WorldWideScience

Sample records for tursiops truncatus resident

  1. Training Atlantic Bottlenose Dolphins (Tursiops truncatus) for Artificial Insemination

    Science.gov (United States)

    1988-07-01

    TURSIOPS TRUNCATUS) FOR ARTIFICIAL INSEMINATION 12. PERSONAL AUTHOR(S) K. V. Keller, Jr. 1a. TYPE OF REPORT 13b. TIME COVERED 14. DATE OF REPORT IlYai. WMt...ATLANTIC BOTTLENOSE DOLPHINS (Tursiops truncatus) FOR ARTIFICIAL INSEMINATION Karl V. Keller Naval Ocean Systems Center, Hawaii Laboratory Kailua, HI 96734...INTRODUCTION The Naval Ocean Systems Center, Hawaii Laboratory, for the past eight years has maintained an artificial insemination (AI) program for

  2. Comprehension of signs by dolphins (Tursiops truncatus).

    Science.gov (United States)

    Tschudin, A; Call, J; Dunbar, R I; Harris, G; van der Elst, C

    2001-03-01

    The authors assessed the ability of 6 captive dolphins (Tursiops truncatus) to comprehend without explicit training 3 human communicative signs (pointing, directed gaze, and replica). Pointing consisted of indicating the target item with the index finger and a fully extended arm. Directed gaze consisted of orienting the head and eyes toward the target item while the rest of the body remained stationary. The replica signal consisted of holding up an exact duplicate of the target item. On the initial series of 12 trials for each condition, 3 dolphins performed above chance on pointing, 2 on gaze, and none for replica. With additional trials, above chance performance increased to 4 dolphins for pointing, 6 for gazing, and 2 for replica. The replica sign seemed to be the most taxing for them (only 2 dolphins achieved results significantly above chance). Taken together, these results indicate that dolphins are able to interpret untrained communicative signs successfully.

  3. Effects of vessel noise on underwater vocalizations of bottlenose dolphins, Tursiops truncatus, in the Sado Estuary

    OpenAIRE

    Sobreira, Filipa Alexandra Veiga

    2017-01-01

    Maritime traffic is an important source of disturbance for coastal cetaceans, especially for local and resident populations, like the bottlenose dolphins (Tursiops truncatus) population in the Sado estuary. Vessel noise might mask important signals such as communication calls. To compensate masking effects, animals may change their vocal behavior by shifting vocal rate, call intensity, call type, call frequency and duration. To evaluate the potential impacts on the acoustic behavior of this p...

  4. Conceptive Estrus Behavior in Three Bottlenose Dolphins (Tursiops truncatus)

    OpenAIRE

    Holley Muraco; Stan A. Kuczaj II

    2015-01-01

    Bottlenose dolphins (Tursiops truncatus) are a highly promiscuous species that routinely engage in socio-sexual interactions, yet relatively little has been reported about actual estrus behavior. For this study of three female dolphins located at two aquarium facilities, 20 reproductive behaviors were investigated during three conceptive estrous cycles with known endocrinology. Reproductive behaviors increased with estradiol levels and peak occurrences of behaviors were observed during the lu...

  5. Source parameters of echolocation clicks from wild bottlenose dolphins (Tursiops aduncus and Tursiops truncatus).

    Science.gov (United States)

    Wahlberg, Magnus; Jensen, Frants H; Soto, Natacha Aguilar; Beedholm, Kristian; Bejder, Lars; Oliveira, Cláudia; Rasmussen, Marianne; Simon, Malene; Villadsgaard, Anne; Madsen, Peter T

    2011-10-01

    The Indian Ocean and Atlantic bottlenose dolphins (Tursiops aduncus and Tursiops truncatus) are among the best studied echolocating toothed whales. However, almost all echolocation studies on bottlenose dolphins have been made with captive animals, and the echolocation signals of free-ranging animals have not been quantified. Here, biosonar source parameters from wild T. aduncus and T. truncatus were measured with linear three- and four-hydrophone arrays in four geographic locations. The two species had similar source parameters, with source levels of 177-228 dB re 1 μPa peak to peak, click durations of 8-72 μs, centroid frequencies of 33-109 kHz and rms bandwidths between 23 and 54 kHz. T. aduncus clicks had a higher frequency emphasis than T. truncatus. The transmission directionality index was up to 3 dB higher for T. aduncus (29 dB) as compared to T. truncatus (26 dB). The high directionality of T. aduncus does not appear to be only a physical consequence of a higher frequency emphasis in clicks, but may also be caused by differences in the internal properties of the sound production system. © 2011 Acoustical Society of America

  6. Measuring and Validating Levels of Steroid Hormones in the Skin of Bottlenose Dolphins (Tursiops Truncatus)

    Science.gov (United States)

    2015-09-30

    the Skin of Bottlenose Dolphins (Tursiops Truncatus) Thea Bechshoft Aarhus University Bioscience Roskilde Frederiksborgvej 399, P.O. Box 358...of, in skin from bottlenose dolphins (Tursiops truncatus), a) the influence of age and sex on progestagens, estrogens, and androgens, b) the...skin by use of an ACTH challenge in bottlenose dolphins ” (Award Number: N000141310771). The dolphins will be sampled as part of an ongoing out- of water

  7. The uncertain response in the bottlenosed dolphin (Tursiops truncatus).

    Science.gov (United States)

    Smith, J D; Schull, J; Strote, J; McGee, K; Egnor, R; Erb, L

    1995-12-01

    Humans respond adaptively to uncertainty by escaping or seeking additional information. To foster a comparative study of uncertainty processes, we asked whether humans and a bottlenosed dolphin (Tursiops truncatus) would use similarly a psychophysical uncertain response. Human observers and the dolphin were given 2 primary discrimination responses and a way to escape chosen trials into easier ones. Humans escaped sparingly from the most difficult trials near threshold that left them demonstrably uncertain of the stimulus. The dolphin performed nearly identically. The behavior of both species is considered from the perspectives of signal detection theory and optimality theory, and its appropriate interpretation is discussed. Human and dolphin uncertain responses seem to be interesting cognitive analogs and may depend on cognitive or controlled decisional mechanisms. The capacity to monitor ongoing cognition, and use uncertainty appropriately, would be a valuable adaptation for animal minds. This recommends uncertainty processes as an important but neglected area for future comparative research.

  8. What do dolphins (Tursiops truncatus) understand about hidden objects?

    Science.gov (United States)

    Jaakkola, Kelly; Guarino, Emily; Rodriguez, Mandy; Erb, Linda; Trone, Marie

    2010-01-01

    Object permanence, the ability to mentally represent and reason about objects that have disappeared from view, is a fundamental cognitive skill that has been extensively studied in human infants and terrestrial animals, but not in marine animals. A series of four experiments examined this ability in bottlenose dolphins (Tursiops truncatus). After being trained on a "find the object" game, dolphins were tested on visible and invisible displacement tasks, and transpositions. In Experiments 1 and 2, dolphins succeeded at visible displacements, but not at invisible displacements or transpositions. Experiment 3 showed that they were able to pass an invisible displacement task in which a person's hand rather than a container was used as the displacement device. However, follow-up controls suggested they did so by learning local rules rather than via a true representation of the movement of hidden objects. Experiment 4 demonstrated that the dolphins did not rely on such local rules to pass visible displacement tasks. Thus, like many terrestrial animals, dolphins are able to succeed on visible displacement tasks, but seem unable to succeed on tasks requiring the tracking of hidden objects.

  9. Epidermal growth in the bottlenose dolphin, Tursiops truncatus

    International Nuclear Information System (INIS)

    Hicks, B.D.; St Aubin, D.J.; Geraci, J.R.; Brown, W.R.

    1985-01-01

    Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed

  10. Conceptive Estrus Behavior in Three Bottlenose Dolphins (Tursiops truncatus

    Directory of Open Access Journals (Sweden)

    Holley Muraco

    2015-02-01

    Full Text Available Bottlenose dolphins (Tursiops truncatus are a highly promiscuous species that routinely engage in socio-sexual interactions, yet relatively little has been reported about actual estrus behavior. For this study of three female dolphins located at two aquarium facilities, 20 reproductive behaviors were investigated during three conceptive estrous cycles with known endocrinology. Reproductive behaviors increased with estradiol levels and peak occurrences of behaviors were observed during the luteinizing hormone (LH surge. Two novel behaviors were observed: (1 genital tracking, an investigatory-type behavior, and (2 immobility, a novel form of standing heat estrus. These behaviors appeared to communicate reproductive readiness and increased copulation success. A total of 314 occurrences of estrus behavior were recorded in 10 hours of footage from the three focal females, and copulation spanned from day -9 to day 0 in one dominant female. Sexual interactions during estrus included female-to-female, immature male-to-female, mature male-to-immature male and masturbation with toys. During estrus, focal females received more behavioral attention than they initiated, and passive and active dorsal fin mounting between females was the most frequent behavior. These dolphins showed behavioral patterns similar to those reported in estrus cows where genitals are nuzzled, females mount and are mounted by other females, and standing heat intensity increases as LH levels rise.

  11. Bottlenose dolphin Tursiops truncatus at São Tomé Island (São ...

    African Journals Online (AJOL)

    Although the bottlenose dolphin Tursiops truncatus is one of the most common cetacean species around São Tomé Island, Gulf of Guinea, little research has focused on this species in this region. This study investigated the population of bottlenose dolphins around São Tomé Island by estimating the minimum population ...

  12. Evolution and the pathology of deep diving in the Bottlenosed Dolphin, Tursiops truncatus (Montagu, 1821) (Notes on Cetacea, Delphinoidea V)

    NARCIS (Netherlands)

    Purves, P.E.; Bree, van P.J.H.

    1972-01-01

    Cadenat (1959) and Rancurel (1964) produced strong indirect evidence that off the west coast of Africa, the Bottle-nosed Dolphin, Tursiops truncatus, is in the habit of diving very deeply, possibly down to 600 m. Examination of the skulls of fully adult specimens of Tursiops taken off Dakar and St.

  13. Sex, Age, and Individual Differences in Bottlenose Dolphins (Tursiops truncatus) in Response to Environmental Enrichment

    OpenAIRE

    Holli C. Eskelinen; Kelley A. Winship; Jill L. Borger-Turner

    2015-01-01

    Application of environmental enrichment, as a means to successfully decrease undesired behaviors (e.g., stereotypic) and improve animal welfare, has been documented in a variety of zoological species. However, a dearth of empirical evidence exists concerning age, sex, and individual differences in response to various types of enrichment tools and activities in Atlantic bottlenose dolphins (Tursiops truncatus). This study involved a comparative assessment of enrichment participation of three r...

  14. Ovarian Follicular Dynamics During the Luteinizing Hormone Surge in the Bottlenose Dolphin (Tursiops truncatus)

    OpenAIRE

    Muraco, Holley; Clough, Pat; Teets, Valerie; Arn, Dennis; Muraco, Mike

    2010-01-01

    Characterizing the relationship between ovarian follicular dynamics and the luteinizing hormone (LH) surge in the bottlenose dolphin (Tursiops truncatus) requires detailed daily monitoring due to the transitory nature of LH and ovulation. Utilizing conditioned dolphins and non-invasive sampling techniques, such as urine collection and trans-abdominal ultrasound exams, provides the means to accurately monitor these fleeting processes. Urine samples and ultrasound exams used in this study were ...

  15. Sex, Age, and Individual Differences in Bottlenose Dolphins (Tursiops truncatus in Response to Environmental Enrichment

    Directory of Open Access Journals (Sweden)

    Holli C. Eskelinen

    2015-08-01

    Full Text Available Application of environmental enrichment, as a means to successfully decrease undesired behaviors (e.g., stereotypic and improve animal welfare, has been documented in a variety of zoological species. However, a dearth of empirical evidence exists concerning age, sex, and individual differences in response to various types of enrichment tools and activities in Atlantic bottlenose dolphins (Tursiops truncatus. This study involved a comparative assessment of enrichment participation of three resident, bottlenose dolphin populations, over the course of 17 months, with respect to sex and age class (calf, sub-adult, adult. Enrichment sessions were randomly assigned, conducted, and categorically assessed based on participation during seven, broad based enrichment classes (Object, Ingestible, Human, or a combination of the three. Overall, the proportion of participation in enrichment sessions was high (≥ 0.74, with individual differences in participation noted among the three populations. Sessions involving Humans and/or Ingestible items resulted in a significantly higher mean proportion of participation. Sub-adult and adult males were significantly more likely to participate in enrichment sessions, as well as engage in Human Interaction/Object sessions. Calves participated significantly more than adults or sub-adults across all enrichment classes with no noted differences between males and females. These data can serve as a tool to better understand the intricacies of bottlenose dolphin responses to enrichment in an effort to develop strategic enrichment plans with the goal of improving animal well-being and welfare.

  16. Modified Endoscopic Removal of Foreign Objects from the Forestomach of a Common Bottlenose Dolphin (Tursiops truncatus

    Directory of Open Access Journals (Sweden)

    Kyung-Yeon Eo, Yong-Gu Yeo and Oh-Deog Kwon*

    2013-04-01

    Full Text Available We report on the removal of foreign objects from the forestomach of a 200 kg adult male common bottlenose dolphin (Tursiops truncatus in the Seoul zoo using a modified stainless steel hook and flexible wire snare attached to a gastrointestinal fiberoptic endoscope. The foreign bodies included a 10 × 3.5 cm plastic tube, 4 × 2.0 cm stainless steel pipe, brush, and concrete debris. Our technique using a stainless steel wire hook and snare attached to a gastroscope can be used to remove foreign objects from the forestomach of common bottlenose dolphins.

  17. Captive-born intergeneric hybrid of a Guiana and bottlenose dolphin: Sotalia guianensis x Tursiops truncatus.

    Science.gov (United States)

    Caballero, S; Baker, C S

    2010-01-01

    Bottlenose dolphins (Tursiops truncatus) and Guiana dolphin (Sotalia guianensis) live in sympatry along the Caribbean Coast of Central and South America and social interactions between these species have been described in the Caribbean Coast of Costa Rica, including sexual encounters. Here we examine and document the only known hybridization event between a male Guiana dolphin and a female bottlenose dolphin, in captivity at Oceanario Islas del Rosario (Colombian Caribbean), using photographic and genetic evidence from mitochondrial DNA markers and nuclear autosomal introns. © 2009 Wiley-Liss, Inc.

  18. Bottlenose dolphins (Tursiops truncatus do also cast neutrophil extracellular traps against the apicomplexan parasite Neospora caninum

    Directory of Open Access Journals (Sweden)

    R. Villagra-Blanco

    2017-12-01

    Full Text Available Neutrophil extracellular traps (NETs are web-like structures composed of nuclear DNA decorated with histones and cytoplasmic peptides which antiparasitic properties have not previously been investigated in cetaceans. Polymorphonuclear neutrophils (PMN were isolated from healthy bottlenose dolphins (Tursiops truncatus, and stimulated with Neospora caninum tachyzoites and the NETs-agonist zymosan. In vitro interactions of PMN with the tachyzoites resulted in rapid extrusion of NETs. For the demonstration and quantification of cetacean NETs, extracellular DNA was stained by using either Sytox Orange® or Pico Green®. Scanning electron microscopy (SEM and fluorescence analyses demonstrated PMN-derived release of NETs upon exposure to tachyzoites of N. caninum. Co-localization studies of N. caninum induced cetacean NETs proved the presence of DNA adorned with histones (H1, H2A/H2B, H3, H4, neutrophil elastase (NE, myeloperoxidase (MPO and pentraxin (PTX confirming the molecular properties of mammalian NETosis. Dolphin-derived N. caninum-NETosis were efficiently suppressed by DNase I and diphenyleneiodonium (DPI treatments. Our results indicate that cetacean-derived NETs represent an ancient, conserved and relevant defense effector mechanism of the host innate immune system against N. caninum and probably other related neozoan parasites circulating in the marine environment. Keywords: Tursiops truncatus, cetaceans, Neutrophil extracellular traps, Innate immunity, Neospora caninum.

  19. Bottlenose dolphin Tursiops truncatus group dynamics, site fidelity ...

    African Journals Online (AJOL)

    ... ecology in these waters. Photo-identification undertaken during systematic, non-systematic and opportunistic surveys conducted between 2001 and 2012 was used to assess group dynamics, site fidelity, residency and movement patterns of bottlenose dolphins in the archipelago. Three different patterns of residency were ...

  20. Microarray applications to understand the impact of exposure to environmental contaminants in wild dolphins (Tursiops truncatus).

    Science.gov (United States)

    Mancia, Annalaura; Abelli, Luigi; Kucklick, John R; Rowles, Teresa K; Wells, Randall S; Balmer, Brian C; Hohn, Aleta A; Baatz, John E; Ryan, James C

    2015-02-01

    It is increasingly common to monitor the marine environment and establish geographic trends of environmental contamination by measuring contaminant levels in animals from higher trophic levels. The health of an ecosystem is largely reflected in the health of its inhabitants. As an apex predator, the common bottlenose dolphin (Tursiops truncatus) can reflect the health of near shore marine ecosystems, and reflect coastal threats that pose risk to human health, such as legacy contaminants or marine toxins, e.g. polychlorinated biphenyls (PCBs) and brevetoxins. Major advances in the understanding of dolphin biology and the unique adaptations of these animals in response to the marine environment are being made as a result of the development of cell-lines for use in in vitro experiments, the production of monoclonal antibodies to recognize dolphin proteins, the development of dolphin DNA microarrays to measure global gene expression and the sequencing of the dolphin genome. These advances may play a central role in understanding the complex and specialized biology of the dolphin with regard to how this species responds to an array of environmental insults. This work presents the creation, characterization and application of a new molecular tool to better understand the complex and unique biology of the common bottlenose dolphin and its response to environmental stress and infection. A dolphin oligo microarray representing 24,418 unigene sequences was developed and used to analyze blood samples collected from 69 dolphins during capture-release health assessments at five geographic locations (Beaufort, NC, Sarasota Bay, FL, Saint Joseph Bay, FL, Sapelo Island, GA and Brunswick, GA). The microarray was validated and tested for its ability to: 1) distinguish male from female dolphins; 2) differentiate dolphins inhabiting different geographic locations (Atlantic coasts vs the Gulf of Mexico); and 3) study in detail dolphins resident in one site, the Georgia coast, known to

  1. Bubble ring play of bottlenose dolphins (Tursiops truncatus): implications for cognition.

    Science.gov (United States)

    McCowan, B; Marino, L; Vance, E; Walke, L; Reiss, D

    2000-03-01

    Research on the cognitive capacities of dolphins and other cetaceans (whales and porpoises) has importance for the study of comparative cognition, particularly with other large-brained social mammals, such as primates. One of the areas in which cetaceans can be compared with primates is that of object manipulation and physical causality, for which there is an abundant body of literature in primates. The authors supplemented qualitative observations with statistical methods to examine playful bouts of underwater bubble ring production and manipulation in 4 juvenile male captive bottlenose dolphins (Tursiops truncatus). The results are consistent with the hypothesis that dolphins monitor the quality of their bubble rings and anticipate their actions during bubble ring play.

  2. On the role of periodic structures in the lower jaw of the atlantic bottlenose dolphin (Tursiops truncatus)

    International Nuclear Information System (INIS)

    Dible, S A; Flint, J A; Lepper, P A

    2009-01-01

    This paper proposes the application of band-gap theory to hearing in the atlantic bottlenose dolphin (Tursiops truncatus). Using the transmission line modelling (TLM) technique and published computed tomography (CT) data of an atlantic bottlenose dolphin (Tursiops truncatus), a series of sound propagation experiments have been carried out. It is shown that the teeth in the lower jaw can be viewed as a periodic array of scattering elements which result in the formation of an acoustic stop band (or band gap) that is angular dependent. It is shown through simple and complex geometry simulations that performance enhancements such as improved gain and isolation between the two receive paths can be achieved. This mechanism has the potential to be exploited in direction-finding sonar

  3. Characterization of a parainfluenza virus isolated from a bottlenose dolphin (Tursiops truncatus).

    Science.gov (United States)

    Nollens, Hendrik H; Wellehan, James F X; Saliki, Jeremiah T; Caseltine, Shannon L; Jensen, Eric D; Van Bonn, William; Venn-Watson, Stephanie

    2008-04-30

    A novel member of the parainfluenza virus family was identified in a bottlenose dolphin with respiratory disease. The case animal was a 19-year old male Atlantic bottlenose dolphin (Tursiops truncatus) that presented with signs of respiratory illness, including raspy, foul-odored breaths and cream-colored exudate from the blowhole. Focally extensive pyogranulomatous bronchointerstitial pneumonia with moderate numbers of intralesional yeast organisms was identified on histopathological examination. Other significant microscopic findings included multifocal erosive and ulcerative tracheitis and laryngitis consisting of active laryngeal lymphatic tissue and dilated glands with eosinophilic fluid. The cause of death was attributed to respiratory disease of unknown etiology. In addition to the postmortem isolation of Candida glabrata and mixed bacteria from lung tissue, a virus was isolated from two antemortem affected lung aspirates collected over a 2-month period and two postmortem samples (mediastinal lymph node and left lung tissue homogenate). The morphology of the virions on negative staining and transmission electron microscopy was consistent with that of paramyxoviruses. Two genomic fragments, comprising 532 and 419 nucleotides from the open reading frames that code for the viral polymerase and fusion protein, respectively, were amplified by polymerase chain reaction using degenerate primers. Phylogenetic analyses of the two viral RNA segments showed that the isolate comprised a novel virus strain, tentatively named T. truncatus parainfluenza virus type 1 (TtPIV-1). The virus is monophyletic with, but genetically distinct from, the various bovine parainfluenza virus type 3 strains.

  4. Spatial orientation of different frequencies within the echolocation beam of a Tursiops truncatus and Pseudorca crassidens.

    Science.gov (United States)

    Ibsen, Stuart D; Nachtigall, Paul E; Krause-Nehring, Jacqueline; Kloepper, Laura; Breese, Marlee; Li, Songhai; Vlachos, Stephanie

    2012-08-01

    A two-dimensional array of 16 hydrophones was created to map the spatial distribution of different frequencies within the echolocation beam of a Tursiops truncatus and a Pseudorca crassidens. It was previously shown that both the Tursiops and Pseudorca only paid attention to frequencies between 29 and 42 kHz while echolocating. Both individuals tightly focused the 30 kHz frequency and the spatial location of the focus was consistently pointed toward the target. At 50 kHz the beam was less focused and less precisely pointed at the target. At 100 kHz the focus was often completely lost and was not pointed at the target. This indicates that these individuals actively focused the beam toward the target only in the frequency range they paid attention to. Frequencies outside this range were left unfocused and undirected. This focusing was probably achieved through sensorimotor control of the melon morphology and nasal air sacs. This indicates that both morphologically different species can control the spatial distribution of different frequency ranges within the echolocation beam to create consistent ensonation of desired targets.

  5. A common bottlenose dolphin (Tursiops truncatus) prey handling technique for marine catfish (Ariidae) in the northern Gulf of Mexico

    OpenAIRE

    Ronje, Errol I.; Barry, Kevin P.; Sinclair, Carrie; Grace, Mark A.; Barros, N?lio; Allen, Jason; Balmer, Brian; Panike, Anna; Toms, Christina; Mullin, Keith D.; Wells, Randall S.

    2017-01-01

    Few accounts describe predator-prey interactions between common bottlenose dolphins (Tursiops truncatus Montagu 1821) and marine catfish (Ariopsis felis Linnaeus 1766, Bagre marinus Mitchill 1815). Over the course of 50,167 sightings of bottlenose dolphin groups in Mississippi Sound and along the Florida coast of the Gulf of Mexico, severed catfish heads were found floating and exhibiting movements at the surface in close proximity to 13 dolphin groups that demonstrated feeding behavior. Thes...

  6. Fine-scale spatial variation of persistent organic pollutants in bottlenose dolphins (Tursiops truncatus) in Biscayne Bay, Florida.

    Science.gov (United States)

    Litz, Jenny A; Garrison, Lance P; Fieber, Lynne A; Martinez, Anthony; Contillo, Joseph P; Kucklick, John R

    2007-11-01

    Bottlenose dolphins (Tursiops truncatus) are long-term residents and apex predators in southeast U.S. estuaries and are vulnerable to bioaccumulation of persistent organic pollutants (POPs). Dart biopsy samples were collected from 45 dolphins in Biscayne Bay (Miami, FL), 34 of which were matched using fin markings to a photo identification catalogue. Blubber samples were analyzed for 73 polychlorinated biphenyl (PCB) congeners, six polybrominated diphenyl ether (PBDE) congeners, and organochlorine pesticides including dichloro-diphenyl-trichloroethane (DDT) and metabolites, chlordanes, and dieldrin. Total PCBs (sigma 73PCBs) were present in the highest concentrations and were 5 times higher in males with sighting histories in the northern, metropolitan area of Biscayne Bay than males with sighting histories in the southern, more rural area [geometric mean: 43.3 (95% confidence interval: 28.0-66.9) vs 8.6 (6.3-11.9) microg/g wet mass, respectively]. All compound classes had higher concentrations in northern animals than southern. The differences in POP concentrations found on this small geographic scale demonstrate that differential habitat use can strongly influence pollutant concentrations and should be considered when interpreting bottlenose dolphin POP data. The PCB concentrations in northern Bay dolphins are high as compared to other studies of estuarine dolphins and may place these animals at risk of reproductive failure and decreased immune function.

  7. Successful amplification of mitochondrial DNA from dentin of the bottlenose dolphin Tursiops truncatus

    Directory of Open Access Journals (Sweden)

    Laura Isabel Weber

    2007-01-01

    Full Text Available Twenty-four teeth of Tursiops truncatus from the collection of the Marine Mammals Laboratory (FURG-RS were analysed for their potential as DNA source for population genetic and taxonomic studies. All teeth were submitted to decontamination, grinding and demineralisation processes. Dentin powder was weighed for DNA extraction, which was evaluated by the amplification of two mitochondrial genes through PCR using universal primers. Cytochrome-b gene was amplified successfully. PCR products showed concentrations of 3-12 ng/µl for dentin powder, which was positively correlated to the quantity of dentin powder used for DNA extraction. To rule out contamination a SSCP was carried out including positive controls, and samples of humans involved in the analysis. The SSCP patterns for T. truncatus differed from all others, showing also polymorphism for the region. It was concluded that dentin was a good source of mtDNA for genetic studies in dolphins.Vinte e quatro amostras de material dentário de Tursiops truncatus oriundas da coleção do Laboratório de Mamíferos Marinhos (FURG-RS foram avaliadas para determinar seu potencial como fonte de DNA para estudos genético-populacionais e sistemáticos. Todos os dentes foram submetidos a processos de desinfecção, trituração e desmineralização. A dentina obtida foi pesada previamente à extração de DNA, a qual foi avaliada através da amplificação de dois genes mitocondriais, através da técnica de PCR (Reação em Cadeia da Polimerase, utilizando oligonucleotídeos iniciadores universais. Obteve-se sucesso apenas na amplificação do gene Citocromo-b. Destes produtos obtiveram-se concentrações de 3-12 ng/µl para o material dentário, observando-se uma relação linear positiva com a quantidade em gramas utilizada na extração de DNA. Com o objetivo de eliminar a possibilidade de contaminação foi realizada uma análise SSCP (Polimorfismo Conformacional de Fita Simples incluindo os controles

  8. Complex Social Structure of an Endangered Population of Bottlenose Dolphins (Tursiops truncatus) in the Aeolian Archipelago (Italy)

    Science.gov (United States)

    Blasi, Monica F.; Boitani, Luigi

    2014-01-01

    We investigated social structure and association patterns for a small population of Mediterranean bottlenose dolphins, Tursiops truncatus, inhabiting the Aeolian Archipelago (southern Italy). Specifically we evaluate the role of sex and age composition, residency patterns and interaction with trammel nets on this social organization. Association data for 23 regularly sighted individuals were obtained from summer photoidentification surveys collected from 2005–2012. Using a combined cluster and social network analysis approach, we found associations between dolphins were hierarchically structured, where two mixed-sex social units were subdivided into smaller temporarily dynamic groups. We found non-random and long-term preferred associations in the population; however, the degree of social cohesion, residence pattern and interaction with trammel nets differed considerably between the two social units. Six of eight females occurred in the more resident social unit-1; in addition, social unit-1 individuals had significantly stronger associations, higher preferred associates, lived in larger groups and occurred less frequently with trammel nets. Nine of eleven males were clustered in social unit-2 and five of these males, interacting with trammel nets, formed small groups and preferred associations. We propose that female and male groups associate in the study area during the breeding season and that some males choose to interact with reproductive females forming a distinct but interrelated social unit. Other males may be associating in a larger fission-fusion network, which consists of dolphins that appear to temporarily join the network from the coastal population. We cannot exclude that some males specialized in trammel net foraging, suggesting that this foraging technique may favor a solitary lifestyle. Large group sizes and high degree of social cohesion for females could be an indication of greater protection and more efficiency in detecting, deterring or

  9. Whistle rates of wild bottlenose dolphins (Tursiops truncatus): influences of group size and behavior.

    Science.gov (United States)

    Quick, Nicola J; Janik, Vincent M

    2008-08-01

    In large social groups acoustic communication signals are prone to signal masking by conspecific sounds. Bottlenose dolphins (Tursiops truncatus) use highly distinctive signature whistles that counter masking effects. However, they can be found in very large groups where masking by conspecific sounds may become unavoidable. In this study we used passive acoustic localization to investigate how whistle rates of wild bottlenose dolphins change in relation to group size and behavioral context. We found that individual whistle rates decreased when group sizes got larger. Dolphins displayed higher whistle rates in contexts when group members were more dispersed as in socializing and in nonpolarized movement than during coordinated surface travel. Using acoustic localization showed that many whistles were produced by groups nearby and not by our focal group. Thus, previous studies based on single hydrophone recordings may have been overestimating whistle rates. Our results show that although bottlenose dolphins whistle more in social situations they also decrease vocal output in large groups where the potential for signal masking by other dolphin whistles increases.

  10. Diffusion tractography reveals pervasive asymmetry of cerebral white matter tracts in the bottlenose dolphin (Tursiops truncatus).

    Science.gov (United States)

    Wright, Alexandra K; Theilmann, Rebecca J; Ridgway, Sam H; Scadeng, Miriam

    2017-11-30

    Brain enlargement is associated with concomitant growth of interneuronal distance, increased conduction time, and reduced neuronal interconnectivity. Recognition of these functional constraints led to the hypothesis that large-brained mammals should exhibit greater structural and functional brain lateralization. As a taxon with the largest brains in the animal kingdom, Cetacea provides a unique opportunity to examine asymmetries of brain structure and function. In the present study, diffusion tensor imaging and tractography were used to investigate cerebral white matter asymmetry in the bottlenose dolphin (Tursiops truncatus). Widespread white matter asymmetries were observed with the preponderance of tracts exhibiting leftward structural asymmetries. Leftward lateralization may reflect differential processing and execution of behaviorally variant sensory and motor functions by the cerebral hemispheres. The arcuate fasciculus, an association tract linked to human language evolution, was isolated and exhibited rightward asymmetry suggesting a right hemisphere bias for conspecific communication unlike that of most mammals. This study represents the first examination of cetacean white matter asymmetry and constitutes an important step toward understanding potential drivers of structural asymmetry and its role in underpinning functional and behavioral lateralization in cetaceans.

  11. Vocalizations associated with pectoral fin contact in bottlenose dolphins (Tursiops truncatus).

    Science.gov (United States)

    Evans-Wilent, J; Dudzinski, K M

    2013-11-01

    Pectoral fin contact in bottlenose dolphins represents one form of tactile communication. Acoustic communication associated with pectoral fin contact is an additional level of communication that may change or enhance the tactile message between two individuals. In this study, we examine vocalization types associated with pectoral fin contact in a group of captive bottlenose dolphins (Tursiops truncatus). From 2006 to 2009, vocalizations potentially associated with 748 pectoral fin contacts were examined: whistles, click trains and overlap of whistles and click trains were documented when associated with fin contact. Dolphins were also documented not vocalizing when exchanging pectoral fin contacts. Call type associated with pectoral fin contact was compared for the proportion of the type of pectoral fin contact, vocalizer sex, initiator and receiver roles, and gender pair. Overall, vocalizations differed significantly by vocalizer role as rubber or rubbee, initiator, and sex. Receivers and rubbees clicked and used overlap vocalizations more frequently, and males produced overlap vocalizations more frequently. These results suggest that whistles may be used to initiate pectoral fin contact or show preference for a particular partner, while click trains may be used to show disinterest in pectoral fin contact or to signal the end of a contact. Examining vocalizations produced in conjunction with tactile contact is a relatively new approach in the study of individual dolphin behavior and may be useful for understanding dolphin social alliances and social preferences for various individuals within a population. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Whistle repertoire of bottlenose dolphins (Tursiops truncatus) in the Mississippi Sound

    Science.gov (United States)

    Hernandez, Erica N.; Kuczaj, Stan; Solangi, Moby

    2005-09-01

    The whistle repertoire of wild bottlenose dolphins (Tursiops truncatus) in the Mississippi Sound, part of the northern Gulf of Mexico, was investigated. There is a large population of dolphins in this area, and many dolphins that are now housed in zoos and aquariums were captured in the Mississippi Sound. This paper reports the types of whistles that are predominant in this area, and how these whistles are used in the context of concurrent surface behavior. Over the course of 1 year (April 2004-March 2005), dolphin whistles were recorded as part of an ongoing study of the effects of human activity on wild bottlenose dolphins. The surface behavior of the focal group was categorized at 1-min intervals as follows: mill, travel, mill/travel, feed, social, with boat, or with shrimp boat. Whistles were then categorized as one of the following: upsweep, downsweep, convex, concave, sine, or constant frequency. Preliminary analysis of the data suggests that both the rate of whistling and the types of whistles produced vary as a function of dolphin behavior. Further analysis of the data will reveal if different types of whistles are associated with specific surface behavior categories. [Research supported by Department of Commerce.

  13. Evidence of Brucella strain ST27 in bottlenose dolphin (Tursiops truncatus) in Europe.

    Science.gov (United States)

    Cvetnić, Željko; Duvnjak, Sanja; Đuras, Martina; Gomerčić, Tomislav; Reil, Irena; Zdelar-Tuk, Maja; Špičić, Silvio

    2016-11-30

    Marine mammal brucellosis has been known for more than 20 years, but recent work suggests it is more widespread than originally thought. Brucella (B.) pinnipedialis has been isolated from pinnipeds, while B. ceti strains have been associated with cetaceans. Here we report a Brucella strain isolated from multiple lymph nodes of one bottlenose dolphin (Tursiops truncatus) during routine examination of dolphin carcasses found in the Croatian part of the northern Adriatic Sea during the summer of 2015. Classical bacteriological biotyping, PCR-based techniques (single, multiplex, PCR-RFLP) and 16S rRNA DNA sequencing were used to identify Brucella spp. Multiple-locus variable number tandem repeat analysis of 16 loci and multilocus sequence typing of 9 loci were used for genotyping and species determination. The combination of bacteriological, molecular and genotyping techniques identified our strain as ST27, previously identified as a human pathogen. This report provides, to our knowledge, the first evidence of ST27 in the Adriatic Sea in particular and in European waters in general. The zoonotic nature of the strain and its presence in the Adriatic, which is inhabited by bottlenose dolphins, suggest that the strain may pose a significant threat to human health. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Exposure to novel parainfluenza virus and clinical relevance in 2 bottlenose dolphin (Tursiops truncatus) populations.

    Science.gov (United States)

    Venn-Watson, Stephanie; Rivera, Rebecca; Smith, Cynthia R; Saliki, Jeremiah T; Caseltine, Shannon; St Leger, Judy; Yochem, Pam; Wells, Randall S; Nollens, Hendrik

    2008-03-01

    Parainfluenza virus (PIV) is a leading cause of respiratory infections in humans. A novel virus closely related to human and bovine parainfluenza viruses types 3 (HPIV-3 and BPIV-3), named Tursiops truncatus parainfluenza virus type 1 (TtPIV-1), was isolated from a dolphin with respiratory disease. We developed a dolphin-specific ELISA to measure acute- and convalescent-phase PIV antibodies in dolphins during 1999-2006 with hemograms similar to that of the positive control. PIV seroconversion occurred concurrently with an abnormal hemogram in 22 animals, of which 7 (31.8%) had respiratory signs. Seroprevalence surveys were conducted on 114 healthy bottlenose dolphins in Florida and California. When the most conservative interpretation of positive was used, 11.4% of healthy dolphins were antibody positive, 29.8% were negative, and 58.8% were inconclusive. PIV appears to be a common marine mammal virus that may be of human health interest because of the similarity of TtPIV-1 to BPIV-3 and HPIV-3.

  15. The social structure of Golfo Dulce bottlenose dolphins (Tursiops truncatus) and the influence of behavioural state.

    Science.gov (United States)

    Moreno, Kelsey; Acevedo-Gutiérrez, Alejandro

    2016-08-01

    Ecological factors such as habitat and food availability affect the social structure of bottlenose dolphins ( Tursiops spp.). Here, we describe the social structure of bottlenose dolphins ( T. truncatus ) in Golfo Dulce, Costa Rica, a semi-enclosed, fjord-like tropical embayment resembling a pelagic system. We also examine behaviour-linked social strategies by comparing social structure relative to behavioural state: feeding versus non-feeding. We analysed 333 sightings over 210 days from boat-based surveys. Despite the uniqueness of the area, the 47 analysed adults had a social structure similar to other populations: a well-differentiated fission-fusion society with sex-specific patterns of associations and aggression. These results indicate that differences in social structure relative to other populations were a matter of degree. Association strength of dyads was highly correlated across behavioural states, indicating constraints on social fluidity. Males displayed a marked difference in lagged association rate and females displayed a small difference in association homogeneity between states. We suggest this difference in population-wide social connections between behavioural states, particularly for males, was due to mating strategies, a pressure which is strongest during non-feeding behaviour and relaxed during feeding. This finding highlights the importance of considering behavioural state when examining individual bonds and the behavioural plasticity for which the bottlenose dolphin is well known.

  16. Phenotypic variation in dorsal fin morphology of coastal bottlenose dolphins (Tursiops truncatus off Mexico

    Directory of Open Access Journals (Sweden)

    Eduardo Morteo

    2017-06-01

    Full Text Available Geographic variation in external morphology is thought to reflect an interplay between genotype and the environment. Morphological variation has been well-described for a number of cetacean species, including the bottlenose dolphin (Tursiops truncatus. In this study we analyzed dorsal fin morphometric variation in coastal bottlenose dolphins to search for geographic patterns at different spatial scales. A total of 533 dorsal fin images from 19 available photo-identification catalogs across the three Mexican oceanic regions (Pacific Ocean n = 6, Gulf of California n = 6 and, Gulf of Mexico n = 7 were used in the analysis. Eleven fin shape measurements were analyzed to evaluate fin polymorphism through multivariate tests. Principal Component Analysis on log-transformed standardized ratios explained 94% of the variance. Canonical Discriminant Function Analysis on factor scores showed separation among most study areas (p < 0.05 with exception of the Gulf of Mexico where a strong morphometric cline was found. Possible explanations for the observed differences are related to environmental, biological and evolutionary processes. Shape distinction between dorsal fins from the Pacific and those from the Gulf of California were consistent with previously reported differences in skull morphometrics and genetics. Although the functional advantages of dorsal fin shape remains to be assessed, it is not unlikely that over a wide range of environments, fin shape may represent a trade-off among thermoregulatory capacity, hydrodynamic performance and the swimming/hunting behavior of the species.

  17. Occurrence of triclosan in plasma of wild Atlantic bottlenose dolphins (Tursiops truncatus) and in their environment

    International Nuclear Information System (INIS)

    Fair, Patricia A.; Lee, H.-B.; Adams, Jeff; Darling, Colin; Pacepavicius, Grazina; Alaee, Mehran; Bossart, Gregory D.; Henry, Natasha; Muir, Derek

    2009-01-01

    The presence of triclosan, a widely-used antibacterial chemical, is currently unknown in higher trophic-level species such as marine mammals. Blood plasma collected from wild bottlenose dolphins (Tursiops truncatus) in Charleston, SC (CHS) (n = 13) and Indian River Lagoon, FL (IRL) (n = 13) in 2005 was analyzed for triclosan. Plasma concentrations in CHS dolphins ranged from 0.12 to 0.27 ng/g wet weight (mean 0.18 ng/g), with 31% of the sampled individuals having detectable triclosan. The mean IRL dolphin plasma concentrations were 0.072 ng/g wet weight (range 0.025-0.11 ng/g); 23% of the samples having detectable triclosan. In the CHS area, triclosan effluent values from two WWTP were both 190 ng/L and primary influents were 2800 ng/L and 3400 ng/L. Triclosan values in CHS estuarine surface water samples averaged 7.5 ng/L (n = 18) ranging from 4.9 to 14 ng/L. This is the first study to report bioaccumulation of anthropogenic triclosan in a marine mammal highlighting the need for further monitoring and assessment. - Triclosan in bottlenose dolphin plasma and their environment.

  18. Dolphin hearing during echolocation: evoked potential responses in an Atlantic bottlenose dolphin (Tursiops truncatus).

    Science.gov (United States)

    Li, Songhai; Nachtigall, Paul E; Breese, Marlee

    2011-06-15

    Auditory evoked potential (AEP) responses were recorded during echolocation in an Atlantic bottlenose dolphin (Tursiops truncatus) trained to accept suction-cup EEG electrodes and detect targets by echolocation. AEP recording was triggered by the echolocation clicks of the animal. Three targets with target strengths of -34, -28 and -22 dB were used at a target distance of 2 to 6.5 m for each target. The results demonstrated that the AEP appeared to both outgoing echolocation clicks and echoes during echolocation, with AEP complexes consisting of alternative positive and negative waves. The echo-related AEP amplitudes were obviously lower than the outgoing click-related AEP amplitudes for all the targets at the investigated target distances. However, for targets with target strengths of -22 and -28 dB, the peak-to-peak amplitudes of the echo-related AEPs were dependent on the target distances. The echo-related AEP response amplitudes increased at further target distances, demonstrating an overcompensation of echo attenuation with target distance in the echo-perception system of the dolphin biosonar. Measurement and analysis of outgoing click intensities showed that the click levels increased with target distance (R) by a factor of approximately 10 to 17.5 logR depending on target strength. The results demonstrated that a dual-component biosonar control system formed by intensity compensation behavior in both the transmission and receiving phases of a biosonar cycle exists synchronously in the dolphin biosonar system.

  19. Depth dependent variation of the echolocation pulse rate of bottlenose dolphins (Tursiops truncatus).

    Science.gov (United States)

    Simard, Peter; Hibbard, Ashley L; McCallister, Kimberly A; Frankel, Adam S; Zeddies, David G; Sisson, Geoffrey M; Gowans, Shannon; Forys, Elizabeth A; Mann, David A

    2010-01-01

    Trained odontocetes appear to have good control over the timing (pulse rate) of their echolocation clicks; however, there is comparatively little information about how free-ranging odontocetes modify their echolocation in relation to their environment. This study investigates echolocation pulse rate in 14 groups of free-ranging bottlenose dolphins (Tursiops truncatus) at a variety of depths (2.4-30.1 m) in the Gulf of Mexico. Linear regression models indicated a significant decrease in mean pulse rate with mean water depth. Pulse rates for most groups were multi-modal. Distance to target estimates were as high as 91.8 m, assuming that echolocation was produced at a maximal rate for the target distance. A 5.29-ms processing lag time was necessary to explain the pulse rate modes observed. Although echolocation is likely reverberation limited, these results support the hypotheses that free-ranging bottlenose dolphins in this area are adapting their echolocation signals for a variety of target detection and ranging purposes, and that the target distance is a function of water depth.

  20. Postnatal development of echolocation abilities in a bottlenose dolphin (Tursiops truncatus): temporal organization.

    Science.gov (United States)

    Favaro, Livio; Gnone, Guido; Pessani, Daniela

    2013-03-01

    In spite of all the information available on adult bottlenose dolphin (Tursiops truncatus) biosonar, the ontogeny of its echolocation abilities has been investigated very little. Earlier studies have reported that neonatal dolphins can produce both whistles and burst-pulsed sounds just after birth and that early-pulsed sounds are probably a precursor of echolocation click trains. The aim of this research is to investigate the development of echolocation signals in a captive calf, born in the facilities of the Acquario di Genova. A set of 81 impulsive sounds were collected from birth to the seventh postnatal week and six additional echolocation click trains were recorded when the dolphin was 1 year old. Moreover, behavioral observations, concurring with sound production, were carried out by means of a video camera. For each sound we measured five acoustic parameters: click train duration (CTD), number of clicks per train, minimum, maximum, and mean click repetition rate (CRR). CTD and number of clicks per train were found to increase with age. Maximum and mean CRR followed a decreasing trend with dolphin growth starting from the second postnatal week. The calf's first head scanning movement was recorded 21 days after birth. Our data suggest that in the bottlenose dolphin the early postnatal weeks are essential for the development of echolocation abilities and that the temporal features of the echolocation click trains remain relatively stable from the seventh postnatal week up to the first year of life. © 2013 Wiley Periodicals, Inc.

  1. Fatal Asphyxiation in Bottlenose Dolphins (Tursiops truncatus from the Indian River Lagoon.

    Directory of Open Access Journals (Sweden)

    Megan Stolen

    Full Text Available Multiple single case reports of asphyxiation in dolphins caused by fish lodged in the esophagus exist. However, the significance of this cause of mortality in a single population has not been documented. We performed a retrospective evaluation of pathology records from stranded bottlenose dolphins (Tursiops truncatus from the Indian River Lagoon to evaluate the impact of this cause of death on this population. From 1997 to 2011, asphyxiation due to choking was identified as the cause of death in 14 of 350 cases (4%. Sampling of an unrelated but adjacent population over this same period yielded 186 necropsy cases of bottlenose dolphins with no cases of asphyxiation. Asphyxiated animals presented with a fish lodged in the cranial esophagus associated with a dislocated and obstructed or compressed larynx. There was no clear sex predilection. Affected animals included 12 adults and two juveniles. The fish species involved included sheepshead, black chin tilapia and striped mojarra. In five cases, recreational fishing gear was also present. Cetacean choking is related to selection of prey fish species with strong dorsal spines and may be secondarily associated with fish attached to fishing gear. Prey abundance and dolphin behavior may influence these selections. Environmental alterations leading to changes in prey availability or increased interactions with fishing gear may change the significance of fatal choking in dolphin populations.

  2. Occurrence of triclosan in plasma of wild Atlantic bottlenose dolphins (Tursiops truncatus) and in their environment

    Energy Technology Data Exchange (ETDEWEB)

    Fair, Patricia A., E-mail: pat.fair@noaa.go [National Oceanic and Atmospheric Administration, National Ocean Services, Center for Coastal Environmental Health and Biomolecular Research, 219 Fort Johnson Road, Charleston, SC 29412-9110 (United States); Lee, H.-B. [Aquatic Ecosystem Protection Research Division, Environment Canada, 867 Lakeshore Road, Burlington, ON L7R 4A6 (Canada); Adams, Jeff [National Oceanic and Atmospheric Administration, National Ocean Services, Center for Coastal Environmental Health and Biomolecular Research, 219 Fort Johnson Road, Charleston, SC 29412-9110 (United States); Darling, Colin; Pacepavicius, Grazina; Alaee, Mehran [Aquatic Ecosystem Protection Research Division, Environment Canada, 867 Lakeshore Road, Burlington, ON L7R 4A6 (Canada); Bossart, Gregory D. [Center for Coastal Research, Marine Mammal Research and Conservation Program, Harbor Branch Oceanographic Institute at Florida Atlantic University, 5600 U.S. 1 North, Ft. Pierce, FL 34946 (United States); Henry, Natasha [National Oceanic and Atmospheric Administration, National Ocean Services, Center for Coastal Environmental Health and Biomolecular Research, 219 Fort Johnson Road, Charleston, SC 29412-9110 (United States); Muir, Derek [Aquatic Ecosystem Protection Research Division, Environment Canada, 867 Lakeshore Road, Burlington, ON L7R 4A6 (Canada)

    2009-08-15

    The presence of triclosan, a widely-used antibacterial chemical, is currently unknown in higher trophic-level species such as marine mammals. Blood plasma collected from wild bottlenose dolphins (Tursiops truncatus) in Charleston, SC (CHS) (n = 13) and Indian River Lagoon, FL (IRL) (n = 13) in 2005 was analyzed for triclosan. Plasma concentrations in CHS dolphins ranged from 0.12 to 0.27 ng/g wet weight (mean 0.18 ng/g), with 31% of the sampled individuals having detectable triclosan. The mean IRL dolphin plasma concentrations were 0.072 ng/g wet weight (range 0.025-0.11 ng/g); 23% of the samples having detectable triclosan. In the CHS area, triclosan effluent values from two WWTP were both 190 ng/L and primary influents were 2800 ng/L and 3400 ng/L. Triclosan values in CHS estuarine surface water samples averaged 7.5 ng/L (n = 18) ranging from 4.9 to 14 ng/L. This is the first study to report bioaccumulation of anthropogenic triclosan in a marine mammal highlighting the need for further monitoring and assessment. - Triclosan in bottlenose dolphin plasma and their environment.

  3. Skin Lesions on Common Bottlenose Dolphins (Tursiops truncatus) from Three Sites in the Northwest Atlantic, USA

    Science.gov (United States)

    Hart, Leslie Burdett; Rotstein, Dave S.; Wells, Randall S.; Allen, Jason; Barleycorn, Aaron; Balmer, Brian C.; Lane, Suzanne M.; Speakman, Todd; Zolman, Eric S.; Stolen, Megan; McFee, Wayne; Goldstein, Tracey; Rowles, Teri K.; Schwacke, Lori H.

    2012-01-01

    Skin disease occurs frequently in many cetacean species across the globe; methods to categorize lesions have relied on photo-identification (photo-id), stranding, and by-catch data. The current study used photo-id data from four sampling months during 2009 to estimate skin lesion prevalence and type occurring on bottlenose dolphins (Tursiops truncatus) from three sites along the southeast United States coast [Sarasota Bay, FL (SSB); near Brunswick and Sapelo Island, GA (BSG); and near Charleston, SC (CHS)]. The prevalence of lesions was highest among BSG dolphins (P = 0.587) and lowest in SSB (P = 0.380), and the overall prevalence was significantly different among all sites (pBSG dolphins (OR = 1.39; 95%CI:1.203–1.614). Approximately one-third of the lesioned dolphins from each site presented with multiple types, and population differences in lesion type occurrence were observed (p<0.05). Lesions on stranded dolphins were sampled to determine the etiology of different lesion types, which included three visually distinct samples positive for herpesvirus. Although generally considered non-fatal, skin disease may be indicative of animal health or exposure to anthropogenic or environmental threats, and photo-id data provide an efficient and cost-effective approach to document the occurrence of skin lesions in free-ranging populations. PMID:22427955

  4. Identification of Lactobacillus strains with probiotic features from the bottlenose dolphin (Tursiops truncatus)

    Science.gov (United States)

    Diaz, MA; Bik, EM; Carlin, KP; Venn-Watson, SK; Jensen, ED; Jones, SE; Gaston, EP; Relman, DA; Versalovic, J

    2013-01-01

    Aims In order to develop complementary health management strategies for marine mammals, we used culture-based and culture-independent approaches to identify gastrointestinal lactobacilli of the common bottlenose dolphin, Tursiops truncatus. Methods and Results We screened 307 bacterial isolates from oral and rectal swabs, milk and gastric fluid, collected from 38 dolphins in the U.S. Navy Marine Mammal Program, for potentially beneficial features. We focused our search on lactobacilli and evaluated their ability to modulate TNF secretion by host cells and inhibit growth of pathogens. We recovered Lactobacillus salivarius strains which secreted factors that stimulated TNF production by human monocytoid cells. These Lact. salivarius isolates inhibited growth of selected marine mammal and human bacterial pathogens. In addition, we identified a novel Lactobacillus species by culture and direct sequencing with 96·3% 16S rDNA sequence similarity to Lactobacillus ceti. Conclusions Dolphin-derived Lact. salivarius isolates possess features making them candidate probiotics for clinical studies in marine mammals. Significance and Impact of the Study This is the first study to isolate lactobacilli from dolphins, including a novel Lactobacillus species and a new strain of Lact. salivarius, with potential for veterinary probiotic applications. The isolation and identification of novel Lactobacillus spp. and other indigenous microbes from bottlenose dolphins will enable the study of the biology of symbiotic members of the dolphin microbiota and facilitate the understanding of the microbiomes of these unique animals. PMID:23855505

  5. Can bottlenose dolphins (Tursiops truncatus) cooperate when solving a novel task?

    Science.gov (United States)

    Kuczaj, Stan A; Winship, Kelley A; Eskelinen, Holli C

    2015-03-01

    Cooperative behavior has been observed in cetacean species in a variety of situations, including foraging, mate acquisition, play, and epimeletic behavior. However, it has proven difficult to demonstrate cooperative behavior among dolphins in more controlled settings. Dolphins (Tursiops truncatus) in this study were exposed to a task that could most easily be solved if dolphins cooperated. Six dolphins were provided opportunities to solve the task and had to learn to do so without human intervention or training. Two adult males consistently and spontaneously jointly interacted in order to most efficiently open a container that contained fish by pulling on ropes at the ends of the container. Their interaction was viewed as cooperative because each dolphin pulled on their respective ropes in the opposite direction, which resulted in one end of the container opening. The dolphins did not show aggression toward one another while solving the task, and both dolphins consumed the food after the container was opened. They also engaged in synchronous non-aggressive behaviors with the container after the food had been consumed. It is possible that some of the remaining four dolphins would have cooperated, but the two successful dolphins were dominant males and their interest in the apparatus appeared to preclude other animals from participating.

