100029 (China); Yang, Weimin [College of Mechanical and Electrical Engineering, Beijing University of Chemical Technology, Beijing China 100029 (China); State Key Laboratory of Organic-Inorganic Composites, Beijing University of Chemical Technology, Beijing China 100029 (China)

    2015-05-22

    Plastic products are becoming more and more widely used in aerospace, IT, digital electronics and many other fields. With the development of technology, the requirement of product precision is getting higher and higher. However, type and working performance of clamping unit play a decisive role in product precision. Clamping characteristics of different types of clamping unit are discussed in this article, which use finite element numerical analysis method through the software ABAQUS to study the clamping uniformity, and detect the clamping force repeatability precision. The result shows that compared with toggled three-platen clamping unit, clamping characteristics of internal circulation two-platen clamping unit are better, for instance, its mold cavity deformation and force that bars and mold parting surface suffered are more uniform, and its clamping uniformity and repeatability precision is also better.

  4. LED-Based High-Voltage Lines Warning System

    Directory of Open Access Journals (Sweden)

    Eldar MUSA

    2013-04-01

    Full Text Available LED-based system, running with the current of high-voltage lines and converting the current flowing through the line into the light by using a toroid transformer, has been developed. The transformer’s primary winding is constituted by the high voltage power line. Toroidal core consists of two equal parts and the secondary windings are evenly placed on these two parts. The system is mounted on the high-voltage lines as a clamp. The secondary winding ends are connected in series by the connector on the clamp. LEDs are supplied by the voltage at the ends of secondary. Current flowing through highvoltage transmission lines is converted to voltage by the toroidal transformer and the light emitting LEDs are supplied with this voltage. The theory of the conversion of the current flowing through the line into the light is given. The system, running with the current of the line and converting the current into the light, has been developed. System has many application areas such as warning high voltage lines (warning winches to not hinder the high-voltage lines when working under the lines, warning planes to not touch the high-voltage lines, remote measurement of high-voltage line currents, and local illumination of the line area

  5. Analysis of low-pressure dc breakdown in nitrogen between two spherical iron electrodes

    International Nuclear Information System (INIS)

    Pejovic, Momcilo M.; Nesic, Nikola T.; Pejovic, Milic M.

    2006-01-01

    The influence of afterglow period τ, voltage increase rate k, and electrode gap d on breakdown voltage U b for a nitrogen-filled tube with spherical electrodes of diameter D>>d and p=6.5 mbar has been investigated. The data for the breakdown voltage were obtained for the case when there is a presence of N( 4 S) atoms, which release secondary electrons via recombination on the cathode. By fitting the experimental data of breakdown voltage mean values as a function of the voltage increase rate, the static breakdown voltages for afterglow periods of 15 and 100 s were estimated. The electrical field as a function of the electrode gap using breakdown voltage mean values was also determined. It is shown that experimental results of the breakdown voltage mean value as a function of pd in the interval of d from 0.82 to 1.62 mm can be very well described with Paschen's law, valid for the case of parallel-plate electrodes

  6. Higher order modes excitation of electrostatically actuated clamped–clamped microbeams: experimental and analytical investigation

    KAUST Repository

    Jaber, Nizar

    2016-01-06

    © 2016 IOP Publishing Ltd. In this study, we demonstrate analytically and experimentally the excitations of the higher order modes of vibrations in electrostatically actuated clamped-clamped microbeam resonators. The concept is based on using partial electrodes with shapes that induce strong excitation of the mode of interest. The devices are fabricated using polyimide as a structural layer coated with nickel from the top and chrome and gold layers from the bottom. Experimentally, frequency sweeps with different electro-dynamical loading conditions are shown to demonstrate the excitation of the higher order modes of vibration. Using a half electrode, the second mode is excited with high amplitude of vibration compared with almost zero response using the full electrode. Also, using a two-third electrode configuration is shown to amplify the third mode resonance amplitude compared with the full electrode under the same electrical loading conditions. An analytical model is developed based on the Euler-Bernollui beam model and the Galerkin method to simulate the device response. Good agreement between the simulation results and the experimental data is reported.

  7. Multilevel Converter by Cascading Two-Level Three-Phase Voltage Source Converter

    Directory of Open Access Journals (Sweden)

    Abdullrahman A. Al-Shamma’a

    2018-04-01

    Full Text Available This paper proposes a topology using isolated, cascaded multilevel voltage source converters (VSCs and employing two-winding magnetic elements for high-power applications. The proposed topology synthesizes 6 two-level, three-phase VSCs, so the power capability of the presented converter is six times the capability of each VSC module. The characteristics of the proposed topology are demonstrated through analyzing its current relationships, voltage relationships and power capability in detail. The power rating is equally shared among the VSC modules without the need for a sharing algorithm; thus, the converter operates as a single three-phase VSC. The comparative analysis with classical neutral-point clamped, flying capacitor and cascaded H-bridge exhibits the superior features of fewer insulated gate bipolar transistors (IGBTs, capacitor requirement and fewer diodes. To validate the theoretical performance of the proposed converter, it is simulated in a MATLAB/Simulink environment and the results are experimentally demonstrated using a laboratory prototype.

  8. Large gap plasma display cell with auxiliary electrodes: macro-cell experiments and two-dimensional modelling

    International Nuclear Information System (INIS)

    Ouyang, J T; Callegari, Th; Caillier, B; Boeuf, J-P

    2003-01-01

    In this paper we use a two-dimensional fluid model and a 'macroscopic' PDP cell to investigate the possibility of using large gap configurations with auxiliary electrodes to improve the efficiency of PDP discharge cells. The large gap allows operation in a transient positive column regime where energy is more efficiently deposited into xenon excitation, while the auxiliary electrodes are used to keep reasonable values of the operating voltage. Two types of auxiliary electrode configurations (floating and powered) are considered. The discharge characteristics and the discharge efficiency in exciting xenon are studied with simulations and by measuring the intensity of infrared emission from xenon and visible emission from neon in a macroscopic PDP cell. The results show that an efficient positive column regime can be achieved at reasonably low operating voltages when the auxiliary electrode configuration is carefully designed

  9. A Hybrid Cascade Converter Topology With Series-Connected Symmetrical and Asymmetrical Diode-Clamped H-Bridge Cells

    DEFF Research Database (Denmark)

    Nami, Alireza; Zare, Firuz; Ghosh, Arindam

    2011-01-01

    to approach a very low total harmonic distortion of voltage and current, which leads to the possible elimination of the output filter. Regarding the proposed configuration, a new cascade inverter is verified by cascading an asymmetrical diode-clamped inverter, in which 19 levels can be synthesized in output......A novel H-bridge multilevel pulsewidth modulation converter topology based on a series connection of a high-voltage diode-clamped inverter and a low-voltage conventional inverter is proposed in this paper. A dc link voltage arrangement for the new hybrid and asymmetric solution is presented to have...... voltage with the same number of components. To balance the dc link capacitor voltages for the maximum output voltage resolution as well as synthesize asymmetrical dc link combination, a new multi-output boost converter is utilized at the dc link voltage of a seven-level H-bridge diode-clamped inverter...

  10. Control Strategy of Two Capacitor Voltages for Separate MPPTs in Photovoltaic Systems Using Neutral-Point-Clamped Inverters

    DEFF Research Database (Denmark)

    Choi, Ui-Min; Blaabjerg, Frede; Lee, Kyo-Beum

    2015-01-01

    The centralized topology with three-level inverters are widely used in photovoltaic (PV) systems due to their less installation costs and complexity. However, the common maximum power point tracking (MPPT) is a disadvantage of the centralized topology particularly under the partial shading...... and panel mismatch conditions. In this system, if PV modules are separately connected to the split capacitor voltage, the MPPT efficiency can be improved by the proposed control strategy. By the proposed method, the two capacitor voltages can be controlled asymmetrically to perform the separate MPPTs...... of each PV module connected to separate capacitors. The outputs can be generated without distortion even if two capacitors are asymmetrically regulated. Simulation and experimental results verify the validity and feasibility of the proposed methods....

  11. Frequency-domain analysis of intrinsic neuronal properties using high-resistant electrodes

    Directory of Open Access Journals (Sweden)

    Christian Rössert

    2009-08-01

    Full Text Available Intrinsic cellular properties of neurons in culture or slices are usually studied by the whole cell clamp method using low-resistant patch pipettes. These electrodes allow detailed analyses with standard electrophysiological methods such as current- or voltage-clamp. However, in these preparations large parts of the network and dendritic structures may be removed, thus preventing an adequate study of synaptic signal processing. Therefore, intact in vivo preparations or isolated in vitro whole brains have been used in which intracellular recordings are usually made with sharp, high-resistant electrodes to optimize the impalement of neurons. The general non-linear resistance properties of these electrodes, however, severely limit accurate quantitative studies of membrane dynamics especially needed for precise modelling. Therefore, we have developed a frequency-domain analysis of membrane properties that uses a Piece-wise Non-linear Electrode Compensation (PNEC method. The technique was tested in second-order vestibular neurons and abducens motoneurons of isolated frog whole brain preparations using sharp potassium chloride- or potassium acetate-filled electrodes. All recordings were performed without online electrode compensation. The properties of each electrode were determined separately after the neuronal recordings and were used in the frequency-domain analysis of the combined measurement of electrode and cell. This allowed detailed analysis of membrane properties in the frequency-domain with high-resistant electrodes and provided quantitative data that can be further used to model channel kinetics. Thus, sharp electrodes can be used for the characterization of intrinsic properties and synaptic inputs of neurons in intact brains.

  12. Cell voltage versus electrode potential range in aqueous supercapacitors

    OpenAIRE

    Dai, Zengxin; Peng, Chuang; Chae, Jung Hoon; Ng, Kok Chiang; Chen, George Z.

    2015-01-01

    Supercapacitors with aqueous electrolytes and nanostructured composite electrodes are attractive because of their high charging-discharging speed, long cycle life, low environmental impact and wide commercial affordability. However, the energy capacity of aqueous supercapacitors is limited by the electrochemical window of water. In this paper, a recently reported engineering strategy is further developed and demonstrated to correlate the maximum charging voltage of a supercapacitor with the c...

  13. Three Level Diode Clamped Inverter Fed Induction Motor with Dtc-Svm

    OpenAIRE

    V. Ranjith Kumar

    2013-01-01

    This project presents a three-level diode-clamped inverter feeding an asynchronous motor drive with direct torque control (DTC). The control method is based on DTC operating principles. The stator voltage vector reference is computed from the stator flux and torque errors imposed by the flux and torque controllers. This voltage reference is then generated using a diode-clamped inverter, where each phase of the inverter can be implemented using a dc source, which would be available from fuel c...

  14. Impact of cell-voltage on energy and power performance of supercapacitors with single-walled carbon nanotube electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Izadi-Najafabadi, Ali; Yamada, Takeo; Futaba, Don N.; Iijima, Sumio [Nanotube Research Center, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hatori, Hiroaki [Project Headquarters, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hata, Kenji [Japan Science and Technology Agency JST, Kawaguchi (Japan)

    2010-12-15

    We report the energy and power voltage-dependencies of supercapacitors using single-walled carbon nanotube electrodes. The energy density was dependent on the cell-voltage cubed (up to 4 V: E = 1.43 x V{sup 3}). The cubic relationship was attributed to the linear increase of the capacitance as a function of voltage, enabled by electrochemical doping. Furthermore, while up to 3.5 V, the maximum power rating of the nanotube electrodes increased as a function of the cell-voltage squared, beyond 3.5 V, a decline in power was observed as a result of depletion of the electrolyte's ions. (author)

  15. Effect of non-uniform Hall parameter on the electrode voltage drop in Faraday-type combustion MHD generators

    International Nuclear Information System (INIS)

    Gupta, G.P.; Rohatgi, V.K.

    1982-01-01

    Following a simplified approach, an expression is derived for the gas-dynamic voltage drop in a finitely segmented Faraday-type combustion MHD generator, taking into account the non-uniform Hall parameter across the channel. Combining the electrical sheath voltage drop, discussed briefly, with the gas-dynamic voltage drop, the effect of a non-uniform Hall parameter on the electrode voltage drop is studied using the theoretical and experimental input parameters of the Indian MHD channel test. The condition for the validity of the usual assumption of uniform Hall parameter across the channel is pointed out. Analysis of the measured electrode voltage drop predicts the real gas conductivity in the core to be in the range of 60 to 75 per cent of the theoretically calculated core conductivity. (author)

  16. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Directory of Open Access Journals (Sweden)

    Sameera Dharia

    2011-02-01

    Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  17. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Science.gov (United States)

    Dharia, Sameera; Rabbitt, Richard D

    2011-02-28

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  18. Multi-mode excitation of a clamped–clamped microbeam resonator

    KAUST Repository

    Younis, Mohammad I.

    2015-02-18

    We present modeling and simulation of the nonlinear dynamics of a microresonator subjected to two-source electrostatic excitation. The resonator is composed of a clamped–clamped beam excited by a DC voltage load superimposed to two AC voltage loads of different frequencies. One frequency is tuned close to the first natural frequency of the beam and the other is close to the third (second symmetric) natural frequency. A multi-mode Galerkin procedure is applied to extract a reduced-order model, which forms the basis of the numerical simulations. Time history response, Poincare’ sections, Fast Fourier Transforms FFT, and bifurcation diagrams are used to reveal the dynamics of the system. The results indicate complex nonlinear phenomena, which include quasiperiodic motion, torus bifurcations, and modulated chaotic attractors.

  19. Transition voltages of vacuum-spaced and molecular junctions with Ag and Pt electrodes

    KAUST Repository

    Wu, Kunlin; Bai, Meilin; Sanvito, Stefano; Hou, Shimin

    2014-01-01

    The transition voltage of vacuum-spaced and molecular junctions constructed with Ag and Pt electrodes is investigated by non-equilibrium Green's function formalism combined with density functional theory. Our calculations show that, similarly

  20. Two-dimensional threshold voltage model and design considerations for gate electrode work function engineered recessed channel nanoscale MOSFET: I

    International Nuclear Information System (INIS)

    Chaujar, Rishu; Kaur, Ravneet; Gupta, Mridula; Gupta, R S; Saxena, Manoj

    2009-01-01

    This paper discusses a threshold voltage model for novel device structure: gate electrode work function engineered recessed channel (GEWE-RC) nanoscale MOSFET, which combines the advantages of both RC and GEWE structures. In part I, the model accurately predicts (a) surface potential, (b) threshold voltage and (c) sub-threshold slope for single material gate recessed channel (SMG-RC) and GEWE-RC structures. Part II focuses on the development of compact analytical drain current model taking into account the transition regimes from sub-threshold to saturation. Furthermore, the drain conductance evaluation has also been obtained, reflecting relevance of the proposed device for analogue design. The analysis takes into account the effect of gate length and groove depth in order to develop a compact model suitable for device design. The analytical results predicted by the model confirm well with the simulated results. Results in part I also provide valuable design insights in the performance of nanoscale GEWE-RC MOSFET with optimum threshold voltage and negative junction depth (NJD), and hence serves as a tool to optimize important device and technological parameters for 40 nm technology

  1. High voltage distributions in RPCs

    International Nuclear Information System (INIS)

    Inoue, Y.; Muranishi, Y.; Nakamura, M.; Nakano, E.; Takahashi, T.; Teramoto, Y.

    1996-01-01

    High voltage distributions on the inner surfaces of RPCs electrodes were calculated by using a two-dimensional resistor network model. The calculated result shows that the surface resistivity of the electrodes should be high, compared to their volume resistivity, to get a uniform high voltage over the surface. Our model predicts that the rate capabilities of RPCs should be inversely proportional to the thickness of the electrodes if the ratio of surface-to-volume resistivity is low. (orig.)

  2. A curved electrode electrostatic actuator designed for large displacement and force in an underwater environment

    International Nuclear Information System (INIS)

    Preetham, B S; Lake, Melinda A; Hoelzle, David J

    2017-01-01

    There is a need for the development of large displacement ( O (10 −6 ) m) and force ( O (10 −6 ) N) electrostatic actuators with low actuation voltages (<  ±8 V) for underwater bio- MEMS applications. In this paper, we present the design, fabrication, and characterization of a curved electrode electrostatic actuator in a clamped–clamped beam configuration meant to operate in an underwater environment. Our curved electrode actuator is unique in that it operates in a stable manner past the pull-in instability. Models based on the Rayleigh–Ritz method accurately predict the onset of static instability and the displacement versus voltage function, as validated by quasistatic experiments. We demonstrate that the actuator is capable of achieving a large peak-to-peak displacement of 19.5 µ m and force of 43 µ N for a low actuation voltage of less than  ±8 V and is thus appropriate for underwater bio -MEMS applications. (paper)

  3. High Operating Voltage Supercapacitor Using PPy/AC Composite Electrode Based on Simple Dipping Method

    Directory of Open Access Journals (Sweden)

    Kyoungho Kim

    2015-01-01

    Full Text Available As various wearable devices are emerging, self-generated power sources, such as piezoelectric generators, triboelectric generators, and thermoelectric generators, are of interest. To adapt self-generated power sources for application devices, a supercapacitor is necessary because of the short generation times (1–10 ms and low generated power (1–100 μW of self-generated power sources. However, to date, supercapacitors are too large to be adapted for wearable devices. There have been many efforts to reduce the size of supercapacitors by using polypyrrole (PPy for high energy supercapacitor electrodes. However, these supercapacitors have several disadvantages, such as a low operating voltage due to the use of an aqueous electrolyte, and complex manufacturing methods, such as the hydrogel and aerosol methods. In particular, the low operating voltage (~1.0 V is a significant issue because most electronic components operate above 3.0 V. In this study, we successfully demonstrated the high operating voltage (3.0 V of a supercapacitor using a PPy/activated carbon (AC composite electrode based on the chemical polymerization of the PPy by simple dipping. In addition, a twofold enhancement of its energy density was achieved compared with conventional supercapacitors using AC electrodes.

  4. Niflumic acid alters gating of HCN2 pacemaker channels by interaction with the outer region of S4 voltage sensing domains.

    Science.gov (United States)

    Cheng, Lan; Sanguinetti, Michael C

    2009-05-01

    Niflumic acid, 2-[[3-(trifluoromethyl)phenyl]amino]pyridine-3-carboxylic acid (NFA), is a nonsteroidal anti-inflammatory drug that also blocks or modifies the gating of many ion channels. Here, we investigated the effects of NFA on hyperpolarization-activated cyclic nucleotide-gated cation (HCN) pacemaker channels expressed in X. laevis oocytes using site-directed mutagenesis and the two-electrode voltage-clamp technique. Extracellular NFA acted rapidly and caused a slowing of activation and deactivation and a hyperpolarizing shift in the voltage dependence of HCN2 channel activation (-24.5 +/- 1.2 mV at 1 mM). Slowed channel gating and reduction of current magnitude was marked in oocytes treated with NFA, while clamped at 0 mV but minimal in oocytes clamped at -100 mV, indicating the drug preferentially interacts with channels in the closed state. NFA at 0.1 to 3 mM shifted the half-point for channel activation in a concentration-dependent manner, with an EC(50) of 0.54 +/- 0.068 mM and a predicted maximum shift of -38 mV. NFA at 1 mM also reduced maximum HCN2 conductance by approximately 20%, presumably by direct block of the pore. The rapid onset and state-dependence of NFA-induced changes in channel gating suggests an interaction with the extracellular region of the S4 transmembrane helix, the primary voltage-sensing domain of HCN2. Neutralization (by mutation to Gln) of any three of the outer four basic charged residues in S4, but not single mutations, abrogated the NFA-induced shift in channel activation. We conclude that NFA alters HCN2 gating by interacting with the extracellular end of the S4 voltage sensor domains.

  5. Robotic Automation of In Vivo Two-Photon Targeted Whole-Cell Patch-Clamp Electrophysiology.

    Science.gov (United States)

    Annecchino, Luca A; Morris, Alexander R; Copeland, Caroline S; Agabi, Oshiorenoya E; Chadderton, Paul; Schultz, Simon R

    2017-08-30

    Whole-cell patch-clamp electrophysiological recording is a powerful technique for studying cellular function. While in vivo patch-clamp recording has recently benefited from automation, it is normally performed "blind," meaning that throughput for sampling some genetically or morphologically defined cell types is unacceptably low. One solution to this problem is to use two-photon microscopy to target fluorescently labeled neurons. Combining this with robotic automation is difficult, however, as micropipette penetration induces tissue deformation, moving target cells from their initial location. Here we describe a platform for automated two-photon targeted patch-clamp recording, which solves this problem by making use of a closed loop visual servo algorithm. Our system keeps the target cell in focus while iteratively adjusting the pipette approach trajectory to compensate for tissue motion. We demonstrate platform validation with patch-clamp recordings from a variety of cells in the mouse neocortex and cerebellum. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  6. A Novel High-Frequency Voltage Standing-Wave Ratio-Based Grounding Electrode Line Fault Supervision in Ultra-High Voltage DC Transmission Systems

    Directory of Open Access Journals (Sweden)

    Yufei Teng

    2017-03-01

    Full Text Available In order to improve the fault monitoring performance of grounding electrode lines in ultra-high voltage DC (UHVDC transmission systems, a novel fault monitoring approach based on the high-frequency voltage standing-wave ratio (VSWR is proposed in this paper. The VSWR is defined considering a lossless transmission line, and the characteristics of the VSWR under different conditions are analyzed. It is shown that the VSWR equals 1 when the terminal resistance completely matches the characteristic impedance of the line, and when a short circuit fault occurs on the grounding electrode line, the VSWR will be greater than 1. The VSWR will approach positive infinity under metallic earth fault conditions, whereas the VSWR in non-metallic earth faults will be smaller. Based on these analytical results, a fault supervision criterion is formulated. The effectiveness of the proposed VSWR-based fault supervision technique is verified with a typical UHVDC project established in Power Systems Computer Aided Design/Electromagnetic Transients including DC(PSCAD/EMTDC. Simulation results indicate that the proposed strategy can reliably identify the grounding electrode line fault and has strong anti-fault resistance capability.

  7. Modeling CICR in rat ventricular myocytes: voltage clamp studies

    Directory of Open Access Journals (Sweden)

    Palade Philip T

    2010-11-01

    Full Text Available Abstract Background The past thirty-five years have seen an intense search for the molecular mechanisms underlying calcium-induced calcium-release (CICR in cardiac myocytes, with voltage clamp (VC studies being the leading tool employed. Several VC protocols including lowering of extracellular calcium to affect Ca2+ loading of the sarcoplasmic reticulum (SR, and administration of blockers caffeine and thapsigargin have been utilized to probe the phenomena surrounding SR Ca2+ release. Here, we develop a deterministic mathematical model of a rat ventricular myocyte under VC conditions, to better understand mechanisms underlying the response of an isolated cell to calcium perturbation. Motivation for the study was to pinpoint key control variables influencing CICR and examine the role of CICR in the context of a physiological control system regulating cytosolic Ca2+ concentration ([Ca2+]myo. Methods The cell model consists of an electrical-equivalent model for the cell membrane and a fluid-compartment model describing the flux of ionic species between the extracellular and several intracellular compartments (cell cytosol, SR and the dyadic coupling unit (DCU, in which resides the mechanistic basis of CICR. The DCU is described as a controller-actuator mechanism, internally stabilized by negative feedback control of the unit's two diametrically-opposed Ca2+ channels (trigger-channel and release-channel. It releases Ca2+ flux into the cyto-plasm and is in turn enclosed within a negative feedback loop involving the SERCA pump, regulating[Ca2+]myo. Results Our model reproduces measured VC data published by several laboratories, and generates graded Ca2+ release at high Ca2+ gain in a homeostatically-controlled environment where [Ca2+]myo is precisely regulated. We elucidate the importance of the DCU elements in this process, particularly the role of the ryanodine receptor in controlling SR Ca2+ release, its activation by trigger Ca2+, and its

  8. Electrode Conduction Processes Segmented Electrode-Insulator Ratio Effects in MHD Power Generation Experiments

    Energy Technology Data Exchange (ETDEWEB)

    Pain, H. J.; Fearn, D. G.; Distefano, E. [Imperial College. London (United Kingdom)

    1966-10-15

    (a) Electrode conduction processes have been investigated using a plasma produced in an electromagnetic shock tube operating with argon at 70 {mu}mHg pressure. Complete voltage-current characteristics were obtained by the variation of load and applied voltage. These indicated the existence of two conduction regimes with a complex transition region. In the first regime the current, controlled by ion mobility, rose linearly with voltage to saturate between 10 mA and 1 A depending on conditions. Electrode contamination was significant. The second regime involved large currents controlled by electron mobility and emission from the cathode. The current again increased linearly with voltage and reached 200 A. Observation of induced voltages in transverse magnetic fields and of plasma deceleration in non-uniform fields showed that in the electromagnetic shock tube the plasma was heated predominantly by the driver discharge. Its conductivity was calculated using properties measured by a Langmuir double probe. In both regimes the plasma conductivity was also found from the gradient of the voltage current characteristics using experimental electric field fringing factors and the experimental values were compared with theory. (b) Larger-scale experiments used a combustion-driven shock tube where argon plasma flow, magnetic field and induced current flow were mutually orthogonal. The supersonic flow velocity and thermodynamic parameters of the plasma were accurately known. The electrode channel consisted of a segmented system of 12 electrode pairs with an electrode insulator ratio ranging from 1 to 21, with electrode plus insulator length remaining constant, and with maximum Hall parameter values of unity. Different electrode load combinations (Faraday and Hall generators) have been studied in measuring the power generated and the flow of longitudinal currents between adjacent electrodes. A maximum power of 0,8 MW was obtained, the power output decreasing inversely with the

  9. Electrode Conduction Processes Segmented Electrode-Insulator Ratio Effects in MHD Power Generation Experiments

    International Nuclear Information System (INIS)

    Pain, H.J.; Fearn, D.G.; Distefano, E.

    1966-01-01

    (a) Electrode conduction processes have been investigated using a plasma produced in an electromagnetic shock tube operating with argon at 70 μmHg pressure. Complete voltage-current characteristics were obtained by the variation of load and applied voltage. These indicated the existence of two conduction regimes with a complex transition region. In the first regime the current, controlled by ion mobility, rose linearly with voltage to saturate between 10 mA and 1 A depending on conditions. Electrode contamination was significant. The second regime involved large currents controlled by electron mobility and emission from the cathode. The current again increased linearly with voltage and reached 200 A. Observation of induced voltages in transverse magnetic fields and of plasma deceleration in non-uniform fields showed that in the electromagnetic shock tube the plasma was heated predominantly by the driver discharge. Its conductivity was calculated using properties measured by a Langmuir double probe. In both regimes the plasma conductivity was also found from the gradient of the voltage current characteristics using experimental electric field fringing factors and the experimental values were compared with theory. (b) Larger-scale experiments used a combustion-driven shock tube where argon plasma flow, magnetic field and induced current flow were mutually orthogonal. The supersonic flow velocity and thermodynamic parameters of the plasma were accurately known. The electrode channel consisted of a segmented system of 12 electrode pairs with an electrode insulator ratio ranging from 1 to 21, with electrode plus insulator length remaining constant, and with maximum Hall parameter values of unity. Different electrode load combinations (Faraday and Hall generators) have been studied in measuring the power generated and the flow of longitudinal currents between adjacent electrodes. A maximum power of 0,8 MW was obtained, the power output decreasing inversely with the

  10. Contributions of counter-charge in a potassium channel voltage-sensor domain

    DEFF Research Database (Denmark)

    Pless, Stephan Alexander; Galpin, Jason D; Niciforovic, Ana P

    2011-01-01

    Voltage-sensor domains couple membrane potential to conformational changes in voltage-gated ion channels and phosphatases. Highly coevolved acidic and aromatic side chains assist the transfer of cationic side chains across the transmembrane electric field during voltage sensing. We investigated...... the functional contribution of negative electrostatic potentials from these residues to channel gating and voltage sensing with unnatural amino acid mutagenesis, electrophysiology, voltage-clamp fluorometry and ab initio calculations. The data show that neutralization of two conserved acidic side chains...

  11. Single stage buck-boost DC-AC neutral point clamped inverter

    DEFF Research Database (Denmark)

    Mo, Wei; Loh, Poh Chiang; Andrew, A.

    2012-01-01

    This paper proposes a new single stage buck-boost DC-AC neutral point clamped inverter topology which integrates the cascaded configurations of recently introduced inductor-capacitor-capacitor-transformer impedance source network (by Adamowicz) and classic NPC configuration. As a consequence......, it has enhanced buck-boost functionality and low output voltage distortions compared to the traditional Z-source inverter; it has continuous input current which reduces the source stress and inverter noise; it also contains two built-in capacitors which can block the DC current in the transformer...... windings thus preventing the core from saturation; lowers the voltage stresses and power losses of inverter switches and reduces the sizes of filtering devices and as well as obtains better output performance compared to the original two-level Z-source inverters. A phase disposition pulse width modulation...

  12. Enhanced Buck–Boost Neutral-Point-Clamped Inverters With Simple Capacitive-Voltage Balancing

    DEFF Research Database (Denmark)

    Tan, Kuan Khoon; Gao, Feng; Loh, Poh Chiang

    2010-01-01

    introduced for extending the inverters’ variation range to include voltageboost operation, but they generally require the inclusion of large passive components or have not yet been optimized in terms of waveform quality. The balancing of their capacitive voltages using a simple technique has also not yet...... simultaneously, two new buck–boost NPC inverters with simple capacitive-voltage-balancing capability are proposed. Both inverters are demonstrated to exhibit a doubling of voltage gain, with one of them also shown to produce a better output waveform quality. Simulation and experimental results are provided...

  13. The Dynamics of a Doubly Clamped Microbeam Near the Primary Resonance: Experimental and Analytical Investigation

    KAUST Repository

    Masri, Karim M.

    2016-01-20

    We present experimental and analytical investigation of the dynamics of a doubly clamped microbeam near its primary resonance. The microbeam is excited electrostatically by an electrode on the first half of the beam. These microbeams are fabricated using polyimide as structural layer coated with nickel from top and chromium and gold layers from bottom. A noise signal is applied to experimentally detect the natural frequencies. Then, frequency sweep tests are generated for various values of DC bias revealing hardening, transition, and softening behavior of the microbeam. We report for the first time the transition from lower stable state, to unstable state, and then to large stable state experimentally. A multi-mode Galerkin method is used to develop a reduced order model (ROM) of the beam. Shooting method is used to find the periodic motion and is utilized to generate frequency response curves. The curves show good agreement with the experimental results with hardening behavior at lower DC voltage then softening at higher voltage loads and dynamic pull-in. © Copyright 2015 by ASME.

  14. Independent control strategy of two DC-link voltages for separate MPPTs in transformerless photovoltaic systems using neutral-point-clamped inverters

    DEFF Research Database (Denmark)

    Choi, Uimin; Blaabjerg, Frede; Lee, Kyo-Beum

    2014-01-01

    To improve the efficiency of the photovoltaic (PV) system, the centralized topology using three-level inverters are widely used. In this system, PV modules are separately connected to the split DC-links. This causes a decrease of maximum power point tracking (MPPT) efficiency under the partial...... shading condition. This paper proposes an independent control of two DC-link voltages for separate MPPT of each PV module in three-level inverters. The proposed method is simply implemented by adding or subtracting the time-offset to the three-phase turn-on times and modifying the reference voltages...

  15. Battery charger with a capacitor-diode clamped LLC resonant converter

    OpenAIRE

    Tsang, C.; Bingham, C.; Foster, M. P.; Stone, D.; Leech, J.

    2016-01-01

    The paper proposes a novel battery charger through use of\\ud two serially-connected LLC resonant converters. The first\\ud stage utilises a capacitor-diode clamped LLC resonant\\ud converter which allows operation in both constant voltage\\ud (CV) and constant current (CC) modes, as found in most\\ud battery chargers, to be realised, whilst the second stage\\ud provides the necessary gain and line and load regulation. A\\ud design example is included that demonstrates the resulting\\ud converter top...

  16. Calculation of Onset Voltage of Sliding Discharge over a Dielectric Barrier

    Directory of Open Access Journals (Sweden)

    Abdel-Salam Mazen

    2016-01-01

    Full Text Available This paper is aimed at calculating the onset voltage of a sliding discharge established between two electrodes at the upper and bottom surfaces of a dielectric barrier plate; named sliding dielectric barrier discharge (SDBD driven by AC voltage during negative half cycle. The onset voltage is based on the condition of self-sustenance of avalanche growth in the vicinity of the stressed electrode. This calls at first for calculation of the electric field in the vicinity of stressed electrode. The dependency of onset voltage on the thickness and permittivity of the dielectric barrier as well as the thickness of the stressed electrode and the inter-electrode spacing between the stressed and ground electrodes is investigated. The obtained results are discussed in the light of gas discharge physics.

  17. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  18. Radial wedge flange clamp

    Science.gov (United States)

    Smith, Karl H.

    2002-01-01

    A radial wedge flange clamp comprising a pair of flanges each comprising a plurality of peripheral flat wedge facets having flat wedge surfaces and opposed and mating flat surfaces attached to or otherwise engaged with two elements to be joined and including a series of generally U-shaped wedge clamps each having flat wedge interior surfaces and engaging one pair of said peripheral flat wedge facets. Each of said generally U-shaped wedge clamps has in its opposing extremities apertures for the tangential insertion of bolts to apply uniform radial force to said wedge clamps when assembled about said wedge segments.

  19. Two distinct voltage-sensing domains control voltage sensitivity and kinetics of current activation in CaV1.1 calcium channels.

    Science.gov (United States)

    Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E

    2016-06-01

    Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms

  20. Charge-pump voltage converter

    Science.gov (United States)

    Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM

    2009-11-03

    A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.

  1. DNA-FET using carbon nanotube electrodes

    International Nuclear Information System (INIS)

    Sasaki, T K; Ikegami, A; Aoki, N; Ochiai, Y

    2006-01-01

    We demonstrate DNA field effect transistor (DNA-FET) using multiwalled carbon nanotube (MWNT) as nano-structural source and drain electrodes. The MWNT electrodes have been fabricated by focused ion-beam bombardment (FIBB). A very short channel, approximately 50 nm, was easily formed between the severed MWNT. The current-voltage (I-V) characteristics of DNA molecules between the MWNT electrodes showed hopping transport property. We have also measured the gate-voltage dependence in the I-V characteristics and found that poly DNA molecules exhibits p-type conduction. The transport of DNA-FET can be explained by two hopping lengths which depend on the range of the source-drain bias voltages

  2. S1 constrains S4 in the voltage sensor domain of Kv7.1 K+ channels.

    Directory of Open Access Journals (Sweden)

    Yoni Haitin

    Full Text Available Voltage-gated K(+ channels comprise a central pore enclosed by four voltage-sensing domains (VSDs. While movement of the S4 helix is known to couple to channel gate opening and closing, the nature of S4 motion is unclear. Here, we substituted S4 residues of Kv7.1 channels by cysteine and recorded whole-cell mutant channel currents in Xenopus oocytes using the two-electrode voltage-clamp technique. In the closed state, disulfide and metal bridges constrain residue S225 (S4 nearby C136 (S1 within the same VSD. In the open state, two neighboring I227 (S4 are constrained at proximity while residue R228 (S4 is confined close to C136 (S1 of an adjacent VSD. Structural modeling predicts that in the closed to open transition, an axial rotation (approximately 190 degrees and outward translation of S4 (approximately 12 A is accompanied by VSD rocking. This large sensor motion changes the intra-VSD S1-S4 interaction to an inter-VSD S1-S4 interaction. These constraints provide a ground for cooperative subunit interactions and suggest a key role of the S1 segment in steering S4 motion during Kv7.1 gating.

  3. Origin of the transition voltage in gold–vacuum–gold atomic junctions

    International Nuclear Information System (INIS)

    Wu Kunlin; Bai Meilin; Hou Shimin; Sanvito, Stefano

    2013-01-01

    The origin and the distance dependence of the transition voltage of gold–vacuum–gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold–vacuum–gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold–vacuum–gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. (paper)

  4. Cell-Detection Technique for Automated Patch Clamping

    Science.gov (United States)

    McDowell, Mark; Gray, Elizabeth

    2008-01-01

    A unique and customizable machinevision and image-data-processing technique has been developed for use in automated identification of cells that are optimal for patch clamping. [Patch clamping (in which patch electrodes are pressed against cell membranes) is an electrophysiological technique widely applied for the study of ion channels, and of membrane proteins that regulate the flow of ions across the membranes. Patch clamping is used in many biological research fields such as neurobiology, pharmacology, and molecular biology.] While there exist several hardware techniques for automated patch clamping of cells, very few of those techniques incorporate machine vision for locating cells that are ideal subjects for patch clamping. In contrast, the present technique is embodied in a machine-vision algorithm that, in practical application, enables the user to identify good and bad cells for patch clamping in an image captured by a charge-coupled-device (CCD) camera attached to a microscope, within a processing time of one second. Hence, the present technique can save time, thereby increasing efficiency and reducing cost. The present technique involves the utilization of cell-feature metrics to accurately make decisions on the degree to which individual cells are "good" or "bad" candidates for patch clamping. These metrics include position coordinates (x,y) in the image plane, major-axis length, minor-axis length, area, elongation, roundness, smoothness, angle of orientation, and degree of inclusion in the field of view. The present technique does not require any special hardware beyond commercially available, off-the-shelf patch-clamping hardware: A standard patchclamping microscope system with an attached CCD camera, a personal computer with an imagedata- processing board, and some experience in utilizing imagedata- processing software are all that are needed. A cell image is first captured by the microscope CCD camera and image-data-processing board, then the image

  5. The LMF triaxial MITL voltage adder system

    International Nuclear Information System (INIS)

    Mazarakis, M.G.; Smith, D.L.; Bennett, L.F.; Lockner, T.R.; Olson, R.E.; Poukey, J.W.

    1992-01-01

    The light-ion microfusion driver design consists of multiple accelerating modules fired in coincidence and sequentially in order to provide the desired ion energy, power pulse shape and energy deposition uniformity on an Inertial Confinement Fusion (ICF) target. The basic energy source is a number of Marx generators which, through the appropriate pulse power conditioning, provide the necessary voltage pulse wave form to the accelerating gaps or feeds of each module. The cavity gaps are inductively isolated, and the voltage addition occurs in the center conductor of the voltage adder which is the positive electrode while the electrons of the sheath flow closer to the outer cylinder which is the magnetically insulated cathode electrode. Each module powers a separate two-stage extraction diode which provides a low divergence ion beam. In order to provide the two separate voltage pulses required by the diode, a triaxial adder system is designed for each module. The voltage addition occurs in two separate MITLs. The center hollow cylinder (anode) of the second MITL also serves as the outer cathode electrode for the extension of the first voltage adder MITL. The voltage of the second stage is about twice that of the first stage. The cavities are connected in series to form the outer cylinder of each module. The accelerating modules are positioned radially in a symmetrical way around the fusion chamber. A preliminary conceptual design of the LMF modules with emphasis on the voltage adders and extension MITLs will be presented and discussed

  6. The relation of electrode voltages to charge position in SLC arc and final focus beam position monitors

    International Nuclear Information System (INIS)

    Fordham, C.

    1989-01-01

    The position of a charged particle beam can be measured with a Beam Position Monitor (BPM) by converting the voltages induced on its array of electrodes into a position offset from the array's center. Most of the BPMs in the Arcs and Final Focus of the SLC use four stripline electrodes arranged symmetrically around the beam; normalized voltage differences are calculated as the difference divided by the sum of voltages on opposite electrode pairs. The resulting number is multiplied by a conversion factor, denoted in this paper as S b , to give the offset (in millimeters) of the charge from the center of the BPM. Prior to installation in the beam line, the BPMs were calibrated with a charge pulse on a rod. Owing to geometric effects which will be discussed later, a different conversion factor had to be used for calibration. It will be denoted here by S r . This paper gives the results of calculations and measurements of S r and S b for Arc and Final Focus BPMs. This paper also describes the relevant physical properties of the several types of BPMs and calculations of the expected scale factors, the measurement methods used, and gives the results of measurements, which are compared with the theoretical expectations. 2 refs., 18 figs., 7 tabs

  7. Understanding capacity fade in silicon based electrodes for lithium-ion batteries using three electrode cells and upper cut-off voltage studies

    Science.gov (United States)

    Beattie, Shane D.; Loveridge, M. J.; Lain, Michael J.; Ferrari, Stefania; Polzin, Bryant J.; Bhagat, Rohit; Dashwood, Richard

    2016-01-01

    Commercial Li-ion batteries are typically cycled between 3.0 and 4.2 V. These voltages limits are chosen based on the characteristics of the cathode (e.g. lithium cobalt oxide) and anode (e.g. graphite). When alternative anode/cathode chemistries are studied the same cut-off voltages are often, mistakenly, used. Silicon (Si) based anodes are widely studied as a high capacity alternative to graphite for Lithium-ion batteries. When silicon-based anodes are paired with high capacity cathodes (e.g. Lithium Nickel Cobalt Aluminium Oxide; NCA) the cell typically suffers from rapid capacity fade. The purpose of this communication is to understand how the choice of upper cut-off voltage affects cell performance in Si/NCA cells. A careful study of three-electrode cell data will show that capacity fade in Si/NCA cells is due to an ever-evolving silicon voltage profile that pushes the upper voltage at the cathode to >4.4 V (vs. Li/Li+). This behaviour initially improves cycle efficiency, due to liberation of new lithium, but ultimately reduces cycling efficiency, resulting in rapid capacity fade.

  8. A Novel Neutral Point Clamped Full-Bridge Topology for Transformerless Photovoltaic Grid-Connected Inverters

    Directory of Open Access Journals (Sweden)

    M. Pakdel

    2017-04-01

    Full Text Available This paper presents a novel neutral point clamped full-bridge topology for transformerless photovoltaic grid-tied inverters. Transformerless grid-connected inverters have been used widely in recent years since they offer higher efficiency and lower costs. Ground leakage current suppression is the main issue which should be considered carefully in transformerless photovoltaic grid-connected inverters. Among different methods used to decline ground leakage current, neutral point clamped (NPC topologies are considered more useful and effective. In NPC topologies, the short-circuited output voltage at the freewheeling period is clamped to the middle of the DC bus voltage. Therefore, the common-mode voltage (CM will be constant at the whole switching period. Various NPC topologies such as H6 [1], HB-ZVR [2], oH5 [3], and PN-NPC [4] have been proposed. In this paper, a novel NPC topology is proposed which has lower power losses and higher efficiency over previous topologies. Furthermore, the proposed NPC topology exhibits a similar ground leakage current with the PN-NPC topology. The proposed NPC topology is analyzed theoretically using simulation studies and an experimental prototype is provided to verify theoretical analysis and simulation studies.

  9. Robotic multi-well planar patch-clamp for native and primary mammalian cells

    Science.gov (United States)

    Milligan, Carol J; Li, Jing; Sukumar, Piruthivi; Majeed, Yasser; Dallas, Mark L; English, Anne; Emery, Paul; Porter, Karen E; Smith, Andrew M; McFadzean, Ian; Beccano-Kelly, Dayne; Bahnasi, Yahya; Cheong, Alex; Naylor, Jacqueline; Zeng, Fanning; Liu, Xing; Gamper, Nikita; Jiang, Lin-Hua; Pearson, Hugh A; Peers, Chris; Robertson, Brian; Beech, David J

    2009-01-01

    Multi-well robotic planar patch-clamp has become common in drug development and safety programmes because it enables efficient and systematic testing of compounds against ion channels during voltage-clamp. It has not, however, been adopted significantly in other important areas of ion channel research, where conventional patch-clamp remains the favoured method. Here we show the wider potential of the multi-well approach with the capability for efficient intracellular solution exchange, describing protocols and success rates for recording from a range of native and primary mammalian cells derived from blood vessels, arthritic joints, and the immune and central nervous systems. The protocol involves preparing a suspension of single cells to be dispensed robotically into 4-8 microfluidic chambers each containing a glass chip with a small aperture. Under automated control, giga-seals and whole-cell access are achieved followed by pre-programmed routines of voltage paradigms and fast extracellular or intracellular solution exchange. Recording from 48 chambers usually takes 1-6 hr depending on the experimental design and yields 16-33 cell recordings. PMID:19197268

  10. Inertial piezoelectric linear motor driven by a single-phase harmonic wave with automatic clamping mechanism

    Science.gov (United States)

    He, Liangguo; Chu, Yuheng; Hao, Sai; Zhao, Xiaoyong; Dong, Yuge; Wang, Yong

    2018-05-01

    A novel, single-phase, harmonic-driven, inertial piezoelectric linear motor using an automatic clamping mechanism was designed, fabricated, and tested to reduce the sliding friction and simplify the drive mechanism and power supply control of the inertial motor. A piezoelectric bimorph and a flexible hinge were connected in series to form the automatic clamping mechanism. The automatic clamping mechanism was used as the driving and clamping elements. A dynamic simulation by Simulink was performed to prove the feasibility of the motor. The finite element method software COMSOL was used to design the structure of the motor. An experimental setup was built to validate the working principle and evaluate the performance of the motor. The prototype motor outputted a no-load velocity of 3.178 mm/s at a voltage of 220 Vp-p and a maximum traction force of 4.25 N under a preload force of 8 N. The minimum resolution of 1.14 μm was achieved at a driving frequency of 74 Hz, a driving voltage of 50 Vp-p, and a preload force of 0 N.

  11. Gating of the two-pore cation channel AtTPC1 in the plant vacuole is based on a single voltage-sensing domain.

    Science.gov (United States)

    Jaślan, D; Mueller, T D; Becker, D; Schultz, J; Cuin, T A; Marten, I; Dreyer, I; Schönknecht, G; Hedrich, R

    2016-09-01

    The two-pore cation channel TPC1 operates as a dimeric channel in animal and plant endomembranes. Each subunit consists of two homologous Shaker-like halves, with 12 transmembrane domains in total (S1-S6, S7-S12). In plants, TPC1 channels reside in the vacuolar membrane, and upon voltage stimulation, give rise to the well-known slow-activating SV currents. Here, we combined bioinformatics, structure modelling, site-directed mutagenesis, and in planta patch clamp studies to elucidate the molecular mechanisms of voltage-dependent channel gating in TPC1 in its native plant background. Structure-function analysis of the Arabidopsis TPC1 channel in planta confirmed that helix S10 operates as the major voltage-sensing site, with Glu450 and Glu478 identified as possible ion-pair partners for voltage-sensing Arg537. The contribution of helix S4 to voltage sensing was found to be negligible. Several conserved negative residues on the luminal site contribute to calcium binding, stabilizing the closed channel. During evolution of plant TPC1s from two separate Shaker-like domains, the voltage-sensing function in the N-terminal Shaker-unit (S1-S4) vanished. © 2016 German Botanical Society and The Royal Botanical Society of the Netherlands.

  12. Is early cord clamping, delayed cord clamping or cord milking best?

    Science.gov (United States)

    Vatansever, Binay; Demirel, Gamze; Ciler Eren, Elif; Erel, Ozcan; Neselioglu, Salim; Karavar, Hande Nur; Gundogdu, Semra; Ulfer, Gozde; Bahadir, Selcen; Tastekin, Ayhan

    2018-04-01

    To compare the antioxidant status of three cord clamping procedures (early clamping, delayed clamping and milking) by analyzing the thiol-disulfide balance. This randomized controlled study enrolled 189 term infants who were divided into three groups according to the cord clamping procedure: early clamping, delayed clamping and milking. Blood samples were collected from the umbilical arteries immediately after clamping, and the thiol/disulfide homeostasis was analyzed. The native and total thiol levels were significantly (p total thiol ratio was significantly (p = .026) lower in the delayed cord clamping and milking groups compared with the early clamping groups. Early cord clamping causes the production of more disulfide bonds and lower thiol levels, indicating that oxidation reactions are increased in the early cord clamping procedure compared with the delayed cord clamping and milking procedures. The oxidant capacity is greater with early cord clamping than with delayed clamping or cord milking. Delayed cord clamping or milking are beneficial in neonatal care, and we suggest that they be performed routinely in all deliveries.

  13. Enhanced Buck-Boost Three-Level Neutral-Point-Clamped Inverters

    DEFF Research Database (Denmark)

    Tan, K. K.; Gao, F.; Chiang Loh, Poh

    2009-01-01

    In traditional three-level neutral-point-clamped (NPC) inverters, a major issue is capacitor voltage imbalance, which results in low order harmonics. The compensation of the capacitor voltages often require additional control complexity, which cannot be conveniently implemented. The "alternative...... phase opposition disposition" (APOD) modulation method used in traditional NPC topologies also has lower harmonics performance as compared to the "phase disposition" (PD) modulation method.In this paper, we introduce a new three-level NPC topology that utilises the harmonically superior PD modulation...... method, with the ability to easily adjust for capacitor voltage imbalances. To further improve the boost capability of the three-level NPC inverters, another new topology introduces 2 additional diodes,achieving higher boost performance while totally eliminating thepossibility of capacitor voltage...

  14. Origin of the transition voltage in gold–vacuum–gold atomic junctions

    KAUST Repository

    Wu, Kunlin

    2012-12-13

    The origin and the distance dependence of the transition voltage of gold-vacuum-gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold-vacuum-gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold-vacuum-gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. © 2013 IOP Publishing Ltd.

  15. Gain-clamping techniques in two-stage double-pass L-band EDFA

    Indian Academy of Sciences (India)

    Two designs of long-wavelength band erbium-doped fiber amplifier (L-band. EDFA) for gain clamping in double-pass systems are demonstrated and compared. The first design is based on ring laser technique where a backward amplified spontaneous emis- sion (ASE) from the second stage is routed into the feedback loop ...

  16. Programming voltage reduction in phase change memory cells with tungsten trioxide bottom heating layer/electrode

    International Nuclear Information System (INIS)

    Rao Feng; Song Zhitang; Gong Yuefeng; Wu Liangcai; Feng Songlin; Chen, Bomy

    2008-01-01

    A phase change memory cell with tungsten trioxide bottom heating layer/electrode is investigated. The crystalline tungsten trioxide heating layer promotes the temperature rise in the Ge 2 Sb 2 Te 5 layer which causes the reduction in the reset voltage compared to a conventional phase change memory cell. Theoretical thermal simulation and calculation for the reset process are applied to understand the thermal effect of the tungsten trioxide heating layer/electrode. The improvement in thermal efficiency of the PCM cell mainly originates from the low thermal conductivity of the crystalline tungsten trioxide material.

  17. Statistical Analysis of Partial Discharge Characteristics in Transformer Oil at the “Point-Plane” Electrode at Alternating Voltage

    Directory of Open Access Journals (Sweden)

    Korobeynikov S.M.

    2017-08-01

    Full Text Available In this paper, we consider the problems related to measuring and analyzing the characteristics of partial discharges which are the main instrument for oil-filled high-voltage electrical equipment diagnosing. The experiments on recording of partial discharges in transformer oil have been carried out in the “point-plane” electrode system at alternating current. The instantaneous voltage and the apparent charge have been measured depending on the root-mean-square voltage and the phase angle of partial discharges. This paper aimes at carrying out a statistical analysis of the obtained experimental results, in particular, the construction of a parametric probabilistic model of the dependence of the partial discharge inception voltage distribution on the value of the root-mean-square voltage. It differs from usual discharges which occur in liquid dielectric materials in case of sharp inhomogeneous electrode system. It has been suggested that discharges of a different type are the discharges in gas bubbles that occur when partial discharges in a liquid emerge. This assumption is confirmed by the fact that the number of such discharges increases with increasing the root-mean-square voltage value. It is the main novelty of this paper. This corresponds to the nature of the occurrence of such discharges. After rejecting the observations corresponding to discharges in gas bubbles, a parametric probabilistic model has been constructed. The model obtained makes it possible to determine the probability of partial discharge occurrence in a liquid at a given value of the instantaneous voltage depending on the root-mean-square voltage.

  18. Vivitron 1995, transient voltage simulation, high voltage insulator tests, electric field calculation

    International Nuclear Information System (INIS)

    Frick, G.; Osswald, F.; Heusch, B.

    1996-01-01

    Preliminary investigations showed clearly that, because of the discrete electrode structure of the Vivitron, important overvoltage leading to insulator damage can appear in case of a spark. The first high voltage tests showed damage connected with such events. This fact leads to a severe voltage limitation. This work describes, at first, studies made to understand the effects of transients and the associated over-voltage appearing in the Vivitron. Then we present the high voltage tests made with full size Vivitron components using the CN 6 MV machine as a pilot machine. Extensive field calculations were made. These involve simulations of static stresses and transient overvoltages, on insulating boards and electrodes. This work gave us the solutions for arrangements and modifications in the machine. After application, the Vivitron runs now without any sparks and damage at 20 MV. In the same manner, we tested column insulators of a new design and so we will find out how to get to higher voltages. Electric field calculation around the tie bars connecting the discrete electrodes together showed field enhancements when the voltages applied on the discrete electrodes are not equally distributed. This fact is one of the sources of discharges and voltage limitations. A scenario of a spark event is described and indications are given how to proceed towards higher voltages, in the 30 MV range. (orig.)

  19. DC dynamic pull-in predictions for a generalized clamped–clamped micro-beam based on a continuous model and bifurcation analysis

    International Nuclear Information System (INIS)

    Chao, Paul C-P; Chiu, C W; Liu, Tsu-Hsien

    2008-01-01

    This study is devoted to providing precise predictions of the dc dynamic pull-in voltages of a clamped–clamped micro-beam based on a continuous model. A pull-in phenomenon occurs when the electrostatic force on the micro-beam exceeds the elastic restoring force exerted by beam deformation, leading to contact between the actuated beam and bottom electrode. DC dynamic pull-in means that an instantaneous application of the voltage (a step function such as voltage) is applied. To derive the pull-in voltage, a dynamic model in partial differential equations is established based on the equilibrium among beam flexibility, inertia, residual stress, squeeze film, distributed electrostatic forces and its electrical field fringing effects. The method of Galerkin decomposition is then employed to convert the established system equations into reduced discrete modal equations. Considering lower-order modes and approximating the beam deflection by a different order series, bifurcation based on phase portraits is conducted to derive static and dynamic pull-in voltages. It is found that the static pull-in phenomenon follows dynamic instabilities, and the dc dynamic pull-in voltage is around 91–92% of the static counterpart. However, the derived dynamic pull-in voltage is found to be dependent on the varied beam parameters, different from a fixed predicted value derived in past works, where only lumped models are assumed. Furthermore, accurate closed-form predictions are provided for non-narrow beams. The predictions are finally validated by finite element analysis and available experimental data

  20. The Effect of an Added Mass on the Frequency Shifts of a Clamped-Clamped Microbeam for Bio-Mass Detection

    KAUST Repository

    Bouchaala, Adam M.

    2016-12-05

    We present analytical formulations to calculate the induced resonance frequency shifts of electrically actuated clamped-clamped microbeams due to an added mass. Based on the Euler-Bernoulli beam theory, we investigate the linear dynamic responses of the beams added masses, which are modeled as discrete point masses. Analytical expressions based on perturbation techniques and a one-mode Galerkin approximation are developed to calculate accurately the frequency shifts under a DC voltage as a function of the added mass and position. The analytical results are compared to numerical solution of the eigenvalue problem. Results are shown for the fundamental as well as the higher-order modes of the beams. The results indicate a significant increase in the frequency shift, and hence the sensitivity of detection, when scaling down to nano scale and using higher-order modes.

  1. The Effect of an Added Mass on the Frequency Shifts of a Clamped-Clamped Microbeam for Bio-Mass Detection

    KAUST Repository

    Bouchaala, Adam M.; Nayfeh, Ali H.; Younis, Mohammad I.

    2016-01-01

    We present analytical formulations to calculate the induced resonance frequency shifts of electrically actuated clamped-clamped microbeams due to an added mass. Based on the Euler-Bernoulli beam theory, we investigate the linear dynamic responses of the beams added masses, which are modeled as discrete point masses. Analytical expressions based on perturbation techniques and a one-mode Galerkin approximation are developed to calculate accurately the frequency shifts under a DC voltage as a function of the added mass and position. The analytical results are compared to numerical solution of the eigenvalue problem. Results are shown for the fundamental as well as the higher-order modes of the beams. The results indicate a significant increase in the frequency shift, and hence the sensitivity of detection, when scaling down to nano scale and using higher-order modes.

  2. A thermoelectric voltage effect in polyethylene oxide

    International Nuclear Information System (INIS)

    Martin, Bjoern; Wagner, Achim; Kliem, Herbert

    2003-01-01

    The conductivity of polyethylene oxide (PEO) is described with a three-dimensional hopping model considering electrostatic interactions between the ions. Ions fluctuate over energy-barriers in a multi-well potential. To decide whether positive or negative charges are responsible for this conductivity, the thermoelectric voltage is measured. The samples are embedded between two aluminium-electrodes. The oxide on the interface between the electrodes and the PEO serves as a blocking layer. The temperature of each electrode is controlled by a Peltier element. A temperature step is applied to one electrode by changing the temperature of one of the Peltier elements. Due to this temperature gradient, the mobile charges fluctuate thermally activated from the warmer side to the colder side of the sample. The direction of the measured thermoelectric voltage indicates the type of mobile charges. It is found that positive charges are mobile. Further, it is shown that the absolute value of the thermoelectric voltage depends on the energy-barrier heights in the multi-well potential

  3. A thermoelectric voltage effect in polyethylene oxide

    CERN Document Server

    Martin, B; Kliem, H

    2003-01-01

    The conductivity of polyethylene oxide (PEO) is described with a three-dimensional hopping model considering electrostatic interactions between the ions. Ions fluctuate over energy-barriers in a multi-well potential. To decide whether positive or negative charges are responsible for this conductivity, the thermoelectric voltage is measured. The samples are embedded between two aluminium-electrodes. The oxide on the interface between the electrodes and the PEO serves as a blocking layer. The temperature of each electrode is controlled by a Peltier element. A temperature step is applied to one electrode by changing the temperature of one of the Peltier elements. Due to this temperature gradient, the mobile charges fluctuate thermally activated from the warmer side to the colder side of the sample. The direction of the measured thermoelectric voltage indicates the type of mobile charges. It is found that positive charges are mobile. Further, it is shown that the absolute value of the thermoelectric voltage depen...

  4. Size-dependent dynamic stability analysis of microbeams actuated by piezoelectric voltage based on strain gradient elasticity theory

    Energy Technology Data Exchange (ETDEWEB)

    Sahmani, Saeid; Bahrami, Mohsen [Amirkabir University of Technology, Tehran (Iran, Islamic Republic of)

    2015-01-15

    In the current paper, dynamic stability analysis of microbeams subjected to piezoelectric voltage is presented in which the microbeam is integrated with piezoelectric layers on the lower and upper surfaces. Both of the flutter and divergence instabilities of microbeams with clamped-clamped and clamped-free boundary conditions are predicted corresponding to various values of applied voltage. To take size effect into account, the classical Timoshenko beam theory in conjunction with strain gradient elasticity theory is utilized to develop nonclassical beam model containing three additional internal length scale parameters. By using Hamilton's principle, the higher-order governing differential equations and associated boundary conditions are derived. Afterward, generalized differential quadrature method is employed to discretize the size-dependent governing differential equations along with clamped-clamped and clamped-free end supports. The critical piezoelectric voltages corresponding to various values dimensionless length scale parameter are evaluated and compared with those predicted by the classical beam theory. It is revealed that in the case of clamped-free boundary conditions, the both of flutter and divergence instabilities occur. However, for the clamped-clamped microbeams, only divergence instability takes place.

  5. Influence of squeeze film damping on the higher-order modes of clamped–clamped microbeams

    KAUST Repository

    Alcheikh, Nouha

    2016-05-06

    This paper presents an experimental study and a finite-element analysis of the effect of squeeze film damping on the resonance frequency and quality factor of the higher-order flexure vibrations modes of clamped-clamped microbeams. Viscoelastic and silicon nitride microbeams are fabricated and are electrostatically actuated by various electrode configurations to trigger the first, second, and third modes. The damping characteristic and the resonance frequency of these modes are examined for a wide range of gas pressure and electrostatic voltage loads. The results of the silicon nitride beams and viscoelastic beams are compared. It is found that the intrinsic material loss is the major dissipation mechanism at low pressure for the viscoelastic microbeams, significantly limiting their quality factor. It is also found that while the silicon nitride beams show higher quality factors at the intrinsic and molecular regimes of pressure, due to their low intrinsic loss, their quality factors near atmospheric pressure are lower than those of the viscoelastic microbeams. Further, the higher-order modes of all the beams show much higher quality factors at atmospheric pressure compared to the first mode, which could be promising for operating such resonators in air. Experimental results and finite element model simulations show good agreement for resonance frequency and quality factor for the three studied modes. © 2016 IOP Publishing Ltd.

  6. Two-dimensional Cu2Si sheet: a promising electrode material for nanoscale electronics

    Science.gov (United States)

    Meng Yam, Kah; Guo, Na; Zhang, Chun

    2018-06-01

    Building electronic devices on top of two-dimensional (2D) materials has recently become one of most interesting topics in nanoelectronics. Finding high-performance 2D electrode materials is one central issue in 2D nanoelectronics. In the current study, based on first-principles calculations, we compare the electronic and transport properties of two nanoscale devices. One device consists of two single-atom-thick planar Cu2Si electrodes, and a nickel phthalocyanine (NiPc) molecule in the middle. The other device is made of often-used graphene electrodes and a NiPc molecule. Planer Cu2Si is a new type of 2D material that was recently predicted to exist and be stable under room temperature [11]. We found that at low bias voltages, the electric current through the Cu2Si–NiPc–Cu2Si junction is about three orders higher than that through graphene–NiPc–graphene. Detailed analysis shows that the surprisingly high conductivity of Cu2Si–NiPc–Cu2Si originates from the mixing of the Cu2Si state near Fermi energy and the highest occupied molecular orbital of NiPc. These results suggest that 2D Cu2Si may be an excellent candidate for electrode materials for future nanoscale devices.

  7. Highly selective water channel activity measured by voltage clamp: analysis of planar lipid bilayers reconstituted with purified AqpZ.

    Science.gov (United States)

    Pohl, P; Saparov, S M; Borgnia, M J; Agre, P

    2001-08-14

    Aquaporins are membrane channels selectively permeated by water or water plus glycerol. Conflicting reports have described ion conductance associated with some water channels, raising the question of whether ion conductance is a general property of the aquaporin family. To clarify this question, a defined system was developed to simultaneously measure water permeability and ion conductance. The Escherichia coli water channel aquaporin-Z (AqpZ) was studied, because it is a highly stable tetramer. Planar lipid bilayers were formed from unilamellar vesicles containing purified AqpZ. The hydraulic conductivity of bilayers made from the total extract of E. coli lipids increased 3-fold if reconstituted with AqpZ, but electric conductance was unchanged. No channel activity was detected under voltage-clamp conditions, indicating that less than one in 10(9) transport events is electrogenic. Microelectrode measurements were simultaneously undertaken adjacent to the membrane. Changes in sodium concentration profiles accompanying transmembrane water flow permitted calculation of the activation energies: 14 kcal/mol for protein-free lipid bilayers and 4 kcal/mol for lipid bilayers containing AqpZ. Neither the water permeability nor the electric conductivity exhibited voltage dependence. This sensitive system demonstrated that AqpZ is permeated by water but not charged ions and should permit direct analyses of putative electrogenic properties of other aquaporins.

  8. Harmonic elimination in diode-clamped multilevel inverter using evolutionary algorithms

    Energy Technology Data Exchange (ETDEWEB)

    Barkati, Said [Laboratoire d' analyse des Signaux et Systemes (LASS), Universite de M' sila, BP. 166, rue Ichbilia 28000 M' sila (Algeria); Baghli, Lotfi [Groupe de Recherche en Electrotechnique et Electronique de Nancy (GREEN), CNRS UMR 7030, Universite Henri Poincare Nancy 1, BP. 239, 54506 Vandoeuvre-les-Nancy (France); Berkouk, El Madjid; Boucherit, Mohamed-Seghir [Laboratoire de Commande des Processus (LCP), Ecole Nationale Polytechnique, BP. 182, 10 Avenue Hassen Badi, 16200 El Harrach, Alger (Algeria)

    2008-10-15

    This paper describes two evolutionary algorithms for the optimized harmonic stepped-waveform technique. Genetic algorithms and particle swarm optimization are applied to compute the switching angles in a three-phase seven-level inverter to produce the required fundamental voltage while, at the same time, specified harmonics are eliminated. Furthermore, these algorithms are also used to solve the starting point problem of the Newton-Raphson conventional method. This combination provides a very effective method for the harmonic elimination technique. This strategy is useful for different structures of seven-level inverters. The diode-clamped topology is considered in this study. (author)

  9. Trans-Z-source and Γ-Z-source neutral-point-clamped inverters

    DEFF Research Database (Denmark)

    Wei, Mo; Loh, Poh Chiang; Blaabjerg, Frede

    2015-01-01

    Z-source neutral-point-clamped (NPC) inverters are earlier proposed for obtaining voltage buck-boost and three-level switching simultaneously. Their performances are, however, constrained by a trade-off between their input-to-output gain and modulation ratio. This trade-off can lead to high...

  10. Dynamic Pull-In Investigation of a Clamped-Clamped Nanoelectromechanical Beam under Ramp-Input Voltage and the Casimir Force

    Directory of Open Access Journals (Sweden)

    Amir R. Askari

    2014-01-01

    Full Text Available The influence of the Casimir excitation on dynamic pull-in instability of a nanoelectromechanical beam under ramp-input voltage is studied. The ramp-input actuation has applications in frequency sweeping of RF-N/MEMS. The presented model is nonlinear due to the inherent nonlinearity of electrostatics and the Casimir excitations as well as the geometric nonlinearity of midplane stretching. A Galerkin based reduced order modeling is utilized. It is found that the calculated dynamic pull-in ramp input voltage leads to dynamic pull-in step input voltage by increasing the slope of voltage-time diagram. This fact is utilized to verify the results of present study.

  11. Sinusoidal voltage protocols for rapid characterisation of ion channel kinetics.

    Science.gov (United States)

    Beattie, Kylie A; Hill, Adam P; Bardenet, Rémi; Cui, Yi; Vandenberg, Jamie I; Gavaghan, David J; de Boer, Teun P; Mirams, Gary R

    2018-03-24

    Ion current kinetics are commonly represented by current-voltage relationships, time constant-voltage relationships and subsequently mathematical models fitted to these. These experiments take substantial time, which means they are rarely performed in the same cell. Rather than traditional square-wave voltage clamps, we fitted a model to the current evoked by a novel sum-of-sinusoids voltage clamp that was only 8 s long. Short protocols that can be performed multiple times within a single cell will offer many new opportunities to measure how ion current kinetics are affected by changing conditions. The new model predicts the current under traditional square-wave protocols well, with better predictions of underlying currents than literature models. The current under a novel physiologically relevant series of action potential clamps is predicted extremely well. The short sinusoidal protocols allow a model to be fully fitted to individual cells, allowing us to examine cell-cell variability in current kinetics for the first time. Understanding the roles of ion currents is crucial to predict the action of pharmaceuticals and mutations in different scenarios, and thereby to guide clinical interventions in the heart, brain and other electrophysiological systems. Our ability to predict how ion currents contribute to cellular electrophysiology is in turn critically dependent on our characterisation of ion channel kinetics - the voltage-dependent rates of transition between open, closed and inactivated channel states. We present a new method for rapidly exploring and characterising ion channel kinetics, applying it to the hERG potassium channel as an example, with the aim of generating a quantitatively predictive representation of the ion current. We fitted a mathematical model to currents evoked by a novel 8 second sinusoidal voltage clamp in CHO cells overexpressing hERG1a. The model was then used to predict over 5 minutes of recordings in the same cell in response to

  12. In-situ experimental characterization of the clamping pressure effects on low temperature polymer electrolyte membrane electrolysis

    DEFF Research Database (Denmark)

    Al Shakhshir, Saher; Cui, Xiaoti; Frensch, Steffen Henrik

    2017-01-01

    as a gas with the circulating water. The effects of clamping pressure (Pc) on the LT-PEME cell performance, polarization resistances, and hydrogen and water crossover through the membrane, and hydrogen and oxygen production rate are studied. A 50 cm2 active area LT-PEME cell designed and manufactured......-PEME splits water into hydrogen and oxygen when the voltage is applied between anode and cathode. Electrical current forces the positively charged ions to migrate to negatively charged cathode through PEM, where hydrogen is produced. Meanwhile, oxygen is produced at the anode side electrode and escapes...... in house is utilized in this work. Higher Pc has shown higher cell performance this refers to lower ohmic and activation resistances. Water crossover from anode to cathode is slightly decreased at higher Pc resulting in a slight decrease in hydrogen crossover from cathode to anode. Also, the percentage...

  13. Gate voltage and drain current stress instabilities in amorphous In–Ga–Zn–O thin-film transistors with an asymmetric graphene electrode

    Directory of Open Access Journals (Sweden)

    Joonwoo Kim

    2015-09-01

    Full Text Available The gate voltage and drain current stress instabilities in amorphous In–Ga–Zn–O thin-film transistors (a-IGZO TFTs having an asymmetric graphene electrode structure are studied. A large positive shift in the threshold voltage, which is well fitted to a stretched-exponential equation, and an increase in the subthreshold slope are observed when drain current stress is applied. This is due to an increase in temperature caused by power dissipation in the graphene/a-IGZO contact region, in addition to the channel region, which is different from the behavior in a-IGZO TFTs with a conventional transparent electrode.

  14. Low Energy Desalination Using Battery Electrode Deionization

    KAUST Repository

    Kim, Taeyoung

    2017-09-21

    New electrochemical technologies that use capacitive or battery electrodes are being developed to minimize energy requirements for desalinating brackish waters. When a pair of electrodes is charged in capacitive deionization (CDI) systems, cations bind to the cathode and anions bind to the anode, but high applied voltages (>1.2 V) result in parasitic reactions and irreversible electrode oxidation. In the battery electrode deionization (BDI) system developed here, two identical copper hexacyanoferrate (CuHCF) battery electrodes were used that release and bind cations, with anion separation occurring via an anion exchange membrane. The system used an applied voltage of 0.6 V, which avoided parasitic reactions, achieved high electrode desalination capacities (up to 100 mg-NaCl/g-electrode, 50 mM NaCl influent), and consumed less energy than CDI. Simultaneous production of desalinated and concentrated solutions in two channels avoided a two-cycle approach needed for CDI. Stacking additional membranes between CuHCF electrodes (up to three anion and two cation exchange membranes) reduced energy consumption to only 0.02 kWh/m3 (approximately an order of magnitude lower than values reported for CDI), for an influent desalination similar to CDI (25 mM decreased to 17 mM). These results show that BDI could be effective as a very low energy method for brackish water desalination.

  15. Allosteric substrate switching in a voltage-sensing lipid phosphatase.

    Science.gov (United States)

    Grimm, Sasha S; Isacoff, Ehud Y

    2016-04-01

    Allostery provides a critical control over enzyme activity, biasing the catalytic site between inactive and active states. We found that the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP), which modifies phosphoinositide signaling lipids (PIPs), has not one but two sequential active states with distinct substrate specificities, whose occupancy is allosterically controlled by sequential conformations of the voltage-sensing domain (VSD). Using fast fluorescence resonance energy transfer (FRET) reporters of PIPs to monitor enzyme activity and voltage-clamp fluorometry to monitor conformational changes in the VSD, we found that Ci-VSP switches from inactive to a PIP3-preferring active state when the VSD undergoes an initial voltage-sensing motion and then into a second PIP2-preferring active state when the VSD activates fully. This two-step allosteric control over a dual-specificity enzyme enables voltage to shape PIP concentrations in time, and provides a mechanism for the complex modulation of PIP-regulated ion channels, transporters, cell motility, endocytosis and exocytosis.

  16. Current-voltage characteristics of single-molecule diarylethene junctions measured with adjustable gold electrodes in solution.

    Science.gov (United States)

    Briechle, Bernd M; Kim, Youngsang; Ehrenreich, Philipp; Erbe, Artur; Sysoiev, Dmytro; Huhn, Thomas; Groth, Ulrich; Scheer, Elke

    2012-01-01

    We report on an experimental analysis of the charge transport through sulfur-free photochromic molecular junctions. The conductance of individual molecules contacted with gold electrodes and the current-voltage characteristics of these junctions are measured in a mechanically controlled break-junction system at room temperature and in liquid environment. We compare the transport properties of a series of molecules, labeled TSC, MN, and 4Py, with the same switching core but varying side-arms and end-groups designed for providing the mechanical and electrical contact to the gold electrodes. We perform a detailed analysis of the transport properties of TSC in its open and closed states. We find rather broad distributions of conductance values in both states. The analysis, based on the assumption that the current is carried by a single dominating molecular orbital, reveals distinct differences between both states. We discuss the appearance of diode-like behavior for the particular species 4Py that features end-groups, which preferentially couple to the metal electrode by physisorption. We show that the energetic position of the molecular orbital varies as a function of the transmission. Finally, we show for the species MN that the use of two cyano end-groups on each side considerably enhances the coupling strength compared to the typical behavior of a single cyano group.

  17. Current–voltage characteristics of single-molecule diarylethene junctions measured with adjustable gold electrodes in solution

    Directory of Open Access Journals (Sweden)

    Bernd M. Briechle

    2012-11-01

    Full Text Available We report on an experimental analysis of the charge transport through sulfur-free photochromic molecular junctions. The conductance of individual molecules contacted with gold electrodes and the current–voltage characteristics of these junctions are measured in a mechanically controlled break-junction system at room temperature and in liquid environment. We compare the transport properties of a series of molecules, labeled TSC, MN, and 4Py, with the same switching core but varying side-arms and end-groups designed for providing the mechanical and electrical contact to the gold electrodes. We perform a detailed analysis of the transport properties of TSC in its open and closed states. We find rather broad distributions of conductance values in both states. The analysis, based on the assumption that the current is carried by a single dominating molecular orbital, reveals distinct differences between both states. We discuss the appearance of diode-like behavior for the particular species 4Py that features end-groups, which preferentially couple to the metal electrode by physisorption. We show that the energetic position of the molecular orbital varies as a function of the transmission. Finally, we show for the species MN that the use of two cyano end-groups on each side considerably enhances the coupling strength compared to the typical behavior of a single cyano group.

  18. Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

    Science.gov (United States)

    Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

    1988-08-01

    Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

  19. Photovoltaic panel clamp

    Science.gov (United States)

    Mittan, Margaret Birmingham [Oakland, CA; Miros, Robert H. J. [Fairfax, CA; Brown, Malcolm P [San Francisco, CA; Stancel, Robert [Loss Altos Hills, CA

    2012-06-05

    A photovoltaic panel clamp includes an upper and lower section. The interface between the assembled clamp halves and the module edge is filled by a flexible gasket material, such as EPDM rubber. The gasket preferably has small, finger like protrusions that allow for easy insertion onto the module edge while being reversed makes it more difficult to remove them from the module once installed. The clamp includes mounting posts or an integral axle to engage a bracket. The clamp also may include a locking tongue to secure the clamp to a bracket.

  20. Selective Arterial Clamping Versus Hilar Clamping for Minimally Invasive Partial Nephrectomy.

    Science.gov (United States)

    Yezdani, Mona; Yu, Sue-Jean; Lee, David I

    2016-05-01

    Partial nephrectomy has become an accepted treatment of cT1 renal masses as it provides improved long-term renal function compared to radical nephrectomy (Campbell et al. J Urol. 182:1271-9, 2009). Hilar clamping is utilized to help reduce bleeding and improve visibility during tumor resection. However, concern over risk of kidney injury with hilar clamping has led to new techniques to reduce length of warm ischemia time (WIT) during partial nephrectomy. These techniques have progressed over the years starting with early hilar unclamping, controlled hypotension during tumor resection, selective arterial clamping, minimal margin techniques, and off-clamp procedures. Selective arterial clamping has progressed significantly over the years. The main question is what are the exact short- and long-term renal effects from increasing clamp time. Moreover, does it make sense to perform these more time-consuming or more complex procedures if there is no long-term preservation of kidney function? More recent studies have shown no difference in renal function 6 months from surgery when selective arterial clamping or even hilar clamping is employed, although there is short-term improved decline in estimated glomerular filtration rate (eGFR) with selective clamping and off-clamp techniques (Komninos et al. BJU Int. 115:921-8, 2015; Shah et al. 117:293-9, 2015; Kallingal et al. BJU Int. doi: 10.1111/bju.13192, 2015). This paper reviews the progression of total hilar clamping to selective arterial clamping (SAC) and the possible difference its use makes on long-term renal function. SAC may be attempted based on surgeon's decision-making, but may be best used for more complex, larger, more central or hilar tumors and in patients who have renal insufficiency at baseline or a solitary kidney.

  1. A multi-electrode and pre-deformed bilayer spring structure electrostatic attractive MEMS actuator with large stroke at low actuation voltage

    International Nuclear Information System (INIS)

    Hu, Fangrong; Li, Zhi; Xiong, Xianming; Niu, Junhao; Peng, Zhiyong; Qian, Yixian; Yao, Jun

    2012-01-01

    This paper presents a multi-electrode and pre-deformed bilayer spring structure electrostatic attractive microelectromechanical systems (MEMS) actuator; it has large stroke at relatively low actuation voltage. Generally, electrostatic-attractive-force-based actuators have small stroke due to the instability resulted from the electrostatic ‘pull-in’ phenomenon. However, in many applications, the electrostatic micro-actuator with large stroke at low voltage is more preferred. By introducing a multi-electrode and a pre-deformed bilayer spring structure, an electrostatic attractive MEMS actuator with large stroke at very low actuation voltage has been successfully demonstrated in this paper. The actuator contains a central plate with a size of 300 µm × 300 µm × 1.5 µm and it is supported by four L-shaped bilayer springs which are pre-deformed due to residual stresses. Each bilayer spring is simultaneously attracted by three adjacent fixed electrodes, and the factors affecting the electrostatic attractive force are analyzed by a finite element analysis method. The prototype of the actuator is fabricated by poly-multi-user-MEMS-process (PolyMUMP) and the static performance is tested using a white light interferometer. The measured stroke of the actuator reaches 2 µm at 13 V dc, and it shows a good agreement with the simulation. (paper)

  2. High Performance ZVT with Bus Clamping Modulation Technique for Single Phase Full Bridge Inverters

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Yinglai; Ayyanar, Raja

    2016-03-20

    This paper proposes a topology based on bus clamping modulation and zero-voltage-transition (ZVT) technique to realize zero-voltage-switching (ZVS) for all the main switches of the full bridge inverters, and inherent ZVS and/or ZCS for the auxiliary switches. The advantages of the strategy include significant reduction in the turn-on loss of the ZVT auxiliary switches which typically account for a major part of the total loss in other ZVT circuits, and reduction in the voltage ratings of auxiliary switches. The modulation scheme and the commutation stages are analyzed in detail. Finally, a 1kW, 500 kHz switching frequency inverter of the proposed topology using SiC MOSFETs has been built to validate the theoretical analysis. The ZVT with bus clamping modulation technique of fixed timing and adaptive timing schemes are implemented in DSP TMS320F28335 resulting in full ZVS for the main switches in the full bridge inverter. The proposed scheme can save up to 33 % of the switching loss compared with no ZVT case.

  3. Evaluation of clamp effects on LMFBR piping systems

    International Nuclear Information System (INIS)

    Jones, G.L.

    1980-01-01

    Loop-type liquid metal breeder reactor plants utilize thin-wall piping to mitigate through-wall thermal gradients due to rapid thermal transients. These piping loops require a support system to carry the combined weight of the pipe, coolant and insulation and to provide attachments for seismic restraints. The support system examined here utilizes an insulated pipe clamp designed to minimize the stresses induced in the piping. To determine the effect of these clamps on the pipe wall a non-linear, two-dimensional, finite element model of the clamp, insulation and pipe wall was used to determine the clamp/pipe interface load distributions which were then applied to a three-dimensional, finite element model of the pipe. The two-dimensional interaction model was also utilized to estimate the combined clamp/pipe stiffness

  4. Functionality and stability data of detergent purified nAChR from Torpedo using lipidic matrixes and macroscopic electrophysiology

    Directory of Open Access Journals (Sweden)

    Luis F. Padilla-Morales

    2016-03-01

    Full Text Available The presented data provides additional information about the assessment of affinity purified nicotinic acetylcholine receptor (nAChR rich membrane solubilized with long chain (16 saturated carbons lysophospholipid with glycerol headgroup (LFG-16. The assessment of stability and functionality of solubilized membrane protein is a critical step prior to further crystallization trails. One of the key factors for this task is the appropriate choice of a detergent that can support nAChR activity and stability comparable to the crude membranes. The stability of the nAChR-LFG-16 complex incorporated into lipid cubic phase (LCP was monitored for a period of 30 days by means of fluorescence recovery after photobleaching (FRAP and the functionality was evaluated after its incorporation into Xenopus oocyte by means of the two electrode voltage clamp technique. Keywords: Detergents, Fluorescence recovery after photobleaching, Lipidic Cubic Phase, nAChR, Planar lipid bilayer, Two-electrode voltage clamp

  5. Neuroprotective effect of interleukin-6 regulation of voltage-gated Na+ channels of cortical neurons is time- and dose-dependent

    Directory of Open Access Journals (Sweden)

    Wei Xia

    2015-01-01

    Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.

  6. Tetrazolyl isoxazole amino acids as ionotropic glutamate receptor antagonists: synthesis, modelling and molecular pharmacology

    DEFF Research Database (Denmark)

    Frølund, Bente; Greenwood, Jeremy R; Holm, Mai Marie

    2005-01-01

    and 1b were pharmacologically characterized in receptor binding assays, and electrophysiologically on homomeric AMPA receptors (GluR1-4), homomeric (GluR5 and GluR6) and heteromeric (GluR6/KA2) kainic acid receptors, using two-electrode voltage-clamped Xenopus laevis oocytes expressing these receptors...

  7. Specific Localization of High-Voltage Discharge in Vicinity of Two Gases

    Science.gov (United States)

    Leonov, Sergey; Shurupov, Michail; Shneider, Michail; Napartovich, Anatoly; Kochetov, Igor

    2011-10-01

    A subject of paper is the appearance and dynamics of sub-microsecond long filamentary high-voltage discharge generated in atmosphere, and in non-homogeneous gaseous media. Typical discharge parameters are: maximal current 1-3kA, breakdown voltage >100 kV, duration 30-100 ns, gap distance 50-100mm. The effect of discharge specific localization within mixing layer of two gases is particularly discussed. The second discussed idea is the filamentary discharge movement within a region with concentration gradient of different components. For the short-pulse discharge the physical mechanism appears as the following. The first stage of the spark breakdown is the multiple streamers propagation from the high-voltage electrode toward the grounded one. In case of high-power electrical source those streamers occupy a huge volume of the gas, covering all possible paths for the further development. The next phase consists of the real selection of the discharge path among the multiple channels with non-zero conductivity. Experiments and calculations are presented for Air-CO2 and Air-C2H4 pairs. The effects found are supposed to be applied for lightning prediction/protection, and for high-speed mixing acceleration. The work was funded through EOARD-ISTC project #3793p. Some part of this work was supported by RFBR grant #10-08-00952.

  8. Active gate driver for dv/dt control and active voltage clamping in an IGBT stack

    DEFF Research Database (Denmark)

    Rasmussen, Tonny Wederberg

    2005-01-01

    For high voltages converters stacks of IGBTs can be used if the static and dynamic voltage sharing among the IGBTs can be applied. dVCE/dt should also be controlled in order not to damage insulation material. This paper describes theory and measurements of an active gate driver for stacking IGBTs....... For the measurements two series connected standard IGBTs made for hard switching applications are used. Problems are shown and proposals for improvements are given....

  9. Voltage uniformity study in large-area reactors for RF plasma deposition

    Energy Technology Data Exchange (ETDEWEB)

    Sansonnens, L.; Pletzer, A.; Magni, D.; Howling, A.A.; Hollenstein, C. [Ecole Polytechnique Federale, Lausanne (Switzerland). Centre de Recherche en Physique des Plasma (CRPP); Schmitt, J.P.M. [Balzers Process Systems, Palaiseau (France)

    1996-09-01

    Non-uniform voltage distribution across the electrode area results in inhomogeneous thin-film RF plasma deposition in large area reactors. In this work, a two-dimensional analytic model for the calculation of the voltage distribution across the electrode area is presented. The results of this model are in good agreement with measurements performed without plasma at 13.56 MHz and 70 MHz in a large area reactor. The principal voltage inhomogeneities are caused by logarithmic singularities in the vicinity of RF connections and not by standing waves. These singularities are only described by a two-dimensional model and cannot be intuitively predicted by analogy to a one-dimensional case. Plasma light emission measurements and thickness homogeneity studies of a-Si:H films show that the plasma reproduces these voltage inhomogeneities. Improvement of the voltage uniformity is investigated by changing the number and position of the RF connections. (author) 13 figs., 20 refs.

  10. High voltage switches having one or more floating conductor layers

    Science.gov (United States)

    Werne, Roger W.; Sampayan, Stephen; Harris, John Richardson

    2015-11-24

    This patent document discloses high voltage switches that include one or more electrically floating conductor layers that are isolated from one another in the dielectric medium between the top and bottom switch electrodes. The presence of the one or more electrically floating conductor layers between the top and bottom switch electrodes allow the dielectric medium between the top and bottom switch electrodes to exhibit a higher breakdown voltage than the breakdown voltage when the one or more electrically floating conductor layers are not present between the top and bottom switch electrodes. This increased breakdown voltage in the presence of one or more electrically floating conductor layers in a dielectric medium enables the switch to supply a higher voltage for various high voltage circuits and electric systems.

  11. Allosteric substrate switching in a voltage sensing lipid phosphatase

    Science.gov (United States)

    Grimm, Sasha S.; Isacoff, Ehud Y.

    2016-01-01

    Allostery provides a critical control over enzyme activity, biasing the catalytic site between inactive and active states. We find the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP), which modifies phosphoinositide signaling lipids (PIPs), to have not one but two sequential active states with distinct substrate specificities, whose occupancy is allosterically controlled by sequential conformations of the voltage sensing domain (VSD). Using fast FRET reporters of PIPs to monitor enzyme activity and voltage clamp fluorometry to monitor conformational changes in the VSD, we find that Ci-VSP switches from inactive to a PIP3-preferring active state when the VSD undergoes an initial voltage sensing motion and then into a second PIP2-preferring active state when the VSD activates fully. This novel 2-step allosteric control over a dual specificity enzyme enables voltage to shape PIP concentrations in time, and provides a mechanism for the complex modulation of PIP-regulated ion channels, transporters, cell motility and endo/exocytosis. PMID:26878552

  12. High voltage dc-dc converter with dynamic voltage regulation and decoupling during load-generated arcs

    Science.gov (United States)

    Shimer, Daniel W.; Lange, Arnold C.

    1995-01-01

    A high-power power supply produces a controllable, constant high voltage output under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules.

  13. High voltage dc--dc converter with dynamic voltage regulation and decoupling during load-generated arcs

    Science.gov (United States)

    Shimer, D.W.; Lange, A.C.

    1995-05-23

    A high-power power supply produces a controllable, constant high voltage output under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules. 5 Figs.

  14. Fluctuation-Coupling of Cathode Cavity Pressure and Arc Voltage in a dc Plasma Torch with a Long Inter-Electrode Channel at Reduced Pressure

    International Nuclear Information System (INIS)

    Cao Jin-Wen; Huang He-Ji; Pan Wen-Xia

    2014-01-01

    Fluctuations of cathode cavity pressure and arc voltage are observed experimentally in a dc plasma torch with a long inter-electrode channel. The results show that they have the same frequency of around 4 kHz under typical experimental conditions. The observed phase difference between the pressure and the voltage, which is influenced by the path length between the pressure sensor and the cathode cavity, varies with different input powers. Combined with numerical simulation, the position of the pressure perturbation origin is estimated, and the results show that it is located at 0.01–0.05 m upstream of the inter-electrode channel outlet

  15. Duo-Active-Neutral-Point-Clamped Multilevel Converter: An Exploration of the Fundamental Topology and Experimental Verification

    DEFF Research Database (Denmark)

    Dargahi, Vahid; Corzine, Keith A.; Enslin, Johan H.

    2018-01-01

    For medium-voltage (MV) industrial applications such as the HVDC and adjustable-speed ac-motor drives, the multilevel voltage-source converters are deemed the predominant topologies. One of the promising derived-topologies from the neutral-point-clamped (NPC) configuration is the active NPC (ANPC......) structure with an improved balanced lossdistribution performance. This paper introduces duo-ANPC (D-ANPC) converter topology, which is controlled with a new modulation technique. The suggested control method regulates the flying capacitor (FC) voltages naturally at their reference values and preserves...

  16. Gambierol, a toxin produced by the dinoflagellate Gambierdiscus toxicus, is a potent blocker of voltage-gated potassium channels☆

    Science.gov (United States)

    Cuypers, Eva; Abdel-Mottaleb, Yousra; Kopljar, Ivan; Rainier, Jon D.; Raes, Adam L.; Snyders, Dirk J.; Tytgat, Jan

    2008-01-01

    In this study, we pharmacologically characterized gambierol, a marine polycyclic ether toxin which is produced by the dinoflagellate Gambierdiscus toxicus. Besides several other polycyclic ether toxins like ciguatoxins, this scarcely studied toxin is one of the compounds that may be responsible for ciguatera fish poisoning (CFP). Unfortunately, the biological target(s) that underlies CFP is still partly unknown. Today, ciguatoxins are described to specifically activate voltage-gated sodium channels by interacting with their receptor site 5. But some dispute about the role of gambierol in the CFP story shows up: some describe voltage-gated sodium channels as the target, while others pinpoint voltage-gated potassium channels as targets. Since gambierol was never tested on isolated ion channels before, it was subjected in this work to extensive screening on a panel of 17 ion channels: nine cloned voltage-gated ion channels (mammalian Nav1.1–Nav1.8 and insect Para) and eight cloned voltage-gated potassium channels (mammalian Kv1.1–Kv1.6, hERG and insect ShakerIR) expressed in Xenopus laevis oocytes using two-electrode voltage-clamp technique. All tested sodium channel subtypes are insensitive to gambierol concentrations up to 10 μM. In contrast, Kv1.2 is the most sensitive voltage-gated potassium channel subtype with almost full block (>97%) and an half maximal inhibitory concentration (IC50) of 34.5 nM. To the best of our knowledge, this is the first study where the selectivity of gambierol is tested on isolated voltage-gated ion channels. Therefore, these results lead to a better understanding of gambierol and its possible role in CFP and they may also be useful in the development of more effective treatments. PMID:18313714

  17. Stable operation of a high-power piezoelectric transformer comprising two identical bolt-clamped Langevin-type transducers and a stepped horn

    Science.gov (United States)

    Adachi, Kazunari; Suzuki, Kohei; Shibamata, Yuki

    2018-06-01

    We previously developed a 100 W piezoelectric transformer comprising two identical bolt-clamped Langevin-type transducers (BLTs) and a stepped horn whose cross-sectional area ratio determines the specified step-up voltage transformation ratio. Unlike conventional piezoelectric transformers, this transformer is driven at a frequency quite near its mechanical resonance, and thus can be mechanically held firmly at its clearly identified vibratory node without mechanical energy loss. However, it has been revealed that the high-power operation of the transformer often becomes very unstable owing to the “jumping and dropping” phenomena first found by Takahashi and Hirose [Jpn. J. Appl. Phys. 31, 3055 (1992)]. To avoid this instability, we have investigated the peculiar phenomena, and found that they can be attributed to a heavily distorted electric field inside the piezoelectric ceramic disks of the BLT on the primary side of the transformer being driven by a low-impedance voltage source near the mechanical resonance. The resultant concentration of the electric field leads to the local reversal of piezoelectric polarization in every half period of the vibration, viz., the instability. Consequently, we have developed a scheme for the steady high-power operation of this type of piezoelectric transformer and examined its validity experimentally. The method has eventually improved the linearity and power transfer efficiency of the transformer significantly.

  18. Real-time management of faulty electrodes in electrical impedance tomography.

    Science.gov (United States)

    Hartinger, Alzbeta E; Guardo, Robert; Adler, Andy; Gagnon, Hervé

    2009-02-01

    Completely or partially disconnected electrodes are a fairly common occurrence in many electrical impedance tomography (EIT) clinical applications. Several factors can contribute to electrode disconnection: patient movement, perspiration, manipulations by clinical staff, and defective electrode leads or electronics. By corrupting several measurements, faulty electrodes introduce significant image artifacts. In order to properly manage faulty electrodes, it is necessary to: 1) account for invalid data in image reconstruction algorithms and 2) automatically detect faulty electrodes. This paper presents a two-part approach for real-time management of faulty electrodes based on the principle of voltage-current reciprocity. The first part allows accounting for faulty electrodes in EIT image reconstruction without a priori knowledge of which electrodes are at fault. The method properly weights each measurement according to its compliance with the principle of voltage-current reciprocity. Results show that the algorithm is able to automatically determine the valid portion of the data and use it to calculate high-quality images. The second part of the approach allows automatic real-time detection of at least one faulty electrode with 100% sensitivity and two faulty electrodes with 80% sensitivity enabling the clinical staff to fix the problem as soon as possible to minimize data loss.

  19. Treatment of emulsified oils by electrocoagulation: pulsed voltage applications.

    Science.gov (United States)

    Genc, Ayten; Bakirci, Busra

    2015-01-01

    The effect of pulsed voltage application on energy consumption during electrocoagulation was investigated. Three voltage profiles having the same arithmetic average with respect to time were applied to the electrodes. The specific energy consumption for these profiles were evaluated and analyzed together with oil removal efficiencies. The effects of applied voltages, electrode materials, electrode configurations, and pH on oil removal efficiency were determined. Electrocoagulation experiments were performed by using synthetic and real wastewater samples. The pulsed voltages saved energy during the electrocoagulation process. In continuous operation, energy saving was as high as 48%. Aluminum electrodes used for the treatment of emulsified oils resulted in higher oil removal efficiencies in comparison with stainless steel and iron electrodes. When the electrodes gap was less than 1 cm, higher oil removal efficiencies were obtained. The highest oil removal efficiencies were 95% and 35% for the batch and continuous operating modes, respectively.

  20. Applications of Dynamic Clamp to Cardiac Arrhythmia Research: Role in Drug Target Discovery and Safety Pharmacology Testing

    Directory of Open Access Journals (Sweden)

    Francis A. Ortega

    2018-01-01

    Full Text Available Dynamic clamp, a hybrid-computational-experimental technique that has been used to elucidate ionic mechanisms underlying cardiac electrophysiology, is emerging as a promising tool in the discovery of potential anti-arrhythmic targets and in pharmacological safety testing. Through the injection of computationally simulated conductances into isolated cardiomyocytes in a real-time continuous loop, dynamic clamp has greatly expanded the capabilities of patch clamp outside traditional static voltage and current protocols. Recent applications include fine manipulation of injected artificial conductances to identify promising drug targets in the prevention of arrhythmia and the direct testing of model-based hypotheses. Furthermore, dynamic clamp has been used to enhance existing experimental models by addressing their intrinsic limitations, which increased predictive power in identifying pro-arrhythmic pharmacological compounds. Here, we review the recent advances of the dynamic clamp technique in cardiac electrophysiology with a focus on its future role in the development of safety testing and discovery of anti-arrhythmic drugs.

  1. Correlation of open cell-attached and excised patch clamp techniques.

    Science.gov (United States)

    Filipovic, D; Hayslett, J P

    1995-11-01

    The excised patch clamp configuration provides a unique technique for some types of single channel analyses, but maintenance of stable, long-lasting preparations may be confounded by rundown and/or rapid loss of seal. Studies were performed on the amiloride-sensitive Na+ channel, located on the apical surface of A6 cells, to determine whether the nystatin-induced open cell-attached patch could serve as an alternative configuration. Compared to excised inside-out patches, stable preparations were achieved more readily with the open cell-attached patch (9% vs. 56% of attempts). In both preparations, the current voltage (I-V) relation was linear, current amplitudes were equal at opposite equivalent clamped voltages, and Erev was zero in symmetrical Na+ solutions, indicating similar Na+ activities on the cytosolic and external surfaces of the patch. Moreover, there was no evidence that nystatin altered channel activity in the patch because slope conductance (3-4pS) and Erev (75 mV), when the bath was perfused with a high K:low Na solution (ENa = 80 mV), were nearly equal in both patch configurations. Our results therefore indicate that the nystatin-induced open cell-attached patch can serve as an alternative approach to the excised inside-out patch when experiments require modulation of univalent ions in the cytosol.

  2. Water Desalination Using Capacitive Deionization with Microporous Carbon Electrodes

    NARCIS (Netherlands)

    Porada, S.; Weinstein, L.; Dash, R.; Wal, van der A.F.; Bryjak, M.; Gogotsi, Y.; Biesheuvel, P.M.

    2012-01-01

    Capacitive deionization (CDI) is a water desalination technology in which salt ions are removed from brackish water by flowing through a spacer channel with porous electrodes on each side. Upon applying a voltage difference between the two electrodes, cations move to and are accumulated in

  3. Insulated pipe clamp design

    International Nuclear Information System (INIS)

    Anderson, M.J.; Hyde, L.L.; Wagner, S.E.; Severud, L.K.

    1980-01-01

    Thin wall large diameter piping for breeder reactor plants can be subjected to significant thermal shocks during reactor scrams and other upset events. On the Fast Flux Test Facility, the addition of thick clamps directly on the piping was undesired because the differential metal temperatures between the pipe wall and the clamp could have significantly reduced the pipe thermal fatigue life cycle capabilities. Accordingly, an insulated pipe clamp design concept was developed. The design considerations and methods along with the development tests are presented. Special considerations to guard against adverse cracking of the insulation material, to maintain the clamp-pipe stiffness desired during a seismic event, to minimize clamp restraint on the pipe during normal pipe heatup, and to resist clamp rotation or spinning on the pipe are emphasized

  4. Pulsed voltage deposited lead selenide thin film as efficient counter electrode for quantum-dot-sensitized solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Bin Bin [Key Laboratory of Macromolecular Science of Shaanxi Province & School of Materials Science and Engineering, Shaanxi Normal University, Xi’an 710062 (China); Department of Chemical Engineering, Institute of Chemical Industry, Shaanxi Institute of Technology, Xi’an 710300 (China); Wang, Ye Feng [Key Laboratory of Macromolecular Science of Shaanxi Province & School of Materials Science and Engineering, Shaanxi Normal University, Xi’an 710062 (China); Wang, Xue Qing [Faculty of Chemical, Environmental and Biological Science and Technology, Dalian University of Technology, Dalian 116024 (China); Zeng, Jing Hui, E-mail: jhzeng@ustc.edu [Key Laboratory of Macromolecular Science of Shaanxi Province & School of Materials Science and Engineering, Shaanxi Normal University, Xi’an 710062 (China)

    2016-04-30

    Highlights: • PbSe thin film is deposited on FTO glass by a pulse voltage electrodeposition method. • The thin film is used as counter electrode (CE) in quantum dot-sensitized solar cell. • Superior electrocatalytic activity and stability in the polysulfide electrolyte is received. • The narrow band gap characteristics and p-type conductivity enhances the cell efficiency. • An efficiency of 4.67% is received for the CdS/CdSe co-sensitized solar cells. - Abstract: Lead selenide (PbSe) thin films were deposited on fluorine doped tin oxide (FTO) glass by a facile one-step pulse voltage electrodeposition method, and used as counter electrode (CE) in CdS/CdSe quantum dot-sensitized solar cells (QDSSCs). A power conversion efficiency of 4.67% is received for the CdS/CdSe co-sensitized solar cells, which is much better than that of 2.39% received using Pt CEs. The enhanced performance is attributed to the extended absorption in the near infrared region, superior electrocatalytic activity and p-type conductivity with a reflection of the incident light at the back electrode in addition. The physical and chemical properties were characterized by X-ray diffraction (XRD), scanning electron microscope (SEM), transmission electron microscopy (TEM), energy-dispersive spectroscopy (EDS), reflectance spectra, electrochemical impedance spectroscopy (EIS) and Tafel polarization measurements. The present work provides a facile pathway to an efficient CE in the QDSSCs.

  5. A patch-clamp ASIC for nanopore-based DNA analysis.

    Science.gov (United States)

    Kim, Jungsuk; Maitra, Raj; Pedrotti, Kenneth D; Dunbar, William B

    2013-06-01

    In this paper, a fully integrated high-sensitivity patch-clamp system is proposed for single-molecule deoxyribonucleic acid (DNA) analysis using a nanopore sensor. This system is composed of two main blocks for amplification and compensation. The amplification block is composed of three stages: 1) a headstage, 2) a voltage-gain difference amplifier, and 3) a track-and-hold circuit, that amplify a minute ionic current variation sensed by the nanopore while the compensation block avoids the headstage saturation caused by the input parasitic capacitances during sensing. By employing design techniques novel for this application, such as an instrumentation--amplifier topology and a compensation switch, we minimize the deleterious effects of the input-offset voltage and the input parasitic capacitances while attaining hardware simplicity. This system is fabricated in a 0.35 μm 4M2P CMOS process and is demonstrated using an α-hemolysin protein nanopore for detection of individual molecules of single-stranded DNA that pass through the 1.5 nm-diameter pore. In future work, the refined system will functionalize single and multiple solid-state nanopores formed in integrated microfluidic devices for advanced DNA analysis, in scientific and diagnostic applications.

  6. Development of a Piezoelectric Vacuum Sensing Component for a Wide Pressure Range

    Directory of Open Access Journals (Sweden)

    Bing-Yu Wang

    2014-11-01

    Full Text Available In this study, we develop a clamped–clamped beam-type piezoelectric vacuum pressure sensing element. The clamped–clamped piezoelectric beam is composed of a PZT layer and a copper substrate. A pair of electrodes is set near each end. An input voltage is applied to a pair of electrodes to vibrate the piezoelectric beam, and the output voltage is measured at the other pair. Because the viscous forces on the piezoelectric beam vary at different air pressures, the vibration of the beam depends on the vacuum pressure. The developed pressure sensor can sense a wide range of pressure, from 6.5 × 10−6 to 760 Torr. The experimental results showed that the output voltage is inversely proportional to the gas damping ratio, and thus, the vacuum pressure was estimated from the output voltage.

  7. Nickel hydrogen bipolar battery electrode design

    Science.gov (United States)

    Puglisi, V. J.; Russell, P.; Verrier, D.; Hall, A.

    1985-01-01

    The preferred approach of the NASA development effort in nickel hydrogen battery design utilizes a bipolar plate stacking arrangement to obtain the required voltage-capacity configuration. In a bipolar stack, component designs must take into account not only the typical design considerations such as voltage, capacity and gas management, but also conductivity to the bipolar (i.e., intercell) plate. The nickel and hydrogen electrode development specifically relevant to bipolar cell operation is discussed. Nickel oxide electrodes, having variable type grids and in thicknesses up to .085 inch are being fabricated and characterized to provide a data base. A selection will be made based upon a system level tradeoff. Negative (hydrpogen) electrodes are being screened to select a high performance electrode which can function as a bipolar electrode. Present nickel hydrogen negative electrodes are not capable of conducting current through their cross-section. An electrode was tested which exhibits low charge and discharge polarization voltages and at the same time is conductive. Test data is presented.

  8. Mechanics of wafer bonding: Effect of clamping

    Science.gov (United States)

    Turner, K. T.; Thouless, M. D.; Spearing, S. M.

    2004-01-01

    A mechanics-based model is developed to examine the effects of clamping during wafer bonding processes. The model provides closed-form expressions that relate the initial geometry and elastic properties of the wafers to the final shape of the bonded pair and the strain energy release rate at the interface for two different clamping configurations. The results demonstrate that the curvature of bonded pairs may be controlled through the use of specific clamping arrangements during the bonding process. Furthermore, it is demonstrated that the strain energy release rate depends on the clamping configuration and that using applied loads usually leads to an undesirable increase in the strain energy release rate. The results are discussed in detail and implications for process development and bonding tool design are highlighted.

  9. Enhanced DC-Link Capacitor Voltage Balancing Control of DC–AC Multilevel Multileg Converters

    DEFF Research Database (Denmark)

    Busquets-Monge, Sergio; Maheshwari, Ram Krishan; Nicolas-Apruzzese, Joan

    2015-01-01

    This paper presents a capacitor voltage balancing control applicable to any multilevel dc–ac converter formed by a single set of series-connected capacitors implementing the dc link and semiconductor devices, such as the diode-clamped topology. The control is defined for any number of dc-link vol......This paper presents a capacitor voltage balancing control applicable to any multilevel dc–ac converter formed by a single set of series-connected capacitors implementing the dc link and semiconductor devices, such as the diode-clamped topology. The control is defined for any number of dc...

  10. Determination of the cathode fall voltage in fluorescent lamps by measurement of the operating voltage

    International Nuclear Information System (INIS)

    Hilscher, A.