  6. Two Cases of Lacaziosis in Bottlenose Dolphins (Tursiops truncatus in Japan

    Directory of Open Access Journals (Sweden)

    Keiichi Ueda

    2013-01-01

    Full Text Available Lacaziosis, formerly called lobomycosis, caused by Lacazia loboi, is a zoonotic mycosis found in humans and dolphins and is endemic in the countries on the Atlantic Ocean. Although the Japanese coast is not considered an endemic area, photographic records of lacaziosis-like skin lesions were found in bottlenose dolphins (Tursiops truncatus that were migrating in the Goto Islands (Nagasaki Prefecture, Japan. We diagnosed 2 cases of lacaziosis in bottlenose dolphins captured simultaneously at the same coast within Japanese territory on the basis of clinical characteristics, cytology, histopathology, immunological tests, and detection of partial sequences of a 43 kDa glycoprotein coding gene (gp43 with a nested-PCR system. The granulomatous skin lesions from the present cases were similar to those found in animals from endemic areas, containing multiple budding and chains of round yeast cells and positive in the immune-staining with anti-Paracoccidioides brasiliensis serum which is a fungal species related to L. loboi; however, the gp43 gene sequences derived from the present cases showed 94.1% homology to P. brasiliensis and 84.1% to L. loboi. We confirmed that the causative agent at the present cases was different genotype of L. loboi from Amazon area.

  7. Fatal necrotizing fasciitis and myositis in a captive common bottlenose dolphin (Tursiops truncatus) associated with Streptococcus agalactiae.

    Science.gov (United States)

    Zappulli, Valentina; Mazzariol, Sandro; Cavicchioli, Laura; Petterino, Claudio; Bargelloni, Luca; Castagnaro, Massimo

    2005-11-01

    A common bottlenose dolphin (Tursiops truncatus) was presented for necropsy after acute onset of gastrointestinal signs and cutaneous lesions that rapidly progressed to death. Gross and microscopic findings were characterized by locally extensive severe necrohemorrhagic fasciitis and cellulitis, and severe necrotizing myositis in the head and dorsocranial thorax, with numerous disseminated gram-positive cocci. Streptococcus agalactiae was isolated from the lesions and from visceral organs (liver and lung), and it was identified by standard microbiology techniques. This communication is the first report of necrotizing fasciitis in a marine mammal associated with S. agalactiae.

  8. Geo(Im)pulseBite marks on early Holocene Tursiops truncatus fossils from the North Sea indicate scavenging by rays (Chondrichthyes, Rajidae)

    NARCIS (Netherlands)

    Netten, H.H. van; Reumer, J.W.F.

    A number of Tursiops truncatus mandibles in the collection of fossil marine mammals in the Rotterdam Natural History Museum have marks consisting of several parallel linear grooves. These marks are also found on four atlas complexes, a scapula and on one vertebra. The hypothesis that they are bite

  9. The Bottlenose Dolphin (Tursiops truncatus) as a Model to Understand Variation in Stress and Reproductive Hormone Measures in Relation to Sampling Matrix, Demographics, and Environmental Factors

    Science.gov (United States)

    2015-09-30

    1 DISTRIBUTION STATEMENT A. Approved for public release; distribution is unlimited. FINAL REPORT The Bottlenose Dolphin (Tursiops truncatus...indicators and methods to quantify chronic stress in bottlenose dolphins . Much research had focused on the stimuli which induce stress in marine mammals, as...mammals was essential for understanding risks and long- term consequences for populations. OBJECTIVES Using the bottlenose dolphin as a model

  10. The metabolic cost of communicative sound production in bottlenose dolphins (Tursiops truncatus).

    Science.gov (United States)

    Noren, Dawn P; Holt, Marla M; Dunkin, Robin C; Williams, Terrie M

    2013-05-01

    Bottlenose dolphins (Tursiops truncatus) produce various communicative sounds that are important for social behavior, maintaining group cohesion and coordinating foraging. For example, whistle production increases during disturbances, such as separations of mother-calf pairs and vessel approaches. It is clear that acoustic communication is important to the survival of these marine mammals, yet the metabolic cost of producing whistles and other socials sounds and the energetic consequences of modifying these sounds in response to both natural and anthropogenic disturbance are unknown. We used flow-through respirometry to determine whether the metabolic cost of sound production could be quantified in two captive dolphins producing social sounds (whistles and squawks). On average, we found that metabolic rates measured during 2 min periods of sound production were 1.2 times resting values. Up to 7 min were required for metabolism to return to resting values following vocal periods. The total metabolic cost (over resting values) of the 2 min vocal period plus the required recovery period (163.3 to 2995.9 ml O2 or 3279.6 to 60,166.7 J) varied by individual as well as by mean duration of sounds produced within the vocal period. Observed variation in received cumulative sound energy levels of vocalizations was not related to total metabolic costs. Furthermore, our empirical findings did not agree with previous theoretical estimates of the metabolic cost of whistles. This study provides the first empirical data on the metabolic cost of sound production in dolphins, which can be used to estimate metabolic costs of vocal responses to environmental perturbations in wild dolphins.

  11. Environmental changes and anthropogenic factors modulate social play in captive bottlenose dolphins (Tursiops truncatus).

    Science.gov (United States)

    Serres, Agathe; Delfour, Fabienne

    2017-03-01

    Social play varies among species and individuals and changes in frequency and duration during ontogeny. This type of play is modulated by environmental changes (e.g., resource availability). In captivity, cetaceans and their environment are managed by humans, and training sessions and/or public presentations punctuate the day as well as other frequent or occasional events. There is a lack of research on the effects of environmental events that occur in captivity and might affect dolphins' behavior. We studied the context in which nine bottlenose dolphins (Tursiops truncatus) played socially and the events that could potentially impact this social interaction. The dolphins' social play behavior was significantly more frequent and lasted longer in the morning than in the afternoon and was present before and after interactions with their trainers with a non-significant tendency to be more frequent before and after a training session than a public presentation. In an experimental paradigm using familiar environmental enrichment, our results demonstrated that environmental enrichment tended to increase social play duration whereas temporary noisy construction work around the pool and display of agonistic behaviors by members of the group significantly decreased it. These results contribute to better understand the social play distribution in captive bottlenose dolphins and the impact of different events within their daily lives. Since play decreases or disappears when animals are facing unfavorable conditions, the evaluation of social play may relate to the animals' current well-being. We suggest that social play has potential to become an indicator of bottlenose dolphins' current welfare state. © 2017 Wiley Periodicals, Inc.

  12. Adrenal Hormones in Common Bottlenose Dolphins (Tursiops truncatus): Influential Factors and Reference Intervals

    Science.gov (United States)

    Hart, Leslie B.; Wells, Randall S.; Kellar, Nick; Balmer, Brian C.; Hohn, Aleta A.; Lamb, Stephen V.; Rowles, Teri; Zolman, Eric S.; Schwacke, Lori H.

    2015-01-01

    Inshore common bottlenose dolphins (Tursiops truncatus) are exposed to a broad spectrum of natural and anthropogenic stressors. In response to these stressors, the mammalian adrenal gland releases hormones such as cortisol and aldosterone to maintain physiological and biochemical homeostasis. Consequently, adrenal gland dysfunction results in disruption of hormone secretion and an inappropriate stress response. Our objective herein was to develop diagnostic reference intervals (RIs) for adrenal hormones commonly associated with the stress response (i.e., cortisol, aldosterone) that account for the influence of intrinsic (e.g., age, sex) and extrinsic (e.g., time) factors. Ultimately, these reference intervals will be used to gauge an individual’s response to chase-capture stress and could indicate adrenal abnormalities. Linear mixed models (LMMs) were used to evaluate demographic and sampling factors contributing to differences in serum cortisol and aldosterone concentrations among bottlenose dolphins sampled in Sarasota Bay, Florida, USA (2000–2012). Serum cortisol concentrations were significantly associated with elapsed time from initial stimulation to sample collection (pserum concentrations of aldosterone and variables reported in previous studies (i.e., age, elapsed sampling time) were not observed in the current project (pSerum aldosterone concentrations from animals sampled at the three additional sites were compared to the detection limit, and the proportion of animals with low aldosterone concentrations was not significantly different than an expected prevalence of 16%. Although this study relied upon long-term, free-ranging bottlenose dolphin health data from a single site, the objective RIs can be used for future evaluation of adrenal function among individuals sampled during capture-release health assessments. PMID:25993341

  13. Spatial distribution of bottlenose dolphins (Tursiops truncatus) inferred from stable isotopes and priority organic pollutants

    International Nuclear Information System (INIS)

    Wilson, Rachel Marie; Kucklick, John R.; Balmer, Brian C.; Wells, Randall S.; Chanton, Jeffrey P.; Nowacek, Douglas P.

    2012-01-01

    Differences in priority organic pollutants (POPs), analyzed by gas chromatography-mass spectrometry, and stable isotope ratios (δ 13 C, δ 34 S, and δ 15 N; analyzed by isotope ratio-mass spectrometry), divide 77 bottlenose dolphins (Tursiops truncatus) from the Florida Gulf Coast into three distinct groups. POP levels reflect human population and historical contamination along the coast. In the least disturbed site, concentrations of ΣPOP in male dolphins were 18,000 ng g −1 ± 6000 (95% confidence interval here and throughout); in the intermediate bay, males had ΣPOP concentrations of 19,000 ng g −1 ± 10,000. St Andrews Bay was home to dolphins with the highest ΣPOP concentrations: 44,000 ng g −1 ± 10,300. δ 34 S and δ 15 N, differed significantly between St. George Sound dolphins and those frequenting each of the other two bays, but not between St. Andrews and St. Joseph Bays. ΣPOP concentrations were statistically higher in dolphins frequenting St. Andrews Bay, but were not significantly different between dolphins occupying St. Joseph Bay and St. George Sound. Thus, using either POP or isotope values alone, we would only be able to identify two dolphin groups, but when POP and isotope data are viewed cumulatively, the results clearly define three distinct communities occupying this region. - Highlights: ► We compare isotopes and POP levels in dolphins occupying three embayments. ► POP levels varied significantly among two embayments separated by < 50 km. ► Differentiation correlated with historical contamination from a SuperFund site. ► Cumulatively, isotopes and POP levels indicate 3 distinct dolphin communities. ► This data provides the first assessment of dolphin POP contamination in the region.

  14. Altrenogest and progesterone therapy during pregnancy in bottlenose dolphins (Tursiops truncatus) with progesterone insufficiency.

    Science.gov (United States)

    Robeck, Todd R; Gill, Claudia; Doescher, Bethany M; Sweeney, Jay; De Laender, Piet; Van Elk, Cornelis E; O'Brien, Justine K

    2012-06-01

    Progesterone production is essential for growth and development of the conceptus during pregnancy. Abnormal development of the corpus luteum (CL) after conception can result in early embryonic loss or fetal abortion. Routine monitoring of bottlenose dolphin (Tursiops truncatus) pregnancy after artificial insemination or natural conception with ultrasonography and serum progesterone determination has allowed for the establishment of expected fetal growth rates and hormone concentrations. Using these monitoring techniques, we revealed four pregnant dolphins (12-24 yr old) with abnormally low progesterone production indicative of luteal insufficiency. Once diagnosed, animals were placed on altrenogest (0.044-0.088 mg/kg once daily) alone or with oral progesterone (50-200 mg twice daily). Doses of hormone were increased or decreased in each animal based on how fetal skull biparietal and thoracic growth rates compared with published normal values. Hormones were withdrawn starting from day 358 of gestation in animals 1 and 2, with labor occurring 6 and 7 days after withdrawal and at 376 and 373 days of gestation, respectively. Both deliveries were dystocic, with each calf requiring manual extraction and fetotomy for calf 1. The fetuses in animals 3 and 4 died at 348 and 390 days of gestation, respectively. Induction of labor was attempted in both animals, after fetal death, by using a combination of rapid progesterone withdrawal and steroid and prostaglandin F2alpha administration. The calf of animal 4 had to be removed with manual cervical dilation and fetotomy All adult females survived the procedures. These data provide the first in vivo evidence that the CL is the primary source of progesterone throughout pregnancy in the bottlenose dolphin. Until further characterization of hormones required during pregnancy and at parturition has been accomplished, the exogenous progestagen supplementation protocol described here cannot be recommended for treatment of progesterone

  15. The diving physiology of bottlenose dolphins (Tursiops truncatus). II. Biomechanics and changes in buoyancy at depth.

    Science.gov (United States)

    Skrovan, R C; Williams, T M; Berry, P S; Moore, P W; Davis, R W

    1999-10-01

    During diving, marine mammals must balance the conservation of limited oxygen reserves with the metabolic costs of swimming exercise. As a result, energetically efficient modes of locomotion provide an advantage during periods of submergence and will presumably increase in importance as the animals perform progressively longer dives. To determine the effect of a limited oxygen supply on locomotor performance, we compared the kinematics and behavior of swimming and diving bottlenose dolphins. Adult bottlenose dolphins (Tursiops truncatus) were trained to swim horizontally near the water surface or submerged at 5 m and to dive to depths ranging from 12 to 112 m. Swimming kinematics (preferred swimming mode, stroke frequency and duration of glides) were monitored using submersible video cameras (Sony Hi-8) held by SCUBA divers or attached to a pack on the dorsal fin of the animal. Drag and buoyant forces were calculated from patterns of deceleration for horizontally swimming and vertically diving animals. The results showed that dolphins used a variety of swimming gaits that correlated with acceleration. The percentage of time spent gliding during the descent phase of dives increased with depth. Glide distances ranged from 7.1+/-1.9 m for 16 m dives to 43.6+/-7.0 m (means +/- s.e.m.) for 100 m dives. These gliding patterns were attributed to changes in buoyancy associated with lung compression at depth. By incorporating prolonged glide periods, the bottlenose dolphin realized a theoretical 10-21 % energetic savings in the cost of a 100 m dive in comparison with dives based on neutral buoyancy models. Thus, modifying locomotor patterns to account for physical changes with depth appears to be one mechanism that enables diving mammals with limited oxygen stores to extend the duration of a dive.

  16. The ontogenetic changes in the thermal properties of blubber from Atlantic bottlenose dolphin Tursiops truncatus.

    Science.gov (United States)

    Dunkin, Robin C; McLellan, William A; Blum, James E; Pabst, D Ann

    2005-04-01

    In Atlantic bottlenose dolphins Tursiops truncatus, both the thickness and lipid content of blubber vary across ontogeny and across individuals of differing reproductive and nutritional status. This study investigates how these changes in blubber morphology and composition influence its thermal properties. Thermal conductivity (W m(-1) deg.(-1), where deg. is degrees C) and thermal insulation (m(2) deg. W(-1)) of dolphin blubber were measured in individuals across an ontogenetic series (fetus through adult, N=36), pregnant females (N=4) and emaciated animals (N=5). These thermal properties were determined by the simultaneous use of two common experimental approaches, the heat flux disc method and the standard material method. Thickness, lipid and water content were measured for each blubber sample. Thermal conductivity and insulation varied significantly across ontogeny. Blubber from fetuses through sub-adults was less conductive (range=0.11-0.13+/-0.02 W m(-1) deg.(-1)) than that of adults (mean=0.18 W m(-1) deg.(-1)). The conductivity of blubber from pregnant females was similar to non-adult categories, while that of emaciated animals was significantly higher (0.24 +/- 0.04 W m deg.(-1)) than all other categories. Blubber from sub-adults and pregnant females had the highest insulation values while fetuses and emaciated animals had the lowest. In nutritionally dependent life history categories, changes in blubber's thermal insulation were characterized by stable blubber quality (i.e. conductivity) and increased blubber quantity (i.e. thickness). In nutritionally independent animals, blubber quantity remained stable while blubber quality varied. A final, unexpected observation was that heat flux measurements at the deep blubber surface were significantly higher than that at the superficial surface, a pattern not observed in control materials. This apparent ability to absorb heat, coupled with blubber's fatty acid composition, suggest that dolphin integument may

  17. Captive bottlenose dolphins (Tursiops truncatus spontaneously using water flow to manipulate objects.

    Directory of Open Access Journals (Sweden)

    Chisato Yamamoto

    Full Text Available Several terrestrial animals and delphinids manipulate objects in a tactile manner, using parts of their bodies, such as their mouths or hands. In this paper, we report that bottlenose dolphins (Tursiops truncatus manipulate objects not by direct bodily contact, but by spontaneous water flow. Three of four dolphins at Suma Aqualife Park performed object manipulation with food. The typical sequence of object manipulation consisted of a three step procedure. First, the dolphins released the object from the sides of their mouths while assuming a head-down posture near the floor. They then manipulated the object around their mouths and caught it. Finally, they ceased to engage in their head-down posture and started to swim. When the dolphins moved the object, they used the water current in the pool or moved their head. These results showed that dolphins manipulate objects using movements that do not directly involve contact between a body part and the object. In the event the dolphins dropped the object on the floor, they lifted it by making water flow in one of three methods: opening and closing their mouths repeatedly, moving their heads lengthwise, or making circular head motions. This result suggests that bottlenose dolphins spontaneously change their environment to manipulate objects. The reason why aquatic animals like dolphins do object manipulation by changing their environment but terrestrial animals do not may be that the viscosity of the aquatic environment is much higher than it is in terrestrial environments. This is the first report thus far of any non-human mammal engaging in object manipulation using several methods to change their environment.

  18. Spatial distribution of bottlenose dolphins (Tursiops truncatus) inferred from stable isotopes and priority organic pollutants

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, Rachel Marie, E-mail: ryounge@ocean.fsu.edu [Department of EOAS-Oceanography, Florida State University, 117 North Woodward Avenue, Tallahassee, Florida, 32306 (United States); Kucklick, John R. [National Institute of Standards and Technology, Hollings Marine Laboratory, Charleston, 331 Fort Johnson Road, Charleston, South Carolina 29412 (United States); Balmer, Brian C.; Wells, Randall S. [Chicago Zoological Society c/o Mote Marine Laboratory, 1600 Ken Thompson Parkway Sarasota, FL, 34236 (United States); Chanton, Jeffrey P. [Department of EOAS-Oceanography, Florida State University, 117 North Woodward Avenue, Tallahassee, Florida, 32306 (United States); Nowacek, Douglas P. [Nicholas School of the Environment and Pratt School of Engineering, Duke University - Marine Laboratory, 135 Duke Marine Lab Rd., Beaufort, NC 28516 (United States)

    2012-05-15

    Differences in priority organic pollutants (POPs), analyzed by gas chromatography-mass spectrometry, and stable isotope ratios ({delta}{sup 13}C, {delta}{sup 34}S, and {delta}{sup 15}N; analyzed by isotope ratio-mass spectrometry), divide 77 bottlenose dolphins (Tursiops truncatus) from the Florida Gulf Coast into three distinct groups. POP levels reflect human population and historical contamination along the coast. In the least disturbed site, concentrations of {Sigma}POP in male dolphins were 18,000 ng g{sup -1} {+-} 6000 (95% confidence interval here and throughout); in the intermediate bay, males had {Sigma}POP concentrations of 19,000 ng g{sup -1} {+-} 10,000. St Andrews Bay was home to dolphins with the highest {Sigma}POP concentrations: 44,000 ng g{sup -1} {+-} 10,300. {delta}{sup 34}S and {delta}{sup 15}N, differed significantly between St. George Sound dolphins and those frequenting each of the other two bays, but not between St. Andrews and St. Joseph Bays. {Sigma}POP concentrations were statistically higher in dolphins frequenting St. Andrews Bay, but were not significantly different between dolphins occupying St. Joseph Bay and St. George Sound. Thus, using either POP or isotope values alone, we would only be able to identify two dolphin groups, but when POP and isotope data are viewed cumulatively, the results clearly define three distinct communities occupying this region. - Highlights: Black-Right-Pointing-Pointer We compare isotopes and POP levels in dolphins occupying three embayments. Black-Right-Pointing-Pointer POP levels varied significantly among two embayments separated by < 50 km. Black-Right-Pointing-Pointer Differentiation correlated with historical contamination from a SuperFund site. Black-Right-Pointing-Pointer Cumulatively, isotopes and POP levels indicate 3 distinct dolphin communities. Black-Right-Pointing-Pointer This data provides the first assessment of dolphin POP contamination in the region.

  19. Skin lesions on common bottlenose dolphins (Tursiops truncatus from three sites in the Northwest Atlantic, USA.

    Directory of Open Access Journals (Sweden)

    Leslie Burdett Hart

    Full Text Available Skin disease occurs frequently in many cetacean species across the globe; methods to categorize lesions have relied on photo-identification (photo-id, stranding, and by-catch data. The current study used photo-id data from four sampling months during 2009 to estimate skin lesion prevalence and type occurring on bottlenose dolphins (Tursiops truncatus from three sites along the southeast United States coast [Sarasota Bay, FL (SSB; near Brunswick and Sapelo Island, GA (BSG; and near Charleston, SC (CHS]. The prevalence of lesions was highest among BSG dolphins (P = 0.587 and lowest in SSB (P = 0.380, and the overall prevalence was significantly different among all sites (p<0.0167. Logistic regression modeling revealed a significant reduction in the odds of lesion occurrence for increasing water temperatures (OR = 0.92; 95%CI:0.906-0.938 and a significantly increased odds of lesion occurrence for BSG dolphins (OR = 1.39; 95%CI:1.203-1.614. Approximately one-third of the lesioned dolphins from each site presented with multiple types, and population differences in lesion type occurrence were observed (p<0.05. Lesions on stranded dolphins were sampled to determine the etiology of different lesion types, which included three visually distinct samples positive for herpesvirus. Although generally considered non-fatal, skin disease may be indicative of animal health or exposure to anthropogenic or environmental threats, and photo-id data provide an efficient and cost-effective approach to document the occurrence of skin lesions in free-ranging populations.

  20. Mucocutaneous lesions in free-ranging Atlantic bottlenose dolphins Tursiops truncatus from the southeastern USA.

    Science.gov (United States)

    Bossart, Gregory D; Schaefer, Adam M; McCulloch, Stephen; Goldstein, Juli; Fair, Patricia A; Reif, John S

    2015-08-20

    Mucocutaneous lesions were biopsied from free-ranging Atlantic bottlenose dolphins Tursiops truncatus inhabiting the Indian River Lagoon (IRL), Florida, and estuarine waters of Charleston (CHS), South Carolina, USA, between 2003 and 2013. A total of 78 incisional biopsies from 58 dolphins (n=43 IRL, n=15 CHS) were examined. Thirteen dolphins had 2 lesions biopsied at the same examination, and 6 dolphins were re-examined and re-biopsied at time intervals varying from 1 to 8 yr. Biopsy sites included the skin (n=47), tongue (n=2), and genital mucosa (n=29). Pathologic diagnoses were: orogenital sessile papilloma (39.7%), cutaneous lobomycosis (16.7%), tattoo skin disease (TSD; 15.4%), nonspecific chronic to chronic-active dermatitis (15.4%), and epidermal hyperplasia (12.8%). Pathologic diagnoses from dolphins with 2 lesions were predominately orogenital sessile papillomas (n=9) with nonspecific chronic to chronic-active dermatitis (n=4), TSD (n=3), lobomycosis (n=1), and epidermal hyperplasia (n=1). Persistent pathologic diagnoses from the same dolphins re-examined and re-biopsied at different times included genital sessile papillomas (n=3), lobomycosis (n=2), and nonspecific dermatitis (n=2). This is the first study documenting the various types, combined prevalence, and progression of mucocutaneous lesions in dolphins from the southeastern USA. The data support other published findings describing the health patterns in dolphins from these geographic regions. Potential health impacts related to the observed suite of lesions are important for the IRL and CHS dolphin populations, since previous studies have indicated that both populations are affected by complex infectious diseases often associated with immunologic disturbances and anthropogenic contaminants.

  1. Blood-Based Indicators of Insulin Resistance and Metabolic Syndrome in Bottlenose Dolphins (Tursiops truncatus)

    Science.gov (United States)

    Venn-Watson, Stephanie; Smith, Cynthia Rowe; Stevenson, Sacha; Parry, Celeste; Daniels, Risa; Jensen, Eric; Cendejas, Veronica; Balmer, Brian; Janech, Michael; Neely, Benjamin A.; Wells, Randall

    2013-01-01

    Similar to people with metabolic syndrome, bottlenose dolphins (Tursiops truncatus) can have a sustained postprandial hyperglycemia and hyperinsulinemia, dyslipidemia, and fatty liver disease. A panel of potential postprandial blood-based indicators of insulin resistance and metabolic syndrome were compared among 34 managed collection dolphins in San Diego Bay, CA, USA (Group A) and 16 wild, free-ranging dolphins in Sarasota Bay, FL, USA (Group B). Compared to Group B, Group A had higher insulin (2.1 ± 2.5 and 13 ± 13 μIU/ml), glucose (87 ± 19 and 108 ± 12 mg/dl), and triglycerides (75 ± 28 and 128 ± 45 mg/dl) as well as higher cholesterol (total, high-density lipoprotein cholesterol, and very low density lipoprotein cholesterol), iron, transferrin saturation, gamma-glutamyl transpeptidase (GGT), alanine transaminase, and uric acid. Group A had higher percent unmodified adiponectin. While Group A dolphins were older, the same blood-based differences remained when controlling for age. There were no differences in body mass index (BMI) between the groups, and comparisons between Group B and Group A dolphins have consistently demonstrated lower stress hormones levels in Group A. Group A dolphins with high insulin (greater than 14 μIU/ml) had higher glucose, iron, GGT, and BMI compared to Group A dolphins with lower insulin. These findings support that some dolphin groups may be more susceptible to insulin resistance compared to others, and primary risk factors are not likely age, BMI, or stress. Lower high-molecular weight adiponectin has been identified as an independent risk factor for type 2 diabetes in humans and may be a target for preventing insulin resistance in dolphins. Future investigations with these two dolphin populations, including dietary and feeding differences, may provide valuable insight for preventing and treating insulin resistance in humans. PMID:24130551

  2. Social Differentiation in Common Bottlenose Dolphins (Tursiops truncatus) that Engage in Human-Related Foraging Behaviors

    Science.gov (United States)

    2017-01-01

    Both natural and human-related foraging strategies by the common bottlenose dolphin (Tursiops truncatus) have resulted in social segregation in several areas of the world. Bottlenose dolphins near Savannah, Georgia beg at an unprecedented rate and also forage behind commercial shrimp trawlers, providing an opportunity to study the social ramifications of two human-related foraging behaviors within the same group of animals. Dolphins were photo-identified via surveys conducted throughout estuarine waterways around Savannah in the summers of 2009–2011. Mean half-weight indices (HWI) were calculated for each foraging class, and community division by modularity was used to cluster animals based on association indices. Pairs of trawler dolphins had a higher mean HWI (0.20 ± 0.07) than pairs of non-trawler dolphins (0.04 ± 0.02) or mixed pairs (0.02 ± 0.02). In contrast, pairs of beggars, non-beggars, and mixed pairs all had similar means, with HWI between 0.05–0.07. Community division by modularity produced a useful division (0.307) with 6 clusters. Clusters were predominately divided according to trawler status; however, beggars and non-beggars were mixed throughout clusters. Both the mean HWI and social clusters revealed that the social structure of common bottlenose dolphins near Savannah, Georgia was differentiated based on trawler status but not beg status. This finding may indicate that foraging in association with trawlers is a socially learned behavior, while the mechanisms for the propagation of begging are less clear. This study highlights the importance of taking into account the social parameters of a foraging behavior, such as how group size or competition for resources may affect how the behavior spreads. The positive or negative ramifications of homophily may influence whether the behaviors are exhibited by individuals within the same social clusters and should be considered in future studies examining social relationships and foraging behaviors

  3. Comparison of nephrolithiasis prevalence in two bottlenose dolphin (Tursiops truncatus populations

    Directory of Open Access Journals (Sweden)

    Cynthia Rowe Smith

    2013-10-01

    Full Text Available In humans, ammonium urate nephrolithiasis is rare in the Western hemisphere and more common in Japan and developing countries. Among a variety of risk factors, insulin resistance has been associated with urate nephrolithiasis in people. Bottlenose dolphins (Tursiops truncatus are susceptible to ammonium urate nephrolithiasis, and it is believed that some populations are more likely to develop nephrolithiasis compared to others. In an effort to better understand population-based risk factors for ammonium urate nephrolithiasis in dolphins and their comparative value to humans, sonographic evaluation was performed on dolphins from a managed collection in San Diego Bay, California (n=40 and dolphins from a free-ranging, nearshore population in Sarasota Bay, Florida (n=39 to look for evidence of nephrolithiasis. While 14 (35% of San Diego Bay dolphins evaluated for the study had sonographic evidence of nephrolithiasis, none of the Sarasota Bay dolphins had evidence of disease. Presence or absence of stones was confirmed by computed tomography in a subset of the San Diego collection (n=10; 4 dolphins with stones, 6 without stones. Age was identified as a risk factor, as dolphins with stones in the San Diego collection were significantly older than dolphins without stones (25.4 vs. 19.1 yrs, respectively; p=0.04. Additionally, San Diego dolphins included in the study were significantly older than Sarasota Bay dolphins (21.3 vs. 13.8 yrs, respectively; p=0.008. In addition to the previously reported risk factors of hypocitraturia and hyperinsulinemia in bottlenose dolphins, other potential factors include geographic location, managed versus free-ranging status, prey species, and feeding schedules.

  4. Behavioral Responses and Temporary Shift in Masked Hearing Threshold of Bottlenose Dolphins, Tursiops truncatus, to 1-second Tones of 141 to 201 dB re 1 Micron Pa

    National Research Council Canada - National Science Library

    Ridgway, Sam

    1997-01-01

    ...) as a means of evaluating impacts of those emissions. Existing Navy methods published in the Journal of the Acoustical Society of America were applied to investigate TTS in the hearing sensitivity of bottlenose dolphins (Tursiops truncatus...

  5. Adrenal Hormones in Common Bottlenose Dolphins (Tursiops truncatus: Influential Factors and Reference Intervals.

    Directory of Open Access Journals (Sweden)

    Leslie B Hart

    Full Text Available Inshore common bottlenose dolphins (Tursiops truncatus are exposed to a broad spectrum of natural and anthropogenic stressors. In response to these stressors, the mammalian adrenal gland releases hormones such as cortisol and aldosterone to maintain physiological and biochemical homeostasis. Consequently, adrenal gland dysfunction results in disruption of hormone secretion and an inappropriate stress response. Our objective herein was to develop diagnostic reference intervals (RIs for adrenal hormones commonly associated with the stress response (i.e., cortisol, aldosterone that account for the influence of intrinsic (e.g., age, sex and extrinsic (e.g., time factors. Ultimately, these reference intervals will be used to gauge an individual's response to chase-capture stress and could indicate adrenal abnormalities. Linear mixed models (LMMs were used to evaluate demographic and sampling factors contributing to differences in serum cortisol and aldosterone concentrations among bottlenose dolphins sampled in Sarasota Bay, Florida, USA (2000-2012. Serum cortisol concentrations were significantly associated with elapsed time from initial stimulation to sample collection (p<0.05, and RIs were constructed using nonparametric methods based on elapsed sampling time for dolphins sampled in less than 30 minutes following net deployment (95% RI: 0.91-4.21 µg/dL and following biological sampling aboard a research vessel (95% RI: 2.32-6.68 µg/dL. To examine the applicability of the pre-sampling cortisol RI across multiple estuarine stocks, data from three additional southeast U.S. sites were compared, revealing that all of the dolphins sampled from the other sites (N = 34 had cortisol concentrations within the 95th percentile RI. Significant associations between serum concentrations of aldosterone and variables reported in previous studies (i.e., age, elapsed sampling time were not observed in the current project (p<0.05. Also, approximately 16% of

  6. Diagnosis and successful treatment of a lung abscess associated with Brucella species infection in a bottlenose dolphin (Tursiops truncatus).

    Science.gov (United States)

    Cassle, Stephen E; Jensen, Eric D; Smith, Cynthia R; Meegan, Jennifer M; Johnson, Shawn P; Lutmerding, Betsy; Ridgway, Sam H; Francis-Floyd, Ruth

    2013-06-01

    This brief communication describes the clinical presentation, antemortem diagnosis, and successful treatment of a pulmonary abscess associated with a Brucella sp. in a 27-yr-old female bottlenose dolphin (Tursiops truncatus). Ultrasound revealed a 3-cm diameter hypoechoic mass deep to the pleural lining in the left lung field. Multiple ultrasound-guided fine-needle aspirates were performed and tested for bacterial and fungal etiology. All cultures were negative, but the infectious agent was identified by MicroSEQ analysis in two samples and confirmed with real-time polymerase chain reaction (PCR) amplification using known Brucella sp. primers. Amikacin was infused into the abscess and was followed by an oral doxycycline and rifampin protocol. Follow-up diagnostic imaging, including radiographs and computed tomography, revealed a resolved lesion with minimal mineralization within the affected lung fields. Brucellosis should be considered for pulmonary disease in dolphins, and personnel who interact with marine animals should use caution to prevent zoonotic brucellosis.

  7. Laryngeal snaring by ingested fishing net in a common bottlenose dolphin (Tursiops truncatus) off the Israeli shoreline.

    Science.gov (United States)

    Levy, Alon M; Brenner, Ori; Scheinin, Aviad; Morick, Dan; Ratner, Eliana; Goffman, Oz; Kerem, Dan

    2009-07-01

    We report an unusual snaring of the larynx in an adult, female common bottlenose dolphin (Tursiops truncatus). The dolphin was observed swimming and diving in Haifa Port, Israel, but was found dead the next day, 60 km south, on the coast. Postmortem examination revealed stranded-cordage, nylon filaments wrapped around the larynx, cutting through the soft tissue, and extending down into the forestomach, where a large mass of netting was found. The cachectic state of the dolphin and the subacute to chronic, hyper-plastic response of soft tissue surrounding the filaments lodged around the larynx, suggest a prolonged period of starvation, which led to the final weakness and wasting of the dolphin.

  8. Development of sperm sexing and associated assisted reproductive technology for sex preselection of captive bottlenose dolphins (Tursiops truncatus).

    Science.gov (United States)

    O'Brien, J K; Robeck, T R

    2006-01-01

    Research was conducted to develop sperm sorting and novel sperm preservation methodologies for sex predetermination in the bottlenose dolphin (Tursiops truncatus) using artificial insemination. In Study 1, the effect of seminal plasma (SP), sperm concentration and freezing rate (FR) on in vitro sperm quality of liquid-stored, non-sorted spermatozoa was examined. There was no effect (P > 0.05) of prefreeze SP addition on post-thaw quality (progressive motility, kinetic rating, sperm motility index (SMI), viability and acrosome integrity). Post-thaw motility parameters and viability were higher (P insemination of three dolphins with sorted, frozen-thawed X-bearing spermatozoa resulted in one conception and the birth of a female calf. High-purity sorting of dolphin spermatozoa, derived from liquid-stored semen, can be achieved with minimal loss of in vitro sperm quality and samples are functional in vivo.

  9. Geographic specificity of Aroclor 1268 in bottlenose dolphins (Tursiops truncatus) frequenting the Turtle/Brunswick River Estuary, Georgia (USA)

    International Nuclear Information System (INIS)

    Pulster, Erin L.; Maruya, Keith A.

    2008-01-01

    Coastal marine resources are at risk from anthropogenic contaminants, including legacy persistent organic pollutants (POPs) with half-lives of decades or more. To determine if polychlorinated biphenyl (PCB) signatures can be used to distinguish among local populations of inshore bottlenose dolphins (Tursiops truncatus) along the southeastern U.S. coast, blubber from free-ranging and stranded animals were collected along the Georgia coast in 2004 and analyzed for PCB congeners using gas chromatography with electron capture and negative chemical ionization mass spectrometric detection (GC-ECD and GC-NCI-MS). Mean total PCB concentrations (77 ± 34 μg/g lipid) were more than 10 fold higher and congener distributions were highly enriched in Cl 7 -Cl 10 homologs in free-ranging animals from the Turtle/Brunswick River estuary (TBRE) compared with strandings samples from Savannah area estuaries 90 km to the north. Using principal components analysis (PCA), the Aroclor 1268 signature associated with TBRE animals was distinct from that observed in Savannah area animals, and also from those in animals biopsied in other southeastern U.S estuaries. Moreover, PCB signatures in dolphin blubber closely resembled those in local preferred prey fish species, strengthening the hypothesis that inshore T. truncatus populations exhibit long-term fidelity to specific estuaries and making them excellent sentinels for assessing the impact of stressors on coastal ecosystem health

  10. Geographic specificity of Aroclor 1268 in bottlenose dolphins (Tursiops truncatus) frequenting the Turtle/Brunswick River Estuary, Georgia (USA)

    Energy Technology Data Exchange (ETDEWEB)

    Pulster, Erin L. [Marine Sciences Department, Savannah State University, Savannah, Georgia, 31404 (United States); Skidaway Institute of Oceanography, 10 Ocean Science Circle, Savannah, Georgia, 31411 (United States)], E-mail: epulster@mote.org; Maruya, Keith A. [Skidaway Institute of Oceanography, 10 Ocean Science Circle, Savannah, Georgia, 31411 (United States)

    2008-04-15

    Coastal marine resources are at risk from anthropogenic contaminants, including legacy persistent organic pollutants (POPs) with half-lives of decades or more. To determine if polychlorinated biphenyl (PCB) signatures can be used to distinguish among local populations of inshore bottlenose dolphins (Tursiops truncatus) along the southeastern U.S. coast, blubber from free-ranging and stranded animals were collected along the Georgia coast in 2004 and analyzed for PCB congeners using gas chromatography with electron capture and negative chemical ionization mass spectrometric detection (GC-ECD and GC-NCI-MS). Mean total PCB concentrations (77 {+-} 34 {mu}g/g lipid) were more than 10 fold higher and congener distributions were highly enriched in Cl{sub 7}-Cl{sub 10} homologs in free-ranging animals from the Turtle/Brunswick River estuary (TBRE) compared with strandings samples from Savannah area estuaries 90 km to the north. Using principal components analysis (PCA), the Aroclor 1268 signature associated with TBRE animals was distinct from that observed in Savannah area animals, and also from those in animals biopsied in other southeastern U.S estuaries. Moreover, PCB signatures in dolphin blubber closely resembled those in local preferred prey fish species, strengthening the hypothesis that inshore T. truncatus populations exhibit long-term fidelity to specific estuaries and making them excellent sentinels for assessing the impact of stressors on coastal ecosystem health.

  11. Atlantic Bottlenose Dolphins (Tursiops truncatus) as A Sentinel for Exposure to Mercury in Humans: Closing the Loop

    Science.gov (United States)

    Reif, John S.; Schaefer, Adam M.; Bossart, Gregory D.

    2015-01-01

    Mercury (Hg) is a ubiquitous global contaminant with important public health implications. Mercury is released from a variety of anthropogenic, industrial processes, enters the earth's atmosphere and is re-deposited onto the earth’s surface in rainfall. Much of this Hg enters the oceans which cover the majority of the earth’s surface. In the marine environment, inorganic Hg is converted to the most toxic form of the element, methylmercury, and biomagnified through the trophic levels of the food web. The bottlenose dolphin (Tursiops truncatus) is the apex predator in many estuarine and coastal ecosystems. Due to their long life span and trophic position, bottlenose dolphins bioaccumulate high concentrations of contaminants including Hg, thus making them an important sentinel species for ecosystem and public health. Bottlenose dolphins in Florida bioaccumulate high concentrations of Hg in their blood, skin and internal organs. The concentrations of Hg in blood and skin of bottlenose dolphins of the Indian River Lagoon, FL (IRL) are among the highest reported world-wide. In previous studies, we demonstrated associations between concentrations of total Hg in the blood and skin of IRL dolphins and markers of endocrine, renal, hepatic, hematologic and immune system dysfunction. The predominant manifestation of exposure to mercury in humans is neurotoxicity. During the 1950s and 1960s, residents of Minamata bay, Japan were exposed to high concentrations of methyl mercury as the result of ingestion of fish and shellfish that had become contaminated in this infamous environmental disaster. Affected adults had severe motor and sensory abnormalities often leading to death. Methyl mercury crosses the placenta during pregnancy. Children exposed in utero were born with multiple congenital anomalies and also suffered from neurologic disorders. Significantly, local cats that consumed Hg contaminated fish developed severe signs of neurotoxicity which led to their subsequent

  12. Atlantic Bottlenose Dolphins (Tursiops truncatus as A Sentinel for Exposure to Mercury in Humans: Closing the Loop

    Directory of Open Access Journals (Sweden)

    John S. Reif

    2015-11-01

    Full Text Available Mercury (Hg is a ubiquitous global contaminant with important public health implications. Mercury is released from a variety of anthropogenic, industrial processes, enters the earth's atmosphere and is re-deposited onto the earth’s surface in rainfall. Much of this Hg enters the oceans which cover the majority of the earth’s surface. In the marine environment, inorganic Hg is converted to the most toxic form of the element, methylmercury, and biomagnified through the trophic levels of the food web. The bottlenose dolphin (Tursiops truncatus is the apex predator in many estuarine and coastal ecosystems. Due to their long life span and trophic position, bottlenose dolphins bioaccumulate high concentrations of contaminants including Hg, thus making them an important sentinel species for ecosystem and public health. Bottlenose dolphins in Florida bioaccumulate high concentrations of Hg in their blood, skin and internal organs. The concentrations of Hg in blood and skin of bottlenose dolphins of the Indian River Lagoon, FL (IRL are among the highest reported world-wide. In previous studies, we demonstrated associations between concentrations of total Hg in the blood and skin of IRL dolphins and markers of endocrine, renal, hepatic, hematologic and immune system dysfunction. The predominant manifestation of exposure to mercury in humans is neurotoxicity. During the 1950s and 1960s, residents of Minamata bay, Japan were exposed to high concentrations of methyl mercury as the result of ingestion of fish and shellfish that had become contaminated in this infamous environmental disaster. Affected adults had severe motor and sensory abnormalities often leading to death. Methyl mercury crosses the placenta during pregnancy. Children exposed in utero were born with multiple congenital anomalies and also suffered from neurologic disorders. Significantly, local cats that consumed Hg contaminated fish developed severe signs of neurotoxicity which led to

  13. Synchronous and Rhythmic Vocalizations and Correlated Underwater Behavior of Free-ranging Atlantic Spotted Dolphins (Stenella frontalis and Bottlenose Dolphins (Tursiops truncatus in the Bahamas

    Directory of Open Access Journals (Sweden)

    Denise L. Herzing

    2015-02-01

    Full Text Available Since 1985 a resident community of Atlantic spotted dolphins (Stenella frontalis, and bottlenose dolphins (Tursiops truncatus, have been studied underwater in the Bahamas. Over 200 individuals of both species have been identified and observed over the years. Basic correlations with sound patterns and behavior such as whistles during contact/reunions and squawks during aggression have been reported. This paper describes a small subset of their vocal repertoire that involves synchronous/rhythmic sound production. Dolphin behavior was recorded underwater using underwater video cameras with hydrophone input. Vocalizations were correlated with basic underwater behavioral activity and analyzed using Raven 1.3. Spotted dolphins were observed using two types of synchronized vocalizations including synchronized squawks (burst pulsed vocalizations and screams- (overlapping FM whistles during intraspecific and interspecific aggression. Bottlenose dolphins used three types of synchronized vocalizations; whistles/buzz bouts, bray/buzz bouts, and buzz bouts during intraspecific aggression. Body postures were synchronous with physical movements and often mirrored the rhythm of the vocalizations. The intervals between highly synchronized vocalizations had small variance and created a rhythmic quality and cadence to the acoustic sequences. Three types of vocalizations had similar ratios of sound duration to the spacing between sounds (Screams, whistle/buzz bouts, and bray/buzz bouts. Temporal aspects of sequences of sound and postures may be important aspects of individual and group coordination and behavior in delphinids.

  14. Abundancia de dos poblaciones de toninas (Tursiops truncatus en el norte de Veracruz, México Abundance of two populations of bottlenose dolphins (Tursiops truncatus in northern Veracruz, Mexico

    Directory of Open Access Journals (Sweden)

    Michelle P. Valdes-Arellanes

    2011-03-01

    Full Text Available En México no se conoce el tamaño de las poblaciones de la tonina (Tursiops truncatus debido a su gran movilidad y al ocasional intercambio de individuos entre poblaciones. El objetivo de este estudio fue determinar la abundancia de toninas en la zona norte de Veracruz. De marzo de 2005 a diciembre de 2007 se realizaron 50 navegaciones con un esfuerzo total de 236.7 horas. Los resultados obtenidos de la foto-identificación de toninas, se emplearon en el modelo Jolly-Seber y se estimó con este modelo un total de N=302 ±113 organismos para toda el área de estudio. Para Tamiahua, se estimó una población de N=177 ± 10 delfines y para Tuxpan N=161 ± 68 delfines. Estos resultados sugieren que existe un mínimo intercambio de delfines entre zonas y por tanto, las poblaciones no están aisladas; sin embargo, los organismos tienen preferencia por ciertas áreas. La foto-recaptura de algunos individuos en la zona de Tamiahua confirma que la fidelidad al sitio se ha mantenido por 13 años. Es probable que esto se deba a que cada una de las zonas presenta estuarios con alta productividad que son ideales para refugio y crianza de las toninas.In Mexico, the population size of the bottlenose dolphin (Tursiops truncatus is unknown, due to the fact that they are highly mobile, and occasionally there are exchanges of individuals between populations. The objective of this study was to determine the abundance of dolphins in the north of Veracruz. From March 2005 to December 2007 were 50 surveys with a total effort of 236.7 hours. The results of the photo-identification of dolphins were used in the Jolly-Seber model, and with this model we estimated a total of N = 302 ± 113 dolphins throughout the study area. For Tamiahua a population estimate of N = 177 ± 10 dolphins, and for Tuxpan N = 161 ± 68 dolphins. These results suggest that there is minimal exchange of dolphins between areas; therefore it is assumed that populations are not isolated but dolphins

  15. Evaluation of Serum for Pathophysiological Effects of Prolonged Low Salinity Water Exposure in Displaced Bottlenose Dolphins (Tursiops truncatus)

    Science.gov (United States)

    Ewing, Ruth Y.; Mase-Guthrie, Blair; McFee, Wayne; Townsend, Forrest; Manire, Charles A.; Walsh, Michael; Borkowski, Rose; Bossart, Gregory D.; Schaefer, Adam M.

    2017-01-01

    We conducted a retrospective study of serum biochemistry and hematologic findings from displaced, out-of-habitat bottlenose dolphins (Tursiops truncatus) exposed to various low salinity environments in waters along the southern United States including southeastern Atlantic and northern Gulf of Mexico. Serum sodium, chloride, and calculated osmolality were significantly lower and below reference ranges in displaced animals compared to free-ranging case control animals. This suggests clinical hyponatremia, hypochloremia, and hypo-osmolality due to an uptake of low saline water from the environment. In addition, significant differences were found in other serum chemistry variables, although none were outside of normal reference ranges for non-controlled free-ranging animals. Multiple linear regressions demonstrated the degree of salinity had a greater pathophysiologic response than the duration of fresh water exposure. The Na/Cl ratio and bicarbonate were the only variables that were significantly modulated by exposure duration. These findings suggest that the degree of salinity is a critical factor when assessing and managing care for dolphins chronically exposed to low salinity water. Results from this study indicate that changes in various biochemical parameters can be used to determine fresh water exposure and aid in determining the treatment for animals recovered from low salinity waters. PMID:28642866

  16. Diet of bottlenose dolphins (Tursiops truncatus from the Gulf of Cadiz: Insights from stomach content and stable isotope analyses.

    Directory of Open Access Journals (Sweden)

    Joan Giménez

    Full Text Available The ecological role of species can vary among populations depending on local and regional differences in diet. This is particularly true for top predators such as the bottlenose dolphin (Tursiops truncatus, which exhibits a highly varied diet throughout its distribution range. Local dietary assessments are therefore critical to fully understand the role of this species within marine ecosystems, as well as its interaction with important ecosystem services such as fisheries. Here, we combined stomach content analyses (SCA and stable isotope analyses (SIA to describe bottlenose dolphins diet in the Gulf of Cadiz (North Atlantic Ocean. Prey items identified using SCA included European conger (Conger conger and European hake (Merluccius merluccius as the most important ingested prey. However, mass-balance isotopic mixing model (MixSIAR, using δ13C and δ15N, indicated that the assimilated diet consisted mainly on Sparidae species (e.g. seabream, Diplodus annularis and D. bellottii, rubberlip grunt, Plectorhinchus mediterraneus, and common pandora, Pagellus erythrinus and a mixture of other species including European hake, mackerels (Scomber colias, S. japonicus and S. scombrus, European conger, red bandfish (Cepola macrophthalma and European pilchard (Sardina pilchardus. These contrasting results highlight differences in the temporal and taxonomic resolution of each approach, but also point to potential differences between ingested (SCA and assimilated (SIA diets. Both approaches provide different insights, e.g. determination of consumed fish biomass for the management of fish stocks (SCA or identification of important assimilated prey species to the consumer (SIA.

  17. Evaluation of Serum for Pathophysiological Effects of Prolonged Low Salinity Water Exposure in Displaced Bottlenose Dolphins (Tursiops truncatus

    Directory of Open Access Journals (Sweden)

    Ruth Y. Ewing

    2017-06-01

    Full Text Available We conducted a retrospective study of serum biochemistry and hematologic findings from displaced, out-of-habitat bottlenose dolphins (Tursiops truncatus exposed to various low salinity environments in waters along the southern United States including southeastern Atlantic and northern Gulf of Mexico. Serum sodium, chloride, and calculated osmolality were significantly lower and below reference ranges in displaced animals compared to free-ranging case control animals. This suggests clinical hyponatremia, hypochloremia, and hypo-osmolality due to an uptake of low saline water from the environment. In addition, significant differences were found in other serum chemistry variables, although none were outside of normal reference ranges for non-controlled free-ranging animals. Multiple linear regressions demonstrated the degree of salinity had a greater pathophysiologic response than the duration of fresh water exposure. The Na/Cl ratio and bicarbonate were the only variables that were significantly modulated by exposure duration. These findings suggest that the degree of salinity is a critical factor when assessing and managing care for dolphins chronically exposed to low salinity water. Results from this study indicate that changes in various biochemical parameters can be used to determine fresh water exposure and aid in determining the treatment for animals recovered from low salinity waters.

  18. Postmortem evidence of interactions of bottlenose dolphins (Tursiops truncatus) with other dolphin species in south-west England.

    Science.gov (United States)

    Barnett, J; Davison, N; Deaville, R; Monies, R; Loveridge, J; Tregenza, N; Jepson, P D

    2009-10-10

    Reports of violent interactions between bottlenose dolphins (Tursiops truncatus) and harbour porpoises (Phocoena phocoena) in the coastal waters of the UK are well documented. Examination of stranded cetaceans by the Cornwall Wildlife Trust Marine Strandings Network and the UK Cetacean Strandings Investigation Programme has indicated that seven animals, of four other species, found stranded in south-west England, had pathology consistent with bottlenose dolphin interaction, including two juvenile and two adult common dolphins (Delphinus delphis), one juvenile pilot whale (Globicephala melas), one juvenile Risso's dolphin (Grampus griseus) and one adult striped dolphin (Stenella coeruleoalba). Although recorded traumatic lesions were often not as severe as those found in harbour porpoises, it is probable that the interactions did contribute to stranding and/or death in all four of the juvenile animals examined. Furthermore, analysis of photographs taken before establishment of the Marine Strandings Network revealed rake (teeth) marks consistent with bottlenose dolphin interaction on one stranded common dolphin in 1992. A number of causes have been suggested for these interactions in harbour porpoises stranded in the UK and it is possible that any combination of these factors may also be implicated in the cases described in this report.

  19. Health and Environmental Risk Assessment Project for bottlenose dolphins Tursiops truncatus from the southeastern USA. I. Infectious diseases.