    2002-01-01

    A new method for the determination of the cathode fall voltage of fluorescent lamps is shown. The cathode fall voltage can be determined by measurement of the lamp operating voltage at constant lamp wall temperature, constant discharge current and variation of the electrode heating current. Commercial lamps, which do not need to be specially prepared, can be used for the measurement. The results show good correlation to other measurements of the cathode fall voltage at various discharge currents by means of capacitive coupling. The measured values of the cathode fall voltage are used for determining the minimum, target and maximum setting of the sum of the squares of the pin currents of one electrode (the so-called SOS value) as a function of the discharge current in fluorescent lamp dimming. (author)

  11. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-07-05

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

  12. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-01-01

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

  13. SGK3 Sensitivity of Voltage Gated K+ Channel Kv1.5 (KCNA5

    Directory of Open Access Journals (Sweden)

    Musaab Ahmed

    2016-01-01

    Full Text Available Background: The serum & glucocorticoid inducible kinase isoform SGK3 is a powerful regulator of several transporters, ion channels and the Na+/K+ ATPase. Targets of SGK3 include the ubiquitin ligase Nedd4-2, which is in turn a known regulator of the voltage gated K+ channel Kv1.5 (KCNA5. The present study thus explored whether SGK3 modifies the activity of the voltage gated K+ channel KCNA5, which participates in the regulation of diverse functions including atrial cardiac action potential, activity of vascular smooth muscle cells, insulin release and tumour cell proliferation. Methods: cRNA encoding KCNA5 was injected into Xenopus oocytes with and without additional injection of cRNA encoding wild-type SGK3, constitutively active S419DSGK3, inactive K191NSGK3 and/or wild type Nedd4-2. Voltage gated K+ channel activity was quantified utilizing dual electrode voltage clamp. Results: Voltage gated current in KCNA5 expressing Xenopus oocytes was significantly enhanced by wild-type SGK3 and S419DSGK3, but not by K191NSGK3. SGK3 was effective in the presence of ouabain (1 mM and thus did not require Na+/K+ ATPase activity. Coexpression of Nedd4-2 decreased the voltage gated current in KCNA5 expressing Xenopus oocytes, an effect largely reversed by additional coexpression of SGK3. Conclusion: SGK3 is a positive regulator of KCNA5, which is at least partially effective by abrogating the effect of Nedd4-2.

  14. Dimerization of the voltage-sensing phosphatase controls its voltage-sensing and catalytic activity.

    Science.gov (United States)

    Rayaprolu, Vamseedhar; Royal, Perrine; Stengel, Karen; Sandoz, Guillaume; Kohout, Susy C

    2018-05-07

    Multimerization is a key characteristic of most voltage-sensing proteins. The main exception was thought to be the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP). In this study, we show that multimerization is also critical for Ci-VSP function. Using coimmunoprecipitation and single-molecule pull-down, we find that Ci-VSP stoichiometry is flexible. It exists as both monomers and dimers, with dimers favored at higher concentrations. We show strong dimerization via the voltage-sensing domain (VSD) and weak dimerization via the phosphatase domain. Using voltage-clamp fluorometry, we also find that VSDs cooperate to lower the voltage dependence of activation, thus favoring the activation of Ci-VSP. Finally, using activity assays, we find that dimerization alters Ci-VSP substrate specificity such that only dimeric Ci-VSP is able to dephosphorylate the 3-phosphate from PI(3,4,5)P 3 or PI(3,4)P 2 Our results indicate that dimerization plays a significant role in Ci-VSP function. © 2018 Rayaprolu et al.

  15. Single-Carrier Modulation for Neutral-Point-Clamped Inverters in Three-Phase Transformerless Photovoltaic Systems

    DEFF Research Database (Denmark)

    Guo, Xiaoqiang; Cavalcanti, Marcelo C.; Farias, Alexandre M.

    2013-01-01

    Modulation strategy is one of the most important issues for three-level neutral-point-clamped inverters in three-phase transformerless photovoltaic systems. A challenge for modulation is how to keep the common-mode voltages constant to reduce the leakage currents. A single-carrier modulation...... strategy is proposed. It has a very simple structure, and the common-mode voltages can be kept constant with no need of complex space-vector modulation or multicarrier pulsewidth modulation. Experimental results verify the theoretical analysis and the effectiveness of the presented method....

  16. Grid Filter Design for a Multi-Megawatt Medium-Voltage Voltage Source Inverter

    DEFF Research Database (Denmark)

    Rockhill, A.A.; Liserre, Marco; Teodorescu, Remus

    2011-01-01

    This paper describes the design procedure and performance of an LCL grid filter for a medium-voltage neutral point clamped (NPC) converter to be adopted for a multimegawatt wind turbine. The unique filter design challenges in this application are driven by a combination of the medium voltage...... converter, a limited allowable switching frequency, component physical size and weight concerns, and the stringent limits for allowable injected current harmonics. Traditional design procedures of grid filters for lower power and higher switching frequency converters are not valid for a multi......-megawatt filter connecting a medium-voltage converter switching at low frequency to the electric grid. This paper demonstrates a frequency domain model based approach to determine the optimum filter parameters that provide the necessary performance under all operating conditions given the necessary design...

  17. Pulsed voltage electrospray ion source and method for preventing analyte electrolysis

    Science.gov (United States)

    Kertesz, Vilmos [Knoxville, TN; Van Berkel, Gary [Clinton, TN

    2011-12-27

    An electrospray ion source and method of operation includes the application of pulsed voltage to prevent electrolysis of analytes with a low electrochemical potential. The electrospray ion source can include an emitter, a counter electrode, and a power supply. The emitter can include a liquid conduit, a primary working electrode having a liquid contacting surface, and a spray tip, where the liquid conduit and the working electrode are in liquid communication. The counter electrode can be proximate to, but separated from, the spray tip. The power system can supply voltage to the working electrode in the form of a pulse wave, where the pulse wave oscillates between at least an energized voltage and a relaxation voltage. The relaxation duration of the relaxation voltage can range from 1 millisecond to 35 milliseconds. The pulse duration of the energized voltage can be less than 1 millisecond and the frequency of the pulse wave can range from 30 to 800 Hz.

  18. Environmental and biotechnological applications of high-voltage pulsed discharges in water

    International Nuclear Information System (INIS)

    Sato, Masayuki

    2008-01-01

    A high-voltage pulse has wide application in fields such as chemistry, physics and biology and their combinations. The high-voltage pulse forms two kinds of physical processes in water, namely (a) a pulsed electric field (PEF) in the parallel electrode configuration and (b) plasma generation by a pulsed discharge in the water phase with a concentrated electric field. The PEF can be used for inactivation of bacteria in liquid foods as a non-thermal process, and the underwater plasma is applicable not only for the decomposition of organic materials in water but also for biological treatment of wastewater. These discharge states are controlled mainly by the applied pulse voltage and the electrode shape. Some examples of environmental and biotechnological applications of a high-voltage pulse are reviewed.

  19. In-situ experimental characterization of the clamping pressure effects on low temperature polymer electrolyte membrane electrolysis International Journal of Hydrogen Energy

    DEFF Research Database (Denmark)

    Al Shakhshir, Saher; Cui, Xiaoti; Frensch, Steffen Henrik

    2017-01-01

    as a gas with the circulating water. The effects of clamping pressure (Pc) on the LT-PEME cell performance, polarization resistances, and hydrogen and water crossover through the membrane, and hydrogen and oxygen production rate are studied. A 50 cm2 active area LT-PEME cell designed and manufactured......-PEME splits water into hydrogen and oxygen when the voltage is applied between anode and cathode. Electrical current forces the positively charged ions to migrate to negatively charged cathode through PEM, where hydrogen is produced. Meanwhile, oxygen is produced at the anode side electrode and escapes...... in house is utilized in this work. Higher Pc has shown higher cell performance this refers to lower ohmic and activation resistances. Water crossover from anode to cathode is slightly decreased at higher Pc resulting in a slight decrease in hydrogen crossover from cathode to anode. Also, the percentage...

  20. Impedances of electrochemically impregnated nickel electrodes as functions of potential, KOH concentration, and impregnation method

    Science.gov (United States)

    Reid, Margaret A.

    1989-01-01

    Impedances of fifteen electrodes form each of the four U.S. manufactures were measured at 0.200 V vs. the Hg/HgO reference electrode. This corresponds to a voltage of 1.145 for a Ni/H2 cell. Measurements were also made of a representative sample of these at 0.44 V. At the higher voltage, the impedances were small and very similar, but at the lower voltage there were major differences between manufacturers. Electrodes from the same manufacturers showed only small differences. The impedances of electrodes from two manufacturers were considerably different in 26 percent KOH from those in 31 percent KOH. These preliminary results seen to correlate with the limited data from earlier life testing of cells from these manufacturers. The impedances of cells being tested for Space Station Freedom are being followed, and more impendance measurements of electrodes are being performed as functions of manufacturer, voltage, electrolyte concentration, and cycle history in hopes of finding better correlations of impedance with life.

  1. Dielectric-wall linear accelerator with a high voltage fast rise time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators

    Science.gov (United States)

    Caporaso, George J.; Sampayan, Stephen E.; Kirbie, Hugh C.

    1998-01-01

    A dielectric-wall linear accelerator is improved by a high-voltage, fast rise-time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators. A high voltage is placed between the electrodes sufficient to stress the voltage breakdown of the insulator on command. A light trigger, such as a laser, is focused along at least one line along the edge surface of the laminated alternating layers of isolated conductors and insulators extending between the electrodes. The laser is energized to initiate a surface breakdown by a fluence of photons, thus causing the electrical switch to close very promptly. Such insulators and lasers are incorporated in a dielectric wall linear accelerator with Blumlein modules, and phasing is controlled by adjusting the length of fiber optic cables that carry the laser light to the insulator surface.

  2. A HIGH CURRENT, HIGH VOLTAGE SOLID-STATE PULSE GENERATOR FOR THE NIF PLASMA ELECTRODE POCKELS CELL

    International Nuclear Information System (INIS)

    Arnold, P A; Barbosa, F; Cook, E G; Hickman, B C; Akana, G L; Brooksby, C A

    2007-01-01

    A high current, high voltage, all solid-state pulse modulator has been developed for use in the Plasma Electrode Pockels Cell (PEPC) subsystem in the National Ignition Facility. The MOSFET-switched pulse generator, designed to be a more capable plug-in replacement for the thyratron-switched units currently deployed in NIF, offers unprecedented capabilities including burst-mode operation, pulse width agility and a steady-state pulse repetition frequency exceeding 1 Hz. Capable of delivering requisite fast risetime, 17 kV flattop pulses into a 6 (Omega) load, the pulser employs a modular architecture characteristic of the inductive adder technology, pioneered at LLNL for use in acceleration applications, which keeps primary voltages low (and well within the capabilities of existing FET technology), reduces fabrication costs and is amenable to rapid assembly and quick field repairs

  3. Influence of a pulse duration of high-voltage supply on the efficiency of ozone synthesis in the 'needle-plane' electrode system

    International Nuclear Information System (INIS)

    Golota, V.I.; Zavada, L.M.; Karas, V.I.; Kotjukov, O.V.; Poliakov, O.V.; Pugach, S.G.

    2007-01-01

    We present the results of studies of the electrodynamic characteristics of a barrier less discharge with electrodes of the 'needle-plane' type and a high-voltage pulse of positive polarity, being applied to the edge electrode. The efficiency of ozone synthesis is determined as a function of the pulse duration and repetition rate. It is shown that the electrodynamic characteristics of the discharge and the effectiveness of ozone synthesis in oxygen-containing gas mixtures essentially depend on the parameters of the pulse supply

  4. Prediction of picosecond voltage collapse and electromagnetic wave generation in gas avalanche switches

    International Nuclear Information System (INIS)

    Mayhall, D.J.; Yee, J.H.; Duong-Van, M.; Villa, F.

    1988-01-01

    A picosecond speed switch, the Gas Avalanche Switch (GAS), has been proposed for GeV linear accelerators. The medium is gas at high pressure (100 - 700 atm). An avalanche discharge is induced between pulse-charged high voltage electrodes by electron deposition from a fast laser pulse. Avalanche electrons move to the positive electrode, causing the applied voltage to collapse in picoseconds. A two-dimensional (2D) electromagnetic electron fluid computer code calculates the avalanche evolution and voltage collapse in air for an infinite parallel plate capacitor with a 0.1 mm spacing. Calculations are done for an accelerator switch geometry consisting of a 0.7 mm wide by 0.8 mm high, rectangular, high voltage center electrode (CE) between the grounded plates of a parallel plate line of 2 mm spacing. Several variations of CE elevation and initial electron deposition are investigated The 2D character of the outgoing TEM waves is shown

  5. Use of the Satinsky clamp for hilar clamping during robotic partial nephrectomy: indications, technique, and multi-center outcomes.

    Science.gov (United States)

    Abdullah, Newaj; Rahbar, Haider; Barod, Ravi; Dalela, Deepansh; Larson, Jeff; Johnson, Michael; Mass, Alon; Zargar, Homayoun; Kaouk, Jihad; Allaf, Mohamad; Bhayani, Sam; Stifelman, Michael; Rogers, Craig

    2017-03-01

    A Satinsky clamp may be a backup option for hilar clamping during robotic partial nephrectomy (RPN) if there are challenges with application of bulldog clamps, but there are potential safety concerns. We evaluate outcomes of RPN using Satinsky vs. bulldog clamps, and provide tips for safe use of the Satinsky as a backup option. Using a multi-center database, we identified 1073 patients who underwent RPN between 2006 and 2013, and had information available about method of hilar clamping (bulldog clamp vs. Satinsky clamp). Patient baseline characteristics, tumor features, and perioperative outcomes were compared between the Satinsky and bulldog clamp groups. A Satinsky clamp was used for hilar clamping in 94 (8.8 %) RPN cases, and bulldog clamps were used in 979 (91.2 %) cases. The use of a Satinsky clamp was associated with greater operative time (198 vs. 175 min, p hilar clamping during challenging RPN cases, but requires careful technique, and was rarely necessary.

  6. Chromatic aberrations of two-electrode transaxial mirrors

    International Nuclear Information System (INIS)

    Bejzina, L.G.; Karetskaya, S.P.

    1991-01-01

    Second order chromatic aberrations of electrostatic two-electrode transaxial mirrors in case the beam axial trajectory of charged particles is curvilinear are considered. Interrelations between coefficients of linear and angular chromatic aberrations are determined. Values of these coefficients for concave and convex transaxial mirrors with plane electrodes in dependence on potential ratio on electrodes by different onnular clearance radii are presented

  7. Methods for Specific Electrode Resistance Measurement during Transcranial Direct Current Stimulation

    Science.gov (United States)

    Khadka, Niranjan; Rahman, Asif; Sarantos, Chris; Truong, Dennis Q.; Bikson, Marom

    2014-01-01

    Background Transcranial Direct Current Stimulation (tDCS) is investigated to treat a wide range of neuropsychiatric disorders, for rehabilitation, and for enhancing cognitive performance. The monitoring of electrode resistance before and during tDCS is considered important for tolerability and safety, where an unusually high resistance is indicative of undesired electrode or poor skin contact conditions. Conventional resistance measurement methods do not isolate individual electrode resistance but rather measures overall voltage. Moreover, for HD-tDCS devices, cross talk across electrodes makes concurrent resistance monitoring unreliable. Objective We propose a novel method for monitoring of the individual electrode resistance during tDCS, using a super-position of direct current with a test-signal (low-intensity and low-frequency sinusoids with electrode– specific frequencies) and a single sentinel electrode (not used for DC). Methods To validate this methodology, we developed lumped-parameter models of two and multi-electrode tDCS. Approaches with and without a sentinel electrode were solved and underlying assumptions identified. Assumptions were tested and parameterized in healthy participants using forearm stimulation combining tDCS (2 mA) and sinusoidal test-signals (38 μA and 76 μA peak to peak at 1 Hz, 10 Hz, and 100 Hz) and an in vitro test (where varied electrode failure modes were created). DC and AC component voltages across the electrodes were compared and participants were asked to rate subjective pain. Results A sentinel electrode is required to isolate electrode resistance in a two-electrode tDCS system. For multi-electrode resistance tracking, cross talk was aggravated with electrode proximity and current/resistance mismatches, but could be corrected using proposed approaches. Average voltage and average pain scores were not significantly different across test current intensities and frequencies (two-way repeated measures ANOVA) indicating the

  8. The plastic instability of clamped-clamped conical thin-walled pipe reducers

    International Nuclear Information System (INIS)

    Awad, Ibrahim; Saleh, Ch.A.R.; Ragab, A.R.

    2016-01-01

    The analytical study for plastic deformation of clamped–clamped conical reducer pipe under internal pressure does not deduce a closed form expression for the pressure at plastic instability. The presented study employs finite element analysis (FEA) to estimate the internal pressure at instability for conical reducers made of different materials and having different dimensional configurations. Forty dimensional configurations, classified as medium type, and five types of materials have been included in the analysis using ABAQUS package. A correlation expression is derived by nonlinear regression to predict the instability pressure. The proposed expression is verified for other dimensional configurations out of the above used forty models and for other materials. Experiments have been conducted by pressurizing conical clamped-clamped reducers until bursting in order to verify the finite element models. Comparison of instability pressures, strains and deflections at specific points along the conical surface shows satisfactory agreement between analysis and experiments. - Highlights: • This study offers a parametric study of the plastic instability pressure of clamped-clamped conical reducers. • A closed form analytical expression for the instability pressure is derived by using nonlinear regression. • The finite element analysis is validated by conducting bursting tests.

  9. High performance control strategy for single-phase three-level neutral-point-clamped traction four-quadrant converters

    DEFF Research Database (Denmark)

    Kejian, Song; Konstantinou, Georgios; Jing, Li

    2017-01-01

    Operational data from Chinese railways indicate a number of challenges for traction four-quadrant converter (4QC) control including low-order voltage and current harmonics and reference tracking. A control strategy for a single-phase three-level neutral-point-clamped 4QC employed in the electric...

  10. High frequency breakdown voltage

    International Nuclear Information System (INIS)

    Chu, Thanh Duy.

    1992-03-01

    This report contains information about the effect of frequency on the breakdown voltage of an air gap at standard pressure and temperature, 76 mm Hg and O degrees C, respectively. The frequencies of interest are 47 MHz and 60 MHz. Additionally, the breakdown in vacuum is briefly considered. The breakdown mechanism is explained on the basis of collision and ionization. The presence of the positive ions produced by ionization enhances the field in the gap, and thus determines the breakdown. When a low-frequency voltage is applied across the gap, the breakdown mechanism is the same as that caused by the DC or static voltage. However, when the frequency exceeds the first critical value f c , the positive ions are trapped in the gap, increasing the field considerably. This makes the breakdown occur earlier; in other words, the breakdown voltage is lowered. As the frequency increases two decades or more, the second critical frequency, f ce , is reached. This time the electrons start being trapped in the gap. Those electrons that travel multiple times across the gap before reaching the positive electrode result in an enormous number of electrons and positive ions being present in the gap. The result is a further decrease of the breakdown voltage. However, increasing the frequency does not decrease the breakdown voltage correspondingly. In fact, the associated breakdown field intensity is almost constant (about 29 kV/cm).The reason is that the recombination rate increases and counterbalances the production rate, thus reducing the effect of the positive ions' concentration in the gap. The theory of collision and ionization does not apply to the breakdown in vacuum. It seems that the breakdown in vacuum is primarily determined by the irregularities on the surfaces of the electrodes. Therefore, the effect of frequency on the breakdown, if any, is of secondary importance

  11. Gabapentin Modulates HCN4 Channel Voltage-Dependence

    Directory of Open Access Journals (Sweden)

    Han-Shen Tae

    2017-08-01

    Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

  12. Wearable Solid-State Supercapacitors Operating at High Working Voltage with a Flexible Nanocomposite Electrode.

    Science.gov (United States)

    Li, Xiaoyan; Wang, Jun; Zhao, Yaping; Ge, Fengyan; Komarneni, Sridhar; Cai, Zaisheng

    2016-10-05

    The proposed approach for fabricating ultralight self-sustained electrodes facilitates the structural integration of highly flexible carbon nanofibers, amino-modified multiwalled carbon nanotubes (AM-MWNT), and MnO 2 nanoflakes for potential use in wearable supercapacitors. Because of the higher orientation of AM-MWNT and the sublimation of terephthalic acid (PTA) in the carbonization process, freestanding electrodes could be realized with high porosity and flexibility and could possess remarkable electrochemical properties without using polymer substrates. Wearable symmetric solid-state supercapacitors were further assembled using a LiCl/PVA gel electrolyte, which exhibit a maximum energy density of 44.57 Wh/kg (at a power density of 337.1 W/kg) and a power density of 13330 W/kg (at an energy density of 19.64 Wh/kg) with a working voltage as high as 1.8 V. Due to the combination of several favorable traits such as flexibility, high energy density, and excellent electrochemical cyclability, the presently developed wearable supercapacitors with wide potential windows are expected to be useful for new kinds of portable electric devices.

  13. Aging of electrochemical double layer capacitors with acetonitrile-based electrolyte at elevated voltages

    International Nuclear Information System (INIS)

    Ruch, P.W.; Cericola, D.; Foelske-Schmitz, A.; Koetz, R.; Wokaun, A.

    2010-01-01

    Laboratory-scale electrochemical capacitor cells with bound activated carbon electrodes and acetonitrile-based electrolyte were aged at various elevated constant cell voltages between 2.75 V and 4.0 V. During the constant voltage tests, the cell capacitance as well as the capacitance and resistance of each electrode was determined. Following each aging experiment, the cells were analyzed by means of electrochemical impedance spectroscopy, and the individual electrodes were characterized by gas adsorption and X-ray photoelectron spectroscopy. At cell voltages above 3.0 V, the positive electrode ages much faster than the negative. Both the capacitance loss and resistance increase of the cell could be totally attributed to the positive electrode. At cell voltages above 3.5 V also the negative electrode aged significantly. X-ray photoelectron spectroscopy indicated the presence of degradation products on the electrode surface with a much thicker layer on the positive electrode. Simultaneously, a significant decrease in electrode porosity could be detected by gas adsorption.

  14. Ion collection from laser-induced plasma by applying radio-frequency voltage

    International Nuclear Information System (INIS)

    Shibata, Takemasa; Ogura, Koichi

    1995-01-01

    Ions were collected on the electrodes from a laser resonance photoionized plasma by applying 1.8MHz radio-frequency voltage to the electrode. It was demonstrated that the ions are collected in a shorter time at the same kinetic energy of the collected ions compared with ion collection by applying DC voltage to the electrode. A simple one-dimensional model was extended for prediction of ion collection times in the cases of applications of not only the DC voltage but also the radio-frequency voltage. The ion collection times estimated using the simple one-dimensional model agreed with experimental values in both cases of DC and radio-frequency voltages. (author)

  15. Electrochemical surface plasmon resonance sensor based on two-electrode configuration

    International Nuclear Information System (INIS)

    Zhang, Bing; Dong, Wei; Wen, Yizhang; Pang, Kai; Wang, Xiaoping; Li, Yazhuo; Zhan, Shuyue

    2016-01-01

    To obtain detailed information about electrochemistry reactions, a two-electrode electrochemical surface plasmon resonance (EC-SPR) sensor has been proposed. We describe the theory of potential modulation for this novel sensor and determine the factors that can change the SPR resonance angle. The reference electrode in three-electrode configuration was eliminated, and comparing with several other electrode materials, activated carbon (AC) is employed as the suitable counter electrode for its potential stability. Just like three-electrode configuration, the simpler AC two-electrode system can also obtain detailed information about the electrochemical reactions. (paper)

  16. Modulation Methods for Three-level Neutral-Point-Clamped Inverter Achieving Stress Redistribution under Moderate Modulation Index

    DEFF Research Database (Denmark)

    Ma, Ke; Blaabjerg, Frede

    2016-01-01

    This letter investigates the loss and thermal behaviors of a three-level neutral-point-clamped (3L-NPC) inverter undergoing moderate modulation index, which is typically presented during minor voltage sags of the power grid or speed changes of the electric machines. A series of new space vector m...

  17. Oscillation of Critical Current by Gate Voltage in Cooper Pair Transistor

    International Nuclear Information System (INIS)

    Kim, N.; Cheong, Y.; Song, W.

    2010-01-01

    We measured the critical current of a Cooper pair transistor consisting of two Josephson junctions and a gate electrode. The Cooper pair transistors were fabricated by using electron-beam lithography and double-angle evaporation technique. The Gate voltage dependence of critical current was measured by observing voltage jumps at various gate voltages while sweeping bias current. The observed oscillation was 2e-periodic, which shows the Cooper pair transistor had low level of quasiparticle poisoning.

  18. Design and Comparison of Cascaded H-Bridge, Modular Multilevel Converter, and 5-L Active Neutral Point Clamped Topologies for Motor Drive Applications

    Energy Technology Data Exchange (ETDEWEB)

    Marzoughi, Alinaghi [Virginia Tech, Blacksburg, VA (United States). Center for Power Electronics Systems; Burgos, Rolando [Virginia Tech, Blacksburg, VA (United States). Bradley Dept. of Electrical and Computer Engineering; Boroyevich, Dushan [Virginia Tech, Blacksburg, VA (United States). Bradley Dept. of Electrical and Computer Engineering; Xue, Yaosuo [Siemens Corporate Research, Princeton, NJ (United States). Power Electronics Dept.

    2018-03-01

    This paper presents the design procedure and comparison of converters currently used in medium-voltage high-power motor drive applications. For this purpose, the cascaded H-bridge (CHB), modular multilevel converter (MMC), and five-level active neutral point clamped (5-L ANPC) topologies are targeted. The design is performed using 1.7-kV insulated gate bipolar transistors (IGBTs) for CHB and MMC converters, and utilizing 3.3- and 4.5-kV IGBTs for 5-L ANPC topology as normally done in industry. The comparison is done between the designed converter topologies at three different voltage levels (4.16, 6.9, and 13.8 kV, with only the first two voltage levels in case of the 5-L ANPC) and two different power levels (3 and 5 MVA), in order to elucidate the dependence of different parameters on voltage and power rating. Finally, the comparison is done from several points of view such as efficiency, capacitive energy storage, semiconductor utilization, parts count (for measure of reliability), and power density.

  19. Neutral-point voltage dynamic model of three-level NPC inverter for reactive load

    DEFF Research Database (Denmark)

    Maheshwari, Ram Krishan; Munk-Nielsen, Stig; Busquets-Monge, Sergio

    2012-01-01

    A three-level neutral-point-clamped inverter needs a controller for the neutral-point voltage. Typically, the controller design is based on a dynamic model. The dynamic model of the neutral-point voltage depends on the pulse width modulation technique used for the inverter. A pulse width modulati...

  20. Insulated pipe clamp design

    International Nuclear Information System (INIS)

    Anderson, M.J.; Hyde, L.L.; Wagner, S.E.; Severud, L.K.

    1980-01-01

    Thin wall large diameter piping for breeder reactor plants can be subjected to significant thermal shocks during reactor scrams and other upset events. On the Fast Flux Test Facility, the addition of thick clamps directly on the piping was undesired because the differential metal temperatures between the pipe wall and the clamp could have significantly reduced the pipe thermal fatigue life cycle capabilities. Accordingly, an insulated pipe clamp design concept was developed. 5 refs

  1. Water Electrolysis at Different Current - Voltage Regimes

    International Nuclear Information System (INIS)

    Kleperis, J.; Blums, J.; Vanags, M.

    2007-01-01

    Full text: Electrochemical impedance and volt-amperic methods were used to compare an efficiency of water electrolysis for different materials and different electrode configurations. Two and three electrode measurements were made, using standard calomel reference electrode. Non-standard capacitative electrolysis was analyzed in special cell made from cylindrical steel electrodes. Volt-amperic measurements from - 15V to +15V DC didn't indicated the presence of oxidation - reduction reactions when distilled water was used as electrolyte. Impedance measurements showed unusual frequency behavior when the AC voltage increased till 0.5V. Different nickel and carbon electrodes (plate, porous and textile - type) were used to learn classical Faraday electrolysis in strong alkali solutions. Flying increase of current was indicator of the presence of electrolysis, and characteristic potential was used differ between materials accordingly they effectiveness for usage in an electrolyser device. (Aithors)

  2. Theoretical and experimental nonlinear dynamics of a clamped-clamped beam MEMS resonator

    NARCIS (Netherlands)

    Mestrom, R.M.C.; Fey, R.H.B.; Nijmeijer, H.

    2008-01-01

    Microelectromechanical resonators feature nonlineardynamic responses. A first-principles based modeling approach is proposed for a clamped-clamped beam resonator. Starting from the partial differential equation for the beam including geometric and electrostatic nonlinear effects, a reduced-order

  3. Optimization of Contact Force and Pull-in Voltage for Series based MEMS Switch

    Directory of Open Access Journals (Sweden)

    Abhijeet KSHIRSAGAR

    2010-04-01

    Full Text Available Cantilever based metal-to-metal contact type MEMS series switch has many applications namely in RF MEMS, Power MEMS etc. A typical MEMS switch consists of a cantilever as actuating element to make the contact between the two metal terminals of the switch. The cantilever is pulled down by applying a pull-in voltage to the control electrode that is located below the middle portion of the cantilever while only the tip portion of the cantilever makes contact between the two terminals. Detailed analysis of bending of the cantilever for different pull-in voltages reveals some interesting facts. At low pull-in voltage the cantilever tip barely touches the two terminals, thus resulting in very less contact area. To increase contact area a very high pull-in voltage is applied, but it lifts the tip from the free end due to concave curving of the cantilever in the middle region of the cantilever where the electrode is located. Again it results in less contact area. Furthermore, the high pull-in voltage produces large stress at the base of the cantilever close to the anchor. Therefore, an optimum, pull-in voltage must exist at which the concave curving is eliminated and contact area is maximum. In this paper authors report the finding of optimum contact force and pull-in voltage.

  4. A High-Voltage SOI CMOS Exciter Chip for a Programmable Fluidic Processor System.

    Science.gov (United States)

    Current, K W; Yuk, K; McConaghy, C; Gascoyne, P R C; Schwartz, J A; Vykoukal, J V; Andrews, C

    2007-06-01

    A high-voltage (HV) integrated circuit has been demonstrated to transport fluidic droplet samples on programmable paths across the array of driving electrodes on its hydrophobically coated surface. This exciter chip is the engine for dielectrophoresis (DEP)-based micro-fluidic lab-on-a-chip systems, creating field excitations that inject and move fluidic droplets onto and about the manipulation surface. The architecture of this chip is expandable to arrays of N X N identical HV electrode driver circuits and electrodes. The exciter chip is programmable in several senses. The routes of multiple droplets may be set arbitrarily within the bounds of the electrode array. The electrode excitation waveform voltage amplitude, phase, and frequency may be adjusted based on the system configuration and the signal required to manipulate a particular fluid droplet composition. The voltage amplitude of the electrode excitation waveform can be set from the minimum logic level up to the maximum limit of the breakdown voltage of the fabrication technology. The frequency of the electrode excitation waveform can also be set independently of its voltage, up to a maximum depending upon the type of droplets that must be driven. The exciter chip can be coated and its oxide surface used as the droplet manipulation surface or it can be used with a top-mounted, enclosed fluidic chamber consisting of a variety of materials. The HV capability of the exciter chip allows the generated DEP forces to penetrate into the enclosed chamber region and an adjustable voltage amplitude can accommodate a variety of chamber floor thicknesses. This demonstration exciter chip has a 32 x 32 array of nominally 100 V electrode drivers that are individually programmable at each time point in the procedure to either of two phases: 0deg and 180deg with respect to the reference clock. For this demonstration chip, while operating the electrodes with a 100-V peak-to-peak periodic waveform, the maximum HV electrode

  5. A novel voltage clamp circuit for the measurement of transistor dynamic on-resistance

    NARCIS (Netherlands)

    Gelagaev, R.; Jacqmaer, P.; Everts, J.; Driesen, Johan

    2012-01-01

    For determining the dynamic on-resistance Rdyn,on of a power transistor, the voltage and current waveforms have to be measured during the switching operation. In measurements of voltage waveforms, using an oscilloscope, the characteristics of an amplifier inside the oscilloscope are distorted when

  6. A new configuration for multilevel converters with diode clamped topology

    DEFF Research Database (Denmark)

    Nami, A.; Zare, F.; Ledwich, G.

    2008-01-01

    Due to the increased use of renewable energy and power elctronic applications, more multilevel converters (MLC) are developed. A Neutral Point Clamped (NPC) inverter is one of the most used multilevel topologies for wind turbine (WT) and photovoltaic (PV) applications. One of the most crucial...... of load changes which can avoid neutral point balancing problem in such converters. In addition, the presented topology is suitable for renewable energy systems to boost the low rectified output-voltage. In order to verify the proposed topology, steady state analysis, modelling and simulations are carried...

  7. Nanosecond electric pulses differentially affect inward and outward currents in patch clamped adrenal chromaffin cells.

    Directory of Open Access Journals (Sweden)

    Lisha Yang

    Full Text Available This study examined the effect of 5 ns electric pulses on macroscopic ionic currents in whole-cell voltage-clamped adrenal chromaffin cells. Current-voltage (I-V relationships first established that the early peak inward current was primarily composed of a fast voltage-dependent Na+ current (INa, whereas the late outward current was composed of at least three ionic currents: a voltage-gated Ca2+ current (ICa, a Ca2+-activated K+ current (IK(Ca, and a sustained voltage-dependent delayed rectifier K+ current (IKV. A constant-voltage step protocol was next used to monitor peak inward and late outward currents before and after cell exposure to a 5 ns pulse. A single pulse applied at an electric (E-field amplitude of 5 MV/m resulted in an instantaneous decrease of ~4% in peak INa that then declined exponentially to a level that was ~85% of the initial level after 10 min. Increasing the E-field amplitude to 8 or 10 MV/m caused a twofold greater inhibitory effect on peak INa. The decrease in INa was not due to a change in either the steady-state inactivation or activation of the Na+ channel but instead was associated with a decrease in maximal Na+ conductance. Late outward current was not affected by a pulse applied at 5 MV/m. However, for a pulse applied at the higher E-field amplitudes of 8 and 10 MV/m, late outward current in some cells underwent a progressive ~22% decline over the course of the first 20 s following pulse exposure, with no further decline. The effect was most likely concentrated on ICa and IK(Ca as IKV was not affected. The results of this study indicate that in whole-cell patch clamped adrenal chromaffin cells, a 5 ns pulse differentially inhibits specific voltage-gated ionic currents in a manner that can be manipulated by tuning E-field amplitude.

  8. Negligible substrate clamping effect on piezoelectric response in (111)-epitaxial tetragonal Pb(Zr, Ti)O3 films

    International Nuclear Information System (INIS)

    Yamada, Tomoaki; Yasumoto, Jun; Ito, Daisuke; Yoshino, Masahito; Nagasaki, Takanori; Sakata, Osami; Imai, Yasuhiko; Kiguchi, Takanori; Shiraishi, Takahisa; Shimizu, Takao; Funakubo, Hiroshi

    2015-01-01

    The converse piezoelectric responses of (111)- and (001)-epitaxial tetragonal Pb(Zr 0.35 Ti 0.65 )O 3 [PZT] films were compared to investigate the orientation dependence of the substrate clamping effect. Synchrotron X-ray diffraction (XRD) and piezoelectric force microscopy revealed that the as-grown (111)-PZT film has a polydomain structure with normal twin boundaries that are changed by the poling process to inclined boundaries, as predicted by Romanov et al. [Phys. Status Solidi A 172, 225 (1999)]. Time-resolved synchrotron XRD under bias voltage showed the negligible impact of substrate clamping on the piezoelectric response in the (111)-PZT film, unlike the case for (001)-PZT film. The origin of the negligible clamping effect in the (111)-PZT film is discussed from the viewpoint of the elastic properties and the compensation of lattice distortion between neighboring domains

  9. Important parameters affecting the cell voltage of aqueous electrical double-layer capacitors

    Science.gov (United States)

    Wu, Tzu-Ho; Hsu, Chun-Tsung; Hu, Chi-Chang; Hardwick, Laurence J.

    2013-11-01

    This study discusses and demonstrates how the open-circuit potential and charges stored in the working potential window on positive and negative electrodes affect the cell voltage of carbon-based electrical double-layer capacitors (EDLCs) in aqueous electrolytes. An EDLC consisting of two activated carbon electrodes is employed as the model system for identifying these key parameters although the potential window of water decomposition can be simply determined by voltammetric methods. First, the capacitive performances of an EDLC with the same charge on positive and negative electrodes are evaluated by cyclic voltammetric, charge-discharge, electrochemical impedance spectroscopic (EIS) analyses, and inductance-capacitance-resistance meter (LCR meter). The principles for obtaining the highest acceptable cell voltage of such symmetric ECs with excellent reversibility and capacitor-like behaviour are proposed. Aqueous charge-balanced EDLCs can be operated as high as 2.0 V with high energy efficiency (about 90%) and only 4% capacitance loss after the 600-cycle stability checking. The necessity of charge balance (but not capacitance balance) for positive and negative electrodes is substantiated from the lower acceptable cell voltage of charge-unbalanced EDLCs.

  10. Faradic resistance of the electrode/electrolyte interface.

    Science.gov (United States)

    Mayer, S; Geddes, L A; Bourland, J D; Ogborn, L

    1992-09-01

    A new method is used to measure the direct-current (Faradic) resistance of a single electrode/electrolyte interface. The method employs a constant-current pulse and a potential-sensing electrode. By choosing a sufficiently long pulse duration, the voltage between the test and potential-sensing electrode exhibits a three-phase response. In the steady-state phase, the voltage measured is equal to the current flowing through the electrode Faradic resistance and the resistance of the electrolyte between the test and potential-sensing electrode. By measuring this latter resistance with a high-frequency sinusoidal alternating current, the voltage drop in the electrolyte is calculated and subtracted from the voltage measured between the test and potential-sensing electrode, thereby allowing calculation of the Faradic resistance. By plotting the reciprocal of the Faradic resistance against current density and fitting the data points to a third-order polynomial, it is possible to determine the zero-current density (Faradic) resistance. This technique was used to determine the Faradic resistance of electrodes (0.1 cm2) of stainless-steel, platinum, platinum-iridium and rhodium in 0.9 per cent NaCl at 25 degrees. The zero current Faradic resistance is lowest for platinum (30.3 k omega), slightly higher for platinum-iridium (47.6k omega), much higher for rhodium (111k omega) and highest for type 316 stainless-steel (345k omega). In all cases, the Faradic resistance decreases dramatically with increasing current density.

  11. Loading dynamics of a sliding DNA clamp.

    KAUST Repository

    Cho, Won-Ki

    2014-05-22

    Sliding DNA clamps are loaded at a ss/dsDNA junction by a clamp loader that depends on ATP binding for clamp opening. Sequential ATP hydrolysis results in closure of the clamp so that it completely encircles and diffuses on dsDNA. We followed events during loading of an E. coli β clamp in real time by using single-molecule FRET (smFRET). Three successive FRET states were retained for 0.3 s, 0.7 s, and 9 min: Hydrolysis of the first ATP molecule by the γ clamp loader resulted in closure of the clamp in 0.3 s, and after 0.7 s in the closed conformation, the clamp was released to diffuse on the dsDNA for at least 9 min. An additional single-molecule polarization study revealed that the interfacial domain of the clamp rotated in plane by approximately 8° during clamp closure. The single-molecule polarization and FRET studies thus revealed the real-time dynamics of the ATP-hydrolysis-dependent 3D conformational change of the β clamp during loading at a ss/dsDNA junction.

  12. Hybrid capacitor with activated carbon electrode, Ni(OH) 2 electrode and polymer hydrogel electrolyte

    Science.gov (United States)

    Nohara, Shinji; Asahina, Toshihide; Wada, Hajime; Furukawa, Naoji; Inoue, Hiroshi; Sugoh, Nozomu; Iwasaki, Hideharu; Iwakura, Chiaki

    A new hybrid capacitor (HC) cell was assembled using an activated carbon (AC) negative electrode, an Ni(OH) 2 positive electrode and a polymer hydrogel electrolyte prepared from crosslinked potassium poly(acrylate) (PAAK) and KOH aqueous solution. The HC cell was characterized compared with an electric double layer capacitor (EDLC) using two AC electrodes and the polymer hydrogel electrolyte. It was found that the HC cell successfully worked in the larger voltage range and exhibited ca. 2.4 times higher capacitance than the EDLC cell. High-rate dischargeability of the HC cell was also superior to that of the EDLC cell. These improved characteristics strongly suggest that the HC cell can be a promising system of capacitors with high energy and power densities.

  13. Crystal structure of DNA polymerase III β sliding clamp from Mycobacterium tuberculosis.

    Science.gov (United States)

    Gui, Wen-Jun; Lin, Shi-Qiang; Chen, Yuan-Yuan; Zhang, Xian-En; Bi, Li-Jun; Jiang, Tao

    2011-02-11

    The sliding clamp is a key component of DNA polymerase III (Pol III) required for genome replication. It is known to function with diverse DNA repair proteins and cell cycle-control proteins, making it a potential drug target. To extend our understanding of the structure/function relationship of the sliding clamp, we solved the crystal structure of the sliding clamp from Mycobacterium tuberculosis (M. tuberculosis), a human pathogen that causes most cases of tuberculosis (TB). The sliding clamp from M. tuberculosis forms a ring-shaped head-to-tail dimer with three domains per subunit. Each domain contains two α helices in the inner ring that lie against two β sheets in the outer ring. Previous studies have indicated that many Escherichia coli clamp-binding proteins have a conserved LF sequence, which is critical for binding to the hydrophobic region of the sliding clamp. Here, we analyzed the binding affinities of the M. tuberculosis sliding clamp and peptides derived from the α and δ subunits of Pol III, which indicated that the LF motif also plays an important role in the binding of the α and δ subunits to the sliding clamp of M. tuberculosis. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. Two coupled Josephson junctions: dc voltage controlled by biharmonic current

    International Nuclear Information System (INIS)

    Machura, L; Spiechowicz, J; Kostur, M; Łuczka, J

    2012-01-01

    We study transport properties of two Josephson junctions coupled by an external shunt resistance. One of the junctions (say, the first) is driven by an unbiased ac current consisting of two harmonics. The device can rectify the ac current yielding a dc voltage across the first junction. For some values of coupling strength, controlled by an external shunt resistance, a dc voltage across the second junction can be generated. By variation of system parameters such as the relative phase or frequency of two harmonics, one can conveniently manipulate both voltages with high efficiency, e.g. changing the dc voltages across the first and second junctions from positive to negative values and vice versa. (paper)

  15. A model for electrode effects using percolation theory

    International Nuclear Information System (INIS)

    Wuethrich, R.; Bleuler, H.

    2004-01-01

    Electrode effects are known for more than 150 years. These effects, with undesirable consequences in industrial aluminium electrolysis, can be used to micro-machine glass with Spark Assisted Chemical Engraving (SACE). In this paper, a novel approach for theoretical analysis of the phenomenon is proposed by considering the bubble growth and bubble departure from electrodes as a stochastic process. The critical conditions (critical voltage and current density) are predicted in function of electrode geometry and electrolyte concentration as well as the static mean current-voltage characteristics prior to the onset of the effects. The different regions of the current-voltage characteristics, as identified by previous authors, are described and explained. It is shown that all relevant processes for the onset of the electrodes effects happen in the adherence region of the bubble layer. The model is applied for vertical cylindrical electrodes and compared with experimental data

  16. A complete dc characterization of a constant-frequency, clamped-mode, series-resonant converter

    Science.gov (United States)

    Tsai, Fu-Sheng; Lee, Fred C.

    1988-01-01

    The dc behavior of a clamped-mode series-resonant converter is characterized systematically. Given a circuit operating condition, the converter's mode of operation is determined and various circuit parameters are calculated, such as average inductor current (load current), rms inductor current, peak capacitor voltage, rms switch currents, average diode currents, switch turn-on currents, and switch turn-off currents. Regions of operation are defined, and various circuit characteristics are derived to facilitate the converter design.

  17. On the mechanism of high-voltage discharge initiation in high-voltage accelerator accelerating tubes

    International Nuclear Information System (INIS)

    Zheleznikov, F.G.

    1983-01-01

    Experimental investigation into physical natupe of discharge processes in high-voltage accelerator accelerating tubes in the absence of the accelerated particle beam are conducted. The installation for the study of the mechanism of initiating vacuum isolation conductivity is used in the experiments. The vacuum chamber of the installation is made of steel and sealed with rubber packings. Electrodes 300-360 mm in diameter are made of stainless steel. Two variants of cleaning technology were used before electrode assembling: 1) degreasing by organic solvents; 2) cleaning by fine grinding cloth with successive washing by rectificated alcohol. Analysis of the obtained data shows that forma. tion of background flux of charged particles in interelectrode gap is caused by external photoelectric effect, excited by X radiation, which initiates the formation of intensive internal field in microfilms of non-conducting impurities on the electrode surfaces. The secondary electron emission plays the minor role at that

  18. Hybrid capacitor with activated carbon electrode, Ni(OH){sub 2} electrode and polymer hydrogel electrolyte

    Energy Technology Data Exchange (ETDEWEB)

    Nohara, Shinji; Asahina, Toshihide; Wada, Hajime; Furukawa, Naoji; Inoue, Hiroshi; Iwakura, Chiaki [Department of Applied Chemistry, Graduate School of Engineering, Osaka Prefecture University, 1-1 Gakuen-cho, Sakai, Osaka 599-8531 (Japan); Sugoh, Nozomu; Iwasaki, Hideharu [Kurashiki Research Laboratory, Kuraray Co., Ltd., 2045-1 Sakazu, Kurashiki, Okayama 710-8691 (Japan)

    2006-06-19

    A new hybrid capacitor (HC) cell was assembled using an activated carbon (AC) negative electrode, an Ni(OH){sub 2} positive electrode and a polymer hydrogel electrolyte prepared from crosslinked potassium poly(acrylate) (PAAK) and KOH aqueous solution. The HC cell was characterized compared with an electric double layer capacitor (EDLC) using two AC electrodes and the polymer hydrogel electrolyte. It was found that the HC cell successfully worked in the larger voltage range and exhibited ca. 2.4 times higher capacitance than the EDLC cell. High-rate dischargeability of the HC cell was also superior to that of the EDLC cell. These improved characteristics strongly suggest that the HC cell can be a promising system of capacitors with high energy and power densities. (author)

  19. High performance cermet electrodes

    Science.gov (United States)

    Isenberg, Arnold O.; Zymboly, Gregory E.

    1986-01-01

    Disclosed is a method of increasing the operating cell voltage of a solid oxide electrochemical cell having metal electrode particles in contact with an oxygen-transporting ceramic electrolyte. The metal electrode is heated with the cell, and oxygen is passed through the oxygen-transporting ceramic electrolyte to the surface of the metal electrode particles so that the metal electrode particles are oxidized to form a metal oxide layer between the metal electrode particles and the electrolyte. The metal oxide layer is then reduced to form porous metal between the metal electrode particles and the ceramic electrolyte.

  20. Time scales of bias voltage effects in FE/MgO-based magnetic tunnel junctions with voltage-dependent perpendicular anisotropy

    International Nuclear Information System (INIS)

    Lytvynenko, Ia.M.; Hauet, T.; Montaigne, F.; Bibyk, V.V.; Andrieu, S.

    2015-01-01

    Interplay between voltage-induced magnetic anisotropy transition and voltage-induced atomic diffusion is studied in epitaxial V/Fe (0.7 nm)/ MgO/ Fe(5 nm)/Co/Au magnetic tunnel junction where thin Fe soft electrode has in-plane or out-of-plane anisotropy depending on the sign of the bias voltage. We investigate the origin of the slow resistance variation occurring when switching bias voltage in opposite polarity. We demonstrate that the time to reach resistance stability after voltage switching is reduced when increasing the voltage amplitude or the temperature. A single energy barrier of about 0.2 eV height is deduced from temperature dependence. Finally, we demonstrate that the resistance change is not correlated to a change in soft electrode anisotropy. This conclusion contrasts with observations recently reported on analogous systems. - Highlights: • Voltage-induced time dependence of resistance is studied in epitaxial Fe/MgO/Fe. • Resistance change is not related to the bottom Fe/MgO interface. • The effect is thermally activated with an energy barrier of the order of 0.2 eV height

  1. Multifrequency excitation of a clamped–clamped microbeam: Analytical and experimental investigation

    KAUST Repository

    Jaber, Nizar

    2016-03-14

    Using partial electrodes and a multifrequency electrical source, we present a large-bandwidth, large-amplitude clamped–clamped microbeam resonator excited near the higher order modes of vibration. We analytically and experimentally investigate the nonlinear dynamics of the microbeam under a two-source harmonic excitation. The first-frequency source is swept around the first three modes of vibration, whereas the second source frequency remains fixed. New additive and subtractive resonances are demonstrated. We illustrated that by properly tuning the frequency and amplitude of the excitation force, the frequency bandwidth of the resonator is controlled. The microbeam is fabricated using polyimide as a structural layer coated with nickel from the top and chromium and gold layers from the bottom. Using the Galerkin method, a reduced order model is derived to simulate the static and dynamic response of the device. A good agreement between the theoretical and experimental data are reported.

  2. Multifrequency excitation of a clamped–clamped microbeam: Analytical and experimental investigation

    KAUST Repository

    Jaber, Nizar; Ramini, Abdallah; Younis, Mohammad I.

    2016-01-01

    Using partial electrodes and a multifrequency electrical source, we present a large-bandwidth, large-amplitude clamped–clamped microbeam resonator excited near the higher order modes of vibration. We analytically and experimentally investigate the nonlinear dynamics of the microbeam under a two-source harmonic excitation. The first-frequency source is swept around the first three modes of vibration, whereas the second source frequency remains fixed. New additive and subtractive resonances are demonstrated. We illustrated that by properly tuning the frequency and amplitude of the excitation force, the frequency bandwidth of the resonator is controlled. The microbeam is fabricated using polyimide as a structural layer coated with nickel from the top and chromium and gold layers from the bottom. Using the Galerkin method, a reduced order model is derived to simulate the static and dynamic response of the device. A good agreement between the theoretical and experimental data are reported.

  3. High voltage holding in the negative ion sources with cesium deposition

    Energy Technology Data Exchange (ETDEWEB)

    Belchenko, Yu.; Abdrashitov, G.; Ivanov, A.; Sanin, A.; Sotnikov, O., E-mail: O.Z.Sotnikov@inp.nsk.su [Budker Institute of Nuclear Physics, Siberian Branch of Russian Academy of Sciences, Novosibirsk (Russian Federation)

    2016-02-15

    High voltage holding of the large surface-plasma negative ion source with cesium deposition was studied. It was found that heating of ion-optical system electrodes to temperature >100 °C facilitates the source conditioning by high voltage pulses in vacuum and by beam shots. The procedure of electrode conditioning and the data on high-voltage holding in the negative ion source with small cesium seed are described. The mechanism of high voltage holding improvement by depletion of cesium coverage is discussed.

  4. Electrode effects of a cellulose-based electro-active paper energy harvester

    International Nuclear Information System (INIS)

    Abas, Zafar; Kim, Heung Soo; Zhai, Lindong; Kim, Jaehwan; Kim, Joo-Hyung

    2014-01-01

    The possibility of cellulose-based electro-active paper (EAPap) as a vibrational energy transducer was investigated in this paper. Thin cellulose EAPap film specimens were prepared by the regenerating process. Three different metal electrodes of gold, silver and aluminum were deposited on a 50 × 50 mm 2 cellulose film using a thermal evaporator. An aluminum cantilever beam was used as a vibrational bender and EAPap was attached close to the root of the cantilever beam. The voltage output of the EAPap was measured under harmonic base excitation of the cantilever beam. The EAPap with aluminum electrode provided the largest open circuit voltage output compared to those with gold or silver electrodes. The output voltages of the EAPap increased linearly with increase of the area of the electrodes. The output voltages also increased with increasing input acceleration but became saturated at a certain magnitude. From the experimental results, we conclude that EAPap with metal electrodes can be used as a flexible energy harvesting transducer by external mechanical stress, and the output voltage is related to the electrode material due to its work function. (paper)

  5. New Insights into the Operating Voltage of Aqueous Supercapacitors.

    Science.gov (United States)

    Yu, Minghao; Lu, Yongzhuang; Zheng, Haibing; Lu, Xihong

    2018-03-12

    The main limitation of aqueous supercapacitors (SCs) lies in their narrow operating voltages, especially when compared with organic SCs. Fundamental understanding of factors relevant to the operating voltage helps providing guidance for the assembly of high-voltage aqueous SCs. In this regard, this concept analyzes the deciding factors for the operating voltage of aqueous SCs. Strategies applied to expand the operating voltage are summarized and discussed from the aspects of electrolyte, electrode, and asymmetric structure. Dynamic factors associated with water electrolysis and maximally using the available potential ranges of electrodes are particularly emphasized. Finally, other promising approaches that have not been explored and their challenges are also elaborated, hoping to provide more insights for the design of high-voltage aqueous SCs. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Nonlinear Impedance of Whole Cells Near an Electrode as a Probe of Mitochondrial Activity

    Directory of Open Access Journals (Sweden)

    John H. Miller Jr.

    2011-04-01

    Full Text Available By simultaneously measuring the bulk media and electrode interface voltages of a yeast (Saccharomyces cerevisiae suspension subjected to an AC voltage, a yeast-dependent nonlinear response was found only near the current injection electrodes. Computer simulation of yeast near a current injection electrode found an enhanced voltage drop across the yeast near the electrode due to slowed charging of the electrode interfacial capacitance. This voltage drop is sufficient to induce conformation change in membrane proteins. Disruption of the mitochondrial electron transport chain is found to significantly change the measured nonlinear current response, suggesting nonlinear impedance can be used as a non-invasive probe of cellular metabolic activity.

  7. Ozone production by an atmospheric pulsed discharge with pre-ionization electrodes and partly covered electrode

    International Nuclear Information System (INIS)

    Kaneda, S.; Shimosaki, M.; Hayashi, N.; Ihara, S.; Satoh, S.; Yamabe, C.