    Science.gov (United States)

    Bossart, Gregory D; Fair, Patricia; Schaefer, Adam M; Reif, John S

    2017-07-24

    From 2003 to 2015, 360 free-ranging Atlantic bottlenose dolphins Tursiops truncatus inhabiting the Indian River Lagoon (IRL, n = 246), Florida, and coastal waters of Charleston (CHS, n = 114), South Carolina, USA, were captured, given comprehensive health examinations, and released as part of a multidisciplinary and multi-institutional study of individual and population health. The aim of this review is to summarize the substantial health data generated by this study and to examine morbidity between capture sites and over time. The IRL and CHS dolphin populations are affected by complex infectious and neoplastic diseases often associated with immunologic disturbances. We found evidence of infection with cetacean morbillivirus, dolphin papilloma and herpes viruses, Chlamydiaceae, a novel uncultivated strain of Paracoccidioides brasiliensis (recently identified as the causal agent of dolphin lobomycosis/lacaziasis), and other pathogens. This is the first long-term study documenting the various types, progression, seroprevalence, and pathologic interrelationships of infectious diseases in dolphins from the southeastern USA. Additionally, the study has demonstrated that the bottlenose dolphin is a valuable sentinel animal that may reflect environmental health concerns and parallel emerging public health issues.

  20. Health and Environmental Risk Assessment Project for bottlenose dolphins Tursiops truncatus from the southeastern USA. II. Environmental aspects.

    Science.gov (United States)

    Reif, John S; Schaefer, Adam M; Bossart, Gregory D; Fair, Patricia A

    2017-07-24

    Bottlenose dolphins Tursiops truncatus are the most common apex predators found in coastal and estuarine ecosystems along the southeastern coast of the USA, where these animals are exposed to multiple chemical pollutants and microbial agents. In this review, we summarize the results of investigations of environmental exposures evaluated in 360 free-ranging dolphins between 2003 and 2015. Bottlenose dolphins inhabiting the Indian River Lagoon, Florida (IRL, n = 246), and coastal waters of Charleston, South Carolina (CHS, n = 114), were captured, given comprehensive health examinations, and released as part of a multidisciplinary and multi-institutional study of individual and population health. High concentrations of persistent organic pollutants including legacy contaminants (DDT and other pesticides, polychlorinated biphenyl compounds) as well as 'emerging' contaminants (polybrominated diphenyl ethers, perfluorinated compounds) were detected in dolphins from CHS, with lower concentrations in the IRL. Conversely, the concentrations of mercury in the blood and skin of IRL dolphins were among the highest reported worldwide and approximately 5 times as high as those found in CHS dolphins. A high prevalence of resistance to antibiotics commonly used in humans and animals was detected in bacteria isolated from fecal, blowhole, and/or gastric samples at both sites, including methicillin-resistant Staphylococcus aureus (MRSA) at CHS. Collectively, these studies illustrate the importance of long-term surveillance of estuarine populations of bottlenose dolphins and reaffirm their important role as sentinels for marine ecosystems and public health.

  1. Effects of oral megestrol acetate administration on the hypothalamic-pituitary-adrenal axis of male bottlenose dolphins (Tursiops truncatus).

    Science.gov (United States)

    Houser, Dorian S; Champagne, Cory D; Jensen, Eric D; Smith, Cynthia R; Cotte, Lara S; Meegan, Jenny M; Booth, Rebecca K; Wasser, Samuel K

    2017-07-15

    OBJECTIVE To evaluate the impact of oral megestrol acetate (MA) administration on adrenal function in male bottlenose dolphins (Tursiops truncatus). DESIGN Serial cross-sectional study. ANIMALS 8 adult male dolphins, all of which were receiving MA at various daily doses (range, 0 to 60 mg, PO) for the control of reproductive behavior. PROCEDURES Blood samples were collected every 2 weeks for 1 year from dolphins trained to voluntarily provide them. Cortisol, ACTH, and other hormone concentrations were measured in serum or plasma via radioimmunoassay or ELISA. Fecal samples, also provided by dolphins voluntarily, were assayed for glucocorticoid metabolite concentrations. Effects of daily MA dose on hormone concentrations were evaluated. RESULTS Daily MA doses as low as 10 mg strongly suppressed cortisol secretion in nearly all dolphins, and except for a single measurement, no dolphin had measurable serum concentrations at doses ≥ 20 mg. Variations in serum cortisol concentration were unrelated to season but were directly related to ACTH concentrations, suggesting primary effects upstream of the adrenal gland. Cessation of MA administration resulted in almost immediate restoration of measurable serum cortisol concentrations, although concentrations continued to rise in a few dolphins over the following weeks to months. CONCLUSIONS AND CLINICAL RELEVANCE Caution should be exercised when administering MA to control reproductive behavior in male dolphins. Because the hypothalamic-pituitary-adrenal axis appeared to be sensitive to even small doses of MA in dolphins, duration of treatment may be the most critical consideration.

  2. The distribution and morphological characteristics of catecholaminergic cells in the diencephalon and midbrain of the bottlenose dolphin (Tursiops truncatus).

    Science.gov (United States)

    Manger, Paul R; Fuxe, Kjell; Ridgway, Sam H; Siegel, Jerome M

    2004-01-01

    The present study describes the distribution and cellular morphology of catecholaminergic neurons in the diencephalon and midbrain of the bottlenose dolphin (Tursiops truncatus). Tyrosine hydroxylase immunohistochemistry was used to visualize these putatively dopaminergic neurons. The standard A1-A17, C1-C3, nomenclature is used for expediency; however, the neuroanatomical names of the various nuclei have also been given. Dolphins exhibit certain tyrosine hydroxylase immunoreactive (TH-ir) catecholaminergic neuronal groups in the midbrain (A8, A9, A10) and diencephalon (A11, A12, A14), however, no neuronal clusters clearly corresponding to the A13 and A15 groups could be identified. The subdivisions of these neuronal groups are in general agreement with those of other mammals, but there is a high degree of species specificity. First, three TH-ir neuronal groups not identified in other species were found: in the ventral lateral peri-aqueductal gray matter, posterior dorsal hypothalamus, and rostral mesencephalic raphe. Second, the normal components of the substantia nigra (A9 or pars compacta, A9 lateral or pars lateralis, A9 ventral or pars reticulata) were extremely cell sparse, but there was a substantial expansion of the A9 medial and A10 lateral subdivisions forming an impressive 'ventral wing' in the posterior substantia nigra. The findings of this and previous studies suggest a distinct evolutionary trend occurring in the neuromodulatory systems in mammals. The results are discussed in relation to motor control, thermoregulation, unihemispheric sleep, and dolphin cognition. Copyright 2004 S. Karger AG, Basel

  3. Foraging habits in a generalist predator: sex and age influence habitat selection and resource use among bottlenose dolphins (Tursiops truncatus)

    Science.gov (United States)

    Sam Rossman,; McCabe, Elizabeth Berens; Nelio B. Barros,; Hasand Gandhi,; Peggy H. Ostrom,; Stricker, Craig A.; Randall S. Wells,

    2015-01-01

    This study examines resource use (diet, habitat use, and trophic level) within and among demographic groups (males, females, and juveniles) of bottlenose dolphins (Tursiops truncatus). We analyzed the δ13C and δ15N values of 15 prey species constituting 84% of the species found in stomach contents. We used these data to establish a trophic enrichment factor (TEF) to inform dietary analysis using a Bayesian isotope mixing model. We document a TEF of 0‰ and 2.0‰ for δ13C and δ15N, respectively. The dietary results showed that all demographic groups relied heavily on low trophic level seagrass-associated prey. Bayesian standard ellipse areas (SEAb) were calculated to assess diversity in resource use. The SEAb of females was nearly four times larger than that of males indicating varied resource use, likely a consequence of small home ranges and habitat specialization. Juveniles possessed an intermediate SEAb, generally feeding at a lower trophic level compared to females, potentially an effect of natal philopatry and immature foraging skills. The small SEAb of males reflects a high degree of specialization on seagrass associated prey. Patterns in resource use by the demographic groups are likely linked to differences in the relative importance of social and ecological factors.

  4. Lateralized visual behavior in bottlenose dolphins (Tursiops truncatus) performing audio-visual tasks: the right visual field advantage.

    Science.gov (United States)

    Delfour, F; Marten, K

    2006-01-10

    Analyzing cerebral asymmetries in various species helps in understanding brain organization. The left and right sides of the brain (lateralization) are involved in different cognitive and sensory functions. This study focuses on dolphin visual lateralization as expressed by spontaneous eye preference when performing a complex cognitive task; we examine lateralization when processing different visual stimuli displayed on an underwater touch-screen (two-dimensional figures, three-dimensional figures and dolphin/human video sequences). Three female bottlenose dolphins (Tursiops truncatus) were submitted to a 2-, 3- or 4-, choice visual/auditory discrimination problem, without any food reward: the subjects had to correctly match visual and acoustic stimuli together. In order to visualize and to touch the underwater target, the dolphins had to come close to the touch-screen and to position themselves using monocular vision (left or right eye) and/or binocular naso-ventral vision. The results showed an ability to associate simple visual forms and auditory information using an underwater touch-screen. Moreover, the subjects showed a spontaneous tendency to use monocular vision. Contrary to previous findings, our results did not clearly demonstrate right eye preference in spontaneous choice. However, the individuals' scores of correct answers were correlated with right eye vision, demonstrating the advantage of this visual field in visual information processing and suggesting a left hemispheric dominance. We also demonstrated that the nature of the presented visual stimulus does not seem to have any influence on the animals' monocular vision choice.

  5. Eosinophilia and biotoxin exposure in bottlenose dolphins (Tursiops truncatus) from a coastal area impacted by repeated mortality events

    International Nuclear Information System (INIS)

    Schwacke, Lori H.; Twiner, Michael J.; De Guise, Sylvain; Balmer, Brian C.; Wells, Randall S.; Townsend, Forrest I.; Rotstein, David C.; Varela, Rene A.; Hansen, Larry J.; Zolman, Eric S.; Spradlin, Trevor R.

    2010-01-01

    Bottlenose dolphins (Tursiops truncatus) inhabiting coastal waters in the northern Gulf of Mexico have been impacted by recurrent unusual mortality events over the past few decades. Several of these mortality events along the Florida panhandle have been tentatively attributed to poisoning from brevetoxin produced by the dinoflagellate Karenia brevis. While dolphins in other regions of the Florida coast are often exposed to K. brevis blooms, large-scale dolphin mortality events are relatively rare and the frequency and magnitude of die-offs along the Panhandle raise concern for the apparent vulnerability of dolphins in this region. We report results from dolphin health assessments conducted near St. Joseph Bay, Florida, an area impacted by 3 unusual die-offs within a 7-year time span. An eosinophilia syndrome, manifested as an elevated blood eosinophil count without obvious cause, was observed in 23% of sampled dolphins. Elevated eosinophil counts were associated with decreased T-lymphocyte proliferation and increased neutrophil phagocytosis. In addition, indication of chronic low-level exposure to another algal toxin, domoic acid produced by the diatom Pseudo-nitzschia spp., was determined. Previous studies of other marine mammal populations exposed recurrently to Pseudo-nitzschia blooms have suggested a possible link between the eosinophilia and domoic acid exposure. While the chronic eosinophilia syndrome could over the long-term produce organ damage and alter immunological status and thereby increase vulnerability to other challenges, the significance of the high prevalence of the syndrome to the observed mortality events in the St. Joseph Bay area is unclear. Nonetheless, the unusual immunological findings and concurrent evidence of domoic acid exposure in this sentinel marine species suggest a need for further investigation to elucidate potential links between chronic, low-level exposure to algal toxins and immune health.

  6. Niche Differentiation and Prey Selectivity among Common Bottlenose Dolphins (Tursiops truncatus Sighted in St. George Sound, Gulf of Mexico

    Directory of Open Access Journals (Sweden)

    Rachel M. Wilson

    2017-07-01

    Full Text Available Two groups of common bottlenose dolphins (Tursiops truncatus have been identified within St. George Sound, Florida, USA: high site-fidelity individuals (HSF which are individuals sighted multiple times in the region (i.e., ≥2 months, ≥2 seasons, and ≥2 years, and low site-fidelity individuals (LSF, which are individuals sighted fewer than 2 months, in 2 different seasons among 2 different years. Our goal was to determine whether differences in foraging behaviors were correlated with differences in sighting frequency and overall usage of St. George Sound by the two groups. We used carbon, nitrogen, and sulfur stable isotopes and niche hypervolume metrics to model the foodweb of St. George Sound. Mixing model results indicated that croaker, mojarra, pigfish, pinfish, and silverperch were the most important prey items for dolphins. The hypervolume metrics demonstrate niche partitioning between HSFs and LSFs, with the HSFs relying more heavily on pinfish, pigfish, and mojarra, while the LSFs relied more on silverperch. Plankton, benthic diatoms, seagrass, and epiphytes all contributed to secondary production within St. George Sound. This diversity of source utilization by seagrass-associated consumers supported by a high rate of total production likely sustains high secondary productivity despite the potential for competition in this system. Zooplankton was the most important basal source to the system, followed by seagrass and benthic primary production (as indicated by a sanddollar proxy. The reliance of dolphins on seagrass-dependent prey indicates that alteration of seagrass habitat would significantly impact the dolphin community foraging in St. George Sound and suggests that preservation of seagrass habitat is an important component of an effective management strategy for dolphin populations in the region.

  7. The relationship between heat flow and vasculature in the dorsal fin of wild bottlenose dolphins Tursiops truncatus.

    Science.gov (United States)

    Meagher, Erin M; McLellan, William A; Westgate, Andrew J; Wells, Randall S; Frierson, Dargan; Pabst, D Ann

    2002-11-01

    The dorsal fin of the bottlenose dolphin Tursiops truncatus contains blood vessels that function either to conserve or to dissipate body heat. Prior studies have demonstrated that heat flux, measured from a single position on the dorsal fin, decreases during body cooling and diving bradycardia and increases after exercise and at the termination of the dive response. While prior studies attributed changes in heat flux to changes in the pattern of blood flow, none directly investigated the influence of vascular structures on heat flux across the dorsal fin. In this study we examined whether heat flux is higher directly over a superficial vein, compared to a position away from a vein, and investigated the temporal relationship between heart rate, respiration and heat flux. Simultaneous records of heat flux and skin temperature at three positions on the dorsal fins of 19 wild bottlenose dolphins (with the fin in air and submerged) were collected, together with heart rate and respiration. When the fin was submerged, heat flux values were highest over superficial veins, usually at the distal tip, suggesting convective delivery of heat, via blood, to the skin's surface. Conversely, in air there was no relationship between heat flux and superficial vasculature. The mean difference in heat flux (48 W m(-2)) measured between the three fin positions was often equal to or greater than the heat flux that had been recorded from a single position after exercising and diving in prior studies. Tachycardia at a respiratory event was not temporally related to an increase in heat flux across the dorsal fin. This study suggests that the dorsal fin is a spatially heterogeneous thermal surface and that patterns of heat flux are strongly influenced by underlying vasculature.

  8. An Inventory of Peer-reviewed Articles on Killer Whales (Orcinus orca with a Comparison to Bottlenose Dolphins (Tursiops truncatus

    Directory of Open Access Journals (Sweden)

    Heather M. Hill

    2016-08-01

    Full Text Available The welfare of killer whales (Orcinus orca has received worldwide attention recently. The purpose of this study was to sample the peer-reviewed scientific research on killer whales with a complementary comparison to Atlantic bottlenose dolphins (Tursiops truncatus to ascertain the primary topics of research conducted with these two cetaceans. A second objective of the study was to assess the relationship between the research topic and the setting in which the research was conducted. From a database-driven search of peer-reviewed academic journal articles, 759 unique articles involving killer whales, 2,022 unique articles involving Atlantic bottlenose dolphins, and 38 additional articles that included both species were retained for analysis. Coders categorized each article by topic (Anthropogenic Response, Cognition, Distribution, Echolocation, Foraging/Predation, Health/Physiology, Interactions with Humans, Sociality, and Vocalization and research setting (Natural Habitat, Captivity, or Both. Most studies of killer whales involved animals in their natural habitat (90% and the majority of killer whale studies, regardless of setting, concentrated on health and physiology, such as contaminants and genetic variability (31%, foraging and predation behaviors (26%, and geographic distribution (20%. The majority of the studies (68% involving bottlenose dolphins were also conducted in their natural habitat, but there was significantly more research comparatively with captive animals and with greater diversity. The results suggested that research with killer whales has been dominated by a limited range of topics with relatively little research conducted on topics that directly address issues of welfare. Similar to killer whales, research with Atlantic bottlenose dolphins has been dominated by health and physiology (48.5% and distribution (17.6%. In contrast to killer whales, topics such as sociality (9.5% and cognition (5% were more prominent in research

  9. Comparative analysis of three brevetoxin-associated bottlenose dolphin (Tursiops truncatus mortality events in the Florida Panhandle region (USA.

    Directory of Open Access Journals (Sweden)

    Michael J Twiner

    Full Text Available In the Florida Panhandle region, bottlenose dolphins (Tursiops truncatus have been highly susceptible to large-scale unusual mortality events (UMEs that may have been the result of exposure to blooms of the dinoflagellate Karenia brevis and its neurotoxin, brevetoxin (PbTx. Between 1999 and 2006, three bottlenose dolphin UMEs occurred in the Florida Panhandle region. The primary objective of this study was to determine if these mortality events were due to brevetoxicosis. Analysis of over 850 samples from 105 bottlenose dolphins and associated prey items were analyzed for algal toxins and have provided details on tissue distribution, pathways of trophic transfer, and spatial-temporal trends for each mortality event. In 1999/2000, 152 dolphins died following extensive K. brevis blooms and brevetoxin was detected in 52% of animals tested at concentrations up to 500 ng/g. In 2004, 105 bottlenose dolphins died in the absence of an identifiable K. brevis bloom; however, 100% of the tested animals were positive for brevetoxin at concentrations up to 29,126 ng/mL. Dolphin stomach contents frequently consisted of brevetoxin-contaminated menhaden. In addition, another potentially toxigenic algal species, Pseudo-nitzschia, was present and low levels of the neurotoxin domoic acid (DA were detected in nearly all tested animals (89%. In 2005/2006, 90 bottlenose dolphins died that were initially coincident with high densities of K. brevis. Most (93% of the tested animals were positive for brevetoxin at concentrations up to 2,724 ng/mL. No DA was detected in these animals despite the presence of an intense DA-producing Pseudo-nitzschia bloom. In contrast to the absence or very low levels of brevetoxins measured in live dolphins, and those stranding in the absence of a K. brevis bloom, these data, taken together with the absence of any other obvious pathology, provide strong evidence that brevetoxin was the causative agent involved in these bottlenose dolphin

  10. A common bottlenose dolphin (Tursiops truncatus) prey handling technique for marine catfish (Ariidae) in the northern Gulf of Mexico.

    Science.gov (United States)

    Ronje, Errol I; Barry, Kevin P; Sinclair, Carrie; Grace, Mark A; Barros, Nélio; Allen, Jason; Balmer, Brian; Panike, Anna; Toms, Christina; Mullin, Keith D; Wells, Randall S

    2017-01-01

    Few accounts describe predator-prey interactions between common bottlenose dolphins (Tursiops truncatus Montagu 1821) and marine catfish (Ariopsis felis Linnaeus 1766, Bagre marinus Mitchill 1815). Over the course of 50,167 sightings of bottlenose dolphin groups in Mississippi Sound and along the Florida coast of the Gulf of Mexico, severed catfish heads were found floating and exhibiting movements at the surface in close proximity to 13 dolphin groups that demonstrated feeding behavior. These observations prompted a multi-disciplinary approach to study the predator-prey relationship between bottlenose dolphins and marine catfish. A review was conducted of bottlenose dolphin visual survey data and dorsal fin photographs from sightings where severed catfish heads were observed. Recovered severed catfish heads were preserved and studied, whole marine catfish were collected and examined, and stranding network pathology reports were reviewed for references to injuries related to fish spines. Photographic identification analysis confirms eight dolphins associated with severed catfish heads were present in three such sightings across an approximately 350 km expanse of coast between the Mississippi Sound and Saint Joseph Bay, FL. An examination of the severed catfish heads indicated interaction with dolphins, and fresh-caught whole hardhead catfish (A. felis) were examined to estimate the presumed total length of the catfish before decapitation. Thirty-eight instances of significant trauma or death in dolphins attributed to ingesting whole marine catfish were documented in stranding records collected from the southeastern United States of America. Bottlenose dolphins typically adhere to a ram-feeding strategy for prey capture followed by whole prey ingestion; however, marine catfish skull morphology may pose a consumption hazard due to rigid spines that can puncture and migrate through soft tissue, prompting a prey handling technique for certain dolphins, facilitating

  11. Serologic response in bottlenose dolphins Tursiops truncatus infected with Brucella sp. using a dolphin-specific indirect ELISA.

    Science.gov (United States)

    Meegan, Jenny; Dunn, J Lawrence; Venn-Watson, Stephanie K; Smith, Cynthia R; Sidor, Inga; Jensen, Eric D; Van Bonn, William G; Pugh, Roberta; Ficht, Thomas; Adams, L Garry; Nielsen, Klaus; Romano, Tracy A

    2012-12-03

    Marine-origin Brucella infections and serologic evidence of exposure have been documented in multiple cetacean species. A dolphin-specific indirect enzyme-linked immunosorbent assay (ELISA) was developed to screen bottlenose dolphin sera for anti-Brucella antibodies. A total of 131 serum samples collected over a 2 to 18 yr period from 6 bottlenose dolphins Tursiops truncatus with confirmed Brucella infections were analyzed for the presence and magnitude of antibody titers against marine-origin Brucella to compare individual antibody responses to various disease manifestations. Additionally, an epidemiologic serologic survey of a managed population of 64 bottlenose dolphins was performed to evaluate for the presence of antibodies and to determine whether there were any clinical pathology predictors for exposure or infection. The serologic results revealed that the dolphins with Brucella-associated abortions were seronegative for 7 to 18 yr until after the abortion and maintained positive titers for several years, with 2 of 3 animals returning to seronegative status. In contrast, the dolphins with Brucella-associated pulmonary or bone lesions maintained persistent positive titers for 2 to 18 yr. The population serosurvey revealed no significant differences in antibody levels among males and females, and dolphins between the ages of 17 and 25 yr were 6.8 times more likely to be Brucella antibody positive compared to those that were younger or older. Seropositive dolphins did not have significant inflammation compared to seronegative dolphins but were more likely to have higher levels of aspartate aminotransferase and gamma-glutamyl transpeptidase. Among 16 dolphins that tested seropositive, 13 (81.3%) had previously been seropositive for at least 3 to 5 yr.

  12. Comparative Analysis of Three Brevetoxin-Associated Bottlenose Dolphin (Tursiops truncatus) Mortality Events in the Florida Panhandle Region (USA)

    Science.gov (United States)

    Twiner, Michael J.; Flewelling, Leanne J.; Fire, Spencer E.; Bowen-Stevens, Sabrina R.; Gaydos, Joseph K.; Johnson, Christine K.; Landsberg, Jan H.; Leighfield, Tod A.; Mase-Guthrie, Blair; Schwacke, Lori; Van Dolah, Frances M.; Wang, Zhihong; Rowles, Teresa K.

    2012-01-01

    In the Florida Panhandle region, bottlenose dolphins (Tursiops truncatus) have been highly susceptible to large-scale unusual mortality events (UMEs) that may have been the result of exposure to blooms of the dinoflagellate Karenia brevis and its neurotoxin, brevetoxin (PbTx). Between 1999 and 2006, three bottlenose dolphin UMEs occurred in the Florida Panhandle region. The primary objective of this study was to determine if these mortality events were due to brevetoxicosis. Analysis of over 850 samples from 105 bottlenose dolphins and associated prey items were analyzed for algal toxins and have provided details on tissue distribution, pathways of trophic transfer, and spatial-temporal trends for each mortality event. In 1999/2000, 152 dolphins died following extensive K. brevis blooms and brevetoxin was detected in 52% of animals tested at concentrations up to 500 ng/g. In 2004, 105 bottlenose dolphins died in the absence of an identifiable K. brevis bloom; however, 100% of the tested animals were positive for brevetoxin at concentrations up to 29,126 ng/mL. Dolphin stomach contents frequently consisted of brevetoxin-contaminated menhaden. In addition, another potentially toxigenic algal species, Pseudo-nitzschia, was present and low levels of the neurotoxin domoic acid (DA) were detected in nearly all tested animals (89%). In 2005/2006, 90 bottlenose dolphins died that were initially coincident with high densities of K. brevis. Most (93%) of the tested animals were positive for brevetoxin at concentrations up to 2,724 ng/mL. No DA was detected in these animals despite the presence of an intense DA-producing Pseudo-nitzschia bloom. In contrast to the absence or very low levels of brevetoxins measured in live dolphins, and those stranding in the absence of a K. brevis bloom, these data, taken together with the absence of any other obvious pathology, provide strong evidence that brevetoxin was the causative agent involved in these bottlenose dolphin mortality

  13. Estrous cycle characterisation and artificial insemination using frozen-thawed spermatozoa in the bottlenose dolphin (Tursiops truncatus).

    Science.gov (United States)

    Robeck, T R; Steinman, K J; Yoshioka, M; Jensen, E; O'Brien, J K; Katsumata, E; Gili, C; McBain, J F; Sweeney, J; Monfort, S L

    2005-05-01

    The reproductive endocrinology of the bottlenose dolphin, Tursiops truncatus, was characterized to facilitate the development of artificial insemination using cryopreserved spermatozoa. Specific objectives were: (i) to determine the excretory dynamics of urinary luteinizing hormone (LH) and ovarian steroid metabolites during the estrous cycle; (ii) to evaluate the effect of an exogenously administered synthetic progesterone analog (altrenogest) on reproductive hormone excretion; (iii) to correlate follicular growth and ovulation (as determined by transabdominal ultrasound) to urinary LH and ovarian steroid metabolites; (iv) examine the in vivo fertilisation capacity of cryopreserved semen, and (v) to develop an intrauterine insemination technique. Based on urinary endocrine monitoring of natural estrous cycles (2 consecutive cycles) and nine post altrenogest cycles in ten females, estrous cycles were found to be 36 days long and comprised of an 8 day and 19 day follicular and luteal phase, respectively. Peak estrogen conjugates (EC; 5.4+/-3.8 ng/mg creatinine (Cr)) occurred 8 h prior to the LH surge (70.9+/-115.7 ng/mg Cr). The time of ovulation, as determined by ultrasonography, occurred 32.1+/-8.9 h and 24.3+/-7.0 h after the onset of the LH surge and LH peak, respectively. Mean preovulatory follicular diameter and circumference were 2.1+/-0.5 cm and 6.5+/-1.5 cm, respectively. Of the 27 estrous synchronisation attempts, 13 resulted in an ovulatory cycle, with ovulation occurring 21 days post-altrenogest treatment. Intrauterine (4 of 5) and intracornual (1 of 3) inseminations conducted across eight estrous cycles resulted in five pregnancies (63%), one pregnancy resulted from the use of liquid stored semen, whereas four were achieved using cryopreserved semen. These data provide new information on female bottlenose dolphin reproductive physiology, and demonstrate that the combination of endocrine monitoring and serial ultrasonography contributed to successful AI

  14. A common bottlenose dolphin (Tursiops truncatus prey handling technique for marine catfish (Ariidae in the northern Gulf of Mexico.

    Directory of Open Access Journals (Sweden)

    Errol I Ronje

    Full Text Available Few accounts describe predator-prey interactions between common bottlenose dolphins (Tursiops truncatus Montagu 1821 and marine catfish (Ariopsis felis Linnaeus 1766, Bagre marinus Mitchill 1815. Over the course of 50,167 sightings of bottlenose dolphin groups in Mississippi Sound and along the Florida coast of the Gulf of Mexico, severed catfish heads were found floating and exhibiting movements at the surface in close proximity to 13 dolphin groups that demonstrated feeding behavior. These observations prompted a multi-disciplinary approach to study the predator-prey relationship between bottlenose dolphins and marine catfish. A review was conducted of bottlenose dolphin visual survey data and dorsal fin photographs from sightings where severed catfish heads were observed. Recovered severed catfish heads were preserved and studied, whole marine catfish were collected and examined, and stranding network pathology reports were reviewed for references to injuries related to fish spines. Photographic identification analysis confirms eight dolphins associated with severed catfish heads were present in three such sightings across an approximately 350 km expanse of coast between the Mississippi Sound and Saint Joseph Bay, FL. An examination of the severed catfish heads indicated interaction with dolphins, and fresh-caught whole hardhead catfish (A. felis were examined to estimate the presumed total length of the catfish before decapitation. Thirty-eight instances of significant trauma or death in dolphins attributed to ingesting whole marine catfish were documented in stranding records collected from the southeastern United States of America. Bottlenose dolphins typically adhere to a ram-feeding strategy for prey capture followed by whole prey ingestion; however, marine catfish skull morphology may pose a consumption hazard due to rigid spines that can puncture and migrate through soft tissue, prompting a prey handling technique for certain dolphins

  15. Abundance of bottlenose dolphins, Tursiops truncatus (Cetacea: Delphinidae, inhabiting the Patos Lagoon estuary, southern Brazil: implications for conservation

    Directory of Open Access Journals (Sweden)

    Pedro F Fruet

    2011-02-01

    Full Text Available A new mark-recapture abundance estimate and a photographic census were carried out to investigate the possible decline in the abundance of the bottlenose dolphins, Tursiops truncatus (Montagu, 1821, in the Patos Lagoon estuary due to the high levels of bycatch mortality which occurred between 2002 and 2006 in oceanic coastal areas close to the estuary. Fourteen systematic boat surveys were conducted between August and early December 2005 to photo-identify the bottlenose dolphins. The estimated number of animals, with long-lasting marks, in the population obtained from Chapman's and Mth models were 51 (95% CI = 49-53 and 52 (95% CI = 51-60, respectively. Taking into account the proportion of dolphins with long-lasting marks in the population, the total estimated population size ranged between 84 (95% CI = 76-93 and 86 (95% CI = 78-95 individuals, respectively, which was very similar to the 84 individuals revealed by the population census. Our results did not differ from the abundance estimate carried out in 1998, prior to the high fishing-related mortality event, suggesting that the population is stable. Plausible argument to explain the stability of the population is that some carcasses found on the oceanic coastal beaches near Patos Lagoon estuary come from animals that do not belong to the estuary community. Future studies should investigate fine-scale habitat partition between estuarine and adjacent coastal dolphins. If the existence of different communities living in close proximity (estuarine and coastal areas near to the estuary is confirmed, a new abundance estimate is needed to access the conservation status of bottlenose dolphins in this region.

  16. Eosinophilia and biotoxin exposure in bottlenose dolphins (Tursiops truncatus) from a coastal area impacted by repeated mortality events

    Energy Technology Data Exchange (ETDEWEB)

    Schwacke, Lori H., E-mail: Lori.Schwacke@noaa.gov [National Oceanic and Atmospheric Administration, National Ocean Service, Center for Human Health Risks, 331 Fort Johnson Road, Charleston, SC 29412 (United States); Twiner, Michael J. [National Oceanic and Atmospheric Administration, National Ocean Service, Center for Coastal Environmental Health and Biomolecular Research, 219 Fort Johnson Road, Charleston, SC 29412 (United States); De Guise, Sylvain [University of Connecticut, Department of Pathobiology and Veterinary Science, 61 North Eagleville Road, U-89, Storrs, CT 06269 (United States); Balmer, Brian C.; Wells, Randall S. [Chicago Zoological Society, c/o Mote Marine Laboratory, 1600 Ken Thompson Parkway, Sarasota, FL 34236 (United States); Townsend, Forrest I. [Bayside Hospital for Animals, 251 N.E. Racetrack Road, Fort Walton Beach, FL 32547 (United States); Rotstein, David C. [National Oceanic and Atmospheric Administration, National Marine Fisheries Service, Office of Protected Resources, Marine Mammal Health and Stranding Response Program, 1315 East West Highway, Silver Spring, MD 20910 (United States); Varela, Rene A. [Ocean Embassy Inc, 6433 Pinecastle Blvd, Ste 2, Orlando, FL 32809 (United States); Hansen, Larry J. [National Oceanic and Atmospheric Administration, National Marine Fisheries Service Southeast Fisheries Science Center,101 Pivers Island Road, Beaufort, NC 28516 (United States); Zolman, Eric S. [National Oceanic and Atmospheric Administration, National Ocean Service, Center for Coastal Environmental Health and Biomolecular Research, 219 Fort Johnson Road, Charleston, SC 29412 (United States); Spradlin, Trevor R. [National Oceanic and Atmospheric Administration, National Marine Fisheries Service, Office of Protected Resources, Marine Mammal Health and Stranding Response Program, 1315 East West Highway, Silver Spring, MD 20910 (United States); and others

    2010-08-15

    Bottlenose dolphins (Tursiops truncatus) inhabiting coastal waters in the northern Gulf of Mexico have been impacted by recurrent unusual mortality events over the past few decades. Several of these mortality events along the Florida panhandle have been tentatively attributed to poisoning from brevetoxin produced by the dinoflagellate Karenia brevis. While dolphins in other regions of the Florida coast are often exposed to K. brevis blooms, large-scale dolphin mortality events are relatively rare and the frequency and magnitude of die-offs along the Panhandle raise concern for the apparent vulnerability of dolphins in this region. We report results from dolphin health assessments conducted near St. Joseph Bay, Florida, an area impacted by 3 unusual die-offs within a 7-year time span. An eosinophilia syndrome, manifested as an elevated blood eosinophil count without obvious cause, was observed in 23% of sampled dolphins. Elevated eosinophil counts were associated with decreased T-lymphocyte proliferation and increased neutrophil phagocytosis. In addition, indication of chronic low-level exposure to another algal toxin, domoic acid produced by the diatom Pseudo-nitzschia spp., was determined. Previous studies of other marine mammal populations exposed recurrently to Pseudo-nitzschia blooms have suggested a possible link between the eosinophilia and domoic acid exposure. While the chronic eosinophilia syndrome could over the long-term produce organ damage and alter immunological status and thereby increase vulnerability to other challenges, the significance of the high prevalence of the syndrome to the observed mortality events in the St. Joseph Bay area is unclear. Nonetheless, the unusual immunological findings and concurrent evidence of domoic acid exposure in this sentinel marine species suggest a need for further investigation to elucidate potential links between chronic, low-level exposure to algal toxins and immune health.

  17. A case of meconium aspiration syndrome in a bottlenose dolphin (Tursiops truncatus) calf.

    Science.gov (United States)

    Tanaka, Miyuu; Izawa, Takeshi; Kuwamura, Mitsuru; Ozaki, Miki; Nakao, Tatsuko; Ito, Shu; Yamate, Jyoji

    2014-01-01

    Stillbirth and neonatal mortality are significant problems in captive breeding of dolphins, however, the causes of these problems are not fully understood. Here, we report a case of meconium aspiration syndrome (MAS) in a male neonate of bottlenose dolphin (Tursiops truncates) who died immediately after birth. At necropsy, a true knot was found in the umbilical cord. The lungs showed diffuse intraalveolar edema, hyperemic congestion and atelectasis due to meconium aspiration with mild inflammatory cell infiltration. Although the exact cause of MAS in this case was unknown, fetal hypoxia due possibly to the umbilical knot might have been associated with MAS, which is the first report in dolphins. MAS due to perinatal asphyxia should be taken into account as a possible cause of neonatal mortality and stillbirth of dolphin calves.

  18. Recognition of Frequency Modulated Whistle-Like Sounds by a Bottlenose Dolphin (Tursiops truncatus) and Humans with Transformations in Amplitude, Duration and Frequency

    Science.gov (United States)

    Branstetter, Brian K.; DeLong, Caroline M.; Dziedzic, Brandon; Black, Amy; Bakhtiari, Kimberly

    2016-01-01

    Bottlenose dolphins (Tursiops truncatus) use the frequency contour of whistles produced by conspecifics for individual recognition. Here we tested a bottlenose dolphin’s (Tursiops truncatus) ability to recognize frequency modulated whistle-like sounds using a three alternative matching-to-sample paradigm. The dolphin was first trained to select a specific object (object A) in response to a specific sound (sound A) for a total of three object-sound associations. The sounds were then transformed by amplitude, duration, or frequency transposition while still preserving the frequency contour of each sound. For comparison purposes, 30 human participants completed an identical task with the same sounds, objects, and training procedure. The dolphin’s ability to correctly match objects to sounds was robust to changes in amplitude with only a minor decrement in performance for short durations. The dolphin failed to recognize sounds that were frequency transposed by plus or minus ½ octaves. Human participants demonstrated robust recognition with all acoustic transformations. The results indicate that this dolphin’s acoustic recognition of whistle-like sounds was constrained by absolute pitch. Unlike human speech, which varies considerably in average frequency, signature whistles are relatively stable in frequency, which may have selected for a whistle recognition system invariant to frequency transposition. PMID:26863519

  19. Tursiops truncatus calf

    African Journals Online (AJOL)

    1990-05-15

    May 15, 1990 ... that any effects on the metabolic state of the animal through the previous behaviour would be minimized. The apneustic plateau (a.p.) was recorded in seconds each time the animals surfaced to breathe. The respira- tion frequencies of both the mother and calf were recorded to indicate any breakdown of ...

  20. Sighting frequency and relative abundance of bottlenose dolphins (Tursiops truncatus) along the northeast coast of Margarita Island and Los Frailes Archipelago, Venezuela.

    Science.gov (United States)

    Oviedo, Lenin; Silva, Noemi

    2005-01-01

    The study of local cetaceans in Venezuela has a very recent history, and few efforts have been made in the assessment of coastal populations based on field research. The occurrence of whales and dolphins along the northeast coast of Venezuela has been documented through sightings and stranding records. Given the underwater topographical features and the influence of upwelling processes, this area is considered a very productive coastal ecosystem. Our objective was to establish the sighting frequency and relative abundance of bottlenose dolphins in the area. Sighting records were gathered on bottlenose dolphins and other cetacean species occurring along the northeast coast of Margarita Island and Los Frailes Archipelago through direct observation during land-based (6 surveys, 48 hours of observation) and boat-based surveys (24 surveys, 121 hours of observation, 1295 km covered). A sighting frequency was calculated using two methodologies and then compared, considering: 1) a mean effective observation time (4.27 hours), and 2) distance covered with cetacean sightings (1108 kin). A third method is proposed relating a mean effective distance covered with cetacean sightings and expressed as a percentage. The abundance index was calculated using the mean effective observation time. The sighting frequency of Tursiops truncattus in the study area was 3 - 4 sightings per day of 4.27 observation hours, or by 185 kilometers covered. The relative abundance was calculated as 35 dolphins in the study area, so a total population of less than 60 dolphins could inhabit the proposed range. Tursiops truncatus is the dominant species in the northeast coast of Margarita Island and Los Frailes Archipelago with 70% of all the sightings, so this locality could be termed as the distribution range of a possible local population of bottlenose dolphins.

  1. Organochlorine, organobromine, metal, and selenium residues in bottlenose dolphins (Tursiops truncatus) collected during an unusual mortality event in the Gulf of Mexico, 1990.

    Science.gov (United States)

    Kuehl, D W; Haebler, R

    1995-05-01

    Polychlorinated biphenyls (PCBs), cis-chlordane, oxychlordane, heptachlor epoxide, mirex, hexachlorobenzene (HCB), lindane, octachlorostyrene (OCS), p,p'-DDE,p,p'-DDT, dieldrin, triphenylphosphate (TPP), polybrominated biphenyls (PBBs), and polybrominated diphenyl ethers (PB-DPEs) were measured in the blubber, and five metals (mercury, lead, cadmium, chromium, and manganese) and selenium were measured in the liver of bottlenose dolphins (Tursiops truncatus) obtained from the Gulf of Mexico during an unusual mortality event in 1990. The collection of animals included fetuses, sucklings (< 1 year old), immature dolphins (2-5 years old), and adults of both sexes. PCBs, p,p'-DDE, HCB, and PBDPEs were detected in the blubber of each animal. Mean concentrations of organic contaminants were generally highest in adult males. p,p'-DDE was the single component analyte measured at the highest concentration. Immature females had greater concentrations of most chlorinated organics than adult females. Mercury and cadmium concentrations in liver increased with increasing age-class. The correlation between mercury and selenium in all animals was r = 0.96, with a mole ratio of 0.90. Concentrations of lead, manganese, cadmium, and chromium did not follow any particular age-class trend.

  2. LIVER ULTRASONOGRAPHY IN DOLPHINS: USE OF ULTRASONOGRAPHY TO ESTABLISH A TECHNIQUE FOR HEPATOBILIARY IMAGING AND TO EVALUATE METABOLIC DISEASE-ASSOCIATED LIVER CHANGES IN BOTTLENOSE DOLPHINS (TURSIOPS TRUNCATUS).

    Science.gov (United States)

    Seitz, Kelsey E; Smith, Cynthia R; Marks, Stanley L; Venn-Watson, Stephanie K; Ivančić, Marina

    2016-12-01

    The objective of this study was to establish a comprehensive technique for ultrasound examination of the dolphin hepatobiliary system and apply this technique to 30 dolphins to determine what, if any, sonographic changes are associated with blood-based indicators of metabolic syndrome (insulin greater than 14 μIU/ml or glucose greater than 112 mg/dl) and iron overload (transferrin saturation greater than 65%). A prospective study of individuals in a cross-sectional population with and without elevated postprandial insulin levels was performed. Twenty-nine bottlenose dolphins ( Tursiops truncatus ) in a managed collection were included in the final data analysis. An in-water ultrasound technique was developed that included detailed analysis of the liver and pancreas. Dolphins with hyperinsulinemia concentrations had larger livers compared with dolphins with nonelevated concentrations. Using stepwise, multivariate regression including blood-based indicators of metabolic syndrome in dolphins, glucose was the best predictor of and had a positive linear association with liver size (P = 0.007, R 2 = 0.24). Bottlenose dolphins are susceptible to metabolic syndrome and associated complications that affect the liver, including fatty liver disease and iron overload. This study facilitated the establishment of a technique for a rapid, diagnostic, and noninvasive ultrasonographic evaluation of the dolphin liver. In addition, the study identified ultrasound-detectable hepatic changes associated primarily with elevated glucose concentration in dolphins. Future investigations will strive to detail the pathophysiological mechanisms for these changes.

  3. Sighting frequency and relative abundance of bottlenose dolphins (Tursiops truncatus along the northeast coast of Margarita Island and Los Frailes Archipelago, Venezuela

    Directory of Open Access Journals (Sweden)

    Lenin Oviedo

    2005-09-01

    Full Text Available The study of local cetaceans in Venezuela has a very recent history, and few efforts have been made in the assessment of coastal populations based on field research. The occurrence of whales and dolphins along the northeast coast of Venezuela has been documented through sightings and stranding records. Given the underwater topographical features and the influence of upwelling processes, this area is considered a very productive coastal ecosystem. Our objective was to establish the sighting frequency and relative abundance of bottlenose dolphins in the area. Sighting records were gathered on bottlenose dolphins and other cetacean species occurring along the northeast coast of Margarita Island and Los Frailes Archipelago through direct observation during land-based (6 surveys, 48 hours of observation and boat-based surveys (24 surveys, 121 hours of observation, 1295 km covered. A sighting frequency was calculated using two methodologies and then compared, considering: 1 a mean effective observation time (4.27 hours, and 2 distance covered with cetacean sightings (1108 km. A third method is proposed relating a mean effective distance covered with cetacean sightings and expressed as a percentage. The abundance index was calculated using the mean effective observation time. The sighting frequency of Tursiops truncatus in the study area was 3 - 4 sightings per day of 4.27 observation hours, or by 185 kilometers covered. The relative abundance was calculated as 35 dolphins in the study area, so a total population of less than 60 dolphins could inhabit the proposed range. Tursiops truncatus is the dominant species in the northeast coast of Margarita Island and Los Frailes Archipelago with 70% of all the sightings, so this locality could be termed as the distribution range of a possible local population of bottlenose dolphins. Rev. Biol. Trop. 53(3-4: 595-600. Epub 2005 Oct 3.El estudio de cetáceos locales en Venezuela tiene una historia bien reciente

  4. The Influence of Age, Sex, and Social Affiliation on the Responses of Bottlenose Dolphins (Tursiops truncatus to a Novel Stimulus Over Time

    Directory of Open Access Journals (Sweden)

    Melissa M. Lopes

    2016-02-01

    Full Text Available Responses to novelty may differ among individuals as a function of age, sex, and/or the presence of offspring, and understanding how marine mammals respond to novel stimuli is critical to management. In this study, 20 captive Atlantic bottlenose dolphins (Tursiops truncatus were exposed to a novel object, consisting of PVC pipes and either a non-reflective or reflective surface. Their responses, broadly defined as either non-social or social, non-aggressive or aggressive interactions with the stimulus, were recorded across 10 exposure trials and compared among age classes and between males and females. Adult females exhibited the highest frequency of interactions, and those with dependent calves participated in more social interactions. Both adults and calves displayed a significantly greater frequency of interactions and aggression when exposed to the reflective versus non-reflective surface, indicating that the characteristics of the stimulus influenced the response. Although the number of interactions did not change across repeated exposures, there were significantly more aggressive interactions during later exposures, suggesting sensitization to the stimulus. There was no evidence of habituation over time for any of the subjects. Thus, when managing marine mammal exposure to anthropogenic stimuli, it is important to consider the demographics of the population, as well as the characteristics of the stimulus that may contribute to habituation, sensitization, and/or tolerance.

  5. Discriminating features of echolocation clicks of melon-headed whales (Peponocephala electra), bottlenose dolphins (Tursiops truncatus), and Gray's spinner dolphins (Stenella longirostris longirostris).

    Science.gov (United States)

    Baumann-Pickering, Simone; Wiggins, Sean M; Hildebrand, John A; Roch, Marie A; Schnitzler, Hans-Ulrich

    2010-10-01

    Spectral parameters were used to discriminate between echolocation clicks produced by three dolphin species at Palmyra Atoll: melon-headed whales (Peponocephala electra), bottlenose dolphins (Tursiops truncatus) and Gray's spinner dolphins (Stenella longirostris longirostris). Single species acoustic behavior during daytime observations was recorded with a towed hydrophone array sampling at 192 and 480 kHz. Additionally, an autonomous, bottom moored High-frequency Acoustic Recording Package (HARP) collected acoustic data with a sampling rate of 200 kHz. Melon-headed whale echolocation clicks had the lowest peak and center frequencies, spinner dolphins had the highest frequencies and bottlenose dolphins were nested in between these two species. Frequency differences were significant. Temporal parameters were not well suited for classification. Feature differences were enhanced by reducing variability within a set of single clicks by calculating mean spectra for groups of clicks. Median peak frequencies of averaged clicks (group size 50) of melon-headed whales ranged between 24.4 and 29.7 kHz, of bottlenose dolphins between 26.7 and 36.7 kHz, and of spinner dolphins between 33.8 and 36.0 kHz. Discriminant function analysis showed the ability to correctly discriminate between 93% of melon-headed whales, 75% of spinner dolphins and 54% of bottlenose dolphins.

  6. Um estudo de longa duração de um grupo costeiro de golfinhos Tursiops truncatus (Montagu, 1821) (Cetacea, Delphinidae) no sul do Brasil : aspectos de sua biologia e bioacústica

    OpenAIRE

    Lilian Sander Hoffmann

    2004-01-01

    Um pequeno grupo de golfinhos Tursiops truncatus, presente na barra da laguna de Tramandaí, RS, vem sendo acompanhado desde 1996 quanto a seus padrões de ocorrência e associação. A partir de 2002, tal acompanhamento passou a incluir dados de bioacústica. Através da fotoidentificação, os indivíduos foram observados na área em todos os anos, o que permite caracterizá-los como residentes, embora predominem os momentos em que estão ausentes. O tamanho do grupo é mantido constante, com oito indiví...

  7. Persistent organic pollutants (POPs) in blood and blubber of common bottlenose dolphins (Tursiops truncatus) at three northern Gulf of Mexico sites following the Deepwater Horizon oil spill.

    Science.gov (United States)

    Balmer, Jennifer E; Ylitalo, Gina M; Rowles, Teresa K; Mullin, Keith D; Wells, Randall S; Townsend, Forrest I; Pearce, Ronald W; Bolton, Jennie L; Zolman, Eric S; Balmer, Brian C; Schwacke, Lori H

    2018-04-15

    Common bottlenose dolphins (Tursiops truncatus), including those impacted by the 2010 Deepwater Horizon (DWH) oil spill, inhabit the coastal and estuarine waters of the northern Gulf of Mexico (GoM). In response to the spill, dolphin health assessments conducted in Barataria Bay, Louisiana - a site that experienced heavy and prolonged oiling - uncovered a high prevalence of health abnormalities and individuals in poor body condition. Although the health effects observed were suggestive of petroleum toxicity, a lack of pre-spill information regarding dolphin health raises the possibility that other environmental factors may have contributed to the adverse health of dolphins in this oil-impacted area. To assess how exposure to other environmental pollutants may affect the health of northern GoM dolphin populations impacted by the DWH oil spill, a suite of 69 persistent organic pollutants (POPs), including PCBs, PBDEs and organochlorine pesticides, was determined in blood and a subset of blubber samples collected during health assessments of 145 bottlenose dolphins at three GoM sites: two oil impacted sites - Barataria Bay, LA (BB), and Mississippi Sound, MS (MS) and an unimpacted reference site - Sarasota Bay, FL (SB). Overall, levels of POPs at all three sites appeared comparable or lower than concentrations previously reported for coastal bottlenose dolphin populations outside of the northern GoM. POP levels measured in BB dolphins were also comparable or lower than those measured at the unimpacted reference site (SB) within the northern GoM. Additionally, the relationship between blubber and blood contaminant levels in a smaller subset of BB and SB suggests that BB animals were not experiencing elevated blood-contaminant concentrations as a result of their poor body condition. Cumulatively, these results suggest that background levels of POPs measured are unlikely to produce the health abnormalities previously reported for BB dolphins. Copyright © 2017 Elsevier B

  8. Hematologic and serum biochemical reference intervals for free-ranging common bottlenose dolphins (Tursiops truncatus) and variation in the distributions of clinicopathologic values related to geographic sampling site.

    Science.gov (United States)

    Schwacke, Lori H; Hall, Ailsa J; Townsend, Forrest I; Wells, Randall S; Hansen, Larry J; Hohn, Aleta A; Bossart, Gregory D; Fair, Patricia A; Rowles, Teresa K

    2009-08-01

    To develop robust reference intervals for hematologic and serum biochemical variables by use of data derived from free-ranging bottlenose dolphins (Tursiops truncatus) and examine potential variation in distributions of clinicopathologic values related to sampling sites' geographic locations. 255 free-ranging bottlenose dolphins. Data from samples collected during multiple bottlenose dolphin capture-release projects conducted at 4 southeastern US coastal locations in 2000 through 2006 were combined to determine reference intervals for 52 clinicopathologic variables. A nonparametric bootstrap approach was applied to estimate 95th percentiles and associated 90% confidence intervals; the need for partitioning by length and sex classes was determined by testing for differences in estimated thresholds with a bootstrap method. When appropriate, quantile regression was used to determine continuous functions for 95th percentiles dependent on length. The proportion of out-of-range samples for all clinicopathologic measurements was examined for each geographic site, and multivariate ANOVA was applied to further explore variation in leukocyte subgroups. A need for partitioning by length and sex classes was indicated for many clinicopathologic variables. For each geographic site, few significant deviations from expected number of out-of-range samples were detected. Although mean leukocyte counts did not vary among sites, differences in the mean counts for leukocyte subgroups were identified. Although differences in the centrality of distributions for some variables were detected, the 95th percentiles estimated from the pooled data were robust and applicable across geographic sites. The derived reference intervals provide critical information for conducting bottlenose dolphin population health studies.

  9. Adrenal Gland and Lung Lesions in Gulf of Mexico Common Bottlenose Dolphins (Tursiops truncatus Found Dead following the Deepwater Horizon Oil Spill.

    Directory of Open Access Journals (Sweden)

    Stephanie Venn-Watson

    Full Text Available A northern Gulf of Mexico (GoM cetacean unusual mortality event (UME involving primarily bottlenose dolphins (Tursiops truncatus in Louisiana, Mississippi, and Alabama began in February 2010 and continued into 2014. Overlapping in time and space with this UME was the Deepwater Horizon (DWH oil spill, which was proposed as a contributing cause of adrenal disease, lung disease, and poor health in live dolphins examined during 2011 in Barataria Bay, Louisiana. To assess potential contributing factors and causes of deaths for stranded UME dolphins from June 2010 through December 2012, lung and adrenal gland tissues were histologically evaluated from 46 fresh dead non-perinatal carcasses that stranded in Louisiana (including 22 from Barataria Bay, Mississippi, and Alabama. UME dolphins were tested for evidence of biotoxicosis, morbillivirus infection, and brucellosis. Results were compared to up to 106 fresh dead stranded dolphins from outside the UME area or prior to the DWH spill. UME dolphins were more likely to have primary bacterial pneumonia (22% compared to 2% in non-UME dolphins, P = .003 and thin adrenal cortices (33% compared to 7% in non-UME dolphins, P = .003. In 70% of UME dolphins with primary bacterial pneumonia, the condition either caused or contributed significantly to death. Brucellosis and morbillivirus infections were detected in 7% and 11% of UME dolphins, respectively, and biotoxin levels were low or below the detection limit, indicating that these were not primary causes of the current UME. The rare, life-threatening, and chronic adrenal gland and lung diseases identified in stranded UME dolphins are consistent with exposure to petroleum compounds as seen in other mammals. Exposure of dolphins to elevated petroleum compounds present in coastal GoM waters during and after the DWH oil spill is proposed as a cause of adrenal and lung disease and as a contributor to increased dolphin deaths.