    2002-01-01

    In this paper, results on ozone production by atmospheric pulsed discharge, are reported. In the research, two types of ozonizer (Type I and Type II) have been used to investigate improvements of ozone concentration and production efficiency. The ozonizer has plane-to-plane metal electrodes structure, and pre-ionization electrodes are placed on the high voltage electrodes (Type I). In Type II, the surface of grounded electrode with 20 mm of width is covered partly by dielectric (thin rubber) with 11 mm of width, while the geometry of both metal electrodes is same to Type I. In the case of Type I, maximum concentration of about 100 ppm and maximum yield of 70 g/kWh were obtained at input power of 0.3 W. On the other hands, in the case of Type II, 800 ppm and 100 g/kWh were obtained at input power of 1.5 W. It was found that the ozone concentration and production yield were improved by using electrode covered by dielectric. (author)

  8. Solid electrolyte gas sensors based on cyclic voltammetry with one active electrode

    Energy Technology Data Exchange (ETDEWEB)

    Jasinski, G; Jasinski, P, E-mail: gregor@biomed.eti.pg.gda.pl [Gdansk University of Technology, Faculty of Electronics, Telecommunication and Informatics, Narutowicza 11/12, 80-233 Gdansk (Poland)

    2011-10-29

    Solid state gas sensors are cost effective, small, rugged and reliable. Typically electrochemical solid state sensors operate in either potentiometric or amperometric mode. However, a lack of selectivity is sometimes a shortcoming of such sensors. It seems that improvements of selectivity can be obtained in case of the electrocatalytic sensors, which operate in cyclic voltammetry mode. Their working principle is based on acquisition of an electric current, while voltage ramp is applied to the sensor. The current-voltage response depends in a unique way on the type and concentration of ambient gas. Most electrocatalytic sensors have symmetrical structure. They are in a form of pellets with two electrodes placed on their opposite sides. Electrochemical reactions occur simultaneously on both electrodes. In this paper results for sensors with only one active electrode exposed to ambient gas are presented. The other electrode was isolated from ambient gas with dielectric sealing. This sensor construction allows application of advanced measuring procedures, which permit sensor regeneration acceleration. Experiments were conducted on Nasicon sensors. Properties of two sensors, one with one active electrode and second with symmetrical structure, used for the detection of mixtures of NO{sub 2} and synthetic air are compared.

  9. Comparative Evaluation of Pulsewidth Modulation Strategies for Z-Source Neutral-Point-Clamped Inverter

    DEFF Research Database (Denmark)

    Loh, P.C.; Blaabjerg, Frede; Wong, C.P.

    2007-01-01

    modulation (PWM) strategies for controlling the Z-source NPC inverter. While developing the PWM techniques, attention has been devoted to carefully derive them from a common generic basis for improved portability, easier implementation, and most importantly, assisting readers in understanding all concepts......Z-source neutral-point-clamped (NPC) inverter has recently been proposed as an alternative three-level buck-boost power conversion solution with an improved output waveform quality. In principle, the designed Z-source inverter functions by selectively "shooting through" its power sources, coupled...... to the inverter using two unique Z-source impedance networks, to boost the inverter three-level output waveform. Proper modulation of the new inverter would therefore require careful integration of the selective shoot-through process to the basic switching concepts to achieve maximal voltage-boost, minimal...

  10. Prediction of breakdown voltages in novel gases for high voltage insulation

    International Nuclear Information System (INIS)

    Koch, M.

    2015-01-01

    This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF_6) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF_6 is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF_6 in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF_6 based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media

  11. Negligible substrate clamping effect on piezoelectric response in (111)-epitaxial tetragonal Pb(Zr, Ti)O{sub 3} films

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Tomoaki, E-mail: t-yamada@nucl.nagoya-u.ac.jp [Department of Materials, Physics and Energy Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan); PRESTO, Japan Science and Technology Agency, 4-1-8 Honcho, Kawaguchi, Saitama 332-0012 (Japan); Yasumoto, Jun; Ito, Daisuke; Yoshino, Masahito; Nagasaki, Takanori [Department of Materials, Physics and Energy Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan); Sakata, Osami [Synchrotron X-ray Station at SPring-8 and Synchrotron X-ray Group, National Institute for Materials Science, Sayo-cho, Sayo-gun, Hyogo 679-5148 (Japan); Department of Innovative and Engineered Material, Tokyo Institute of Technology, Yokohama 226-8503 (Japan); Imai, Yasuhiko [Japan Synchrotron Radiation Research Institute, SPring-8, Sayo-cho, Sayo-gun, Hyogo 679-5198 (Japan); Kiguchi, Takanori [Institute for Materials Research, Tohoku University, Sendai, Miyagi 980-8577 (Japan); Shiraishi, Takahisa; Shimizu, Takao; Funakubo, Hiroshi [Department of Innovative and Engineered Material, Tokyo Institute of Technology, Yokohama 226-8503 (Japan)

    2015-08-21

    The converse piezoelectric responses of (111)- and (001)-epitaxial tetragonal Pb(Zr{sub 0.35}Ti{sub 0.65})O{sub 3} [PZT] films were compared to investigate the orientation dependence of the substrate clamping effect. Synchrotron X-ray diffraction (XRD) and piezoelectric force microscopy revealed that the as-grown (111)-PZT film has a polydomain structure with normal twin boundaries that are changed by the poling process to inclined boundaries, as predicted by Romanov et al. [Phys. Status Solidi A 172, 225 (1999)]. Time-resolved synchrotron XRD under bias voltage showed the negligible impact of substrate clamping on the piezoelectric response in the (111)-PZT film, unlike the case for (001)-PZT film. The origin of the negligible clamping effect in the (111)-PZT film is discussed from the viewpoint of the elastic properties and the compensation of lattice distortion between neighboring domains.

  12. Pipe clamp effects on thin-walled pipe design

    International Nuclear Information System (INIS)

    Lindquist, M.R.

    1980-01-01

    Clamp induced stresses in FFTF piping are sufficiently large to require structural assessment. The basic principles and procedures used in analyzing FFTF piping at clamp support locations for compliance with ASME Code rules are given. Typical results from a three-dimensional shell finite element pipe model with clamp loads applied over the clamp/pipe contact area are shown. Analyses performed to categorize clamp induced piping loads as primary or secondary in nature are described. The ELCLAMP Computer Code, which performs analyses at clamp locations combining clamp induced stresses with stresses from overall piping system loads, is discussed. Grouping and enveloping methods to reduce the number of individual clamp locations requiring analysis are described

  13. Technological Aspects: High Voltage

    CERN Document Server

    Faircloth, D.C.

    2013-12-16

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.

  14. Modulation of voltage-gated Na+ and K+ channels by pumiliotoxin 251D: a "joint venture" alkaloid from arthropods and amphibians.

    Science.gov (United States)

    Vandendriessche, Thomas; Abdel-Mottaleb, Yousra; Maertens, Chantal; Cuypers, Eva; Sudau, Alexander; Nubbemeyer, Udo; Mebs, Dietrich; Tytgat, Jan

    2008-03-01

    Certain amphibians provide themselves with a chemical defense by accumulating lipophilic alkaloids into skin glands from dietary arthropods. Examples of such alkaloids are pumiliotoxins (PTXs). In general, PTXs are known as positive modulators of voltage-gated sodium channels (VGSCs). Unlike other PTXs, PTX 251D does not share this characteristic. However, mice and insect studies showed that PTX 251D is highly toxic and to date the basis of its toxicity remains unknown. In this work, we searched for the possible target of PTX 251D. The toxin was therefore made synthetically and tested on four VGSCs (mammalian rNa(v)1.2/beta(1), rNa(v)1.4/beta(1), hNa(v)1.5/beta(1) and insect Para/tipE) and five voltage-gated potassium channels (VGPCs) (mammalian rK(v)1.1-1.2, hK(v)1.3, hK(v)11.1 (hERG) and insect Shaker IR) expressed heterologously in Xenopus laevis oocytes, using the two-electrode voltage clamp technique. PTX 251D not only inhibited the Na(+) influx through the mammalian VGSCs but also affected the steady-state activation and inactivation. Interestingly, in the insect ortholog, the inactivation process was dramatically affected. Additionally, PTX 251D inhibited the K(+) efflux through all five tested VGPCs and slowed down the deactivation kinetics of the mammalian VGPCs. hK(v)1.3 was the most sensitive channel, with an IC(50) value 10.8+/-0.5 microM. To the best of our knowledge this is the first report of a PTX affecting VGPCs.

  15. Ion channel electrophysiology via integrated planar patch-clamp chip with on-demand drug exchange.

    Science.gov (United States)

    Chen, Chang-Yu; Tu, Ting-Yuan; Jong, De-Shien; Wo, Andrew M

    2011-06-01

    Planar patch clamp has revolutionized characterization of ion channel behavior in drug discovery primarily via advancement in high throughput. Lab use of planar technology, however, addresses different requirements and suffers from inflexibility to enable wide range of interrogation via a single cell. This work presents integration of planar patch clamp with microfluidics, achieving multiple solution exchanges for tailor-specific measurement and allowing rapid replacement of the cell-contacting aperture. Studies via endogenously expressed ion channels in HEK 293T cells were commenced to characterize the device. Results reveal the microfluidic concentration generator produces distinct solution/drug combination/concentrations on-demand. Volume-regulated chloride channel and voltage-gated potassium channels in HEK 293T cells immersed in generated solutions under various osmolarities or drug concentrations show unique channel signature under specific condition. Excitation and blockage of ion channels in a single cell was demonstrated via serial solution exchange. Robustness of the reversible bonding and ease of glass substrate replacement were proven via repeated usage of the integrated device. The present approach reveals the capability and flexibility of integrated microfluidic planar patch-clamp system for ion channel assays. Copyright © 2011 Wiley Periodicals, Inc.

  16. The high voltage system for the novel MPGD-based photon detectors of COMPASS RICH-1

    CERN Document Server

    Dalla Torre, S.; Birsa, R.; Bradamante, F.; Bressan, A.; Chatterjee, C.; Ciliberti, P.; Dasgupta, S.; Gobbo, B.; Gregori, M.; Hamar, G.; Levorato, S.; Martin, A.; Menon, G.; Tessarotto, F.; Zhao, Y.

    2018-01-01

    The architecture of the novel MPGD-based photon detectors of COMPASS RICH-1 consists in a large-size hybrid MPGD multilayer layout combining two layers of Thick-GEMs and a bulk resistive MICROMEGAS. Concerning biasing voltage, the Thick-GEMs are segmented in order to reduce the energy released in case of occasional discharges, while the MICROMEGAS anode is segmented in pads individually biased at positive voltage, while the micromesh is grounded. In total, there are ten different electrode types and more than 20000 electrodes supplied by more than 100 HV channels. Commercial power supply units are used. The original elements of the power supply system are the architecture of the voltage distribution net, the compensation, by voltage adjustment, of the effects of pressure and temperature variation affecting the detector gain and a sophisticated control software, which allows to protect the detectors against errors by the operator, to monitor and log voltages and current at 1 Hz rate and to automatically react ...

  17. Multifrequency Excitation of a Clamped-Clamped Microbeam

    KAUST Repository

    Jaber, Nizar R.

    2016-01-20

    We present analytical and experimental investigation of an electrically actuated clamped-clamped microbeam under a twosource harmonic excitation. The first frequency is swept around the first mode of vibration where the second one is fixed. These microbeams are fabricated using polyimide as structural layer coated with nickel form top and chromium and gold layers from bottom. We demonstrate the excitation of additive and subtractive type resonance. We show that by properly tuning the frequency and the amplitude of the excitation force, the frequency bandwidth of the resonator is increased. Theoretically, we solved the eigenvalue problem for different axial forces to find the natural frequencies ratio that match the experimental values. Using Galerkin method, a reduced order model is derived to simulate the static and dynamic response of the device where using three symmetric mode shapes provided a good agreement with experimental data. © Copyright 2015 by ASME.

  18. The Significance of Breakdown Voltages for Quality Assurance of Low-Voltage BME Ceramic Capacitors

    Science.gov (United States)

    Teverovsky, Alexander A.

    2014-01-01

    Application of thin dielectric, base metal electrode (BME) ceramic capacitors for high-reliability applications requires development of testing procedures that can assure high quality and reliability of the parts. In this work, distributions of breakdown voltages (VBR) in variety of low-voltage BME multilayer ceramic capacitors (MLCCs) have been measured and analyzed. It has been shown that analysis of the distributions can indicate the proportion of defective parts in the lot and significance of the defects. Variations of the distributions after solder dip testing allow for an assessment of the robustness of capacitors to soldering-related stresses. The drawbacks of the existing screening and qualification methods to reveal defects in high-value, low-voltage MLCCs and the importance of VBR measurements are discussed. Analysis has shown that due to a larger concentration of oxygen vacancies, defect-related degradation of the insulation resistance (IR) and failures are more likely in BME compared to the precious metal electrode (PME) capacitors.

  19. Applicability of fiber model in seismic response analysis for center-clamp type bushings on transformers

    International Nuclear Information System (INIS)

    Miyagawa, Yoshinori; Sato, Hiroaki

    2015-01-01

    A bushing is a device for insulation and support of a conductor. Especially it is called center-clamp type when it is connected with a metal holder through clamping force. As a consequence of damage of center-clamp type bushings in Tohoku Earthquake in 2011, refinement of the response analysis method and review of the seismic design procedure became necessary. In the present report, the fiber model, which can evaluate non-linear behavior in the section subjected to axial force and bending moment, was implemented to the CRIEPI's finite element analysis program 'Mastrd' considering following characteristics of center-clamp type bushings. a) The gasket section between a porcelain tube and a metal holder has a torus shape. b) Springs around the top of the bushing give clamping force, but they lock in excessive base rotation. c) The gasket does not resist against tension. d) Local resistance against compression due to bending increases in use of very thin gaskets. The developed program was verified through comparison with the shaking table test result for real bushings whose voltage classes were 154 kV and 275 kV. Deformation indices as rotation angle and base opening due to bending were influenced by damping conditions. Though there was not the condition which brought about remarkable underestimation, reduction of damping for a fiber model element was preferable for safety. On the other hand, bending moment was consistent with experimental results because it tended not to fluctuate in the non-linear region. (author)

  20. An ionization chamber with magnetic levitated electrodes

    CERN Document Server

    Kawaguchi, T

    1999-01-01

    A new type of ionization chamber which has magnetically levitated electrodes has been developed. The electrodes are supplied voltages for the repelling of ions by a battery which is also levitated with the electrodes. The characteristics of this ionization chamber are investigated in this paper.

  1. Prediction of breakdown voltages in novel gases for high voltage insulation

    Energy Technology Data Exchange (ETDEWEB)

    Koch, M.

    2015-07-01

    This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF{sub 6}) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF{sub 6} is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF{sub 6} in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF{sub 6} based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media.

  2. Structural consideration for hot and cold pipe clamps in LMFBR applications

    International Nuclear Information System (INIS)

    Anderson, M.J.; Huang, S.N.; Kappauf, H.; Wagner, S.E.; Wirtz, K.H.

    1983-01-01

    A series of analytical studies are described which evaluate stress levels induced in a 600 mm high temperature, thin-wall sodium pipeline by two alternate clamp designs. The first design consists of a band mounted directly on the pipe and is called the hot clamp. The second design consists of a band mounted using insulation standoffs and is called the cold clamp. Pipe stress levels induced by transient thermal dead weight and seismic loads are discussed. Pipe stress levels and system dynamic spring rates are presented. Procedures utilized to combine clamp induced pipe stress with other short and long term pipe system stresses are detailed. Recommendations for practical application in LMFBR pipe systems are made

  3. Structural considerations for hot and cold pipe clamps in LMFBR applications

    International Nuclear Information System (INIS)

    Anderson, M.J.; Huang, S.N.; Wagner, S.E.; Kappauf, H.; Wirtz, K.H.

    1983-01-01

    A series of analytical studies are described which evaluate stress levels induced in a 600 mm high temperature, thin-wall sodium pipeline by two alternate clamp designs. The first design consists of a band mounted directly on the pipe and is called the hot clamp. The second design consists of a band mounted using insulation standoffs and is called the cold clamp. Pipe stress levels induced by transient thermal dead weight and seismic loads are discussed. Pipe stress levels and system dynamic spring rates are presented. Procedures utilized to combine clamp induced pipe stress with other short and long term pipe system stresses are detailed. Recommendations for practical application in LMFBR pipe systems are made

  4. The two-pore domain potassium channel, TWIK-1, has a role in the regulation of heart rate and atrial size

    DEFF Research Database (Denmark)

    Christensen, Alex Hørby; Chatelain, Franck C; Huttner, Inken G

    2016-01-01

    distribution with predominant localization in the endosomal compartment. Two-electrode voltage-clamp experiments using Xenopus oocytes showed that both zebrafish and wild-type human TWIK-1 channels produced K(+) currents that are sensitive to external K(+) concentration as well as acidic pH. There were......The two-pore domain potassium (K(+)) channel TWIK-1 (or K2P1.1) contributes to background K(+) conductance in diverse cell types. TWIK-1, encoded by the KCNK1 gene, is present in the human heart with robust expression in the atria, however its physiological significance is unknown. To evaluate......-coding regions in two independent cohorts of patients (373 subjects) and identified three non-synonymous variants, p.R171H, p.I198M and p.G236S, that were all located in highly conserved amino acid residues. In transfected mammalian cells, zebrafish and wild-type human TWIK-1 channels had a similar cellular...

  5. Numerical analysis of the heat source characteristics of a two-electrode TIG arc

    International Nuclear Information System (INIS)

    Ogino, Y; Hirata, Y; Nomura, K

    2011-01-01

    Various kinds of multi-electrode welding processes are used to ensure high productivity in industrial fields such as shipbuilding, automotive manufacturing and pipe fabrication. However, it is difficult to obtain the optimum welding conditions for a specific product, because there are many operating parameters, and because welding phenomena are very complicated. In the present research, the heat source characteristics of a two-electrode TIG arc were numerically investigated using a 3D arc plasma model with a focus on the distance between the two electrodes. The arc plasma shape changed significantly, depending on the electrode spacing. The heat source characteristics, such as the heat input density and the arc pressure distribution, changed significantly when the electrode separation was varied. The maximum arc pressure of the two-electrode TIG arc was much lower than that of a single-electrode TIG. However, the total heat input of the two-electrode TIG arc was nearly constant and was independent of the electrode spacing. These heat source characteristics of the two-electrode TIG arc are useful for controlling the heat input distribution at a low arc pressure. Therefore, these results indicate the possibility of a heat source based on a two-electrode TIG arc that is capable of high heat input at low pressures.

  6. Trans-Z-source Neutral Point Clamped inverter

    DEFF Research Database (Denmark)

    Mo, W.; Loh, P. C.; Li, D.

    2012-01-01

    Transformer based Z-source (trans-Z-source) inverters are recently proposed by extending the traditional Z-source inverter with higher buck-boost capability as well as reducing the passive components at the same time. Multi-Level Z-source inverters are single-stage topological solutions used...... for buck-boost energy conversion with all the favourable advantages of multi-level switching retained. This paper presents three-level trans-Z-source Neutral Point Clamped (NPC) inverter topology, which achieves both the advantages of trans-Z-source and three-level NPC inverter configuration. With proper...... modulation scheme, the three-level trans-Z-source inverter can function with minimum of six device commutations per half carrier cycle (same as the traditional buck NPC inverter), while maintaining to produce the designed volt-sec average and inductive voltage boosting at ac output terminals. The designed...

  7. Technological Aspects: High Voltage

    International Nuclear Information System (INIS)

    Faircloth, D C

    2013-01-01

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)

  8. High voltage bus and auxiliary heater control system for an electric or hybrid vehicle

    Science.gov (United States)

    Murty, Balarama Vempaty

    2000-01-01

    A control system for an electric or hybrid electric vehicle includes a vehicle system controller and a control circuit having an electric immersion heater. The heater is electrically connected to the vehicle's high voltage bus and is thermally coupled to a coolant loop containing a heater core for the vehicle's climate control system. The system controller responds to cabin heat requests from the climate control system by generating a pulse width modulated signal that is used by the control circuit to operate the heater at a duty cycle appropriate for the amount of cabin heating requested. The control system also uses the heater to dissipate excess energy produced by an auxiliary power unit and to provide electric braking when regenerative braking is not desirable and manual braking is not necessary. The control system further utilizes the heater to provide a safe discharge of a bank of energy storage capacitors following disconnection of the battery or one of the high voltage connectors used to transmit high voltage operating power to the various vehicle systems. The control circuit includes a high voltage clamping circuit that monitors the voltage on the bus and operates the heater to clamp down the bus voltage when it exceeds a pre-selected maximum voltage. The control system can also be used to phase in operation of the heater when the bus voltage exceeds a lower threshold voltage and can be used to phase out the auxiliary power unit charging and regenerative braking when the battery becomes fully charged.

  9. Long Life Nickel Electrodes for Nickel-Hydrogen Cells: Fiber Substrates Nickel Electrodes

    Science.gov (United States)

    Rogers, Howard H.

    2000-01-01

    Samples of nickel fiber mat electrodes were investigated over a wide range of fiber diameters, electrode thickness, porosity and active material loading levels. Thickness' were 0.040, 0.060 and 0.080 inches for the plaque: fiber diameters were primarily 2, 4, and 8 micron and porosity was 85, 90, and 95%. Capacities of 3.5 in. diameter electrodes were determined in the flooded condition with both 26 and 31% potassium hydroxide solution. These capacity tests indicated that the highest capacities per unit weight were obtained at the 90% porosity level with a 4 micron diameter fiber plaque. It appeared that the thinner electrodes had somewhat better performance, consistent with sintered electrode history. Limited testing with two-positive-electrode boiler plate cells was also carried out. Considerable difficulty with constructing the cells was encountered with short circuits the major problem. Nevertheless, four cells were tested. The cell with 95% porosity electrodes failed during conditioning cycling due to high voltage during charge. Discharge showed that this cell had lost nearly all of its capacity. The other three cells after 20 conditioning cycles showed capacities consistent with the flooded capacities of the electrodes. Positive electrodes made from fiber substrates may well show a weight advantage of standard sintered electrodes, but need considerably more work to prove this statement. A major problem to be investigated is the lower strength of the substrate compared to standard sintered electrodes. Problems with welding of leads were significant and implications that the electrodes would expand more than sintered electrodes need to be investigated. Loading levels were lower than had been expected based on sintered electrode experiences and the lower loading led to lower capacity values. However, lower loading causes less expansion and contraction during cycling so that stress on the substrate is reduced.

  10. Design and development of electrical impedance tomography system with 32 electrodes and microcontroller

    Science.gov (United States)

    Ansory, Achmad; Prajitno, Prawito; Wijaya, Sastra Kusuma

    2018-02-01

    Electrical Impedance Tomography (EIT) is an imaging method that is able to estimate electrical impedance distribution inside an object. This EIT system is developed by using 32 electrodes and microcontroller based module. From a pair of electrodes, sinusoidal current of 3 mA is injected and the voltage differences between other pairs of electrodes are measured. Voltage measurement data are then sent to MATLAB and EIDORS software; the data are used to reconstruct two dimensions image. The system can detect and determine the position of a phantom in the tank. The object's position is accurately reconstructed and determined with the average shifting of 0.69 cm but object's area cannot be accurately reconstructed. The object's image is more accurately reconstructed when the object is located near to electrodes, has a larger size, and when the current injected to the system has a frequency of 100 kHz or 200kHz.

  11. Clamp wins pipe repair prize

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    2001-04-01

    This paper describes the permanent pipeline repair system, developed by Tekmar, which is powered by seawater hydraulics and is easily installed and tested by any workclass remotely operated vehicle (rov). Details are given of the two main components of the system, namely, the diverless high pressure split repair clamp and the rov-operated tool to install it.

  12. Calendering effect on the electrochemical performances of the thick Li-ion battery electrodes using a three dimensional Ni alloy foam current collector

    International Nuclear Information System (INIS)

    Yang, Gui-Fu; Joo, Seung-Ki

    2015-01-01

    High surface area and a three dimensional NiCrAl alloy foam current collector was used for two kinds of thick lithium iron phosphate electrodes. One kind of electrodes were compressed after the slurry of active material in the metal foam was dried and then annealed at 140 °C for half a day whereas the other kind of electrodes were prepared without pressing. When the addition of carbon black was 4 wt% for the two kinds of electrodes, a charge-discharge test revealed that the capacity of the cell using the pressed electrode faded much more although the voltage-drop was much smaller at the plateau region. For example, the capacity of the pressed electrode exhibited 85 mA h g −1 , while it was 135 mA h g −1 for the unpressed electrode although the voltage-drop at the plateau region was 250 mV higher at 0.5C-rate for the unpressed electrode. The AC impedance analysis showed that the charge transfer resistance of the pressed electrode was only 15 Ω whereas it was 4 times higher for the unpressed electrode. The results illustrated that the effective redox area was much larger for the unpressed electrode since the cell using the unpressed electrode exhibited much higher capacity even at the condition of poor electronic conductivity. To solve the low electronic conductivity issue for the unpressed electrode, the addition of carbon black was further increased to 14 wt% and as a result, there was almost no difference in voltage drop at plateau region or charge transfer resistance between the two kinds of electrodes. Obviously, the capacity of unpressed electrode exhibited much higher at higher current rate due to the larger effective redox area

  13. Clamped end conditions and cross section deformation in the finite element absolute nodal coordinate formulation

    International Nuclear Information System (INIS)

    Hussein, Bassam A.; Weed, David; Shabana, Ahmed A.

    2009-01-01

    In the finite element absolute nodal coordinate formulation (ANCF), the elimination of the relative translations and rotations at a point does not necessarily define a fully clamped joint, particularly in the case of fully parameterized ANCF finite elements that allow for the deformation of the cross section. In this investigation, the formulations and results of two different sets of clamped end conditions that define two different joints are compared. The first joint, called the partially clamped joint, eliminates only the translations and rotations at a point on the cross section. The second joint, called the fully clamped joint, eliminates all the translation, rotation and deformation degrees of freedom at a point on the cross section. The kinematic equations that define the partially and fully clamped joints are developed, and the dynamic equations used in the comparative numerical study presented in this paper are shown. As discussed in this investigation, the fully clamped joint does not allow for the deformation of the cross section at the joint node since the gradient vectors remain orthogonal unit vectors. The partially clamped joint, on the other hand, allows for the deformation of the cross section. Nanson's formula is used as a measure of the deformation of the cross section in the case of the partially clamped joint. A very flexible pendulum that has a rigid body attached to its free end is used to compare the results of the partially and fully clamped joints. The numerical results obtained using this very flexible pendulum example show that, while the type of joint (partially or fully clamped) does not significantly affect the gross reference motion of the system, there are fundamental differences between the two joints since the partially clamped joint allows for the cross section deformations at the joint node

  14. Design and Implementation of a High Efficiency, Low Component Voltage Stress, Single-Switch High Step-Up Voltage Converter for Vehicular Green Energy Systems

    Directory of Open Access Journals (Sweden)

    Yu-En Wu

    2016-09-01

    Full Text Available In this study, a novel, non-isolated, cascade-type, single-switch, high step-up DC/DC converter was developed for green energy systems. An integrated coupled inductor and voltage lift circuit were applied to simplify the converter structure and satisfy the requirements of high efficiency and high voltage gain ratios. In addition, the proposed structure is controllable with a single switch, which effectively reduces the circuit cost and simplifies the control circuit. With the leakage inductor energy recovery function and active voltage clamp characteristics being present, the circuit yields optimizable conversion efficiency and low component voltage stress. After the operating principles of the proposed structure and characteristics of a steady-state circuit were analyzed, a converter prototype with 450 W, 40 V of input voltage, 400 V of output voltage, and 95% operating efficiency was fabricated. The Renesas MCU RX62T was employed to control the circuits. Experimental results were analyzed to validate the feasibility and effectiveness of the proposed system.

  15. Dynamic assembly of Hda and the sliding clamp in the regulation of replication licensing.

    Science.gov (United States)

    Kim, Jin S; Nanfara, Michael T; Chodavarapu, Sundari; Jin, Kyeong S; Babu, Vignesh M P; Ghazy, Mohamed A; Chung, Scisung; Kaguni, Jon M; Sutton, Mark D; Cho, Yunje

    2017-04-20

    Regulatory inactivation of DnaA (RIDA) is one of the major regulatory mechanisms of prokaryotic replication licensing. In RIDA, the Hda-sliding clamp complex loaded onto DNA directly interacts with adenosine triphosphate (ATP)-bound DnaA and stimulates the hydrolysis of ATP to inactivate DnaA. A prediction is that the activity of Hda is tightly controlled to ensure that replication initiation occurs only once per cell cycle. Here, we determined the crystal structure of the Hda-β clamp complex. This complex contains two pairs of Hda dimers sandwiched between two β clamp rings to form an octamer that is stabilized by three discrete interfaces. Two separate surfaces of Hda make contact with the β clamp, which is essential for Hda function in RIDA. The third interface between Hda monomers occludes the active site arginine finger, blocking its access to DnaA. Taken together, our structural and mutational analyses of the Hda-β clamp complex indicate that the interaction of the β clamp with Hda controls the ability of Hda to interact with DnaA. In the octameric Hda-β clamp complex, the inability of Hda to interact with DnaA is a novel mechanism that may regulate Hda function. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Four- year thyroidectomy procedures: Ligasure Vs. clamp & tie

    Directory of Open Access Journals (Sweden)

    Pazoki AR

    2010-01-01

    Full Text Available "n Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:Arial; mso-bidi-theme-font:minor-bidi;} Background: The electrothermal bipolar vessel sealing system is an adjunct to the hemostatic technique, which has been successfully used in many abdominal operation, recently made available to thyroid surgery. The purpose of this was compare the outcomes of new hemostatic technique with traditional method of clamp and tie."n"nMethods: In this retrospective cross-sectional study has been done in surgery's wards of Milad & Rasul- Akram hospitals in Tehran, Iran. During three- year period between 2005-2008 all patients with different kind of pathology that need operation were assessed. Time duration of surgery and hospital stay and post surgery complication in two group, ligasure (n=45 and clamp & tie (n=145 were compared with each others."n"nResults: No difference was seen between two groups in time duration of surgery. Significant difference was seen in hospital stay and complications of surgery. Time of operation in Ligasure group was 132/22 minute and in clamp and tie group was 130/10 minute. There was found significant difference in duration of hospital stay and postoperative complication. Hypocalcemia were seen in two and 24 cases in Ligasure and Clamp & Tie group, respectively (p<0.05. Hospital stay was 2

  17. Surface potential distribution and airflow performance of different air-exposed electrode plasma actuators at different alternating current/direct current voltages

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Liang; Yan, Hui-Jie; Qi, Xiao-Hua; Hua, Yue; Ren, Chun-Sheng, E-mail: rchsh@dlut.edu.cn [School of Physics and Optoelectronic Technology, Key laboratory of Materials Modification by Laser, Ion and Electron Beams, Ministry of Education, Dalian University of Technology, Dalian 116023 (China)

    2015-04-15

    Asymmetric surface dielectric barrier discharge (SDBD) plasma actuators have been intensely studied for a number of years due to their potential applications for aerodynamic control. In this paper, four types of actuators with different configurations of exposed electrode are proposed. The SDBD actuators investigated are driven by dual-power supply, referred to as a fixed AC high voltage and an adjustable DC bias. The effects of the electrode structures on the dielectric surface potential distribution, the electric wind velocity, and the mean thrust production are studied, and the dominative factors of airflow acceleration behavior are revealed. The results have shown that the actions of the SDBD actuator are mainly dependent on the geometry of the exposed electrode. Besides, the surface potential distribution can effectively affect the airflow acceleration behavior. With the application of an appropriate additional DC bias, the surface potential will be modified. As a result, the performance of the electric wind produced by a single SDBD can be significantly improved. In addition, the work also illustrates that the actuators with more negative surface potential present better mechanical performance.

  18. Surface potential distribution and airflow performance of different air-exposed electrode plasma actuators at different alternating current/direct current voltages

    International Nuclear Information System (INIS)

    Yang, Liang; Yan, Hui-Jie; Qi, Xiao-Hua; Hua, Yue; Ren, Chun-Sheng

    2015-01-01

    Asymmetric surface dielectric barrier discharge (SDBD) plasma actuators have been intensely studied for a number of years due to their potential applications for aerodynamic control. In this paper, four types of actuators with different configurations of exposed electrode are proposed. The SDBD actuators investigated are driven by dual-power supply, referred to as a fixed AC high voltage and an adjustable DC bias. The effects of the electrode structures on the dielectric surface potential distribution, the electric wind velocity, and the mean thrust production are studied, and the dominative factors of airflow acceleration behavior are revealed. The results have shown that the actions of the SDBD actuator are mainly dependent on the geometry of the exposed electrode. Besides, the surface potential distribution can effectively affect the airflow acceleration behavior. With the application of an appropriate additional DC bias, the surface potential will be modified. As a result, the performance of the electric wind produced by a single SDBD can be significantly improved. In addition, the work also illustrates that the actuators with more negative surface potential present better mechanical performance

  19. Elimination of voltage reversal in multiple membrane electrode assembly installed microbial fuel cells (mMEA-MFCs) stacking system by resistor control.

    Science.gov (United States)

    Kim, Bongkyu; Chang, In Seop

    2018-08-01

    Voltage reversal (VR) in series connection of multiple membrane electrode assembly installed microbial fuel cells (mMEA-MFC) is eliminated by manipulating the resistor control. Discharge test results collected from two mMEA-MFCs initially operated (designated as P1 and P2) confirm that the performance of P2 exceeds that of P1. Thus, driving P1 and P2 as serially stacked MFCs generate the VR in P1. Controlling the inserted resistor adjust the current production of P2 to maintain balance with P1, and the VR in P1 is eliminated in the operation of stacking mode. Thus, manipulating the internal resistance provide an applicable approach to suppress VR in the stacking of mMEA-MFCs system. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. Analysis list: Clamp [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Clamp Cell line + dm3 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/target/Clamp.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/target/Clam...p.5.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/target/Clam...p.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/colo/Clamp.Cell_line.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/colo/Cell_line.gml ...

  1. Time varying voltage combustion control and diagnostics sensor

    Science.gov (United States)

    Chorpening, Benjamin T [Morgantown, WV; Thornton, Jimmy D [Morgantown, WV; Huckaby, E David [Morgantown, WV; Fincham, William [Fairmont, WV

    2011-04-19

    A time-varying voltage is applied to an electrode, or a pair of electrodes, of a sensor installed in a fuel nozzle disposed adjacent the combustion zone of a continuous combustion system, such as of the gas turbine engine type. The time-varying voltage induces a time-varying current in the flame which is measured and used to determine flame capacitance using AC electrical circuit analysis. Flame capacitance is used to accurately determine the position of the flame from the sensor and the fuel/air ratio. The fuel and/or air flow rate (s) is/are then adjusted to provide reduced flame instability problems such as flashback, combustion dynamics and lean blowout, as well as reduced emissions. The time-varying voltage may be an alternating voltage and the time-varying current may be an alternating current.

  2. Improved DNA clamps by stacking to adjacent nucleobases

    DEFF Research Database (Denmark)

    Fatthalla, M.I.; Pedersen, Erik Bjerregaard

    2012-01-01

    Three or four aromatic rings interconnected by acetylene bridges form a stiff conjugated system with sufficient conformational freedom to make it useful to link together the two strands of a DNA clamp. Upon targeting a ssDNA, the conformational flexibility allows better stacking of the linker...... to the underlying non-planar base triplet in the formed triplex. This type of triplexes has a substantially higher thermal melting temperature which can be further improved by inserting locked nucleic acids (LNAs) in the Hoogsteen part of the clamp. An extremely high sensitivity to mismatches is observed...

  3. Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

    Directory of Open Access Journals (Sweden)

    Seok-Yong Lee

    2009-03-01

    Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

  4. Voltage-Step Transient on Circular Electrodes

    Czech Academy of Sciences Publication Activity Database

    Wein, Ondřej; Tovčigrečko, Valentin

    2011-01-01

    Roč. 41, č. 9 (2011), s. 1065-1075 ISSN 0021-891X R&D Projects: GA ČR GA104/08/0428; GA ČR GA104/09/0972 Institutional research plan: CEZ:AV0Z40720504 Keywords : ohmic loss * voltage-step transient * cottrell asymptote Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 1.745, year: 2011

  5. Dependence of hydrogen arcjet operation on electrode geometry

    Science.gov (United States)

    Pencil, Eric J.; Sankovic, John M.; Sarmiento, Charles J.; Hamley, John A.

    1992-01-01

    The dependence of 2kW hydrogen arcjet performance on cathode to anode electrode spacing was evaluated at specific impulses of 900 and 1000 s. Less than 2 absolute percent change in efficiency was measured for the spacings tested which did not repeat the 14 absolute percent variation reported in earlier work with similar electrode designs. A different nozzle configuration was used to quantify the variation in hydrogen arcjet performance over an extended range of electrode spacing. Electrode gap variation resulted in less than 3 absolute percent change in efficiency. These null results suggested that electrode spacing is decoupled from hydrogen arcjet ignition. The dependence of breakdown voltage on mass flow rate and electrode agreed with Paschen curves for hydrogen. Preliminary characterization of the dependence of hydrogen arcjet ignition on rates of pulse repetition and pulse voltage rise were also included for comparison with previous results obtained using simulated hydrazine.

  6. Development of DBD plasma actuators: The double encapsulated electrode

    Science.gov (United States)

    Erfani, Rasool; Zare-Behtash, Hossein; Hale, Craig; Kontis, Konstantinos

    2015-04-01

    Plasma actuators are electrical devices that generate a wall bounded jet without the use of any moving parts. For aerodynamic applications they can be used as flow control devices to delay separation and augment lift on a wing. The standard plasma actuator consists of a single encapsulated (ground) electrode. The aim of this project is to investigate the effect of varying the number and distribution of encapsulated electrodes in the dielectric layer. Utilising a transformer cascade, a variety of input voltages are studied for their effect. In the quiescent environment of a Faraday cage the velocity flow field is recorded using particle image velocimetry. Through understanding of the mechanisms involved in producing the wall jet and the importance of the encapsulated electrode a novel actuator design is proposed. The actuator design distributes the encapsulated electrode throughout the dielectric layer. The experiments have shown that actuators with a shallow initial encapsulated electrode induce velocities greater than the baseline case at the same voltage. Actuators with a deep initial encapsulated electrode are able to induce the highest velocities as they can operate at higher voltages without breakdown of the dielectric.

  7. Exploiting Stretchable Metallic Springs as Compliant Electrodes for Cylindrical Dielectric Elastomer Actuators (DEAs

    Directory of Open Access Journals (Sweden)

    Chien-Hao Liu

    2017-11-01

    Full Text Available In recent years, dielectric elastomer actuators (DEAs have been widely used in soft robots and artificial bio-medical applications. Most DEAs are composed of a thin dielectric elastomer layer sandwiched between two compliant electrodes. DEAs vary in their design to provide bending, torsional, and stretch/contraction motions under the application of high external voltages. Most compliant electrodes are made of carbon powders or thin metallic films. In situations involving large deformations or improper fabrication, the electrodes are susceptible to breakage and increased resistivity. The worst cases result in a loss of conductivity and functional failure. In this study, we developed a method by which to exploit stretchable metallic springs as compliant electrodes for cylindrical DEAs. This design was inspired by the extensibility of mechanical springs. The main advantage of this approach is the fact that the metallic spring-like compliant electrodes remain conductive and do not increase the stiffness as the tube-like DEAs elongate in the axial direction. This can be attributed to a reduction in thickness in the radial direction. The proposed cylindrical structure is composed of highly-stretchable VHB 4905 film folded within a hollow tube and then sandwiched between copper springs (inside and outside to allow for stretching and contraction in the axial direction under the application of high DC voltages. We fabricated a prototype and evaluated the mechanical and electromechanical properties of the device experimentally using a high-voltage source of 9.9 kV. This device demonstrated a non-linear increase in axial stretching with an increase in applied voltage, reaching a maximum extension of 0.63 mm (axial strain of 2.35% at applied voltage of 9.9 kV. Further miniaturization and the incorporation of compressive springs are expected to allow the implementation of the proposed method in soft micro-robots and bio-mimetic applications.

  8. Voltage quantization by ballistic vortices in two-dimensional superconductors

    International Nuclear Information System (INIS)

    Orlando, T.P.; Delin, K.A.

    1991-01-01

    The voltage generated by moving ballistic vortices with a mass m ν in a two-dimensional superconducting ring is quantized, and this quantization depends on the amount of charge enclosed by the ring. The quantization of the voltage is the dual to flux quantization in a superconductor, and is a manifestation of the Aharonov-Casher effect. The quantization is obtained by applying the Bohr-Sommerfeld criterion to the canonical momentum of the ballistic vortices. The results of this quantization condition can also be used to understand the persistent voltage predicted by van Wees for an array of Josephson junctions

  9. Enhanced Open-Circuit Voltage in Visible Quantum Dot Photovoltaics by Engineering of Carrier-Collecting Electrodes

    KAUST Repository

    Wang, Xihua

    2011-10-26

    Colloidal quantum dots (CQDs) enable multijunction solar cells using a single material programmed using the quantum size effect. Here we report the systematic engineering of 1.6 eV PbS CQD solar cells, optimal as the front cell responsible for visible-wavelength harvesting in tandem photovoltaics. We rationally optimize each of the device\\'s collecting electrodes-the heterointerface with electron-accepting TiO2 and the deep-work-function hole-collecting MoO3 for ohmic contact-for maximum efficiency. We report an open-circuit voltage of 0.70 V, the highest observed in a colloidal quantum dot solar cell operating at room temperature. We report an AM1.5 solar power conversion efficiency of 3.5%, the highest observed in >1.5 eV bandgap CQD PV device. © 2011 American Chemical Society.

  10. Increasing break-down strength of the support colomn of high-voltage accelerators

    International Nuclear Information System (INIS)

    Rezvykh, K.A.; Romanov, V.A.

    1981-01-01

    Calculation results of strength of electric field of the EG-2.5 electrostatic accelerator for the support colomn with electrodes of circular and elliptical transverse cross sections are presented. Conducted is the choice of constructing the column under the condition that the dimensions of the tank, high-voltage electrode, step between the sections and internal diameter of the colomn electrodes are not changed. The potential at the high-voltage electrode equals 2.5 MV while the average longitudinal gradient of the colomn field equals 1.25 MV/m. The support insulation colomn of the high-voltage accelerator screened by rings with transverse cross section in the form of orientation oval in some accelerators promotes obtaining higher operating voltage and at the same time increase of operation reliability at the rest unchanged dimensions of the plant because the probability of break-down between the support colomn and the tank wall decreases. The latter is especially significant for most high-energy accelerators as well as for accelerators used in national economy [ru

  11. Multilevel-clamped multilevel converters (MLC2)

    DEFF Research Database (Denmark)

    Rodriguez, Pedro; Bellar, Maria Dias; Muñoz-Aguliar, Raúl Santiago

    2012-01-01

    clamping scheme is the ML clamping cell, which is composed of a pair of dc sources associated with one single-pole/triple-throw type of switch arrangement. The number of series-connected ML-clamping cells will set the number of levels of the synthesized waveform. By depending on the MCU arrangements......, different converter configurations can be derived, namely, the common clamping and the modular types. Both approaches can be accomplished by employing classical three-level neutral-point-clamped (NPC) technology. Thus, the overall structure of the resultant converter is kept simple, wherein the number...

  12. Structure of Voltage-gated Two-pore Channel TPC1 from Arabidopsis thaliana

    Science.gov (United States)

    Guo, Jiangtao; Zeng, Weizhong; Chen, Qingfeng; Lee, Changkeun; Chen, Liping; Yang, Yi; Cang, Chunlei; Ren, Dejian; Jiang, Youxing

    2015-01-01

    Two-pore channels (TPCs) contain two copies of a Shaker-like six-transmembrane (6-TM) domain in each subunit and are ubiquitously expressed in both animals and plants as organellar cation channels. Here, we present the first crystal structure of a vacuolar two-pore channel from Arabidopsis thaliana, AtTPC1, which functions as a homodimer. AtTPC1 activation requires both voltage and cytosolic Ca2+. Ca2+ binding to the cytosolic EF-hand domain triggers conformational changes coupled to the pair of pore-lining inner helices (IS6 helices) from the first 6-TM domains, whereas membrane potential only activates the second voltage-sensing domain (VSD2) whose conformational changes are coupled to the pair of inner helices (IIS6 helices) from the second 6-TM domains. Luminal Ca2+ or Ba2+ can modulate voltage activation by stabilizing VSD2 in the resting state and shifts voltage activation towards more positive potentials. Our Ba2+ bound AtTPC1 structure reveals a voltage sensor in the resting state, providing hitherto unseen structural insight into the general voltage-gating mechanism among voltage-gated channels. PMID:26689363

  13. Effects of atmospheric pressure plasma jet with floating electrode on murine melanoma and fibroblast cells

    Science.gov (United States)

    Xu, G.; Liu, J.; Yao, C.; Chen, S.; Lin, F.; Li, P.; Shi, X.; Zhang, Guan-Jun

    2017-08-01

    Atmospheric pressure cold plasma jets have been recently shown as a highly promising tool in certain cancer therapies. In this paper, an atmospheric pressure plasma jet (APPJ) with a one inner floating and two outer electrode configuration using helium gas for medical applications is developed. Subjected to a range of applied voltages with a frequency of 19.8 kHz at a fixed rate of gas flow (i.e., 3 l/min), electrical and optical characteristics of the APPJ are investigated. Compared with the device only with two outer electrodes, higher discharge current, longer jet, and more active species in the plasma plume at the same applied voltage together with the lower gas breakdown voltage can be achieved through embedding a floating inner electrode. Employing the APPJ with a floating electrode, the effects of identical plasma treatment time durations on murine melanoma cancer and normal fibroblast cells cultured in vitro are evaluated. The results of cell viability, cell apoptosis, and DNA damage detection show that the plasma can inactivate melanoma cells in a time-dependent manner from 10 s to 60 s compared with the control group (p cells compared with their control group, the plasma with treatment time from 30 s to 60 s can induce significant changes (p cells at the same treatment time. The different basal reactive oxygen species level and antioxidant superoxide dismutase level of two kinds of cells may account for their different responses towards the identical plasma exposure.

  14. Functional diversity of voltage-sensing phosphatases in two urodele amphibians.

    Science.gov (United States)

    Mutua, Joshua; Jinno, Yuka; Sakata, Souhei; Okochi, Yoshifumi; Ueno, Shuichi; Tsutsui, Hidekazu; Kawai, Takafumi; Iwao, Yasuhiro; Okamura, Yasushi

    2014-07-16

    Voltage-sensing phosphatases (VSPs) share the molecular architecture of the voltage sensor domain (VSD) with voltage-gated ion channels and the phosphoinositide phosphatase region with the phosphatase and tensin homolog (PTEN), respectively. VSPs enzymatic activities are regulated by the motions of VSD upon depolarization. The physiological role of these proteins has remained elusive, and insights may be gained by investigating biological variations in different animal species. Urodele amphibians are vertebrates with potent activities of regeneration and also show diverse mechanisms of polyspermy prevention. We cloned cDNAs of VSPs from the testes of two urodeles; Hynobius nebulosus and Cynops pyrrhogaster, and compared their expression and voltage-dependent activation. Their molecular architecture is highly conserved in both Hynobius VSP (Hn-VSP) and Cynops VSP (Cp-VSP), including the positively-charged arginine residues in the S4 segment of the VSD and the enzymatic active site for substrate binding, yet the C-terminal C2 domain of Hn-VSP is significantly shorter than that of Cp-VSP and other VSP orthologs. RT-PCR analysis showed that gene expression pattern was distinct between two VSPs. The voltage sensor motions and voltage-dependent phosphatase activities were investigated electrophysiologically by expression in Xenopus oocytes. Both VSPs showed "sensing" currents, indicating that their voltage sensor domains are functional. The phosphatase activity of Cp-VSP was found to be voltage dependent, as shown by its ability to regulate the conductance of coexpressed GIRK2 channels, but Hn-VSP lacked such phosphatase activity due to the truncation of its C2 domain. © 2014 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  15. Experimental investigation of cathode spots and plasma jets behavior subjected to two kinds of axial magnetic field electrodes

    International Nuclear Information System (INIS)

    Wang, Lijun; Deng, Jie; Zhou, Xin; Jia, Shenli; Qian, Zhonghao; Shi, Zongqian

    2016-01-01

    In this paper, cathode spot plasma jet (CSPJ) rotation and cathode spots behavior subjected to two kinds of large diameter axial magnetic field (AMF) electrode (cup-shaped and coil-shaped) are studied and analyzed based on experiments. The influence of gap distances on the CSPJ rotational behavior is analyzed. Experimental results show that CSPJ rotational phenomena extensively exist in the vacuum interrupters, and CSPJ rotational direction is along the direction of composite magnetic field (mainly the combination of the axial and azimuthal components). For coil-shaped and cup-shaped AMF electrodes, the rotational or inclination phenomena before the current peak value are much more significant than that after current peak value (for the same arc current), which is related to the larger ratio of azimuthal magnetic field B_t and AMF B_z (B_t/B_z). With the increase of the gap distance, the AMF strength decreases, when the arc current is kept as constant, the azimuthal magnetic field is kept invariable, the ratio between azimuthal magnetic field and AMF is increased, which results in the increase of rotational effect. For cathode spots motion, compared with cup-shaped electrode, coil-shaped electrode has the inverse AMF direction. The Robson drift direction of cathode spots of coil-shaped electrode is opposite to that of cup-shaped electrode. With the increase of gap distance, the Robson angle is decreased, which is associated with the reduced AMF strength. Erosion imprints of anode and cathode are also related to the CSPJ rotational phenomena and cathode spots behavior. The noise of arc voltage in the initial arcing stage is related to the weaker AMF.

  16. Experimental investigation of cathode spots and plasma jets behavior subjected to two kinds of axial magnetic field electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Lijun; Deng, Jie; Zhou, Xin; Jia, Shenli; Qian, Zhonghao; Shi, Zongqian [State Key Laboratory of Electrical Insulation and Power Equipment, Xi' an Jiaotong University, Xi' an 710049 (China)

    2016-04-15

    In this paper, cathode spot plasma jet (CSPJ) rotation and cathode spots behavior subjected to two kinds of large diameter axial magnetic field (AMF) electrode (cup-shaped and coil-shaped) are studied and analyzed based on experiments. The influence of gap distances on the CSPJ rotational behavior is analyzed. Experimental results show that CSPJ rotational phenomena extensively exist in the vacuum interrupters, and CSPJ rotational direction is along the direction of composite magnetic field (mainly the combination of the axial and azimuthal components). For coil-shaped and cup-shaped AMF electrodes, the rotational or inclination phenomena before the current peak value are much more significant than that after current peak value (for the same arc current), which is related to the larger ratio of azimuthal magnetic field B{sub t} and AMF B{sub z} (B{sub t}/B{sub z}). With the increase of the gap distance, the AMF strength decreases, when the arc current is kept as constant, the azimuthal magnetic field is kept invariable, the ratio between azimuthal magnetic field and AMF is increased, which results in the increase of rotational effect. For cathode spots motion, compared with cup-shaped electrode, coil-shaped electrode has the inverse AMF direction. The Robson drift direction of cathode spots of coil-shaped electrode is opposite to that of cup-shaped electrode. With the increase of gap distance, the Robson angle is decreased, which is associated with the reduced AMF strength. Erosion imprints of anode and cathode are also related to the CSPJ rotational phenomena and cathode spots behavior. The noise of arc voltage in the initial arcing stage is related to the weaker AMF.

  17. Two unique ligand-binding clamps of Rhizopus oryzae starch binding domain for helical structure disruption of amylose.

    Directory of Open Access Journals (Sweden)

    Ting-Ying Jiang

    Full Text Available The N-terminal starch binding domain of Rhizopus oryzae glucoamylase (RoSBD has a high binding affinity for raw starch. RoSBD has two ligand-binding sites, each containing a ligand-binding clamp: a polyN clamp residing near binding site I is unique in that it is expressed in only three members of carbohydrate binding module family 21 (CBM21 members, and a Y32/F58 clamp located at binding site II is conserved in several CBMs. Here we characterized different roles of these sites in the binding of insoluble and soluble starches using an amylose-iodine complex assay, atomic force microscopy, isothermal titration calorimetry, site-directed mutagenesis, and structural bioinformatics. RoSBD induced the release of iodine from the amylose helical cavity and disrupted the helical structure of amylose type III, thereby significantly diminishing the thickness and length of the amylose type III fibrils. A point mutation in the critical ligand-binding residues of sites I and II, however, reduced both the binding affinity and amylose helix disruption. This is the first molecular model for structure disruption of the amylose helix by a non-hydrolytic CBM21 member. RoSBD apparently twists the helical amylose strands apart to expose more ligand surface for further SBD binding. Repeating the process triggers the relaxation and unwinding of amylose helices to generate thinner and shorter amylose fibrils, which are more susceptible to hydrolysis by glucoamylase. This model aids in understanding the natural roles of CBMs in protein-glycan interactions and contributes to potential molecular engineering of CBMs.

  18. Integrated Three-Voltage-Booster DC-DC Converter to Achieve High Voltage Gain with Leakage-Energy Recycling for PV or Fuel-Cell Power Systems

    Directory of Open Access Journals (Sweden)

    Chih-Lung Shen

    2015-09-01

    Full Text Available In this paper, an integrated three-voltage-booster DC-DC (direct current to direct current converter is proposed to achieve high voltage gain for renewable-energy generation systems. The proposed converter integrates three voltage-boosters into one power stage, which is composed of an active switch, a coupled-inductor, five diodes, and five capacitors. As compared with conventional high step-up converters, it has a lower component count. In addition, the features of leakage-energy recycling and switching loss reduction can be accomplished for conversion efficiency improvement. While the active switch is turned off, the converter can inherently clamp the voltage across power switch and suppress voltage spikes. Moreover, the reverse-recovery currents of all diodes can be alleviated by leakage inductance. A 200 W prototype operating at 100 kHz switching frequency with 36 V input and 400 V output is implemented to verify the theoretical analysis and to demonstrate the feasibility of the proposed high step-up DC-DC converter.

  19. Graphene-gold supercapacitor as a voltage controlled saturable absorber for femtosecond pulse generation.

    Science.gov (United States)

    Baylam, Isinsu; Balci, Osman; Kakenov, Nurbek; Kocabas, Coskun; Sennaroglu, Alphan

    2016-03-01

    We report, for the first time to the best of our knowledge, use of a graphene-gold supercapacitor as a voltage controlled fast saturable absorber for femtosecond pulse generation. The unique design involving only one graphene electrode lowers the insertion loss of the device, in comparison with capacitor designs with two graphene electrodes. Furthermore, use of the high-dielectric electrolyte allows reversible, adjustable control of the absorption level up to the visible region with low bias voltages of only a few volts (0-2 V). The fast saturable absorber action of the graphene-gold supercapacitor was demonstrated inside a multipass-cavity Cr:forsterite laser to generate nearly transform-limited, sub-100 fs pulses at a pulse repetition rate of 4.51 MHz at 1.24 μm.

  20. Electrochemical Deposition of CdTe Semiconductor Thin Films for Solar Cell Application Using Two-Electrode and Three-Electrode Configurations: A Comparative Study

    Directory of Open Access Journals (Sweden)

    O. K. Echendu

    2016-01-01

    Full Text Available Thin films of CdTe semiconductor were electrochemically deposited using two-electrode and three-electrode configurations in potentiostatic mode for comparison. Cadmium sulphate and tellurium dioxide were used as cadmium and tellurium sources, respectively. The layers obtained using both configurations exhibit similar structural, optical, and electrical properties with no specific dependence on any particular electrode configuration used. These results indicate that electrochemical deposition (electrodeposition of CdTe and semiconductors in general can equally be carried out using two-electrode system as well as the conventional three-electrode system without compromising the essential qualities of the materials produced. The results also highlight the advantages of the two-electrode configuration in process simplification, cost reduction, and removal of a possible impurity source in the growth system, especially as the reference electrode ages.

  1. Analysis of the Pallet Clamping Conditions in Work Positioning

    Directory of Open Access Journals (Sweden)

    L. A. Kolesnikov

    2016-01-01

    Full Text Available Pallets of automatic transfer lines serve as the technological and work-transfer equipment. However, their design is based on the general principles of designing machine accessories. Calculation of the basic design parameters of work based on their functioning features is fairly relevant.In pallet transfer movement over work positioning there is a mismatch between axes of the basic bushing of a pallet and the clamping locks of positioning. The paper identifies the factors influencing it, and defines the conditions to ensure the trouble-free clamping lock. The circular and rhombic clamping of pallet is simultaneous. Further, a clamping load is calculated from the pallet mass (together with the work-piece and the geometric parameters of the pallet clamping.The paper reveals three movement stages of the clamping lock in a vertical plane when setting the pallet in work positioning:- a clamping lock free play till it encounters with the location bushing;- a clamping lock play length when the lead-in chamfer contacts the bushing chamfer;- a clamping lock play length over the circular surface of bushing.The study of this process has allowed us to calculate the time of pallet clamping and dynamic loads acting on the clamping lock. These calculations made it possible to calculate the required diameter of the clamping lock. The presented calculations allow a reasonable assigning the main design parameters of work positioning for the pallet automatic lines.

  2. Flexible and stretchable electrodes for dielectric elastomer actuators

    Science.gov (United States)

    Rosset, Samuel; Shea, Herbert R.

    2013-02-01

    Dielectric elastomer actuators (DEAs) are flexible lightweight actuators that can generate strains of over 100 %. They are used in applications ranging from haptic feedback (mm-sized devices), to cm-scale soft robots, to meter-long blimps. DEAs consist of an electrode-elastomer-electrode stack, placed on a frame. Applying a voltage between the electrodes electrostatically compresses the elastomer, which deforms in-plane or out-of plane depending on design. Since the electrodes are bonded to the elastomer, they must reliably sustain repeated very large deformations while remaining conductive, and without significantly adding to the stiffness of the soft elastomer. The electrodes are required for electrostatic actuation, but also enable resistive and capacitive sensing of the strain, leading to self-sensing actuators. This review compares the different technologies used to make compliant electrodes for DEAs in terms of: impact on DEA device performance (speed, efficiency, maximum strain), manufacturability, miniaturization, the integration of self-sensing and self-switching, and compatibility with low-voltage operation. While graphite and carbon black have been the most widely used technique in research environments, alternative methods are emerging which combine compliance, conduction at over 100 % strain with better conductivity and/or ease of patternability, including microfabrication-based approaches for compliant metal thin-films, metal-polymer nano-composites, nanoparticle implantation, and reel-to-reel production of μm-scale patterned thin films on elastomers. Such electrodes are key to miniaturization, low-voltage operation, and widespread commercialization of DEAs.

  3. Receivers for processing electron beam pick-up electrode signals

    International Nuclear Information System (INIS)

    Anon.

    1991-01-01

    There are several methods of determining the transverse position of the electron beam, based upon sensing either the electric field, the magnetic field, or both. At the NSLS the transverse beam position monitors each consist of a set of four circular electrodes. There are 48 sets of pick-up electrodes in the X-ray ring and 24 in the VUV storage ring for determining the electron orbit, and a few extra sets installed for specialized purposes. When the beam passes between the four electrodes, charge is induced on each electrode, the amount depending upon the distance of the beam from that electrode. If V a , V b , V c and V d given by a difference between pairs of electrodes normalized for variations in beam current by dividing by the sum of electrode voltages. The method of processing these signals depends upon their time structure. The electrons circulating around the vacuum chamber are concentrated in short bunches within stability buckets produced by the accelerating voltage in the RF cavities. The charges induced on the pickup electrodes then are narrow pulses, a fraction of a nanosecond long, and would result in a monopolar voltage pulses if it were not for the impedance of the cable connecting the electrode to the processing apparatus. The capacitance between each electrode and the chamber wall is only a few picofarads and is effectively in parallel with the cable impedance (50 ohms). Thus an appreciable amount of the charge flows off the electrode while the bunch is between the electrodes, resulting in potential of opposite sign as the bunch is leaving the vicinity of the electrode. The resulting signal consists of a series of bipolar pulses, each of less than one nanosecond duration

  4. Dispersion of breakdown voltage of liquid helium

    International Nuclear Information System (INIS)

    Ishii, Itaru; Noguchi, Takuya

    1978-01-01

    As for the electrical insulation characteristics of liquid helium, the discrepancy among the measured values by each person is very large even in the fundamental DC breakdown voltage in uniform electric field. The dispersion of experimental values obtained in the experiments by the same person is also large. Hereafter, the difference among the mean values obtained by each experimenter will be referred to as ''deviation of mean values'', and the dispersion of measured values around the mean value obtained by the same person as ''deviation around the man value''. The authors have mainly investigated on the latter experimentally. The cryostat was made of stainless steel, and the innermost helium chamber was of 500 mm I.D. and approximately 1200 mm deep. The high voltage electrode was of brass sphere of 25 mm diameter, and the low voltage electrode was of brass plate. The experiment was conducted for liquid helium boiling at 4.2 K and 1 atm, and the breakdown voltage and time lag were measured by applying the approximately square wave impulses of fast rise and long tail, ramp and DC voltages. The cause of the deviation of mean values may be the presence of impurity particles or the effect of electrode shape. As for the deviation around the mean value, the dispersion is large, and its standard deviation may amount to 10 to 20% of the man value. The dispersion is not due to the statistical time lag, but is due to parameters that vary with breakdown. (Wakatsuki, Y.)

  5. Γ-source Neutral Point Clamped Inverter

    DEFF Research Database (Denmark)

    Mo, Wei; Loh, Poh Chiang; Blaabjerg, Frede

    Transformer based Z-source inverters are recently proposed to achieve promising buck-boost capability. They have improved higher buck-boost capability, smaller size and less components count over Z-source inverters. On the other hand, neutral point clamped inverters have less switching stress...... and better output performance comparing with traditional two-level inverters. Integrating these two types of configurations can help neutral point inverters achieve enhanced votlage buck-boost capability....

  6. Electrochemical characterisation of solid oxide cell electrodes for hydrogen production

    DEFF Research Database (Denmark)

    Bernuy-Lopez, Carlos; Knibbe, Ruth; He, Zeming

    2011-01-01

    Oxygen electrodes and steam electrodes are designed and tested to develop improved solid oxide electrolysis cells for H2 production with the cell support on the oxygen electrode. The electrode performance is evaluated by impedance spectroscopy testing of symmetric cells at open circuit voltage (OCV...

  7. Driving Pressure Influence in Voltage Maps Measurement Process Using Advanced Pneumatic Mapping Probe

    Directory of Open Access Journals (Sweden)

    Marek Kukucka

    2016-01-01

    Full Text Available Our paper deals with the method of the voltage-impedance map measurement process as a method useful for the electric mapping of human skin. The area of research extends from the basic research to its practical application in acupuncture skin mapping and acupuncture point localization and visualization. The problem of sufficient skin coverage and electrical contact with measuring electrodes is solved by the conventional mechanical telescopic electrodes and by the pneumatic matrix electrode probe. A 2D or 3D voltage-impedance map of skin is an output of the measuring, interpretation and evaluation process. New pneumatic construction of measuring probe was implemented to achieve a better coverage of specified skin area and get a reduced force range of the touching electrodes allowing the steady contact of the skin-electrode. A skin contact is related to the driving pressure of touching electrodes. Our paper offers experimentally measured results, voltage maps of skin on specific areas, selected measured and described acupuncture points and their applications in electro-acupuncture.

  8. Low voltage initiation of damaging arcs between electrical contacts

    International Nuclear Information System (INIS)

    Cuthrell, R.E.

    1975-07-01

    Metallic arcs were found to precede the firm contacting of electrical contacts which were closed without bounce. When the open-circuit voltages were below the ionization potential, the initiation of these arcs was found to depend on the presence of asperities on the surfaces and on asperity contracting, melting, and pinching off by magnetic forces. The arc is thought to be initiated inductively when the molten metallic asperity contact is pinched off, and the electrode damage is similar to that produced by the arcing of opening contacts. Arcing could not be produced for exceptionally smooth surfaces, or, for rough surfaces when the open-circuit potential was below the melting voltages of the electrode metals. In order to prevent damage to contact surfaces by melting or arcing, it is suggested that test potentials be limited to below the melting voltages, that the current be limited, the test circuits be designed to prevent inductively generated high voltage transients, and the contact surfaces be very smooth. In order to facilitate arc initiation in arc welding applications, it is suggested that the surfaces of electrodes and work pieces be roughened. (U.S.)

  9. Asymmetric Electrodes Constructed with PAN-Based Activated Carbon Fiber in Capacitive Deionization

    Directory of Open Access Journals (Sweden)

    Mingzhe Li

    2014-01-01

    Full Text Available Capacitive deionization (CDI method has drawn much attention for its low energy consumption, low pollution, and convenient manipulation. Activated carbon fibers (ACFs possess high adsorption ability and can be used as CDI electrode material. Herein, two kinds of PAN-based ACFs with different specific surface area (SSA were used for the CDI electrodes. The CDI performance was investigated; especially asymmetric electrodes’ effect was evaluated. The results demonstrated that PAN-based ACFs showed a high electrosorption rate (complete electrosorption in less than half an hour and moderate electrosorption capacity (up to 0.2 mmol/g. CDI experiments with asymmetric electrodes displayed a variation in electrosorption capacity between forward voltage and reverse voltage. It can be attributed to the electrical double layer (EDL overlap effect and inner pore potential; thus the ions with smaller hydrated ionic radius can be adsorbed more easily.

  10. Ventilation onset prior to umbilical cord clamping (physiological-based cord clamping improves systemic and cerebral oxygenation in preterm lambs.

    Directory of Open Access Journals (Sweden)

    Graeme R Polglase

    Full Text Available As measurement of arterial oxygen saturation (SpO2 is common in the delivery room, target SpO2 ranges allow clinicians to titrate oxygen therapy for preterm infants in order to achieve saturation levels similar to those seen in normal term infants in the first minutes of life. However, the influence of the onset of ventilation and the timing of cord clamping on systemic and cerebral oxygenation is not known.We investigated whether the initiation of ventilation, prior to, or after umbilical cord clamping, altered systemic and cerebral oxygenation in preterm lambs.Systemic and cerebral blood-flows, pressures and peripheral SpO2 and regional cerebral tissue oxygenation (SctO2 were measured continuously in apnoeic preterm lambs (126±1 day gestation. Positive pressure ventilation was initiated either 1 prior to umbilical cord clamping, or 2 after umbilical cord clamping. Lambs were monitored intensively prior to intervention, and for 10 minutes following umbilical cord clamping.Clamping the umbilical cord prior to ventilation resulted in a rapid decrease in SpO2 and SctO2, and an increase in arterial pressure, cerebral blood flow and cerebral oxygen extraction. Ventilation restored oxygenation and haemodynamics by 5-6 minutes. No such disturbances in peripheral or cerebral oxygenation and haemodynamics were observed when ventilation was initiated prior to cord clamping.The establishment of ventilation prior to umbilical cord clamping facilitated a smooth transition to systemic and cerebral oxygenation following birth. SpO2 nomograms may need to be re-evaluated to reflect physiological management of preterm infants in the delivery room.

  11. An Implantable Versatile Electrode-Driving ASIC for Chronic Epidural Stimulation in Rats.

    Science.gov (United States)

    Giagka, Vasiliki; Eder, Clemens; Donaldson, Nick; Demosthenous, Andreas

    2015-06-01

    This paper presents the design and testing of an electrode driving application specific integrated circuit (ASIC) intended for epidural spinal cord electrical stimulation in rats. The ASIC can deliver up to 1 mA fully programmable monophasic or biphasic stimulus current pulses, to 13 electrodes selected in any possible configuration. It also supports interleaved stimulation. Communication is achieved via only 3 wires. The current source and the control of the stimulation timing were kept off-chip to reduce the heat dissipation close to the spinal cord. The ASIC was designed in a 0.18- μm high voltage CMOS process. Its output voltage compliance can be up to 25 V. It features a small core area (ASIC was developed to be suitable for integration on the epidural electrode array, and two different versions were fabricated and electrically tested. Results from both versions were almost indistinguishable. The performance of the system was verified for different loads and stimulation parameters. Its suitability to drive a passive epidural 12-electrode array in saline has also been demonstrated.

  12. Dependence of hydrogen arcjet operation on electrode geometry

    Science.gov (United States)

    Pencil, Eric J.; Sankovic, John M.; Sarmiento, Charles J.; Hamley, John A.

    1992-01-01

    The dependence of 2 kW hydrogen arcjet performance on cathode to anode electrode spacing was evaluated at specific impulses of 900 and 1000 s. Less than 2 absolute percent change in efficiency was measured for the spacings tested which did not repeat the 14 absolute percent variation reported in earlier work with similar electrode designs. A different nozzle configuration was used to quantify the variation in hydrogen arcjet performance over an extended range of electrode spacing. Electrode gap variation resulted in less than 3 absolute percent change in efficiency. These null results suggested that electrode spacing is decoupled from hydrogen arcjet performance considerations over the ranges tested. Initial studies were conducted on hydrogen arcjet ignition. The dependence of breakdown voltage on mass flow rate and hydrogen arcjet ignition on rates of pulse repetition and pulse voltage rise were also included for comparison with previous results obtained using simulated hydrazine.

  13. The cardiovascular effects of aortic clamping and unclamping

    African Journals Online (AJOL)

    aortic clamping is that afterload and blood pressure increase, and ... individually, albeit they interact with each other. The degree of ... position of the aortic clamp, the greater the increase ... the increase in preload in response to aortic clamping.

  14. Single guard cell recordings in intact plants : light-induced hyperpolarization of the plasma membrane

    NARCIS (Netherlands)

    Roelfsema, MRG; Steinmeyer, R; Staal, M; Hedrich, R

    Guard cells are electrically isolated from other plant cells and therefore offer the unique possibility to conduct current- and voltage-clamp recordings on single cells in an intact plant. Guard cells in their natural environment were impaled with double-barreled electrodes and found to exhibit

  15. A study of the electrochemical behaviour of electrodes in operating solid-state supercapacitors

    International Nuclear Information System (INIS)

    Staiti, P.; Lufrano, F.

    2007-01-01

    The electrochemical behaviour of electrodes and of complete solid-state supercapacitors has been studied by cyclic voltammetry (CV) and galvanostatic charge/discharge (CD) measurements using two independent electrochemical equipments. The first one controlled the execution of the test and recorded the voltage and current values of the complete supercapacitor while the other one recorded the potential changes of the single electrodes. In this work, two different types of capacitors were studied: (a) a symmetric supercapacitor using carbon electrodes, and (b) a hybrid (asymmetric) supercapacitor with ruthenium oxide/carbon in the positive electrode and carbon in the negative electrode. The studies evidenced that in the symmetric capacitors the positive electrode controlled the capacitive performance and an optimal mass ratio from 1.2:1 to 1.3:1 between the positive and the negative electrodes was found in the investigated conditions. For the hybrid supercapacitor it was observed that the ruthenium-based positive electrode influenced the capacitive performance of carbon-based negative electrode and that an accurate balance of carbon loading in the negative electrode was necessary

  16. Current voltage perspective of an organic electronic device

    Science.gov (United States)

    Mukherjee, Ayash K.; Kumari, Nikita

    2018-05-01

    Nonlinearity in current (I) - voltage (V) measurement is a well-known attribute of two-terminal organic device, irrespective of the geometrical or structural arrangement of the device. Most of the existing theories that are developed for interpretation of I-V data, either focus current-voltage relationship of charge injection mechanism across the electrode-organic material interface or charge transport mechanism through the organic active material. On the contrary, both the mechanisms work in tandem charge conduction through the device. The transport mechanism is further complicated by incoherent scattering from scattering centres/charge traps that are located at the electrode-organic material interface and in the bulk of organic material. In the present communication, a collective expression has been formulated that comprises of all the transport mechanisms that are occurring at various locations of a planar organic device. The model has been fitted to experimental I-V data of Au/P3HT/Au device with excellent degree of agreement. Certain physical parameters such as the effective area of cross-section and resistance due to charge traps have been extracted from the fit.

  17. Water Treatment Using Plasma Discharge with Variation of Electrode Materials

    Science.gov (United States)

    Chanan, N.; Kusumandari; Saraswati, T. E.

    2018-03-01

    This research studied water treatment using plasma discharge. Plasma generated in this study produced active species that played a role in organic compound decomposition. The plasma reactor consisted of two needle electrodes made from stainless steel, tungsten, aluminium and grafit. It placed approximately 2 mm above the solution and connected with high-AC voltage. A solution of methylene blue used as an organic solution model. Plasma treatment times were 2, 4, 6, 8 and 10 min. The absorbance, temperature and pH of the solution were measured before and after treatment using various electrodes. The best electrode used in plasma discharging for methylene blue absorbance reduction was the graphite electrode, which provided the highest degradation efficiency of 98% at 6 min of treatment time.

  18. A comparison of two patient friendly ERG electrodes

    International Nuclear Information System (INIS)

    Hidajat, R.; McLay, J.; Elder, M.; Burley, C.; Goode, D.; Morton, J.

    2000-01-01

    Full text: The ideal electroretinography (ERG) electrode should provide reproducible waveforms, maximal amplitudes and minimal irritation of the patient's eyes. Contact lens electrodes (e.g. Burian-Allen, ERG jet) generate large amplitudes but are very uncomfortable and quite intimidating for the patient. Two other types, the gold foil and the H-K loop, provide a much more patient friendly alternative at the cost of somewhat reduced amplitudes. With the purchase of a new Nicolet Bravo electrodiagnostic system we had to select a suitable type of ERG electrode and establish the normal range for each ERG test with that electrode. It was decided to trial two electrodes, the gold foil (CH Electronics, UK) and the H-K loop (Avanta, Slovenia) before making the final choice. Seventeen normal volunteers, ranging in age from 14 to 56 years, were subjected to three standard measurements namely the flash photopic, white flash scotopic and transient pattern (PERG) ERG. Each test followed the guidelines set by the International Society for Clinical Electrophysiology of Vision (ISCEV). Before starting the measurements both eyes were anaesthetised with Ophthetic and for the flash ERG's the pupils were dilated with 1% Tropicamide. Immediately after the measurements each subject was asked which electrode was most comfortable. As specified by ISCEV the amplitudes were measured between adjacent troughs and peaks. The mean and standard deviation of the flash ERG b wave and the PERG P 50 amplitudes for each electrode are shown m the accompanying table together with the mean and standard deviation of the ratios of the amplitudes (gold foil/H-K loop) from each subject. It can be seen that the amplitudes measured with the gold foil electrodes are approximately twice those from the H-K loop and that the fractional variation (standard deviation/mean) of the gold foil amplitudes is also lower. In addition nearly all the subjects (13/17) felt less discomfort with the gold foil electrodes, only

  19. The Investigation of the Corrosion Resistance of the Tension Clamps Skl14

    Directory of Open Access Journals (Sweden)

    Marek Pětioký

    2015-05-01

    Full Text Available At the level crossings it is possible to find the problems with the corrosion of the parts of the fastening system. These problems are especially at the rubber level crossings and in the tunnels. As a part of the thesis the problem of the corrosion of the tension clamp Skl14 of the producer Vossloh at the rubber level crossings is examined. For the purposes of the comparison the tension clamps without the corrosion protection and the tension clamps with the corrosion protection KTL were examined. As a first step the corrosion features of the tension clamps Skl14 were solved. The examination was divided into two parts. First part it was the examination according to ČSN EN ISO 9227. The samples of the tension clamps were putted into the corrosion chamber. After 1728 h the results of the corrosion impacts were not satisfied. It was decided for the second step of the examination. It was the immersion in an electrolyte solution. As a result of the paper the corrosion features of the tension clamps without the corrosion protection and with the corrosion protection are compared.

  20. Co-axial electrodes gun characteristics

    International Nuclear Information System (INIS)

    Masoud, M.M.; Soliman, H.M.

    1981-01-01

    A coaxial electrodes gun is constructed with inner electrode diameter of 3.2 cm; outer electrode diameter of 6.6 cm and length of 25 cm it is connected to a condenser bank which delivers 4 K joule stored energy. The maximum power of the discharge is equal to 4.5x10 4 K watt; for 5 KV charging voltage. The inductance showed two main peak values of 0.257μH and 0.27μH. Theoretical calculations using one-dimension-single fluid model is μ sed, which shows that the maximum acceleration is at 0.5 sec, and the gas breakdown takes place at the gun breech; at the start of the discharge, will leave the gun after 1.625μ sec, also the drift velocity, the force and the magnetic field are given. The measured results show quite reasonable agreement with the calculations for most of the results, and the position of the plasma sheath inside the gun slightly deviated from the theoretical calculations due to viscosity and wall interaction, as well as other parameters which did not be take into consideration. The plasma current density of the sheath has its maximum value at Z=18 cm, the plasma will leave the coaxial source after 1.5μ sec, from the start of the discharge, which conferms with the theoretical model. Resistance of the gas between the electrodes, changes with time according to the particle injected from this source, and the maximum efficiency of the installation for charging voltage 5kV and pressure 80μ Hg is at approx.=10μ sec and 20.5μ sec

  1. Luminous flux improvement of xenon fluorescent lamps by applying synchronized high-voltage pulse to the auxiliary external electrode

    Energy Technology Data Exchange (ETDEWEB)

    Motomura, Hideki; Oka, Kojiro; Sogabe, Toru; Jinno, Masafumi, E-mail: hmoto@mayu.ee.ehime-u.ac.jp [Department of Electrical and Electronic Engineering, Ehime University 3 Bunkyo-cho, Matsuyama, Ehime 790-8577 (Japan)

    2011-06-08

    As the environmental awareness of people becomes stronger, the demand for mercury-free light sources also becomes stronger. The authors have been developing cold cathode fluorescent lamps in which xenon gas is filled as an ultraviolet radiator instead of mercury. Previously the authors reported the luminous flux enhancement method using a grounded auxiliary external electrode (AEE). In this paper, in order to improve the luminous flux much more, a positive voltage pulse which was synchronized to the main driving negative voltage pulse was applied to the AEE. As a result, the maximum input power increased under which the positive column did not constrict and the luminous flux improved by 70% at the xenon filling pressure of 6.7 kPa. It is proved that the positive voltage pulse application to the AEE with the amplitude of more than 2 kV expands the positive column in the radial direction. It is attributed to the phenomenon that the residual ions and electrons, which are generated by dielectric barrier discharge between the AEE and the anode during the falling edge of the negative pulse to the cathode, spread the discharge path from the anode towards the AEE during the cold cathode discharge mode. By increasing the xenon filling pressure, luminous efficacy was improved to 25 lm W{sup -1}.

  2. Dioxythiophene-based polymer electrodes for supercapacitor modules.

    Science.gov (United States)

    Liu, David Y; Reynolds, John R

    2010-12-01

    We report on the electrochemical and capacitive behaviors of poly(2,2-dimethyl-3,4-propylene-dioxythipohene) (PProDOT-Me2) films as polymeric electrodes in Type I electrochemical supercapacitors. The supercapacitor device displays robust capacitive charging/discharging behaviors with specific capacitance of 55 F/g, based on 60 μg of PProDOT-Me2 per electrode, that retains over 85% of its storage capacity after 32 000 redox cycles at 78% depth of discharge. Moreover, an appreciable average energy density of 6 Wh/kg has been calculated for the device, along with well-behaved and rapid capacitive responses to 1.0 V between 5 to 500 mV s(-1). Tandem electrochemical supercapacitors were assembled in series, in parallel, and in combinations of the two to widen the operating voltage window and to increase the capacitive currents. Four supercapacitors coupled in series exhibited a 4.0 V charging/discharging window, whereas assembly in parallel displayed a 4-fold increase in capacitance. Combinations of both serial and parallel assembly with six supercapacitors resulted in the extension of voltage to 3 V and a 2-fold increase in capacitive currents. Utilization of bipolar electrodes facilitated the encapsulation of tandem supercapacitors as individual, flexible, and lightweight supercapacitor modules.

  3. DETERMINATION OF ANALYTICAL CALCULATION ERROR OF MAGNETIC FIELD OF HIGH-VOLTAGE CABLE LINES WITH TWO-POINT BONDED CABLE SHIELDS CAUSED BY NON-UNIFORM CURRENT DISTRIBUTION IN THE SHIELDS

    Directory of Open Access Journals (Sweden)

    M. I. Baranov

    2017-06-01

    Full Text Available Purpose. To obtain new calculation correlations, determining approximate energy dissipation and electric erosion of massive basic metallic electrodes in the high-voltage high-current air switchboard (HVCAS of atmospheric pressure, in-use in the bit chain of the high-voltage electrophysics setting (HVES with the powerful capacity store of energy (CSE. Methodology. Electrophysics bases of technique of high-voltage and large impulsive currents (LIC, scientific and technical bases of development and planning of high-voltage heavy-current impulsive electro-devices, including HVES and powerful CSE, and also methods of measuring in their bit chains of LIC of the microsecond temporal range. Results. On the basis of new engineering approach the results of calculation estimation of excretions energy and electric erosion of massive basic metallic electrodes are resulted in probed HVCAS. New correlations are obtained for the approximate calculation of thermal energy, selected in an impulsive air spark and on the workings surfaces of anode and cathode of HVCAS. It is entered and a new electrophysics concept, touching equivalent active resistance of impulsive air spark, is mathematically certain. New formulas are obtained for the approximate calculation of most depth of single round crater of destruction on the workings surfaces of basic metallic electrodes of HVCAS, and also mass of metal, thrown out magnetic pressure from this crater of destruction on the electrodes of switch for one electric discharge through them powerful CSE HVES. It is shown that the radius of the indicated single crater of destruction is approximately equal to the maximal radius of plasma channel of a spark discharge between a cathode and anode of HVCAS. The executed high-current experiments in the bit chain of HVES with powerful CSE validated row of the got and in-use calculation correlations for the estimation of energy dissipation and electric erosion of metallic electrodes in

  4. Role of Ti and Pt electrodes on resistance switching variability of HfO2-based Resistive Random Access Memory

    International Nuclear Information System (INIS)

    Cabout, T.; Buckley, J.; Cagli, C.; Jousseaume, V.; Nodin, J.-F.; Salvo, B. de; Bocquet, M.; Muller, Ch.

    2013-01-01

    This paper deals with the role of platinum or titanium–titanium nitride electrodes on variability of resistive switching characteristics and electrical performances of HfO 2 -based memory elements. Capacitor-like Pt/HfO 2 (10 nm)/Pt and Ti/HfO 2 (10 nm)/TiN structures were fabricated on top of a tungsten pillar bottom electrode and integrated in-between two interconnect metal lines. First, quasi-static measurements were performed to apprehend the role of electrodes on electroforming, set and reset operations and their corresponding switching parameters. Memory elements with Pt as top and bottom electrodes exhibited a non-polar behavior with sharp decrease of current during reset operation while Ti/HfO 2 /TiN capacitors showed a bipolar switching behavior, with a gradual reset. In a second step, statistical distributions of switching parameters (voltage and resistance) were extracted from data obtained on few hundreds of capacitors. Even if the resistance in low resistive state and reset voltage was found to be comparable for both types of electrodes, the progressive reset operation observed on samples with Ti/TiN electrodes led to a lower variability of resistance in high resistive state and concomitantly of set voltage. In addition Ti–TiN electrodes enabled gaining: (i) lower forming and set voltages with significantly narrower capacitor-to-capacitor distributions; (ii) a better data retention capability (10 years at 65 °C instead of 10 years at 50 °C for Pt electrodes); (iii) satisfactory dynamic performances with lower set and reset voltages for ramp speed ranging from 10 −2 to 10 7 V/s. The significant improvement of switching behavior with Ti–TiN electrodes is mainly attributed to the formation of a native interface layer between HfO 2 oxide and Ti top electrode. - Highlights: ► HfO2 based capacitor-like structures were fabricated with Pt and Ti based electrodes. ► Influence of electrode materials on switching parameter variability is assessed.

  5. A High-Voltage Integrated Circuit Engine for a Dielectrophoresis-based Programmable Micro-Fluidic Processor

    Science.gov (United States)

    Current, K. Wayne; Yuk, Kelvin; McConaghy, Charles; Gascoyne, Peter R. C.; Schwartz, Jon A.; Vykoukal, Jody V.; Andrews, Craig

    2010-01-01

    A high-voltage (HV) integrated circuit has been demonstrated to transport droplets on programmable paths across its coated surface. This chip is the engine for a dielectrophoresis (DEP)-based micro-fluidic lab-on-a-chip system. This chip creates DEP forces that move and help inject droplets. Electrode excitation voltage and frequency are variable. With the electrodes driven with a 100V peak-to-peak periodic waveform, the maximum high-voltage electrode waveform frequency is about 200Hz. Data communication rate is variable up to 250kHz. This demonstration chip has a 32×32 array of nominally 100V electrode drivers. It is fabricated in a 130V SOI CMOS fabrication technology, dissipates a maximum of 1.87W, and is about 10.4 mm × 8.2 mm. PMID:23989241

  6. Floating electrode microelectromechanical system capacitive switches: A different actuation mechanism

    Science.gov (United States)

    Papaioannou, G.; Giacomozzi, F.; Papandreou, E.; Margesin, B.

    2011-08-01

    The paper investigates the actuation mechanism in floating electrode microelectromechanical system capacitive switches. It is demonstrated that in the pull-in state, the device operation turns from voltage to current controlled actuation. The current arises from Poole-Frenkel mechanism in the dielectric film and Fowler-Nordheim in the bridge-floating electrode air gap. The pull-out voltage seems to arise from the abrupt decrease of Fowler-Nordheim electric field intensity. This mechanism seems to be responsible for the very small difference with respect to the pull-in voltage.

  7. 21 CFR 882.4460 - Neurosurgical head holder (skull clamp).

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Neurosurgical head holder (skull clamp). 882.4460... holder (skull clamp). (a) Identification. A neurosurgical head holder (skull clamp) is a device used to clamp the patient's skull to hold head and neck in a particular position during surgical procedures. (b...

  8. High-Efficiency Isolated Boost DCDC Converter for High-Power Low-Voltage Fuel-Cell Applications

    DEFF Research Database (Denmark)

    Nymand, Morten; Andersen, Michael A. E.

    2010-01-01

    high winding losses. The analysis of transformer leakage inductance reveals that extremely low leakage inductance can be achieved, allowing stored energy to be dissipated. Power MOSFETs fully rated for repetitive avalanches allow primary-side voltage clamp circuits to be eliminated. The oversizing...

  9. Discharge Characteristics of the Nickel Hydroxide Electrode in 30% KOH

    International Nuclear Information System (INIS)

    Kim, Young Jin

    1989-01-01

    The discharge behavior of the nickel hydroxide electrode has been investigated in 30% KOH at 25 .deg. C. Two voltage plateaus are displayed on the discharge curve of C/20. It is shown that the impedance of the nickel hydroxide electrode increases with decrease of the discharge potential. The discharge behavior of the nickel hydroxide electrode has been investigated in 30% KOH indicating the reduction of the β-NiOOH to the β-Ni(OH) 2 by proton diffusion process and hence the electronic conductivity change of the nickel hydroxide electrode. Furthermore, the γ-NiOOH, produced by prolonged oxidation of the β-NiOOH in 30% KOH, discharges at a slightly lower potential than the β-Ni(OH) 2 that could result in the life-limiting factor of several alkaline electrolyte storage batteries using the nickel hydroxide electrode as the positive plate

  10. Optical and Electrical Performance of MOS-Structure Silicon Solar Cells with Antireflective Transparent ITO and Plasmonic Indium Nanoparticles under Applied Bias Voltage.

    Science.gov (United States)

    Ho, Wen-Jeng; Sue, Ruei-Siang; Lin, Jian-Cheng; Syu, Hong-Jang; Lin, Ching-Fuh

    2016-08-10

    This paper reports impressive improvements in the optical and electrical performance of metal-oxide-semiconductor (MOS)-structure silicon solar cells through the incorporation of plasmonic indium nanoparticles (In-NPs) and an indium-tin-oxide (ITO) electrode with periodic holes (perforations) under applied bias voltage. Samples were prepared using a plain ITO electrode or perforated ITO electrode with and without In-NPs. The samples were characterized according to optical reflectance, dark current voltage, induced capacitance voltage, external quantum efficiency, and photovoltaic current voltage. Our results indicate that induced capacitance voltage and photovoltaic current voltage both depend on bias voltage, regardless of the type of ITO electrode. Under a bias voltage of 4.0 V, MOS cells with perforated ITO and plain ITO, respectively, presented conversion efficiencies of 17.53% and 15.80%. Under a bias voltage of 4.0 V, the inclusion of In-NPs increased the efficiency of cells with perforated ITO and plain ITO to 17.80% and 16.87%, respectively.

  11. Optical and Electrical Performance of MOS-Structure Silicon Solar Cells with Antireflective Transparent ITO and Plasmonic Indium Nanoparticles under Applied Bias Voltage

    Directory of Open Access Journals (Sweden)

    Wen-Jeng Ho

    2016-08-01

    Full Text Available This paper reports impressive improvements in the optical and electrical performance of metal-oxide-semiconductor (MOS-structure silicon solar cells through the incorporation of plasmonic indium nanoparticles (In-NPs and an indium-tin-oxide (ITO electrode with periodic holes (perforations under applied bias voltage. Samples were prepared using a plain ITO electrode or perforated ITO electrode with and without In-NPs. The samples were characterized according to optical reflectance, dark current voltage, induced capacitance voltage, external quantum efficiency, and photovoltaic current voltage. Our results indicate that induced capacitance voltage and photovoltaic current voltage both depend on bias voltage, regardless of the type of ITO electrode. Under a bias voltage of 4.0 V, MOS cells with perforated ITO and plain ITO, respectively, presented conversion efficiencies of 17.53% and 15.80%. Under a bias voltage of 4.0 V, the inclusion of In-NPs increased the efficiency of cells with perforated ITO and plain ITO to 17.80% and 16.87%, respectively.

  12. New perspectives in vacuum high voltage insulation. II. Gas desorption

    CERN Document Server

    Diamond, W T

    1998-01-01

    An examination has been made of gas desorption from unbaked electrodes of copper, niobium, aluminum, and titanium subjected to high voltage in vacuum. It has been shown that the gas is composed of water vapor, carbon monoxide, and carbon dioxide, the usual components of vacuum outgassing, plus an increased yield of hydrogen and light hydrocarbons. The gas desorption was driven by anode conditioning as the voltage was increased between the electrodes. The gas is often desorbed as microdischarges-pulses of a few to hundreds of microseconds-and less frequently in a more continuous manner without the obvious pulsed structure characteristic of microdischarge activity. The quantity of gas released was equivalent to many monolayers and consisted mostly of neutral molecules with an ionic component of a few percent. A very significant observation was that the gas desorption was more dependent on the total voltage between the electrodes than on the electric field. It was not triggered by field-emitted electrons but oft...

  13. Study of surface atmospheric pressure glow discharge plasma based on ultrathin laminated electrodes in air

    Science.gov (United States)

    Zhao, Luxiang; Liu, Wenzheng; Li, Zhiyi; Ma, Chuanlong

    2018-05-01

    A method to generate large-area surface plasma in air by micro-discharge is proposed. Two ultrathin laminated electrode structures of non-insulating and insulating types were formed by using the nanoscale ITO conductive layer. The surface glow discharge in atmospheric air is realized in low discharge voltage by constructing the special electric field of two-dimensional unidirectional attenuation. In particular, the insulating electrode structure can avoid the loss of ITO electrodes so that the discharge stability can be increased, and the treated objects can be prevented from metal ion pollution caused by the electrode in the discharge. It has broad application prospects in the fields of aerodynamics and material surface treatment.

  14. Oxidation of S(IV) in Seawater by Pulsed High Voltage Discharge Plasma with TiO2/Ti Electrode as Catalyst

    Science.gov (United States)

    Gong, Jianying; Zhang, Xingwang; Wang, Xiaoping; Lei, Lecheng

    2013-12-01

    Oxidation of S(IV) to S(VI) in the effluent of a flue gas desulfurization(FGD) system is very critical for industrial applications of seawater FGD. This paper reports a pulsed corona discharge oxidation process combined with a TiO2 photocatalyst to convert S(IV) to S(VI) in artificial seawater. Experimental results show that the oxidation of S(IV) in artificial seawater is enhanced in the pulsed discharge plasma process through the application of TiO2 coating electrodes. The oxidation rate of S(IV) using Ti metal as a ground electrode is about 2.0×10-4 mol · L-1 · min-1, the oxidation rate using TiO2/Ti electrode prepared by annealing at 500°C in air is 4.5×10-4 mol · L-1 · min-1, an increase with a factor 2.25. The annealing temperature for preparing TiO2/Ti electrode has a strong effect on the oxidation of S(IV) in artificial seawater. The results of in-situ emission spectroscopic analysis show that chemically active species (i.e. hydroxyl radicals and oxygen radicals) are produced in the pulsed discharge plasma process. Compared with the traditional air oxidation process and the sole plasma-induced oxidation process, the combined application of TiO2 photocatalysts and a pulsed high-voltage electrical discharge process is useful in enhancing the energy and conversion efficiency of S(IV) for the seawater FGD system.

  15. Giant rectification in graphene nanoflake molecular devices with asymmetric graphene nanoribbon electrodes

    International Nuclear Information System (INIS)

    Ji, Xiao-Li; Xie, Zhen; Zuo, Xi; Zhang, Guang-Ping; Li, Zong-Liang; Wang, Chuan-Kui

    2016-01-01

    By applying density functional theory based nonequilibrium Green's function method, we theoretically investigate the electron transport properties of a zigzag-edged trigonal graphene nanoflake (ZTGNF) sandwiched between two asymmetric zigzag graphene nanoribbon (zGNR) and armchair graphene nanoribbon (aGNR) electrodes with carbon atomic chains (CACs) as the anchoring groups. Significant rectifying effects have been observed for these molecular devices in low bias voltage regions. Interestingly, the rectifying performance of molecular devices can be optimized by changing the width of the aGNR electrode and the number of anchoring CACs. Especially, the molecular device displays giant rectification ratios up to the order of 10"4 when two CACs are used as the anchoring group between the ZTGNF and the right aGNR electrode. Further analysis indicates that the asymmetric shift of the perturbed molecular energy levels and the spatial parity of the electron wavefunctions in the electrodes around the Fermi level play key roles in determining the rectification performance. And the spatial distributions of tunneling electron wavefunctions under negative bias voltages can be modified to be very localized by changing the number of anchoring CACs, which is found to be the origin of the giant rectification ratios. - Highlights: • The rectification properties of triangular Graphene nanoflakes are investigated. • The rectifying performance can be optimized by changing the width of the right arm-chaired GNR electrode. • The rectifying performance can also be tuned by varying the number of anchoring carbon atomic chains.

  16. Active voltage contrast imaging of cross-sectional surface of multilayer ceramic capacitor using helium ion microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Sakai, C., E-mail: SAKAI.Chikako@nims.go.jp; Ishida, N.; Masuda, H.; Nagano, S.; Kitahara, M.; Fujita, D. [National Institute for Materials Science, Tsukuba, Ibaraki 305-0047 (Japan); Ogata, Y. [TAIYO YUDEN CO., LTD., Takasaki-shi, Gunma 370-3347 (Japan)

    2016-08-01

    We studied active voltage contrast (AVC) imaging using helium ion microscopy (HIM). We observed secondary electron (SE) images of the cross-sectional surface of multilayer ceramic capacitors (MLCCs) with and without a voltage applied to the internal electrodes. When no voltage was applied, we obtained an image reflecting the material contrast between the Ni internal electrode region and the BaTiO{sub 3} dielectric region of the cross-sectional surface of the MLCC. When a voltage was applied, the electrical potential difference between the grounded and the positively biased internal electrodes affected the contrast (voltage contrast). Moreover, attenuation of the SE intensity from the grounded to the positively biased internal electrodes was observed in the dielectric region. Kelvin probe force microscopy (KPFM) measurements of the contact potential difference (CPD) were performed on the same sample. By using the AVC image from the HIM observation and the CPD image from the KPFM measurement, we could quantitatively evaluate the electrical potential. We think that the results of this study will lead to an expansion in the number of applications of HIM.

  17. Development of parallel-plate-based MEMS tunable capacitors with linearized capacitance–voltage response and extended tuning range

    International Nuclear Information System (INIS)

    Shavezipur, M; Nieva, P; Khajepour, A; Hashemi, S M

    2010-01-01

    This paper presents a design technique that can be used to linearize the capacitance–voltage (C–V) response and extend the tuning range of parallel-plate-based MEMS tunable capacitors beyond that of conventional designs. The proposed technique exploits the curvature of the capacitor's moving electrode which could be induced by either manipulating the stress gradients in the plate's material or using bi-layer structures. The change in curvature generates a nonlinear structural stiffness as the moving electrode undergoes out-of-plane deformation due to the actuation voltage. If the moving plate curvature is tailored such that the capacitance increment is proportional to the voltage increment, then a linear C–V response is obtained. The larger structural resistive force at higher bias voltage also delays the pull-in and increases the maximum tunability of the capacitor. Moreover, for capacitors containing an insulation layer between the two electrodes, the proposed technique completely eliminates the pull-in effect. The experimental data obtained from different capacitors fabricated using PolyMUMPs demonstrate the advantages of this design approach where highly linear C–V responses and tunabilities as high as 1050% were recorded. The design methodology introduced in this paper could be easily extended to for example, capacitive pressure and temperature sensors or infrared detectors to enhance their response characteristics.

  18. Ultrasonic cleaning of electrodes of wire chambers

    International Nuclear Information System (INIS)

    Krasnov, V.A.; Kurepin, A.B.; Razin, V.I.

    1980-01-01

    A technological process of cleaning electrodes and working volume surfaces of wire chambers from contaminations by the simultaneous mechanical action of the energy of ultrasonic oscillations and the chemical action of detergents is discussed. A device for cleaning wire electrodes of proportional chambers of 0.3x0.4 m is described. The device uses two ultrasonic generators with a total power of 0.5 kW. As a detergent use is made of a mixture of ethyl alcohol, gasoline and freon. In the process of cleaning production defects can be detected in the wire chambers which makes it possible to timely remove the defects. Measurements of the surface resistance of fiberglass laminate of printed drift chamber electrodes at a voltage of 2 kV showed that after completing the cleaning process the resistance increases 15-20%

  19. Alkali metal ion battery with bimetallic electrode

    Science.gov (United States)

    Boysen, Dane A; Bradwell, David J; Jiang, Kai; Kim, Hojong; Ortiz, Luis A; Sadoway, Donald R; Tomaszowska, Alina A; Wei, Weifeng; Wang, Kangli

    2015-04-07

    Electrochemical cells having molten electrodes having an alkali metal provide receipt and delivery of power by transporting atoms of the alkali metal between electrode environments of disparate chemical potentials through an electrochemical pathway comprising a salt of the alkali metal. The chemical potential of the alkali metal is decreased when combined with one or more non-alkali metals, thus producing a voltage between an electrode comprising the molten the alkali metal and the electrode comprising the combined alkali/non-alkali metals.

  20. The Electrode Modality Development in Pulsed Electric Field Treatment Facilitates Biocellular Mechanism Study and Improves Cancer Ablation Efficacy.

    Science.gov (United States)

    Cen, Chao; Chen, Xinhua

    2017-01-01

    Pulsed electric field treatment is now widely used in diverse biological and medical applications: gene delivery, electrochemotherapy, and cancer therapy. This minimally invasive technique has several advantages over traditional ablation techniques, such as nonthermal elimination and blood vessel spare effect. Different electrodes are subsequently developed for a specific treatment purpose. Here, we provide a systematic review of electrode modality development in pulsed electric field treatment. For electrodes invented for experiment in vitro, sheet electrode and electrode cuvette, electrodes with high-speed fluorescence imaging system, electrodes with patch-clamp, and electrodes with confocal laser scanning microscopy are introduced. For electrodes invented for experiment in vivo, monopolar electrodes, five-needle array electrodes, single-needle bipolar electrode, parallel plate electrodes, and suction electrode are introduced. The pulsed electric field provides a promising treatment for cancer.

  1. Performance of two different types of anodes in membrane electrode assembly microbial fuel cells for power generation from domestic wastewater

    KAUST Repository

    Hays, Sarah

    2011-10-01

    Graphite fiber brush electrodes provide high surface areas for exoelectrogenic bacteria in microbial fuel cells (MFCs), but the cylindrical brush format limits more compact reactor designs. To enable MFC designs with closer electrode spacing, brush anodes were pressed up against a separator (placed between the electrodes) to reduce the volume occupied by the brush. Higher maximum voltages were produced using domestic wastewater (COD = 390 ± 89 mg L-1) with brush anodes (360 ± 63 mV, 1000 Ω) than woven carbon mesh anodes (200 ± 81 mV) with one or two separators. Maximum power densities were similar for brush anode reactors with one or two separators after 30 days (220 ± 1.2 and 240 ± 22 mW m-2), but with one separator the brush anode MFC power decreased to 130 ± 55 mW m-2 after 114 days. Power densities in MFCs with mesh anodes were very low (<45 mW m-2). Brush anodes MFCs had higher COD removals (80 ± 3%) than carbon mesh MFCs (58 ± 7%), but similar Coulombic efficiencies (8.6 ± 2.9% brush; 7.8 ± 7.1% mesh). These results show that compact (hemispherical) brush anodes can produce higher power and more effective domestic wastewater treatment than flat mesh anodes in MFCs. © 2011 Elsevier B.V. All rights reserved.

  2. A novel NaV1.5 voltage sensor mutation associated with severe atrial and ventricular arrhythmias.

    Science.gov (United States)

    Wang, Hong-Gang; Zhu, Wandi; Kanter, Ronald J; Silva, Jonathan R; Honeywell, Christina; Gow, Robert M; Pitt, Geoffrey S

    2016-03-01

    Inherited autosomal dominant mutations in cardiac sodium channels (NaV1.5) cause various arrhythmias, such as long QT syndrome and Brugada syndrome. Although dozens of mutations throughout the protein have been reported, there are few reported mutations within a voltage sensor S4 transmembrane segment and few that are homozygous. Here we report analysis of a novel lidocaine-sensitive recessive mutation, p.R1309H, in the NaV1.5 DIII/S4 voltage sensor in a patient with a complex arrhythmia syndrome. We expressed the wild type or mutant NaV1.5 heterologously for analysis with the patch-clamp and voltage clamp fluorometry (VCF) techniques. p.R1309H depolarized the voltage-dependence of activation, hyperpolarized the voltage-dependence of inactivation, and slowed recovery from inactivation, thereby reducing the channel availability at physiologic membrane potentials. Additionally, p.R1309H increased the "late" Na(+) current. The location of the mutation in DIIIS4 prompted testing for a gating pore current. We observed an inward current at hyperpolarizing voltages that likely exacerbates the loss-of-function defects at resting membrane potentials. Lidocaine reduced the gating pore current. The p.R1309H homozygous NaV1.5 mutation conferred both gain-of-function and loss-of-function effects on NaV1.5 channel activity. Reduction of a mutation-induced gating pore current by lidocaine suggested a therapeutic mechanism. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Characterizations of a loss-of-function mutation in the Kir3.4 channel subunit

    DEFF Research Database (Denmark)

    Calloe, Kirstine; Ravn, Lasse Steen; Schmitt, Nicole

    2007-01-01

    and two-electrode voltage-clamp revealed that Kir3.4-G247R basal current was reduced compared to wild-type Kir3.4 and co-expression with the muscarinic acetylcholine receptor type 2 showed that also the acetylcholine induced current was severely reduced in Kir3.4-G247R, indicating that the mutation...... the lack of clear clinical manifestations and further studies are necessary to elucidate if mutations in Kir3.4 are predisposing AF. Udgivelsesdato: 2007-Dec-28...

  4. Three phase voltage measurements with simple open air sensors

    NARCIS (Netherlands)

    Heesch, van E.J.M.; Caspers, R.; Gulickx, P.F.M.; Jacobs, G.A.P.; Kersten, W.F.J.; Laan, van der P.C.T.

    1991-01-01

    A low cost, easy to install high-voltage measuring system is described for open air substations and overhead lines. Based on the Differentiating/Integrating (D/I) principle, three free-standing capacitive pickup electrodes are used to sense the three phase to ground voltages. Apart from the

  5. Flexible electrode belt for EIT using nanofiber web dry electrodes.

    Science.gov (United States)

    Oh, Tong In; Kim, Tae Eui; Yoon, Sun; Kim, Kap Jin; Woo, Eung Je; Sadleir, Rosalind J

    2012-10-01

    Efficient connection of multiple electrodes to the body for impedance measurement and voltage monitoring applications is of critical importance to measurement quality and practicality. Electrical impedance tomography (EIT) experiments have generally required a cumbersome procedure to attach the multiple electrodes needed in EIT. Once placed, these electrodes must then maintain good contact with the skin during measurements that may last several hours. There is usually also the need to manage the wires that run between the electrodes and the EIT system. These problems become more severe as the number of electrodes increases, and may limit the practicality and portability of this imaging method. There have been several trials describing human-electrode interfaces using configurations such as electrode belts, helmets or rings. In this paper, we describe an electrode belt we developed for long-term EIT monitoring of human lung ventilation. The belt included 16 embossed electrodes that were designed to make good contact with the skin. The electrodes were fabricated using an Ag-plated PVDF nanofiber web and metallic threads. A large contact area and padding were used behind each electrode to improve subject comfort and reduce contact impedances. The electrodes were incorporated, equally spaced, into an elasticated fabric belt. We tested the electrode belt in conjunction with the KHU Mark1 multi-frequency EIT system, and demonstrate time-difference images of phantoms and human subjects during normal breathing and running. We found that the Ag-plated PVDF nanofiber web electrodes were suitable for long-term measurement because of their flexibility and durability. Moreover, the contact impedance and stability of the Ag-plated PVDF nanofiber web electrodes were found to be comparable to similarly tested Ag/AgCl electrodes.