  10. Ratiometric measurements of adiponectin by mass spectrometry in bottlenose dolphins (Tursiops truncatus with iron overload reveal an association with insulin resistance and glucagon

    Directory of Open Access Journals (Sweden)

    Benjamin A Neely

    2013-09-01

    Full Text Available High molecular weight (HMW adiponectin levels are reduced in humans with type 2 diabetes and insulin resistance. Similar to humans with insulin resistance, managed bottlenose dolphins (Tursiops truncatus diagnosed with hemochromatosis (iron overload have higher levels of 2 h post-prandial plasma insulin than healthy controls. A parallel reaction monitoring assay for dolphin serum adiponectin was developed based on tryptic peptides identified by mass spectrometry. Using identified post-translational modifications, a differential measurement was constructed. Total and unmodified adiponectin levels were measured in sera from dolphins with (n=4 and without (n=5 iron overload. This measurement yielded total adiponectin levels as well as site specific percent unmodified adiponectin that may inversely correlate with HMW adiponectin. Differences in insulin levels between iron overload cases and controls were observed 2 h post-prandial, but not during the fasting state. Thus, post-prandial as well as fasting serum adiponectin levels were measured to determine whether adiponectin and insulin would follow similar patterns. There was no difference in total adiponectin or percent unmodified adiponectin from case or control fasting animals. There was no difference in post-prandial total adiponectin levels between case and control dolphins (mean ± S.D. at 763 ± 298 and 727 ± 291 pmol/ml, respectively (p = 0.91; however, percent unmodified adiponectin was significantly higher in post-prandial cases compared controls (30.0 ± 6.3 versus 17.0 ± 6.6%, respectively; p = 0.016. Interestingly, both total and percent unmodified adiponectin were correlated with glucagon levels in controls (r = 0.999, p < 0.001, but not in cases, which is possibly a reflection of insulin resistance. Although total adiponectin levels were not significantly different, the elevated percent unmodified adiponectin follows a trend similar to HMW adiponectin reported for humans with

  11. Purine metabolism in response to hypoxic conditions associated with breath-hold diving and exercise in erythrocytes and plasma from bottlenose dolphins (Tursiops truncatus).

    Science.gov (United States)

    Del Castillo Velasco-Martínez, Iris; Hernández-Camacho, Claudia J; Méndez-Rodríguez, Lía C; Zenteno-Savín, Tania

    2016-01-01

    In mammalian tissues under hypoxic conditions, ATP degradation results in accumulation of purine metabolites. During exercise, muscle energetic demand increases and oxygen consumption can exceed its supply. During breath-hold diving, oxygen supply is reduced and, although oxygen utilization is regulated by bradycardia (low heart rate) and peripheral vasoconstriction, tissues with low blood flow (ischemia) may become hypoxic. The goal of this study was to evaluate potential differences in the circulating levels of purine metabolism components between diving and exercise in bottlenose dolphins (Tursiops truncatus). Blood samples were taken from captive dolphins following a swimming routine (n=8) and after a 2min dive (n=8). Activity of enzymes involved in purine metabolism (hypoxanthine guanine phosphoribosyl transferase (HGPRT), inosine monophosphate deshydrogenase (IMPDH), xanthine oxidase (XO), purine nucleoside phosphorylase (PNP)), and purine metabolite (hypoxanthine (HX), xanthine (X), uric acid (UA), inosine monophosphate (IMP), inosine, nicotinamide adenine dinucleotide (NAD(+)), adenosine, adenosine monophosphate (AMP), adenosine diphosphate (ADP), ATP, guanosine diphosphate (GDP), guanosine triphosphate (GTP)) concentrations were quantified in erythrocyte and plasma samples. Enzymatic activity and purine metabolite concentrations involved in purine synthesis and degradation, were not significantly different between diving and exercise. Plasma adenosine concentration was higher after diving than exercise (p=0.03); this may be related to dive-induced ischemia. In erythrocytes, HGPRT activity was higher after diving than exercise (p=0.007), suggesting an increased capacity for purine recycling and ATP synthesis from IMP in ischemic tissues of bottlenose dolphins during diving. Purine recycling and physiological adaptations may maintain the ATP concentrations in bottlenose dolphins after diving and exercise. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Adrenal Gland and Lung Lesions in Gulf of Mexico Common Bottlenose Dolphins (Tursiops truncatus) Found Dead following the Deepwater Horizon Oil Spill.

    Science.gov (United States)

    Venn-Watson, Stephanie; Colegrove, Kathleen M; Litz, Jenny; Kinsel, Michael; Terio, Karen; Saliki, Jeremiah; Fire, Spencer; Carmichael, Ruth; Chevis, Connie; Hatchett, Wendy; Pitchford, Jonathan; Tumlin, Mandy; Field, Cara; Smith, Suzanne; Ewing, Ruth; Fauquier, Deborah; Lovewell, Gretchen; Whitehead, Heidi; Rotstein, David; McFee, Wayne; Fougeres, Erin; Rowles, Teri

    2015-01-01

    A northern Gulf of Mexico (GoM) cetacean unusual mortality event (UME) involving primarily bottlenose dolphins (Tursiops truncatus) in Louisiana, Mississippi, and Alabama began in February 2010 and continued into 2014. Overlapping in time and space with this UME was the Deepwater Horizon (DWH) oil spill, which was proposed as a contributing cause of adrenal disease, lung disease, and poor health in live dolphins examined during 2011 in Barataria Bay, Louisiana. To assess potential contributing factors and causes of deaths for stranded UME dolphins from June 2010 through December 2012, lung and adrenal gland tissues were histologically evaluated from 46 fresh dead non-perinatal carcasses that stranded in Louisiana (including 22 from Barataria Bay), Mississippi, and Alabama. UME dolphins were tested for evidence of biotoxicosis, morbillivirus infection, and brucellosis. Results were compared to up to 106 fresh dead stranded dolphins from outside the UME area or prior to the DWH spill. UME dolphins were more likely to have primary bacterial pneumonia (22% compared to 2% in non-UME dolphins, P = .003) and thin adrenal cortices (33% compared to 7% in non-UME dolphins, P = .003). In 70% of UME dolphins with primary bacterial pneumonia, the condition either caused or contributed significantly to death. Brucellosis and morbillivirus infections were detected in 7% and 11% of UME dolphins, respectively, and biotoxin levels were low or below the detection limit, indicating that these were not primary causes of the current UME. The rare, life-threatening, and chronic adrenal gland and lung diseases identified in stranded UME dolphins are consistent with exposure to petroleum compounds as seen in other mammals. Exposure of dolphins to elevated petroleum compounds present in coastal GoM waters during and after the DWH oil spill is proposed as a cause of adrenal and lung disease and as a contributor to increased dolphin deaths.

  13. Serum antibody levels against select bacterial pathogens in Atlantic bottlenose dolphins, Tursiops truncatus, from Beaufort NC USA and Charleston Harbor, Charleston, SC, USA.

    Science.gov (United States)

    Beck, B M; Rice, C D

    2003-03-01

    Concern over the emergence of zoonotic diseases in marine organisms is growing. In response to this concern, this study set out to measure antibody activities against bacterial pathogens in Atlantic bottlenose dolphins, Tursiops truncatus, from the coastal estuaries of NC and SC, USA. Individuals from Charleston SC harbor, a heavily industrialized shipping harbor estuary, and from Beaufort NC, a non-shipping estuary, were examined. Purified IgG was obtained from pooled sera using ammonium sulfate precipitation steps and protein-G procedures, which was then used to generate a panel of IgG-specific monoclonal antibodies. Two of these antibodies, mAbs BB-10-2 (IgG1) and BB-32-2 (IgG2b), were then used to determine total serum IgG concentrations using a sandwich capture ELISA. Circulating IgG levels were variable between individuals and between the two pods. MAb BB-10-2 was then used in an indirect ELISA to determine serum antibody activities against several common marine bacteria as well as the human pathogens E. coli and E. coli strain 0157:H7, Vibrio parahemolyticus, V. vulnificus, V. cholerae, Mycobacteria marinum, M. fortuitum, and M. chelonae. The highest antibody activities were against mycobacteria, two of which are zoonotic pathogens. Males had the highest antibody activities, thus suggesting low cell-mediated immunity against intracellular pathogens in these individuals. T-cell proliferation in response to Con-A, an indicator of cell-mediated immune function, was then measured in the Beaufort population. Males had the lowest proliferation responses, however a negative correlation between antibody activities and T-cell proliferation in individuals could not be established for either of the Mycobacteria species. Overall, antibody activities against all bacteria, including innocuous species such as V. anguillarum, V. natrigens, and M. xenopi were highly variable between individual dolphins and the two pods, with some animals exhibiting very high activities

  14. A new dolphin species, the Burrunan Dolphin Tursiops australis sp. nov., endemic to southern Australian coastal waters.

    Science.gov (United States)

    Charlton-Robb, Kate; Gershwin, Lisa-ann; Thompson, Ross; Austin, Jeremy; Owen, Kylie; McKechnie, Stephen

    2011-01-01

    Small coastal dolphins endemic to south-eastern Australia have variously been assigned to described species Tursiops truncatus, T. aduncus or T. maugeanus; however the specific affinities of these animals is controversial and have recently been questioned. Historically 'the southern Australian Tursiops' was identified as unique and was formally named Tursiops maugeanus but was later synonymised with T. truncatus. Morphologically, these coastal dolphins share some characters with both aforementioned recognised Tursiops species, but they also possess unique characters not found in either. Recent mtDNA and microsatellite genetic evidence indicates deep evolutionary divergence between this dolphin and the two currently recognised Tursiops species. However, in accordance with the recommendations of the Workshop on Cetacean Systematics, and the Unified Species Concept the use of molecular evidence alone is inadequate for describing new species. Here we describe the macro-morphological, colouration and cranial characters of these animals, assess the available and new genetic data, and conclude that multiple lines of evidence clearly indicate a new species of dolphin. We demonstrate that the syntype material of T. maugeanus comprises two different species, one of which is the historical 'southern form of Tursiops' most similar to T. truncatus, and the other is representative of the new species and requires formal classification. These dolphins are here described as Tursiops australis sp. nov., with the common name of 'Burrunan Dolphin' following Australian aboriginal narrative. The recognition of T. australis sp. nov. is particularly significant given the endemism of this new species to a small geographic region of southern and south-eastern Australia, where only two small resident populations in close proximity to a major urban and agricultural centre are known, giving them a high conservation value and making them susceptible to numerous anthropogenic threats.

  15. Comparison of potential dietary and urinary risk factors for ammonium urate nephrolithiasis in two bottlenose dolphin (Tursiops truncatus) populations.

    Science.gov (United States)

    Le-Bert, Carolina R; Smith, Cynthia R; Poindexter, John; Ardente, Amanda; Meegan, Jenny; Wells, Randall S; Venn-Watson, Stephanie; Jensen, Eric D; Sakhaee, Khashayar

    2018-04-04

    Dietary and urinary risk factors have been implicated in conditions favoring ammonium urate nephrolithiasis in managed dolphins compared to free-ranging dolphins. In this study, urine samples were collected from 16 dolphins (8 cases, 8 controls) from the U.S. Navy Marine Mammal Program (MMP) for the purposes of assessing changes in urinary biomarkers after a large meal. Urinary biomarkers and nephrolithiasis presence were assessed opportunistically in 15 long-term resident free-ranging dolphins living in Sarasota Bay, Florida (SB). Additionally, the total purine contents of fish commonly consumed by each dolphin population were measured to evaluate potential dietary risk factors. Populations were compared for total dietary purine composition, recently fed status, nephrolithiasis presence, and differences in urinary biochemical, acid-base, and physicochemical parameters via Wilcoxon rank sum analysis and least square means. Managed dolphins had higher urinary pH and ammonium (NH4+) in both pre- and postprandial conditions and higher urinary uric acid and saturation indices of NH4U in the postprandial condition compared to free-ranging dolphins (p dolphins (7 mmol/Mcal ME) than in the free-ranging dolphin diet (4 mmol/Mcal ME). Free-ranging dolphins did not show evidence of nephrolithiasis. Observed differences in urinary biomarkers and dietary purine content in these two dolphin populations suggest a pathophysiologic basis for the role of fish types on risk of NH4U stone formation. Future research should investigate fish type and feeding frequency, inhibitors and promoters, and alkalinizing therapy for reducing NH4U nephrolithiasis in dolphins.

  16. Isotope turnover rates and diet-tissue discrimination in skin of ex situ bottlenose dolphins (Tursiops truncatus).

    Science.gov (United States)

    Browning, Nicole E; Dold, Christopher; I-Fan, Jack; Worthy, Graham A J

    2014-01-15

    Diet-tissue discrimination factors (Δ(15)N or Δ(13)C) and turnover times are thought to be influenced by a wide range of variables including metabolic rate, age, dietary quality, tissue sampled and the taxon being investigated. In the present study, skin samples were collected from ex situ dolphins that had consumed diets of known isotopic composition for a minimum of 8 weeks. Adult dolphins consuming a diet of low fat (5-6%) and high δ(15)N value had significantly lower Δ(15)N values than animals consuming a diet with high fat (13.9%) and low δ(15)N value. Juvenile dolphins consuming a diet with low fat and an intermediate δ(15)N value had significantly higher Δ(15)N values than adults consuming the same diet. Calculated half-lives for δ(15)N ranged from 14 to 23 days (17.2 ± 1.3 days). Half-lives for δ(13)C ranged from 11 to 23 days with a significant difference between low fat (13.9 ± 4.8 days) and high fat diets (22.0 ± 0.5 days). Overall, our results indicate that while assuming a Δ(13)C value of 1‰ may be appropriate for cetaceans, Δ(15)N values may be closer to 1.5‰ rather than the commonly assumed 3‰. Our data also suggest that understanding seasonal variability in prey composition is another significant consideration when applying discrimination factors or turnover times to field studies focused on feeding habits. Isotope retention times of only a few weeks suggest that, in addition, these isotope data could play an important role in interpreting recent fine-scale habitat utilization and residency patterns.

  17. Genomic and expression analyses of Tursiops truncatus T cell receptor gamma (TRG) and alpha/delta (TRA/TRD) loci reveal a similar basic public γδ repertoire in dolphin and human.

    Science.gov (United States)

    Linguiti, Giovanna; Antonacci, Rachele; Tasco, Gianluca; Grande, Francesco; Casadio, Rita; Massari, Serafina; Castelli, Vito; Consiglio, Arianna; Lefranc, Marie-Paule; Ciccarese, Salvatrice

    2016-08-15

    The bottlenose dolphin (Tursiops truncatus) is a mammal that belongs to the Cetartiodactyla and have lived in marine ecosystems for nearly 60 millions years. Despite its popularity, our knowledge about its adaptive immunity and evolution is very limited. Furthermore, nothing is known about the genomics and evolution of dolphin antigen receptor immunity. Here we report a evolutionary and expression study of Tursiops truncatus T cell receptor gamma (TRG) and alpha/delta (TRA/TRD) genes. We have identified in silico the TRG and TRA/TRD genes and analyzed the relevant mature transcripts in blood and in skin from four subjects. The dolphin TRG locus is the smallest and simplest of all mammalian loci as yet studied. It shows a genomic organization comprising two variable (V1 and V2), three joining (J1, J2 and J3) and a single constant (C), genes. Despite the fragmented nature of the genome assemblies, we deduced the TRA/TRD locus organization, with the recent TRDV1 subgroup genes duplications, as it is expected in artiodactyls. Expression analysis from blood of a subject allowed us to assign unambiguously eight TRAV genes to those annotated in the genomic sequence and to twelve new genes, belonging to five different subgroups. All transcripts were productive and no relevant biases towards TRAV-J rearrangements are observed. Blood and skin from four unrelated subjects expression data provide evidence for an unusual ratio of productive/unproductive transcripts which arise from the TRG V-J gene rearrangement and for a "public" gamma delta TR repertoire. The productive cDNA sequences, shared both in the same and in different individuals, include biases of the TRGV1 and TRGJ2 genes. The high frequency of TRGV1-J2/TRDV1- D1-J4 productive rearrangements in dolphins may represent an interesting oligo-clonal population comparable to that found in human with the TRGV9- JP/TRDV2-D-J T cells and in primates. Although the features of the TRG and TRA/TRD loci organization reflect

  18. The neocortex of cetartiodactyls: I. A comparative Golgi analysis of neuronal morphology in the bottlenose dolphin (Tursiops truncatus), the minke whale (Balaenoptera acutorostrata), and the humpback whale (Megaptera novaeangliae).

    Science.gov (United States)

    Butti, Camilla; Janeway, Caroline M; Townshend, Courtney; Wicinski, Bridget A; Reidenberg, Joy S; Ridgway, Sam H; Sherwood, Chet C; Hof, Patrick R; Jacobs, Bob

    2015-11-01

    The present study documents the morphology of neurons in several regions of the neocortex from the bottlenose dolphin (Tursiops truncatus), the North Atlantic minke whale (Balaenoptera acutorostrata), and the humpback whale (Megaptera novaeangliae). Golgi-stained neurons (n = 210) were analyzed in the frontal and temporal neocortex as well as in the primary visual and primary motor areas. Qualitatively, all three species exhibited a diversity of neuronal morphologies, with spiny neurons including typical pyramidal types, similar to those observed in primates and rodents, as well as other spiny neuron types that had more variable morphology and/or orientation. Five neuron types, with a vertical apical dendrite, approximated the general pyramidal neuron morphology (i.e., typical pyramidal, extraverted, magnopyramidal, multiapical, and bitufted neurons), with a predominance of typical and extraverted pyramidal neurons. In what may represent a cetacean morphological apomorphy, both typical pyramidal and magnopyramidal neurons frequently exhibited a tri-tufted variant. In the humpback whale, there were also large, star-like neurons with no discernable apical dendrite. Aspiny bipolar and multipolar interneurons were morphologically consistent with those reported previously in other mammals. Quantitative analyses showed that neuronal size and dendritic extent increased in association with body size and brain mass (bottlenose dolphin whale humpback whale). The present data thus suggest that certain spiny neuron morphologies may be apomorphies in the neocortex of cetaceans as compared to other mammals and that neuronal dendritic extent covaries with brain and body size.

  19. The relationship of maternal characteristics and circulating progesterone concentrations with reproductive outcome in the bottlenose dolphin (Tursiops truncatus) after artificial insemination, with and without ovulation induction, and natural breeding.

    Science.gov (United States)

    O'Brien, J K; Robeck, T R

    2012-08-01

    Bottlenose dolphins (Tursiops truncatus) undergoing natural breeding and artificial insemination (AI) were examined to characterize serum progesterone concentrations and determine relationships among age, parity, and reproductive outcome. Progesterone profiles of five cycle types (n = 119 total cycles from 54 animals) were characterized as follows: (i) conception and production of a live term calf (conceptive-term, n = 73); (ii) conception and abortion after Day 60 (conceptive-abortion, n = 12); (iii) unknown conception status with prolonged, elevated progesterone and absence of a fetus (conceptive-unknown, n = 14); (iv) conception failure with normal luteal phase progesterone concentrations (non-conceptive, n = 14, AI cycles only); and (v) conception failure with progesterone insufficiency occuring after spontaneous ovulation or owing to premature ovulation induction using GnRH (non-conceptive-PI, n = 6, AI cycles only). By Day 21 post-insemination (PI), progesterone concentrations were similar (P > 0.05) among conceptive-term, conceptive-abortion and conceptive-unknown, and higher (P 0.05) progesterone concentrations than conceptive-abortion and unknown conception status cycles. Parity was not associated with reproductive outcome based on cycle type (P > 0.05). Age of females in conceptive-unknown (26.5 ± 10.1 yrs) and conceptive-abortion (22.1 ± 9.4 yrs) groups was higher (P < 0.05) than in conceptive-term (15.7 ± 7.2 yrs). The conceptive-unknown cycle type possibly represents undetected early embryonic loss occurring before Day 60 PI. Length of gestation using known conception dates was 376.1 ± 11.0 days and the range of this parameter (355-395 days) has implications for peri-parturient management procedures for the species. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Distribución y condiciones ambientales asociadas al comportamiento del delfín bufeo (Tursiops truncatus y el delfín manchado (Stenella attenuata (Cetacea: Delphinidae en el Golfo Dulce, Costa Rica

    Directory of Open Access Journals (Sweden)

    Priscilla Cubero-Pardo

    2007-06-01

    Full Text Available Las características del hábitat que influyen en las especies animales varían de un lugar a otro. Al mismo tiempo, toda especie es rodeada por una serie de factores ambientales que interactúan entre sí, pero la influencia que una característica ambiental particular pueda ejercer sobre una especie depende no sólo de las demás variables, sino de las condiciones morfológicas, fisiológicas y sociales de esa especie. En este estudio, desarrollado de junio 1996 a julio 1997, la pregunta fue enfocada a determinar si comportamientos específicos en el delfín bufeo (Tursiops truncatus y el delfín manchado (Stenella attenuata están relacionados con áreas de distribución y factores ambientales particulares. El área de estudio fue cubierta siguiendo transectos lineares oblicuos predeterminados y cada grupo fue observado de 15 min a 5 h. Las variables ambientales fueron medidas al inicio y al final de cada avistamiento junto con la determinación de la posición geográfica y el comportamiento llevado a cabo por los delfines. Para el bufeo, las actividades de forrajeo/ alimentación mostraron coincidencia exclusiva con bocas de ríos y áreas de coral y manglar, y las actividades sociales y de merodeo, se asociaron a áreas cercanas a los sitios de forrajeo. El desplazamiento ocurrió a lo largo de diferentes puntos paralelos a la costa, con un bajo porcentaje de casos a través del golfo (16.56 %, lo cual sugiere que el bufeo rara vez cruza el golfo. En el caso del manchado, no fue posible asociar zonas comportamientos particulares, pues todo el grupo se mueve junto; sin embargo, si fue observada la presencia de distintos comportamientos en un mismo momento, llevados a cabo por grupos específicos dentro de la manada. Se consideraron factores ambientales tales como la profundidad, la temperatura, la salinidad y la distancia respecto a la costa, entre otros. El ANDEVA de bloques no reveló una relación marcada entre actividades y zonas

  1. Iron Indices in Bottlenose Dolphins (Tursiops truncatus)

    Science.gov (United States)

    Mazzaro, Lisa M; Johnson, Shawn P; Fair, Patricia A; Bossart, Greg; Carlin, Kevin P; Jensen, Eric D; Smith, Cynthia R; Andrews, Gordon A; Chavey, Patricia S; Venn-Watson, Stephanie

    2012-01-01

    Bottlenose dolphins can have iron overload (that is, hemochromatosis), and managed populations of dolphins may be more susceptible to this disease than are wild dolphins. Serum iron, total iron-binding capacity (TIBC), transferrin saturation, and ferritin were measured in 181 samples from 141 dolphins in 2 managed collections and 2 free-ranging populations. Although no iron indices increased with age among free-ranging dolphins, ferritin increased with age in managed collections. Dolphins from managed collections had higher iron, ferritin, and transferrin saturation values than did free-ranging dolphins. Dolphins with high serum iron (exceeding 300 μg/dL) were more likely to have elevated ferritin but not ceruloplasmin or haptoglobin, demonstrating that high serum levels of iron are due to a true increase in total body iron. A time-series study of 4 dolphins with hemochromatosis that were treated with phlebotomy demonstrated significant decreases in serum ferritin, iron, and TIBC between pre- and posttreatment samples; transferrin saturation initially fell but returned to prephlebotomy levels by 6 mo after treatment. Compared with those in managed collections, wild dolphins were 15 times more likely to have low serum iron (100 μg/dL or less), and this measure was associated with lower haptoglobin. In conclusion, bottlenose dolphins in managed collections are more likely to have greater iron stores than are free-ranging dolphins. Determining why this situation occurs among some dolphin populations and not others may improve the treatment of hemochromatosis in dolphins and provide clues to causes of nonhereditary hemochromatosis in humans. PMID:23561885

  2. Whistle Matching in Wild Bottlenose Dolphins (Tursiops truncatus)

    Science.gov (United States)

    Janik, Vincent M.

    2000-08-01

    Dolphin communication is suspected to be complex, on the basis of their call repertoires, cognitive abilities, and ability to modify signals through vocal learning. Because of the difficulties involved in observing and recording individual cetaceans, very little is known about how they use their calls. This report shows that wild, unrestrained bottlenose dolphins use their learned whistles in matching interactions, in which an individual responds to a whistle of a conspecific by emitting the same whistle type. Vocal matching occurred over distances of up to 580 meters and is indicative of animals addressing each other individually.

  3. The Development of Social Play in Bottlenose Dolphins (Tursiops truncatus

    Directory of Open Access Journals (Sweden)

    Angela D. Mackey

    2014-08-01

    Full Text Available For the young of many species, social play is an important aspect of development. Previous research has shown that bottlenose dolphin calves engage in social play early in life. Despite these observations, little is known about the development of social play in this species. The present study examined the social play behavior of three aquarium-housed bottlenose dolphin calves during their first year of life. We were particularly interested in the partner with whom each calf played as well as the initiator of social play bouts. Each calf was observed from birth until the end of its first year and all bouts of social and solitary play were recorded during observation sessions. While the calves engaged in both social and solitary play throughout their first year, play became increasingly social as they aged. The calves also became more likely to initiate social play interactions with increasing age. A calf’s first social play partner was typically its mother, but other calves quickly replaced the mother as the most common play partner. When it came to play partner preferences, we found that calves of similar age were preferred as play partners, but age similarity became less characteristic of play partners as the calves grew older. These findings likely reflect changes in the developmental competence of each of the calves individually, and support the notion that calves use social play to challenge themselves.

  4. Lesiones papilomatosas en genitales externos de delfines Tursiops truncatus

    OpenAIRE

    Ancheta, O.; Cruz, D.; Guevara, C.; Rodríguez, S.; Chamizo, E.; Valdés, T.; Harvey, Y.; Gutiérrez, N.; González, L.

    2009-01-01

    La papilomatosis es una entidad tumoral generalmente benigna que ataca la piel y mucosas de diferentes zonas del cuerpo. Esta enfermedad puede limitar la reproducción en los cetáceos y una de sus causas puede ser la infección por papilomavirus. La observación de pequeñas verrugas en la piel o mucosas de estos animales hace inferir la presencia de lesiones papilomatosas.

  5. TOXOPLASMOSIS IN CAPTIVE DOLPHINS (TURSIOPS TRUNCATUS) AND WALRUS (ODOBENUS ROSMRUS)

    Science.gov (United States)

    Toxoplasma gondii infection in marine mammals is intriguing and indicative of contamination of the ocean environment and coastal waters with oocysts. Toxoplasma gondii infection was detected in captive marine mammals at a seaquarium in Canada. Antibodies to T. gondii were found in all 7 bottlenose ...

  6. Hepatitis E virus in bottlenose dolphins Tursiops truncatus.

    Science.gov (United States)

    Montalvo Villalba, María Caridad; Cruz Martínez, Danilo; Ahmad, Imran; Rodriguez Lay, Licel A; Bello Corredor, Marite; Guevara March, Celia; Martínez, Liena Sánchez; Martínez-Campo, Laima Sánchez; Jameel, Shahid

    2017-02-08

    Hepatitis E virus (HEV) infects several animal species that act as zoonotic reservoirs for viral transmission. Solid and liquid residues from infected animals could lead to HEV contamination of food and surface waters. Evidence of human HEV infection through ingestion of seafood (shellfish, mussels) has been reported. Dolphins generally feed on fish and squid but are able to adapt to an environment and consume whatever prey is available. Clinical signs of infected dolphins include lethargy, inappetence, behavioral aberrations and increased serum alanine aminotransferase (ALT). The dolphins examined in this study were maintained at the National Aquarium, Havana, Cuba. A total of 31 dolphins were evaluated for HEV markers. Sera were collected and screened for total immunoglobin (Ig) anti-HEV. Sera and liver homogenate were tested for HEV RNA by nested RT-PCR using primers targeting the open reading frame 1. Phylogenetic analysis was performed using partial nucleotide sequences at the amplified RNA-dependent RNA polymerase gene. Total anti-HEV Ig was detected in 32.2% (10 of 31), and 16.1% (5 of 31) of these dolphins were positive by both serology and HEV RNA testing. Nucleotide sequence analyses revealed that HEV strains identified in dolphins were genotype 3. This virus may represent an environmental contamination of food or wastewater as a source of HEV exposure and infection. Our findings provide evidence that HEV is associated with liver disorders in cetaceans and that it is advisable to screen for exposure of this virus in captive dolphins, particularly animals with elevated serum ALT or compromised liver function test results of undetermined cause.

  7. Resting behaviors of captive bottlenose dolphins (Tursiops truncatus).

    Science.gov (United States)

    Sekiguchi, Yuske; Kohshima, Shiro

    2003-09-01

    In order to specify the resting behaviors in captive bottlenose dolphin, we quantitatively analyzed behavior of 16 dolphins in three aquariums in Japan. We observed their behaviors in the low-activity time (0 a.m.-3 a.m.), assuming that the resting behaviors would be most prominent and abundant at this time. We analyzed these behaviors based on the data of their diurnal activity rhythm that we have clarified by measuring swimming speed and breath frequency. The behavior patterns characteristic to the low-activity time could be categorized into the following three types: "bottom-rest" characterized by long immobile stay on the tank bottom, "surface-rest" characterized by long immobile stay at the water surface, and "swim-rest" characterized by slow circle-swim near the bottom along a fixed trajectory. During these behaviors, breath frequency was significantly lower than the daily mean and at least one eye tended to be closed. These three behaviors accounted for 86.6% of the total observation time in the low-activity time. The resting behaviors were often observed even in the high-activity time (0 p.m.-4 p.m.); these three behaviors accounted for 38.5% of the total observation time in the high-activity time. In swim-rest, frequency of sound emission was significantly lower than that of other behaviors with high-speed swimming, and both eyes or one eye, especially the eye facing the inner side of the swimming circle tended to be closed. The eye condition and the periodical change of circle-swim direction or position-exchange observed during swim-rest suggest a relation between this behavior and unihemispheric sleep. The change in the resting behavior observed in the dolphins under nervous situations suggests that the dolphins flexibly change the type and the quantity of the resting behaviors according to the situation.

  8. Prostephanus truncatus in Africa: A review of biological trends and ...

    African Journals Online (AJOL)

    Since P. truncatus invaded Africa from approximately 1970, research mostly addressed its biology, ecology, dispersal and control methods. This review paper aims at evaluating P. truncatus pest status in Africa as a basis for designing pragmatic strategies for its control. Prostephanus truncatus pest status in Africa is high ...

  9. Functional brain imaging and bioacoustics in the Bottlenose dolphins, Tursiops truncatus

    Science.gov (United States)

    Ridgway, Sam; Finneran, James; Carder, Donald; van Bonn, William; Smith, Cynthia; Houser, Dorian; Mattrey, Robert; Hoh, Carl

    2003-10-01

    The dolphin brain is the central processing computer for a complex and effective underwater echolocation and communication system. Until now, it has not been possible to study or diagnose disorders of the dolphin brain employing modern functional imaging methods like those used in human medicine. Our most recent studies employ established methods such as behavioral tasks, physiological observations, and computed tomography (CT) and, for the first time, single photon emission computed tomography (SPECT), and positron emission tomography (PET). Trained dolphins slide out of their enclosure on to a mat and are transported by trainers and veterinarians to the laboratory for injection of a ligand. Following ligand injection, brief experiments include trained vocal responses to acoustic, visual, or tactile stimuli. We have used the ligand technetium (Tc-99m) biscisate (Neurolite) to image circulatory flow by SPECT. Fluro-deoxy-d-glucose (18-F-FDG) has been employed to image brain metabolism with PET. Veterinarians carefully monitored dolphins during and after the procedure. Through these methods, we have demonstrated that functional imaging can be employed safely and productively with dolphins to obtain valuable information on brain structure and function for medical and research purposes. Hemispheric differences and variations in flow and metabolism in different brain areas will be shown.

  10. Modulation of whistle production related to training sessions in bottlenose dolphins (Tursiops truncatus) under human care.

    Science.gov (United States)

    Lopez Marulanda, Juliana; Adam, Olivier; Delfour, Fabienne

    2016-11-01

    Bottlenose dolphins are highly social cetaceans with an extensive sound production including clicks, burst-pulsed sounds, and whistles. Some whistles, known as signature whistles, are individually specific. These acoustic signatures are commonly described as being emitted in contexts of stress during forced isolation and as group cohesion calls. Interactions between humans and captive dolphins is largely based on positive reinforcement conditioning within several training/feeding sessions per day. Vocal behavior of dolphins during these interactions might vary. To investigate this, we recorded 10 bottlenose dolphins of Parc Asterix dolphinarium (France) before, during and after 10 training sessions for a total duration of 7 hr and 32 min. We detected 3,272 whistles with 2,884 presenting a quality good enough to be categorized. We created a catalog of whistle types by visual categorization verified by five naive judges (Fleiss' Kappa Test). We then applied the SIGID method to identify the signatures whistles present in our recordings. We found 279 whistles belonging to one of the four identified signature whistle types. The remaining 2,605 were classified as non-signature whistles. The non-signature whistles emission rate was higher during and after the training sessions than before. Emission rate of three signature whistles types significantly increased afterwards as compared to before the training sessions. We suggest that dolphins use their signature whistles when they return to their intraspecific social interactions succeeding scheduled and human-organized training sessions. More observations are needed to make conclusions about the function of signature whistles in relation to training sessions. Zoo Biol. 35:495-504, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  11. Food-related bray calls in wild bottlenose dolphins (Tursiops truncatus).

    Science.gov (United States)

    Janik, V M

    2000-05-07

    Because cetaceans are difficult to study in the wild, little is known about how they use their sounds in their natural environment. Only the recent development of passive acoustic localization systems has enabled observations of the communication behaviour of individuals for correlation with their surface behaviour. Using such a system, I show that bottlenose dolphins in the Moray Firth, Scotland, produce low-frequency bray calls which are clearly correlated with feeding on salmonids. The production of these calls is followed by fast approaches by conspecifics in the area. In animals which use sound as a foraging tool, it is difficult to distinguish between food calls which have evolved because of their role in attracting conspecifics, and food manipulation or searching calls which may attract conspecifics as a by-product. However, the low-frequency structure of the bottlenose dolphin bray suggests that it evolved because of a role in manipulating prey rather than in attracting conspecifics. This conclusion suggests that dolphins exploit the perceptual systems of their prey to facilitate capture.

  12. The acoustic repertoire of bottlenose dolphins (Tursiops truncatus) from the southern Gulf of Mexico

    Science.gov (United States)

    Bazua-Duran, Carmen

    2005-04-01

    Bottlenose dolphins live in a variety of habitats of the world's oceans using their acoustic repertoire to communicate and inspect their environment. This work investigates the acoustic repertoire of bottlenose dolphins that inhabit a coastal lagoon of the southern Gulf of Mexico, the Laguna de Terminos and how it may relate to the dolphins' general behavioral state and herd size, and to the general characteristics of the habitat, such as visibility, depth, and sea state. Preliminary results show that bottlenose dolphins produce by far more clicks than whistles in all behavioral states (feeding, resting, social, and travel) and herd sizes, which may correlate with the decreased visibility and shallow depth of the Laguna de Terminos. Additionally, silence was found during all behavioral states, but very seldom in herds of large size. These preliminary results suggest that bottlenose dolphins are choosing when and where to produce their phonations. Therefore, more detailed studies are needed to understand how these animals are using their acoustic sense to communicate and inspect their environment. [Work supported by CONACyT-Gobierno Edo. de Campeche and PAPIIT, UNAM.

  13. Bottlenose dolphin (Tursiops truncatus) strandings in South Carolina, 1992-1996

    OpenAIRE

    McFee, Wayne E.; Hopkins-Murphy, Sally R.

    2002-01-01

    From 1992 to 1996, 153 bottlenose dolphin stranded in South Carolina, accounting for 73% of all marine mammal strandings during this period. The objectives of our study were to evaluate data from these strandings to deter-mine 1) annual trends in strandings, 2) seasonal and spatial distribution trends, 3) life history parameters such as sex ratio and age classes, 3) seasonal trends in reproduction, and 4) the extent to which humans have played a role in causing these strandings (human inter-a...

  14. Increased number of whistles of bottlenose dolphins, Tursiops truncatus, arising from interaction with people.

    Science.gov (United States)

    Akiyama, Junko; Ohta, Mitsuaki

    2007-02-01

    The acoustic mode is the most reasonable means for social animals such as dolphins to maintain contact in the underwater habitat, and has been developed since they moved to the sea. This study investigates variations in dolphin vocalizations under the following conditions in a captive environment: 1) before feeding (Pre-feeding), 2) during feeding (Feeding), 3) during free time without the presence of people (Free), 4) during interaction with people located upon a float (Float), 5) during interaction with people in the water (Water). During the experiments, a total of 2642 whistles were extracted from sonogram data using a spectrogram. About 44% of the total whistles were observed during Pre-feeding (1171/2642), and the number recorded during Free, when people were absent, was the smallest. The acoustic contours of dolphin whistles differed in different situations: convex, wave, and trill whistles were made repeatedly during Pre-feeding, thereby being more common at this time than at other times. The situation of Feeding saw an increased number of Upsweeps, which might be related to the use of echolocation. The lower frequencies were recorded during Pre-feeding, reflecting the emotion related to the dolphin's hunger. The results of this study indicate that dolphins increase their vocalization during interaction with people, suggesting that interactions with dolphins provide an effective treatment for human health problems, which is discussed with a reference article in this study. Vocal data obtained during contact with humans might serve as an important index for the dolphin-assisted therapy.

  15. The environment as a driver of immune and endocrine responses in dolphins (Tursiops truncatus.

    Directory of Open Access Journals (Sweden)

    Patricia A Fair

    Full Text Available Immune and endocrine responses play a critical role in allowing animals to adjust to environmental perturbations. We measured immune and endocrine related markers in multiple samples from individuals from two managed-care care dolphin groups (n = 82 samples from 17 dolphins and single samples collected from two wild dolphin populations: Indian River Lagoon, (IRL FL (n = 26; and Charleston, (CHS SC (n = 19. The immune systems of wild dolphins were more upregulated than those of managed-care-dolphins as shown by higher concentrations of IgG and increases in lysozyme, NK cell function, pathogen antibody titers and leukocyte cytokine transcript levels. Collectively, managed-care care dolphins had significantly lower levels of transcripts encoding pro-inflammatory cytokine TNF, anti-viral MX1 and INFα and regulatory IL-10. IL-2Rα and CD69, markers of lymphocyte activation, were both lower in managed-care care dolphins. IL-4, a cytokine associated with TH2 activity, was lower in managed-care care dolphins compared to the free-ranging dolphins. Differences in immune parameters appear to reflect the environmental conditions under which these four dolphin populations live which vary widely in temperature, nutrition, veterinary care, pathogen/contaminant exposures, etc. Many of the differences found were consistent with reduced pathogenic antigenic stimulation in managed-care care dolphins compared to wild dolphins. Managed-care care dolphins had relatively low TH2 lymphocyte activity and fewer circulating eosinophils compared to wild dolphins. Both of these immunologic parameters are associated with exposure to helminth parasites which is uncommon in managed-care care dolphins. Less consistent trends were observed in a suite of hormones but significant differences were found for cortisol, ACTH, total T4, free T3, and epinephrine. While the underlying mechanisms are likely multiple and complex, the marked differences observed in the immune and endocrine systems of wild and managed-care care dolphins appear to be shaped by their environment.

  16. Characterization and phylogenetic analysis of a Cunninghamella bertholletiae isolate from a bottlenose dolphin (Tursiops truncatus).

    Science.gov (United States)

    Bragulat, M Rosa; Castellá, Gemma; Isidoro-Ayza, Marcos; Domingo, Mariano; Cabañes, F Javier

    Cunninghamella is a genus of the order Mucorales which includes saprophytic species, rarely causing mycoses. The most frequently reported in human mycoses is the thermophilic species Cunninghamella bertholletiae. However, this species does not appear to cause mucormycosis in animals, so there is scarce information about C. bertholletiae isolates from animals. In this paper we describe the phenotypic and genotypic characterization, and the phylogenetic analysis, of an isolate of C. bertholletiae involved in a central nervous system mucormycosis in a dolphin. The isolate studied in this publication was characterized using the current morphological and physiological identification system for Cunninghamella species. DNA sequencing and analysis of the D1/D2 regions of the 26S rRNA gene and the ITS-5.8S rRNA gene sequences were also performed. Colonies were fast-growing, white at first, although they became tannish-gray, covering the whole plate after 7 days of incubation at 30 and 40°C. Limited growth was observed after 7 days at 45°C. The micromorphology showed characteristic erect sporangiophores. The identification of the isolate was confirmed by DNA sequencing of the D1/D2 regions of the 26S and the ITS-5.8S (ITS) rRNA gene sequencing. In the phylogenetic study, the isolate clustered in the same clade as C. bertholletiae neotype strain although some differences were observed in the ITS sequences. In the cetacean cases, the possible sources of infection are unclear. The reasons why this pathogen has been found only in cetaceans and not in other domestic or wild animals are at the moment unknown and need further study. Copyright © 2017 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

  17. Cognitive enrichment for bottlenose dolphins (Tursiops truncatus): evaluation of a novel underwater maze device.

    Science.gov (United States)

    Clark, Fay E; Davies, Samuel L; Madigan, Andrew W; Warner, Abby J; Kuczaj, Stan A

    2013-01-01

    Cognitive enrichment is gaining popularity as a tool to enhance captive animal well-being, but research on captive cetaceans is lacking. Dolphin cognition has been studied intensively since the 1950s, and several hundred bottlenose dolphins are housed in major zoos and aquaria worldwide, but most dolphin enrichment consists of simple floating objects. The aim of this study was to investigate whether a novel, underwater maze device (UMD) was cognitively enriching for one group of male and one group of female dolphins at Six Flags Discovery Kingdom, CA. The dolphin's task was to navigate a rubber ball through a maze of pipes, towards an exit pipe. We also tested a modification where an edible gelatine ball fell into the pool once the UMD was solved. The UMD was provided to each group between 8 and 11 times over a 4-week period. Male dolphins used the UMD without prior training, whereas females did not use the UMD at all. Two male dolphins solved the UMD 17 times, using a variety of problem-solving strategies. The UMD had no significant effect on circular (repetitive) swimming patterns, but males spent significantly more time underwater when the UMD was present. Males used the UMD significantly more when it contained the rubber ball, but the gelatine ball stimulated social play. The UMD is a safe and practical device for captive dolphins. It now requires further testing on other dolphins, particularly females, to in order to examine whether the sex differences we observed are a general phenomenon. © 2013 Wiley Periodicals, Inc.

  18. Sound Use, Sequential Behavior and Ecology of Foraging Bottlenose Dolphins, Tursiops Truncatus

    Science.gov (United States)

    1999-09-01

    34... a conglomerate of many elements of very different order, of reflexes, of simple patterns like locomotion , of conditioned reactions, of ’insight...Discrimination of different metallic plates by an echolocating delphinid. In Animal Sonar Systems: Biology and Bionics (ed. R. G. Busnel), pp. 363...costs of flight and echolocation are high for bats. The relative costs of locomotion are likely to be much lower in swimming dolphins than flying bats

  19. Fractal scaling in bottlenose dolphin (Tursiops truncatus) echolocation: A case study

    Science.gov (United States)

    Perisho, Shaun T.; Kelty-Stephen, Damian G.; Hajnal, Alen; Houser, Dorian; Kuczaj, Stan A., II

    2016-02-01

    Fractal scaling patterns, which entail a power-law relationship between magnitude of fluctuations in a variable and the scale at which the variable is measured, have been found in many aspects of human behavior. These findings have led to advances in behavioral models (e.g. providing empirical support for cascade-driven theories of cognition) and have had practical medical applications (e.g. providing new methods for early diagnosis of medical conditions). In the present paper, fractal analysis is used to investigate whether similar fractal scaling patterns exist in inter-click interval and peak-peak amplitude measurements of bottlenose dolphin click trains. Several echolocation recordings taken from two male bottlenose dolphins were analyzed using Detrended Fluctuation Analysis and Higuchi's (1988) method for determination of fractal dimension. Both animals were found to exhibit fractal scaling patterns near what is consistent with persistent long range correlations. These findings suggest that recent advances in human cognition and medicine may have important parallel applications to echolocation as well.

  20. Pathophysiology of Stress in Wild and Managed-Care Bottlenose Dolphins (Tursiops truncatus)

    Science.gov (United States)

    2014-09-30

    GGT) and amylase . Fibrinogen concentration was determined by the method of Schalm using heat precipitation. 7 ACTH, Cortisol, Aldosterone and...dolphins. GA dolphins had lower levels of total protein due to lower total alpha globulins, total beta globulins and total gamma globulin protein...bilirubin 0.09 0.03 0.07 0.05 0.10 0.00 Direct bilirubin 0.05 0.04 0.01 0.03 0.10 0.00 Indirect bilirubin 0.04 0.03 0.06 0.05 0.10 0.00 Amylase 2.87 0.28

  1. Buzzing during biosonar-based interception of prey in the delphinids Tursiops truncatus and Pseudorca crassidens.

    Science.gov (United States)

    Wisniewska, Danuta M; Johnson, Mark; Nachtigall, Paul E; Madsen, Peter T

    2014-12-15

    Echolocating bats and toothed whales probe their environment with ultrasonic sound pulses, using returning echoes to navigate and find prey in a process that appears to have resulted from a remarkable convergence of the two taxa. Here, we report the first detailed quantification of echolocation behaviour during prey capture in the most studied delphinid species, a false killer whale and a bottlenose dolphin. Using acoustic DTAGs, we demonstrate that just prior to prey interception these delphinids change their acoustic gaze dramatically by reducing inter-click intervals and output >10-fold in a high repetition rate, low output buzz. Buzz click rates of 250-500 Hz for large but agile animals suggest that sampling rates during capture are scaled with the whale's manoeuvrability. These observations support the growing notion that fast sonar sampling accompanied by a low output level is critical for high rate feedback to inform motor patterns during prey interception in all echolocating toothed whales. © 2014. Published by The Company of Biologists Ltd.

  2. Nocturnal Vocal Activity in Captive Bottlenose Dolphins (Tursiops truncatus: Could Dolphins have Presleep Choruses?

    Directory of Open Access Journals (Sweden)

    Dorothee Kremers

    2014-11-01

    Full Text Available Nocturnal vocal activity in dolphins is often thought to be associated with feeding activity. However, when no food resources are available dolphins spend their time for the most part resting/sleeping. While unihemispherically sleeping, dolphins mostly swim slowly and synchronously in close proximity with one or more other individuals. Although vocal activity is lower during resting/sleeping, dolphins are not entirely silent the entire night. However, nothing is known about the temporal patterning of vocal activity at night and its potential relation with activity in dolphins. Here we recorded the vocal activity of a group of five captive bottlenose dolphins at night while having no feeding opportunity, examined whether there was any temporal pattern and/or a relation with breathing activity, used here as an index of overall activity. The temporal pattern revealed two peaks of intense whistle activity (8 p.m. and midnight, which were followed by a strong decrease of whistle rate and a slight decrease of respiration rate. We suggest that the high vocal activity at the peak periods might indicate socializing periods and that dolphins, like many other species, show periods of increased social and vocal interactions (chorusing? before starting to rest/sleep, maybe to ensure the synchrony of slow swimming observed in this species. These findings contribute to a better understanding of nocturnal vocal activity in cetaceans and suggest new lines of research on vocal/social activity of dolphins in relation to presleep and resting behavior.

  3. The orexin system in the enteric nervous system of the bottlenose dolphin (Tursiops truncatus.

    Directory of Open Access Journals (Sweden)

    Claudia Gatta

    Full Text Available This study provides a general approach to the presence and possible role of orexins and their receptors in the gut (three gastric chambers and intestine of confined environment bottlenose dolphin. The expression of prepro-orexin, orexin A and B and orexin 1 and 2 receptors were investigated by single immunostaining and western blot analysis. The co-localization of vasoactive intestinal peptide and orexin 1 receptor in the enteric nervous system was examined by double immunostaining. Also, orexin A concentration were measured in plasma samples to assess the possible diurnal variation of the plasma level of peptide in this species. Our results showed that the orexin system is widely distributed in bottlenose dolphin enteric nervous system of the all gastrointestinal tract examined. They are very peculiar and partially differs from that of terrestrial mammals. Orexin peptides and prepro-orexin were expressed in the main stomach, pyloric stomach and proximal intestine; while orexin receptors were expressed in the all examined tracts, with the exception of main stomach where found no evidence of orexin 2 receptor. Co-localization of vasoactive intestinal peptide and orexin 1 receptor were more evident in the pyloric stomach and proximal intestine. These data could suggest a possible role of orexin system on the contractility of bottlenose dolphin gastrointestinal districts. Finally, in agreement with several reports, bottlenose dolphin orexin A plasma level was higher in the morning during fasting. Our results emphasize some common features between bottlenose dolphin and terrestrial mammals. Certainly, further functional investigations may help to better explain the role of the orexin system in the energy balance of bottlenose dolphin and the complex interaction between feeding and digestive physiology.

  4. The orexin system in the enteric nervous system of the bottlenose dolphin (Tursiops truncatus).

    Science.gov (United States)

    Gatta, Claudia; Russo, Finizia; Russolillo, Maria Grazia; Varricchio, Ettore; Paolucci, Marina; Castaldo, Luciana; Lucini, Carla; de Girolamo, Paolo; Cozzi, Bruno; Maruccio, Lucianna

    2014-01-01

    This study provides a general approach to the presence and possible role of orexins and their receptors in the gut (three gastric chambers and intestine) of confined environment bottlenose dolphin. The expression of prepro-orexin, orexin A and B and orexin 1 and 2 receptors were investigated by single immunostaining and western blot analysis. The co-localization of vasoactive intestinal peptide and orexin 1 receptor in the enteric nervous system was examined by double immunostaining. Also, orexin A concentration were measured in plasma samples to assess the possible diurnal variation of the plasma level of peptide in this species. Our results showed that the orexin system is widely distributed in bottlenose dolphin enteric nervous system of the all gastrointestinal tract examined. They are very peculiar and partially differs from that of terrestrial mammals. Orexin peptides and prepro-orexin were expressed in the main stomach, pyloric stomach and proximal intestine; while orexin receptors were expressed in the all examined tracts, with the exception of main stomach where found no evidence of orexin 2 receptor. Co-localization of vasoactive intestinal peptide and orexin 1 receptor were more evident in the pyloric stomach and proximal intestine. These data could suggest a possible role of orexin system on the contractility of bottlenose dolphin gastrointestinal districts. Finally, in agreement with several reports, bottlenose dolphin orexin A plasma level was higher in the morning during fasting. Our results emphasize some common features between bottlenose dolphin and terrestrial mammals. Certainly, further functional investigations may help to better explain the role of the orexin system in the energy balance of bottlenose dolphin and the complex interaction between feeding and digestive physiology.

  5. Acoustic behavior associated with cooperative task success in bottlenose dolphins (Tursiops truncatus).

    Science.gov (United States)

    Eskelinen, Holli C; Winship, Kelley A; Jones, Brittany L; Ames, Audra E M; Kuczaj, Stan A

    2016-07-01

    Although many species have proven capable of cooperating to achieve common goals, the role of communication in cooperation has received relatively little attention. Analysis of communication between partners is vital in determining whether actions are truly cooperative rather than serendipitous or learned via trial and error (Chalmeau and Gallo in Behav Process 35:101-111, 1996a. doi: 10.1016/0376-6357(95)00049-6 , Primates 37:39-47, 1996b. doi: 10.1007/BF02382918 ). Wild cetaceans often produce sounds during cooperative foraging, playing, and mating, but the role of these sounds in cooperative events is largely unknown. Here, we investigated acoustic communication between two male bottlenose dolphins while they cooperatively opened a container (Kuczaj et al. in Anim Cogn 18:543-550, 2015b. doi: 10.1007/s10071-014-0822-4 ). Analyses of whistles, burst pulses, and bi-phonations that occurred during four contexts (i.e., no container, no animals interacting with container, one animal interacting with container, and two animals interacting with container) revealed that overall sound production rate significantly increased during container interactions. Sound production rates were also significantly higher during cooperative successes than solo successes, suggesting that the coordination of efforts rather than the apparatus itself was responsible for the phonation increase. The most common sound type during cooperative successes was burst pulse signals, similar to past recordings of cooperative events in bottlenose dolphins (Bastian in Animal sonar systems. Laboratoire de Physiologie Acoustique, Jouy-en Josas, pp 803-873, 1967; Connor and Smolker 1996).