  6. Load-deflection characteristics of small-bore insulated-pipe clamps

    International Nuclear Information System (INIS)

    Severud, L.K.; Clark, G.L.

    1981-12-01

    The special insulated clamps used on both FFTF and CRBR piping utilize a Belleville spring arrangement to compensate for pipe thermal expansion. Analysis indicates that this produces a non-linear, directionally sensitive clamp spring rate. Since these spring rates influence the seismic response of a supported piping system, it was deemed necessary to evaluate them further by test. This has been accomplished for the FFTF clamps. A more standard insulated pipe clamp, which does not incorporate Belleville springs to accommodate thermal expansion, was also tested. This type clamp is simple in design, and economically attractive. It may have wide application prospects for use in LMFBR small bore auxiliary piping operating at temperatures below 427 0 C. Load deflection tests were conducted on 2.54 CM and 7.62 CM diameter samples of these commercial clamps

  7. A low knee voltage and high breakdown voltage of 4H-SiC TSBS employing poly-Si/Ni Schottky scheme

    Science.gov (United States)

    Kim, Dong Young; Seok, Ogyun; Park, Himchan; Bahng, Wook; Kim, Hyoung Woo; Park, Ki Cheol

    2018-02-01

    We report a low knee voltage and high breakdown voltage 4H-SiC TSBS employing poly-Si/Ni dual Schottky contacts. A knee voltage was significantly improved from 0.75 to 0.48 V by utilizing an alternative low work-function material of poly-Si as an anode electrode. Also, reverse breakdown voltage was successfully improved from 901 to 1154 V due to a shrunk low-work-function Schottky region by a proposed self-align etching process between poly-Si and SiC. SiC TSBS with poly-Si/Ni dual Schottky scheme is a suitable structure for high-efficiency rectification and high-voltage blocking operation.

  8. Effects of cadmium electrode properties on nickel-cadmium cell performance

    International Nuclear Information System (INIS)

    Zimmerman, A.H.

    1986-01-01

    Tests have been conducted on a number of nickel-cadmium cells that have exhibited a variety of performance problems, ranging from high voltages and pressures during overcharge to low capacity. The performance problems that have been specifically linked to the cadmium electrode are primarily related to two areas, poor sinter and the buildup of excessive pressure during overcharge. A number of specific nickel-cadmium cell and cadmium electrode characterists have been studied in this work to determine what the effects of poor sinter are, and to determine what factors are important in causing excessive pressures during overcharge in cells that otherwise appear normal. Several of the tests appear suitable for screening cells and electrodes for such problems

  9. Medium voltage three-level converters for the grid connection of a multi-MW wind turbine

    DEFF Research Database (Denmark)

    Senturk, Osman Selcuk; Helle, Lars; Munk-Nielsen, Stig

    2009-01-01

    Three-level (3L) neutral point clamped (NPC), flying capacitor (FC), and H-bridge (HB) voltage source converters (VSCs) as a grid-side full-scale medium voltage (MV) converter are modeled, controlled, and simulated for the grid connection of a hypothetical 6MW wind turbine. Via the converter...... topological features and the simulation results demonstrating the converter performance, these three 3L-VSCs are discussed and compared in terms of power density and reliability, which can be considered as two of the most important criteria for the converters placed in wind turbine nacelles. Given the grid...... connection circuit (without capacitive switching ripple filters), the 3L-HB-VSC is expected to be superior with respect to power density and reliability over the 3L-NPC- and -FC-VSCs....

  10. Medium Voltage Three-level Converters for the Grid Connection of aMulti-MW Wind Turbine

    DEFF Research Database (Denmark)

    Senturk, Osman Selcuk; Helle, Lars; Munk-Nielsen, Stig

    2009-01-01

    Three-level (3L) neutral point clamped (NPC), flying capacitor (FC), and H-bridge (HB) voltage source converters (VSCs) as a grid-side full-scale medium voltage (MV) converter are modeled, controlled, and simulated for the grid connection of a hypothetical 6MW wind turbine. Via the converter...... topological features and the simulation results demonstrating the converter performance, these three 3L-VSCs are discussed and compared in terms of power density and reliability, which can be considered as two of the most important criteria for the converters placed in wind turbine nacelles. Given the grid...... connection circuit (without capacitive switching ripple filters), the 3L-HB-VSC is expected to be superior with respect to power density and reliability over the 3L-NPC- and -FC-VSCs....

  11. Noncovalent Pi-Pi Stacking at the Carbon-Electrolyte Interface: Controlling the Voltage Window of Electrochemical Supercapacitors.

    Science.gov (United States)

    Li, Mengya; Westover, Andrew S; Carter, Rachel; Oakes, Landon; Muralidharan, Nitin; Boire, Timothy C; Sung, Hak-Joon; Pint, Cary L

    2016-08-03

    A key parameter in the operation of an electrochemical double-layer capacitor is the voltage window, which dictates the device energy density and power density. Here we demonstrate experimental evidence that π-π stacking at a carbon-ionic liquid interface can modify the operation voltage of a supercapacitor device by up to 30%, and this can be recovered by steric hindrance at the electrode-electrolyte interface introduced by poly(ethylene oxide) polymer electrolyte additives. This observation is supported by Raman spectroscopy, electrochemical impedance spectroscopy, and differential scanning calorimetry that each independently elucidates the signature of π-π stacking between imidazole groups in the ionic liquid and the carbon surface and the role this plays to lower the energy barrier for charge transfer at the electrode-electrolyte interface. This effect is further observed universally across two separate ionic liquid electrolyte systems and is validated by control experiments showing an invariant electrochemical window in the absence of a carbon-ionic liquid electrode-electrolyte interface. As interfacial or noncovalent interactions are usually neglected in the mechanistic picture of double-layer capacitors, this work highlights the importance of understanding chemical properties at supercapacitor interfaces to engineer voltage and energy capability.

  12. Neutral-point current modeling and control for Neutral-Point Clamped three-level converter drive with small DC-link capacitors

    DEFF Research Database (Denmark)

    Maheshwari, Ram Krishan; Munk-Nielsen, Stig; Busquets-Monge, Sergio

    2011-01-01

    A Neutral-Point-Clamped (NPC) three-level inverter with small DC-link capacitors is presented in this paper. This inverter requires zero average neutral-point current for stable neutral-point potential. A simple carrier based modulation strategy is proposed for achieving zero average neutral...... drive with only 14 μF DC-link capacitors. A fast and stable performance of the neutral-point voltage controller is achieved and verified by experiments....

  13. Load-deflection characteristics of small bore insulated pipe clamps

    International Nuclear Information System (INIS)

    Severud, L.K.; Clark, G.L.

    1982-01-01

    High temperature LMFBR piping is subject to rapid temperature changes during transient events. Typically, this pipe is supported by specially designed insulated pipe clamps to prevent excessive thermal stress from developing during these transients. The special insulated clamps used on both FFTF and CRBR piping utilize a Belleville spring arrangement to compensate for pipe thermal expansion. Analysis indicates that this produces a non-linear, directionally sensitive clamp spring rate. Since these spring rates influence the seismic response of a supported piping system, it was deemed necessary to evaluate them further by test. This has been accomplished for the FFTF clamps. A more standard insulated pipe clamp, which does not incorporate Belleville springs to accommodate thermal expansion, was also tested. This type clamp is simple in design, and economically attractive. It may have wide application prospects for use in LMFBR small bore auxiliary piping operating at temperatures below 427 0 C. Load deflection tests were conducted on 2.54 CM and 7.62 CM diameter samples of these commercial clamps

  14. Water desalination using capacitive deionization with microporous carbon electrodes.

    Science.gov (United States)

    Porada, S; Weinstein, L; Dash, R; van der Wal, A; Bryjak, M; Gogotsi, Y; Biesheuvel, P M

    2012-03-01

    Capacitive deionization (CDI) is a water desalination technology in which salt ions are removed from brackish water by flowing through a spacer channel with porous electrodes on each side. Upon applying a voltage difference between the two electrodes, cations move to and are accumulated in electrostatic double layers inside the negatively charged cathode and the anions are removed by the positively charged anode. One of the key parameters for commercial realization of CDI is the salt adsorption capacity of the electrodes. State-of-the-art electrode materials are based on porous activated carbon particles or carbon aerogels. Here we report the use for CDI of carbide-derived carbon (CDC), a porous material with well-defined and tunable pore sizes in the sub-nanometer range. When comparing electrodes made with CDC with electrodes based on activated carbon, we find a significantly higher salt adsorption capacity in the relevant cell voltage window of 1.2-1.4 V. The measured adsorption capacity for four materials tested negatively correlates with known metrics for pore structure of the carbon powders such as total pore volume and BET-area, but is positively correlated with the volume of pores of sizes <1 nm, suggesting the relevance of these sub-nanometer pores for ion adsorption. The charge efficiency, being the ratio of equilibrium salt adsorption over charge, does not depend much on the type of material, indicating that materials that have been identified for high charge storage capacity can also be highly suitable for CDI. This work shows the potential of materials with well-defined sub-nanometer pore sizes for energy-efficient water desalination. © 2012 American Chemical Society

  15. Wireless desalination using inductively powered porous carbon electrodes

    NARCIS (Netherlands)

    Kuipers, J.; Porada, S.

    2013-01-01

    Water desalination by capacitive deionization (CDI) uses electrochemical cell pairs formed of porous carbon electrodes, which are brought in contact with the water that must be desalinated. Upon applying a cell voltage or current between the electrodes, ions are electrosorbed and water is produced

  16. Comparison of two voltage control strategies for a wind power plant

    DEFF Research Database (Denmark)

    Martinez, Jorge; Kjær, Philip C.; Rodriguez, Pedro

    2011-01-01

    plants. This paper addresses the analysis of two different voltage control strategies for a wind power plant, i.e. decentralized and centralized voltage control schemes. The analysis has been performed using the equivalent and simplified transfer functions of the system. Using this representation......Larger percentages of wind power penetration translate to more demanding requirements from grid codes. Recently, voltage support at the point of connection has been introduced by several grid codes from around the world, thus, making it important to analyze this control when applied to wind power......, it is possible to investigate the influence of the plant control gain, short circuit ratio, and time delays on the system stability, as well as the fulfillment of the design requirements. The implemented plant voltage control is based on a slope voltage controller, which calculates the references to be sent...

  17. Timing of umbilical cord-clamping and infant anaemia: the role of maternal anaemia.

    Science.gov (United States)

    Blouin, Brittany; Penny, Mary E; Maheu-Giroux, Mathieu; Casapía, Martín; Aguilar, Eder; Silva, Hermánn; Creed-Kanashiro, Hilary M; Joseph, Serene A; Gagnon, Anita; Rahme, Elham; Gyorkos, Theresa W

    2013-05-01

    Evidence from randomized controlled trials has shown that delayed cord-clamping is beneficial to infant iron status. The role of maternal anaemia in this relationship, however, has not been established. To determine the effect of maternal anaemia at delivery on the association between timing of umbilical cord-clamping and infant anaemia at 4 and 8 months of age. A cohort of pregnant women admitted to the labour room of Hospital Iquitos (Iquitos, Peru) and their newborns were recruited into the study during two time periods (18 May to 3 June and 6-20 July 2009). Between the two recruitment periods, the hospital's policy changed from early to delayed umbilical cord-clamping. Maternal haemoglobin levels were measured before delivery, and the time between delivery and cord-clamping was recorded at delivery for the entire cohort. Mother-infant pairs were followed-up at 4 (n = 207) and 8 months (n = 184) post partum. Infant haemoglobin levels were measured at follow-up visits. Data were analysed using logistic regression models. The prevalence of maternal anaemia (Hb anaemia was modified by the mother's anaemia status. Significant benefits of delayed cord-clamping in preventing anaemia were found in infants born to anaemic mothers at both 4 months (aOR = 0.59, 95% CI 0.36-0.99) and 8 months (aOR = 0.38, 95% CI 0.19-0.76) of age. The study contributes additional evidence in support of delayed cord-clamping. This intervention is likely to have most public health impact in areas with a high prevalence of anaemia during pregnancy.

  18. Crystallographic origin of cycle decay of the high-voltage LiNi0.5Mn1.5O4 spinel lithium-ion battery electrode.

    Science.gov (United States)

    Pang, Wei Kong; Lu, Cheng-Zhang; Liu, Chia-Erh; Peterson, Vanessa K; Lin, Hsiu-Fen; Liao, Shih-Chieh; Chen, Jin-Ming

    2016-06-29

    High-voltage spinel LiNi0.5Mn1.5O4 (LNMO) is considered a potential high-power-density positive electrode for lithium-ion batteries, however, it suffers from capacity decay after extended charge-discharge cycling, severely hindering commercial application. Capacity fade is thought to occur through the significant volume change of the LNMO electrode occurring on cycling, and in this work we use operando neutron powder diffraction to compare the structural evolution of the LNMO electrode in an as-assembled 18650-type battery containing a Li4Ti5O12 negative electrode with that in an identical battery following 1000 cycles at high-current. We reveal that the capacity reduction in the battery post cycling is directly proportional to the reduction in the maximum change of the LNMO lattice parameter during its evolution. This is correlated to a corresponding reduction in the MnO6 octahedral distortion in the spinel structure in the cycled battery. Further, we find that the rate of lattice evolution, which reflects the rate of lithium insertion and removal, is ∼9 and ∼10% slower in the cycled than in the as-assembled battery during the Ni(2+)/Ni(3+) and Ni(3+)/Ni(4+) transitions, respectively.

  19. Site Selection for Hvdc Ground Electrodes

    Science.gov (United States)

    Freire, P. F.; Pereira, S. Y.

    2014-12-01

    High-Voltage Direct Current (HVDC) transmission systems are composed of a bipole transmission line with a converter substation at each end. Each substation may be equipped with a HVDC ground electrode, which is a wide area (up to 1 km Ø) and deep (from 3 to 100m) electrical grounding. When in normal operation, the ground electrode will dissipate in the soil the unbalance of the bipole (~1.5% of the rated current). When in monopolar operation with ground return, the HVDC electrode will inject in the soil the nominal pole continuous current, of about 2000 to 3000 Amperes, continuously for a period up to a few hours. HVDC ground electrodes site selection is a work based on extensive geophysical and geological surveys, in order to attend the desired design requirements established for the electrodes, considering both its operational conditions (maximum soil temperature, working life, local soil voltage gradients etc.) and the interference effects on the installations located up to 50 km away. This poster presents the geophysical investigations conducted primarily for the electrodes site selection, and subsequently for the development of the crust resistivity model, which will be used for the interference studies. A preliminary site selection is conducted, based on general geographical and geological criteria. Subsequently, the geology of each chosen area is surveyed in detail, by means of electromagnetic/electrical geophysical techniques, such as magnetotelluric (deep), TDEM (near-surface) and electroresistivity (shallow). Other complementary geologic and geotechnical surveys are conducted, such as wells drilling (for geotechnical characterization, measurement of the water table depth and water flow, and electromagnetic profiling), and soil and water sampling (for measurement of thermal parameters and evaluation of electrosmosis risk). The site evaluation is a dynamic process along the surveys, and some sites will be discarded. For the two or three final sites, the

  20. Loading dynamics of a sliding DNA clamp.

    KAUST Repository

    Cho, Won-Ki; Jergic, Slobodan; Kim, Daehyung; Dixon, Nicholas E; Lee, Jong-Bong

    2014-01-01

    8° during clamp closure. The single-molecule polarization and FRET studies thus revealed the real-time dynamics of the ATP-hydrolysis-dependent 3D conformational change of the β clamp during loading at a ss/dsDNA junction.

  1. Decomposition of methane to hydrogen using nanosecond pulsed plasma reactor with different active volumes, voltages and frequencies

    International Nuclear Information System (INIS)

    Khalifeh, Omid; Mosallanejad, Amin; Taghvaei, Hamed; Rahimpour, Mohammad Reza; Shariati, Alireza

    2016-01-01

    Highlights: • CH 4 conversion into H 2 is investigated in a nanosecond pulsed DBD reactor. • The absence of CO and CO 2 in the product gas is highly favorable. • Effects of external electrode length, applied voltage and frequency are examined. • The maximum efficiency of 7.23% is achieved at the electrode length of 15 cm. • The maximum CH 4 conversion of 87.2% is obtained at discharge power 268.92 W. - Abstract: In this paper, the methane conversion into hydrogen is investigated experimentally in a nanosecond pulsed DBD reactor. In order to achieve pure hydrogen production with minimum power consumption, effects of some operating parameters including external electrode length, applied voltage and pulse repetition frequency have been evaluated. Results show that although higher CH 4 conversion and H 2 concentration can be obtained at longer electrode lengths, higher applied voltages and pulse repetition frequencies, these parameters should be optimized for efficient hydrogen production. Actually, the maximum CH 4 conversion of 87.2% and maximum hydrogen percentage of 80% are obtained at the external electrode length, discharge power, voltage and frequency of 15 cm, 268.92 W, 12 kV and 10 kHz, respectively. However, the maximum efficiency of 7.23% is achieved at the external electrode length of 15 cm, applied voltage of 6 kV, pulse repetition frequency of 0.9 kHz and discharge power of 4 W. Furthermore, at this condition, due to low temperature of discharge zone very little amount of solid carbon was observed on the inner electrode surface of the reactor.

  2. Contribution to high voltage matrix switches reliability

    International Nuclear Information System (INIS)

    Lausenaz, Yvan

    2000-01-01

    Nowadays, power electronic equipment requirements are important, concerning performances, quality and reliability. On the other hand, costs have to be reduced in order to satisfy the market rules. To provide cheap, reliability and performances, many standard components with mass production are developed. But the construction of specific products must be considered following these two different points: in one band you can produce specific components, with delay, over-cost problems and eventuality quality and reliability problems, in the other and you can use standard components in a adapted topologies. The CEA of Pierrelatte has adopted this last technique of power electronic conception for the development of these high voltage pulsed power converters. The technique consists in using standard components and to associate them in series and in parallel. The matrix constitutes high voltage macro-switch where electrical parameters are distributed between the synchronized components. This study deals with the reliability of these structures. It brings up the high reliability aspect of MOSFETs matrix associations. Thanks to several homemade test facilities, we obtained lots of data concerning the components we use. The understanding of defects propagation mechanisms in matrix structures has allowed us to put forwards the necessity of robust drive system, adapted clamping voltage protection, and careful geometrical construction. All these reliability considerations in matrix associations have notably allowed the construction of a new matrix structure regrouping all solutions insuring reliability. Reliable and robust, this product has already reaches the industrial stage. (author) [fr

  3. The effect of the configuration of a single electrode corona discharge on its acoustic characteristics

    Science.gov (United States)

    Zhu, Xinlei; Zhang, Liancheng; Huang, Yifan; Wang, Jin; Liu, Zhen; Yan, Keping

    2017-07-01

    A new sparker system based on pulsed spark discharge with a single electrode has already been utilized for oceanic seismic exploration. However, the electro-acoustic energy efficiency of this system is lower than that of arc discharge based systems. A simple electrode structure was investigated in order to improve the electro-acoustic energy efficiency of the spark discharge. Experiments were carried out on an experimental setup with discharge in water driven by a pulsed power source. The voltage-current waveform, acoustic signal and bubble oscillation were recorded when the relative position of the electrode varied. The electro-acoustic energy efficiency was also calculated. The load voltage had a saltation for the invaginated electrode tip, namely an obvious voltage remnant. The more the electrode tip was invaginated, the larger the pressure peaks and first period became. The results show that electrode recessing into the insulating layer is a simple and effective way to improve the electro-acoustic energy efficiency from 2% to about 4%.

  4. Constant-frequency, clamped-mode resonant converters

    Science.gov (United States)

    Tsai, Fu-Sheng; Materu, Peter; Lee, Fred C.

    1987-01-01

    Two novel clamped-mode resonant converters are proposed which operate at a constant frequency while retaining many desired features of conventional series- and parallel-resonant converters. State-plane analysis techniques are used to identify all possible operating modes and define their mode boundaries. Control-to-output characteristics are derived that specify the regions for natural and forced commutation. The predicted operating modes are verified using a prototype circuit.

  5. The effect of illumination and electrode adjustment on the carrier behavior in special multilayer devices

    Science.gov (United States)

    Deng, Yanhong; Ou, Qingdong; Wang, Jinjiang; Zhang, Dengyu; Chen, Liezun; Li, Yanqing

    2017-08-01

    Intermediate connectors play an important role in semiconductor devices, especially in tandem devices. In this paper, four types of different intermediate connectors (e.g. Mg:Alq3/MoO3, MoO3, Mg:Alq3, and none) and two kinds of modified electrode materials (LiF and MoO3) integrated into the special multilayer devices are proposed, with the aim of studying the impact of light illumination and electrode adjustment on the carrier behavior of intermediate connectors through the current density-voltage characteristics, interfacial electronic structures, and capacitance-voltage characteristics. The results show that the illumination enhances the charge generation and separation in intermediate connectors, and further electrode interface modifications enhance the functionality of intermediate connectors. In addition, the device with an efficient intermediate connector structure shows a photoelectric effect, which paves the way for organic photovoltaic devices to realize optical-electrical integration transformation.

  6. Mathematical modeling and measurement of electric fields of electrode-based through-the-earth (TTE) communication

    Science.gov (United States)

    Yan, Lincan; Zhou, Chenming; Reyes, Miguel; Whisner, Bruce; Damiano, Nicholas

    2017-06-01

    There are two types of through-the-earth (TTE) wireless communication in the mining industry: magnetic loop TTE and electrode-based (or linear) TTE. While the magnetic loop systems send signal through magnetic fields, the transmitter of an electrode-based TTE system sends signal directly through the mine overburden by driving an extremely low frequency (ELF) or ultralow frequency (ULF) AC current into the earth. The receiver at the other end (underground or surface) detects the resultant current and receives it as a voltage. A wireless communication link between surface and underground is then established. For electrode-based TTE communications, the signal is transmitted through the established electric field and is received as a voltage detected at the receiver. It is important to understand the electric field distribution within the mine overburden for the purpose of designing and improving the performance of the electrode-based TTE systems. In this paper, a complete explicit solution for all three electric field components for the electrode-based TTE communication was developed. An experiment was conducted using a prototype electrode-based TTE system developed by National Institute for Occupational Safety and Health. The mathematical model was then compared and validated with test data. A reasonable agreement was found between them.

  7. Membrane voltage changes in passive dendritic trees: a tapering equivalent cylinder model.

    Science.gov (United States)

    Poznański, R R

    1988-01-01

    An exponentially tapering equivalent cylinder model is employed in order to approximate the loss of the dendritic trunk parameter observed from anatomical data on apical and basilar dendrites of CA1 and CA3 hippocampal pyramidal neurons. This model allows dendritic trees with a relative paucity of branching to be treated. In particular, terminal branches are not required to end at the same electrotonic distance. The Laplace transform method is used to obtain analytic expressions for the Green's function corresponding to an instantaneous pulse of current injected at a single point along a tapering equivalent cylinder with sealed ends. The time course of the voltage in response to an arbitrary input is computed using the Green's function in a convolution integral. Examples of current input considered are (1) an infinitesimally brief (Dirac delta function) pulse and (2) a step pulse. It is demonstrated that inputs located on a tapering equivalent cylinder are more effective at the soma than identically placed inputs on a nontapering equivalent cylinder. Asymptotic solutions are derived to enable the voltage response behaviour over both relatively short and long time periods to be analysed. Semilogarithmic plots of these solutions provide a basis for estimating the membrane time constant tau m from experimental transients. Transient voltage decrement from a clamped soma reveals that tapering tends to reduce the error associated with inadequate voltage clamping of the dendritic membrane. A formula is derived which shows that tapering tends to increase the estimate of the electrotonic length parameter L.

  8. Electrical impedance tomography in 3D using two electrode planes: characterization and evaluation.

    Science.gov (United States)

    Wagenaar, Justin; Adler, Andy

    2016-06-01

    Electrical impedance tomography (EIT) uses body surface electrical stimulation and measurements to create conductivity images; it shows promise as a non-invasive technology to monitor the distribution of lung ventilation. Most applications of EIT have placed electrodes in a 2D ring around the thorax, and thus produced 2D cross-sectional images. These images are unable to distinguish out-of-plane contributions, or to image volumetric effects. Volumetric EIT can be calculated using multiple electrode planes and a 3D reconstruction algorithm. However, while 3D reconstruction algorithms are available, little has been done to understand the performance of 3D EIT in terms of the measurement configurations available. The goal of this paper is to characterize the phantom and in vivo performance of 3D EIT with two electrode planes. First, phantom measurements are used to measure the reconstruction characteristics of seven stimulation and measurement configurations. Measurements were then performed on eight healthy volunteers as a function of body posture, postures, and with various electrode configurations. Phantom results indicate that 3D EIT using two rings of electrodes provides reasonable resolution in the electrode plane but low vertical resolution. For volunteers, functional EIT images are created from inhalation curve features to analyze the effect of posture (standing, sitting, supine and decline) on regional lung behaviour. An ability to detect vertical changes in lung volume distribution was shown for two electrode configurations. Based on tank and volunteer results, we recommend the use of the 'square' stimulation and measurement pattern for two electrode plane EIT.

  9. Two types of photomultiplier voltage dividers for high and changing count rates

    International Nuclear Information System (INIS)

    Reiter, W.L.; Stengl, G.

    1980-01-01

    We report on the design of two types of voltage distribution circuits for high stability photomultiplier operation. 'Type A' voltage divider is an ohmic voltage divider with high bleeder current (up to 10 mA) and the resistor chain split at one of the last dynodes, usually the dynode where the analog signal is derived from. This simple constructive measure improves the stability of the dynode voltage by a factor of 5 compared with an unsplit conventional resistor chain. 'Type B' is a novel active voltage divider using cold cathode tubes ar regulating elements. This voltage divider exhibits excellent temperature stability (about 10 -4 / 0 C). With 'type B' an equal stability compared with conventional ohmic dividers can be achieved at a bleeder current smaller by one order of magnitude. Of course both concepts, 'type A' and 'type B', can be combined. (orig.)

  10. Mechanism of formation of subnanosecond current front in high-voltage pulse open discharge

    Science.gov (United States)

    Schweigert, I. V.; Alexandrov, A. L.; Zakrevsky, Dm. E.; Bokhan, P. A.

    2014-11-01

    The mechanism of subnanosecond current front rise observed previously in the experiment in high-voltage pulse open discharge in helium is studied in kinetic particle-in-cell simulations. The Boltzmann equations for electrons, ions, and fast atoms are solved self-consistently with the Poisson equations for the electrical potential. The partial contributions to the secondary electron emission from the ions, fast atoms, photons, and electrons, bombarding the electrode, are calculated. In simulations, as in the experiment, the discharge glows between two symmetrical cathodes and the anode grid in the midplane at P =6 Torr and the applied voltage of 20 kV. The electron avalanche development is considered for two experimental situations during the last stage of breakdown: (i) with constant voltage and (ii) with decreasing voltage. For case (i), the subnanosecond current front rise is set by photons from the collisional excitation transfer reactions. For the case (ii), the energetic electrons swamp the cathode during voltage drop and provide the secondary electron emission for the subnanosecond current rise, observed in the experiment.

  11. Nonlinear dynamics of capacitive charging and desalination by porous electrodes

    Science.gov (United States)

    Biesheuvel, P. M.; Bazant, M. Z.

    2010-03-01

    The rapid and efficient exchange of ions between porous electrodes and aqueous solutions is important in many applications, such as electrical energy storage by supercapacitors, water desalination and purification by capacitive deionization, and capacitive extraction of renewable energy from a salinity difference. Here, we present a unified mean-field theory for capacitive charging and desalination by ideally polarizable porous electrodes (without Faradaic reactions or specific adsorption of ions) valid in the limit of thin double layers (compared to typical pore dimensions). We illustrate the theory for the case of a dilute, symmetric, binary electrolyte using the Gouy-Chapman-Stern (GCS) model of the double layer, for which simple formulae are available for salt adsorption and capacitive charging of the diffuse part of the double layer. We solve the full GCS mean-field theory numerically for realistic parameters in capacitive deionization, and we derive reduced models for two limiting regimes with different time scales: (i) in the “supercapacitor regime” of small voltages and/or early times, the porous electrode acts like a transmission line, governed by a linear diffusion equation for the electrostatic potential, scaled to the RC time of a single pore, and (ii) in the “desalination regime” of large voltages and long times, the porous electrode slowly absorbs counterions, governed by coupled, nonlinear diffusion equations for the pore-averaged potential and salt concentration.

  12. Application of Simplified Neutral Point Clamped Multilevel Converter in a Small Wind Turbine

    Directory of Open Access Journals (Sweden)

    Mlodzikowski Pawel

    2014-05-01

    Full Text Available In low power distributed generation systems low cost together with the energy quality requirements are a key element. It is known that quality of voltage waveforms generated from multilevel converters is better in comparison with those from two-level. Due to advancements in power electronics and microcontrollers, multilevel converters are being built with the use of integrated power modules thus this type of converters are getting more compact in size. This paper investigates performance of a derivation from the most popular multilevel topology - a neutral point clamped converter (NPC. Applying the idea for simplifying the topology by reducing the number of switches (what came from drives this NPC converter is capable of bidirectional AC/DC/AC operation. For the AC/DC part two schemes are tested: Direct Torque Control Space Vector Modulated and Field Oriented Control but for the DC/AC part a control scheme utilizing the proportional-resonant controller was chosen. Laboratory setup was based on a permanent magnet synchronous generator with control and acquisition completed with the help of dSpace 1005 control box. Experimental verification shows that system operates properly.

  13. Exploiting the spontaneous potential of the electrodes used in the capacitive mixing technique for the extraction of energy from salinity difference

    NARCIS (Netherlands)

    Brogioli, D.; Ziano, R.; Rica, R.A.; Salerno, D.; Kozynchenko, O.; Hamelers, H.V.M.; Mantegazza, F.

    2012-01-01

    The "capacitive mixing" (CAPMIX) technique is aimed at the extraction of energy from the salinity difference between the sea and rivers. It is based on the voltage rise that takes place at the electrodes when changing the salt concentration of the solution in which the two electrodes are dipped. In

  14. Parameterized Analysis of Zero Voltage Switching in Resonant Converters for Optimal Electrode Layout of Piezoelectric Transformers

    DEFF Research Database (Denmark)

    Meyer, Kaspar Sinding; Andersen, Michael Andreas E.; Jensen, Flemming

    2008-01-01

    Ring shaped PTs (Piezoelectric Transformers) are an attractive alternative to magnetics in power converters. The achievable energy efficiency is 98% and the power density is up to 30W/cm3. Additionally power supplies based on PTs display low levels of conducted and radiated EMI due to power...... conversion based on the piezoelectric effect. Rooted in the physics of this effect, both the in- and output terminal of a PT has a noticeable parasitic capacitance. In a common half-bridge power stage without any supporting magnetic components, the input parasitic capacitance can lead to hard switching...... losses that are in the range of the actual power rating of a specific PT. In this paper it is demonstrated how the electrode layout of a PT can be designed to enable ZVS (Zero Voltage Switching). This optimization is made simple with a novel set of accurate and simple symbolic equations which relates ZVS...

  15. Sealed two-electrode photoelectrochemical cell based on nanocrystalline TiO2 analyzed as a UV sensor

    International Nuclear Information System (INIS)

    Forcade, Fresnel; Gonzalez, Bernardo; Maqueda, Ma. de la Luz; Curbelo, Larisa; Vigil, Elena; Jennings, James R.; Dunn, Halina; Wang, Hongxia; PeteR, Lauri M.

    2008-01-01

    Potentialities as UV sensor of a sealed two-electrode photoelectrochemical cell (PEC) based on nanocrystalline TiO 2 are analyzed. Ultraviolet component of solar light is responsible for a number of skin disorders and diseases. An inexpensive and simple UV sensor would be convenient to measure the UV intensity been exposed to. Nanocrystalline TiO 2 is a rather inexpensive material, innocuous and very stable which is intensively studied at the present moment because of its possible applications in dye-sensitized solar cells, photocatalysis, electrochromics, etc. The method for obtaining the sensor and its structure are described. Different TiO 2 layer structures for the photoelectrode are studied. Important parameters, such as, spectral response, external quantum efficiency, current vs light intensity and current-voltage curve are presented. Results show prospective for the implementation of this type of sensor. (Full text)

  16. Development of a prototype solid state fault current limiting and interrupting device for low voltage distribution networks.

    OpenAIRE

    Ahmed, M.; Putrus, G. A.; Ran, L.; Penlington, R.

    2006-01-01

    This paper describes the development of a solid-state Fault Current Limiting and Interrupting Device (FCLID) suitable for low voltage distribution networks. The main components of the FCLID are a bidirectional semiconductor switch that can disrupt the short-circuit current, and a voltage clamping element that helps in controlling the current and absorbing the inductive energy stored in the network during current interruption. Using a hysteresis type control algorithm, the short-circuit curren...

  17. Solution Processable Electrochemiluminescent Ion Gels for Flexible, Low Voltage, Emissive Displays on Plastic

    Science.gov (United States)

    Moon, Hong Chul; Lodge, Timothy P.; Frisbie, C. Daniel

    2014-03-01

    We have expanded the functionality of ion gels and successfully demonstrated low voltage, flexible electrochemiluminescent (ECL) devices using patterned ECL gels. An ECL device composed of only an emissive gel and two electrodes was fabricated on an ITO-coated substrate by solution casting the ECL gel and brush-painting the top silver electrode. The device turned on at an AC voltage as low as 2.6 V (-1.3 V ~ +1.3 V) and showed a relatively rapid response (sub-ms). Also, we varied the mechanical properties of the ECL gel simply by substituting polystyrene-block-poly(methyl methacrylate)-block-polystyrene (SMS) with commercially available poly(vinylidene fluoride-co-hexafluoropropylene) (P(VDF-co-HFP)), enabling the fabrication of flexible ECL devices on any target substrate by the ``cut-and-stick'' strategy. This simple, rubbery ECL gel should be attractive for flexible electronics applications such as displays on packaging.

  18. On the Distribution of Lightning Current among Interconnected Grounding Systems in Medium Voltage Grids

    Directory of Open Access Journals (Sweden)

    Guido Ala

    2018-03-01

    Full Text Available This paper presents the results of a first investigation on the effects of lightning stroke on medium voltage installations’ grounding systems, interconnected with the metal shields of the Medium Voltage (MV distribution grid cables or with bare buried copper ropes. The study enables us to evaluate the distribution of the lightning current among interconnected ground electrodes in order to estimate if the interconnection, usually created to reduce ground potential rise during a single-line-to-ground fault, can give place to dangerous situations far from the installation hit by the lightning stroke. Four different case studies of direct lightning stroke are presented and discussed: (1 two secondary substations interconnected by the cables’ shields; (2 two secondary substations interconnected by a bare buried conductor; (3 a high voltage/medium voltage station connected with a secondary substation by the medium voltage cables’ shields; (4 a high voltage/medium voltage station connected with a secondary substation by a bare buried conductor. The results of the simulations show that a higher peak-lowering action on the lighting-stroke current occurs due to the use of bare conductors as interconnection elements in comparison to the cables’ shields.

  19. Core clamping device for a nuclear reactor

    International Nuclear Information System (INIS)

    Guenther, R.W.

    1974-01-01

    The core clamping device for a fast neutron reactor includes clamps to support the fuel zone against the pressure vessel. The clamps are arranged around the circumference of the core. They consist of torsion bars arranged parallel at some distance around the core with lever arms attached to the ends whose force is directed in the opposite direction, pressing against the wall of the pressure vessel. The lever arms and pressure plates also actuated by the ends of the torsion bars transfer the stress, the pressure plates acting upon the fuel elements or fuel assemblies. Coupling between the ends of the torsion bars and the pressure plates is achieved by end carrier plates directly attached to the torsion bars and radially movable. This clamping device follows the thermal expansions of the core, allows specific elements to be disengaged in sections and saves space between the core and the neutron reflectors. (DG) [de

  20. Operation of a Segmented Hall Thruster with Low-sputtering Carbon-velvet Electrodes

    International Nuclear Information System (INIS)

    Raitses, Y.; Staack, D.; Dunaevsky, A.; Fisch, N.J.

    2005-01-01

    Carbon fiber velvet material provides exceptional sputtering resistance properties exceeding those for graphite and carbon composite materials. A 2 kW Hall thruster with segmented electrodes made of this material was operated in the discharge voltage range of 200-700 V. The arcing between the floating velvet electrodes and the plasma was visually observed, especially, during the initial conditioning time, which lasted for about 1 h. The comparison of voltage versus current and plume characteristics of the Hall thruster with and without segmented electrodes indicates that the magnetic insulation of the segmented thruster improves with the discharge voltage at a fixed magnetic field. The observations reported here also extend the regimes wherein the segmented Hall thruster can have a narrower plume than that of the conventional nonsegmented thruster

  1. High-voltage pulsed generator for dynamic fragmentation of rocks.

    Science.gov (United States)

    Kovalchuk, B M; Kharlov, A V; Vizir, V A; Kumpyak, V V; Zorin, V B; Kiselev, V N

    2010-10-01

    A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ∼50 ns, current amplitude of ∼6 kA with the 40 Ω active load, and ∼20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.

  2. High-voltage pulsed generator for dynamic fragmentation of rocks

    Science.gov (United States)

    Kovalchuk, B. M.; Kharlov, A. V.; Vizir, V. A.; Kumpyak, V. V.; Zorin, V. B.; Kiselev, V. N.

    2010-10-01

    A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ˜50 ns, current amplitude of ˜6 kA with the 40 Ω active load, and ˜20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.

  3. Multimodal Examination of Atrial Fibrillation Substrate: Correlation of Left Atrial Bipolar Voltage Using Multi-Electrode Fast Automated Mapping, Point-by-Point Mapping, and Magnetic Resonance Image Intensity Ratio.

    Science.gov (United States)

    Zghaib, Tarek; Keramati, Ali; Chrispin, Jonathan; Huang, Dong; Balouch, Muhammad A; Ciuffo, Luisa; Berger, Ronald D; Marine, Joseph E; Ashikaga, Hiroshi; Calkins, Hugh; Nazarian, Saman; Spragg, David D

    2018-01-01

    Bipolar voltage mapping, as part of atrial fibrillation (AF) ablation, is traditionally performed in a point-by-point (PBP) approach using single-tip ablation catheters. Alternative techniques for fibrosis-delineation include fast-anatomical mapping (FAM) with multi-electrode circular catheters, and late gadolinium-enhanced magnetic-resonance imaging (LGE-MRI). The correlation between PBP, FAM, and LGE-MRI fibrosis assessment is unknown. In this study, we examined AF substrate using different modalities (PBP, FAM, and LGE-MRI mapping) in patients presenting for an AF ablation. LGE-MRI was performed pre-ablation in 26 patients (73% males, age 63±8years). Local image-intensity ratio (IIR) was used to normalize myocardial intensities. PBP- and FAM-voltage maps were acquired, in sinus rhythm, prior to ablation and co-registered to LGE-MRI. Mean bipolar voltage for all 19,087 FAM voltage points was 0.88±1.27mV and average IIR was 1.08±0.18. In an adjusted mixed-effects model, each unit increase in local IIR was associated with 57% decrease in bipolar voltage (p0.74 corresponded to bipolar voltage voltage was significantly associated with log-PBP bipolar voltage (ß=0.36, pvoltages, FAM-mapping distribution was shifted to the left compared to PBP-mapping; at intermediate voltages, FAM and PBP voltages were overlapping; and at high voltages, FAM exceeded PBP-voltages. LGE-MRI, FAM and PBP-mapping show good correlation in delineating electro-anatomical AF substrate. Each approach has fundamental technical characteristics, the awareness of which allows proper assessment of atrial fibrosis.

  4. A 3D-Space Vector Modulation Algorithm for Three Phase Four Wire Neutral Point Clamped Inverter Systems as Power Quality Compensator

    Directory of Open Access Journals (Sweden)

    Palanisamy Ramasamy

    2017-11-01

    Full Text Available A Unified Power Quality Conditioner (UPQC is designed using a Neutral Point Clamped (NPC multilevel inverter to improve the power quality. When designed for high/medium voltage and power applications, the voltage stress across the switches and harmonic content in the output voltage are increased. A 3-phase 4-wire NPC inverter system is developed as Power Quality Conditioner using an effectual three dimensional Space Vector Modulation (3D-SVM technique. The proposed system behaves like a UPQC with shunt and series active filter under balanced and unbalanced loading conditions. In addition to the improvement of the power quality issues, it also balances the neutral point voltage and voltage balancing across the capacitors under unbalanced condition. The hardware and simulation results of proposed system are compared with 2D-SVM and 3D-SVM. The proposed system is stimulated using MATLAB and the hardware is designed using FPGA. From the results it is evident that effectual 3D-SVM technique gives better performance compared to other control methods.

  5. Lotus birth, a holistic approach on physiological cord clamping.

    Science.gov (United States)

    Zinsser, Laura A

    2018-04-01

    The positive effects of delayed cord clamping (DCC) has been extensively researched. DCC means: waiting at least one minute after birth before clamping and cutting the cord or till the pulsation has stopped. With physiological clamping and cutting (PCC) the clamping and cutting can happen at the earliest after the pulsation has stopped. With a Lotus birth, no clamping and cutting of the cord is done. A woman called Clair Lotus Day imitated the holistic approach of PCC from an anthropoid ape in 1974. The chimpanzee did not separate the placenta from the newborn. The aim of this case report is to discuss and learn a different approach in the third stage of labour. Three cases of Lotus birth by human beings were observed. All three women gave birth in an out-of-hospital setting and had ambulant postnatal care. The placenta was washed, salted and herbs were put on 2-3h post partum. The placenta was wrapped in something that absorbs the moisture. The salting was repeated with a degreasing frequency depending on moistness of the placenta. On life day six all three Lotus babies experiences a natural separation of the cord. All three Lotus birth cases were unproblematic, no special incidence occurred. One should differentiate between early cord clamping (ECC), delayed cord clamping (DCC) and physiological cord clamping (PCC). Lotus birth might lead to an optimisation of the bonding and attachment. Research is needed in the areas of both PCC and Lotus birth. Copyright © 2017 Australian College of Midwives. Published by Elsevier Ltd. All rights reserved.

  6. Improved open-circuit voltage in Cu(In,Ga)Se2 solar cells with high work function transparent electrodes

    International Nuclear Information System (INIS)

    Jäger, Timo; Romanyuk, Yaroslav E.; Bissig, Benjamin; Pianezzi, Fabian; Nishiwaki, Shiro; Reinhard, Patrick; Steinhauser, Jérôme; Tiwari, Ayodhya N.; Schwenk, Johannes

    2015-01-01

    Hydrogenated indium oxide (IOH) is implemented as transparent front contact in Cu(In,Ga)Se 2 (CIGS) solar cells, leading to an open circuit voltage V OC enhanced by ∼20 mV as compared to reference devices with ZnO:Al (AZO) electrodes. This effect is reproducible in a wide range of contact sheet resistances corresponding to various IOH thicknesses. We present the detailed electrical characterization of glass/Mo/CIGS/CdS/intrinsic ZnO (i-ZnO)/transparent conductive oxide (TCO) with different IOH/AZO ratios in the front TCO contact in order to identify possible reasons for the enhanced V OC . Temperature and illumination intensity-dependent current-voltage measurements indicate that the dominant recombination path does not change when AZO is replaced by IOH, and it is mainly limited to recombination in the space charge region and at the junction interface of the solar cell. The main finding is that the introduction of even a 5 nm-thin IOH layer at the i-ZnO/TCO interface already results in a step-like increase in V OC . Two possible explanations are proposed and verified by one-dimensional simulations using the SCAPS software. First, a higher work function of IOH as compared to AZO is simulated to yield an V OC increase by 21 mV. Second, a lower defect density in the i-ZnO layer as a result of the reduced sputter damage during milder sputter-deposition of IOH can also add to a maximum enhanced V OC of 25 mV. Our results demonstrate that the proper choice of the front TCO contact can reduce the parasitic recombination and boost the efficiency of CIGS cells with improved corrosion stability

  7. Relaxation-Induced Memory Effect of LiFePO4 Electrodes in Li-Ion Batteries.

    Science.gov (United States)

    Jia, Jianfeng; Tan, Chuhao; Liu, Mengchuang; Li, De; Chen, Yong

    2017-07-26

    In Li-ion batteries, memory effect has been found in several commercial two-phase materials as a voltage bump and a step in the (dis)charging plateau, which delays the two-phase transition and influences the estimation of the state of charge. Although memory effect has been first discovered in olivine LiFePO 4 , the origination and dependence are still not clear and are critical for regulating the memory effect of LiFePO 4 . Herein, LiFePO 4 has been synthesized by a home-built spray drying instrument, of which the memory effect has been investigated in Li-ion batteries. For as-synthesized LiFePO 4 , the memory effect is significantly dependent on the relaxation time after phase transition. Besides, the voltage bump of memory effect is actually a delayed voltage overshooting that is overlaid at the edge of stepped (dis)charging plateau. Furthermore, we studied the kinetics of LiFePO 4 electrode with electrochemical impedance spectroscopy (EIS), which shows that the memory effect is related to the electrochemical kinetics. Thereby, the underlying mechanism has been revealed in memory effect, which would guide us to optimize two-phase electrode materials and improve Li-ion battery management systems.

  8. High plasma rotation velocity and density transitions by biased electrodes in RF produced, magnetized plasma

    International Nuclear Information System (INIS)

    Matsuyama, Shoichiro; Shinohara, Shunjiro

    2001-01-01

    A large density profile modification was successfully obtained by voltage biasing to electrodes inserted in a RF (radio frequency) produced, magnetized plasma, and formation of strong shear of azimuthal plasma rotation velocity in a supersonic regime was found. For the case of biasing to an electrode near the central plasma region, two types of density transitions were observed in the outer plasma region: one was an oscillatory transition between two states, and the other was a transition from high to low density states with a large reduction of density fluctuations. (author)

  9. High plasma rotation velocity and density transitions by biased electrodes in RF produced, magnetized plasma

    Energy Technology Data Exchange (ETDEWEB)

    Matsuyama, Shoichiro; Shinohara, Shunjiro [Kyushu Univ., Interdisciplinary Graduate School of Engineering Sciences, Fukuoka (Japan)

    2001-07-01

    A large density profile modification was successfully obtained by voltage biasing to electrodes inserted in a RF (radio frequency) produced, magnetized plasma, and formation of strong shear of azimuthal plasma rotation velocity in a supersonic regime was found. For the case of biasing to an electrode near the central plasma region, two types of density transitions were observed in the outer plasma region: one was an oscillatory transition between two states, and the other was a transition from high to low density states with a large reduction of density fluctuations. (author)

  10. The influence of electrode angle on the minimization of the aberration coefficients of the two electrodes electrostatic immersion lens

    International Nuclear Information System (INIS)

    Al-Khashab, M. A.; Ahmad, A. A.

    2012-01-01

    This paper deals with electron optical properties of a set asymmetrical electrostatic immersion lenses with two electrodes which have been designed using different angles (θ) of the outer lens electrodes as well as air gaps (S) between the electrodes of each lens. It was found that the angle of the outer electrode and the air gap have a clear effect on the electron optical performance of such lenses. In addition to that, it was noticed that the better electron optical properties occurred when the angle of the outer electrode equals (θ = O d egree) and the air gap equals (S = 11 mm). the results of the perferable design of the prsent work were compared with those in published papers in terms of the optical properties. It was found that results are in good agreement with each other. (authors).

  11. π-Clamp-mediated cysteine conjugation

    Science.gov (United States)

    Zhang, Chi; Welborn, Matthew; Zhu, Tianyu; Yang, Nicole J.; Santos, Michael S.; van Voorhis, Troy; Pentelute, Bradley L.

    2016-02-01

    Site-selective functionalization of complex molecules is one of the most significant challenges in chemistry. Typically, protecting groups or catalysts must be used to enable the selective modification of one site among many that are similarly reactive, and general strategies that selectively tune the local chemical environment around a target site are rare. Here, we show a four-amino-acid sequence (Phe-Cys-Pro-Phe), which we call the ‘π-clamp’, that tunes the reactivity of its cysteine thiol for site-selective conjugation with perfluoroaromatic reagents. We use the π-clamp to selectively modify one cysteine site in proteins containing multiple endogenous cysteine residues. These examples include antibodies and cysteine-based enzymes that would be difficult to modify selectively using standard cysteine-based methods. Antibodies modified using the π-clamp retained binding affinity to their targets, enabling the synthesis of site-specific antibody-drug conjugates for selective killing of HER2-positive breast cancer cells. The π-clamp is an unexpected approach to mediate site-selective chemistry and provides new avenues to modify biomolecules for research and therapeutics.

  12. Functional studies of sodium pump isoforms

    DEFF Research Database (Denmark)

    Clausen, Michael Jakob

    The Na+,K+-ATPase is an essential ion pump found in all animal cells. It uses the energy from ATP hydrolysis to export three Na+ and import two K+, both against their chemical gradients and for Na+ also against the electrical potential. Mammals require four Na+,K+-ATPase isoforms that each have...... unique expression profiles and specialized functional features. We use a Two Electrode Voltage Clamp setup to determine pre-steady-state and steady-state characteristics of each isoform and design chimeras to pin-point the structural elements responsible for observed differences. With this strategy we...

  13. A voltage regulator system with dynamic bandwidth boosting for passive UHF RFID transponders

    International Nuclear Information System (INIS)

    Shen Jinpeng; Wang Xin'an; Liu Shan; Li Shoucheng; Ruan Zhengkun

    2013-01-01

    This paper presents a voltage regulator system for passive UHF RFID transponders, which contains a rectifier, a limiter, and a regulator. The rectifier achieves power by rectifying the incoming RF energy. Due to the huge variation of the rectified voltage, a limiter at the rectifier output is used to clamp the rectified voltage. In this paper, the design of a limiter circuit is discussed in detail, which can provide a stable limiting voltage with low sensitivity to temperature variation and process dispersion. The key aspect of the voltage regulator system is the dynamic bandwidth boosting in the regulator. By sensing the excess current that is bypassed in the limiter during periods of excess energy, the bias current as well as the bandwidth of the regulator are increased, the output supply voltage can recover quickly from line transients during the periods of no RF energy to a full blast of RF energy. This voltage regulator system is implemented in a 0.18 μm CMOS process. (semiconductor integrated circuits)

  14. Axially Modulated Clamped-Guided Arch Resonator for Memory and Logic Applications

    KAUST Repository

    Hafiz, Md Abdullah Al; Tella, Sherif Adekunle; Alcheikh, Nouha; Fariborzi, Hossein; Younis, Mohammad I.

    2017-01-01

    We experimentally demonstrate memory and logic devices based on an axially modulated clamped-guided arch resonator. The device are electrostatically actuated and capacitively sensed, while the resonance frequency modulation is achieved through an axial electrostatic force from the guided side of the clamped-guided arch microbeam. We present two case studies: first, a dynamic memory based on the nonlinear frequency response of the resonator, and second, a reprogrammable two-input logic gate based on the linear frequency modulation of the resonator. These devices show energy cost per memory/logic operation in pJ, are fully compatible with CMOS fabrication processes, have the potential for on-chip system integration, and operate at room temperature.

  15. Axially Modulated Clamped-Guided Arch Resonator for Memory and Logic Applications

    KAUST Repository

    Hafiz, Md Abdullah Al

    2017-11-03

    We experimentally demonstrate memory and logic devices based on an axially modulated clamped-guided arch resonator. The device are electrostatically actuated and capacitively sensed, while the resonance frequency modulation is achieved through an axial electrostatic force from the guided side of the clamped-guided arch microbeam. We present two case studies: first, a dynamic memory based on the nonlinear frequency response of the resonator, and second, a reprogrammable two-input logic gate based on the linear frequency modulation of the resonator. These devices show energy cost per memory/logic operation in pJ, are fully compatible with CMOS fabrication processes, have the potential for on-chip system integration, and operate at room temperature.

  16. Mechanical nonlinearity elimination with a micromechanical clamped-free semicircular beams resonator

    Science.gov (United States)

    Chen, Dongyang; Chen, Xuying; Wang, Yong; Liu, Xinxin; Guan, Yangyang; Xie, Jin

    2018-04-01

    This paper reports a micro-machined clamped-free semicircular beam resonator aiming to eliminate the nonlinearity that widely exists in traditional mechanical resonators. Cubic coefficients over vibration displacement due to axial extension of the beams are analyzed through theoretical modelling, and the corresponding frequency effect is demonstrated. With the device working in the elastic vibration mode, the cubic coefficients are eliminated by using a free end to release the nonlinear extension of beams and thus the inside axial stress. The amplitude-frequency (A-f) effect is overcome in a large region of source power, and the coefficient of frequency softening is linearized in a large region of polarization voltage. As a result, the resonator can be driven at larger vibration amplitude to achieve a high signal to noise ratio and power handling performance.