  6. Relaxin as a hormonal aid to evaluate pregnancy and pregnancy loss in bottlenose dolphins (Tursiops truncatus).

    Science.gov (United States)

    Bergfelt, Don R; Blum, Jason L; Steinetz, Bernard G; Steinman, Karen J; O'Brien, Justin K; Robeck, Todd R

    2017-02-01

    This study was conducted to critically evaluate weekly and monthly circulating concentrations of immunoreactive relaxin throughout pregnancies that resulted in live births, stillbirths, and abortions in aquarium-based bottlenose dolphins. A relaxin RIA was used to analyze serum collected during 74 pregnancies involving 41 dolphins and 8 estrous cycles as well as 8 non-pregnant dolphins. Pregnancies resulted in live births (n=60), stillbirths (n=7), or abortions (n=7). Relative to parturition (Month 0), monthly changes (Pdolphins (status-by-week interaction, P=0.59). Status-by-month interaction (Pdolphins with live births, stillbirths, and abortions except concentrations were lower (Pdolphins with stillbirths but not in dolphins with abortions. In conclusion, this study provided new information on the pregnancy-specific nature of relaxin, critical evaluation of the fundamental characteristics of relaxin during pregnancy and pregnancy loss, and clarification on the strengths and limitations of relaxin as a diagnostic aid to determine pregnancy status and assess maternal-fetal health in bottlenose dolphins. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. The environment as a driver of immune and endocrine responses in dolphins (Tursiops truncatus).

    Science.gov (United States)

    Fair, Patricia A; Schaefer, Adam M; Houser, Dorian S; Bossart, Gregory D; Romano, Tracy A; Champagne, Cory D; Stott, Jeffrey L; Rice, Charles D; White, Natasha; Reif, John S

    2017-01-01

    Immune and endocrine responses play a critical role in allowing animals to adjust to environmental perturbations. We measured immune and endocrine related markers in multiple samples from individuals from two managed-care care dolphin groups (n = 82 samples from 17 dolphins and single samples collected from two wild dolphin populations: Indian River Lagoon, (IRL) FL (n = 26); and Charleston, (CHS) SC (n = 19). The immune systems of wild dolphins were more upregulated than those of managed-care-dolphins as shown by higher concentrations of IgG and increases in lysozyme, NK cell function, pathogen antibody titers and leukocyte cytokine transcript levels. Collectively, managed-care care dolphins had significantly lower levels of transcripts encoding pro-inflammatory cytokine TNF, anti-viral MX1 and INFα and regulatory IL-10. IL-2Rα and CD69, markers of lymphocyte activation, were both lower in managed-care care dolphins. IL-4, a cytokine associated with TH2 activity, was lower in managed-care care dolphins compared to the free-ranging dolphins. Differences in immune parameters appear to reflect the environmental conditions under which these four dolphin populations live which vary widely in temperature, nutrition, veterinary care, pathogen/contaminant exposures, etc. Many of the differences found were consistent with reduced pathogenic antigenic stimulation in managed-care care dolphins compared to wild dolphins. Managed-care care dolphins had relatively low TH2 lymphocyte activity and fewer circulating eosinophils compared to wild dolphins. Both of these immunologic parameters are associated with exposure to helminth parasites which is uncommon in managed-care care dolphins. Less consistent trends were observed in a suite of hormones but significant differences were found for cortisol, ACTH, total T4, free T3, and epinephrine. While the underlying mechanisms are likely multiple and complex, the marked differences observed in the immune and endocrine systems of wild and managed-care care dolphins appear to be shaped by their environment.

  8. Determining the Molecular and Genetic Basis for Diabetes in Navy Bottlenose Dolphins (Tursiops truncatus)

    Science.gov (United States)

    2015-01-12

    compared to those from humans, mice, and rats. Targeted binding sites, including TATA boxes, included those for the transcription factors, forkhead box 01...CCTACTGATGATGCACCTTTGATCAATAGATTTTAGACAAAAGTGTTTTTTTGAGTCCAA ******* ******************** ************ * * ***** ******** TATA Box AGATCAGGGCTGGGTTGACCTGAATACTGGATACAGGGCA

  9. The locus coeruleus complex of the bottlenose dolphin (Tursiops truncatus) as revealed by tyrosine hydroxylase immunohistochemistry.

    Science.gov (United States)

    Manger, Paul R; Ridgway, Sam H; Siegel, Jerome M

    2003-06-01

    Using tyrosine hydroxylase immunohistochemistry we examined the structure of the pontine, or rostral rhombencephalic, catecholaminergic cells groups, which may be collectively termed the locus coeruleus complex (LC), in the bottlenose dolphin. The present study is the first to describe the LC in a cetacean species and, at 1.3 kg, represents the largest non-human brain to date in which the LC has been investigated. We identified four catecholaminergic cell groups in the dorsal pontine tegementum and peri-aqueductal gray matter: A6 dorsal (locus coeruleus), A6 ventral (locus coeruleus alpha), A7 (subcoeruleus), and A5 (fifth arcuate nucleus). No patterns of cellular distribution, nuclear subdivision, or cellular morphology indicate specialization of the LC, which might have been anticipated because of the large absolute brain size and unihemispheric sleep phenomenology of cetaceans.

  10. Nocturnal Vocal Activity in Captive Bottlenose Dolphins (Tursiops truncatus): Could Dolphins have Presleep Choruses?

    OpenAIRE

    Kremers, Dorothee; Briseño Jaramillo, Margarita; Böye, Martin; Lemasson, Alban; Hausberger, Martine

    2014-01-01

    Lemasson & Hausberger : Equal contribution; International audience; Nocturnal vocal activity in dolphins is often thought to be associated with feeding activity. However, when no food resources are available dolphins spend their time for the most part resting/sleeping. While unihemispherically sleeping, dolphins mostly swim slowly and synchronously in close proximity with one or more other individuals. Although vocal activity is lower during resting/sleeping, dolphins are not entirely silent ...

  11. Auditory masking patterns in bottlenose dolphins (Tursiops truncatus) with natural, anthropogenic, and synthesized noise.

    Science.gov (United States)

    Branstetter, Brian K; Trickey, Jennifer S; Bakhtiari, Kimberly; Black, Amy; Aihara, Hitomi; Finneran, James J

    2013-03-01

    Auditory masking occurs when one sound (usually called noise) interferes with the detection, discrimination, or recognition of another sound (usually called the signal). This interference can lead to detriments in a listener's ability to communicate, forage, and navigate. Most studies of auditory masking in marine mammals have been limited to detection thresholds of pure tones in Gaussian noise. Environmental noise marine mammals encounter is often more complex. In the current study, detection thresholds were estimated for bottlenose dolphins with a 10 kHz signal masked by natural, anthropogenic, and synthesized noise. Using a band-widening paradigm, detection thresholds exhibited a pattern where signal thresholds increased proportionally to bandwidth for narrow band noise. However, when noise bandwidth was greater than a critical band, masking patterns diverged. Subsequent experiments demonstrated that the auditory mechanisms responsible for the divergent masking patterns were related to across-channel comparison and within-valley listening.

  12. Food-related bray calls in wild bottlenose dolphins (Tursiops truncatus).

    Science.gov (United States)

    Janik, V M

    2000-01-01

    Because cetaceans are difficult to study in the wild, little is known about how they use their sounds in their natural environment. Only the recent development of passive acoustic localization systems has enabled observations of the communication behaviour of individuals for correlation with their surface behaviour. Using such a system, I show that bottlenose dolphins in the Moray Firth, Scotland, produce low-frequency bray calls which are clearly correlated with feeding on salmonids. The production of these calls is followed by fast approaches by conspecifics in the area. In animals which use sound as a foraging tool, it is difficult to distinguish between food calls which have evolved because of their role in attracting conspecifics, and food manipulation or searching calls which may attract conspecifics as a by-product. However, the low-frequency structure of the bottlenose dolphin bray suggests that it evolved because of a role in manipulating prey rather than in attracting conspecifics. This conclusion suggests that dolphins exploit the perceptual systems of their prey to facilitate capture. PMID:10853736

  13. Hearing Mechanisms and Noise Metrics Related to Auditory Masking in Bottlenose Dolphins (Tursiops truncatus).

    Science.gov (United States)

    Branstetter, Brian K; Bakhtiari, Kimberly L; Trickey, Jennifer S; Finneran, James J

    2016-01-01

    Odontocete cetaceans are acoustic specialists that depend on sound to hunt, forage, navigate, detect predators, and communicate. Auditory masking from natural and anthropogenic sound sources may adversely affect these fitness-related capabilities. The ability to detect a tone in a broad range of natural, anthropogenic, and synthesized noise was tested with bottlenose dolphins using a psychophysical, band-widening procedure. Diverging masking patterns were found for noise bandwidths greater than the width of an auditory filter. Despite different noise types having equal-pressure spectral-density levels (95 dB re 1 μPa(2)/Hz), masked detection threshold differences were as large as 22 dB. Consecutive experiments indicated that noise types with increased levels of amplitude modulation resulted in comodulation masking release due to within-channel and across-channel auditory mechanisms. The degree to which noise types were comodulated (comodulation index) was assessed by calculating the magnitude-squared coherence between the temporal envelope from an auditory filter centered on the signal and temporal envelopes from flanking filters. Statistical models indicate that masked thresholds in a variety of noise types, at a variety of levels, can be explained with metrics related to the comodulation index in addition to the pressure spectral-density level of noise. This study suggests that predicting auditory masking from ocean noise sources depends on both spectral and temporal properties of the noise.

  14. Immunotoxicity of Silver Nanoparticles (AgNPs) on the Leukocytes of Common Bottlenose Dolphins (Tursiops truncatus).

    Science.gov (United States)

    Li, Wen-Ta; Chang, Hui-Wen; Yang, Wei-Cheng; Lo, Chieh; Wang, Lei-Ya; Pang, Victor Fei; Chen, Meng-Hsien; Jeng, Chian-Ren

    2018-04-04

    Silver nanoparticles (AgNPs) have been extensively used and are considered as an emerging contaminant in the ocean. The environmental contamination of AgNPs is expected to increase greatly over time, and cetaceans, as the top ocean predators, will suffer the negative impacts of AgNPs. In the present study, we investigate the immunotoxicity of AgNPs on the leukocytes of cetaceans using several methods, including cytomorphology, cytotoxicity, and functional activity assays. The results reveal that 20 nm Citrate-AgNPs (C-AgNP 20 ) induce different cytomorphological alterations and intracellular distributions in cetacean polymorphonuclear cells (cPMNs) and peripheral blood mononuclear cells (cPBMCs). At high concentrations of C-AgNP 20 (10 and 50 μg/ml), the time- and dose-dependent cytotoxicity in cPMNs and cPBMCs involving apoptosis is demonstrated. C-AgNP 20 at sub-lethal doses (0.1 and 1 μg/ml) negatively affect the functional activities of cPMNs (phagocytosis and respiratory burst) and cPBMCs (proliferative activity). The current study presents the first evidence of the cytotoxicity and immunotoxicity of AgNPs on the leukocytes of cetaceans and improves our understanding of environmental safety concerning AgNPs. The dose-response data of AgNPs on the leukocytes of cetaceans are invaluable for evaluating the adverse health effects in cetaceans and for proposing a conservation plan for marine mammals.

  15. Novel adenovirus detected in captive bottlenose dolphins (Tursiops truncatus) suffering from self-limiting gastroenteritis.

    Science.gov (United States)

    Rubio-Guerri, Consuelo; García-Párraga, Daniel; Nieto-Pelegrín, Elvira; Melero, Mar; Álvaro, Teresa; Valls, Mónica; Crespo, Jose Luis; Sánchez-Vizcaíno, Jose Manuel

    2015-03-07

    Adenoviruses are common pathogens in vertebrates, including humans. In marine mammals, adenovirus has been associated with fatal hepatitis in sea lions. However, only in rare cases have adenoviruses been detected in cetaceans, where no clear correlation was found between presence of the virus and disease status. A novel adenovirus was identified in four captive bottlenose dolphins with self-limiting gastroenteritis. Viral detection and identification were achieved by: PCR-amplification from fecal samples; sequencing of partial adenovirus polymerase (pol) and hexon genes; producing the virus in HeLa cells, with PCR and immunofluorescence detection, and with sequencing of the amplified pol and hexon gene fragments. A causative role of this adenovirus for gastroenteritis was suggested by: 1) we failed to identify other potential etiological agents; 2) the exclusive detection of this novel adenovirus and of seropositivity for canine adenoviruses 1 and 2 in the four sick dolphins, but not in 10 healthy individuals of the same captive population; and 3) the virus disappeared from feces after clinical signs receded. The partial sequences of the amplified fragments of the pol and hexon genes were closest to those of adenoviruses identified in sea lions with fatal adenoviral hepatitis, and to a Genbank-deposited sequence obtained from a harbour porpoise. These data suggest that adenovirus can cause self-limiting gastroenteritis in dolphins. This adenoviral infection can be detected by serology and by PCR detection in fecal material. Lack of signs of hepatitis in sick dolphins may reflect restricted tissue tropism or virulence of this adenovirus compared to those of the adenovirus identified in sea lions. Gene sequence-based phylogenetic analysis supports a common origin of adenoviruses that affect sea mammals. Our findings suggest the need for vigilance against adenoviruses in captive and wild dolphin populations.

  16. influence of simultaneous infestations of prostephanus truncatus ...

    African Journals Online (AJOL)

    significant differences in the percentage change of adult insect numbers between single and simultaneous infestations at P< 0.01. Further, the grain ... complete development over a wide range of temperatures, 270C to 320C and between ... Aging, sexing and conditioning P. truncatus and S. zeamais. Adults were removed ...

  17. Genetic isolation between coastal and fishery-impacted, offshore bottlenose dolphin (Tursiops spp.) populations.

    Science.gov (United States)

    Allen, Simon J; Bryant, Kate A; Kraus, Robert H S; Loneragan, Neil R; Kopps, Anna M; Brown, Alexander M; Gerber, Livia; Krützen, Michael

    2016-06-01

    The identification of species and population boundaries is important in both evolutionary and conservation biology. In recent years, new population genetic and computational methods for estimating population parameters and testing hypotheses in a quantitative manner have emerged. Using a Bayesian framework and a quantitative model-testing approach, we evaluated the species status and genetic connectedness of bottlenose dolphin (Tursiops spp.) populations off remote northwestern Australia, with a focus on pelagic 'offshore' dolphins subject to incidental capture in a trawl fishery. We analysed 71 dolphin samples from three sites beyond the 50 m depth contour (the inshore boundary of the fishery) and up to 170 km offshore, including incidentally caught and free-ranging individuals associating with trawl vessels, and 273 dolphins sampled at 12 coastal sites inshore of the 50 m depth contour and within 10 km of the coast. Results from 19 nuclear microsatellite markers showed significant population structure between dolphins from within the fishery and coastal sites, but also among dolphins from coastal sites, identifying three coastal populations. Moreover, we found no current or historic gene flow into the offshore population in the region of the fishery, indicating a complete lack of recruitment from coastal sites. Mitochondrial DNA corroborated our findings of genetic isolation between dolphins from the offshore population and coastal sites. Most offshore individuals formed a monophyletic clade with common bottlenose dolphins (T. truncatus), while all 273 individuals sampled coastally formed a well-supported clade of Indo-Pacific bottlenose dolphins (T. aduncus). By including a quantitative modelling approach, our study explicitly took evolutionary processes into account for informing the conservation and management of protected species. As such, it may serve as a template for other, similarly inaccessible study populations. © 2016 John Wiley & Sons Ltd.

  18. Gotta Go, Mom’s Calling: Dolphin (Tursiops truncatus Mothers Use Individually Distinctive Acoustic Signals To Call Their Calves

    Directory of Open Access Journals (Sweden)

    Stan A. Kuczaj II

    2015-02-01

    Full Text Available Dolphin calves often wander away from their mothers, which can compromise their safety and survival. Mothers can retrieve their calves by actively pursuing them or by signaling their wandering calves to return. However, little is known about the retrieval techniques employed by mothers in specific calf recall contexts. We experimentally investigated maternal calf retrieval methods by assessing behavioral and acoustic strategies employed by three Atlantic bottlenose dolphin mothers to elicit their calf’s return in a controlled, non-threatening setting. Three mothers were asked to retrieve their calves on cue in this setting, and could do so however they chose. Mothers were much more likely to use energetically less costly acoustic signals than physical retrievals. Each mother produced individually distinctive calls that incorporated the mother’s signature whistle but often also involved additional whistles and clicks. The dolphin mothers’ use of individually distinctive calls to request a calf’s return is consistent with the notion that other dolphins can distinguish such calls and provides additional support for the notion that dolphin communication is flexible rather than fixed.

  19. Gotta Go, Mom’s Calling: Dolphin (Tursiops truncatus) Mothers Use Individually Distinctive Acoustic Signals To Call Their Calves

    OpenAIRE

    Stan A. Kuczaj II; Holli C. Eskelinen; Brittany L. Jones; Jill L. Borger-Turner

    2015-01-01

    Dolphin calves often wander away from their mothers, which can compromise their safety and survival. Mothers can retrieve their calves by actively pursuing them or by signaling their wandering calves to return. However, little is known about the retrieval techniques employed by mothers in specific calf recall contexts. We experimentally investigated maternal calf retrieval methods by assessing behavioral and acoustic strategies employed by three Atlantic bottlenose dolphin mothers to elicit t...

  20. Estimates of DNA strand breakage in bottlenose dolphin (Tursiops truncatus leukocytes measured with the Comet and DNA diffusion assays

    Directory of Open Access Journals (Sweden)

    Adriana Díaz

    2009-01-01

    Full Text Available The analysis of DNA damage by mean of Comet or single cell gel electrophoresis (SCGE assay has been commonly used to assess genotoxic impact in aquatic animals being able to detect exposure to low concentrations of contaminants in a wide range of species. The aims of this work were 1 to evaluate the usefulness of the Comet to detect DNA strand breakage in dolphin leukocytes, 2 to use the DNA diffusion assay to determine the amount of DNA strand breakage associated with apoptosis or necrosis, and 3 to determine the proportion of DNA strand breakage that was unrelated to apoptosis and necrosis. Significant intra-individual variation was observed in all of the estimates of DNA damage. DNA strand breakage was overestimated because a considerable amount (~29% of the DNA damage was derived from apoptosis and necrosis. The remaining DNA damage in dolphin leukocytes was caused by factors unrelated to apoptosis and necrosis. These results indicate that the DNA diffusion assay is a complementary tool that can be used together with the Comet assay to assess DNA damage in bottlenose dolphins.

  1. Vascularization of air sinuses and fat bodies in the head of the Bottlenose dolphin (Tursiops truncatus: morphological implications on physiology

    Directory of Open Access Journals (Sweden)

    Alex eCostidis

    2012-07-01

    Full Text Available AbstractCetaceans have long been considered capable of limiting diving-induced nitrogen absorption and subsequent decompression sickness through a series of behavioral, anatomical, and physiological adaptations. Recent studies however suggest that in some situations these adaptive mechanisms might be overcome, resulting in lethal and sublethal injuries. Perhaps most relevant to this discussion is the finding of intravascular gas and fat emboli in mass-stranded beaked whales. Although the source of the gas emboli has as yet to been ascertained, preliminary findings suggest nitrogen is the primary component. Since nitrogen gas embolus formation in divers is linked to nitrogen saturation, it seems premature to dismiss similar pathogenic mechanisms in breath-hold diving cetaceans. Due to the various anatomical adaptations in cetacean lungs, the pulmonary system is thought of as an unlikely site of significant nitrogen absorption. The accessory sinus system on the ventral head of odontocete cetaceans contains a sizeable volume of air that is exposed to the changing hydrostatic pressures during a dive, and is intimately associated with vasculature potentially capable of absorbing nitrogen through its walls. The source of the fat emboli has also remained elusive. Most mammalian fat deposits are considered poorly-vascularized and therefore unlikely sites of intravascular introduction of lipid, although cetacean blubber may not be as poorly vascularized as previously thought. We present new data on the vasculature of air sinuses and acoustic fat bodies in the head of bottlenose dolphins and compare it to published accounts. We show that the mandibular fat bodies and accessory sinus system are associated with extensive venous plexuses and suggest potential physiological and pathological implications.

  2. The bottlenose dolphin Tursiops truncatus foraging around a fish farm: Effects of prey abundance on dolphins’ behavior

    Directory of Open Access Journals (Sweden)

    Bruno Díaz LÓPEZ

    2009-08-01

    Full Text Available The extent to which prey abundance influences both bottlenose dolphin foraging behavior and group size in the presence of human activities has not previously been studied. The primary aim of this study was to identify and quantify how wild bottlenose dolphins respond, individually and as groups, to the relative abundance of prey around a fish farm. Detailed views of dolphins’ behavior were obtained by focal following individual animals whilst simultaneously collecting surface and underwater behavioral data. A total of 2150 dive intervals were analyzed, corresponding to 342 focal samples, lasting over 34 hours. Bottlenose dolphins remained submerged for a mean duration of 46.4 seconds and a maximum of 249 seconds. This study provides the first quantified data on bottlenose dolphin diving behavior in a marine fin-fish farm area. This study’s results indicate that within a fish farm area used intensively by bottlenose dolphins for feeding, dolphins did not modify dive duration. Additionally, underwater observations confirmed that dolphins find it easier to exploit a concentrated food source and it appears that hunting tactic and not group size plays an important role during feeding activities. Thus, bottlenose dolphins appear capable of modifying their hunting tactics according to the abundance of prey. When top predators display behavioral responses to activities not directed at them, the task of studying all possible effects of human activities can become even more challenging [Current Zoology 55(4: 243–248, 2009].

  3. Development and evaluation of deep intra-uterine artificial insemination using cryopreserved sexed spermatozoa in bottlenose dolphins (Tursiops truncatus).

    Science.gov (United States)

    Robeck, Todd R; Montano, G A; Steinman, K J; Smolensky, P; Sweeney, J; Osborn, S; O'Brien, J K

    2013-06-01

    Since its development in bottlenose dolphins, widespread application of AI with sex-selected, frozen-thawed (FT) spermatozoa has been limited by the significant expense of the sorting process. Reducing the total number of progressively motile sperm (PMS) required for an AI would reduce the sorting cost. As such, this research compared the efficacy of small-dose deep uterine AI with sexed FT spermatozoa (SEXED-SMALL; ~50×10(6)PMS, n=20), to a moderate dose deposited mid-horn (SEXED-STD, ~200×10(6)PMS; n=20), and a large dose of FT non-sexed spermatozoa deposited in the uterine body (NONSEXED-LARGE, 660×10(6)PMS, n=9). Ten of the 11 calves resulting from use of sexed spermatozoa were of the predetermined sex. Similar rates of conception (NONSEXED-LARGE: 78%, SEXED-STD: 60%, SEXED-SMALL: 57%) and total pregnancy loss (TPL: NONSEXED-LARGE: 28.6%; SEXED-STD: 41.0%; SEXED-SMALL: 63.6%) were observed across groups, but early pregnancy loss (EPL,

  4. Complete mitochondrial DNA genome of Pseudobagrus truncatus (Siluriformes: Bagridae).

    Science.gov (United States)

    Liang, Hong-wei; Meng, Yan; Li, Zhong; Zhang, Yan; Zou, Gui-wei

    2014-06-01

    In this study, the complete mitochondrial DNA (mtDNA) sequence of Pseudobagrus truncatus (Siluriformes: Bagridae) was determined. The complete mtDNA genome sequence of P. truncatus is 16,533 bp in size. It consists of 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes and one non-coding control region. The gene order and genes were the same as that found in other previously reported catfishes. The overall-based composition was 31.6% A, 26.7% T, 14.9% G and 26.8% C, with a high A + T content (58.3%). This complete mitogenome of P. truncatus provides a basic data for studies on species identification, molecular systematics and conservation genetics.

  5. Molluscicidal Effects of Talinum triangulare on Bulinus truncatus.

    African Journals Online (AJOL)

    Ogo Okeke

    definitive host, acquires infection by contact with freshwater infested with schistosome cercariae, which actively penetrate .... environment whose conditions threaten their survival. Interestingly, it was ... other biota in the freshwater ecosystem where B. truncatus is found and if not harmful to non target animals, be integrated ...

  6. Miracidial infectivity of snail host ( Bulinus truncatus ) in the laboratory

    African Journals Online (AJOL)

    Miracidial infectivity rate of snail Bulinus truncatus collected from Agulu Lake was studied in the laboratory. The snails were maintained in the laboratory and eggs deposited were allowed to hatch and dates noted until snails of different ages were produced. These snails were consequently exposed to miracidia hatched ...

  7. Current status of the larger grain borer, Prostephanus truncatus ...

    African Journals Online (AJOL)

    The study investigated the current distribution of the larger grain borer (LGB), Prostephanus truncatus, in five states of South-western Nigeria; Ogun, Oyo, Lagos, Ondo and Osun by visual observation of maize stored in cribs and using the synthetic aggregation pheromone of LGB as baits in survey traps for twenty days.

  8. Comportamientos conspicuos de Dendrobates truncatus (Cope, 1861) en cautiverio

    OpenAIRE

    DE LA OSSA, J., CONTRERAS-GUTIÉRREZ, J., CAMPILLO-CASTRO, J.

    2012-01-01

    El presente trabajo evaluó los despliegues de comportamientos más notorios que presenta Dendrobates truncatus (Cope, 1861) en cautiverio. Como comportamientos conspicuos por la frecuencia y duración de los mismos se tienen: refugio (39,9%), asoleado (22,8%) y quietud (20,9%), despliegues caracterizados por inmovilidad. Se plantea que existe una fidelidad de sitio, que no tiene que ver con comportamiento sexual ni con defensa territorial, como sucede en medio natural, que se relaciona con las ...

  9. Advies over de kans op vestiging van Dendrobates truncatus in Vlaanderen

    OpenAIRE

    Adriaens, Tim; Speybroeck, Jeroen

    2016-01-01

    De beheerders van de Plantentuin Meise willen in hun tropische serres een pijlgifkikker (Dendrobates truncatus) inzetten voor biologische bestrijding. Omdat er steeds een kans bestaat dat deze uitheemse dieren ontsnappen, verplicht het Soortenbesluit om een impactonderzoek uit te voeren. In dit advies gaat het INBO na of er een kans bestaat dat bij een eventuele ontsnapping zich een populatie Dendrobates truncatus kan vestigen in Vlaanderen. De beheerders van de Plantentuin Meise willen in...

  10. Comportamientos conspicuos de Dendrobates truncatus (Cope, 1861 en cautiverio

    Directory of Open Access Journals (Sweden)

    DE LA OSSA, J., CONTRERAS-GUTIÉRREZ, J., CAMPILLO-CASTRO, J.

    2012-01-01

    Full Text Available El presente trabajo evaluó los despliegues de comportamientos más notorios que presenta Dendrobates truncatus (Cope, 1861 en cautiverio. Como comportamientos conspicuos por la frecuencia y duración de los mismos se tienen: refugio (39,9%, asoleado (22,8% y quietud (20,9%, despliegues caracterizados por inmovilidad. Se plantea que existe una fidelidad de sitio, que no tiene que ver con comportamiento sexual ni con defensa territorial, como sucede en medio natural, que se relaciona con las condiciones de hábitat y se demuestra que aspectos etológicos como refugio y quietud, que no se reportan de forma concisa para medio natural, son parte importante del repertorio conductual de esta especie bajo condiciones restrictivas de hábitat.

  11. African Journal of Marine Science - Vol 38, No 2 (2016)

    African Journals Online (AJOL)

    Bottlenose dolphin Tursiops truncatus group dynamics, site fidelity, residency and movement patterns in the Madeira Archipelago (North-East Atlantic) · EMAIL FULL TEXT EMAIL FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. A Dinis, F Alves, C Nicolau, C Ribeiro, M Kaufmann, A Cañadas, L Freitas, 151- ...

  12. Author Details

    African Journals Online (AJOL)

    Ribeiro, C. Vol 38, No 2 (2016) - Articles Bottlenose dolphin Tursiops truncatus group dynamics, site fidelity, residency and movement patterns in the Madeira Archipelago (North-East Atlantic) Abstract. ISSN: 1814-232X. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's ...

  13. Author Details

    African Journals Online (AJOL)

    Cañadas, A. Vol 38, No 2 (2016) - Articles Bottlenose dolphin Tursiops truncatus group dynamics, site fidelity, residency and movement patterns in the Madeira Archipelago (North-East Atlantic) Abstract. ISSN: 1814-232X. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors ...

  14. Platelet-rich plasma and adipose-derived mesenchymal stem cells for regenerative medicine-associated treatments in bottlenose dolphins (Tursiops truncatus.

    Directory of Open Access Journals (Sweden)

    Richard J Griffeth

    Full Text Available Dolphins exhibit an extraordinary capacity to heal deep soft tissue injuries. Nevertheless, accelerated wound healing in wild or captive dolphins would minimize infection and other side effects associated with open wounds in marine animals. Here, we propose the use of a biological-based therapy for wound healing in dolphins by the application of platelet-rich plasma (PRP. Blood samples were collected from 9 different dolphins and a specific and simple protocol which concentrates platelets greater than two times that of whole blood was developed. As opposed to a commonly employed human protocol for PRP preparation, a single centrifugation for 3 minutes at 900 rpm resulted in the best condition for the concentration of dolphin platelets. By FACS analysis, dolphin platelets showed reactivity to platelet cell-surface marker CD41. Analysis by electron microscopy revealed that dolphin platelets were larger in size than human platelets. These findings may explain the need to reduce the duration and speed of centrifugation of whole blood from dolphins to obtain a 2-fold increase and maintain proper morphology of the platelets. For the first time, levels of several growth factors from activated dolphin platelets were quantified. Compared to humans, concentrations of PDGF-BB were not different, while TGFβ and VEGF-A were significantly lower in dolphins. Additionally, adipose tissue was obtained from cadaveric dolphins found along the Spanish Mediterranean coast, and adipose-derived mesenchymal stem cells (ASCs were successfully isolated, amplified, and characterized. When dolphin ASCs were treated with 2.5 or 5% dolphin PRP they exhibited significant increased proliferation and improved phagocytotic activity, indicating that in culture, PRP may improve the regenerative capacity of ASCs. Taken together, we show an effective and well-defined protocol for efficient PRP isolation. This protocol alone or in combination with ASCs, may constitute the basis of a biological treatment for wound-healing and tissue regeneration in dolphins.

  15. Gene expression changes in bottlenose dolphin, Tursiops truncatus, skin cells following exposure to methylmercury (MeHg) or perfluorooctane sulfonate (PFOS)

    International Nuclear Information System (INIS)

    Mollenhauer, Meagan A.M.; Carter, Barbara J.; Peden-Adams, Margie M.; Bossart, Gregory D.; Fair, Patricia A.

    2009-01-01

    Methylmercury (MeHg) and perfluorooctane sulfonate (PFOS) bioaccumulate and biomagnify in the environment and increasing concentrations of these pollutants have been found in wildlife and humans. Both chemicals are worldwide contaminants with wide ranging biological effects and have been identified in relatively high concentrations in apex level marine mammals such as bottlenose dolphins. The primary objective of this study was to determine if exposure to MeHg or PFOS would alter the gene expression in primary bottlenose dolphin epidermal cell cultures. Primary skin cells were isolated and cultured from skin samples collected from wild bottlenose dolphins. The cells were subsequently exposed to 13 ppm PFOS or 1 ppm MeHg and changes in gene expression were analyzed by suppressive subtractive hybridization (SSH) and quantitative real-time PCR (QPCR). 116 genes were positively identified in the dolphin skin cells by SSH. Of these, 16 total genes were analyzed by QPCR (9 and 11 genes following PFOS or MeHg exposure, respectively, with four overlapping genes). Results indicate MeHg significantly alters gene expression patterns following 24 h exposure, but has no measurable effect after only 1 h. PFOS exposure, however, caused significant alterations following both 1 and 25 h. Overall, the changes in gene expression observed indicate these concentrations of MeHg and PFOS significantly alter normal gene expression patterns. The changes in gene expression following exposure to these contaminants not only indicate a cellular stress response, but also decreased cell cycle progression and cellular proliferation and reduced protein translation. Alterations in normal cellular biology, like those observed, may lead to changes in health in marine mammals exposed to contaminants; however, this warrants further investigation

  16. The Bottlenose Dolphin (Tursiops truncatus) as a Model to Understand Variation in Stress and Reproductive Hormones Measures in Relation to Sampling Matrix, Demographics, and Environmental Factors

    Science.gov (United States)

    2014-09-30

    progesterone) have been routinely measured in blood serum as part of the health assessment, which also includes a complete physical examination...sampling generally limit its utility to investigations of coastal cetaceans, remote biopsy has the potential to be a powerful tool for investigations...remote biopsy samples have been collected across 4 seasons in estuarine and coastal waters near Charleston, South Carolina, and across 2 seasons in

  17. Real-time PCR assays for detection of Brucella spp. and the identification of genotype ST27 in bottlenose dolphins (Tursiops truncatus).

    Science.gov (United States)

    Wu, Qingzhong; McFee, Wayne E; Goldstein, Tracey; Tiller, Rebekah V; Schwacke, Lori

    2014-05-01

    Rapid detection of Brucella spp. in marine mammals is challenging. Microbiologic culture is used for definitive diagnosis of brucellosis, but is time consuming, has low sensitivity and can be hazardous to laboratory personnel. Serological methods can aid in diagnosis, but may not differentiate prior exposure versus current active infection and may cross-react with unrelated Gram-negative bacteria. This study reports a real-time PCR assay for the detection of Brucella spp. and application to screen clinical samples from bottlenose dolphins stranded along the coast of South Carolina, USA. The assay was found to be 100% sensitive for the Brucella strains tested, and the limit of detection was 0.27fg of genomic DNA from Brucella ceti B1/94 per PCR volume. No amplification was detected for the non-Brucella pathogens tested. Brucella DNA was detected in 31% (55/178) of clinical samples tested. These studies indicate that the real-time PCR assay is highly sensitive and specific for the detection of Brucella spp. in bottlenose dolphins. We also developed a second real-time PCR assay for rapid identification of Brucella ST27, a genotype that is associated with human zoonotic infection. Positive results were obtained for Brucella strains which had been identified as ST27 by multilocus sequence typing. No amplification was found for other Brucella strains included in this study. ST27 was identified in 33% (18/54) of Brucella spp. DNA-positive clinical samples. To our knowledge, this is the first report on the use of a real-time PCR assay for identification of Brucella genotype ST27 in marine mammals. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Evaluation of motility, membrane status and DNA integrity of frozen-thawed bottlenose dolphin (Tursiops truncatus) spermatozoa after sex-sorting and recryopreservation.

    Science.gov (United States)

    Montano, G A; Kraemer, D C; Love, C C; Robeck, T R; O'Brien, J K

    2012-06-01

    Artificial insemination (AI) with sex-sorted frozen-thawed spermatozoa has led to enhanced management of ex situ bottlenose dolphin populations. Extended distance of animals from the sorting facility can be overcome by the use of frozen-thawed, sorted and recryopreserved spermatozoa. Although one bottlenose dolphin calf had been born using sexed frozen-thawed spermatozoa derived from frozen semen, a critical evaluation of in vitro sperm quality is needed to justify the routine use of such samples in AI programs. Sperm motility parameters and plasma membrane integrity were influenced by stage of the sex-sorting process, sperm type (non-sorted and sorted) and freezing method (straw and directional) (P0.05) at 24 h. The viability of sorted spermatozoa was higher (Pdolphin spermatozoa undergoing cryopreservation, sorting and recryopreservation are of adequate quality for use in AI.

  19. Population Structure of Island-Associated Dolphins: Evidence from Mitochondrial and Microsatellite Markers for Common Bottlenose Dolphins (Tursiops truncatus) Around the Main Hawaiian Islands

    Science.gov (United States)

    2011-01-01

    commercial and recreational fisheries, marine ecotourism , and boat traffic. If the animals being affected by these anthropogenic activities are...insular populations are exposed to greater vessel traffic, including that associated with ecotourism , and are thus more likely to suffer vessel strikes

  20. Abundance and Summer Distribution of a Local Stock of Black Sea Bottlenose Dolphins, Tursiops truncatus (Cetacea, Delphinidae, in Coastal Waters near Sudak (Ukraine, Crimea

    Directory of Open Access Journals (Sweden)

    Gladilina E. V.

    2016-02-01

    Full Text Available The first assessment of abundance of a local population of bottlenose dolphins in the Black Sea (near the Sudak coast in 2011–2012 has been conducted: the results of a mark-recapture study of photo identified animals were complemented by a vessel line transect survey. The overall abundance of a population was estimated at between 621 ± 198 and 715 ± 267 animals (Chapman and Petersen estimates, and the majority of members of the population were recorded in the surveyed area. The summer range covered the area of a few hundred square kilometers, similar to migrating coastal stocks in other world regions. The greatest density of distribution was observed in August in sea 45–60 m deep; in addition, frequent approaches to the coastline are usual for dolphins of this stock. These trends in distribution may be partly explained by distribution of prey. Interaction with sprat trawling fisheries can be a factor shaping the local population structure. Coastal waters of Sudak and adjoining sea areas are an important habitat for bottlenose dolphins in the northern Black Sea, significant for their conservation.

  1. Gene expression changes in bottlenose dolphin, Tursiops truncatus, skin cells following exposure to methylmercury (MeHg) or perfluorooctane sulfonate (PFOS)

    Energy Technology Data Exchange (ETDEWEB)

    Mollenhauer, Meagan A.M. [Department of Pediatrics, Medical University of South Carolina, Charleston, SC (United States); Department of Molecular and Cellular Biology and Pathobiology, Medical University of South Carolina, Charleston, SC (United States)], E-mail: willimea@musc.edu; Carter, Barbara J. [EcoArray, Inc., Gainesville, FL (United States); Peden-Adams, Margie M. [Department of Pediatrics, Medical University of South Carolina, Charleston, SC (United States); Department of Molecular and Cellular Biology and Pathobiology, Medical University of South Carolina, Charleston, SC (United States); Marine Biomedicine and Environmental Science Center, Medical University of South Carolina, Charleston, SC (United States); Mystic Aquarium and Institute for Exploration, Mystic, CT (United States); Bossart, Gregory D. [Harbor Branch Oceanographic Institution, Fort Pierce, FL (United States); Fair, Patricia A. [National Oceanic and Atmospheric Administration/National Ocean Service/Center for Coastal Environmental Health and Biomolecular Research, Charleston, SC (United States)

    2009-01-18

    Methylmercury (MeHg) and perfluorooctane sulfonate (PFOS) bioaccumulate and biomagnify in the environment and increasing concentrations of these pollutants have been found in wildlife and humans. Both chemicals are worldwide contaminants with wide ranging biological effects and have been identified in relatively high concentrations in apex level marine mammals such as bottlenose dolphins. The primary objective of this study was to determine if exposure to MeHg or PFOS would alter the gene expression in primary bottlenose dolphin epidermal cell cultures. Primary skin cells were isolated and cultured from skin samples collected from wild bottlenose dolphins. The cells were subsequently exposed to 13 ppm PFOS or 1 ppm MeHg and changes in gene expression were analyzed by suppressive subtractive hybridization (SSH) and quantitative real-time PCR (QPCR). 116 genes were positively identified in the dolphin skin cells by SSH. Of these, 16 total genes were analyzed by QPCR (9 and 11 genes following PFOS or MeHg exposure, respectively, with four overlapping genes). Results indicate MeHg significantly alters gene expression patterns following 24 h exposure, but has no measurable effect after only 1 h. PFOS exposure, however, caused significant alterations following both 1 and 25 h. Overall, the changes in gene expression observed indicate these concentrations of MeHg and PFOS significantly alter normal gene expression patterns. The changes in gene expression following exposure to these contaminants not only indicate a cellular stress response, but also decreased cell cycle progression and cellular proliferation and reduced protein translation. Alterations in normal cellular biology, like those observed, may lead to changes in health in marine mammals exposed to contaminants; however, this warrants further investigation.

  2. Development and testing of species-specific ELISA assays to measure IFN-gamma and TNF-alpha in bottlenose dolphins (Tursiops truncatus)

    Science.gov (United States)

    Monitoring the immune status of cetaceans is important for a variety of health conditions. Assays to quantify cytokines, especially pro-inflammatory cytokines, could be employed, in addition to currently available diagnostic assays, to screen for alterations in the health status of an animal. Thou...

  3. Phenotyping and comparing the immune cell populations of free-ranging Atlantic bottlenose dolphins (Tursiops truncatus) and dolphins under human care.

    Science.gov (United States)

    Nouri-Shirazi, Mahyar; Bible, Brittany F; Zeng, Menghua; Tamjidi, Saba; Bossart, Gregory D

    2017-03-27

    Studies suggest that free-ranging bottlenose dolphins exhibit a suppressed immune system because of exposure to contaminants or microorganisms. However, due to a lack of commercially available antibodies specific to marine mammal immune cell surface markers, the research has been indecisive. The purpose of this study was to identify cross-reactive terrestrial-specific antibodies in order to assess the changes in the immune cell populations of dolphins under human care and free-ranging dolphins. The blood and PBMC fraction of blood samples from human care and free-ranging dolphins were characterized by H&E staining of cytospin slides and flow cytometry using a panel of terrestrial-specific antibodies. In this study, we show that out of 65 terrestrial-specific antibodies tested, 11 were cross-reactive and identified dolphin immune cell populations within their peripheral blood. Using these antibodies, we found significant differences in the absolute number of cells expressing specific markers within their lymphocyte and monocyte fractions. Interestingly, the peripheral blood mononuclear cell profile of free-ranging dolphins retained an additional population of cells that divided them into two groups showing a low (56%) percentage of smaller cells resembling granulocytes. We found that the cross-reactive antibodies not only identified specific changes in the immune cells of free-ranging dolphins, but also opened the possibility to investigate the causal relationship between immunosuppression and mortality seen in free-ranging dolphins.

  4. Skin Transcriptomes of common bottlenose dolphins (Tursiops truncatus) from the northern Gulf of Mexico and southeastern U.S. Atlantic coasts.

    Science.gov (United States)

    Neely, Marion G; Morey, Jeanine S; Anderson, Paul; Balmer, Brian C; Ylitalo, Gina M; Zolman, Eric S; Speakman, Todd R; Sinclair, Carrie; Bachman, Melannie J; Huncik, Kevin; Kucklick, John; Rosel, Patricia E; Mullin, Keith D; Rowles, Teri K; Schwacke, Lori H; Van Dolah, Frances M

    2018-04-01

    Common bottlenose dolphins serve as sentinels for the health of their coastal environments as they are susceptible to health impacts from anthropogenic inputs through both direct exposure and food web magnification. Remote biopsy samples have been widely used to reveal contaminant burdens in free-ranging bottlenose dolphins, but do not address the health consequences of this exposure. To gain insight into whether remote biopsies can also identify health impacts associated with contaminant burdens, we employed RNA sequencing (RNA-seq) to interrogate the transcriptomes of remote skin biopsies from 116 bottlenose dolphins from the northern Gulf of Mexico and southeastern U.S. Atlantic coasts. Gene expression was analyzed using principal component analysis, differential expression testing, and gene co-expression networks, and the results correlated to season, location, and contaminant burden. Season had a significant impact, with over 60% of genes differentially expressed between spring/summer and winter months. Geographic location exhibited lesser effects on the transcriptome, with 23.5% of genes differentially expressed between the northern Gulf of Mexico and the southeastern U.S. Atlantic locations. Despite a large overlap between the seasonal and geographical gene sets, the pathways altered in the observed gene expression profiles were somewhat distinct. Co-regulated gene modules and differential expression analysis both identified epidermal development and cellular architecture pathways to be expressed at lower levels in animals from the northern Gulf of Mexico. Although contaminant burdens measured were not significantly different between regions, some correlation with contaminant loads in individuals was observed among co-expressed gene modules, but these did not include classical detoxification pathways. Instead, this study identified other, possibly downstream pathways, including those involved in cellular architecture, immune response, and oxidative stress, that may prove to be contaminant responsive markers in bottlenose dolphin skin. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  5. Effects of the cestode parasite, Cyathocephalus truncatus, on the fecundity and feeding rate of Gammarus pulex (Crustacea: Amphipoda).

    Science.gov (United States)

    Bollache, Loïc

    2016-01-01

    The amphipod Gammarus pulex is an intermediate host to the Cestode fish parasite Cyathocephalus truncatus. In this study, we investigate effect of parasitism on female fecundity and feeding rate and compare ours results to those obtained previously with acanthocephalan parasite. Similar reduction of the female fecundity was measured, whereas ours results on feeding rate were inconsistent, with a decrease of feeding rate induced by C. truncatus. The impacts of C. truncatus on G. pulex and similarities on the host infection effect between parasites from different phyla are discussed.

  6. New polymorphic tetranucleotide microsatellites improve scoring accuracy in the bottlenose dolphin Tursiops aduncus

    NARCIS (Netherlands)

    Nater, Alexander; Kopps, Anna M.; Kruetzen, Michael

    We isolated and characterized 19 novel tetranucleotide microsatellite markers in the Indo-Pacific bottlenose dolphin (Tursiops aduncus) in order to improve genotyping accuracy in applications like large-scale population-wide paternity and relatedness assessments. One hundred T. aduncus from Shark

  7. Feeding and growth in a captive-born bottlenose dolphin Tursiops ...

    African Journals Online (AJOL)

    The feeding and growth of a captive-born bottlenose dolphin Tursiops trunatus calf were studied for 30 months post partum. Changes in the behaviours associated with suckling were monitored and suggested that the mammary glands need tactile stimulation before the calf can feed. The calf exhibited no teat preference ...

  8. Estabilidad Proteolítica de Prostephanus truncatus (Horn (Coleoptera: Bostrichidae en México Estabilidad Proteolítica de Prostephanus truncatus (Horn (Coleoptera: Bostrichidae en México

    Directory of Open Access Journals (Sweden)

    M. Alvarado-Balleza

    2012-02-01

    Full Text Available Prostephanus truncatus (Horn (Coleoptera: Bostrichidae es un insecto plaga del maíz almacenado en México, América Central y parte de América del Sur. En el continente africano ha causado grandes pérdidas desde que fue introducido. México y América Central parecen ser los países que dieron origen a esta plaga en África. Por diferencias encontradas, en el patrón electroforético de proteasas, en 3 colonias de P. truncatus procedentes de México, Tanzania y Togo, se sugiere que tienen diferente origen. Con el objeto de instaurar la estabilidad genética de P. truncatus en México, se colectaron insectos adultos en 4 estados de la República Mexicana a los que se les determinó su patrón de isoenzimas proteolíticas. Los resultados obtenidos demuestran que P. truncatus en México presentan el mismo patrón electroforético, a pesar de pertenecer a diferentes localidades con diversas condiciones ambientales. Esta similitud apoya la teoría de que México no puede ser el origen de P. truncatus en África. Además, confirma que la información obtenida a través de zimogramas, utilizando larvas completas, es útil para diferenciar insectos de la misma especie de diferentes zonas geográficas. La técnica es de fácil manejo y relativamente económica.Prostephanus truncatus (Horn (Coleoptera: Bostrichidae is a pest of stored maize in Mexico, Central America, and some places of South America. In Africa has caused severe maize damage since its introduction. The outbreak in Africa seems to have its origin in Mexico or Central America. Differences found, in the electrophoretic pattern of proteasaes, on three P. truncatus colonies from Mexico, Tanzania, and Togo, suggest that they have different origin. In order to establish the genetic stability of P. truncatus in Mexico, adult insects from four States of the central part of this country were collected and determined their isoenzyme pattern of proteases. Results demonstrate that P. truncatus in

  9. Abundance of the Indo-Pacific bottlenose dolphin Tursiops aduncus ...

    African Journals Online (AJOL)

    Identification photographs were collected between April 2008 and June 2010 from dolphins occurring along a 30 km length of coast where a dolphin tourism industry is concentrated. A total of 137 groups were ... Keywords: dolphin watching, photo-identification, population estimate, residency. African Journal of Marine ...

  10. LA MEMBRANA PERITRÓFICA EN Prostephanus truncatus (HORN (COLEÓPTERA: BOSTRICHIDAE: ¿BLANCO PARA SU CONTROL? LA MEMBRANA PERITRÓFICA EN Prostephanus truncatus (HORN (COLEÓPTERA: BOSTRICHIDAE: ¿BLANCO PARA SU CONTROL?

    Directory of Open Access Journals (Sweden)

    M. Vázquez-Arista

    2012-02-01

    Full Text Available Prostephanus truncatus (Horn is a pest of maize stored in Mexico, Central America, some parts of South America, and it is expanding rapidly in Africa since it was introduced to that continent. Control of this pest in storehouses is carried out with the massive use of pesticides. With the object of finding an alternative method of control, an electron microscope study was made of the mid intestine of adults and larvae. Detected in the mid intestine of adult. P. truncatus was the presence of a peritrophic membrane. This membrane is formed by an irregular grid composed of various layers which are absent in the mid intestine of the last larval stage of P. truncatus. This indicates that formation of the peritrophic membrane take place mainly during the pupal stage, for which P. truncatus may be controlled biologically by using transgenic plants with the specific information to interfere in the synthesis of this membrane.Prostephanus truncatus (Horn es un insecto plaga del maíz almacenado en México, América Central, parte de América del Sur y se está expandiendo rápidamente en África desde que fue introducido a este continente. El control de este insecto en los almacenes se lleva a cabo con el uso masivo de insecticidas. Con el objeto de encontrar una alternativa para su control, se realizó un estudio de microscopía electrónica en el intestino medio del insecto adulto y su larva. Se detectó, en el intestino medio de P. truncatus adulto, la presencia de una membrana peritrófica. Esta membrana está formada por una red irregular compuesta de varias capas, la cual está ausente en el intestino medio del último estadío larvario de P. truncatus. Esto indica que su formación tiene lugar, principalmente, durante el período de pupa, por lo que P. truncatus podría ser controlado biológicamente usando plantas transgénicas con la información específica para interferir en la síntesis de esta membrana.

  11. Resident resistance.

    Science.gov (United States)

    Price, J L; Cleary, B

    1999-01-01

    Clearly, faculty must work hard with residents to explore the nature of their resistance to a program's learning and growth opportunities. Initial steps to a deeper, more effective, and longer-lasting change process must be pursued. If resident resistance is mishandled or misunderstood, then learning and professional growth may be sidetracked and the purposes of residency training defeated. Listening to the whole person of the resident and avoiding the trap of getting caught up in merely responding to select resident behaviors that irritate us is critical. Every faculty member in the family practice residency program must recognize resistance as a form of defense that cannot immediately be torn down or taken away. Resident defenses have important purposes to play in stress reduction even if they are not always healthy. Residents, especially interns, use resistance to avoid a deeper and more truthful look at themselves as physicians. A family practice residency program that sees whole persons in their residents and that respects resident defenses will effectively manage the stress and disharmony inherent to the resistant resident.

  12. Population genetics of the Schistosoma snail host Bulinus truncatus in Egypt.

    Science.gov (United States)

    Zein-Eddine, Rima; Djuikwo-Teukeng, Félicité F; Dar, Yasser; Dreyfuss, Gilles; Van den Broeck, Frederik

    2017-08-01

    The tropical freshwater snail Bulinus truncatus serves as an important intermediate host of several human and cattle Schistosoma species in many African regions. Despite some ecological and malacological studies, there is no information on the genetic diversity of B. truncatus in Egypt. Here, we sampled 70-100 snails in ten localities in Upper Egypt and the Nile Delta. Per locality, we sequenced 10 snails at a partial fragment of the cytochrome c oxidase subunit 1 gene (cox1) and we genotyped 25-30 snails at six microsatellite markers. A total of nine mitochondrial haplotypes were detected, of which five were unique to the Nile Delta and three were unique to Upper Egypt, indicating that snail populations may have evolved independently in both regions. Bayesian clustering and hierarchical F-statistics using microsatellite markers further revealed strong population genetic structure at the level of locality. Observed heterozygosity was much lower compared to what is expected under random mating, which could be explained by high selfing rates, population size reductions and to a lesser extent by the Wahlund effect. Despite these observations, we found signatures of gene flow and cross-fertilization, even between snails from the Nile Delta and Upper Egypt, indicating that B. truncatus can travel across large distances in Egypt. These observations could have serious consequences for disease epidemiology, as it means that infected snails from one region could rapidly and unexpectedly spark a new epidemic in another distant region. This could be one of the factors explaining the rebound of human Schistosoma infections in the Nile Delta, despite decades of sustained schistosomiasis control. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Biosonar adjustments to target range of echolocating bottlenose dolphins (Tursiops sp.) in the wild

    DEFF Research Database (Denmark)

    Frants, Jensen; Lars, Bejder; Wahlberg, Magnus

    2009-01-01

    intervals, and source levels of wild bottlenose dolphins (Tursiops sp.) by recording regular (non-buzz) echolocation clicks with a linear hydrophone array. Dolphins clicked faster with decreasing distance to the array, reflecting a decreasing delay between the outgoing echolocation click and the returning...... longer than a few body lengths of the dolphin. Source level estimates drop with reducing range between the echolocating dolphins and the target as a function of 17 log(R). This may indicate either (1) an active form of time-varying gain in the biosonar independent of click intervals or (2) a bias...

  14. Pairing success and sperm reserve of male Gammarus pulex infected by Cyathocephalus truncatus (Cestoda: Spathebothriidea).

    Science.gov (United States)

    Galipaud, Matthias; Gauthey, Zoé; Bollache, Loïc

    2011-09-01

    Manipulative parasites with complex life cycles are known to induce behavioural and physiological changes in their intermediate hosts. Cyathocephalus truncatus is a manipulative parasite which infects Gammarus pulex as intermediate host. G. pulex males display pre-copulatory mate guarding as a response to male-male competition for access to receptive females. In this paper, we tested the influence that C. truncatus-infection might have on male G. pulex sperm number and pairing success. We considered 3 classes of G. pulex males in our experiments: (i) uninfected males found paired in the field, (ii) uninfected males found unpaired in the field, or (iii) infected males found unpaired in the field. Both infected males and uninfected unpaired males paired less with a new female than uninfected paired males did. Furthermore, infected males appear to be at a strong disadvantage when directly competing for females with a healthy rival male, and had fewer sperm in their testes. We discuss the potential effect of male and female mating strategies on such male host mating alteration.

  15. Fatal Sarcocystis canis-like hepatitis in an Indo-Pacific bottlenose dolphin (Tursiops aduncus) in Hong Kong

    Science.gov (United States)

    Unlike most species in the genus Sarcocystis, Sarcocystis canis has a broad intermediate host range. Its life cycle is incompletely known and most reports are from the USA. Here we report fatal hepatitis in a 4 year old male Indo-Pacific bottlenose dolphin (Tursiops aduncus) from Hong Kong associate...

  16. Atypical colororation in the yellow-striped poisonous frog, Dendrobates truncatus (Cope, 1861), in the Colombian Magdalena river valley

    OpenAIRE

    Rivera Prieto, Diego A.; Marín C., David

    2017-01-01

    Herein we report an atypical coloration in one individual of the yellow-striped poisonous frog, Dendrobates truncatus, in Colombian Magdalena middle valley. The adult individual presented leucism, a rare phenomenon occurs in nature or at very low frequencies

  17. Permanent resident

    Directory of Open Access Journals (Sweden)

    John F. Fisher

    2016-05-01

    Full Text Available The training of physicians in the past century was based primarily on responsibility and the chain-of-command. Those with the bulk of that responsibility in the fields of pediatrics and internal medicine were residents. Residents trained the medical students and supervised them carefully in caring for patients. Most attending physicians supervised their teams at arm's length, primarily serving as teachers of the finer points of diagnosis and treatment during set periods of the day or week with a perfunctory signature on write-ups or progress notes. Residents endeavored to protect the attending physician from being heavily involved unless they were unsure about a clinical problem. Before contacting the attending physician, a more senior resident would be called. Responsibility was the ultimate teacher. The introduction of diagnosis-related groups by the federal government dramatically changed the health care delivery system, placing greater emphasis on attending physician visibility in the medical record, ultimately resulting in more attending physician involvement in day-to-day care of patients in academic institutions. Without specified content in attending notes, hospital revenues would decline. Although always in charge technically, attending physicians increasingly have assumed the role once dominated by the resident. Using biographical experiences of more than 40 years, the author acknowledges and praises the educational role of responsibility in his own training and laments its declining role in today's students and house staff.

  18. Permanent resident.

    Science.gov (United States)

    Fisher, John F

    2016-01-01

    The training of physicians in the past century was based primarily on responsibility and the chain-of-command. Those with the bulk of that responsibility in the fields of pediatrics and internal medicine were residents. Residents trained the medical students and supervised them carefully in caring for patients. Most attending physicians supervised their teams at arm's length, primarily serving as teachers of the finer points of diagnosis and treatment during set periods of the day or week with a perfunctory signature on write-ups or progress notes. Residents endeavored to protect the attending physician from being heavily involved unless they were unsure about a clinical problem. Before contacting the attending physician, a more senior resident would be called. Responsibility was the ultimate teacher. The introduction of diagnosis-related groups by the federal government dramatically changed the health care delivery system, placing greater emphasis on attending physician visibility in the medical record, ultimately resulting in more attending physician involvement in day-to-day care of patients in academic institutions. Without specified content in attending notes, hospital revenues would decline. Although always in charge technically, attending physicians increasingly have assumed the role once dominated by the resident. Using biographical experiences of more than 40 years, the author acknowledges and praises the educational role of responsibility in his own training and laments its declining role in today's students and house staff.

  19. Image collection: 152 [Togo Picture Gallery[Archive

    Lifescience Database Archive (English)

    Full Text Available 152 Tursiops_truncatus_NL.png ハンドウイルカ Bottlenose Dolphin Tursiops truncatus 9739 生物アイコン,脊索動物門,脊椎動物亜門,哺乳綱,獣亜綱,真獣下綱,クジラ目

  20. Residency training program: Perceptions of residents

    African Journals Online (AJOL)

    Abstract. Background: There is a phobia among doctors for the residency training program, since the establishment of ... Materials and Methods: Structured questionnaires were administered to residents at 3 training institutions in Nigeria. Results: ... Keywords: Decentralization, motivation, perception, remuneration, residents.

  1. Population Genetic Structure and Genetic Diversity in Twisted-Jaw Fish, Belodontichthys truncatus Kottelat & Ng, 1999 (Siluriformes: Siluridae, from Mekong Basin

    Directory of Open Access Journals (Sweden)

    Surapon Yodsiri

    2017-01-01

    Full Text Available The Mekong River and its tributaries possess the second highest diversity in fish species in the world. However, the fish biodiversity in this river is threatened by several human activities, such as hydropower plant construction. Understanding the genetic diversity and genetic structure of the species is important for natural resource management. Belodontichthys truncatus Kottelat & Ng is endemic to the Mekong River basin and is an important food source for people in this area. In this study, the genetic diversity, genetic structure, and demographic history of the twisted-jaw fish, B. truncatus, were investigated using mitochondrial cytochrome b gene sequences. A total of 124 fish specimens were collected from 10 locations in the Mekong and its tributaries. Relatively high genetic diversity was found in populations of B. truncatus compared to other catfish species in the Mekong River. The genetic structure analysis revealed that a population from the Chi River in Thailand was genetically significantly different from other populations, which is possibly due to the effect of genetic drift. Demographic history analysis indicated that B. truncatus has undergone recent demographic expansion dating back to the end of the Pleistocene glaciation.

  2. Behavioural and physiological effects of the trophically transmitted cestode parasite, Cyathocephalus truncatus, on its intermediate host, Gammarus pulex.

    Science.gov (United States)

    Franceschi, N; Rigaud, T; Moret, Y; Hervant, F; Bollache, L

    2007-11-01

    Some parasites with complex life-cycles are able to manipulate the behaviour of their intermediate hosts in a way that increases their transmission to the next host. Gammarids infected by the tapeworm Cyathocephalus truncatus (Cestoda: Spathebothriidea) are known to be more predated by fish than uninfected ones, but potential behavioural manipulation by the parasite has never been investigated. In this study, we tested the hypothesis that C. truncatus is able to manipulate the behaviour of one of its intermediate hosts, Gammarus pulex (Crustacea: Amphipoda). To assess if any behavioural change was linked to other phenotypic alterations, we also measured the immunity of infected and uninfected individuals and investigated the pathogenic effects of the parasite. Infected gammarids were significantly less photophobic than uninfected ones, but no effect of infection on the level of immune defence was found. The results on survival, swimming activity and oxygen consumption suggest that the parasite also has various pathogenic effects. However, the alteration in host phototaxis was not correlated to some of these pathogenic effects. Therefore, we propose that the modification in host reaction to light is a behavioural manipulation, explaining the previously observed increase of gammarid predation rate.

  3. Comparison of mercury contamination in live and dead dolphins from a newly described species, Tursiops australis.

    Directory of Open Access Journals (Sweden)

    Alissa Monk

    Full Text Available Globally it is estimated that up to 37% of all marine mammals are at a risk of extinction, due in particular to human impacts, including coastal pollution. Dolphins are known to be at risk from anthropogenic contaminants due to their longevity and high trophic position. While it is known that beach-cast animals are often high in contaminants, it has not been possible to determine whether levels may also be high in live animals from the same populations. In this paper we quantitatively assess mercury contamination in the two main populations of a newly described dolphin species from south eastern Australia, Tursiops australis. This species appear to be limited to coastal waters in close proximity to a major urban centre, and as such is likely to be vulnerable to anthropogenic pollution. For the first time, we were able to compare blubber mercury concentrations from biopsy samples of live individuals and necropsies of beach-cast animals and show that beach-cast animals were highly contaminated with mercury, at almost three times the levels found in live animals. Levels in live animals were also high, and are attributable to chronic low dose exposure to mercury from the dolphin's diet. Measurable levels of mercury were found in a number of important prey fish species. This illustrates the potential for low dose toxins in the environment to pass through marine food webs and potentially contribute to marine mammal deaths. This study demonstrates the potential use of blubber from biopsy samples to make inferences about the health of dolphins exposed to mercury.

  4. Comparison of mercury contamination in live and dead dolphins from a newly described species, Tursiops australis.

    Science.gov (United States)

    Monk, Alissa; Charlton-Robb, Kate; Buddhadasa, Saman; Thompson, Ross M

    2014-01-01

    Globally it is estimated that up to 37% of all marine mammals are at a risk of extinction, due in particular to human impacts, including coastal pollution. Dolphins are known to be at risk from anthropogenic contaminants due to their longevity and high trophic position. While it is known that beach-cast animals are often high in contaminants, it has not been possible to determine whether levels may also be high in live animals from the same populations. In this paper we quantitatively assess mercury contamination in the two main populations of a newly described dolphin species from south eastern Australia, Tursiops australis. This species appear to be limited to coastal waters in close proximity to a major urban centre, and as such is likely to be vulnerable to anthropogenic pollution. For the first time, we were able to compare blubber mercury concentrations from biopsy samples of live individuals and necropsies of beach-cast animals and show that beach-cast animals were highly contaminated with mercury, at almost three times the levels found in live animals. Levels in live animals were also high, and are attributable to chronic low dose exposure to mercury from the dolphin's diet. Measurable levels of mercury were found in a number of important prey fish species. This illustrates the potential for low dose toxins in the environment to pass through marine food webs and potentially contribute to marine mammal deaths. This study demonstrates the potential use of blubber from biopsy samples to make inferences about the health of dolphins exposed to mercury.

  5. Comparison of Mercury Contamination in Live and Dead Dolphins from a Newly Described Species, Tursiops australis

    Science.gov (United States)

    Monk, Alissa; Charlton-Robb, Kate; Buddhadasa, Saman; Thompson, Ross M.

    2014-01-01

    Globally it is estimated that up to 37% of all marine mammals are at a risk of extinction, due in particular to human impacts, including coastal pollution. Dolphins are known to be at risk from anthropogenic contaminants due to their longevity and high trophic position. While it is known that beach-cast animals are often high in contaminants, it has not been possible to determine whether levels may also be high in live animals from the same populations. In this paper we quantitatively assess mercury contamination in the two main populations of a newly described dolphin species from south eastern Australia, Tursiops australis. This species appear to be limited to coastal waters in close proximity to a major urban centre, and as such is likely to be vulnerable to anthropogenic pollution. For the first time, we were able to compare blubber mercury concentrations from biopsy samples of live individuals and necropsies of beach-cast animals and show that beach-cast animals were highly contaminated with mercury, at almost three times the levels found in live animals. Levels in live animals were also high, and are attributable to chronic low dose exposure to mercury from the dolphin's diet. Measurable levels of mercury were found in a number of important prey fish species. This illustrates the potential for low dose toxins in the environment to pass through marine food webs and potentially contribute to marine mammal deaths. This study demonstrates the potential use of blubber from biopsy samples to make inferences about the health of dolphins exposed to mercury. PMID:25137255

  6. Residency Allocation Database

    Data.gov (United States)

    Department of Veterans Affairs — The Residency Allocation Database is used to determine allocation of funds for residency programs offered by Veterans Affairs Medical Centers (VAMCs). Information...

  7. Larval feeding behavior of the truncatus group of Thrypticus (Diptera: Dolichopodidae that breed in the aerenchyma of Pontederiaceae

    Directory of Open Access Journals (Sweden)

    M. Cristina HERNÁNDEZ

    2007-01-01

    Full Text Available Se da a conocer el comportamiento alimentario de las larvas de algunas especies del grupo truncatus de Thrypticus (Diptera: Dolichopodidae, que se desarrollan en plantas hospedadoras de Pontederiaceae. Los estadios inmaduros de T. circularis Bickel & Hernández se crían en los pecíolos globosos de Eichhornia crassipes (Martius Solms-Laubach (Pontederiaceae, minando cerca de la epidermis y abriendo varios orificios al exterior. La larva de T. romus Bickel & Hernández crece en E. azurea (Sw. Kunth, formando una mina curva, corta en comparación con las otras especies. La larva de T. formosensis Bickel & Hernández se desarrolla en Pontederia cordata L. (Pontederiaceae, excavando la mina entre la epidermis y la gran celda central de los pecíolos. Por último, la larva de T. taragui Bickel & Hernández se cría en tallos sumergidos de P. subovata (Seub. in Mart. Lowden, formando una mina subepidérmica con ramificaciones hacia la estela central del tallo. No se pudieron asociar las minas correspondientes a las especies T. yanayacu, T. chanophalus y T. azuricola. No se encontraron predadores ni parásitos de larvas o pupas, se observaron casos de canibalismo entre larvas cuando el trazado de dos minas confluye. Las especies del grupo truncatus poseen un modo de alimentación sumamente específico, confinadas al aerénquima, se alimentan de la savia extraída de los orificios roídos en los haces vasculares de los pecíolos y tallos, posiblemente con levaduras simbiontes como suplemento para la nutrición. Numerosas colecciones en el campo y pruebas en el laboratorio, indican que estos insectos están asociados con plantas hospedadoras específicas dentro de la misma familia. Esta especialización sugiere una larga asociación insecto-hospedadora.

  8. DAÑOS CAUSADOS POR EL BARRENADOR MAYOR DE LOS GRANOS Prostephanus truncatus (Horn(COLEOPTERA: BOSTRICHIDAE EN MAÍZ Y RAMAS DE PLANTAS SILVESTRES

    Directory of Open Access Journals (Sweden)

    Luz R. Bourne-Murrieta

    2014-01-01

    Full Text Available Prostephanus truncatus (Horn es un insecto barrenador de la madera que se ha adaptado a los productos alimenticios almacenados, principalmente de maíz. En este trabajo se cuantificaron las pérdidas y daños ocasionados por el barrenador en 10 variedades de maíz y 10 especies vegetales para determinar la susceptibilidad y los efectos que el insecto pudiera ocasionar si se adapta a las condiciones del noroeste de México. Las semillas de los maíces y los trozos de ramas de las especies arbóreas se sometieron a infestación artificial por adultos de P. truncatus y se incubaron a 27 ± 1 °C y 70 ± 3 % de humedad relativa. La preferencia de los insectos y los daños ocasionados en cada material fueron determinados. Los insectos prefirieron y dañaron en mayor grado al “Maizón”, una variedad de maíz criollo sembrado por los productores de la región serrana de Sonora. Los trozos de ramas con mayor daño provocado por P. truncatus fueron Ricinus communis, Jatropha cardiophylla y Parkinsonia aculeata; sin embargo, el insecto no fue capaz de reproducirse en éstas. El “Maizón” también presentó la disminución más drástica de germinación y fue una de las variedades con mayor número de adultos de P. truncatus emergidos.

  9. Residency training program: Perceptions of residents

    African Journals Online (AJOL)

    This study was carried out to ascertain the perception of the residency ... the time of the study. Analysis of the respondents showed similar findings for both senior and junior levels of training. Discussion. The introduction of the residency training program .... Overseas training/ attachment should be re-introduced. 12. (10.1).

  10. Resident Characteristics Report

    Data.gov (United States)

    Department of Housing and Urban Development — The Resident Characteristics Report summarizes general information about households who reside in Public Housing, or who receive Section 8 assistance. The report...

  11. Development and application of specific cytokine assays in tissue samples from a bottlenose dolphin with hyperinsulinemia

    Science.gov (United States)

    Chronic inflammation has been associated with insulin resistance and type 2 diabetes in humans. Postmortem hepatic and splenic tissue from a 46-year old geriatric male bottlenose dolphin (Tursiops truncatus) with insulin resistance (chronic hyperinsulinemia with hyperglycemia) , chronic = inflamma...

  12. On the occurrence of spondylosis deformans in white-beaked dolphins Lagenorhynchus albirostris (Gray, 1846) stranded on the Dutch coast

    NARCIS (Netherlands)

    Kompanje, E.J.O.

    1995-01-01

    Fourty-three skeletons of Lagenorhynchus albirostris were examined for the occurrence of pathological changes in the vertebral column. In comparison, 83 skeletons of Phocoena phocoena and 18 of Tursiops truncatus were studied. The pathogenesis of spondylosis deformans is discussed.

  13. Effect of seismic operations on cetaceans sightings off-shore Akwa ...

    African Journals Online (AJOL)

    66.78%) sightings of whales and 94 (33.22%) sightings of dolphins. Four species of cetaceans were identified, bottlenose dolphins (Tursiops truncatus) were the most abundant followed by pantropical spotted dolphins (Stenella attenuata).

  14. The occurrence and position of the ”connecting sac” in the nasal tract complex of small odontocetes (Mammalia, Cetacea)

    NARCIS (Netherlands)

    Schenkkan, E.J.

    1971-01-01

    The aspects of the “connecting sac” are studied in Lagenorhynchus albirostris, Lagenorhynchus obliquidens, Lagenorhynchus acutus, Tursiops truncatus, Delphinus delphis, Phocoena phocoena, Sotalia guianensis, Stenella coeruleoalba and Stenella frontalis. Comparing the development of the connecting

  15. [Burnout in nursing residents].

    Science.gov (United States)

    Franco, Gianfábio Pimentel; de Barros, Alba Lúcia Bottura Leite; Nogueira-Martins, Luiz Antônio; Zeitoun, Sandra Salloum

    2011-03-01

    Nursing residents may experience physical and emotional exhaustion from the daily life of attending the Program. The aim of this study was to determine the Burnout incidence among Nursing Residents. An investigative, descriptive, analytical, longitudinal-prospective study was conducted with 16 Residents over two years. The Maslach Burnout Inventory was used, translated and validated for Brazil, as well as a sociodemographic/occupational data tool. Of all residents, 17.2% showed high rates in Emotional Exhaustion and Depersonalization; 18.8% showed impaired commitment in Personal Accomplishment, 75% of which belonged to specialty areas, such as Emergency Nursing, Adult and Pediatric Intensive Care. Age and specialty area were positively correlated with Personal Accomplishment. One of the Residents was identified with changes in three subscales of the Maslach Burnout Inventory, thus characterized as a Burnout Syndrome patient. Nursing Residents have profiles of disease. Knowing these factors can minimize health risks of these workers.

  16. Whistle emissions of Indo-Pacific bottlenose dolphins (Tursiops aduncus) differ with group composition and surface behaviors.

    Science.gov (United States)

    Hawkins, Elizabeth R; Gartside, Donald F

    2010-04-01

    The intricate and highly developed acoustic communication system of bottlenose dolphins reflects the complexities of their social organization. Indo-Pacific bottlenose dolphins (Tursiops aduncus) produce numerous types of acoustic emissions, including a diverse repertoire of whistles used for communicative purposes. The influence of group composition on whistle production and the function of different whistles produced by dolphins in wild contexts are relatively unknown. Recordings of acoustic emissions and behavior of dolphins were made concurrently during vessel-based surveys along the coast of northern New South Wales, Australia. Whistles were divided into five tonal classes (sine, rise, down-sweep, flat, and concave) and categorized into distinct whistle types. It is shown that while whistle repetition rate and whistle diversity was influenced by group composition, it is not influenced by behavior. Noncalf groups produced a significantly higher whistle repetition rate and whistle diversity than calf groups. In contrast, the types of whistles produced were related to the behavior in which the dolphins were engaged in: some tonal classes and distinct whistle types were related to different behavior states. Findings suggested that some whistle types may be used to communicate specific information on the behavioral context of the individuals involved.

  17. Why do dolphins jump? Interpreting the behavioural repertoire of bottlenose dolphins (Tursiops sp.) in Doubtful Sound, New Zealand.

    Science.gov (United States)

    Lusseau, David

    2006-11-01

    Only a limited number of studies have tried to determine the purpose of surface behavioural events performed by dolphins. To date only one study has attempted to aggregate the behavioural events observed in a population in contextual groups using co-occurrence as the grouping factor. In the present study, I tried to characterise the behavioural repertoire of a bottlenose dolphin population (Tursiops sp.) present in Doubtful Sound, New Zealand. I first looked at the relationship between events performed by individuals depending on the behavioural state of their schools. I then assessed the likelihood for events to co-occur. Four main behavioural categories (orientation, travel, social displays and fights) emerged from this analysis. Aerial events (jumps) did not fall into one category, showing that different aerial behaviours play different roles. Moreover, it appears that dolphins used side-flopping and upside-down lobtailing to communicate motivation. Side-flops occurred when the focal schools finished a behavioural bout and started to travel, while upside-down lobtails occurred when the focal schools instigated a behavioural bout after travelling. This non-vocal communication can take place over a few meters to hundreds of meters. Having signals that are effective over very short ranges avoids unwanted signalling to prey, predators or conspecifics.

  18. Organohalogen compounds in blubber of Indo-Pacific bottlenose dolphin (Tursiops aduncus) and spinner dolphin (Stenella longirostris) from Zanzibar, Tanzania.

    Science.gov (United States)

    Mwevura, Haji; Amir, Omar A; Kishimba, Michael; Berggren, Per; Kylin, Henrik

    2010-06-01

    Blubber samples of Indo-Pacific bottlenose (Tursiops aduncus) and spinner (Stenella longirostris) dolphins from Zanzibar, East Africa, were analyzed for a wide range of organohalogen compounds. Methoxylated polybrominated diphenyl ethers (MeO-BDEs), presumably biogenic, were found at higher concentrations than anthropogenic organochlorine pesticides (OCPs). Only traces of industrial pollutants, such as polychlorinated biphenyls, were detected. The OCP levels found off Zanzibar were lower than those reported from other regions while MeO-BDE levels were higher. The relative composition of the OCPs indicated recent use of lindane (gamma-hexachlorocyclohexane) and aged residues of DDT and technical HCH. Placental transfer was estimated to 2.5% and 0.5% of the total burden of OCPs and MeO-BDEs, respectively. Overall transfer from mother to calf in Indo-Pacific bottlenose dolphins was estimated to 72% and 85% for the OCPs and MeO-BDEs burdens, respectively. Health effects of MeO-BDEs are not known, but structural similarities with well-known environmental toxins are cause for concern. Copyright 2010 Elsevier Ltd. All rights reserved.

  19. Feeding ecology of the Indo-Pacific bottlenose dolphin ( Tursiops aduncus) incidentally caught in the gillnet fisheries off Zanzibar, Tanzania

    Science.gov (United States)

    Amir, Omar A.; Berggren, Per; Ndaro, Simon G. M.; Jiddawi, Narriman S.

    2005-05-01

    The stomach contents of 26 Indo-Pacific bottlenose dolphins ( Tursiops aduncus) incidentally caught in gillnet fisheries around Unguja Island (Zanzibar) between February 2000 and August 2002 were examined. The relative importance of each prey species was assessed through indices of relative importance. In total, 1403 prey items comprising 50 species of bony fish and three species of squid were identified from food remains. Five species of fish, Uroconger lepturus, Synaphobranchus kaupii, Apogon apogonides, Lethrinus crocineus, Lutjanus fulvus, and three species of squid, Sepioteuthis lessoniana, Sepia latimanus and Loligo duvauceli, were the most important prey species. Based on an index that included frequency of occurrence, percentage by number and by weight, Uroconger lepturus proved to be the most important prey species of mature dolphins whereas Apogon apogonides was the preferred prey of immature dolphins. These results indicate that Indo-Pacific bottlenose dolphins off the coast of Zanzibar forage on a relatively large number of prey species, but that only a few small- and medium-sized neritic fish and cephalopods contribute substantially to the diet. Further, the ecology and behavior of the preferred fish prey species indicate that the dolphins forage over reef or soft bottom substrata and near the shore.

  20. Organohalogen compounds in blubber of Indo-Pacific bottlenose dolphin (Tursiops aduncus) and spinner dolphin (Stenella longirostris) from Zanzibar, Tanzania

    International Nuclear Information System (INIS)

    Mwevura, Haji; Amir, Omar A.; Kishimba, Michael; Berggren, Per; Kylin, Henrik

    2010-01-01

    Blubber samples of Indo-Pacific bottlenose (Tursiops aduncus) and spinner (Stenella longirostris) dolphins from Zanzibar, East Africa, were analyzed for a wide range of organohalogen compounds. Methoxylated polybrominated diphenyl ethers (MeO-BDEs), presumably biogenic, were found at higher concentrations than anthropogenic organochlorine pesticides (OCPs). Only traces of industrial pollutants, such as polychlorinated biphenyls, were detected. The OCP levels found off Zanzibar were lower than those reported from other regions while MeO-BDE levels were higher. The relative composition of the OCPs indicated recent use of lindane (γ-hexachlorocyclohexane) and aged residues of DDT and technical HCH. Placental transfer was estimated to 2.5% and 0.5% of the total burden of OCPs and MeO-BDEs, respectively. Overall transfer from mother to calf in Indo-Pacific bottlenose dolphins was estimated to 72% and 85% for the OCPs and MeO-BDEs burdens, respectively. Health effects of MeO-BDEs are not known, but structural similarities with well-known environmental toxins are cause for concern. - Biogenic brominated organic compounds were found at higher concentrations than anthropogenic organochlorine pesticides in dolphins off Zanzibar.

  1. Organohalogen compounds in blubber of Indo-Pacific bottlenose dolphin (Tursiops aduncus) and spinner dolphin (Stenella longirostris) from Zanzibar, Tanzania

    Energy Technology Data Exchange (ETDEWEB)

    Mwevura, Haji, E-mail: mwevura@yahoo.co [Department of Chemistry, University of Dar es Salaam, Dar es Salaam (Tanzania, United Republic of); Amir, Omar A., E-mail: omar.amir@zoologi.su.s [Institute of Marine Sciences, University of Dar es Salaam, P O Box 668, Zanzibar (Tanzania, United Republic of); Department of Zoology, Stockholm University, SE-106 91 Stockholm (Sweden); Kishimba, Michael, E-mail: kishimba@chem.udsm.ac.t [Department of Chemistry, University of Dar es Salaam, Dar es Salaam (Tanzania, United Republic of); Berggren, Per, E-mail: per.berggren@zoologi.su.s [Department of Zoology, Stockholm University, SE-106 91 Stockholm (Sweden); School of Marine Science and Technology, University of Newcastle upon Tyne, NE1 7RU (United Kingdom); Kylin, Henrik, E-mail: henrik.kylin@vatten.slu.s [Department of Aquatic Sciences and Assessment, Swedish University of Agricultural Sciences, P O Box 7050, SE-750 07 Uppsala (Sweden); Norwegian Institute of Air Research, Polar Environmental Centre, NO-9296 Tromso (Norway)

    2010-06-15

    Blubber samples of Indo-Pacific bottlenose (Tursiops aduncus) and spinner (Stenella longirostris) dolphins from Zanzibar, East Africa, were analyzed for a wide range of organohalogen compounds. Methoxylated polybrominated diphenyl ethers (MeO-BDEs), presumably biogenic, were found at higher concentrations than anthropogenic organochlorine pesticides (OCPs). Only traces of industrial pollutants, such as polychlorinated biphenyls, were detected. The OCP levels found off Zanzibar were lower than those reported from other regions while MeO-BDE levels were higher. The relative composition of the OCPs indicated recent use of lindane (gamma-hexachlorocyclohexane) and aged residues of DDT and technical HCH. Placental transfer was estimated to 2.5% and 0.5% of the total burden of OCPs and MeO-BDEs, respectively. Overall transfer from mother to calf in Indo-Pacific bottlenose dolphins was estimated to 72% and 85% for the OCPs and MeO-BDEs burdens, respectively. Health effects of MeO-BDEs are not known, but structural similarities with well-known environmental toxins are cause for concern. - Biogenic brominated organic compounds were found at higher concentrations than anthropogenic organochlorine pesticides in dolphins off Zanzibar.

  2. Echolocation parameters of Australian humpback dolphins (Sousa sahulensis) and Indo-Pacific bottlenose dolphins (Tursiops aduncus) in the wild.

    Science.gov (United States)

    de Freitas, Mafalda; Jensen, Frants H; Tyne, Julian; Bejder, Lars; Madsen, Peter T

    2015-06-01

    Echolocation is a key sensory modality for toothed whale orientation, navigation, and foraging. However, a more comparative understanding of the biosonar properties of toothed whales is necessary to understand behavioral and evolutionary adaptions. To address this, two free-ranging sympatric delphinid species, Australian humpback dolphins (Sousa sahulensis) and Indo-Pacific bottlenose dolphins (Tursiops aduncus), were studied. Biosonar clicks from both species were recorded within the same stretch of coastal habitat in Exmouth Gulf, Western Australia, using a vertical seven element hydrophone array. S. sahulensis used biosonar clicks with a mean source level of 199 ± 3 dB re 1 μPa peak-peak (pp), mean centroid frequency of 106 ± 11 kHz, and emitted at interclick intervals (ICIs) of 79 ± 33 ms. These parameters were similar to click parameters of sympatric T. aduncus, characterized by mean source levels of 204 ± 4 dB re 1 μPa pp, centroid frequency of 112 ± 9 kHz, and ICIs of 73 ± 29 ms. These properties are comparable to those of other similar sized delphinids and suggest that biosonar parameters are independent of sympatric delphinids and possibly driven by body size. The dynamic biosonar behavior of these delphinids may have, consequently, allowed for adaptations to local environments through high levels of control over sonar beam properties.

  3. Cultural transmission of tool use by Indo-Pacific bottlenose dolphins (Tursiops sp.) provides access to a novel foraging niche.

    Science.gov (United States)

    Krützen, Michael; Kreicker, Sina; MacLeod, Colin D; Learmonth, Jennifer; Kopps, Anna M; Walsham, Pamela; Allen, Simon J

    2014-06-07

    Culturally transmitted tool use has important ecological and evolutionary consequences and has been proposed as a significant driver of human evolution. Such evidence is still scarce in other animals. In cetaceans, tool use has been inferred using indirect evidence in one population of Indo-Pacific bottlenose dolphins (Tursiops sp.), where particular dolphins ('spongers') use marine sponges during foraging. To date, evidence of whether this foraging tactic actually provides access to novel food items is lacking. We used fatty acid (FA) signature analysis to identify dietary differences between spongers and non-spongers, analysing data from 11 spongers and 27 non-spongers from two different study sites. Both univariate and multivariate analyses revealed significant differences in FA profiles between spongers and non-spongers between and within study sites. Moreover, FA profiles differed significantly between spongers and non-spongers foraging within the same deep channel habitat, whereas the profiles of non-spongers from deep channel and shallow habitats at this site could not be distinguished. Our results indicate that sponge use by bottlenose dolphins is linked to significant differences in diet. It appears that cultural transmission of tool use in dolphins, as in humans, allows the exploitation of an otherwise unused niche.

  4. The spatial and seasonal distribution of Bulinus truncatus, Bulinus forskalii and Biomphalaria pfeifferi, the intermediate host snails of schistosomiasis, in N’Djamena, Chad

    Directory of Open Access Journals (Sweden)

    Wendelin Moser

    2014-11-01

    Full Text Available There is a paucity of epidemiological and malacological data pertaining to schistosomiasis in Chad. In view of a recently articulated elimination agenda, a deeper understanding of the spatio-temporal distribution of schistosomiasis inter- mediate host snails is pivotal. We conducted cross-sectional malacological surveys during the dry season (April/May 2013 and after the short rainy season (October 2013 in N’Djamena, the capital of Chad. Snails were identified at the genus and species level using morphological keys and molecular DNA barcoding approaches. Those belonging to Bulinus and Biomphalaria were examined for cercarial shedding. Snail habitats were characterised and their predictive potential for the presence of schistosomiasis intermediate host snails explored. Seasonal patterns were studied using geographical information system and kriging in order to interpolate snail abundance data to make predictions at non-sampled locations across N’Djamena. Overall, 413 Bulinus truncatus, 369 Bulinus forskalii and 108 Biomphalaria pfeifferi snails were collected and subjected to cercarial shedding. During the dry season, one Bu. truncatus of 119 snails collected shed Schistosoma spp. cer- cariae (0.84%, while S. mansoni was shed by one of 108 Bi. pfeifferi snails (0.93%. None of the snails collected after the rainy season shed Schistosoma spp. cercariae. The abundance of Bu. truncatus and Bu. forskalii showed an inverse U-shape relationship with the square term of conductivity, i.e. low abundance at the lowest and highest levels of conductivity and high abundance at intermediate levels. Bi. pfeifferi showed a negative, linear association with pH in the dry seasons. It is planned to link these intermediate host snail data to infection data in human populations with the goal to draw a predictive risk map that can be utilised for control and elimination of schistosomiasis in N’Djamena.

  5. Facility Focus: Residence Halls.

    Science.gov (United States)

    College Planning & Management, 2003

    2003-01-01

    Describes four examples of residence hall design, one renovation and three new residence halls, that exemplify design principles that meet student and institutional requirements. The examples are at (1) the University of Illinois at Chicago; (2) Bowdoin College; (3) Muhlenberg College; and (4) Spring Arbor University. (SLD)

  6. Rain Forest Dance Residency.

    Science.gov (United States)

    Watson, Dawn

    1997-01-01

    Outlines the author's experience as a dancer and choreographer artist-in-residence with third graders at a public elementary school, providing a cultural arts experience to tie in with a theme study of the rain forest. Details the residency and the insights she gained working with students, teachers, and theme. (SR)

  7. Population Consequences of Acoustic Disturbance of Marine Mammals

    Science.gov (United States)

    2013-09-30

    and motivational interactions of coastal bottlenose dolphins (Tursiops truncatus) in the Moray Firth, Scotland, to assess the biological effects of...potential responses of species to disturbance and diverse human activities. OBJECTIVES 1. Explore how the U.S. National Research Council (NRC... dolphins (Tursiops spp.). The third meeting focused on how disturbance might affect northern right whales (Eubalaena glacialis). During the fourth

  8. Psychologic effects of residency.

    Science.gov (United States)

    Reuben, D B

    1983-03-01

    The intense situational and physiologic stresses that accompany postgraduate training may have serious psychosocial ramifications. Although only a small proportion of residents have overt psychiatric illness, virtually all display some psychologic impairment. Contributing factors include life-changes, stresses associated with providing patient care, loss of social support, long working hours, sleep deprivation, and underlying personality traits of residents. The manifestations of this impairment are variable and may be subtle. In response to these problems, residency programs have taken steps to provide psychosocial support. Unfortunately, most programs do not offer formal support groups or seminars to discuss difficulties that accompany residency. Further definition of the psychosocial effects of residency may prompt changes that make the training of physicians a more humane process.

  9. Residents in difficulty

    DEFF Research Database (Denmark)

    Christensen, Mette Krogh; O'Neill, Lotte; Hansen, Dorthe Høgh

    2016-01-01

    Background The majority of studies on prevalence and characteristics of residents in difficulty have been conducted in English-speaking countries and the existing literature may not reflect the prevalence and characteristics of residents in difficulty in other parts of the world such as the Scand......Background The majority of studies on prevalence and characteristics of residents in difficulty have been conducted in English-speaking countries and the existing literature may not reflect the prevalence and characteristics of residents in difficulty in other parts of the world...... such as the Scandinavian countries, where healthcare systems are slightly different. The aim of this study was to examine prevalence and characteristics of residents in difficulty in one out of three postgraduate medical training regions in Denmark, and to produce both a quantifiable overview and in-depth understanding...... of the topic. Methods We performed a mixed methods study. All regional residency program directors (N = 157) were invited to participate in an e-survey about residents in difficulty. Survey data were combined with database data on demographical characteristics of the background population (N = 2399...

  10. New possible molluscicides from Calendula micrantha officinalis and Ammi majus. II. Molluscicidal, physiological, and egg-laying effects against Biomphalaria alexandrina and Bulinus truncatus.

    Science.gov (United States)

    Rawi, S M; El-Gindy, H; Abd-El-Kader, A

    1996-12-01

    In the present study, the effects of CuSo4 and crude extracts of the different parts of Calendula micrantha officinalis and Ammi majus, i. e., leaves, stems, roots, and flowers, on adult Biomphalaria alexandrina and Bulinus truncatus were investigated. Generally, leaves and flowers of both plants exhibited marked potency in killing the snail vectors of schistosomiasis. The recorded LC50 and LC90 values showed that C. officinalis was more toxic to both snails than A. majus, and B. truncatus are more sensitive to the extracts of both plants than B. alexandrina. Snails that are produced from snails previously exposed to low doses were more sensitive to the tested extracts, which may give primary indication of no possibility of inherited resistance. Moreover, prolonged exposure to the sublethal concentrations of A. majus have a definite lethal effect on the egg laying and longevity of both snails. Also, treatment with sublethal doses of both plants clearly inhibited the transaminase activity (ALAT, ASAT), diminished the total protein content, and increased markedly total lipid contents in the hemolymph of both snails.

  11. Technology in Residence.

    Science.gov (United States)

    Fox, Jordan

    1999-01-01

    Discusses the necessity for incorporating current technology in today's college residence halls to meet the more diverse and continued activities of its students. Technology addressed covers data networking and telecommunications, heating and cooling systems, and fire-safety systems. (GR)

  12. Satisfaction among residents in ASHP-accredited pharmacy residency programs.

    Science.gov (United States)

    VanDenBerg, C; Murphy, J E

    1997-07-01

    The level of work satisfaction among pharmacists in ASHP-accredited residencies was studied. In March 1996 a questionnaire designed to measure residency satisfaction was mailed to 697 individuals in ASHP-accredited pharmacy practice and specialty practice residencies. Subjects responded to 16 statements relating to intrinsic and extrinsic determinants of work satisfaction on a scale of 1 to 5, where 1 = strongly disagree and 5 = strongly agree. Questionnaires were returned by 413 (59%) of the residents. The respondents were predominantly women (76%), and most (86%) had at least a Pharm. D. degree. Hospitals were the primary work setting (88%). Of the 413 residents, 305 were in pharmacy practice residencies and 108 were in specialized residencies. None of the mean scores indicated disagreement (scores 3) with the negatively worded statements. The median and mode were equal to 2 (disagree) for the three negatively worded items and 4 (agree) for all but three positively worded items. Only 8% of the residents indicated that they would not accept the residency again if given the chance. Specialized residents tended to rate positively worded statements higher and negatively worded statements lower than pharmacy practice residents. Female residents indicated greater satisfaction than male residents. Pay and benefits were rated slightly better than neutral. Pharmacy residents appeared generally satisfied with their residencies. Specialized pharmacy residents were more satisfied than pharmacy practice residents, and women were more satisfied than men.

  13. Burnout Syndrome During Residency.

    Science.gov (United States)

    Turgut, Namigar; Karacalar, Serap; Polat, Cengiz; Kıran, Özlem; Gültop, Fethi; Kalyon, Seray Türkmen; Sinoğlu, Betül; Zincirci, Mehmet; Kaya, Ender

    2016-10-01

    The aim of this study is identified the degree of Burnout Syndrome (BOS) and find out its correlation with years of recidency and sociodemograpfic chareacteristics, training, sleeping habits, such as smoking and alcohol consumption. After approval from the Hospital Ethics Committee and obtaining informed consent, First, second, third, fourth and fifth year of recidency staff (n=127) working in our hospital were involved in this study. The standardized Maslach Burnout Inventory (MBI) was used in this study. Fifty six male (44.1%) and seventy one female (55.9%) residents were enroled in this study (Coranbach Alfa(α)=0.873). 57% of the first year residents smokes cigaret and 54% of them use alcohol. 2% of them gets one day off after hospital night shift, 61% of them suffers from disturbed sleep. 60% of them had been stated that they willingly selected their profession. 61% of them prefers talking to friends and 32% of them prefers shopping to overcome stress. There were statistical difference acording to years of recidency in MBI, Emotional Burnout (EB) and desensitisation scale (DS) points. EB scale points of the second year of residency group was statisticaly higher than fourth year of residency group. DS points of second year of residency group was also statisticaly higher than the third and fourth year of residency group. There was no statistical difference between any groups in Personal Success. BOS is a frequent problem during residency in anaesthesia. Appropriate definition and awareness are the first important steps to prevent this syndrome. Further administrative approaches should be evaluated with regard to their effects.

  14. Analysis of Resident Case Logs in an Anesthesiology Residency Program

    DEFF Research Database (Denmark)

    Yamamoto, Satoshi; Tanaka, Pedro; Madsen, Matias Vested

    2016-01-01

    Our goal in this study was to examine Accreditation Council for Graduate Medical Education case logs for Stanford anesthesia residents graduating in 2013 (25 residents) and 2014 (26 residents). The resident with the fewest recorded patients in 2013 had 43% the number of patients compared with the...

  15. Residents as teachers: survey of Canadian family medicine residents.

    Science.gov (United States)

    Ng, Victor K; Burke, Clarissa A; Narula, Archna

    2013-09-01

    To examine Canadian family medicine residents' perspectives surrounding teaching opportunities and mentorship in teaching. A 16-question online survey. Canadian family medicine residency programs. Between May and June 2011, all first- and second-year family medicine residents registered in 1 of the 17 Canadian residency programs as of September 2010 were invited to participate. A total of 568 of 2266 residents responded. Demographic characteristics, teaching opportunities during residency, and resident perceptions about teaching. A total of 77.7% of family medicine residents indicated that they were either interested or highly interested in teaching as part of their future careers, and 78.9% of family medicine residents had had opportunities to teach in various settings. However, only 60.1% of respondents were aware of programs within residency intended to support residents as teachers, and 33.0% of residents had been observed during teaching encounters. It appears that most Canadian family medicine residents have the opportunity to teach during their residency training. Many are interested in integrating teaching as part of their future career goals. Family medicine residencies should strongly consider programs to support and further develop resident teaching skills.

  16. Spatial and Temporal Variation in the Acoustic Habitat of Bottlenose Dolphins (Tursiops aduncus within a Highly Urbanized Estuary

    Directory of Open Access Journals (Sweden)

    Sarah A. Marley

    2017-06-01

    Full Text Available There is growing awareness of underwater noise in a variety of marine habitats, and how such noise may adversely affect marine species. This is of particular concern for acoustically-specialized species, such as dolphins. In order to ascertain the potential impacts of anthropogenic noise on these animals, baseline information is required for defining the soundscape of dolphin habitats. The Swan-Canning River system in Western Australia flows through the city of Perth, and experiences numerous anthropogenic activities. Despite this, the river system is home to a community of Indo-Pacific bottlenose dolphins (Tursiops aduncus. To provide a baseline soundscape description of dolphin habitat, over 11,600 h of acoustic data were analyzed from five sites within the Swan River (from Fremantle Inner Harbor to 20 km upstream across an 8-year period. Multiple sound sources were recorded at these sites, including: snapping shrimp; fishes; dolphins; pile-driving; bridge and road traffic; and vessel traffic. The two most prevalent sound sources, vessel traffic and snapping shrimp, likely have very different effects on dolphin communication with the former expected to be more disruptive. Sites were characteristic in their prominent sound sources, showing clear among-site variations, with some sites being “noisier” than others based on broadband noise levels, octave-band noise levels, and power spectrum density percentiles. Perth Waters had the highest broadband noise (10–11 kHz; median 113 dB re 1 μPa rms, whilst Heirisson Island was quietest (median 100 dB re 1 μPa rms. Generalized estimating equations identified variation in broadband noise levels within sites at a fine temporal scale, although sites differed in the significance of temporal variables. At Mosman Bay, a long-term dataset spanning eight years highlighted inter-annual variation in broadband noise levels, but no overall upwards or downwards trend over time. Acoustic habitats of the Swan

  17. Resident fatigue in otolaryngology residents: a Web based survey.

    Science.gov (United States)

    Nida, Andrew M; Googe, Benjamin J; Lewis, Andrea F; May, Warren L

    2016-01-01

    Resident fatigue has become a point of emphasis in medical education and its effects on otolaryngology residents and their patients require further study. The purpose of our study was to evaluate the prevalence and nature of fatigue in otolaryngology residents, evaluate various quality of life measures, and investigate associations of increased fatigue with resident safety. Anonymous survey. Internet based. United States allopathic otolaryngology residents. None. The survey topics included demographics, residency structure, sleep habits and perceived stress. Responses were correlated with a concurrent Epworth Sleep Scale questionnaire to evaluate effects of fatigue on resident training and quality of life. 190 residents responded to the survey with 178 completing the Epworth Sleep Scale questionnaire. Results revealed a mean Epworth Sleep Scale score of 9.9±5.1 with a median of 10.0 indicating a significant number of otolaryngology residents are excessively sleepy. Statistically significant correlations between Epworth Sleep Scale and sex, region, hours of sleep, and work hours were found. Residents taking in-house call had significantly fewer hours of sleep compared to home call (p=0.01). Residents on "head and neck" (typically consisting of a large proportion of head and neck oncologic surgery) rotations tended to have higher Epworth Sleep Scale and had significantly fewer hours of sleep (p=.003) and greater work hours (potolaryngology residents are excessively sleepy. Our data suggest that the effects of fatigue play a role in resident well-being and resident safety. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Concentrations of metallic elements in kidney, liver, and lung tissue of Indo-Pacific bottlenose dolphin Tursiops aduncus from coastal waters of Zanzibar, Tanzania.

    Science.gov (United States)

    Mapunda, Edgar C; Othman, Othman C; Akwilapo, Leonard D; Bouwman, Hindrik; Mwevura, Haji

    2017-09-15

    Concentrations of metallic elements in kidney, liver and lung tissues of Indo-Pacific bottlenose dolphins Tursiops aduncus from coastal waters of Zanzibar were determined using inductively coupled plasma - optical emission spectroscopy. Cadmium, chromium, copper, and zinc were quantifiable in all tissues at concentration ranges of 0.10-150, 0.08-3.2, 1.1-88 and 14-210μg/g dry mass, respectively. Copper and zinc was significantly higher in liver, and females had significantly higher Cd in liver, and chromium in lung. Generally, T. aduncus dolphins from coastal waters around Zanzibar carry low concentrations of metals compared with dolphins from other areas. Cadmium increased significantly with age in kidney and lung. Copper decreased significantly with age in liver, probably due to foetal metallothionein. This study supplied baseline data against which future trends in marine mammals in the Indian Ocean, the world's third largest, can be assessed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Leadership Training in Otolaryngology Residency.

    Science.gov (United States)

    Bent, John P; Fried, Marvin P; Smith, Richard V; Hsueh, Wayne; Choi, Karen

    2017-06-01

    Although residency training offers numerous leadership opportunities, most residents are not exposed to scripted leadership instruction. To explore one program's attitudes about leadership training, a group of otolaryngology faculty (n = 14) and residents (n = 17) was polled about their attitudes. In terms of self-perception, more faculty (10 of 14, 71.4%) than residents (9 of 17, 52.9%; P = .461) considered themselves good leaders. The majority of faculty and residents (27 of 31) thought that adults could be taught leadership ability. Given attitudes about leadership ability and the potential for improvement through instruction, consideration should be given to including such training in otolaryngology residency.

  20. Larval feeding behavior of the truncatus group of Thrypticus (Diptera: Dolichopodidae that breed in the aerenchyma of Pontederiaceae Comportamiento alimentario de las larvas del grupo truncatus de Thrypticus (Diptera: Dolichopodidae que se crían en el aerénquima de Pontederiaceae

    Directory of Open Access Journals (Sweden)

    M. Cristina Hernández

    2007-12-01

    Full Text Available Larval feeding behavior of the truncatus group of Thrypticus (Diptera: Dolichopodidae that breed in Pontederiaceae species are presented. The larvae of T. circularis Bickel & Hernández develop in globous petioles of Eichhornia crassipes (Martius Solms- Laubach (Pontederiaceae, digging a mine near the epidermis and forming several holes to the exterior. T. romus Bickel & Hernández develop in E. azurea (Sw. Kunth petioles; the mine is curved and short compared with other Thrypticus species. T. formosensis Bickel & Hernández develops in Pontederia cordata L. (Pontederiaceae, and digs the mine between the epidermis and the big central cell of the petioles. T. taragui Bickel & Hernández breeds in submersed stems of P. subovata (Seub. in Mart. Lowden, and forms a mine close to the epidermis with branches to the central vascular stele. The mines of T. yanayacu, T. chanophalus and T. azuricola could not be associated with the corresponding species. Neither predators nor parasites were found associated with the group, but some cases of cannibalism were observed when two mines were confluent. The truncatus group species have a very specific feeding habit, live completely enclosed within host plant tissues, and feed on the sap obtained from holes chewed in the vascular bundles of the petioles, possibly using yeast as supplementary nourishment. Extensive field collections and laboratory tests indicate that each species in the truncatus group is associated with a specific host plant in the Pontederiaceae. Such specialization suggests a long association between the members of this group and their respective host plants.Se da a conocer el comportamiento alimentario de las larvas de algunas especies del grupo truncatus de Thrypticus (Diptera: Dolichopodidae, que se desarrollan en plantas hospedadoras de Pontederiaceae. Los estadios inmaduros de T. circularis Bickel & Hernández se crían en los pecíolos globosos de Eichhornia crassipes (Martius Solms

  1. Lawful Permanent Residents - Annual Report

    Data.gov (United States)

    Department of Homeland Security — A lawful permanent resident (LPR) or 'green card' recipient is defined by immigration law as a person who has been granted lawful permanent residence in the United...

  2. Education Research: Neurology resident education

    Science.gov (United States)

    Mayans, David; Schneider, Logan; Adams, Nellie; Khawaja, Ayaz M.; Engstrom, John

    2016-01-01

    Objective: To survey US-trained graduating neurology residents who are American Academy of Neurology members, in an effort to trend perceived quality and completeness of graduate neurology education. Methods: An electronic survey was sent to all American Academy of Neurology members graduating from US neurology residency programs in the Spring of 2014. Results: Of 805 eligible respondents, 24% completed the survey. Ninety-three percent of adult neurology residents and 56% of child neurology residents reported plans to pursue fellowship training after residency. Respondents reported a desire for additional training in neurocritical care, neuro-oncology, neuromuscular diseases, botulinum toxin injection, and nerve blocks. There remains a clear deficit in business training of neurology residents, although there was notable improvement in knowledge of coding and office management compared to previous surveys. Discussion: Although there are still areas of perceived weakness in neurology training, graduating neurology residents feel generally well prepared for their chosen careers. However, most still pursue fellowship training for reasons that are little understood. In addition to certain subspecialties and procedures, practice management remains deficient in neurology training and is a point of future insecurity for most residents. Future curriculum changes should consider resident-reported gaps in knowledge, with careful consideration of improving business training. PMID:26976522

  3. Factors Influencing Resident Choice of Prosthodontic Residency Program.

    Science.gov (United States)

    Wojnarwsky, Pandora Keala Lee; Wang, Yan; Shah, Kumar; Koka, Sreenivas

    2017-06-01

    The decision by prosthodontic residency program directors to employ the Match process highlights the need to understand applicant priorities that influence their choice of which programs to rank highly. The purpose of this study is to determine the factors that were most important to residents when choosing from among nonmilitary based prosthodontics dental residency programs in the United States. Following completion of a pilot study, all currently enrolled prosthodontic residents at nonmilitary residency programs were invited to participate via the internet. The study consisted of a survey instrument asking residents to rank 26 possible factors that might impact an applicant's choice of residency program. In addition, the instrument collected other possible influencing variables including gender and debt load. Mean rank scores were compared to determine the most and least important factors. Kruskal-Wallis test was used to compare specific factors between the possible influencing variables. Two hundred and thirty residents completed the survey instrument, representing a 54.1% response rate of possible participants. With regard to factors influencing program choice, reputation of the residency program was the factor ranked the highest by participants, followed in descending order by the program director's personality, curriculum content, access to use of the latest digital technology, and opportunities for dental implant placement. Quality of schools for children, community outreach opportunities, and the ability to moonlight were ranked as the least important factors. Male and female residents ranked factors such as tuition/stipend, curriculum content, and community outreach opportunities significantly differently. Depending on debt load, residents ranked the factors tuition/stipend, ability to moonlight, curriculum content, and safety of the area where the program is differently. Current prosthodontic residents valued the reputation of the program as the most

  4. Pathology Informatics Essentials for Residents

    Science.gov (United States)

    Karcher, Donald S.; Harrison, James H.; Sinard, John H.; Riben, Michael W.; Boyer, Philip J.; Plath, Sue; Thompson, Arlene; Pantanowitz, Liron

    2016-01-01

    Context: Recognition of the importance of informatics to the practice of pathology has surged. Training residents in pathology informatics has been a daunting task for most residency programs in the United States because faculty often lacks experience and training resources. Nevertheless, developing resident competence in informatics is essential for the future of pathology as a specialty. Objective: To develop and deliver a pathology informatics curriculum and instructional framework that guides pathology residency programs in training residents in critical pathology informatics knowledge and skills, and meets Accreditation Council for Graduate Medical Education Informatics Milestones. Design: The College of American Pathologists, Association of Pathology Chairs, and Association for Pathology Informatics formed a partnership and expert work group to identify critical pathology informatics training outcomes and to create a highly adaptable curriculum and instructional approach, supported by a multiyear change management strategy. Results: Pathology Informatics Essentials for Residents (PIER) is a rigorous approach for educating all pathology residents in important pathology informatics knowledge and skills. PIER includes an instructional resource guide and toolkit for incorporating informatics training into residency programs that vary in needs, size, settings, and resources. PIER is available at http://www.apcprods.org/PIER (accessed April 6, 2016). Conclusions: PIER is an important contribution to informatics training in pathology residency programs. PIER introduces pathology trainees to broadly useful informatics concepts and tools that are relevant to practice. PIER provides residency program directors with a means to implement a standardized informatics training curriculum, to adapt the approach to local program needs, and to evaluate resident performance and progress over time. PMID:28725772

  5. Pathology Informatics Essentials for Residents

    Directory of Open Access Journals (Sweden)

    Walter H. Henricks MD

    2016-07-01

    Full Text Available Context: Recognition of the importance of informatics to the practice of pathology has surged. Training residents in pathology informatics has been a daunting task for most residency programs in the United States because faculty often lacks experience and training resources. Nevertheless, developing resident competence in informatics is essential for the future of pathology as a specialty. Objective: To develop and deliver a pathology informatics curriculum and instructional framework that guides pathology residency programs in training residents in critical pathology informatics knowledge and skills, and meets Accreditation Council for Graduate Medical Education Informatics Milestones. Design: The College of American Pathologists, Association of Pathology Chairs, and Association for Pathology Informatics formed a partnership and expert work group to identify critical pathology informatics training outcomes and to create a highly adaptable curriculum and instructional approach, supported by a multiyear change management strategy. Results: Pathology Informatics Essentials for Residents (PIER is a rigorous approach for educating all pathology residents in important pathology informatics knowledge and skills. PIER includes an instructional resource guide and toolkit for incorporating informatics training into residency programs that vary in needs, size, settings, and resources. PIER is available at http://www.apcprods.org/PIER (accessed April 6, 2016. Conclusions: PIER is an important contribution to informatics training in pathology residency programs. PIER introduces pathology trainees to broadly useful informatics concepts and tools that are relevant to practice. PIER provides residency program directors with a means to implement a standardized informatics training curriculum, to adapt the approach to local program needs, and to evaluate resident performance and progress over time.