  17. From understanding cellular function to novel drug discovery: the role of planar patch-clamp array chip technology

    Directory of Open Access Journals (Sweden)

    Christophe ePy

    2011-10-01

    Full Text Available All excitable cell functions rely upon ion channels that are embedded in their plasma membrane. Perturbations of ion channel structure or function result in pathologies ranging from cardiac dysfunction to neurodegenerative disorders. Consequently, to understand the functions of excitable cells and to remedy their pathophysiology, it is important to understand the ion channel functions under various experimental conditions – including exposure to novel drug targets. Glass pipette patch-clamp is the state of the art technique to monitor the intrinsic and synaptic properties of neurons. However, this technique is labor-intensive and has low data throughput. Planar patch-clamp chips, integrated into automated systems, offer high throughputs but are limited to isolated cells from suspensions, resulting in questionable models of true physiological function, and are unsuitable for studies involving neuronal communication. Multi-electrode arrays (MEA, in contrast, have the ability to monitor network activity by measuring local field potentials from multiple extracellular sites, but specific ion channel activity is challenging to extract from these multiplexed signals. Here we describe a novel planar patch-clamp chip technology that enables the simultaneous high resolution electrophysiological interrogation of individual neurons at multiple sites in synaptically connected neuronal networks, thereby combining the advantages of MEA and patch-clamp techniques. Each neuron can be probed through an aperture that connects to a dedicated subterranean microfluidic channel. Neurons growing in networks are aligned to the apertures by physisorbed or chemisorbed chemical cues. In this review, we describe the design and fabrication process of these chips, the approach to the chemical patterning for cell placement, and present physiological data from cultured neuronal cells.

  18. An isolated Hda-clamp complex is functional in the regulatory inactivation of DnaA and DNA replication.

    Science.gov (United States)

    Kawakami, Hironori; Su'etsugu, Masayuki; Katayama, Tsutomu

    2006-10-01

    In Escherichia coli, a complex consisting of Hda and the DNA-loaded clamp-subunit of the DNA polymerase III holoenzyme promotes hydrolysis of DnaA-ATP. The resultant ADP-DnaA is inactive for initiation of chromosomal DNA replication, thereby repressing excessive initiations. As the cellular content of the clamp is 10-100 times higher than that of Hda, most Hda molecules might be complexed with the clamp in vivo. Although Hda predominantly forms irregular aggregates when overexpressed, in the present study we found that co-overexpression of the clamp with Hda enhances Hda solubility dramatically and we efficiently isolated the Hda-clamp complex. A single molecule of the complex appears to consist of two Hda molecules and a single clamp. The complex is competent in DnaA-ATP hydrolysis and DNA replication in the presence of DNA and the clamp deficient subassembly of the DNA polymerase III holoenzyme (pol III*). These findings indicate that the clamp contained in the complex is loaded onto DNA through an interaction with the pol III* and that the Hda activity is preserved in these processes. The complex consisting of Hda and the DNA-unloaded clamp may play a specific role in a process proceeding to the DnaA-ATP hydrolysis in vivo.

  19. Nanothorn electrodes for ionic polymer-metal composite artificial muscles.

    Science.gov (United States)

    Palmre, Viljar; Pugal, David; Kim, Kwang J; Leang, Kam K; Asaka, Kinji; Aabloo, Alvo

    2014-08-22

    Ionic polymer-metal composites (IPMCs) have recently received tremendous interest as soft biomimetic actuators and sensors in various bioengineering and human affinity applications, such as artificial muscles and actuators, aquatic propulsors, robotic end-effectors, and active catheters. Main challenges in developing biomimetic actuators are the attainment of high strain and actuation force at low operating voltage. Here we first report a nanostructured electrode surface design for IPMC comprising platinum nanothorn assemblies with multiple sharp tips. The newly developed actuator with the nanostructured electrodes shows a new way to achieve highly enhanced electromechanical performance over existing flat-surfaced electrodes. We demonstrate that the formation and growth of the nanothorn assemblies at the electrode interface lead to a dramatic improvement (3- to 5-fold increase) in both actuation range and blocking force at low driving voltage (1-3 V). These advances are related to the highly capacitive properties of nanothorn assemblies, increasing significantly the charge transport during the actuation process.

  20. Design of Neutral-Point Voltage Controller of a Three-level NPC Inverter with Small DC-Link Capacitors

    DEFF Research Database (Denmark)

    Maheshwari, Ram Krishan; Munk-Nielsen, Stig; Busquets-Monge, S.

    2013-01-01

    A Neutral-Point-Clamped (NPC) three-level inverter with small dc-link capacitors is presented in this paper. The inverter requires zero average neutral-point current for stable neutral-point voltage. The small dc-link capacitors may not maintain capacitor voltage balance, even with zero neutral......-point voltage control on the basis of the continuous model. The design method for optimum performance is discussed. The implementation of the proposed modulation strategy and the controller is very simple. The controller is implemented in a 7.5 kW induction machine based drive with only 14 ìF dc-link capacitors...

  1. Design of A Grid Integrated PV System with MPPT Control and Voltage Oriented Controller using MATLAB/PLECES

    Science.gov (United States)

    Soreng, Bineeta; Behera, Pradyumna; Pradhan, Raseswari

    2017-08-01

    This paper presents model of a grid-integrated photovoltaic array with Maximum Power Point Tracker (MPPT) and voltage oriented controller. The MPPT of the PV array is usually an essential part of PV system as MPPT helps the operating point of the solar array to align its maximum power point. In this model, the MPPT along with a DC-DC converter lets a PV generator to produce continuous power, despite of the measurement conditions. The neutral-point-clamped converter (NPC) with a boost converter raises the voltage from the panels to the DC-link. An LCL-filter smoothens the current ripple caused by the PWM modulation of the grid-side inverter. In addition to the MPPT, the system has two more two controllers, such as voltage controller and a current controller. The voltage control has a PI controller to regulate the PV voltage to optimal level by controlling the amount of current injected into the boost stage. Here, the grid-side converter transfers the power from the DC-link into the grid and maintains the DC-link voltage. Three-phase PV inverters are used for off-grid or designed to create utility frequency AC. The PV system can be connected in series or parallel to get the desired output power. To justify the working of this model, the grid-integrated PV system has been designed in MATLAB/PLECS. The simulation shows the P-V curve of implemented PV Array consisting 4 X 20 modules, reactive, real power, grid voltage and current.

  2. Multi-stage LLC resonant converters designed for wide output voltage ranges

    OpenAIRE

    Tsang, C.-W.; Bingham, C. M.; Foster, M. P.; Stone, D. A.; Leech, J. M.

    2016-01-01

    The paper describes a novel multi-stage LLC resonant converter topology for facilitating wide output voltage ranges. This is achieved by combining the gain range of a capacitor-diode clamped LLC resonant converter with that of a traditional LLC resonant converter. A prototype converter is designed and commissioned to illustrate the design procedure and demonstrate resulting operational characteristics. Experimental results are used to show operational characteristics of the proposed conver...

  3. High stored-energy breakdown tests on electrodes made of stainless steel, copper, titanium and molybdenum

    Energy Technology Data Exchange (ETDEWEB)

    Esch, H. P. L. de, E-mail: hubert.de-esch@cea.fr; Simonin, A.; Grand, C. [CEA-Cadarache, IRFM, F-13108 St. Paul-lez-Durance (France)

    2015-04-08

    IRFM have conducted resilience tests on electrodes made of Cu, stainless steel 304L, Ti and Mo against breakdowns up to 170 kV and 300 J. The tests of the 10×10 cm{sup 2} electrodes have been performed at an electrode distance d=11 mm under vacuum (P∼5×10{sup −6} mbar). No great difference in voltage holding between the materials could be identified; all materials could reach a voltage holding between 140 and 170 kV over the 11 mm gap, i.e. results scatter within a ±10% band. After exposure to ∼10000 seconds of high-voltage (HV) on-time, having accumulated ∼1000 breakdowns, the electrodes were inspected. The anodes were covered with large and small craters. The rugosity of the anodes had increased substantially, that of the cathodes to a lesser extent. The molybdenum electrodes are least affected, but this does not show in their voltage holding capability. It is hypothesized that penetrating high-energy electrons from the breakdown project heat below the surface of the anode and cause a micro-explosion of material when melting point is exceeded. Polished electrodes have also been tested. The polishing results in a substantially reduced breakdown rate in the beginning, but after having suffered a relatively small number (∼100) of breakdowns, the polished electrodes behaved the same as the unpolished ones.

  4. Super agonist actions of clothianidin and related compounds on the SAD beta 2 nicotinic acetylcholine receptor expressed in Xenopus laevis oocytes.

    Science.gov (United States)

    Ihara, Makoto; Matsuda, Kazuhiko; Shimomura, Masaru; Sattelle, David B; Komai, Koichiro

    2004-03-01

    To compare the actions of clothianidin, a neonicotinoid acting on insect nicotinic acetylcholine receptors, and related compounds with that of imidacloprid, the compounds were tested on the Drosophila SAD-chicken beta2 nicotinic acetylcholine receptor expressed in Xenopus laevis oocytes using two-electrode voltage-clamp electrophysiology. The maximum response of the SAD beta 2 nicotinic receptor to clothianidin was larger than that observed for acetylcholine. Ring breakage of the imidazolidine ring of imidacloprid resulting in the generation of a guanidine group was critical for this super agonist action.

  5. ß-adrenergic regulation of ion transport in pancreatic ducts: Patch-clamp study of isolated rat pancreatic ducts

    DEFF Research Database (Denmark)

    Novak, I

    1998-01-01

    BACKGROUND & AIMS: In the intact pancreas, bicarbonate secretion is thought to be controlled by a number of regulators, including adrenergic agonists. The aim of this study was to investigate the effects of adrenergic agonists on pancreatic ducts, which are the site of bicarbonate secretion....... METHODS: Small intralobular ducts were isolated from rat pancreas and studied in vitro by the whole-cell patch clamp technique. Cell membrane voltages and currents were indicators of cellular ion transport. In some ducts, intracellular Ca2+ activity was measured by fluorescence optical methods. RESULTS...

  6. Operation and thermal loading of three-level Neutral-Point-Clamped wind power converter under various grid faults

    DEFF Research Database (Denmark)

    Ma, Ke; Blaabjerg, Frede; Liserre, Marco

    2012-01-01

    In order to fulfill the continuous growing grid-side demands, the full-scale power converters are becoming more and more popular in the wind power application. Nevertheless, the more severe loading of the power semiconductor devices in the full-scale power converters, especially during Low Voltage...... Ride Through (LVRT) operation under grid faults, may compromise the reliability of the system and consequently further increase its cost. In this paper, the impact of various grid faults on a three-level Neutral-Point-Clamped (3L-NPC) grid-converter in terms of thermal loading of power semiconductor...

  7. A LabVIEW based experiment system for the efficient collection and analysis of cyclic voltametry and electrode charge capacity measurements.

    Science.gov (United States)

    Detlefsen, D; Hu, Z; Troyk, P R

    2006-01-01

    Cyclic voltametry and recording of stimulation electrode voltage excursions are two critical methods of measurement for understanding the performance of implantable electrodes. Because implanted electrodes cannot easily be replaced, it is necessary to have an a-priori understanding of an electrode's implanted performance and capabilities. In-vitro exhaustive tests are often needed to quantify an electrodes performance. Using commonly available equipment, the human labor cost to conduct this work is immense. Presented is an automated experiment system that is highly configurable that can efficiently conduct a battery of repeatable CV and stimulation recording measurements. Results of preparing 96 electrodes prior to an animal implantation are also discussed.

  8. A new clamp method for firing bricks | Obeng | Journal of Applied ...

    African Journals Online (AJOL)

    A new clamp method for firing bricks. ... Journal of Applied Science and Technology ... To overcome this operational deficiencies, a new method of firing bricks that uses brick clamp technique that incorporates a clamp wall of 60 cm thickness, a six tier approach of sealing the top of the clamp (by combination of green bricks) ...

  9. Method to Minimize the Low-Frequency Neutral-Point Voltage Oscillations With Time-Offset Injection for Neutral-Point-Clamped Inverters

    DEFF Research Database (Denmark)

    Choi, Ui-Min; Blaabjerg, Frede; Lee, Kyo-Beum

    2015-01-01

    time of small- and medium-voltage vectors. However, if the power factor is lower, there is a limitation to eliminate neutral-point oscillations. In this case, the proposed method can be improved by changing the switching sequence properly. Additionally, a method for neutral-point voltage balancing......This paper proposes a method to reduce the low-frequency neutral-point voltage oscillations. The neutral-point voltage oscillations are considerably reduced by adding a time offset to the three-phase turn-on times. The proper time offset is simply calculated considering the phase currents and dwell...

  10. A Self-diagnostic Method for the Electrode Adhesion of an Electromagnetic Flow-meter

    Directory of Open Access Journals (Sweden)

    Wen-Hua Cui

    2014-07-01

    Full Text Available Electrodes of electromagnetic flow-meter are subject to contamination in sewage measurement. In this paper, the relationship between the internal resistance of the flow-induced voltage and the electrode contamination is analyzed on the basis of numerical analysis. A new self- diagnostic method for electrode adhesion with additional excitation based on photovoltaic cell is proposed, in which magnetic excitation for flow-rate measurement and electric excitation for electrode self-diagnosis is divided in both time domain and frequency domain. A dual-excited electromagnetic flow-meter with electrode self-diagnosis was designed and validated. Simulation experiments based on the change of the internal resistance of the flow-induced voltage were carried out. And the experimental results fully show that this new method is feasible and promising.

  11. Systems and methods for the magnetic insulation of accelerator electrodes in electrostatic accelerators

    Science.gov (United States)

    Grisham, Larry R

    2013-12-17

    The present invention provides systems and methods for the magnetic insulation of accelerator electrodes in electrostatic accelerators. Advantageously, the systems and methods of the present invention improve the practically obtainable performance of these electrostatic accelerators by addressing, among other things, voltage holding problems and conditioning issues. The problems and issues are addressed by flowing electric currents along these accelerator electrodes to produce magnetic fields that envelope the accelerator electrodes and their support structures, so as to prevent very low energy electrons from leaving the surfaces of the accelerator electrodes and subsequently picking up energy from the surrounding electric field. In various applications, this magnetic insulation must only produce modest gains in voltage holding capability to represent a significant achievement.

  12. The high-sensitive magnetic levitated electrode ionization chamber of the noncontacting type

    International Nuclear Information System (INIS)

    Kawaguchi, Toshiro; Yoshimura, Atsushi

    1999-01-01

    There are two types of ionization chamber using magnetically levitated electrode: one is that by Tanaka et al. and the other, by authors'. The latter lacks the sensitivity relative to the former and thereby to solve the problem, authors made an improvement so that the electrode charge could be readout by noncontact after the leviated electrode was electrified by noncontact for an interval. This new type ionization chamber made it possible to measure the quite low dose radiation with stability and high sensitivity. Actually, the electrode was suspended by the teflon thread fixed on the steel cup levitated magnetically in the ionization chamber of which wall was covered by Al and equipped with an electrostatic charger for the electrode by noncontact. After measurement, the electrode was moved in the Faraday cage placed under the chamber to readout the voltage. For operation conditions of the apparatus, observation was done on the relationship between ionization current by 137 Cs and the applied voltage. For actual measurement, ionizations by low dose γ ray derived from KCl which containing 40 K in a small amount and by Rn at the fine and rainy days were measured. The exposure rate by KCl (500 g bottle) was found to be 12.7 x 10 -10 C/kg·h with the background value of 9.8 x 10 -10 . Rn concentrations in the air were 112.3 and 18.34 Bq/m 3 for 1 hr in the rainy and fine day, respectively, in Fukuoka City. (K.H.)

  13. Small Molecules for Early Endosome-Specific Patch Clamping.

    Science.gov (United States)

    Chen, Cheng-Chang; Butz, Elisabeth S; Chao, Yu-Kai; Grishchuk, Yulia; Becker, Lars; Heller, Stefan; Slaugenhaupt, Susan A; Biel, Martin; Wahl-Schott, Christian; Grimm, Christian

    2017-07-20

    To resolve the subcellular distribution of endolysosomal ion channels, we have established a novel experimental approach to selectively patch clamp Rab5 positive early endosomes (EE) versus Rab7/LAMP1-positive late endosomes/lysosomes (LE/LY). To functionally characterize ion channels in endolysosomal membranes with the patch-clamp technique, it is important to develop techniques to selectively enlarge the respective organelles. We found here that two small molecules, wortmannin and latrunculin B, enlarge Rab5-positive EE when combined but not Rab7-, LAMP1-, or Rab11 (RE)-positive vesicles. The two compounds act rapidly, specifically, and are readily applicable in contrast to genetic approaches or previously used compounds such as vacuolin, which enlarges EE, RE, and LE/LY. We apply this approach here to measure currents mediated by TRPML channels, in particular TRPML3, which we found to be functionally active in both EE and LE/LY in overexpressing cells as well as in endogenously expressing CD11b+ lung-tissue macrophages. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Is "Delayed Umbilical Cord Clamping" Beneficial for Premature Newborns?

    Directory of Open Access Journals (Sweden)

    Amir-Mohammad Armanian

    2017-05-01

    Full Text Available Background: The appropriate moment for clamping the umbilical cord is controversial. Immediate cord clamping (ICC is an item of active management of the third stage of labor (AMTSL. Unclamped umbilical cord may cause inconvenience in preterm neonates because they commonly need some levels of emergent services. Some studies revealed delayed cord clamping (DCC of preterm neonates results in better health conditions like lower rates of respiratory distress syndrome (RDS, less morbidities in labor room and lower risk of postpartum hemorrhage. The aim of the present study was to determine the effect of delayed umbilical cord clamping on premature neonatal outcomes. Materials and Methods: In this single‑center randomized control trial study, sixty premature neonates (gestational age ≤ 34 weeks were randomly assigned to ICC (cord clamped at 5–10 seconds or DCC (30–45 seconds groups and followed up in neonatal intensive care unit (NICU. Primary outcomes were 1st and 5th minute Apgar score, average of level of hematocrit after birth, intra ventricle hemorrhage and need some levels of resuscitation. Results: Differences in demographic characteristics were not statistically significant. After birth, neonates who had delayed clamping had significantly higher mean hematocrit after at 4-hour of birth (49.58+5.15gr/dl vs. 46.58+5.40gr/dlin DCC vs. ICC groups, respectively (P=0.031. Delayed cord clamping reduced the duration of need to nasal continues positive airway pressure (NCPAP (86.7% and 60.0% in ICC and DCC groups, respectively, P= 0.039. Attractively, the results showed lower incidence of clinical sepsis in delayed cord clamping neonates (53.3% vs. 23.3% in ICC and DCC groups, respectively, P=0.033. Conclusion: Prematurity complications might decrease by delay umbilical cord clamping which improve the hematocrit, duration of need to NCPAP and incidence of clinical sepsis. Furthermore, DCC may have no negative impact on neonatal resuscitation.

  15. A method and an electrode for excitation of a plasma

    International Nuclear Information System (INIS)

    Glejboel, K.

    1998-01-01

    The method for excitation of a plasma comprises the step of subjecting a gas to an electric field generated by an electrode system. Each of 3 to 30 electrodes are connected to one of three specified AC voltages. The frequency is preferably between 50 and 60 Hz. The invention also concerns an electrode system for carrying out the method. 3 figs

  16. A missing factor in chip-based patch clamp assay: gigaseal

    International Nuclear Information System (INIS)

    Ong, W-L; Yobas, L; Ong, W-Y

    2006-01-01

    The 'gold' standard in the study of ionic currents across biological membranes is the Patch Clamp method. However, this is a slow, labor and skill intensive process. High throughput patch clamp devices are mainly chip-based. A major challenge in these miniaturized devices is the low rate of 'Gigaseal' formation which is critical in the study of Single Channel effect. In a conventional patch clamp, a pipette moves and patches a fixed cell (cell-adhered patch) which is grown on the bottom of a Petri dish. In the chip-based case, the cells are in suspension and move towards the fixed patch clamp sites (cell-suspended patch). In this study, using the proven conventional patch clamp setup, we investigated the effect of the differences in the cell configurations between the convention patch clamp and cell-based patch clamp. It is shown that adhered cells (as used in the conventional setup) have a much higher rate of gigaseal formation as compared to the cells in suspension (as used in chip-based devices). We postulate that the arrangement of the cytoskeleton within the cell plays a major part in the formation of the gigaseal

  17. Alternating voltage-induced electrochemical synthesis of colloidal Au nanoicosahedra

    Energy Technology Data Exchange (ETDEWEB)

    McCann, Kevin; Cloud, Jacqueline E.; Yang, Yongan, E-mail: yonyang@mines.edu [Colorado School of Mines, Department of Chemistry and Geochemistry (United States)

    2013-11-15

    A simple method of alternating voltage-induced electrochemical synthesis has been developed to synthesize highly dispersed colloidal Au nanoicosahedra of 14 ± 3 nm in size. This simple and effective method uses a common transformer to apply a zero-offset alternating voltage to a pair of identical Au electrodes that are immersed in an electrolyte solution containing ligands. The obtained Au nanoicosahedra in this work are among the smallest Au icosahedra synthesized in aqueous solutions. A series of experimental conditions have been studied, such as voltage, the electrolyte identity and concentration, stabilizer identity and concentration, and reaction temperature. The mechanistic study indicates that Au nanoicosahedra are produced on electrode surfaces through an intermediate state of AuO{sub x}. The kinetic rate constant of these Au icosahedra in catalyzing the reduction of 4-nitrophenol with sodium borohydride is found much larger than the literature values of similar Au nanocrystals. In addition, the synthesis of Au–Pd-alloyed NCs has also been attempted.Graphical Abstract.

  18. Patch-Clamp Recording from Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes: Improving Action Potential Characteristics through Dynamic Clamp

    Science.gov (United States)

    Veerman, Christiaan C.; Zegers, Jan G.; Mengarelli, Isabella; Bezzina, Connie R.

    2017-01-01

    Human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) hold great promise for studying inherited cardiac arrhythmias and developing drug therapies to treat such arrhythmias. Unfortunately, until now, action potential (AP) measurements in hiPSC-CMs have been hampered by the virtual absence of the inward rectifier potassium current (IK1) in hiPSC-CMs, resulting in spontaneous activity and altered function of various depolarising and repolarising membrane currents. We assessed whether AP measurements in “ventricular-like” and “atrial-like” hiPSC-CMs could be improved through a simple, highly reproducible dynamic clamp approach to provide these cells with a substantial IK1 (computed in real time according to the actual membrane potential and injected through the patch-clamp pipette). APs were measured at 1 Hz using perforated patch-clamp methodology, both in control cells and in cells treated with all-trans retinoic acid (RA) during the differentiation process to increase the number of cells with atrial-like APs. RA-treated hiPSC-CMs displayed shorter APs than control hiPSC-CMs and this phenotype became more prominent upon addition of synthetic IK1 through dynamic clamp. Furthermore, the variability of several AP parameters decreased upon IK1 injection. Computer simulations with models of ventricular-like and atrial-like hiPSC-CMs demonstrated the importance of selecting an appropriate synthetic IK1. In conclusion, the dynamic clamp-based approach of IK1 injection has broad applicability for detailed AP measurements in hiPSC-CMs. PMID:28867785

  19. Improved Active-Neutral-Point-Clamped (I-ANPC) Multilevel Converter: Fundamental Circuit Topology, Innovative Modulatioin Technique, and Experimental Validation

    DEFF Research Database (Denmark)

    Dargahi, Vahid; Corzine, Keith A.; Enslin, Johan H.

    2018-01-01

    For medium-voltage (MV) high-power industrial applications including HVDC and variable-speed motor drives, multilevel converters are deemed predominant topology. One of the promising derived-topologies from neutral-point-clamped (NPC) configuration is active NPC (ANPC) inverter that offers improved......-capacitor (FC) and four switches such as the insulated-gate bipolar transistors (IGBTs). The I-ANPC converter has considerable advantages over the classic multilevel inverters that makes it a preferable topology for MV applications. The substantial reduction in the number of cells in comparison with classic...

  20. Effect of the number of electrodes on the reconstructed lung shape in electrical impedance tomography

    Directory of Open Access Journals (Sweden)

    Schullcke Benjamin

    2016-09-01

    Full Text Available Electrical impedance tomography (EIT is used to monitor the regional distribution of ventilation in a transversal plane of the thorax. In this manuscript we evaluate the impact of different quantities of electrodes used for current injection and voltage measurement on the reconstructed shape of the lungs. Results indicate that the shape of reconstructed impedance changes in the body depends on the number of electrodes. In this manuscript, we demonstrate that a higher number of electrodes do not necessarily increase the image quality. For the used stimulation pattern, utilizing neighboring electrodes for current injection and voltage measurement, we conclude that the shape of the lungs is best reconstructed if 16 electrodes are used.

  1. Impact of electrode geometry on an atmospheric pressure surface barrier discharge

    Science.gov (United States)

    Hasan, M. I.; Morabit, Y.; Dickenson, A.; Walsh, J. L.

    2017-06-01

    Several of the key characteristics of an atmospheric pressure surface barrier discharge (SBD) are heavily dependent on the geometrical configuration of the plasma generating electrodes. This paper reveals that increasing the surface area of an SBD device by reducing the gaps within the electrodes can have major and unforeseen consequence on the discharge properties. It is experimentally demonstrated that a critical limit exists when reducing the diameter of a circular electrode gap below 5 mm, beyond which the required breakdown voltage increases exponentially and the power deposited in the discharge is impeded. Using a numerical model, it is shown that a reduced electrode gap diameter yields a decrease in the voltage difference between the electrode and dielectric surface, thus lowering the maximum electric field. This study indicates a link between the electrode geometry and the nature of the reactive chemistry produced in the plasma, findings which have wide-reaching implications for many applications where multiple closely packed surface barrier discharges are employed to achieve uniform and large area plasma processing.

  2. Voltage-sensing phosphatase modulation by a C2 domain.

    Science.gov (United States)

    Castle, Paul M; Zolman, Kevin D; Kohout, Susy C

    2015-01-01

    The voltage-sensing phosphatase (VSP) is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD), the inter-domain linker, the cytosolic catalytic domain, and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate (PIP) lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] (Kalli et al., 2014). Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5)P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry (VCF) were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5)P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in

  3. Study on the streamer inception characteristics under positive lightning impulse voltage

    Directory of Open Access Journals (Sweden)

    Zezhong Wang

    2017-11-01

    Full Text Available The streamer is the main process in an air gap discharge, and the inception characteristics of streamers have been widely applied in engineering. Streamer inception characteristics under DC voltage have been studied by many researchers, but the inception characteristics under impulse voltage, and particularly under lightning impulse voltage with a high voltage rise rate have rarely been studied. A measurement system based on integrated optoelectronic technology has been proposed in this paper, and the streamer inception characteristics in a 1-m-long rod-plane air gap that was energized by a positive lightning impulse voltage have been researched. We have also measured the streamer inception electric field using electrodes with different radii of curvature and different voltage rise rates. As a result, a modified empirical criterion for the streamer inception electric field that considers the voltage rise rate has been proposed, and the wide applicability of this criterion has been proved. Based on the streamer inception time-lag obtained, we determined that the field distribution obeys a Rayleigh distribution, which explains the change law of the streamer inception time-lag. The characteristic parameter of the Rayleigh distribution lies in the range from 0.6 to 2.5 when the radius of curvature of the electrode head is in the range from 0.5 cm to 2.5 cm and the voltage rise rate ranges from 80 kV/μs to 240kV/μs under positive lightning impulse voltage.

  4. Study on the streamer inception characteristics under positive lightning impulse voltage

    Science.gov (United States)

    Wang, Zezhong; Geng, Yinan

    2017-11-01

    The streamer is the main process in an air gap discharge, and the inception characteristics of streamers have been widely applied in engineering. Streamer inception characteristics under DC voltage have been studied by many researchers, but the inception characteristics under impulse voltage, and particularly under lightning impulse voltage with a high voltage rise rate have rarely been studied. A measurement system based on integrated optoelectronic technology has been proposed in this paper, and the streamer inception characteristics in a 1-m-long rod-plane air gap that was energized by a positive lightning impulse voltage have been researched. We have also measured the streamer inception electric field using electrodes with different radii of curvature and different voltage rise rates. As a result, a modified empirical criterion for the streamer inception electric field that considers the voltage rise rate has been proposed, and the wide applicability of this criterion has been proved. Based on the streamer inception time-lag obtained, we determined that the field distribution obeys a Rayleigh distribution, which explains the change law of the streamer inception time-lag. The characteristic parameter of the Rayleigh distribution lies in the range from 0.6 to 2.5 when the radius of curvature of the electrode head is in the range from 0.5 cm to 2.5 cm and the voltage rise rate ranges from 80 kV/μs to 240kV/μs under positive lightning impulse voltage.

  5. Equilibrium fluctuation relations for voltage coupling in membrane proteins.

    Science.gov (United States)

    Kim, Ilsoo; Warshel, Arieh

    2015-11-01

    A general theoretical framework is developed to account for the effects of an external potential on the energetics of membrane proteins. The framework is based on the free energy relation between two (forward/backward) probability densities, which was recently generalized to non-equilibrium processes, culminating in the work-fluctuation theorem. Starting from the probability densities of the conformational states along the "voltage coupling" reaction coordinate, we investigate several interconnected free energy relations between these two conformational states, considering voltage activation of ion channels. The free energy difference between the two conformational states at zero (depolarization) membrane potential (i.e., known as the chemical component of free energy change in ion channels) is shown to be equivalent to the free energy difference between the two "equilibrium" (resting and activated) conformational states along the one-dimensional voltage couplin reaction coordinate. Furthermore, the requirement that the application of linear response approximation to the free energy functionals of voltage coupling should satisfy the general free energy relations, yields a novel closed-form expression for the gating charge in terms of other basic properties of ion channels. This connection is familiar in statistical mechanics, known as the equilibrium fluctuation-response relation. The theory is illustrated by considering the coupling of a unit charge to the external voltage in the two sites near the surface of membrane, representing the activated and resting states. This is done using a coarse-graining (CG) model of membrane proteins, which includes the membrane, the electrolytes and the electrodes. The CG model yields Marcus-type voltage dependent free energy parabolas for the response of the electrostatic environment (electrolytes etc.) to the transition from the initial to the final configuratinal states, leading to equilibrium free energy difference and free

  6. Supercapacitive transport of pharmacologic agents using nanoporous gold electrodes.

    Science.gov (United States)

    Gittard, Shaun D; Pierson, Bonnie E; Ha, Cindy M; Wu, Chung-An Max; Narayan, Roger J; Robinson, David B

    2010-02-01

    In this study, nanoporous gold supercapacitors were produced by electrochemical dealloying of gold-silver alloy. Scanning electron microscopy and energy dispersive X-ray spectroscopy confirmed completion of the dealloying process and generation of a porous gold material with approximately 10 nm diameter pores. Cyclic voltammetry and chronoamperometry of the nanoporous gold electrodes indicated that these materials exhibited supercapacitor behavior. The storage capacity of the electrodes measured by chronoamperometry was approximately 3 mC at 200 mV. Electrochemical storage and voltage-controlled delivery of two model pharmacologic agents, benzylammonium and salicylic acid, was demonstrated. These results suggest that capacitance-based storage and delivery of pharmacologic agents may serve as an alternative to conventional drug delivery methods.

  7. Ultraflat and broadband optical frequency comb generator based on cascaded two dual-electrode Mach-Zehnder modulators

    Science.gov (United States)

    Qu, Kun; Zhao, Shanghong; Li, Xuan; Tan, Qinggui; Zhu, Zihang

    2018-04-01

    A novel scheme for the generation of ultraflat and broadband optical frequency comb (OFC) is proposed based on cascaded two dual-electrode Mach-Zehnder modulators (DE-MZM). The first DE-MZM can generate a four-comb-line OFC, then the OFC is injected into the second DE-MZM as a carrier, which can increase the number of comb lines. Our modified scheme finally can generate a broadband OFC with high flatness by simply modifying the electrical power and the bias voltage of the DE-MZM. Theoretical analysis and simulation results reveal that a 16-comb-line OFC with a frequency spacing that two times the frequency of the RF signal can be obtained. The power fluctuation of the OFC lines is 0.48 dB and the unwanted-mode suppression ratio (UMSR) can reach 16.5 dB. Additionally, whether the bias drift of the DE-MZMs has little influence on the power fluctuation is also analyzed. These results demonstrate the robustness of our scheme and verify its good accuracy and high stability with perfect flatness.

  8. Electro-chemical deposition of zinc oxide nanostructures by using two electrodes

    Directory of Open Access Journals (Sweden)

    B. A. Taleatu

    2011-09-01

    Full Text Available One of the most viable ways to grow nanostructures is electro deposition. However, most electrodeposited samples are obtained by three-electrode electrochemical cell. We successfully use a much simpler two-electrode cell to grow different ZnO nanostructures from common chemical reagents. Concentration, pH of the electrolytes and growth parameters like potentials at the electrodes, are tailored to allow fast growth without complexity. Morphology and surface roughness are investigated by Scanning Electron and Air Force Microscopy (SEM and AFM respectively, crystal structure by X-Ray Diffraction measurements (XRD and ZnO stoichiometry by core level photoemission spectroscopy (XPS.

  9. Processing of carbon composite paper as electrode for fuel cell

    Energy Technology Data Exchange (ETDEWEB)

    Mathur, R.B.; Maheshwari, Priyanka H.; Dhami, T.L. [Carbon Technology Unit, National Physical Laboratory, New Delhi 110012 (India); Sharma, R.K.; Sharma, C.P. [Soft Polymeric Group, Division of Engineering Materials, National Physical Laboratory, New Delhi 110012 (India)

    2006-10-27

    The porous carbon electrode in a fuel cell not only acts as an electrolyte and a catalyst support, but also allows the diffusion of hydrogen fuel through its fine porosity and serves as a current-carrying conductor. A suitable carbon paper electrode is developed and possesses the characteristics of high porosity, permeability and strength along with low electrical resistivity so that it can be effectively used in proton-exchange membrane and phosphoric acid fuel cells. The electrode is prepared through a combination of two important techniques, viz., paper-making technology by first forming a porous chopped carbon fibre preform, and composite technology using a thermosetting resin matrix. The study reveals an interdependence of one parameter on another and how judicious choice of the processing conditions are necessary to achieve the desired characteristics. The current-voltage performance of the electrode in a unit fuel cell matches that of a commercially-available material. (author)

  10. Effect of ciguatoxin 3C on voltage-gated Na+ and K+ currents in mouse taste cells.

    Science.gov (United States)

    Ghiaroni, Valeria; Fuwa, Haruhiko; Inoue, Masayuki; Sasaki, Makoto; Miyazaki, Keisuke; Hirama, Masahiro; Yasumoto, Takeshi; Rossini, Gian Paolo; Scalera, Giuseppe; Bigiani, Albertino

    2006-09-01

    The marine dinoflagellate Gambierdiscus toxicus produces highly lipophilic, polycyclic ether toxins that cause a seafood poisoning called ciguatera. Ciguatoxins (CTXs) and gambierol represent the two major causative agents of ciguatera intoxication, which include taste alterations (dysgeusiae). However, information on the mode of action of ciguatera toxins in taste cells is scarce. Here, we have studied the effect of synthetic CTX3C (a CTX congener) on mouse taste cells. By using the patch-clamp technique to monitor membrane ion currents, we found that CTX3C markedly affected the operation of voltage-gated Na(+) channels but was ineffective on voltage-gated K(+) channels. This result was the exact opposite of what we obtained earlier with gambierol, which inhibits K(+) channels but not Na(+) channels. Thus, CTXs and gambierol affect with high potency the operation of separate classes of voltage-gated ion channels in taste cells. Our data suggest that taste disturbances reported in ciguatera poisoning might be due to the ability of ciguatera toxins to interfere with ion channels in taste buds.

  11. Scalable Electrophysiology in Intact Small Animals with Nanoscale Suspended Electrode Arrays

    OpenAIRE

    Gonzales, Daniel L.; Badhiwala, Krishna N.; Vercosa, Daniel G.; Avants, Ben W.; Liu, Zheng; Zhong, Weiwei; Robinson, Jacob T.

    2017-01-01

    Electrical measurements from large populations of animals would help reveal fundamental properties of the nervous system and neurological diseases. Small invertebrates are ideal for these large-scale studies; however, patch-clamp electrophysiology in microscopic animals typically requires low-throughput and invasive dissections. To overcome these limitations, we present nano-SPEARs: suspended electrodes integrated into a scalable microfluidic device. Using this technology, we have made the fi...

  12. Hysteretic current-voltage characteristics in RF-sputtered nanocrystalline TiO2 thin films

    International Nuclear Information System (INIS)

    Villafuerte, Manuel; Juarez, Gabriel; Heluani, Silvia P. de; Comedi, David

    2007-01-01

    We have measured the current-voltage characteristics at room temperature of a nanocrystalline TiO 2 thin film fabricated by reactive RF-sputtering deposition and sandwiched between ITO (indium-tin-oxide)-buffered glass substrate and an indium top electrode. The I-V characteristics are ohmic for low voltages and become non-linear, hysteretic and asymmetric as the voltage is increased. The system is shown to be well represented by two distinct resistance states in the non-ohmic region. Current transient evolutions were also measured for constant voltage excitations. The resistance is stable in time for voltages in the ohmic regime. In contrast, for voltages in the non-ohmic regime, the resistance has a small variation for a short period of time (order of tens seconds) and then increases with time. For those transients, long characteristic times (on the order of tens of minutes up to hours) were found. The behavior of the system is discussed on the basis of experimental results reported in the literature for similar systems and existing models for electric-field induced resistive switching

  13. Water surface deformation in strong electrical fields and its influence on electrical breakdown in a metal pin-water electrode system

    International Nuclear Information System (INIS)

    Bruggeman, Peter; Graham, Leigh; Groote, Joris de; Vierendeels, Jan; Leys, Christophe

    2007-01-01

    Electrical breakdown and water surface deformation in a metal pin-water electrode system with dc applied voltages is studied for small inter-electrode distances (2-12 mm). The radius of curvature of the metal pin is 0.5 cm to exclude corona before breakdown at these small inter-electrode spacings. Calculations of the water surface deformation as a function of the applied voltage and initial inter-electrode spacing are compared with measurements of the water elevation. For distances smaller than 7 mm the calculated stability limit of the water surface corresponds with the experimentally obtained breakdown voltage. It is proved with fast CCD images and calculations of the electrical field distribution that the water surface instability triggers the electrical breakdown in this case. The images show that at breakdown the water surface has a Taylor cone-like shape. At inter-electrode distance of 7 mm and larger the breakdown voltage is well below the water stability limit and the conductive channel at breakdown is formed between the pin electrode and the static water surface. Both cases are discussed and compared

  14. Surface effects of electrode-dependent switching behavior of resistive random-access memory

    KAUST Repository

    Ke, Jr Jian; Wei, Tzu Chiao; Tsai, Dung Sheng; Lin, Chun-Ho; He, Jr-Hau

    2016-01-01

    of the oxygen chemisorption process was proposed to explain this electrode-dependent switching behavior. The temperature-dependent switching voltage demonstrates that the ReRAM devices fabricated with Pt electrodes have a lower activation energy

  15. Design of a microscopic electrical impedance tomography system using two current injections

    International Nuclear Information System (INIS)

    Liu, Qin; Oh, Tong In; Wi, Hun; Woo, Eung Je; Lee, Eun Jung; Seo, Jin Keun

    2011-01-01

    We describe a novel design of a microscopic electrical impedance tomography (micro-EIT) system for long-term noninvasive monitoring of cell or tissue cultures. The core of the micro-EIT system is a sample container including two pairs of current-injection electrodes and 360 voltage-sensing electrodes. In designing the container, we took advantage of a hexagonal structure with fixed dimensions and electrode configuration. This eliminated technical difficulties related to the unknown irregular boundary geometry of an imaging object in conventional medical EIT. Attaching a pair of large current-injection electrodes fully covering the left and right sides of the hexagonal container, we generated uniform parallel current density inside the container filled with saline. The 360 voltage-sensing electrodes were placed on the front, bottom and back sides of the hexagonal container in three sets of 8 × 15 arrays with equal gaps between them. We measured voltage differences between all neighboring pairs along the direction of the parallel current pathway. For the homogeneous container, all measured voltages must be the same since the voltage changes linearly along that direction. Any anomaly in the container perturbed the current pathways and therefore equipotential lines to produce different differential voltage data. For conductivity image reconstructions, we adopted a lately developed image reconstruction algorithm for this electrode configuration to first produce projected conductivity images on the front, bottom and back sides. Using a backprojection method, we reconstructed three-dimensional conductivity images from those projection images. To improve the image quality and also to meet the mathematical requirement on the uniqueness of a reconstructed image, we used a second pair of thin and long current-injection electrodes located at the middle of the front and back sides. This paper describes the design and construction of such a micro-EIT system with experimental

  16. High-voltage measurements on the 5 ppm relative uncertainty level with collinear laser spectroscopy

    Science.gov (United States)

    Krämer, J.; König, K.; Geppert, Ch; Imgram, P.; Maaß, B.; Meisner, J.; Otten, E. W.; Passon, S.; Ratajczyk, T.; Ullmann, J.; Nörtershäuser, W.

    2018-04-01

    We present the results of high-voltage collinear laser spectroscopy measurements on the 5 ppm relative uncertainty level using a pump and probe scheme at the 4s ^2S1/2 → 4p ^2P3/2 transition of {\\hspace{0pt}}40Ca+ involving the 3d ^2D5/2 metastable state. With two-stage laser interaction and a reference measurement we can eliminate systematic effects such as differences in the contact potentials due to different electrode materials and thermoelectric voltages, and the unknown starting potential of the ions in the ion source. Voltage measurements were performed between  -5 kV and  -19 kV and parallel measurements with stable high-voltage dividers calibrated to 5 ppm relative uncertainty were used as a reference. Our measurements are compatible with the uncertainty limits of the high-voltage dividers and demonstrate an unprecedented (factor of 20) increase in the precision of direct laser-based high-voltage measurements.

  17. Sequential injection of domain walls into ferroelectrics at different bias voltages: Paving the way for “domain wall memristors”

    Energy Technology Data Exchange (ETDEWEB)

    Whyte, J. R.; McQuaid, R. G. P.; Einsle, J. F.; Gregg, J. M., E-mail: m.gregg@qub.ac.uk [Centre for Nanostructured Media (CNM), School of Maths and Physics, Queen' s University Belfast, University Road, Belfast BT7 1NN (United Kingdom); Ashcroft, C. M. [Centre for Nanostructured Media (CNM), School of Maths and Physics, Queen' s University Belfast, University Road, Belfast BT7 1NN (United Kingdom); Department of Physics, Cavendish Laboratory, J. J. Thomson Avenue, Cambridge CB3 0HE (United Kingdom); Canalias, C. [Department of Applied Physics, Royal Institute of Technology, Roslagstullsbacken 21, 10691 Stockholm (Sweden); Gruverman, A. [Department of Physics and Astronomy, University of Nebraska Lincoln, Nebraska 68588–0299 (United States)

    2014-08-14

    Simple meso-scale capacitor structures have been made by incorporating thin (∼300 nm) single crystal lamellae of KTiOPO{sub 4} (KTP) between two coplanar Pt electrodes. The influence that either patterned protrusions in the electrodes or focused ion beam milled holes in the KTP have on the nucleation of reverse domains during switching was mapped using piezoresponse force microscopy imaging. The objective was to assess whether or not variations in the magnitude of field enhancement at localised “hot-spots,” caused by such patterning, could be used to both control the exact locations and bias voltages at which nucleation events occurred. It was found that both the patterning of electrodes and the milling of various hole geometries into the KTP could allow controlled sequential injection of domain wall pairs at different bias voltages; this capability could have implications for the design and operation of domain wall electronic devices, such as memristors, in the future.

  18. Coulometry and Calorimetry of Electric Double Layer Formation in Porous Electrodes

    NARCIS (Netherlands)

    Janssen, Mathijs; Griffioen, Elian; Biesheuvel, P. M.; Van Roij, René; Erné, Ben

    2017-01-01

    Coulometric measurements on salt-water-immersed nanoporous carbon electrodes reveal, at a fixed voltage, a charge decrease with increasing temperature. During far-out-of-equilibrium charging of these electrodes, calorimetry indicates the production of both irreversible Joule heat and reversible

  19. Improved open-circuit voltage in Cu(In,Ga)Se{sub 2} solar cells with high work function transparent electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Jäger, Timo, E-mail: timo.jaeger@empa.ch; Romanyuk, Yaroslav E.; Bissig, Benjamin; Pianezzi, Fabian; Nishiwaki, Shiro; Reinhard, Patrick; Steinhauser, Jérôme; Tiwari, Ayodhya N. [Empa—Swiss Federal Laboratories for Materials Science and Technology, Laboratory for Thin Films and Photovoltaics, Überlandstrasse 129, 8600 Dübendorf (Switzerland); Schwenk, Johannes [Empa—Swiss Federal Laboratories for Materials Science and Technology, Laboratory for Nanoscale Materials Science, Überlandstrasse 129, 8600 Dübendorf (Switzerland)

    2015-06-14

    Hydrogenated indium oxide (IOH) is implemented as transparent front contact in Cu(In,Ga)Se{sub 2} (CIGS) solar cells, leading to an open circuit voltage V{sub OC} enhanced by ∼20 mV as compared to reference devices with ZnO:Al (AZO) electrodes. This effect is reproducible in a wide range of contact sheet resistances corresponding to various IOH thicknesses. We present the detailed electrical characterization of glass/Mo/CIGS/CdS/intrinsic ZnO (i-ZnO)/transparent conductive oxide (TCO) with different IOH/AZO ratios in the front TCO contact in order to identify possible reasons for the enhanced V{sub OC}. Temperature and illumination intensity-dependent current-voltage measurements indicate that the dominant recombination path does not change when AZO is replaced by IOH, and it is mainly limited to recombination in the space charge region and at the junction interface of the solar cell. The main finding is that the introduction of even a 5 nm-thin IOH layer at the i-ZnO/TCO interface already results in a step-like increase in V{sub OC}. Two possible explanations are proposed and verified by one-dimensional simulations using the SCAPS software. First, a higher work function of IOH as compared to AZO is simulated to yield an V{sub OC} increase by 21 mV. Second, a lower defect density in the i-ZnO layer as a result of the reduced sputter damage during milder sputter-deposition of IOH can also add to a maximum enhanced V{sub OC} of 25 mV. Our results demonstrate that the proper choice of the front TCO contact can reduce the parasitic recombination and boost the efficiency of CIGS cells with improved corrosion stability.

  20. Insulating electrodes: a review on biopotential front ends for dielectric skin–electrode interfaces

    International Nuclear Information System (INIS)

    Spinelli, Enrique; Haberman, Marcelo

    2010-01-01

    Insulating electrodes, also known as capacitive electrodes, allow acquiring biopotentials without galvanic contact with the body. They operate with displacement currents instead of real charge currents, and the electrolytic electrode–skin interface is replaced by a dielectric film. The use of insulating electrodes is not the end of electrode interface problems but the beginning of new ones: coupling capacitances are of the order of pF calling for ultra-high input impedance amplifiers and careful biasing, guarding and shielding techniques. In this work, the general requirements of front ends for capacitive electrodes are presented and the different contributions to the overall noise are discussed and estimated. This analysis yields that noise bounds depend on features of the available devices as current and voltage noise, but the final noise level also depends on parasitic capacitances, requiring a careful shield and printed circuit design. When the dielectric layer is placed on the skin, the present-day amplifiers allow achieving noise levels similar to those provided by wet electrodes. Furthermore, capacitive electrode technology allows acquiring high quality ECG signals through thin clothes. A prototype front end for capacitive electrodes was built and tested. ECG signals were acquired with these electrodes in direct contact with the skin and also through cotton clothes 350 µm thick. They were compared with simultaneously acquired signals by means of wet electrodes and no significant differences were observed between both output signals

  1. Analysis of voltage-drop near cold-electrodes of a combustion MHD generator

    International Nuclear Information System (INIS)

    Satyamurthy, P.; Venkatramani, N.; Rohatgi, V.K.

    1983-01-01

    In this paper turbulent compressible boundary layer equations for mass, momentum and energy are solved near the cold electrode wall of a combustion MHD generator. Arcs are simulated by freezing the electron temperature (and hence electrical conductivity) to a temperature called Tsub(arc) when gas temperature is less than Tsub(arc). Theoretical near electrode drop for various current densities along the flow direction is analysed for various Tsub(arc) temperatures and compared with experimentally obtained near electrode drop. It is found that the Tsub(arc) temperature increases as a square root along the flow direction and has linear dependency on current density. (author)

  2. Patch clamp study of mouse glomus cells using a whole carotid body.

    Science.gov (United States)

    Yamaguchi, Shigeki; Lande, Boris; Kitajima, Toshimitsu; Hori, Yuichi; Shirahata, Machiko

    2004-03-04

    Some electrophysiological characteristics of mouse glomus cells (DBA/2J strain) were investigated using an undissociated carotid body. The carotid body with major carotid arteries was placed in a recording chamber, and glomus cells were visualized with a water immersion lens combined with an infrared differential interference video camera. Patch clamp experiments revealed that voltage-gated outward current, but not inward current, was easily observed in glomus cells. Pharmacological experiments and the kinetics of the current suggest that outward current is via delayed rectifier, A type, and large conductance calcium-activated K channels. Furthermore, K current was reversibly attenuated by mild hypoxia. The results suggest electrophysiological similarities of glomus cells among the cat, the rat, and the DBA/2J mouse. The method appears useful for physiological experiments.

  3. Textile Wastewater Treatment by Electrocoagulation Process using Aluminum Electrodes

    Directory of Open Access Journals (Sweden)

    Edris Bazrafshan

    2014-03-01

    Full Text Available Background and purpose: Textile industries are among the most polluting industries regarding the volume and the complexity of treatment of its effluents discharge. This study investigated the efficiency of electrocoagulation process using aluminum electrodes in basic red 18 dye removal from aqueous solutions. Materials and Methods: This study was performed in a bipolar batch reactor with six aluminum electrodes connected in parallel. Several important parameters, such as initial pH of solution, initial dye concentration, applied voltage; conductivity and reaction time were studied in an attempt to achieve higher removal efficiency. Results: The electrochemical technique showed satisfactory dye removal efficiency and reliable performance in treating of basic red 18. The maximum efficiency of dye removal which was obtained in voltage of 50 V, reaction time of 60 min, initial concentration 50 mg/L, conductivity 3000 μS/cm and pH 7 was equal to 97.7%. Dye removal efficiency was increased accordance to increase of applied voltage and in contrast electrode and energy consumption was increased simultaneously. Conclusion: As a conclusion, the method was found to be highly efficient and relatively fast compared to conventional existing techniques for dye removal from aqueous solutions.

  4. Fast two-photon imaging of subcellular voltage dynamics in neuronal tissue with genetically encoded indicators.

    Science.gov (United States)

    Chamberland, Simon; Yang, Helen H; Pan, Michael M; Evans, Stephen W; Guan, Sihui; Chavarha, Mariya; Yang, Ying; Salesse, Charleen; Wu, Haodi; Wu, Joseph C; Clandinin, Thomas R; Toth, Katalin; Lin, Michael Z; St-Pierre, François

    2017-07-27

    Monitoring voltage dynamics in defined neurons deep in the brain is critical for unraveling the function of neuronal circuits but is challenging due to the limited performance of existing tools. In particular, while genetically encoded voltage indicators have shown promise for optical detection of voltage transients, many indicators exhibit low sensitivity when imaged under two-photon illumination. Previous studies thus fell short of visualizing voltage dynamics in individual neurons in single trials. Here, we report ASAP2s, a novel voltage indicator with improved sensitivity. By imaging ASAP2s using random-access multi-photon microscopy, we demonstrate robust single-trial detection of action potentials in organotypic slice cultures. We also show that ASAP2s enables two-photon imaging of graded potentials in organotypic slice cultures and in Drosophila . These results demonstrate that the combination of ASAP2s and fast two-photon imaging methods enables detection of neural electrical activity with subcellular spatial resolution and millisecond-timescale precision.

  5. Reducing blood loss during laparoscopic myomectomy by temporary uterine artery clamping using bulldog clamp

    Directory of Open Access Journals (Sweden)

    Kai-Jo Chiang

    2014-01-01

    Full Text Available Uterine myoma is the most common benign gynecologic tumor worldwide. Mini-invasive surgery has become popular for myomectomy, with advantages over laparotomy. However, reducing blood loss during laparoscopic myomectomy is a major concern for the surgeon because of the limitation in making a quick control bleeding during the operation. Several methods have proved to decrease blood flow, but are not always effective or available. We present a case of uterine myoma with the uterine arteries clamped by bulldog clamps during laparoscopic myomectomy. The myoma was removed successfully with minimal blood loss (<50 ml during the operation. This is an effective, safe, and reliable method for reducing bleeding during laparoscopic myomectomy that does not require ligation of the uterine artery.

  6. Block of voltage-gated potassium channels by Pacific ciguatoxin-1 contributes to increased neuronal excitability in rat sensory neurons

    International Nuclear Information System (INIS)

    Birinyi-Strachan, Liesl C.; Gunning, Simon J.; Lewis, Richard J.; Nicholson, Graham M.