  6. Incorporating resident research into the dermatology residency program

    Science.gov (United States)

    Wagner, Richard F; Raimer, Sharon S; Kelly, Brent C

    2013-01-01

    Programmatic changes for the dermatology residency program at The University of Texas Medical Branch were first introduced in 2005, with the faculty goal incorporating formal dermatology research projects into the 3-year postgraduate training period. This curriculum initially developed as a recommendation for voluntary scholarly project activity by residents, but it evolved into a program requirement for all residents in 2009. Departmental support for this activity includes assignment of a faculty mentor with similar interest about the research topic, financial support from the department for needed supplies, materials, and statistical consultation with the Office of Biostatistics for study design and data analysis, a 2-week elective that provides protected time from clinical activities for the purpose of preparing research for publication and submission to a peer-reviewed medical journal, and a departmental award in recognition for the best resident scholarly project each year. Since the inception of this program, five classes have graduated a total of 16 residents. Ten residents submitted their research studies for peer review and published their scholarly projects in seven dermatology journals through the current academic year. These articles included three prospective investigations, three surveys, one article related to dermatology education, one retrospective chart review, one case series, and one article about dermatopathology. An additional article from a 2012 graduate about dermatology education has also been submitted to a journal. This new program for residents was adapted from our historically successful Dermatology Honors Research Program for medical students at The University of Texas Medical Branch. Our experience with this academic initiative to promote dermatology research by residents is outlined. It is recommended that additional residency programs should consider adopting similar research programs to enrich resident education. PMID:23901305

  7. Burnout among Dutch medical residents

    NARCIS (Netherlands)

    Prins, J.T.; Hoekstra-Weebers, J.E.; Van De Wiel, H.B.; Gazendam-Donofrio, S.M.; Sprangers, F.; Jaspers, F.C.; van der Heijden, F.M.

    2007-01-01

    We examined levels of burnout and relationships between burnout, gender, age, years in training, and medical specialty in 158 medical residents working at the University Medical Center Groningen, the Netherlands. Thirteen percent of the residents met the criteria for burnout, with the highest

  8. Surgical residency: A tenant's view

    African Journals Online (AJOL)

    'To sleep: perchance to dream', is the frequent mantra of the surgical resident. However, unlike. Hamlet, there is no ensuing speculation as to what dreams may come as there are seldom any!! Surgical residency has been both vilified and immortalized, but the fact remains that it is one of the most challenging, provocative ...

  9. Early resident-to-resident physics education in diagnostic radiology.

    Science.gov (United States)

    Kansagra, Akash P

    2014-01-01

    The revised ABR board certification process has updated the method by which diagnostic radiology residents are evaluated for competency in clinical radiologic physics. In this work, the author reports the successful design and implementation of a resident-taught physics course consisting of 5 weekly, hour-long lectures intended for incoming first-year radiology residents in their first month of training. To the author's knowledge, this is the first description of a course designed to provide a very early framework for ongoing physics education throughout residency without increasing the didactic burden on faculty members. Twenty-six first-year residents spanning 2 academic years took the course and reported subjective improvement in their knowledge (90%) and interest (75%) in imaging physics and a high level of satisfaction with the use of senior residents as physics educators. Based on the success of this course and the minimal resources required for implementation, this work may serve as a blueprint for other radiology residency programs seeking to develop revised physics curricula. Copyright © 2014 American College of Radiology. Published by Elsevier Inc. All rights reserved.

  10. Needs Assessment for Incoming PGY-1 Residents in Neurosurgical Residency.

    Science.gov (United States)

    Brandman, David M; Haji, Faizal A; Matte, Marie C; Clarke, David B

    2015-01-01

    Residents must develop a diverse range of skills in order to practice neurosurgery safely and effectively. The purpose of this study was to identify the foundational skills required for neurosurgical trainees as they transition from medical school to residency. Based on the CanMEDS competency framework, a web-based survey was distributed to all Canadian academic neurosurgical centers, targeting incoming and current PGY-1 neurosurgical residents as well as program directors. Using Likert scale and free-text responses, respondents rated the importance of various cognitive (e.g. management of raised intracranial pressure), technical (e.g. performing a lumbar puncture) and behavioral skills (e.g. obtaining informed consent) required for a PGY-1 neurosurgical resident. Of 52 individuals contacted, 38 responses were received. Of these, 10 were from program directors (71%), 11 from current PGY-1 residents (58%) and 17 from incoming PGY-1 residents (89%). Respondents emphasized operative skills such as proper sterile technique and patient positioning; clinical skills such as lesion localization and interpreting neuro-imaging; management skills for common scenarios such as raised intracranial pressure and status epilepticus; and technical skills such as lumbar puncture and external ventricular drain placement. Free text answers were concordant with the Likert scale results. We surveyed Canadian neurosurgical program directors and PGY-1 residents to identify areas perceived as foundational to neurosurgical residency education and training. This information is valuable for evaluating the appropriateness of a training program's goals and objectives, as well as for generating a national educational curriculum for incoming PGY-1 residents.

  11. Helping Residents Protect Water Sources

    Science.gov (United States)

    Building on the successful early engagement of the Plain Sect agricultural community, the Eastern Lancaster County Source Water Protection Collaborative is expanding its efforts to involve local residents in the work of protecting drinking water sources.

  12. the contribution of resident physicians

    OpenAIRE

    Trusch, Klaus

    2011-01-01

    A telephone survey of resident physicians to the basic conditions in which they work has been conducted in 14 of the 16 federal states. In the center of the survey stood the general medicine within the prisons. This limitation was necessary in order to achieve comparability to primary medical care outside of correctional services. There are 140 salaried and tenured resident pysicians and 97 contract doctors in the general medical care of approx. 70000 prisoners in 185 independent prisons ...

  13. 77 FR 2040 - Taking and Importing Marine Mammals: Taking Marine Mammals Incidental to Navy Training Exercises...

    Science.gov (United States)

    2012-01-13

    ...-review papers (e.g., Perrin et al. (1979), W[uuml]rsig and W[uuml]rsig (1979), Hui (1987), and Mate et al... truncatus 3.08 W[uuml]rsig and W[uuml]rsig (1979) Delphinus delphis 3.11 Hui (1987) Tursiops truncatus 2.65.../min) for a delphinid based on Perrin et al. (1979), W[uuml]rsig and W[uuml]rsig (1979), Hui (1987...

  14. Minimum Data Set Active Resident Information Report

    Data.gov (United States)

    U.S. Department of Health & Human Services — The MDS Active Resident Report summarizes information for residents currently in nursing homes. The source of these counts is the residents MDS assessment record....

  15. Sleep Quality Among Psychiatry Residents.

    Science.gov (United States)

    Carvalho Aguiar Melo, Matias; das Chagas Medeiros, Francisco; Meireles Sales de Bruin, Veralice; Pinheiro Santana, José Abraão; Bastos Lima, Alexandre; De Francesco Daher, Elizabeth

    2016-01-01

    Medical residency programs are traditionally known for long working hours, which can be associated with a poor quality of sleep and daytime sleepiness. However, few studies have focused on this theme. Our objective was to investigate sleep quality, daytime sleepiness, and their relation with anxiety, social phobia, and depressive symptoms. This cross-sectional observational study involved 59 psychiatry residents. The Pittsburgh Sleep Quality Index (PSQI) and the Epworth Sleepiness Scale (ESS) were used to measure the quality of sleep and excessive daytime sleepiness ([EDS] and ESS > 10), respectively. Among the 59 psychiatry residents, 59.3% had poor sleep quality (PSQI > 5) and 28.8% had EDS. Poor sleep quality was associated with higher EDS (P = 0.03) and the year of residency program (P = 0.03). Only 20% of residents with poor sleep had consulted at least once for sleep problems; 54.2% had used medications for sleep; and 16.9% were using medications at the time of interview. Only 30% obtained medication during medical consultations. Poor sleep was associated with irregular sleep hours (P = 0.001) and long periods lying down without sleep (P = 0.03). Poor sleep quality was also associated with high scores of anxiety symptoms (P Psychiatry residents frequently have poor sleep quality and EDS. Considering that sleep disorders can affect quality of life, predispose to metabolic syndrome, and be associated with worse performance at work, attention to this clinical problem is needed. © The Author(s) 2016.

  16. Selection criteria of residents for residency programs in Kuwait.

    Science.gov (United States)

    Marwan, Yousef; Ayed, Adel

    2013-01-19

    In Kuwait, 21 residency training programs were offered in the year 2011; however, no data is available regarding the criteria of selecting residents for these programs. This study aims to provide information about the importance of these criteria. A self-administered questionnaire was used to collect data from members (e.g. chairmen, directors, assistants …etc.) of residency programs in Kuwait. A total of 108 members were invited to participate. They were asked to rate the importance level (scale from 1 to 5) of criteria that may affect the acceptance of an applicant to their residency programs. Average scores were calculated for each criterion. Of the 108 members invited to participate, only 12 (11.1%) declined to participate. Interview performance was ranked as the most important criteria for selecting residents (average score: 4.63/5.00), followed by grade point average (average score: 3.78/5.00) and honors during medical school (average score: 3.67/5.00). On the other hand, receiving disciplinary action during medical school and failure in a required clerkship were considered as the most concerning among other criteria used to reject applicants (average scores: 3.83/5.00 and 3.54/5.00 respectively). Minor differences regarding the importance level of each criterion were noted across different programs. This study provided general information about the criteria that are used to accept/reject applicants to residency programs in Kuwait. Future studies should be conducted to investigate each criterion individually, and to assess if these criteria are related to residents' success during their training.

  17. Long-term responses of Burrunan dolphins (Tursiops australis to swim-with dolphin tourism in Port Phillip Bay, Victoria, Australia: A population at risk

    Directory of Open Access Journals (Sweden)

    Nicole E. Filby

    2014-12-01

    Full Text Available This study investigated Burrunan dolphin responses to dolphin-swim tour vessels across two time periods: 1998–2000 and 2011–2013. A total of 211 dolphin sightings were documented across 306 surveys. Sighting success rate and mean encounter time with dolphins decreased significantly by 12.8% and 8.2 min, respectively, between periods. Approaches that did not contravene regulations elicited highest approach responses by dolphins towards tour vessels, whereas dolphins’ responded to illegal approaches most frequently with avoidance. Small groups responded to tour vessels with avoidance significantly more than large groups. Initial dolphin behaviour had a strong effect on dolphin’s responses to tour vessels, with resting groups the most likely to exhibit avoidance. Calves were significantly more likely to be present during swims in 2011–2013. Dolphin’s responses to tour vessels changed across time, with effect responses (avoidance and approach increasing significantly as dolphins gained cumulative experience. These dolphins are forced to expend a greater level of time and energy avoiding or approaching boats, shifting from a non-effect response to an effect response. Consequences of this include possible decrease in biological fitness by detracting from core biological activities such as foraging and resting. Combined with a decrease in sighting success between periods, the results imply that this population of dolphins, which is endemic to Australia and listed as threatened under the Victorian Flora and Fauna Guarantee Act 1988, may not be well suited to the dolphin-swim industry. The management implications of these results warrant a shift from passive to active management in Port Phillip Bay. The importance of long-term research is highlighted, given behavioural responses detected herein would be undetected in short-term studies. Keywords: Burrunan dolphin (Tursiops australis, Avoidance, Behaviour, Compliance, Management

  18. Demographic clusters identified within the northern Gulf of Mexico common bottlenose dolphin (Tursiops truncates unusual mortality event: January 2010-June 2013.

    Directory of Open Access Journals (Sweden)

    Stephanie Venn-Watson

    Full Text Available A multi-year unusual mortality event (UME involving primarily common bottlenose dolphins (Tursiops truncates was declared in the northern Gulf of Mexico (GoM with an initial start date of February 2010 and remains ongoing as of August 2014. To examine potential changing characteristics of the UME over time, we compared the number and demographics of dolphin strandings from January 2010 through June 2013 across the entire GoM as well as against baseline (1990-2009 GoM stranding patterns. Years 2010 and 2011 had the highest annual number of stranded dolphins since Louisiana's record began, and 2011 was one of the years with the highest strandings for both Mississippi and Alabama. Statewide, annual numbers of stranded dolphins were not elevated for GoM coasts of Florida or Texas during the UME period. Demographic, spatial, and temporal clusters identified within this UME included increased strandings in northern coastal Louisiana and Mississippi (March-May 2010; Barataria Bay, Louisiana (August 2010-December 2011; Mississippi and Alabama (2011, including a high prevalence and number of stranded perinates; and multiple GoM states during early 2013. While the causes of the GoM UME have not been determined, the location and magnitude of dolphin strandings during and the year following the 2010 Deepwater Horizon oil spill, including the Barataria Bay cluster from August 2010 to December 2011, overlap in time and space with locations that received heavy and prolonged oiling. There are, however, multiple known causes of previous GoM dolphin UMEs, including brevetoxicosis and dolphin morbillivirus. Additionally, increased dolphin strandings occurred in northern Louisiana and Mississippi before the Deepwater Horizon oil spill. Identification of spatial, temporal, and demographic clusters within the UME suggest that this mortality event may involve different contributing factors varying by location, time, and bottlenose dolphin populations that will be

  19. Applying Expectancy Theory to residency training: proposing opportunities to understand resident motivation and enhance residency training

    Directory of Open Access Journals (Sweden)

    Shweiki E

    2015-04-01

    Full Text Available Ehyal Shweiki,1 Niels D Martin,2 Alec C Beekley,1 Jay S Jenoff,1 George J Koenig,1 Kris R Kaulback,1 Gary A Lindenbaum,1 Pankaj H Patel,1 Matthew M Rosen,1 Michael S Weinstein,1 Muhammad H Zubair,2 Murray J Cohen1 1Department of Surgery, Thomas Jefferson University Hospital, Philadelphia, PA, USA; 2Department of Surgery, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, PA, USA Abstract: Medical resident education in the United States has been a matter of national priority for decades, exemplified initially through the Liaison Committee for Graduate Medical Education and then superseded by the Accreditation Council for Graduate Medical Education. A recent Special Report in the New England Journal of Medicine, however, has described resident educational programs to date as prescriptive, noting an absence of innovation in education. Current aims of contemporary medical resident education are thus being directed at ensuring quality in learning as well as in patient care. Achievement and work-motivation theories attempt to explain people's choice, performance, and persistence in tasks. Expectancy Theory as one such theory was reviewed in detail, appearing particularly applicable to surgical residency training. Correlations between Expectancy Theory as a work-motivation theory and residency education were explored. Understanding achievement and work-motivation theories affords an opportunity to gain insight into resident motivation in training. The application of Expectancy Theory in particular provides an innovative perspective into residency education. Afforded are opportunities to promote the development of programmatic methods facilitating surgical resident motivation in education. Keywords: learning, education, achievement

  20. Evaluating Dermatology Residency Program Websites.

    Science.gov (United States)

    Ashack, Kurt A; Burton, Kyle A; Soh, Jonathan M; Lanoue, Julien; Boyd, Anne H; Milford, Emily E; Dunnick, Cory; Dellavalle, Robert P

    2016-03-16

    Internet resources play an important role in how medical students access information related to residency programs.Evaluating program websites is necessary in order to provide accurate information for applicants and provide information regarding areas of website improvement for programs. To date, dermatology residency websites (D  WS) have not been evaluated.This paper evaluates dermatology residency websites based on availability of predefined measures. Using the FREIDA (Fellowship and Residency Electronic Interactive Database) Online database, authors searched forall accredited dermatology program websites. Eligible programs were identified through the FREIDA Online database and had a functioning website. Two authors independently extracted data with consensus or third researcher resolution of differences. This data was accessed and archived from July 15th to July 17th, 2015.Primary outcomes measured were presence of content on education, resident and faculty information, program environment, applicant recruitment, schedule, salary, and website quality evaluated using an online tool (WooRank.com). Out of 117 accredited dermatology residencies, 115 had functioning webpages. Of these, 76.5% (75) had direct links found on the FRIEDA Online database. Most programs contained information on education, faculty, program environment, and applicant recruitment. However, website quality and marketing effectiveness were highly variable; most programs were deemed to need improvements in the functioning of their webpages. Also, additional information on current residents and about potential away rotations were lacking from most websites with only 52.2% (60) and 41.7% (48) of programs providing this content, respectively. A majority of dermatology residency websites contained adequate information on many of the factors we evaluated. However, many were lacking in areas that matter to applicants. We hope this report will encourage dermatology residencyprograms

  1. Simulation Activity in Otolaryngology Residencies.

    Science.gov (United States)

    Deutsch, Ellen S; Wiet, Gregory J; Seidman, Michael; Hussey, Heather M; Malekzadeh, Sonya; Fried, Marvin P

    2015-08-01

    Simulation has become a valuable tool in medical education, and several specialties accept or require simulation as a resource for resident training or assessment as well as for board certification or maintenance of certification. This study investigates current simulation resources and activities in US otolaryngology residency programs and examines interest in advancing simulation training and assessment within the specialty. Web-based survey. US otolaryngology residency training programs. An electronic web-based survey was disseminated to all US otolaryngology program directors to determine their respective institutional and departmental simulation resources, existing simulation activities, and interest in further simulation initiatives. Descriptive results are reported. Responses were received from 43 of 104 (43%) residency programs. Simulation capabilities and resources are available in most respondents' institutions (78.6% report onsite resources; 73.8% report availability of models, manikins, and devices). Most respondents (61%) report limited simulation activity within otolaryngology. Areas of simulation are broad, addressing technical and nontechnical skills related to clinical training (94%). Simulation is infrequently used for research, credentialing, or systems improvement. The majority of respondents (83.8%) expressed interest in participating in multicenter trials of simulation initiatives. Most respondents from otolaryngology residency programs have incorporated some simulation into their curriculum. Interest among program directors to participate in future multicenter trials appears high. Future research efforts in this area should aim to determine optimal simulators and simulation activities for training and assessment as well as how to best incorporate simulation into otolaryngology residency training programs. © American Academy of Otolaryngology—Head and Neck Surgery Foundation 2015.

  2. Plagiarism in residency application essays.

    Science.gov (United States)

    Segal, Scott; Gelfand, Brian J; Hurwitz, Shelley; Berkowitz, Lori; Ashley, Stanley W; Nadel, Eric S; Katz, Joel T

    2010-07-20

    Anecdotal reports suggest that some residency application essays contain plagiarized content. To determine the prevalence of plagiarism in a large cohort of residency application essays. Retrospective cohort study. 4975 application essays submitted to residency programs at a single large academic medical center between 1 September 2005 and 22 March 2007. Specialized software was used to compare residency application essays with a database of Internet pages, published works, and previously submitted essays and the percentage of the submission matching another source was calculated. A match of more than 10% to an existing work was defined as evidence of plagiarism. Evidence of plagiarism was found in 5.2% (95% CI, 4.6% to 5.9%) of essays. The essays of non-U.S. citizens were more likely to demonstrate evidence of plagiarism. Other characteristics associated with the prevalence of plagiarism included medical school location outside the United States and Canada; previous residency or fellowship; lack of research experience, volunteer experience, or publications; a low United States Medical Licensing Examination Step 1 score; and non-membership in the Alpha Omega Alpha Honor Medical Society. The software database is probably incomplete, the 10%-match threshold for defining plagiarism has not been statistically validated, and the study was confined to applicants to 1 institution. Evidence of matching content in an essay cannot be used to infer the applicant's intent and is not sensitive to variations in the cultural context of copying in some societies. Evidence of plagiarism in residency application essays is more common in international applicants but was found in those by applicants to all specialty programs, from all medical school types, and even among applicants with significant academic honors. No external funding.

  3. 38 CFR 51.70 - Resident rights.

    Science.gov (United States)

    2010-07-01

    ... FOR NURSING HOME CARE OF VETERANS IN STATE HOMES Standards § 51.70 Resident rights. The resident has a... legal representative. (5) Conveyance upon death. Upon the death of a resident with a personal fund...; (iii) Physicians of the resident's choice (to provide care in the nursing home, physicians must meet...

  4. Mentorship in orthopaedic and trauma residency training ...

    African Journals Online (AJOL)

    Background: Mentorship is important in residency training as it is necessary for personal and professional development of the resident trainees. Objectives: This study documents mentorship in orthopaedic residency training programme in Nigeria by assessing the awareness of orthopaedic residents on the role of a mentor, ...

  5. Surgery resident learning styles and academic achievement.

    Science.gov (United States)

    Contessa, Jack; Ciardiello, Kenneth A; Perlman, Stacie

    2005-01-01

    To determine if surgical residents share a preferred learning style as measured by Kolb's Learning Style Inventory (LSI) and if a relationship exists between resident learning style and achievement as measured by a standardized examination (AME). Also, core faculty learning styles were assessed to determine if faculty and residents share a preferred learning style. Kolb's LSI, Version 3, was administered to 16 surgical residents and the residency program's core faculty of 6 attending physicians. To measure academic achievement, the American Medical Education (AME) examination was administered to residents. The Hospital of Saint Raphael, General Surgery Residency Program, New Haven, Connecticut. Both instruments were administered to residents during protected core curriculum time. Core faculty were administered the LSI on an individual basis. Surgical residents of the Hospital of Saint Raphael's General Surgery Residency Program and 6 core faculty members Analysis of resident learning style preference revealed Converging as the most commonly occurring style for residents (7) followed by Accommodating (5), Assimilating (3), and Diverging (1). The predominant learning style for core faculty was also Converging (4) with 2 Divergers. The average score for the Convergers on the AME was 62.6 compared with 42 for the next most frequently occurring learning style, Accommodators. In this surgical residency program, a preferred learning style for residents seems to exist (Converging), which confirms what previous studies have found. Additionally, residents with this learning style attained a higher average achievement score as measured by the AME. Also, core faculty share the same preferential learning style as this subset of residents.

  6. The resident's view of residency training in Canada.

    Science.gov (United States)

    Fish, D G

    1966-04-09

    In the view of residents in their last year of specialty training, the Fellowship is now becoming the operative standard for obtaining hospital privileges in urban centres and they felt that this implied that the two standards, the Certificate and the Fellowship of the Royal College, were not achieving the purpose for which they were designed. Although 80% of the residents intended to write the Fellowship, few viewed a year in a basic science department or in research as of intrinsic value in terms of their future practice.The examinations of the Royal College were the subject of criticism, most residents feeling that the examinations did not test the knowledge and ability gained in training. Most expressed a desire for ongoing evaluation during the training period.Service responsibilities were generally regarded as too heavy.Despite the criticism of both training and examination, most residents felt that their training had provided them with the experience and background they needed to practise as specialists.

  7. Conversations with Holocaust survivor residents.

    Science.gov (United States)

    Hirst, Sandra P; LeNavenec, Carole Lynne; Aldiabat, Khaldoun

    2011-03-01

    Traumatic events in one's younger years can have an impact on how an individual copes with later life. One traumatic experience for Jewish individuals was the Holocaust. Some of these people are moving into long-term care facilities. It was within this context that the research question emerged: What are Holocaust survivor residents' perceptions of a life lived as they move into a long-term care facility? For this qualitative study, Holocaust survivors were individually interviewed. Findings emphasize that nursing care needs to ensure that Holocaust survivor residents participate in activities, receive timely health care, and receive recognition of their life experiences. Copyright 2011, SLACK Incorporated.

  8. Model Legislation on Student Residency.

    Science.gov (United States)

    Higher Education in the States, 1971

    1971-01-01

    Because of the radical variance in residency requirements from state to state and sometimes from institution to institution, and because of several court cases involving this issue, the Education Commission of the States appointed a Committee to develop (1) a statement of principles for consideration in drafting legislation in connection with…

  9. From Residency to Lifelong Learning.

    Science.gov (United States)

    Brandt, Keith

    2015-11-01

    The residency training experience is the perfect environment for learning. The university/institution patient population provides a never-ending supply of patients with unique management challenges. Resources abound that allow the discovery of knowledge about similar situations. Senior teachers provide counseling and help direct appropriate care. Periodic testing and evaluations identify deficiencies, which can be corrected with future study. What happens, however, when the resident graduates? Do they possess all the knowledge they'll need for the rest of their career? Will medical discovery stand still limiting the need for future study? If initial certification establishes that the physician has the skills and knowledge to function as an independent physician and surgeon, how do we assure the public that plastic surgeons will practice lifelong learning and remain safe throughout their career? Enter Maintenance of Certification (MOC). In an ideal world, MOC would provide many of the same tools as residency training: identification of gaps in knowledge, resources to correct those deficiencies, overall assessment of knowledge, feedback about communication skills and professionalism, and methods to evaluate and improve one's practice. This article discusses the need; for education and self-assessment that extends beyond residency training and a commitment to lifelong learning. The American Board of Plastic Surgery MOC program is described to demonstrate how it helps the diplomate reach the goal of continuous practice improvement.

  10. Student Expenses in Residency Interviewing.

    Science.gov (United States)

    Walling, Anne; Nilsen, Kari; Callaway, Paul; Grothusen, Jill; Gillenwater, Cole; King, Samantha; Unruh, Gregory

    2017-08-01

    The student costs of residency interviewing are of increasing concern but limited current information is available. Updated, more detailed information would assist students and residency programs in decisions about residency selection. The study objective was to measure the expenses and time spent in residency interviewing by the 2016 graduating class of the University of Kansas School of Medicine and assess the impact of gender, regional campus location, and primary care application. All 195 students who participated in the 2016 National Residency Matching Program (NRMP) received a 33 item questionnaire addressing interviewing activity, expenses incurred, time invested and related factors. Main measures were self-reported estimates of expenses and time spent interviewing. Descriptive analyses were applied to participant characteristics and responses. Multivariate analysis of variance (MANOVA) and chi-square tests compared students by gender, campus (main/regional), and primary care/other specialties. Analyses of variance (ANOVA) on the dependent variables provided follow-up tests on significant MANOVA results. A total of 163 students (84%) completed the survey. The average student reported 38 (1-124) applications, 16 (1-54) invitations, 11 (1-28) completed interviews, and spent $3,500 ($20-$12,000) and 26 (1-90) days interviewing. No significant differences were found by gender. After MANOVA and ANOVA analyses, non-primary care applicants reported significantly more applications, interviews, and expenditures, but less program financial support. Regional campus students reported significantly fewer invitations, interviews, and days interviewing, but equivalent costs when controlled for primary care application. Cost was a limiting factor in accepting interviews for 63% and time for 53% of study respondents. Students reported investing significant time and money in interviewing. After controlling for other variables, primary care was associated with significantly

  11. Teaching residents to write a research paper.

    Science.gov (United States)

    Coleridge, S T

    1993-09-01

    Medical writing and publications are important in developing a scholarly basis for residency programs and in providing a learning experience for both resident and faculty mentors. Residency directors must provide the stimulus and support for both faculty and residents' varied creative activities. This support manifests itself in a commitment to scholarly activity (including a dedicated research person), the procurement of available research materials, the establishment of a process or plan for beginning a research project, and the development of a method for rewarding or recognizing faculty and residents who produce scholarly works. Some osteopathic residency programs may need to train faculty in research skills at the same time that residents are learning to write. Trained faculty are better models and coaches for residents engaged in research. Beginning with a fundamental, but disciplined, writing program, both faculty and residents may learn methods for sharing new knowledge or acquiring those skills necessary to critically analyze the medical literature.

  12. A patient safety curriculum for medical residents based on the perspectives of residents and supervisors

    NARCIS (Netherlands)

    Jansma, J.D.; Wagner, C.; Bijnen, A.B.

    2011-01-01

    Objectives: To develop a patient safety course for medical residents based on the views of medical residents and their supervisors. Methods: In 2007, questionnaires were distributed to investigate residents' and supervisors' perspectives on the current patient safety performance and educational

  13. Feasibility of an innovative third-year chief resident system: an internal medicine residency leadership study.

    Science.gov (United States)

    Kolade, Victor O; Staton, Lisa J; Jayarajan, Ramesh; Bentley, Nanette K; Huang, Xiangke

    2014-01-01

    The role of the internal medicine chief resident includes various administrative, academic, social, and educational responsibilities, fulfillment of which prepares residents for further leadership tasks. However, the chief resident position has historically only been held by a few residents. As fourth-year chief residents are becoming less common, we considered a new model for rotating third-year residents as the chief resident. Online surveys were given to all 29 internal medicine residents in a single university-based program after implementation of a leadership curriculum and specific job description for the third-year chief resident. Chief residents evaluated themselves on various aspects of leadership. Participation was voluntary. Descriptive statistics were generated using SPSS version 21. Thirteen junior (first- or second-year) resident responses reported that the chief residents elicited input from others (mean rating 6.8), were committed to the team (6.8), resolved conflict (6.7), ensured efficiency, organization and productivity of the team (6.7), participated actively (7.0), and managed resources (6.6). Responses from senior residents averaged 1 point higher for each item; this pattern repeated itself in teaching evaluations. Chief resident self-evaluators were more comfortable running a morning report (8.4) than with being chief resident (5.8). The feasibility of preparing internal medicine residents for leadership roles through a rotating PGY-3 (postgraduate year) chief residency curriculum was explored at a small internal medicine residency, and we suggest extending the study to include other programs.

  14. Lawful Permanent Residents Fiscal Year 2011 Country

    Data.gov (United States)

    Department of Homeland Security — Lawful permanet residents (LPRs) are foreign nationals who have been gratned the right to reside permanently in the United States. LPRs are also known as 'permanent...

  15. Lawful Permanent Residents Fiscal Year 2014 Country

    Data.gov (United States)

    Department of Homeland Security — Lawful permanent residents (LPRs) are foreign nationals who have been granted the right to reside permanently in the United States. LPRs are also known as 'permanent...

  16. Lawful Permanent Residents Fiscal Year 2015 State

    Data.gov (United States)

    Department of Homeland Security — Lawful permanent residents (LPRs) are foreign nationals who have been granted the right to reside permanently in the United States. LPRs are also known as 'permanent...

  17. Lawful Permanent Residents Fiscal Year 2014 State

    Data.gov (United States)

    Department of Homeland Security — Lawful permanent residents (LPRs) are foreign nationals who have been granted the right to reside permanently in the United States. LPRs are also known as 'permanent...

  18. Lawful Permanent Residents Fiscal Year 2011 State

    Data.gov (United States)

    Department of Homeland Security — Lawful permanent residents (LPRs) are foreign nationals who have been granted the right to reside permanently in the United States. LPRs are also known as 'permanent...

  19. Lawful Permanent Residents Fiscal Year 2016 State

    Data.gov (United States)

    Department of Homeland Security — Lawful permanent residents (LPRs) are foreign nationals who have been granted the right to reside permanently in the United States. LPRs are also known as 'permanent...

  20. Lawful Permanent Residents Fiscal Year 2015 Country

    Data.gov (United States)

    Department of Homeland Security — Lawful permanent residents (LPRs) are foreign nationals who have been granted the right to reside permanently in the United States. LPRs are also known as 'permanent...

  1. The Chief Resident Role in Emergency Medicine Residency Programs

    Directory of Open Access Journals (Sweden)

    Hafner, John W. Jr., MD, MPH

    2010-05-01

    Full Text Available Study Objectives: Although other specialties have examined the role of the chief resident (CR, the role and training of the emergency medicine (EM CR has largely been undefined.Methods: A survey was mailed to all EM CRs and their respective program directors (PD in 124 EM residency programs. The survey consisted of questions defining demographics, duties of the typical CR, and opinions regarding the level of support and training received. Multiple choice, Likert scale (1 strong agreement, 5 strong disagreement and short-answer responses were used. We analyzed associations between CR and PD responses using Chi-square, Student’s T and Mann-Whitney U tests.Results: Seventy-six percent of CRs and 65% of PDs responded and were similar except for age (31 vs. 42 years; p<0.001. CR respondents were most often male, in year 3 of training and held the position for 12 months. CRs and PDs agreed that the assigned level of responsibility is appropriate (2.63 vs. 2.73, p=0.15; but CRs underestimate their influence in the residency program (1.94 vs. 2.34, p=0.002 and the emergency department (2.61 vs. 3.03, p=0.002. The majority of CRs (70% and PDs (77% report participating in an extramural training program, and those CRs who participated in training felt more prepared for their job duties (2.26 vs. 2.73; p=0.03.Conclusion: EM CRs feel they have appropriate job responsibility but believe they are less influential in program and department administration than PD respondents. Extramural training programs for incoming CRs are widely used and felt to be helpful. [West J Emerg Med. 2010; 11(2:120-125.

  2. 75 FR 64247 - Marine Mammals; File No. 15543

    Science.gov (United States)

    2010-10-19

    ... including paternity patterns, and human interactions. The sampling and tagging would support studies of... (Principal Investigator), Sarasota Dolphin Research Program, c/o Mote Marine Laboratory, 1600 Ken Thompson... dolphins (Tursiops truncatus). DATES: Written, telefaxed, or e-mail comments must be received on or before...

  3. Pinniped Hearing in Complex Acoustic Environments

    Science.gov (United States)

    2013-09-30

    noise (Dooling et al., 2009; Lohr et al., 2003) and build upon previous research in our laboratory on hearing capabilities and cognitive processing of...Trickey, J. S., Bakhtiari, K., Black, A., Aihara, H., & Finneran, J. J. (2013). Auditory masking patterns in bottlenose dolphins (Tursiops truncatus) with

  4. 76 FR 35411 - Marine Mammals; File No. 16000

    Science.gov (United States)

    2011-06-17

    ... conduct commercial/educational photography. ADDRESSES: The permit and related documents are available for... commercial/educational photography of bottlenose dolphins (Tursiops truncatus) had been submitted by the.... Filmmakers may use two filming platforms: an inflatable 21ft boat and a helicopter. Up to 500 dolphins...

  5. 78 FR 33811 - Marine Mammals; File No. 17941

    Science.gov (United States)

    2013-06-05

    ... permit has been issued to Brian Skerry, 285 High Street, Uxbridge, MA 01569, to conduct commercial or educational photography on bottlenose (Tursiops truncatus) and spinner (Stenella longirostris) dolphins... Register (78 FR 17639) that a request for a permit to conduct commercial/educational photography had been...

  6. Development of specific cytokine and Chemokine ELISAs for Bottlenose Dolphins

    Science.gov (United States)

    Earlier detection of changes in the health status of bottlenose dolphins (Tursiops truncatus) is expected to further improve their medical care. Cytokines and chemokines are critical mediators of the cellular immune response, and studies have suggested that these molecules may serve as important bio...

  7. African Zoology - Vol 27, No 2 (1992)

    African Journals Online (AJOL)

    Feeding and growth in a captive-born bottlenose dolphin Tursiops truncatus · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. V.M. Peddemors, M Fothergill, V.G. Cockcroft, 74-80 ...

  8. Longitudinal monitoring of bottlenose dolphin leukocyte cytokine mRNA responsiveness by qPCR

    Science.gov (United States)

    Both veterinarians caring for bottlenose dolphins (Tursiops truncatus) in managed populations and researchers monitoring wild populations use blood-based diagnostics to monitor bottlenose dolphin health. Quantitative PCR (qPCR) can be used to assess cytokine expression patterns of peripheral blood m...

  9. Cetacean strandings along the coast of Izmir Bay, Turkey

    NARCIS (Netherlands)

    Guclusoy, H.; Veryeri, N.; Cirik, S.

    2004-01-01

    The present paper provides information on the stranding of cetaceans in Izmir Bay, Aegean Sea, between 1992 and 2004. The data were collected opportunistically during sightings and stranding data collection for Monk Seals. A total of 12 cetaceans, namely Bottle-nosed Dolphin, Tursiops truncatus

  10. PFOS and PFOSA in Bottlenose Dolphins: An Investigation into Two Unusually High Mortality Epizootics

    Science.gov (United States)

    Along the Atlantic coast of the United States during 1987 and 1988, bottlenose dolphins (Tursiops truncatus) suffered one of this country's largest marine mammal mass mortality events. An estimated 50% of all near-shore bottlenose died during this short period. Two years later a ...

  11. PFOS and PFOSA in Bottlenose Dolphins: An Investigation into Two Unusual Mortality Epizootics (WDA)

    Science.gov (United States)

    Along the Atlantic coast of the United States during 1987 and 1988, bottlenose dolphins (Tursiops truncatus) suffered one of this country's largest marine mammal mass mortality events. An estimated 50% of all near-shore bottlenose died during this short period. Two years later a ...

  12. Browse Title Index

    African Journals Online (AJOL)

    Issue, Title. Vol 32, No 4 (1997), Shark and skate egg-cases cast up on two South African beaches and their rates of hatching success, or causes of death, Abstract PDF. Craig Smith, Charles Griffiths. Vol 24, No 4 (1989), Shark predation on Indian Ocean bottlenose dolphins Tursiops truncatus off Natal, South Africa ...

  13. PFOS and PFOSA in Bottlenose Dolphins: An Investigation into Two High Mortality Epizootics (NRMMSTSN2009)

    Science.gov (United States)

    Along the Atlantic coast of the United States during 1987 and 1988, bottlenose dolphins (Tursiops truncatus) suffered one of this country's largest marine mammal mass mortality events. An estimated 50% of all near-shore bottlenose died during this short period. Two years later a ...

  14. PFOS and PFOSA in Bottlenose Dolphins: An Investigation into Two Unusually High Mortality Events

    Science.gov (United States)

    Along the Atlantic coast of the United States during 1987 and 1988, bottlenose dolphins (Tursiops truncatus) suffered one of this country's largest marine mammal mass mortality events. An estimated 50% of all near-shore bottlenose died during this short period. Two years later a ...

  15. Browse Title Index

    African Journals Online (AJOL)

    Venetia Stuart, J.G. Field. Vol 10, No 1 (1975), Respiratory characteristics of the blood of Labeo umbratus(Smith) and Labeo capensis (Smith), Abstract PDF. AJJ Van Pletzen, J Hattingh. Vol 25, No 3 (1990), Respiratory development in a captive-born bottlenose dolphin Tursiops truncatus calf, Abstract PDF. V.M. Peddemors.

  16. Author Details

    African Journals Online (AJOL)

    Aguilar, N. Vol 36, No 1 (2014) - Articles Inter-island movements of common bottlenose dolphins Tursiops truncatus among the Canary Islands: online catalogues and implications for conservation and management. Abstract. ISSN: 1814-232X. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for ...

  17. Sleep behaviour: activity and sleep in dolphins.

    Science.gov (United States)

    Gnone, Guido; Moriconi, Tiziana; Gambini, Giorgia

    2006-06-22

    According to Lyamin and co-authors, neonate bottlenose dolphins (Tursiops truncatus) almost never sleep, unlike all other mammals that have been studied. Although we agree that young dolphins never stop and float at the surface, we find that they spend a considerable amount of time asleep while swimming. Our findings therefore call into question the conclusions of Lyamin et al..

  18. The Cetaceans

    NARCIS (Netherlands)

    Verwey, J.

    1975-01-01

    In this paper observations are summarized, dealing with the occurrence, movements and part of the life-history of the Cetaceans Tursiops truncatus (the bottlenosed dolphin) and Phocoena phocoena (the harbour porpoise or common porpoise). The observations were made in the neighbourhood

  19. Pediatric Program Leadership's Contribution Toward Resident Wellness.

    Science.gov (United States)

    Carson, Savanna L; Perkins, Kate; Reilly, Maura R; Sim, Myung-Shin; Li, Su-Ting T

    2018-02-27

    Residency program leaders are required to support resident well-being, but often do not receive training in how to do so. Determine frequency in which program leadership provides support for resident well-being, comfort in supporting resident well-being, and factors associated with need for additional training in supporting resident well-being. National cross-sectional web-based survey of pediatric program directors, associate program directors, and coordinators in June 2015, on their experience supporting resident well-being. Univariate and bivariate descriptive statistics compared responses between groups. Generalized linear modeling, adjusting for program region, size, program leadership role, and number of years in role determined factors associated with need for additional training. 39.3% (322/820) of participants responded. Most respondents strongly agreed that supporting resident well-being is an important part of their role, but few reported supporting resident well-being as part of their job description. Most reported supporting residents' clinical, personal, and health issues at least annually, and in some cases weekly, with 72% spending >10% of their time on resident well-being. Most program leaders desired more training. After adjusting for level of comfort in dealing with resident well-being issues, program leaders more frequently exposed to resident well-being issues were more likely to desire additional training (pProgram leaders spend a significant amount of time supporting resident well-being. While they feel that supporting resident well-being is an important part of their job, opportunities exist for developing program leaders through including resident wellness on job descriptions and training program leaders how to support resident well-being. Copyright © 2018 Academic Pediatric Association. Published by Elsevier Inc. All rights reserved.

  20. 45 CFR 233.40 - Residence.

    Science.gov (United States)

    2010-10-01

    .... For purposes of this section: (1) A resident of a State is one: (i) Who is living in the State... resident of the State in which he or she is living other than on a temporary basis. Residence may not depend upon the reason for which the individual entered the State, except insofar as it may bear upon...

  1. Breaking Bad News - Perceptions of Pediatric Residents.

    Science.gov (United States)

    Geeta, M G; Krishnakumar, P

    2017-08-15

    The present study evaluated the perceptions and practice of 92 final year pediatric residents with regard to breaking bad news. Only 16% of residents had received any training in communication skills. Majority (65%) of the residents were not comfortable while breaking bad news.

  2. 8 CFR 325.3 - Residence.

    Science.gov (United States)

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Residence. 325.3 Section 325.3 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY NATIONALITY REGULATIONS NATIONALS BUT NOT CITIZENS OF THE UNITED STATES; RESIDENCE WITHIN OUTLYING POSSESSIONS § 325.3 Residence. (a) For purposes of applying the...

  3. Sexual Health Education: A Psychiatric Resident's Perspective

    Science.gov (United States)

    Waineo, Eva; Arfken, Cynthia L.; Morreale, Mary K.

    2010-01-01

    Objective: This report discusses psychiatric residents' perceptions of sexual health education and their opinions regarding curricular improvements. Methods: An anonymous, web-based survey was sent to residents in one general psychiatry program (N = 33). The response rate was 69.7%. Results: Residents reported inadequate experience in multiple…

  4. Pioneering partnerships: Resident involvement from multiple perspectives

    NARCIS (Netherlands)

    Baur, V.E.; Abma, T.A.; Boelsma, F.; Woelders, S.

    2013-01-01

    Resident involvement in residential care homes is a challenge due to shortcomings of consumerist and formal approaches such as resident councils. The PARTNER approach aims to involve residents through collective action to improve their community life and wellbeing. The purpose of this article is to

  5. 24 CFR 206.39 - Principal residence.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Principal residence. 206.39 Section... CONVERSION MORTGAGE INSURANCE Eligibility; Endorsement Eligible Mortgagors § 206.39 Principal residence. The property must be the principal residence of each mortgagor at closing. For purposes of this section, the...

  6. 25 CFR 700.97 - Residence.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 2 2010-04-01 2010-04-01 false Residence. 700.97 Section 700.97 Indians THE OFFICE OF NAVAJO AND HOPI INDIAN RELOCATION COMMISSION OPERATIONS AND RELOCATION PROCEDURES General Policies and Instructions Definitions § 700.97 Residence. (a) Residence is established by proving that the head of household...

  7. Suicidal Thoughts Among Medical Residents with Burnout

    NARCIS (Netherlands)

    van der Heijden, Frank; Dillingh, Gea; Bakker, Arnold; Prins, Jelle

    2008-01-01

    Objectives: Recent research showed that medical residents have a high risk for developing burnout. The present study investigates the prevalence of burnout and its relationship with suicidal thoughts among medical residents. Methods: All Dutch medical residents (n = 5126) received a self-report

  8. Does Targeted Training Improve Residents' Teaching Skills?

    Science.gov (United States)

    Polreis, Sean; D'Eon, Marcel F.; Premkumar, Kalyani; Trinder, Krista; Bonnycastle, Deirdre

    2015-01-01

    Resident doctors have an important and integral responsibility of teaching a number of individuals. The purpose of this study was to measure the effectiveness of the University of Saskatchewan's resident-as-teacher training course--Teaching Improvement Project Systems (TIPS). Residents who attended the TIPS course from January, 2010 through June,…

  9. Negotiations of Acknowledgement among Middle Class Residents

    DEFF Research Database (Denmark)

    Andersen, Nina Blom

    2013-01-01

    The article presents an analysis of communication processes between residents, between residents and people in the broader societal context as well as of media coverage of a fireworks disaster in a Danish suburb. It demonstrates how residents (all members of the Danish middle class) were able...

  10. 2003 survey of Canadian radiation oncology residents

    International Nuclear Information System (INIS)

    Yee, Don; Fairchild, Alysa; Keyes, Mira; Butler, Jim; Dundas, George

    2005-01-01

    Purpose: Radiation oncology's popularity as a career in Canada has surged in the past 5 years. Consequently, resident numbers in Canadian radiation oncology residencies are at all-time highs. This study aimed to survey Canadian radiation oncology residents about their opinions of their specialty and training experiences. Methods and Materials: Residents of Canadian radiation oncology residencies that enroll trainees through the Canadian Resident Matching Service were identified from a national database. Residents were mailed an anonymous survey. Results: Eight of 101 (7.9%) potential respondents were foreign funded. Fifty-two of 101 (51.5%) residents responded. A strong record of graduating its residents was the most important factor residents considered when choosing programs. Satisfaction with their program was expressed by 92.3% of respondents, and 94.3% expressed satisfaction with their specialty. Respondents planning to practice in Canada totaled 80.8%, and 76.9% plan to have academic careers. Respondents identified job availability and receiving adequate teaching from preceptors during residency as their most important concerns. Conclusions: Though most respondents are satisfied with their programs and specialty, job availability and adequate teaching are concerns. In the future, limited time and resources and the continued popularity of radiation oncology as a career will magnify the challenge of training competent radiation oncologists in Canada

  11. Operative Landscape at Canadian Neurosurgery Residency Programs.

    Science.gov (United States)

    Tso, Michael K; Dakson, Ayoub; Ahmed, Syed Uzair; Bigder, Mark; Elliott, Cameron; Guha, Daipayan; Iorio-Morin, Christian; Kameda-Smith, Michelle; Lavergne, Pascal; Makarenko, Serge; Taccone, Michael S; Wang, Bill; Winkler-Schwartz, Alexander; Sankar, Tejas; Christie, Sean D

    2017-07-01

    Background Currently, the literature lacks reliable data regarding operative case volumes at Canadian neurosurgery residency programs. Our objective was to provide a snapshot of the operative landscape in Canadian neurosurgical training using the trainee-led Canadian Neurosurgery Research Collaborative. Anonymized administrative operative data were gathered from each neurosurgery residency program from January 1, 2014, to December 31, 2014. Procedures were broadly classified into cranial, spine, peripheral nerve, and miscellaneous procedures. A number of prespecified subspecialty procedures were recorded. We defined the resident case index as the ratio of the total number of operations to the total number of neurosurgery residents in that program. Resident number included both Canadian medical and international medical graduates, and included residents on the neurosurgery service, off-service, or on leave for research or other personal reasons. Overall, there was an average of 1845 operative cases per neurosurgery residency program. The mean numbers of cranial, spine, peripheral nerve, and miscellaneous procedures were 725, 466, 48, and 193, respectively. The nationwide mean resident case indices for cranial, spine, peripheral nerve, and total procedures were 90, 58, 5, and 196, respectively. There was some variation in the resident case indices for specific subspecialty procedures, with some training programs not performing carotid endarterectomy or endoscopic transsphenoidal procedures. This study presents the breadth of neurosurgical training within Canadian neurosurgery residency programs. These results may help inform the implementation of neurosurgery training as the Royal College of Physicians and Surgeons residency training transitions to a competence-by-design curriculum.

  12. Resident-Led Palliative Care Education Project.

    Science.gov (United States)

    Karlen, Naomi; Cruz, Brian; Leigh, A E

    2016-04-01

    Despite the growth of palliative medicine, 39% of hospitals do not have palliative care teams for consultation or to provide resident education. We examined the impact of resident-led education in palliative care principles on attitudes toward and comfort with palliative medicine and end-of-life care among internal medicine residents. An educational module designed by the authors was presented to other internal medicine residents in the program. Pre- and post-intervention survey data measuring residents' agreement with various statements regarding palliative medicine and end-of-life care were analyzed. Residents' agreement with various statements regarding palliative medicine and end-of-life care on a 5-point Likert scale was analyzed. Following the intervention, participants reported improved comfort with general knowledge of palliative medicine (p palliative care and end-of-life care (p curriculum in palliative medicine can improve resident comfort within this still-under-represented area of medicine.

  13. A Time Study of Plastic Surgery Residents.

    Science.gov (United States)

    Lau, Frank H; Sinha, Indranil; Jiang, Wei; Lipsitz, Stuart R; Eriksson, Elof

    2016-05-01

    Resident work hours are under scrutiny and have been subject to multiple restrictions. The studies supporting these changes have not included data on surgical residents. We studied the workday of a team of plastic surgery residents to establish prospective time-study data of plastic surgery (PRS) residents at a single tertiary-care academic medical center. Five trained research assistants observed all residents (n = 8) on a PRS service for 10 weeks and produced minute-by-minute activity logs. Data collection began when the team first met in the morning and continued until the resident being followed completed all non-call activities. We analyzed our data from 3 perspectives: 1) time spent in direct patient care (DPC), indirect patient care, and didactic activities; 2) time spent in high education-value activities (HEAs) versus low education-value activities; and 3) resident efficiency. We defined HEAs as activities that surgeons must master; other activities were LEAs. We quantified resident efficiency in terms of time fragmentation and time spent waiting. A total of 642.4 hours of data across 50 workdays were collected. Excluding call, residents worked an average of 64.2 hours per week. Approximately 50.7% of surgical resident time was allotted to DPC, with surgery accounting for the largest segment of this time (34.8%). Time spent on HEAs demonstrated trended upward with higher resident level (P = 0.086). Time in spent in surgery was significantly associated with higher resident levels (P time study of PRS residents, we found that compared with medicine trainees, surgical residents spent 3.23 times more time on DPC. High education-value activities comprised most of our residents' workdays. Surgery was the leading component of both DPC and HEAs. Our residents were highly efficient and fragmented, with the majority of all activities requiring 4 minutes or less. Residents spent a large portion of their time waiting for other services. In light of these data, we

  14. Neurocritical care education during neurology residency

    Science.gov (United States)

    Drogan, O.; Manno, E.; Geocadin, R.G.; Ziai, W.