    2005-01-01

    The present study investigated the actions of the polyether marine toxin Pacific ciguatoxin-1 (P-CTX-1) on neuronal excitability in rat dorsal root ganglion (DRG) neurons using patch-clamp recording techniques. Under current-clamp conditions, bath application of 2-20 nM P-CTX-1 caused a rapid, concentration-dependent depolarization of the resting membrane potential in neurons expressing tetrodotoxin (TTX)-sensitive voltage-gated sodium (Na v ) channels. This action was completely suppressed by the addition of 200 nM TTX to the external solution, indicating that this effect was mediated through TTX-sensitive Na v channels. In addition, P-CTX-1 also prolonged action potential and afterhyperpolarization (AHP) duration. In a subpopulation of neurons, P-CTX-1 also produced tonic action potential firing, an effect that was not accompanied by significant oscillation of the resting membrane potential. Conversely, in neurons expressing TTX-resistant Na v currents, P-CTX-1 failed to alter any parameter of neuronal excitability examined in this study. Under voltage-clamp conditions in rat DRG neurons, P-CTX-1 inhibited both delayed-rectifier and 'A-type' potassium currents in a dose-dependent manner, actions that occurred in the absence of alterations to the voltage dependence of activation. These actions appear to underlie the prolongation of the action potential and AHP, and contribute to repetitive firing. These data indicate that a block of potassium channels contributes to the increase in neuronal excitability, associated with a modulation of Na v channel gating, observed clinically in response to ciguatera poisoning

  7. Planar patch clamp: advances in electrophysiology.

    Science.gov (United States)

    Brüggemann, Andrea; Farre, Cecilia; Haarmann, Claudia; Haythornthwaite, Ali; Kreir, Mohamed; Stoelzle, Sonja; George, Michael; Fertig, Niels

    2008-01-01

    Ion channels have gained increased interest as therapeutic targets over recent years, since a growing number of human and animal diseases have been attributed to defects in ion channel function. Potassium channels are the largest and most diverse family of ion channels. Pharmaceutical agents such as Glibenclamide, an inhibitor of K(ATP) channel activity which promotes insulin release, have been successfully sold on the market for many years. So far, only a small group of the known ion channels have been addressed as potential drug targets. The functional testing of drugs on these ion channels has always been the bottleneck in the development of these types of pharmaceutical compounds.New generations of automated patch clamp screening platforms allow a higher throughput for drug testing and widen this bottleneck. Due to their planar chip design not only is a higher throughput achieved, but new applications have also become possible. One of the advantages of planar patch clamp is the possibility of perfusing the intracellular side of the membrane during a patch clamp experiment in the whole-cell configuration. Furthermore, the extracellular membrane remains accessible for compound application during the experiment.Internal perfusion can be used not only for patch clamp experiments with cell membranes, but also for those with artificial lipid bilayers. In this chapter we describe how internal perfusion can be applied to potassium channels expressed in Jurkat cells, and to Gramicidin channels reconstituted in a lipid bilayer.

  8. Effect of voltage waveform on dielectric barrier discharge ozone production efficiency

    Science.gov (United States)

    Mericam-Bourdet, N.; Kirkpatrick, M. J.; Tuvache, F.; Frochot, D.; Odic, E.

    2012-03-01

    Dielectric barrier discharges (DBDs) are commonly used for gas effluent cleanup and ozone generation. For these applications, the energy efficiency of the discharge is a major concern. This paper reports on investigations carried out on the voltage shape applied to DBD reactor electrodes, aiming to evaluate a possible energy efficiency improvement for ozone production. Two DBD reactor geometries were used: pin-to-pin and cylinder-to-cylinder, both driven either by a bi-directional power supply (voltage rise rate 1 kV/μs) or by a pulsed power supply (voltage rise rate 1 kV/ns). Ozone formed in dry air was measured at the reactor outlet. Special attention was paid to discharge input power evaluation using different methods including instantaneous current-voltage product and transferred charge-applied voltage figures. The charge transferred by the discharges was also correlated to the ozone production. It is shown that, in the case of the DBD reactors under investigation, the applied voltage shape has no influence on the ozone production efficiency. For the considered voltage rise rate, the charge deposit on the dielectric inserted inside the discharge gap is the important factor (as opposed to the voltage shape) governing the efficiency of the discharge - it does this by tailoring the duration of the current peak into the tens of nanosecond range.

  9. Fluoride Removal From Drinking Water by Electrocoagulation Using Iron and Aluminum Electrodes

    Directory of Open Access Journals (Sweden)

    Takdastan

    2014-07-01

    Full Text Available Background Existence of fluoride in drinking water above the permissible level causes human skeletal fluorosis. Objectives Electrocoagulation by iron and aluminum electrodes was proposed for removing fluoride from drinking water. Materials and Methods Effects of different operating conditions such as treatment time, initial pH, applied voltage, type and number of electrodes, the spaces between aluminum and iron electrodes, and energy consumption during electrocoagulation were investigated in the batch reactor. Variable concentrations of fluoride solution were prepared by mixing proper amounts of sodium fluoride with deionized water. Results Experimental results showed that aluminum electrode is more effective in fluoride removal than iron, as in 40 minutes and initial pH of 7.5 at 20 V, the fluoride removal process reached to 97.86%. The final recommendable limit of fluoride (1.5 mg/L was obtained in 10 minutes at 20 V with the aluminum electrode. Conclusions In electrocoagulation with iron and aluminum electrodes, increase of voltage, number of electrodes and reaction time as well as decrease of the spaces between electrodes, enhanced the fluoride removal efficiency from drinking water. In addition the effect of pH and initial concentration of fluoride varied with types of electrodes.

  10. Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel

    International Nuclear Information System (INIS)

    Barchi, R.L.; Tanaka, J.C.

    1984-01-01

    In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab

  11. Asymmetric voltage behavior of the tunnel magnetoresistance in double barrier magnetic tunnel junctions

    KAUST Repository

    Useinov, Arthur

    2012-06-01

    In this paper, we study the value of the tunnel magnetoresistance (TMR) as a function of the applied voltage in double barrier magnetic tunnel junctions (DMTJs) with the left and right ferromagnetic (FM) layers being pinned and numerically estimate the possible difference of the TMR curves for negative and positive voltages in the homojunctions (equal barriers and electrodes). DMTJs are modeled as two single barrier junctions connected in series with consecutive tunneling (CST). We investigated the asymmetric voltage behavior of the TMR for the CST in the range of a general theoretical model. Significant asymmetries of the experimental curves, which arise due to different annealing regimes, are mostly explained by different heights of the tunnel barriers and asymmetries of spin polarizations in magnetic layers. © (2012) Trans Tech Publications.

  12. Asymmetric voltage behavior of the tunnel magnetoresistance in double barrier magnetic tunnel junctions

    KAUST Repository

    Useinov, Arthur; Gooneratne, Chinthaka Pasan; Kosel, Jü rgen

    2012-01-01

    In this paper, we study the value of the tunnel magnetoresistance (TMR) as a function of the applied voltage in double barrier magnetic tunnel junctions (DMTJs) with the left and right ferromagnetic (FM) layers being pinned and numerically estimate the possible difference of the TMR curves for negative and positive voltages in the homojunctions (equal barriers and electrodes). DMTJs are modeled as two single barrier junctions connected in series with consecutive tunneling (CST). We investigated the asymmetric voltage behavior of the TMR for the CST in the range of a general theoretical model. Significant asymmetries of the experimental curves, which arise due to different annealing regimes, are mostly explained by different heights of the tunnel barriers and asymmetries of spin polarizations in magnetic layers. © (2012) Trans Tech Publications.

  13. Baking of tandem accelerator tube by low voltage arc discharge

    International Nuclear Information System (INIS)

    Nakajima, Yutaka

    1982-01-01

    In designing the accelerating tube for a static tandem accelerator in Kyushu University, the basic policy was as described below: individual unit composing the accelerating tube should fully withstand the electric field of 2 MV/m, and electric discharge must not be propagated from one unit to the adjacent unit when these are assembled to the accelerating tube. The accelerating tube units are each 25 cm in length, and both high and low energy sides are composed of 20 units, respectively. Although about 10 -9 Torr vacuum was obtained at the both ends of the accelerating tube by baking the tube at 300 to 350 deg C with electric heaters wound outside the tube in the conventional method, vast outgas was generated, which decreased vacuum by two or three figures if breakdown occurred through the intermediary of outgas. As a method of positively outgassing and cleaning the electrodes inside the accelerating tube, it was attempted to directly bake all the electrodes in the accelerating tube by causing strong arc discharge flowing H 2 gas in the tube. As a result of considering the conditions for this method, the low voltage arc discharge was employed using oxide cathodes. Thus, after implementing 10A arc discharge for several hours, the voltage was able to be raised to 10 MV almost immediately after the vacuum recovery, and further, after another conditioning for several hours, it was successful to raise voltage up to 11 MV. (Wakatsuki, Y.)

  14. An electrode polarization impedance based flow sensor for low water flow measurement

    International Nuclear Information System (INIS)

    Yan, Tinghu; Sabic, Darko

    2013-01-01

    This note describes an electrode polarization impedance based flow sensor for low water flow measurement. It consists of two pairs of stainless steel electrodes set apart and inserted into a non-conductive flow tube with each pair of electrodes placed diametrically at the opposite sides. The flow sensor is modeled as a typical four-electrode system of which two electrodes are current-carrying and the other two serve as output pick ups. The polarization impedances of the two current carrying electrodes are affected by water flows resulting in changes of differential potential between the two pick-up electrodes which are separated by the same fluid. The interrogation of the two excitation electrodes with dc biased ac signals offers significantly higher sensor sensitivities to flow. The prototype flow sensor constructed for a 20 mm diameter pipeline was able to measure water flow rate as low as tested at 1.06 l h −1 and remained sensitive at a flow rate of 25.18 l h −1 when it was driven with a sinusoidal voltage at 1000 Hz with a peak ac amplitude of 2 V and a dc offset of +8 V. The nonlinear characteristics of the sensor response indicate that the sensor is more sensitive at low flows and will not be able to measure at very high flows. Additional experiments are needed to evaluate the influences of impurities, chemical species, ions constituents, conductivity and temperature over a practical range of residential water conditions, the effects of fluctuating ground signals, measurement uncertainty, power consumption, compensation of effects and practical operations. The flow sensor (principle) presented may be used as (in) a secondary sensor in combination with an existing electronic water meter to extend the low end of measurement range in residential water metering. (technical design note)

  15. A SVPWM based on fluctuate capacitor voltage in 3L-NPC back-to-back converter applied to wind energy

    DEFF Research Database (Denmark)

    Chen, Quan; Wang, Qunjing; Chen, Zhe

    2014-01-01

    Three-level Neutral-point-clamped (3L-NPC) converters are becoming a realistic alternative to the conventional converters in high-power wind-energy applications. But the unbalance in the supported capacitors' voltage of back-to-back 3L-NPC converters, including the dynamics of the capacitors...... between the fluctuate voltage of upper and lower capacitors is extracted. Based on this error factor the duty-time of every active voltage vector is calculated. In order to validate the model and the control strategy proposed in this paper, a 2MW 3L-NPC converter used in wind energy has been simulated....

  16. Experimental investigation of an optimum configuration for a high-voltage photoemission gun for operation at ≥500  kV

    Directory of Open Access Journals (Sweden)

    Nobuyuki Nishimori

    2014-05-01

    Full Text Available We demonstrated the generation of a 500-keV electron beam from a high dc voltage photoemission gun for an energy recovery linac light source [N. Nishimori et al., Appl. Phys. Lett. 102, 234103 (2013]. This demonstration was achieved by addressing two discharge problems that lead to vacuum breakdown in the dc gun. One is field emission generated from a central stem electrode. We employed a segmented insulator to protect the ceramic insulator surface from the field emission. The other is microdischarge at an anode electrode or a vacuum chamber, which is triggered by microparticle transfer or field emission from a cathode electrode. An experimental investigation revealed that a larger acceleration gap, optimized mainly to reduce the surface electric field of the anode electrode, suppresses the microdischarge events that accompany gas desorption. It was also found that nonevaporable getter pumps placed around the acceleration gap greatly help to suppress those microdischarge events. The applied voltage as a function of the total gas desorption is shown to be a good measure for finding the optimum dc gun configuration.

  17. Analysis of the role of PCNA-DNA contacts during clamp loading

    Directory of Open Access Journals (Sweden)

    Goedken Eric R

    2010-01-01

    Full Text Available Abstract Background Sliding clamps, such as Proliferating Cell Nuclear Antigen (PCNA in eukaryotes, are ring-shaped protein complexes that encircle DNA and enable highly processive DNA replication by serving as docking sites for DNA polymerases. In an ATP-dependent reaction, clamp loader complexes, such as the Replication Factor-C (RFC complex in eukaryotes, open the clamp and load it around primer-template DNA. Results We built a model of RFC bound to PCNA and DNA based on existing crystal structures of clamp loaders. This model suggests that DNA would enter the clamp at an angle during clamp loading, thereby interacting with positively charged residues in the center of PCNA. We show that simultaneous mutation of Lys 20, Lys 77, Arg 80, and Arg 149, which interact with DNA in the RFC-PCNA-DNA model, compromises the ability of yeast PCNA to stimulate the DNA-dependent ATPase activity of RFC when the DNA is long enough to extend through the clamp. Fluorescence anisotropy binding experiments show that the inability of the mutant clamp proteins to stimulate RFC ATPase activity is likely caused by reduction in the affinity of the RFC-PCNA complex for DNA. We obtained several crystal forms of yeast PCNA-DNA complexes, measuring X-ray diffraction data to 3.0 Å resolution for one such complex. The resulting electron density maps show that DNA is bound in a tilted orientation relative to PCNA, but makes different contacts than those implicated in clamp loading. Because of apparent partial disorder in the DNA, we restricted refinement of the DNA to a rigid body model. This result contrasts with previous analysis of a bacterial clamp bound to DNA, where the DNA was well resolved. Conclusion Mutational analysis of PCNA suggests that positively charged residues in the center of the clamp create a binding surface that makes contact with DNA. Disruption of this positive surface, which had not previously been implicated in clamp loading function, reduces RFC

  18. The evaluation on clamping force of high strength bolts by length parameter

    International Nuclear Information System (INIS)

    Kim, Kang-Seok; Nah, Hwan-Seon; Lee, Hyeon-Ju; Lee, Kang-Min

    2009-01-01

    It has been reported that the length parameter of high strength bolts results in the variance in tension loads. The required turn for each length is specified in AISC RCSC specification. This study was focused on evaluating any influence on the clamping torque subjected to length parameter of high strength bolts. The two kinds of high strength bolts of specimen are as follows; High Strength Hexagon bolt defined on ASTM A490 and Torque Shear Bolt on KS B 2819. The length parameter ranged from 60mm(3d) to 140mm(7d). The torque, turn of nut and the clamping force were analyzed to review whether length parameter can be affected on the required tension load. To test whether the length parameter has an impact on the torque and turn of nut for the required strength and clamping force, statistical analysis is carried out. (author)

  19. Fabrication of Two Columns Dye-Sensitized Solar-Cell

    International Nuclear Information System (INIS)

    Phyu Sin Khaing Oo; Su Su Hlaing; Khin Lay Thwe; Nwe Ni Khin

    2011-12-01

    A two columns dye-sensitized solar cell has been fabricated using dye extract form teak leaves. This solar cell was assembled with two 20-30 ohms conductive glasses (one for TiO2 coated electrode and another for carbon coated electrode), TiO2 nano-powder P25, iodide electrolyte solution and soft graphite pencil for carbon coating. It was found that the open circuit voltage Voc was 0.688V and the short circuit Isc was 0.724mA

  20. File list: Oth.ALL.50.Clamp.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.50.Clamp.AllCell dm3 TFs and others Clamp All cell types SRX159172,SRX15917...0,SRX159174,SRX159166,SRX159173 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Oth.ALL.50.Clamp.AllCell.bed ...

  1. Water transport by Na+-coupled cotransporters of glucose (SGLT1) and of iodide (NIS). The dependence of substrate size studied at high resolution

    DEFF Research Database (Denmark)

    Zeuthen, Thomas; Belhage, Bo; Zeuthen, Emil

    2005-01-01

    and osmosis at the membrane with diffusion in the cytoplasm. The combination of high resolution measurements and precise modelling showed that water transport across the membrane can be explained by cotransport of water in the membrane proteins and that intracellular unstirred layers effects are minute.......The relation between substrate and water transport was studied in Na+-coupled cotransporters of glucose (SGLT1) and of iodide (NIS) expressed in Xenopus oocytes. The water transport was monitored from changes in oocyte volume at a resolution of 20 pl, more than one order of magnitude better than...... previous investigations. The rate of cotransport was monitored as the clamp current obtained from two-electrode voltage clamp. The high resolution data demonstrated a fixed ratio between the turn-over of the cotransporter and the rate of water transport. This applied to experiments in which the rate...

  2. Electrode and limiter biasing experiments on the tokamak ISTTOK

    International Nuclear Information System (INIS)

    Silva, C.; Figueiredo, H.; Cabral, J.A.C.; Nedzelsky, I.; Varandas, C.A.F.

    2003-01-01

    In this contribution limiter and electrode biasing experiments are compared, in particular in what concerns their effects on the edge plasma parameters. For electrode AC bias a substantial increase (>50%) in the average plasma density is observed with positive voltage, without significant changes in the edge density, leading to steeper profiles. The ratio n e /Hα also increases significantly (>20%), indicating an improvement in gross particle confinement. The plasma potential profile is strongly modified as both the edge E r and its shear increase significantly. For positive limiter bias an increase in the average plasma density and the radiation losses is observed, resulting in almost no modification, or a slight, in particle confinement. Preliminary results of simultaneous electrode and limiter bias experiments show that the control of the plasma potential profile is very limited, since negative voltages do not modify the plasma parameters significantly. (author)

  3. Flexible conductive-bridging random-access-memory cell vertically stacked with top Ag electrode, PEO, PVK, and bottom Pt electrode

    Science.gov (United States)

    Seung, Hyun-Min; Kwon, Kyoung-Cheol; Lee, Gon-Sub; Park, Jea-Gun

    2014-10-01

    Flexible conductive-bridging random-access-memory (RAM) cells were fabricated with a cross-bar memory cell stacked with a top Ag electrode, conductive polymer (poly(n-vinylcarbazole): PVK), electrolyte (polyethylene oxide: PEO), bottom Pt electrode, and flexible substrate (polyethersulfone: PES), exhibiting the bipolar switching behavior of resistive random access memory (ReRAM). The cell also exhibited bending-fatigue-free nonvolatile memory characteristics: i.e., a set voltage of 1.0 V, a reset voltage of -1.6 V, retention time of >1 × 105 s with a memory margin of 9.2 × 105, program/erase endurance cycles of >102 with a memory margin of 8.4 × 105, and bending-fatigue-free cycles of ˜1 × 103 with a memory margin (Ion/Ioff) of 3.3 × 105.

  4. Electrodes for bio-application: recording and stimulation

    International Nuclear Information System (INIS)

    Fontes, M B A

    2013-01-01

    Recording and stimulation electrodes applied on excitable tissue are the basis of electrophysiological research, such as brain, muscles, peripheral nerves or sensory systems. Electrode-electrolyte impedance is one of the important characteristics due to its influence on the signal/noise ratio, signal distortion and built-up voltage. Strategies to lowering and tuning the impedance are achieved by biasing iridium oxide modified platinum microelectrodes. Surface and impedance analysis after pulse stimulation are also addressed.

  5. Cavallo's multiplier for in situ generation of high voltage

    Science.gov (United States)

    Clayton, S. M.; Ito, T. M.; Ramsey, J. C.; Wei, W.; Blatnik, M. A.; Filippone, B. W.; Seidel, G. M.

    2018-05-01

    A classic electrostatic induction machine, Cavallo's multiplier, is suggested for in situ production of very high voltage in cryogenic environments. The device is suitable for generating a large electrostatic field under conditions of very small load current. Operation of the Cavallo multiplier is analyzed, with quantitative description in terms of mutual capacitances between electrodes in the system. A demonstration apparatus was constructed, and measured voltages are compared to predictions based on measured capacitances in the system. The simplicity of the Cavallo multiplier makes it amenable to electrostatic analysis using finite element software, and electrode shapes can be optimized to take advantage of a high dielectric strength medium such as liquid helium. A design study is presented for a Cavallo multiplier in a large-scale, cryogenic experiment to measure the neutron electric dipole moment.

  6. Carbon electrode for desalination purpose in capacitive deionization

    International Nuclear Information System (INIS)

    Endarko,; Fadilah, Nurul; Anggoro, Diky

    2016-01-01

    Carbon electrodes for desalination purpose have been successfully synthesized using activated carbon powder (BET surface area=700 – 1400 m 2 /g), carbon black and polyvinyl alcohol (PVA) binder by cross-linking method with glutaric acid (GA) at 120 °C. The electrochemical properties of the carbon electrodes were analyzed using electrical impedance spectroscopy (EIS) and cyclic voltammetry (CV) whilst the physical properties were observed with scanning electron microscopy with energy dispersive X-ray spectroscopy (SEM/EDX). In order to assess the desalting performance, salt removal experiments were performed by constructing a capacitive deionization unit cell with five pairs of carbon electrodes. For each pair consisted of two parallel carbon electrodes separated by a spacer. Desalination and regeneration processes were also observed in the salt-removal experiments. The salt-removal experiments were carried out in single-pass mode using a solution with 0.1 M NaCl at a flow rate of 10 mL/min. A voltage of 3 V was applied to the cell for 60 minutes for both processes in desalination and regeneration. The result showed that the percentage value of the salt-removal was achieved at 20%.

  7. Carbon electrode for desalination purpose in capacitive deionization

    Energy Technology Data Exchange (ETDEWEB)

    Endarko,, E-mail: endarko@physics.its.ac.id; Fadilah, Nurul; Anggoro, Diky [Physics Department, Institut Teknologi Sepuluh Nopember (ITS) Kampus ITS, Sukolilo Surabaya 60111, Jawa Timur (Indonesia)

    2016-03-11

    Carbon electrodes for desalination purpose have been successfully synthesized using activated carbon powder (BET surface area=700 – 1400 m{sup 2}/g), carbon black and polyvinyl alcohol (PVA) binder by cross-linking method with glutaric acid (GA) at 120 °C. The electrochemical properties of the carbon electrodes were analyzed using electrical impedance spectroscopy (EIS) and cyclic voltammetry (CV) whilst the physical properties were observed with scanning electron microscopy with energy dispersive X-ray spectroscopy (SEM/EDX). In order to assess the desalting performance, salt removal experiments were performed by constructing a capacitive deionization unit cell with five pairs of carbon electrodes. For each pair consisted of two parallel carbon electrodes separated by a spacer. Desalination and regeneration processes were also observed in the salt-removal experiments. The salt-removal experiments were carried out in single-pass mode using a solution with 0.1 M NaCl at a flow rate of 10 mL/min. A voltage of 3 V was applied to the cell for 60 minutes for both processes in desalination and regeneration. The result showed that the percentage value of the salt-removal was achieved at 20%.

  8. E-beam high voltage switching power supply

    Science.gov (United States)

    Shimer, Daniel W.; Lange, Arnold C.

    1997-01-01

    A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360.degree./n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load.

  9. E-beam high voltage switching power supply

    International Nuclear Information System (INIS)

    Shimer, D.W.; Lange, A.C.

    1997-01-01

    A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360 degree/n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load. 7 figs

  10. Clinicians? and womens? experiences of two consent pathways in a trial of timing of clamping at very preterm birth: a qualitative study

    OpenAIRE

    Ayers, Susan; Sawyer, Alex; Chhoa, Celine; Pushpa-Rajah, Angela; Duley, Lelia

    2015-01-01

    Background\\ud Recruitment to trials when birth is imminent requires offering consent at a difficult and stressful time, often with limited time. The Cord Pilot Trial assessed timing of cord clamping at very preterm birth. To ensure high risk women were not excluded we developed a two stage oral assent pathway, for use when birth was imminent. A third of women were recruited using this pathway. The aim of this study was to explore clinicians’ and women’s’ experiences of the two consent pathway...

  11. Low Impedance Carbon Adhesive Electrodes with Long Shelf Life.

    Science.gov (United States)

    Posada-Quintero, Hugo F; Reyes, Bersaín A; Burnham, Ken; Pennace, John; Chon, Ki H

    2015-10-01

    A novel electrocardiogram (ECG) electrode film is developed by mixing carbon black powder and a quaternary salt with a visco-elastic polymeric adhesive. Unlike traditional wet gel-based electrodes, carbon/salt/adhesive (CSA) electrodes should theoretically have an infinite shelf life as they do not dehydrate even after a prolonged period of storage. The CSA electrodes are electrically activated for use through the process of electrophoresis. Specifically, the activation procedure involves sending a high voltage and current through the electrode, which results in significant reduction of impedance so that high fidelity ECG signals can be obtained. Using the activation procedure, the ideal concentration of carbon black powder in the mixture with the adhesive was examined. It was determined that the optimum concentration of carbon black which minimized post-activation impedance was 10%. Once the optimal carbon black powder concentration was determined, extensive signal analysis was performed to compare the performance of the CSA electrodes to the standard silver-silver chloride (Ag/AgCl) electrodes. As a part of data analysis, electrode-skin contact impedance of the CSA was measured and compared to the standard Ag/AgCl electrodes; we found consistently lower impedance for CSA electrodes. For quantitative data analysis, we simultaneously collected ECG data with CSA and Ag/AgCl electrodes from 17 healthy subjects. Heart rate variability (HRV) indices and ECG morphological waveforms were calculated to compare CSA and Ag/AgCl electrodes. Non-significant differences for most of the HRV indices between CSA and Ag/AgCl electrodes were found. Of the morphological waveform metrics consisting of R-wave peak amplitude, ST-segment elevation and QT interval, only the first index was found to be significantly different between the two media. The response of CSA electrodes to motion artifacts was also tested, and we found in general no difference in the quality of the ECG signal

  12. A compact 100 kV high voltage glycol capacitor.

    Science.gov (United States)

    Wang, Langning; Liu, Jinliang; Feng, Jiahuai

    2015-01-01

    A high voltage capacitor is described in this paper. The capacitor uses glycerol as energy storage medium, has a large capacitance close to 1 nF, can hold off voltages of up to 100 kV for μs charging time. Allowing for low inductance, the capacitor electrode is designed as coaxial structure, which is different from the common structure of the ceramic capacitor. With a steady capacitance at different frequencies and a high hold-off voltage of up to 100 kV, the glycol capacitor design provides a potential substitute for the ceramic capacitors in pulse-forming network modulator to generate high voltage pulses with a width longer than 100 ns.

  13. Acoustic performance of dual-electrode electrostatic sound generators based on CVD graphene on polyimide film.

    Science.gov (United States)

    Lee, Kyoung-Ryul; Jang, Sung Hwan; Jung, Inhwa

    2018-08-10

    We investigated the acoustic performance of electrostatic sound-generating devices consisting of bi-layer graphene on polyimide film. The total sound pressure level (SPL) of the sound generated from the devices was measured as a function of source frequency by sweeping, and frequency spectra were measured at 1/3 octave band frequencies. The relationship between various operation conditions and total SPL was determined. In addition, the effects of changing voltage level, adding a DC offset, and using two pairs of electrodes were evaluated. It should be noted that two pairs of electrode operations improved sound generation by about 10 dB over all frequency ranges compared with conventional operation. As for the sound-generating capability, total SPL was 70 dBA at 4 kHz when an AC voltage of 100 V pp was applied with a DC offset of 100 V. Acoustic characteristics differed from other types of graphene-based sound generators, such as graphene thermoacoustic devices and graphene polyvinylidene fluoride devices. The effects of diameter and distance between electrodes were also studied, and we found that diameter greatly influenced the frequency response. We anticipate that the design information provided in this paper, in addition to describing key parameters of electrostatic sound-generating devices, will facilitate the commercial development of electrostatic sound-generating systems.

  14. Preparation of Electrospun Polymer Fibers Using a Copper Wire Electrode in a Capillary Tube

    Science.gov (United States)

    Shinbo, Kazunari; Onozuka, Shintaro; Hoshino, Rikiya; Mizuno, Yoshinori; Ohdaira, Yasuo; Baba, Akira; Kato, Keizo; Kaneko, Futao

    2010-04-01

    Polymer fibers were prepared by an electrospinning method utilizing a copper wire electrode in a capillary tube. The morphology of electrospun poly(vinyl alcohol) (PVA) fibers was observed, and was found to be dependent on the wire electrode tip position in the capillary tube, the concentration of the polymer solution, the distance between the electrodes, and the applied voltage. By using the wire electrode, the experimental setup is simple and the distance between the electrodes and the applied voltage can be easily reduced. Furthermore, the preparation of poly(3-hexylthiophene) (P3HT) fibers was carried out. P3HT fibers were successfully prepared by mixing poly(ethylene oxide) (PEO) in P3HT solution. Orientation control was also carried out by depositing the fibers on a rotating collector electrode, and the alignment of the P3HT:PEO fibers was confirmed. Anisotropy of the optical absorption spectra was also observed for the aligned fibers.

  15. Radiofrequency ablation in the liver using two cooled-wet electrodes in the bipolar mode

    International Nuclear Information System (INIS)

    Han, Joon Koo; Lee, Jeong Min; Kim, Se Hyung; Lee, Jae Young; Park, Hee Sun; Eo, Hong; Choi, Byung Ihn

    2005-01-01

    The purpose of this study was to demonstrate the efficacy of bipolar radiofrequency ablation (RFA) using cooled-wet electrodes inducing coagulation in ex vivo bovine livers and in in vivo canine livers. In ex vivo experiments, 20 coagulations were created by monopolar (group A), and bipolar RFA (group B) using a 200 W generator (Valleylab) and one or two cooled-wet electrodes. In in vivo experiments, one coagulation was created by bipolar RFA in each of eight dogs via laparotomy. In ex vivo and in vivo experiments, RF was applied to one or two electrodes at 100 W for 10 min. The dimensions of the coagulations were compared in the two groups. In ex vivo experiments, the mean volumes of the coagulations produced in group B (54.0±16.5 cm 3 ) were greater than those produced in group A (33.9±12.7 cm 3 ) (P=0.007). In in vivo experiments, bipolar RFA produced a coagulation of 39.4±15.6 cm 3 without a major complication. The present study showed that a RF electrode system using two cooled-wet electrodes in the bipolar mode created larger coagulation volumes than the monopolar mode, and this system can be used to create large coagulation without major complications. (orig.)

  16. A New Approach to High Efficincy in Isolated Boost Converters for High-Power Low-Voltage Fuel Cell Apllications

    DEFF Research Database (Denmark)

    Nymand, Morten; Andersen, Michael A. E.

    2008-01-01

    A new low-leakage-inductance low-resistance design approach to low-voltage high-power isolated boost converters is presented. Very low levels of parasitic circuit inductances are achieved by optimizing transformer design and circuit lay-out. Primary side voltage clamp circuits can be eliminated...... by the use of power MOSFETs fully rated for repetitive avalanche. Voltage rating of primary switches can now be reduced, significantly reducing switch on-state losses. Finally, silicon carbide rectifying diodes allow fast diode turn-off, further reducing losses. Test results from a 1.5 kW full-bridge boost...... converter verify theoretical analysis and demonstrate very high efficiency. Worst case efficiency, at minimum input voltage maximum power, is 96.8 percent and maximum efficiency reaches 98 percent....

  17. High Voltage Design Considerations for the Electrostatic Septum for the Mu2e Beam Resonant

    Energy Technology Data Exchange (ETDEWEB)

    Alvarez, Matthew L. [Fermilab; Jensen, C.; Morris, D.; Nagaslaev, V.; Pham, H.; Tinsley, D.

    2018-04-01

    aTwo electrostatic septa (ESS) are being designed for the slow extraction of 8GeV proton beam for the Mu2e experiment at Fermilab. Special attention is given to the high voltage components that affect the performance of the septa. The components under consideration are the high voltage (HV) feedthrough, cathode standoff (CS), and clearing electrode ceramic standoffs (CECS). Previous experience with similar HV systems at Fermilab was used to define the evaluation criteria of the design of the high voltage components. Using electric field simulation software, high E-field intensities on the components and integrated field strength along the surface of the dielectric material were minimized. Here we discuss the limitations found and improvements made based on those studies.

  18. Control of local intracellular calcium concentration with dynamic-clamp controlled 2-photon uncaging.

    Directory of Open Access Journals (Sweden)

    Erwin Idoux

    Full Text Available The variations of the intracellular concentration of calcium ion ([Ca(2+](i are at the heart of intracellular signaling, and their imaging is therefore of enormous interest. However, passive [Ca(2+](i imaging provides no control over these variations, meaning that a full exploration of the functional consequences of [Ca(2+](i changes is difficult to attain. The tools designed so far to modify [Ca(2+](i, even qualitatively, suffer drawbacks that undermine their widespread use. Here, we describe an electro-optical technique to quantitatively set [Ca(2+](i, in real time and with sub-cellular resolution, using two-photon Ca(2+ uncaging and dynamic-clamp. We experimentally demonstrate, on neurons from acute olfactory bulb slices of Long Evans rats, various capabilities of this technique previously difficult to achieve, such as the independent control of the membrane potential and [Ca(2+](i variations, the functional knocking-in of user-defined virtual voltage-dependent Ca(2+ channels, and the standardization of [Ca(2+](i patterns across different cells. Our goal is to lay the groundwork for this technique and establish it as a new and versatile tool for the study of cell signaling.

  19. Study of electric discharges between moving electrodes in air

    International Nuclear Information System (INIS)

    Andreev, V. V.; Pichugin, Yu. P.; Telegin, V. G.; Telegin, G. G.

    2011-01-01

    A barrier electric discharge excited between a fixed electrode and a rotating electrode covered with a dielectric layer in atmospheric-pressure air is studied experimentally. A distinctive feature of this type of discharge is that it operates at a constant voltage between the electrodes. An advantage of the proposed method for plasma generation in the boundary layer of the rotating electrode (e.g., for studying the influence of plasma on air flows) is the variety of forms of the discharge and conditions for its initiation, simplicity of the design of the discharge system, and ease of its practical implementation

  20. Study of electric discharges between moving electrodes in air

    Energy Technology Data Exchange (ETDEWEB)

    Andreev, V. V.; Pichugin, Yu. P.; Telegin, V. G.; Telegin, G. G. [Chuvash State University (Russian Federation)

    2011-12-15

    A barrier electric discharge excited between a fixed electrode and a rotating electrode covered with a dielectric layer in atmospheric-pressure air is studied experimentally. A distinctive feature of this type of discharge is that it operates at a constant voltage between the electrodes. An advantage of the proposed method for plasma generation in the boundary layer of the rotating electrode (e.g., for studying the influence of plasma on air flows) is the variety of forms of the discharge and conditions for its initiation, simplicity of the design of the discharge system, and ease of its practical implementation.

  1. Indirect Electrochemical Oxidation with Multi Carbon Electrodes for Restaurant Wastewater Treatment

    Directory of Open Access Journals (Sweden)

    I Dewa Ketut Sastrawidana

    2018-01-01

    Full Text Available The removal of organic matter from the restaurant wastewater was investigated using the electrochemical oxida-tion method with multi carbon electrodes in a parallel construction. The degradation process was monitored by the measurement of COD concentration as a function of electrolysis time. The effectof operating parameter conditions on COD removal were investigated including initial pH, distance between electrodes, and the applied voltage difference.The results showed that the treatment of restaurant wastewater containing 2 g/L chloride ion using the electrochemical oxidation technique at the operation conditions characterized by: pH 5, distance between electrode of 10 cm and applied voltage of 12 V, enabled to obtained COD removal of 92.84% within 90 min electrolysis time. It is can be concluded that the indirect electrochemical oxidation method with multi carbon electrodes can be used effectivelyas an alternative technology for reducing COD and may be potentially applied for removal organic pollutants from wastewater at the industrial scale.

  2. Development of a mesh-type computer tomography for the two-phase flow

    International Nuclear Information System (INIS)

    Lee, Jae Young; Lee, In Wook

    1998-01-01

    This paper is to describe the development of a mesh-type computer tomography for the two-phase flow. The sensor is made of many parallel wires in the orthogonal orientation. A demultiplexer circuits is developed for electrodes to supply driving voltage and for data acquisition system to get the output voltage form the electrode unit. For the reconstruction of image a direct inversion algorithm is adopted. Full automation is provided from the data sensing to the image construction. Through the careful calibariation and field tests in the horizontal and vertical two-phase loop, the present sensor detect images for the solitary wave and the slug realistically. This sensor could be a useful tool in the laboratory experiments

  3. New strategy for eliminating zero-sequence circulating current between parallel operating three-level NPC voltage source inverters

    DEFF Research Database (Denmark)

    Li, Kai; Dong, Zhenhua; Wang, Xiaodong

    2018-01-01

    A novel strategy based on a zero common mode voltage pulse-width modulation (ZCMV-PWM) technique and zero-sequence circulating current (ZSCC) feedback control is proposed in this study to eliminate ZSCCs between three-level neutral point clamped (NPC) voltage source inverters, with common AC and DC......, the ZCMV-PWM method is presented to reduce CMVs, and a simple electric circuit is adopted to control ZSCCs and neutral point potential. Finally, simulation and experiment are conducted to illustrate effectiveness of the proposed strategy. Results show that ZSCCs between paralleled inverters can...

  4. Dielectric capacitors with three-dimensional nanoscale interdigital electrodes for energy storage.

    Science.gov (United States)

    Han, Fangming; Meng, Guowen; Zhou, Fei; Song, Li; Li, Xinhua; Hu, Xiaoye; Zhu, Xiaoguang; Wu, Bing; Wei, Bingqing

    2015-10-01

    Dielectric capacitors are promising candidates for high-performance energy storage systems due to their high power density and increasing energy density. However, the traditional approach strategies to enhance the performance of dielectric capacitors cannot simultaneously achieve large capacitance and high breakdown voltage. We demonstrate that such limitations can be overcome by using a completely new three-dimensional (3D) nanoarchitectural electrode design. First, we fabricate a unique nanoporous anodic aluminum oxide (AAO) membrane with two sets of interdigitated and isolated straight nanopores opening toward opposite planar surfaces. By depositing carbon nanotubes in both sets of pores inside the AAO membrane, the new dielectric capacitor with 3D nanoscale interdigital electrodes is simply realized. In our new capacitors, the large specific surface area of AAO can provide large capacitance, whereas uniform pore walls and hemispheric barrier layers can enhance breakdown voltage. As a result, a high energy density of 2 Wh/kg, which is close to the value of a supercapacitor, can be achieved, showing promising potential in high-density electrical energy storage for various applications.

  5. Large Magnetoresistance at High Bias Voltage in Double-layer Organic Spin Valves

    Science.gov (United States)

    Subedi, R. C.; Liang, S. H.; Geng, R.; Zhang, Q. T.; Lou, L.; Wang, J.; Han, X. F.; Nguyen, T. D.

    We report studies of magnetoresistance (MR) in double-layer organic spin valves (DOSV) using tris (8-hydroxyquinolinato) aluminum (Alq3) spacers. The device exhibits three distinct resistance levels depending on the relative magnetizations of the ferromagnetic electrodes. We observed a much weaker bias voltage dependence of MR in the device compared to that in the conventional organic spin valve (OSV). The MR magnitude reduces by the factor of two at 0.7 V bias voltage in the DOSV compared to 0.02 V in the conventional OSV. Remarkably, the MR magnitude reaches 0.3% at 6 V bias in the DOSVs, the largest MR response ever reported in OSVs at this bias. Our finding may have a significant impact on achieving high efficient bipolar OSVs strictly performed at high voltages. University of Georgia start-up fund, Ministry of Education, Singapore, National Natural Science Foundation of China.

  6. Liquid-crystal microlens array with swing and adjusting focus and constructed by dual patterned ITO-electrodes

    Science.gov (United States)

    Dai, Wanwan; Xie, Xingwang; Li, Dapeng; Han, Xinjie; Liu, Zhonglun; Wei, Dong; Xin, Zhaowei; Zhang, Xinyu; Wang, Haiwei; Xie, Changsheng

    2018-02-01

    Under the condition of existing intense turbulence, the object's wavefront may be severely distorted. So, the wavefront sensors based on the traditional microlens array (MLA) with a fixed focal length can not be used to measure the wavefront effectively. In order to obtain a larger measurement range and higher measurement accuracy, we propose a liquid-crystal microlens array (LCMLA) with needed ability of swing focus over the focal plane and further adjusting focal length, which is constructed by a dual patterned ITO electrodes. The main structure of the LCMLA is divided into two layers, which are made of glass substrate with ITO transparent electrodes. The top layer of each liquid-crystal microlens consists of four rectangular electrodes, and the bottom layer is a circular electrode. In common optical measurements performed, the operations are carried out such as adding the same signal voltage over four electrodes of each microlens to adjust the focal length of the lens cell and adding a signal voltage with different RMS amplitude to adjust the focus position on the focal plane. Experiments show that the LCMLA developed by us demonstrate a desired focal length adjustable function and dynamic swing ability, so as to indicate that the method can be used not only to measure wavefront but also correct the wavefront with strong distortion.

  7. Curare Alkaloids: Constituents of a Matis Dart Poison.

    Science.gov (United States)

    Malca Garcia, Gonzalo R; Hennig, Lothar; Shelukhina, Irina V; Kudryavtsev, Denis S; Bussmann, Rainer W; Tsetlin, Victor I; Giannis, Athanassios

    2015-11-25

    A phytochemical study of dart and arrow poison from the Matis tribe led to the identification of D-(-)-quinic acid, L-malic acid, ethyldimethylamine, magnoflorine, and five new bisbenzyltetrahydroisoquinoline alkaloids (BBIQAs), 1-5. D-Tubocurarine could not be identified among these products. BBIQA (3) contains a unique linkage at C-8 and C-11'. All structures were characterized by a combination of NMR and HRESIMS data. The effects of Matis poison and individual BBIQAs (1-3) on rat muscle nAChR expressed in Xenopus oocytes have been investigated using the two-electrode voltage clamp technique.

  8. Variable wide range of lens power and its improvement in a liquid-crystal lens using highly resistive films divided into two regions with different diameters

    Science.gov (United States)

    Kawamura, Marenori; Sato, Susumu

    2018-05-01

    The variable range of lens power of a liquid-crystal (LC) lens driven by two voltages is discussed on the basis of calculated and experimental results. The LC lens has two electrodes, which are a circularly hole-patterned electrode and a circular electrode, in addition to a common electrode, and highly resistive transparent films. The variable range of lens power increases with increasing driving voltage applied across the circularly hole-patterned electrode and the common electrode, and with decreasing diameter of highly resistive films. However, the optical-phase retardation profile tends to deviate from a parabolic curve in these cases. As a method to improve the trade-off properties, the highly resistive film is divided into two regions with different diameters, where the sheet resistance of an outer film is larger than that of an inner one. The improved LC lens has a lens power that varies in a wide range, and it exhibits a good parabolic phase retardation profile.

  9. Low Voltage Ride-Through of Two-Stage Grid-Connected Photovoltaic Systems Through the Inherent Linear Power-Voltage Characteristic

    DEFF Research Database (Denmark)

    Yang, Yongheng; Sangwongwanich, Ariya; Liu, Hongpeng

    2017-01-01

    In this paper, a cost-effective control scheme for two-stage grid-connected PhotoVoltaic (PV) systems in Low Voltage Ride-Through (LVRT) operation is proposed. In the case of LVRT, the active power injection by PV panels should be limited to prevent from inverter over-current and also energy...... aggregation at the dc-link, which will challenge the dc-link capacitor lifetime if remains uncontrolled. At the same time, reactive currents should be injected upon any demand imposed by the system operators. In the proposed scheme, the two objectives can be feasibly achieved. The active power is regulated...... point tracking controller without significant hardware or software modifications. In this way, the PV system will not operate at the maximum power point, whereas the inverter will not face any over-current challenge but can provide reactive power support in response to the grid voltage fault...

  10. A planar lens based on the electrowetting of two immiscible liquids

    International Nuclear Information System (INIS)

    Liu Chaoxuan; Park, Jihwan; Choi, Jin-Woo

    2008-01-01

    This paper reports the development and characterization of a planar liquid lens based on electrowetting. The working concept of electrowetting two immiscible liquids is demonstrated with measurement and characterization of contact angles with regard to externally applied electric voltages. Consequently, a planar liquid lens is designed and implemented based on this competitive electrowetting. A droplet of silicone oil confined in an aqueous solution (1% KCl) works as a liquid lens. Electrowetting then controls the shape of the confined silicone oil and the focal length of the liquid lens varies depending upon an applied dc voltage. A unique feature of this lens design is the double-ring planar electrodes beneath the hydrophobic substrate. While an outer ring electrode provides an initial boundary for the silicone oil droplet, an inner ring works as the actuation electrode for the lens. Further, the planar electrodes, instead of vertical or out-of-plane wall electrodes, facilitate the integration of liquid lenses into microfluidic systems. With the voltage applied in the range of 50–250 V, the confined silicone oil droplet changed its shape and the optical magnification of a 3 mm-diameter liquid lens was clearly demonstrated. Moreover, focal lengths of liquid lenses with diameters of 2 mm, 3 mm and 4 mm were characterized, respectively. The obtained results suggest that a larger lens diameter yields a longer focal length and a wider range of focal length change in response to voltage. The demonstrated liquid lens has a simple structure and is easy to fabricate

  11. Tuning permanent magnets with adjustable field clamps

    International Nuclear Information System (INIS)

    Schermer, R.I.

    1987-01-01

    The effective length of a permanent-magnet assembly can be varied by adjusting the geometrical parameters of a field clamp. This paper presents measurements on a representative dipole and quadrupole as the field clamp is withdrawn axially or radially. The detailed behavior depends upon the magnet multipolarity and geometry. As a rule-of-thumb, a 3-mm-thick iron plate placed at one end plane of the magnet will shorten the length by one-third of the magnet bore radius

  12. Analysis and Experiments on Sea Load and Fastened Mechanics on Pipe Clamps

    Directory of Open Access Journals (Sweden)

    Wang Zhuo

    2017-08-01

    Full Text Available When an offshore oil field completed and put into production, new subsea pipelines and the new cable need to be established. Cable protection pipe clamp is used to fix cable protection pipe on the jacket. In order to avoid the problem of traditional steel structure clamp splice, counterpoint, fastening difficulty when installed cable protection pipe under water, reduce the risk and workload of under water, This paper develop a new type of portable connecting riser clamp -“backpack clamp” which solve the riser cable protection pipe difficult underwater installation problem. The main structure of backpack clamp used three valves type structure. The load characteristic of a clamping device was determined by the Morison equation which was a classical theory. Clamp device underwater mechanics analysis model was established. The minimum tension pre-tightening force was determined. The results show that the strength of the base meets the requirements after strength analysis with finite element analysis method, stability and strength experiments, which means the clamp based on resin matrix composite is feasible.

  13. A new linear induction voltage adder approach to radiography

    International Nuclear Information System (INIS)

    Mazarakis, M.G.; Poukey, J.W.; Frost, C.A.; Johnson, D.L.; Shope, S.L.; Halbleib, J.A.; Prestwich, K.R.; Turman, B.N.; Smith, I.

    1992-01-01

    At present, two types of accelerators are being utilized for x-ray radiography: first a linear RF or induction accelerator with multiple accelerating gaps and beam vacuum magnetic transport systems; and second, single gap pulse-power devices with a high voltage Blumlein pulse forming line. The authors present a conceptual design of a new type of linear induction accelerator that can bridge the gap between the two devices. It can produce 30--50-kA electron currents small diameter (∼ 1 mm) and high energy (12--20-MV) beams. There is no beam drifting through the device. The voltage addition of the accelerating gaps occurs at the central self-magnetically insulated cathode electrode. The electron beam is created at the high voltage end in a single gap diode. A magnetically-immersed foilless diode can produce high quality 0.5 mm radius 30--50 kA beams. A short 100--200-kG small bore solenoidal coil is required to maintain the beam radius during transport from the cathode tips to the x-ray converter target, 50--70 cm downstream. The idea of very high impedance MITL voltage adder accelerators was first tested with RADLAC II/SMILE experiments where 12--14-MV, 50-kA 1 cm radius beams were produced with 2--3 mm annulus thickness. A 12.5 m eight-stage voltage adder was utilized, coupled to a 20 kG magnetically immersed foilless diode. In addition the magnetically-immersed foilless diodes with very thin (mm diameter) cathode tips were investigated in experiments with the IBEX accelerator. As an example of this new accelerator technology the authors present the following point design for a 16-MV, 50-kA accelerator producing 1-mm diameter electron beams. The design is based on a cavity fed MITL voltage adder which performs the series addition of the voltage pulses from 16 identical inductively-isolated cavity feed systems. Each cavity is a structure that is driven by one 14 ohm pulse-forming line, providing a 1 MV voltage pulse to the accelerating gap

  14. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  15. Cermet insert high voltage holdoff for ceramic/metal vacuum devices

    Science.gov (United States)

    Ierna, William F.

    1987-01-01

    An improved metal-to-ceramic seal is provided wherein the ceramic body of the seal contains an integral region of cermet material in electrical contact with the metallic member, e.g., an electrode, of the seal. The seal is useful in high voltage vacuum devices, e.g., vacuum switches, and increases the high-voltage holdoff capabilities of such devices. A method of fabricating such seals is also provided.

  16. Voltage-sensing phosphatase modulation by a C2 domain

    Directory of Open Access Journals (Sweden)

    Paul M. Castle

    2015-04-01

    Full Text Available The voltage-sensing phosphatase (VSP is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD, the inter-domain linker, the cytosolic catalytic domain and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate (PI(4,5P2 (Kalli et al., 2014. Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in

  17. Effects of Voltage-Gated K+ Channel on Cell Proliferation in Multiple Myeloma

    Directory of Open Access Journals (Sweden)

    Wei Wang

    2014-01-01

    Full Text Available Objective. To study the effects and underlying mechanisms of voltage-gated K+ channels on the proliferation of multiple myeloma cells. Methods. RPMI-8226 MM cell line was used for the experiments. Voltage-gated K+ currents and the resting potential were recorded by whole-cell patch-clamp technique. RT-PCR detected Kv channel mRNA expression. Cell viability was analyzed with MTT assay. Cell counting system was employed to monitor cell proliferation. DNA contents and cell volume were analyzed by flow cytometry. Results. Currents recorded in RPMI-8226 cells were confirmed to be voltage-gated K+ channels. A high level of Kv1.3 mRNA was detected but no Kv3.1 mRNA was detected in RPMI-8226 cells. Voltage-gated K+ channel blocker 4-aminopyridine (4-AP (2 mM depolarized the resting potential from −42 ± 1.7 mV to −31.8 ± 2.8 mV (P0.05. Conclusions. In RPMI-8226, voltage-gated K+ channels are involved in proliferation and cell cycle progression its influence on the resting potential and cell volume may be responsible for this process; the inhibitory effect of the voltage-gated K+ channel blocker on RPMI-8226 cell proliferation is a phase-specific event.

  18. Method to minimize the low-frequency neutral-point voltage oscillations with time-offset injection for neutral-point-clamped inverters

    DEFF Research Database (Denmark)

    Choi, Uimin; Lee, Kyo-Beum; Blaabjerg, Frede

    2013-01-01

    This paper proposes a method to reduce the low-frequency neutral-point voltage oscillations. The neutral-point voltage oscillations are considerably reduced by adding a time-offset to the three phase turn-on times. The proper time-offset is simply calculated considering the phase currents and dwell...

  19. Kinetics of Ca2+- and ATP-dependent, voltage-controlled anion conductance in the plasma membrane of mesophyll cells of Pisum sativum

    NARCIS (Netherlands)

    Elzenga, J.T.M.; van Volkenburgh, E.

    Whole-cell patch-clamp techniques were used to measure anion currents through the plasma membrane of protoplasts of mesophyll cells of expanding pea (Pisum sativum L.) leaves. Voltage-induced changes of the currents could be modelled with single exponential activation and deactivation kinetics. The

  20. Simulation and optimization of a polymer directional coupler electro-optic switch with push pull electrodes

    Science.gov (United States)

    Zheng, Chuan-Tao; Ma, Chun-Sheng; Yan, Xin; Wang, Xian-Yin; Zhang, Da-Ming

    2008-07-01

    Structural model and design technique are proposed for a polymer directional coupler electro-optic switch with rib waveguides and push-pull electrodes, of which the electric field distribution is analyzed by the conformal transforming method and image method. In order to get the minimum mode loss and the minimum switching voltage, the parameters of the waveguide and electrode are optimized, such as the core with, core thickness, buffer layer between the core and the electrode, coupling gap between the waveguides, electrode thickness, electrode width and electrode gap. Switching Characteristics are analyzed, which include the output power, insertion loss, and crosstalk. To realize normal switching function, the fabrication error, spectrum shift, and coupling loss between a single mode fiber (SMF) and the waveguide are discussed. Simulation results show that the coupling length is 3082 μm, push-pull switching voltage is 2.14 V, insertion loss is less than 1.17 dB, and crosstalk is less than -30 dB for the designed device.