    2012-01-01

    Objective: Limited information is available regarding the current state of neurocritical care education for neurology residents. The goal of our survey was to assess the need and current state of neurocritical care training for neurology residents. Methods: A survey instrument was developed and, with the support of the American Academy of Neurology, distributed to residency program directors of 132 accredited neurology programs in the United States in 2011. Results: A response rate of 74% (98 of 132) was achieved. A dedicated neuroscience intensive care unit (neuro-ICU) existed in 64%. Fifty-six percent of residency programs offer a dedicated rotation in the neuro-ICU, lasting 4 weeks on average. Where available, the neuro-ICU rotation was required in the vast majority (91%) of programs. Neurology residents' exposure to the fundamental principles of neurocritical care was obtained through a variety of mechanisms. Of program directors, 37% indicated that residents would be interested in performing away rotations in a neuro-ICU. From 2005 to 2010, the number of programs sending at least one resident into a neuro-ICU fellowship increased from 14% to 35%. Conclusions: Despite the expansion of neurocritical care, large proportions of US neurology residents have limited exposure to a neuro-ICU and neurointensivists. Formal training in the principles of neurocritical care may be highly variable. The results of this survey suggest a charge to address the variability of resident education and to develop standardized curricula in neurocritical care for neurology residents. PMID:22573636

  15. PNEUMONIA IN NURSING HOME RESIDENTS

    Directory of Open Access Journals (Sweden)

    Renato Eržen

    2002-10-01

    Full Text Available Background. Pneumonia remains one of the leading causes of morbidity and mortality worldwide, especially in advanced age. Prognosis of the disease depends on premorbid condition and immune competence of the patient, severity of the disease and causative microorganism. In our analysis we wanted to establish clinical, x-ray and microbiological characteristics of pneumonia in nursing home residents, estimate suitability of therapeutic measures and find out risk factors for adverse outcome in this group of patients.Material and methods. This retrospective study includes all nursing home residents hospitalised due to CAP in Hospital Golnik in 2000. Clinical data was/were evaluated according to case history. Microbiological data and laboratory results were gathered from the patients files. Chi-square test was used for statistical analysis.Results. 30 patients, 17 women were included, aged 82.5 ± 11.7 years. 60% of patients had at least 2 accompanying diseases, most frequently cardiovascular and neurologic diseases. At admittance 83% of patients presented with severe form of the disease. Dispnea (93%, tachypnea, cough (67% and confusion (47% dominate clinical picture. Patients rarely expectorate, are frequently hypoxemic (93%, have leucocytosis (63%, electrolyte disturbances and elevated urea (67%. According to the microbiologic results most frequent causative agents are Enterobacteriae, S. pneumoniae, H. influenzae and also some multiresistant bacteria. Amoxycillin with clavulanic acid was the most frequently used antibiotic, followed by macrolides and 3rd generation cephalosporines.9 patients died, mortality rate was 30%. Their average age was 83,4 years, 67% of them had more than 2 accompanying diseases, all of them severe form of the disease, 89% severe respiratory insufficiency and 22% positive hemoculture.Conclusions. Patients are characterised with numerous comorbidities and advanced age. Clinical presentation is unspecific. Mortality is high

  16. Learning environment: assessing resident experience.

    Science.gov (United States)

    Byszewski, Anna; Lochnan, Heather; Johnston, Donna; Seabrook, Christine; Wood, Timothy

    2017-06-01

    Given their essential role in developing professional identity, academic institutions now require formal assessment of the learning environment (LE). We describe the experience of introducing a novel and practical tool in postgraduate programmes. The Learning Environment for Professionalism (LEP) survey, validated in the undergraduate setting, is relatively short, with 11 questions balanced for positive and negative professionalism behaviours. LEP is anonymous and focused on rotation setting, not an individual, and can be used on an iterative basis. We describe how we implemented the LEP, preliminary results, challenges encountered and suggestions for future application. Academic institutions now require formal assessment of the learning environment METHODS: The study was designed to test the feasibility of introducing the LEP in the postgraduate setting, and to establish the validity and the reliability of the survey. Residents in four programmes completed 187 ratings using LEP at the end of one of 11 rotations. The resident response rate was 87 per cent. Programme and rotation ratings were similar but not identical. All items rated positively (favourably), but displays of altruism tended to have lower ratings (meaning less desirable behaviour was witnessed), as were ratings for derogatory comments (again meaning that less desirable behaviour was witnessed). We have shown that the LEP is a feasible and valid tool that can be implemented on an iterative basis to examine the LE. Two LEP questions in particular, regarding derogatory remarks and demonstrating altruism, recorded the lowest scores, and these areas deserve attention at our institution. Implementation in diverse programmes is planned at our teaching hospitals to further assess reliability. This work may influence other postgraduate programmes to introduce this assessment tool. © 2016 John Wiley & Sons Ltd and The Association for the Study of Medical Education.

  17. Case-Logging Practices in Otolaryngology Residency Training: National Survey of Residents and Program Directors.

    Science.gov (United States)

    Dermody, Sarah M; Gao, William; McGinn, Johnathan D; Malekzadeh, Sonya

    2017-06-01

    Objective (1) Evaluate the consistency and manner in which otolaryngology residents log surgical cases. (2) Assess the extent of instruction and guidance provided by program directors on case-logging practices. Study Design Cross-sectional national survey. Setting Accreditation Council for Graduate Medical Education otolaryngology residency programs in the United States. Subjects and Methods US otolaryngology residents, postgraduate year 2 through graduating chiefs as of July 2016, were recruited to respond to an anonymous questionnaire designed to characterize surgical case-logging practices. Program directors of US otolaryngology residency programs were recruited to respond to an anonymous questionnaire to elucidate how residents are instructed to log cases. Results A total of 272 residents and 53 program directors completed the survey, yielding response rates of 40.6% and 49.5%, respectively. Perceived accuracy of case logs is low among residents and program directors. Nearly 40% of residents purposely choose not to log certain cases, and 65.1% of residents underreport cases performed. More than 80% of program directors advise residents to log procedures performed outside the operating room, yet only 16% of residents consistently log such cases. Conclusion Variability in surgical case-logging behaviors and differences in provided instruction highlight the need for methods to improve consistency of logging practices. It is imperative to standardize practices across otolaryngology residency programs for case logs to serve as an accurate measure of surgical competency. This study provides a foundation for reform efforts within residency programs and for the Resident Case Log System.

  18. Understanding how residents' preferences for supervisory methods change throughout residency training: a mixed-methods study.

    Science.gov (United States)

    Olmos-Vega, Francisco; Dolmans, Diana; Donkers, Jeroen; Stalmeijer, Renée E

    2015-10-16

    A major challenge for clinical supervisors is to encourage their residents to be independent without jeopardising patient safety. Residents' preferences according to level of training on this regard have not been completely explored. This study has sought to investigate which teaching methods of the Cognitive Apprenticeship (CA) model junior, intermediate and senior residents preferred and why, and how these preferences differed between groups. We invited 301 residents of all residency programmes of Javeriana University, Bogotá, Colombia, to participate. Each resident was asked to complete a Maastricht Clinical Teaching Questionnaire (MCTQ), which, being based on the teaching methods of CA, asked residents to rate the importance to their learning of each teaching method and to indicate which of these they preferred the most and why. A total of 215 residents (71 %) completed the questionnaire. All concurred that all CA teaching methods were important or very important to their learning, regardless of their level of training. However, the reasons for their preferences clearly differed between groups: junior and intermediate residents preferred teaching methods that were more supervisor-directed, such as modelling and coaching, whereas senior residents preferred teaching methods that were more resident-directed, such as exploration and articulation. The results indicate that clinical supervision (CS) should accommodate to residents' varying degrees of development by attuning the configuration of CA teaching methods to each level of residency training. This configuration should initially vest more power in the supervisor, and gradually let the resident take charge, without ever discontinuing CS.

  19. Feasibility of an innovative third-year chief resident system: an internal medicine residency leadership study

    Directory of Open Access Journals (Sweden)

    Victor O. Kolade

    2014-07-01

    Full Text Available Introduction: The role of the internal medicine chief resident includes various administrative, academic, social, and educational responsibilities, fulfillment of which prepares residents for further leadership tasks. However, the chief resident position has historically only been held by a few residents. As fourth-year chief residents are becoming less common, we considered a new model for rotating third-year residents as the chief resident. Methods: Online surveys were given to all 29 internal medicine residents in a single university-based program after implementation of a leadership curriculum and specific job description for the third-year chief resident. Chief residents evaluated themselves on various aspects of leadership. Participation was voluntary. Descriptive statistics were generated using SPSS version 21. Results: Thirteen junior (first- or second-year resident responses reported that the chief residents elicited input from others (mean rating 6.8, were committed to the team (6.8, resolved conflict (6.7, ensured efficiency, organization and productivity of the team (6.7, participated actively (7.0, and managed resources (6.6. Responses from senior residents averaged 1 point higher for each item; this pattern repeated itself in teaching evaluations. Chief resident self-evaluators were more comfortable running a morning report (8.4 than with being chief resident (5.8. Conclusion: The feasibility of preparing internal medicine residents for leadership roles through a rotating PGY-3 (postgraduate year chief residency curriculum was explored at a small internal medicine residency, and we suggest extending the study to include other programs.

  20. What is an anesthesiology resident worth?

    Science.gov (United States)

    Ferrera, Marisa H; Beaman, Shawn T; Metro, David G; Handley, Linda J; Walker, James E

    2009-08-01

    To determine the cost of replacing an anesthesiology resident with a certified registered nurse anesthetist (CRNA) for equal operating room (OR) work. Retrospective financial analysis. Academic anesthesiology department. Clinical anesthesia (CA)-1 through CA-3 residents. Cost of replacing anesthesiology residents with CRNAs for equal OR work was determined. The cost of replacing one anesthesiology resident with a CRNA for the same number of OR hours ranged from $9,940.32 to $43,300 per month ($106,241.68 to $432,937.50 per yr). Numbers varied depending on the CRNA pay scale and whether the calculations were based on the number of OR hours worked at our residency program or OR hours worked in a maximum duty hour model. A CRNA is paid substantially more per OR hour worked, at all pay levels, than an anesthesiology resident.

  1. Motherhood during residency training: challenges and strategies.

    Science.gov (United States)

    Walsh, Allyn; Gold, Michelle; Jensen, Phyllis; Jedrzkiewicz, Michelle

    2005-07-01

    To determine what factors enable or impede women in a Canadian family medicine residency program from combining motherhood with residency training. To determine how policies can support these women, given that in recent decades the number of female family medicine residents has increased. Qualitative study using in-person interviews. McMaster University Family Medicine Residency Program. Twenty-one of 27 family medicine residents taking maternity leave between 1994 and 1999. Semistructured interviews. The research team reviewed transcripts of audiotaped interviews for emerging themes; consensus was reached on content and meaning. NVIVO software was used for data analysis. Long hours, unpredictable work demands, guilt because absences from work increase workload for colleagues, and residents' high expectations of themselves cause pregnant residents severe stress. This stress continues upon return to work; finding adequate child care is an added stress. Residents report receiving less support from colleagues and supervisors upon return to work; they associate this with no longer being visibly pregnant. Physically demanding training rotations put additional strain on pregnant residents and those newly returned to work. Flexibility in scheduling rotations can help accommodate needs at home. Providing breaks, privacy, and refrigerators at work can help maintain breastfeeding. Allowing residents to remain involved in academic and clinical work during maternity leave helps maintain clinical skills, build new knowledge, and promote peer support. Pregnancy during residency training is common and becoming more common. Training programs can successfully enhance the experience of motherhood during residency by providing flexibility at work to facilitate a healthy balance among the competing demands of family, work, and student life.

  2. [Heart failure in nursing home residents].

    Science.gov (United States)

    Daamen, M A M J; Hamers, J P H; Brunner-la Rocca, H P; Schols, J M G A

    2016-01-01

    To determine the prevalence of heart failure (HF) in nursing home residents and to gain insight into the clinical characteristics of residents with heart failure. Multi-centre, observational, cross-sectional study. 501 nursing home residents aged 65 years and over, in a department for chronic somatic diseases or a psychogeriatric department, participated in this study. The diagnosis of HF and the related characteristics were based on data collected from clinical examinations for heart failure (including history, physical examination, ECG, cardiac markers and echocardiography), patient records and questionnaires. A panel of two cardiologists and an internist-geriatrician made the final diagnosis of HF. The prevalence of HF in nursing home residents was 33%. Dyspnoea, oedema and a history of cardiac disease were more common in residents with heart failure. Diabetes mellitus and chronic obstructive pulmonary disease also appeared to be more prevalent in this group. In 54% of the residents with HF, the diagnosis had not previously been made. Diagnosis of HF was not confirmed by the expert panel in 31% of residents with a history of HF. Heart failure does indeed appear to be very prevalent in nursing home residents. Heart failure had not been previously diagnosed in many cases but also a previous diagnosis of heart failure could be disproved in many participants. It is therefore important that the diagnostic process for heart failure in nursing home residents be improved.

  3. Radiology residents' experience with intussusception reduction.

    Science.gov (United States)

    Bateni, Cyrus; Stein-Wexler, Rebecca; Wootton-Gorges, Sandra L; Li, Chin-Shang

    2011-06-01

    Residents should be exposed to adequate procedural volume to act independently upon completion of training. Informal inquiry led us to question whether residents encounter enough intussusception reductions to become comfortable with the procedure. We sought to determine radiology residents' exposure to intussusception reductions, and whether their experiences vary by region or institution. U.S. radiology residency program directors were asked to encourage their residents to complete a 12-question online survey describing characteristics of their pediatric radiology department, experiences with intussusception reduction, and confidence in their own ability to perform the procedure. Six hundred sixty-four residents responded during the study period. Of those, 308 (46.4%) had not experienced an intussusception reduction, and 228 (34%) had experienced only one or two. Twenty-two percent of fourth-year residents had never experienced an intussusception reduction, and 21% had experienced only one. Among second- through fourth-year residents, only 99 (18.3%) felt confident that they could competently reduce an intussusception (P Radiology residents have limited opportunity to learn intussusception reduction and therefore lack confidence. Most think they would benefit from additional training with a computer-simulation model.

  4. Internal medicine residency training in Turkey.

    Science.gov (United States)

    Sahin, Hatice; Akcicek, Fehmi

    2005-12-01

    Medical school entrance depends on passing a central examination that is given annually by the National Selection and Placement Center. Undergraduate medical education takes 6 years. About 5000 students graduate from medical faculties annually. The central exam necessary for residency training is given by the National Selection and Placement Center. A Specialist Training Regulation regulates residency training. Internal medicine residency training takes 4 years and includes inpatient and outpatient care in wards and rotations. Residents prepare a dissertation that is used in the evaluation of residency competency. At the end of the residency period, residents who have been successful in previous evaluations take an oral exam followed by a written exam, which lead to their certification in internal medicine. Residents' scientific knowledge and skills are assessed by a jury consisting of five people, four from the same department and one from the equivalent department in another training institution. The title of specialist is granted after a certification exam given by training institutions and approved by the Ministry of Health. Internists are mainly employed in state hospitals, which are under the Ministry of Health. Subspecialty areas in internal medicine include gastroenterology, geriatrics, endocrinology, nephrology, hematology, rheumatology, immunology, allergology, and oncology. The training period for a subspecialty is 2 years. A substantial effort is being made all over the country to improve regulations and health care service delivery. These changes will also affect the residency training and manpower planning and employment of internists.

  5. The challenges of residents teaching neurology.

    Science.gov (United States)

    Frank, Samuel A; Józefowicz, Ralph F

    2004-07-01

    Teaching is integrated into the daily practice of residents, and it is a skill necessary for practice as well as academics. The settings in which teaching and learning take place are ubiquitous but include classrooms, small groups, bedside rounds, and grand rounds. Given the learning environment of residency, neurology residents should have working knowledge of basic principles of effective teaching to make learning successful. Teaching also reinforces knowledge, and residents will likely be better practitioners if some basic skills of teaching are practiced. Neurology teaching techniques for residents are rarely addressed in the medical literature. Although information regarding teaching principles in medicine exists, there is little information regarding how residents teach. We examine and review some of the more effective methods and appreciated qualities in teachers, with a particular emphasis for the neurology resident. We also review whom neurologists need to teach and the various settings in which teaching may take place. Neurology residents encounter a variety of audiences in a variety of settings that require diverse teaching skills to effectively convey information to other providers as well as patients. The majority of these skills should be learned in residency to establish a foundation for teaching, regardless of future practice settings.

  6. Contemporary Trends in Radiation Oncology Resident Research

    Energy Technology Data Exchange (ETDEWEB)

    Verma, Vivek [Department of Radiation Oncology, University of Nebraska, Omaha, Nebraska (United States); Burt, Lindsay [Department of Radiation Oncology, University of Utah, Salt Lake City, Utah (United States); Gimotty, Phyllis A. [Department of Biostatistics and Epidemiology, University of Pennsylvania, Philadelphia, Pennsylvania (United States); Ojerholm, Eric, E-mail: eric.ojerholm@uphs.upenn.edu [Department of Radiation Oncology, University of Pennsylvania, Philadelphia, Pennsylvania (United States)

    2016-11-15

    Purpose: To test the hypothesis that recent resident research productivity might be different than a decade ago, and to provide contemporary information about resident scholarly activity. Methods and Materials: We compiled a list of radiation oncology residents from the 2 most recent graduating classes (June 2014 and 2015) using the Association of Residents in Radiation Oncology annual directories. We queried the PubMed database for each resident's first-authored publications from postgraduate years (PGY) 2 through 5, plus a 3-month period after residency completion. We abstracted corresponding historical data for 2002 to 2007 from the benchmark publication by Morgan and colleagues (Int J Radiat Oncol Biol Phys 2009;74:1567-1572). We tested the null hypothesis that these 2 samples had the same distribution for number of publications using the Wilcoxon rank-sum test. We explored the association of demographic factors and publication number using multivariable zero-inflated Poisson regression. Results: There were 334 residents publishing 659 eligible first-author publications during residency (range 0-17; interquartile range 0-3; mean 2.0; median 1). The contemporary and historical distributions were significantly different (P<.001); contemporary publication rates were higher. Publications accrued late in residency (27% in PGY-4, 59% in PGY-5), and most were original research (75%). In the historical cohort, half of all articles were published in 3 journals; in contrast, the top half of contemporary publications were spread over 10 journals—most commonly International Journal of Radiation Oncology • Biology • Physics (17%), Practical Radiation Oncology (7%), and Radiation Oncology (4%). Male gender, non-PhD status, and larger residency size were associated with higher number of publications in the multivariable analysis. Conclusion: We observed an increase in first-author publications during training compared with historical data from the mid-2000s. These

  7. Contemporary Trends in Radiation Oncology Resident Research.

    Science.gov (United States)

    Verma, Vivek; Burt, Lindsay; Gimotty, Phyllis A; Ojerholm, Eric

    2016-11-15

    To test the hypothesis that recent resident research productivity might be different than a decade ago, and to provide contemporary information about resident scholarly activity. We compiled a list of radiation oncology residents from the 2 most recent graduating classes (June 2014 and 2015) using the Association of Residents in Radiation Oncology annual directories. We queried the PubMed database for each resident's first-authored publications from postgraduate years (PGY) 2 through 5, plus a 3-month period after residency completion. We abstracted corresponding historical data for 2002 to 2007 from the benchmark publication by Morgan and colleagues (Int J Radiat Oncol Biol Phys 2009;74:1567-1572). We tested the null hypothesis that these 2 samples had the same distribution for number of publications using the Wilcoxon rank-sum test. We explored the association of demographic factors and publication number using multivariable zero-inflated Poisson regression. There were 334 residents publishing 659 eligible first-author publications during residency (range 0-17; interquartile range 0-3; mean 2.0; median 1). The contemporary and historical distributions were significantly different (Pcontemporary publication rates were higher. Publications accrued late in residency (27% in PGY-4, 59% in PGY-5), and most were original research (75%). In the historical cohort, half of all articles were published in 3 journals; in contrast, the top half of contemporary publications were spread over 10 journals-most commonly International Journal of Radiation Oncology • Biology • Physics (17%), Practical Radiation Oncology (7%), and Radiation Oncology (4%). Male gender, non-PhD status, and larger residency size were associated with higher number of publications in the multivariable analysis. We observed an increase in first-author publications during training compared with historical data from the mid-2000s. These contemporary figures may be useful to medical students considering

  8. Contemporary Trends in Radiation Oncology Resident Research

    International Nuclear Information System (INIS)

    Verma, Vivek; Burt, Lindsay; Gimotty, Phyllis A.; Ojerholm, Eric

    2016-01-01

    Purpose: To test the hypothesis that recent resident research productivity might be different than a decade ago, and to provide contemporary information about resident scholarly activity. Methods and Materials: We compiled a list of radiation oncology residents from the 2 most recent graduating classes (June 2014 and 2015) using the Association of Residents in Radiation Oncology annual directories. We queried the PubMed database for each resident's first-authored publications from postgraduate years (PGY) 2 through 5, plus a 3-month period after residency completion. We abstracted corresponding historical data for 2002 to 2007 from the benchmark publication by Morgan and colleagues (Int J Radiat Oncol Biol Phys 2009;74:1567-1572). We tested the null hypothesis that these 2 samples had the same distribution for number of publications using the Wilcoxon rank-sum test. We explored the association of demographic factors and publication number using multivariable zero-inflated Poisson regression. Results: There were 334 residents publishing 659 eligible first-author publications during residency (range 0-17; interquartile range 0-3; mean 2.0; median 1). The contemporary and historical distributions were significantly different (P<.001); contemporary publication rates were higher. Publications accrued late in residency (27% in PGY-4, 59% in PGY-5), and most were original research (75%). In the historical cohort, half of all articles were published in 3 journals; in contrast, the top half of contemporary publications were spread over 10 journals—most commonly International Journal of Radiation Oncology • Biology • Physics (17%), Practical Radiation Oncology (7%), and Radiation Oncology (4%). Male gender, non-PhD status, and larger residency size were associated with higher number of publications in the multivariable analysis. Conclusion: We observed an increase in first-author publications during training compared with historical data from the mid-2000s. These

  9. Lawful Permanent Residents Fiscal Year 2014 Core Based Statistical Area (CBSA) of Residence

    Data.gov (United States)

    Department of Homeland Security — Lawful permanent residents (LPRs) are foreign nationals who have been granted the right to reside permanently in the United States. LPRs are also known as 'permanent...

  10. Lawful Permanent Residents Fiscal Year 2015 Core Based Statistical Area (CBSA) of Residence

    Data.gov (United States)

    Department of Homeland Security — Lawful permanent residents (LPRs) are foreign nationals who have been granted the right to reside permanently in the United States. LPRs are also known as 'permanent...

  11. Lawful Permanent Residents Fiscal Year 2016 Core Based Statistical Area (CBSA) of Residence

    Data.gov (United States)

    Department of Homeland Security — Lawful permanet residents (LPRs) are foreign nationals who have been gratned the right to reside permanently in the United States. LPRs are also known as 'permanent...

  12. Lawful Permanent Residents Fiscal Year 2011 Core Based Statistical Area (CBSA) of Residence

    Data.gov (United States)

    Department of Homeland Security — Lawful permanent residents (LPRs) are foreign nationals who have been granted the right to reside permanently in the United States. LPRs are also known as 'permanent...

  13. Radiology residents as teachers: Current status of teaching skills training in United States residency programs.

    Science.gov (United States)

    Donovan, Andrea

    2010-07-01

    Radiology residents often teach medical students and other residents. Workshops developed with the goal of improving resident teaching skills are becoming increasingly common in various fields of medicine. The purpose of this study was to determine the prevalence and structure of resident-teacher training opportunities within radiology programs in the United States. Program directors with membership in the Association of Program Directors in Radiology (APDR) were surveyed to determine views on a panel of topics related to resident-teacher training programs. A total of 114 (56%) of 205 APDR members completed an online survey. Approximately one-third (32%) stated that their program provided instruction to residents on teaching skills. The majority of these programs (72%) were established within the last 5 years. Residents provided teaching to medical students (94%) and radiology residents (90%). The vast majority of program directors agreed that it is important for residents to teach (98%) and that these teaching experiences helped residents become better radiologists (85%). Ninety-four percent of program directors felt that the teaching skills of their residents could be improved, and 85% felt that residents would benefit from instruction on teaching methods. Only one-third of program directors felt their program adequately recognized teaching provided by residents. Program directors identified residents as being active contributors to teaching in most programs. Although teaching was viewed as an important skill to develop, few programs had instituted a resident-teacher curriculum. Program directors felt that residents would benefit from structured training to enhance teaching skills. Future studies are needed to determine how best to provide teaching skills training for radiology trainees. 2010 AUR. Published by Elsevier Inc. All rights reserved.

  14. Radiology resident teaching skills improvement: impact of a resident teacher training program.

    Science.gov (United States)

    Donovan, Andrea

    2011-04-01

    Teaching is considered an essential competency for residents to achieve during their training. Instruction in teaching skills may assist radiology residents in becoming more effective teachers and increase their overall satisfaction with teaching. The purposes of this study were to survey radiology residents' teaching experiences during residency and to assess perceived benefits following participation in a teaching skills development course. Study participants were radiology residents with membership in the American Alliance of Academic Chief Residents in Radiology or the Siemens AUR Radiology Resident Academic Development Program who participated in a 1.5-hour workshop on teaching skills development at the 2010 Association of University Radiologists meeting. Participants completed a self-administered, precourse questionnaire that addressed their current teaching strategies, as well as the prevalence and structure of teaching skills training opportunities at their institutions. A second postcourse questionnaire enabled residents to evaluate the seminar and assessed new knowledge and skill acquisition. Seventy-eight residents completed the precourse and postcourse questionnaires. The vast majority of respondents indicated that they taught medical students (72 of 78 [92.3%]). Approximately 20% of residency programs (17 of 78) provided residents with formal didactic programs on teaching skills. Fewer than half (46.8%) of the resident respondents indicated that they received feedback on their teaching from attending physicians (36 of 77), and only 18% (13 of 78) routinely gave feedback to their own learners. All of the course participants agreed or strongly agreed that this workshop was helpful to them as teachers. Few residency programs had instituted resident teacher training curricula. A resident teacher training workshop was perceived as beneficial by the residents, and they reported improvement in their teaching skills. Copyright © 2011 AUR. Published by

  15. Invitational Engineering in the Residence Halls.

    Science.gov (United States)

    Murphy, Jack; Purkey, William

    1981-01-01

    Presents various ways in which a residence hall environment may be specifically engineered to encourage individual participation in the process of education. Invitational engineering is defined as one way to transpose psychological principles to residence halls so they contribute to the developmental life of students. (RC)

  16. Emotional intelligence in orthopedic surgery residents

    Science.gov (United States)

    Chan, Kevin; Petrisor, Brad; Bhandari, Mohit

    2014-01-01

    Background Emotional intelligence (EI) is the ability to understand and manage emotions in oneself and others. It was originally popularized in the business literature as a key attribute for success that was distinct from cognitive intelligence. Increasing focus is being placed on EI in medicine to improve clinical and academic performance. Despite the proposed benefits, to our knowledge, there have been no previous studies on the role of EI in orthopedic surgery. We evaluated baseline data on EI in a cohort of orthopedic surgery residents. Methods We asked all orthopedic surgery residents at a single institution to complete an electronic version of the Mayer–Salovey–Caruso Emotional Intelligence Test (MSCEIT). We used completed questionnaires to calculate total EI scores and 4 branch scores. Data were analyzed according to a priori cutoff values to determine the proportion of residents who were considered competent on the test. Data were also analyzed for possible associations with age, sex, race and level of training. Results Thirty-nine residents (100%) completed the MSCEIT. The mean total EI score was 86 (maximum score 145). Only 4 (10%) respondents demonstrated competence in EI. Junior residents (p = 0.026), Caucasian residents (p = 0.009) and those younger than 30 years (p = 0.008) had significantly higher EI scores. Conclusion Our findings suggest that orthopedic residents score low on EI based on the MSCEIT. Optimizing resident competency in noncognitive skills may be enhanced by dedicated EI education, training and testing. PMID:24666445

  17. Sedation practice among Nigerian radiology residents | Omisore ...

    African Journals Online (AJOL)

    Background: Providing safe and effective sedation to patients, especially those with multiple medical problems, can be challenging for radiology residents and fellows. This study aimed to determine knowledge, attitude and practice of Nigerian radiology residents concerning sedation. Keywords: anaesthetist, guidelines ...

  18. Emotional intelligence in orthopedic surgery residents.

    Science.gov (United States)

    Chan, Kevin; Petrisor, Brad; Bhandari, Mohit

    2014-04-01

    Emotional intelligence (EI) is the ability to understand and manage emotions in oneself and others. It was originally popularized in the business literature as a key attribute for success that was distinct from cognitive intelligence. Increasing focus is being placed on EI in medicine to improve clinical and academic performance. Despite the proposed benefits, to our knowledge, there have been no previous studies on the role of EI in orthopedic surgery. We evaluated baseline data on EI in a cohort of orthopedic surgery residents. We asked all orthopedic surgery residents at a single institution to complete an electronic version of the Mayer-Salovey-Caruso Emotional Intelligence Test (MSCEIT). We used completed questionnaires to calculate total EI scores and 4 branch scores. Data were analyzed according to a priori cutoff values to determine the proportion of residents who were considered competent on the test. Data were also analyzed for possible associations with age, sex, race and level of training. Thirty-nine residents (100%) completed the MSCEIT. The mean total EI score was 86 (maximum score 145). Only 4 (10%) respondents demonstrated competence in EI. Junior residents (p = 0.026), Caucasian residents (p = 0.009) and those younger than 30 years (p = 0.008) had significantly higher EI scores. Our findings suggest that orthopedic residents score low on EI based on the MSCEIT. Optimizing resident competency in noncognitive skills may be enhanced by dedicated EI education, training and testing.

  19. 42 CFR 483.10 - Resident rights.

    Science.gov (United States)

    2010-10-01

    ... to Medicaid benefits, in writing, at the time of admission to the nursing facility or, when the resident becomes eligible for Medicaid of— (A) The items and services that are included in nursing facility... eligibility for Medicaid or SSI. (6) Conveyance upon death. Upon the death of a resident with a personal fund...

  20. Tax treaty entitlement issues concerning dual residents

    NARCIS (Netherlands)

    Sanghavi, D.

    2014-01-01

    The question whether a dual resident taxpayer is entitled to tax treaties concluded by each residence state with a third state has been controversial. Since 2008, the Organisation for Economic Co-operation and Development (OECD) Commentary on Article 4(1) of the OECD Model states that such a

  1. Displacing Media: LCD LAB Artistic Residency

    Directory of Open Access Journals (Sweden)

    Filipe Pais

    2012-12-01

    Full Text Available This review refers to an artistic residency which took place at LCD LAB -  CAAA at Guimarães, in March, exploring a strategy for media art called Media Displacement. The text introduces the strategy very briefly and describes the residency's organization, structure, processses and the results produced.

  2. 20th Annual Residence Hall Construction Report

    Science.gov (United States)

    Agron, Joe

    2009-01-01

    Even in difficult economic times, colleges and universities continue to invest in residence hall construction projects as a way to attract new students and keep existing ones on campus. According to data from "American School & University"'s 20th annual Residence Hall Construction Report, the median new project completed in 2008 was…

  3. 38 CFR 3.653 - Foreign residence.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Foreign residence. 3.653 Section 3.653 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS ADJUDICATION Pension, Compensation, and Dependency and Indemnity Compensation Adjustments and Resumptions § 3.653 Foreign residence...

  4. Medication Refusal: Resident Rights, Administration Dilemma.

    Science.gov (United States)

    Haskins, Danielle R; Wick, Jeannette Y

    2017-12-01

    Occasionally, residents actively or passively refuse to take medications. Residents may refuse medication for a number of reasons, including religious beliefs, dietary restrictions, misunderstandings, cognitive impairment, desire to self-harm, or simple inconvenience. This action creates a unique situation for pharmacists and long-term facility staff, especially if patients have dementia. Residents have the legal right to refuse medications, and long-term care facilities need to employ a process to resolve disagreement between the health care team that recommends the medication and the resident who refuses it. In some cases, simple interventions like selecting a different medication or scheduling medications in a different time can address and resolve the resident's objection. If the medical team and the resident cannot resolve their disagreement, often an ethics consultation is helpful. Documenting the resident's refusal to take any or all medications, the health care team's actions and any other outcomes are important. Residents' beliefs may change over time, and the health care team needs to be prepared to revisit the issue as necessary.

  5. 42 CFR 436.403 - State residence.

    Science.gov (United States)

    2010-10-01

    ...) Definition. For purposes of this section—Institution has the same meaning as Institution and Medical... intention to remain there permanently or for an indefinite period. (2) For any individual not residing in an... of residence is the State where the individual is— (i) Living with the intention to remain there...

  6. 42 CFR 435.403 - State residence.

    Science.gov (United States)

    2010-10-01

    ... set forth in § 431.52 of this chapter. (b) Definition. For purposes of this section—Institution has... intent, the State of residence is the State where the individual is living with the intention to remain...), the State of residence is the State where the individual is— (i) Living with the intention to remain...

  7. Adult neurology training during child neurology residency.

    Science.gov (United States)

    Schor, Nina F

    2012-08-21

    As it is currently configured, completion of child neurology residency requires performance of 12 months of training in adult neurology. Exploration of whether or not this duration of training in adult neurology is appropriate for what child neurology is today must take into account the initial reasons for this requirement and the goals of adult neurology training during child neurology residency.

  8. Teaching Forensic Psychiatry to General Psychiatry Residents

    Science.gov (United States)

    Lewis, Catherine F.

    2004-01-01

    Objective: The Accreditation Council on Graduate Medical Education (ACGME) requires that general psychiatry residency training programs provide trainees with exposure to forensic psychiatry. Limited information is available on how to develop a core curriculum in forensic psychiatry for general psychiatry residents and few articles have been…

  9. Simulation and resident education in spinal neurosurgery.

    Science.gov (United States)

    Bohm, Parker E; Arnold, Paul M

    2015-01-01

    A host of factors have contributed to the increasing use of simulation in neurosurgical resident education. Although the number of simulation-related publications has increased exponentially over the past two decades, no studies have specifically examined the role of simulation in resident education in spinal neurosurgery. We performed a structured search of several databases to identify articles detailing the use of simulation in spinal neurosurgery education in an attempt to catalogue potential applications for its use. A brief history of simulation in medicine is given, followed by current trends of spinal simulation utilization in residency programs. General themes from the literature are identified that are integral for implementing simulation into neurosurgical residency curriculum. Finally, various applications are reported. The use of simulation in spinal neurosurgery education is not as ubiquitous in comparison to other neurosurgical subspecialties, but many promising methods of simulation are available for augmenting resident education.

  10. Introducing "optimal challenges" in resident training

    DEFF Research Database (Denmark)

    Sørensen, Anette Bagger; Christensen, Mette Krogh

    Background: Residents are often caught between two interests: the resident’s desire to participate in challenging learning situations and the department’s work planning. However, these interests may clash if they are not coordinated by the senior doctors, and challenging learning situations risk...... being subject to work planning. Summary of work: Inspired by Csikszentmihalyi’s concept of optimal challenges, an intervention study aimed at introducing a more suitable planning of residents' learning in terms of optimal allocation of educational patient contacts. The objective was to coordinating...... residents’ individual competences and learning needs with patient characteristics in order to match each resident with a case (an outpatient or a patient) that meets the learning needs of the resident and thus pose an optimal challenge to the resident. Summary of results: The preliminary results show...

  11. Child Neurology Education for Pediatric Residents.

    Science.gov (United States)

    Albert, Dara V F; Patel, Anup D; Behnam-Terneus, Maria; Sautu, Beatriz Cunill-De; Verbeck, Nicole; McQueen, Alisa; Fromme, H Barrett; Mahan, John D

    2017-03-01

    The aim of this study was to evaluate whether the current state of child neurology education during pediatric residency provides adequate preparation for pediatric practice. A survey was sent to recent graduates from 3 pediatric residency programs to assess graduate experience, perceived level of competence, and desire for further education in child neurology. Responses from generalists versus subspecialists were compared. The response rate was 32%, half in general pediatric practice. Only 22% feel very confident in approaching patients with neurologic problems. This may represent the best-case scenario as graduates from these programs had required neurology experiences, whereas review of Accreditation Council of Graduate Medical Education-accredited residency curricula revealed that the majority of residencies do not. Pediatric neurologic problems are common, and pediatric residency graduates do encounter such problems in practice. The majority of pediatricians report some degree of confidence; however, some clear areas for improvement are apparent.

  12. Pregnancy and the Plastic Surgery Resident.

    Science.gov (United States)

    Garza, Rebecca M; Weston, Jane S; Furnas, Heather J

    2017-01-01

    Combining pregnancy with plastic surgery residency has historically been difficult. Two decades ago, 36 percent of plastic surgery program directors surveyed actively discouraged pregnancy among residents, and 33 percent of women plastic surgeons suffered from infertility. Most alarmingly, 26 percent of plastic surgery trainees had had an elective abortion during residency. With increasing numbers of women training in plastic surgery, this historical lack of support for pregnancy deserves further attention. To explore the current accommodations made for the pregnant plastic surgery resident, an electronic survey was sent to 88 plastic surgery program directors in the United States. Fifty-four responded, for a response rate of 61.36 percent. On average, a director trained a total of 7.91 women among 17.28 residents trained over 8.19 years. Of the women residents, 1.43 were pregnant during a director's tenure, with 1.35 of those residents taking maternity leave. An average 1.75 male residents took paternity leave. Approximately one-third of programs had a formal maternity/paternity leave policy (36.54 percent) which, in most cases, was limited to defining allowed weeks of leave, time required to fulfill program requirements, and remuneration during leave. This survey of plastic surgery directors is a first step in defining the challenges training programs face in supporting the pregnant resident. Directors provided comments describing their challenges accommodating an absent resident in a small program and complying with the American Board of Plastic Surgery's required weeks of training per year. A discussion of these challenges is followed by suggested solutions.

  13. Evaluation of stress experienced by pharmacy residents.

    Science.gov (United States)

    Le, Hung M; Young, Shardae D

    2017-04-15

    Results of a study of stress and negative affect levels in postgraduate year 1 (PGY1) and postgraduate year 2 (PGY2) pharmacy residents are presented. A cross-sectional approach was used. Pharmacy residency program directors received e-mailed invitation letters requesting that they ask their residents to participate in an online survey in 2011. The main study outcomes included evaluation of resident scores on the 10-item Perceived Stress Scale (PSS10) and the Multiple Affect Adjective Checklist-Revised (MAACL-R) anxiety, depression, hostility, and dysphoria subscales. Of the 524 pharmacy residents included in the study, 75.4% were female, 41.2% were under 26 years of age, and 41% reported working more than 60 hours per week. There were no significant differences between PGY1 and PGY2 residents in stress levels, as assessed with the PSS10 (mean ± S.D. score, 19.05 ± 5.96 versus 19.09 ± 5.77). MAACL-R scores for hostility were, on average, higher among PGY2 residents (mean ± S.D., 50.83 ± 10.02) than among PGY1 residents (48.62 ± 8.96), while there were no significant differences in anxiety, depression, and dysphoria levels. Relative to residents who worked 60 or fewer hours per week, those who worked more than 60 hours had higher perceived stress levels as well as higher depression, hostility, and dysphoria scores. Pharmacy residents exhibited high levels of perceived stress, especially those who worked more than 60 hours per week. Perceived stress was highly correlated to negative affect levels. Copyright © 2017 by the American Society of Health-System Pharmacists, Inc. All rights reserved.

  14. Evolution of the Pathology Residency Curriculum

    Science.gov (United States)

    Powell, Suzanne Z.; Black-Schaffer, W. Stephen

    2016-01-01

    The required medical knowledge and skill set for the pathologist of 2020 are different than in 2005. Pathology residency training curriculum must accordingly change to fulfill the needs of these ever-changing requirements. In order to make rational curricular adjustments, it is important for us to know the current trajectory of resident training in pathology—where we have been, what our actual current training curriculum is now—to understand how that might change in anticipation of meeting the needs of a changing patient and provider population and to fit within the evolving future biomedical and socioeconomic health-care setting. In 2013, there were 143 Accreditation Council for Graduate Medical Education-accredited pathology residency training programs in the United States, with approximately 2400 residents. There is diversity among residency training programs not only with respect to the number of residents but also in training venue(s). To characterize this diversity among pathology residency training programs, a curriculum survey was conducted of pathology residency program directors in 2013 and compared with a similar survey taken almost 9 years previously in 2005 to identify trends in pathology residency curriculum. Clinical pathology has not changed significantly in the number of rotations over 9 years; however, anatomic pathology has changed dramatically, with an increase in the number of surgical pathology rotations coupled with a decline in stand-alone autopsy rotations. With ever-expanding medical knowledge that the graduating pathology resident must know, it is necessary to (1) reflect upon what are the critical need subjects, (2) identify areas that have become of lesser importance, and then (3) prioritize training accordingly. PMID:28725779

  15. Enhancing teamwork between chief residents and residency program directors: description and outcomes of an experiential workshop.

    Science.gov (United States)

    McPhillips, Heather A; Frohna, John G; Murad, M Hassan; Batra, Maneesh; Panda, Mukta; Miller, Marsha A; Brigham, Timothy P; Doughty, Robert A

    2011-12-01

    An effective working relationship between chief residents and residency program directors is critical to a residency program's success. Despite the importance of this relationship, few studies have explored the characteristics of an effective program director-chief resident partnership or how to facilitate collaboration between the 2 roles, which collectively are important to program quality and resident satisfaction. We describe the development and impact of a novel workshop that paired program directors with their incoming chief residents to facilitate improved partnerships. The Accreditation Council for Graduate Medical Education sponsored a full-day workshop for residency program directors and their incoming chief residents. Sessions focused on increased understanding of personality styles, using experiential learning, and open communication between chief residents and program directors, related to feedback and expectations of each other. Participants completed an anonymous survey immediately after the workshop and again 8 months later to assess its long-term impact. Participants found the workshop to be a valuable experience, with comments revealing common themes. Program directors and chief residents expect each other to act as a role model for the residents, be approachable and available, and to be transparent and fair in their decision-making processes; both groups wanted feedback on performance and clear expectations from each other for roles and responsibilities; and both groups identified the need to be innovative and supportive of changes in the program. Respondents to the follow-up survey reported that workshop participation improved their relationships with their co-chiefs and program directors. Participation in this experiential workshop improved the working relationships between chief residents and program directors. The themes that were identified can be used to foster communication between incoming chief residents and residency directors and to

  16. Comparison of Emergency Medicine Malpractice Cases Involving Residents to Non-Resident Cases.

    Science.gov (United States)

    Gurley, Kiersten L; Grossman, Shamai A; Janes, Margaret; Yu-Moe, C Winnie; Song, Ellen; Tibbles, Carrie D; Shapiro, Nathan I; Rosen, Carlo L

    2018-04-17

    Data are lacking on how emergency medicine (EM) malpractice cases with resident involvement differs from cases that do not name a resident. To compare malpractice case characteristics in cases where a resident is involved (resident case) to cases that do not involve a resident (non-resident case) and to determine factors that contribute to malpractice cases utilizing EM as a model for malpractice claims across other medical specialties. We used data from the Controlled Risk Insurance Company (CRICO) Strategies' division Comparative Benchmarking System (CBS) to analyze open and closed EM cases asserted from 2009-2013. The CBS database is a national repository that contains professional liability data on > 400 hospitals and > 165,000 physicians, representing over 30% of all malpractice cases in the U.S (> 350,000 claims). We compared cases naming residents (either alone or in combination with an attending) to those that did not involve a resident (non-resident cohort). We reported the case statistics, allegation categories, severity scores, procedural data, final diagnoses and contributing factors. Fisher's exact test or t-test was used for comparisons (alpha set at 0.05). Eight hundred and forty-five EM cases were identified of which 732 (87%) did not name a resident (non-resident cases), while 113 (13%) included a resident (resident cases) (Figure 1). There were higher total incurred losses for non-resident cases (Table 1). The most frequent allegation categories in both cohorts were "Failure or Delay in Diagnosis/Misdiagnosis" and "Medical Treatment" (non-surgical procedures or treatment regimens i.e. central line placement). Allegation categories of Safety and Security, Patient Monitoring, Hospital Policy and Procedure and Breach of Confidentiality were found in the non-resident cases. Resident cases incurred lower payments on average ($51,163 vs. $156,212 per case). Sixty six percent (75) of resident vs 57% (415) of non-resident cases were high severity claims

  17. Pediatric dermatology training during residency: a survey of the 2014 graduating residents.

    Science.gov (United States)

    Akhavan, Alaleh; Murphy-Chutorian, Blair; Friedman, Adam

    2015-01-01

    Knowledge of pediatric dermatology is considered a core competency of dermatology training and should be expected of all practicing dermatologists. While the numbers of both pediatric dermatology fellowships and board certified pediatric dermatologists in the workforce have increased over the years, recent reports suggest that there is a gap in pediatric dermatology education during dermatology residency. The goal of this study is to assess the current state of pediatric education during residency, as well as the clinical experience, satisfaction and expectations of graduating dermatology residents. A 31-question self-report survey was distributed electronically to 294 third-year dermatology residents with questions pertaining to demographics, didactic education, resident experience in pediatric dermatology training, satisfaction with pediatric training and future plans. One hundred and twenty-three residents responded (41.8% response rate) representing approximately 29.1% of the total number of graduating residents. 69 (56.1%) residents reported academic time specifically devoted to pediatric dermatology, the majority (79.7%) of which was led by pediatric dermatologists. 82% of residents reported dedicated pediatric dermatology clinics at their program. 86.8% of respondents felt that their training in pediatric dermatology will allow them to confidently see pediatric dermatology patients in practice. This survey highlights a promising state of pediatric dermatology training among current graduating dermatology residents. The majority of current graduating dermatology residents are satisfied with their pediatric dermatology education, feel confident treating pediatric patients, and plan to see pediatric patients in clinical practice. © 2015 Wiley Periodicals, Inc.

  18. Do otolaryngology residency applicants relocate for training?

    Science.gov (United States)

    Gebhard, Grant M; Hauser, Leah J; Dally, Miranda J; Weitzenkamp, David A; Cabrera-Muffly, Cristina

    2016-04-01

    To determine whether there is an association between the geographic location of an applicant's undergraduate school, medical school, and residency program among matched otolaryngology residency applicants. Observational. Otolaryngology residency program applications to our institution from 2009 to 2013 were analyzed. The geographic location of each applicant's undergraduate education and medical education were collected. Online public records were queried to determine the residency program location of matched applicants. Applicants who did not match or who attended medical school outside the United States were excluded. Metro area, state, and region were determined according to US Census Bureau definitions. From 2009 to 2013, 1,089 (78%) of 1,405 applicants who matched into otolaryngology residency applied to our institution. The number of subjects who attended medical school and residency in the same geographic region was 241 (22%) for metropolitan area, 305 (28%) for state, and 436 (40%) for region. There was no difference in geographic location retention by gender or couples match status of the subject. United States Medical Licensing Exam step 1 scores correlated with an increased likelihood of subjects staying within the same geographic region (P = .03). Most otolaryngology applicants leave their previous geographic area to attend residency. Based on these data, the authors recommend against giving weight to geography as a factor when inviting applicants to interview. NA. © 2015 The American Laryngological, Rhinological and Otological Society, Inc.

  19. Neurosurgery resident leadership development: an innovative approach.

    Science.gov (United States)

    Pettit, Jeffrey E; Dahdaleh, Nader S; Albert, Gregory W; Greenlee, Jeremy D

    2011-02-01

    A great deal of time and resources go into the development and training of neurosurgeons. One area that has minimal literature and assessment is leadership development. Under the core competency of interpersonal and communication skills, the Accreditation Council for Graduate Medical Education has indicated that residents are expected to work effectively as a member or leader of a healthcare team. This article reveals how a structured leadership program was developed so that residents are better prepared for the role of chief resident and future leadership roles. Beginning in October 2006, residents attended a series of 1-hour workshops conducted monthly. Topics included leadership style, conflict management, effective feedback, team building, team leadership, motivation, and moving from peer to leader. A retrospective pretest was conducted at the end of the program. Residents reported a significant knowledge gain for the majority of topics. Resident comments indicated a greater awareness of the impact of leading and ways to improve their personal leadership. Quantitatively and qualitatively, residents and faculty reported that the leadership program made a significant impact on the development of future neurosurgical leaders.

  20. Problem neurology residents: a national survey.

    Science.gov (United States)

    Tabby, David S; Majeed, Muhammed H; Schwartzman, Robert J

    2011-06-14

    Problem residents are found across most medical specialties at a prevalence of about 10%. This study was designed to explore the prevalence and causes of problem neurology residents and to compare neurology programs' responses and outcomes. Directors of 126 US neurology residency programs were sent an electronic survey. We collected data on demographics, first and all "identifiers" of problem residents, and year of training in which the problem was found. We asked about observable signs, etiology, and who performed remediation. We asked what resources were used and what outcomes occurred. Ninety-five program directors completed surveys (75% response rate). Almost all neurology programs have problem residents (81%). Age, sex, marital status, being a US native, or attending a US medical school had no effect on problem status. Being a parent carried a lower likelihood of problems (32%). Most commonly the problem is acted on during the first year of training. Faculty members without defined educational roles were the most frequent first identifiers. Program directors were the most common remediators. The most common remediation techniques were increasing supervision and assigning a faculty mentor. Graduate medical education office and psychiatric or psychological counseling services were most often used. Eleven percent of problem residents required a program for impaired physicians and 14% required a leave of absence. Sixteen percent were dismissed from their programs. The prevalence of problem residents in neurology is similar to other disciplines, and various resources are available to remediate them.

  1. A systematic health assessment of indian ocean bottlenose (Tursiops aduncus and indo-pacific humpback (Sousa plumbea dolphins incidentally caught in shark nets off the KwaZulu-Natal Coast, South Africa.

    Directory of Open Access Journals (Sweden)

    Emily P Lane

    Full Text Available Coastal dolphins are regarded as indicators of changes in coastal marine ecosystem health that could impact humans utilizing the marine environment for food or recreation. Necropsy and histology examinations were performed on 35 Indian Ocean bottlenose dolphins (Tursiops aduncus and five Indo-Pacific humpback dolphins (Sousa plumbea incidentally caught in shark nets off the KwaZulu-Natal coast, South Africa, between 2010 and 2012. Parasitic lesions included pneumonia (85%, abdominal and thoracic serositis (75%, gastroenteritis (70%, hepatitis (62%, and endometritis (42%. Parasitic species identified were Halocercus sp. (lung, Crassicauda sp. (skeletal muscle and Xenobalanus globicipitis (skin. Additional findings included bronchiolar epithelial mineralisation (83%, splenic filamentous tags (45%, non-suppurative meningoencephalitis (39%, and myocardial fibrosis (26%. No immunohistochemically positive reaction was present in lesions suggestive of dolphin morbillivirus, Toxoplasma gondii and Brucella spp. The first confirmed cases of lobomycosis and sarcocystosis in South African dolphins were documented. Most lesions were mild, and all animals were considered to be in good nutritional condition, based on blubber thickness and muscle mass. Apparent temporal changes in parasitic disease prevalence may indicate a change in the host/parasite interface. This study provided valuable baseline information on conditions affecting coastal dolphin populations in South Africa and, to our knowledge, constitutes the first reported systematic health assessment in incidentally caught dolphins in the Southern Hemisphere. Further research on temporal disease trends as well as disease pathophysiology and anthropogenic factors affecting these populations is needed.

  2. A systematic health assessment of indian ocean bottlenose (Tursiops aduncus) and indo-pacific humpback (Sousa plumbea) dolphins incidentally caught in shark nets off the KwaZulu-Natal Coast, South Africa.

    Science.gov (United States)

    Lane, Emily P; de Wet, Morné; Thompson, Peter; Siebert, Ursula; Wohlsein, Peter; Plön, Stephanie

    2014-01-01

    Coastal dolphins are regarded as indicators of changes in coastal marine ecosystem health that could impact humans utilizing the marine environment for food or recreation. Necropsy and histology examinations were performed on 35 Indian Ocean bottlenose dolphins (Tursiops aduncus) and five Indo-Pacific humpback dolphins (Sousa plumbea) incidentally caught in shark nets off the KwaZulu-Natal coast, South Africa, between 2010 and 2012. Parasitic lesions included pneumonia (85%), abdominal and thoracic serositis (75%), gastroenteritis (70%), hepatitis (62%), and endometritis (42%). Parasitic species identified were Halocercus sp. (lung), Crassicauda sp. (skeletal muscle) and Xenobalanus globicipitis (skin). Additional findings included bronchiolar epithelial mineralisation (83%), splenic filamentous tags (45%), non-suppurative meningoencephalitis (39%), and myocardial fibrosis (26%). No immunohistochemically positive reaction was present in lesions suggestive of dolphin morbillivirus, Toxoplasma gondii and Brucella spp. The first confirmed cases of lobomycosis and sarcocystosis in South African dolphins were documented. Most lesions were mild, and all animals were considered to be in good nutritional condition, based on blubber thickness and muscle mass. Apparent temporal changes in parasitic disease prevalence may indicate a change in the host/parasite interface. This study provided valuable baseline information on conditions affecting coastal dolphin populations in South Africa and, to our knowledge, constitutes the first reported systematic health assessment in incidentally caught dolphins in the Southern Hemisphere. Further research on temporal disease trends as well as disease pathophysiology and anthropogenic factors affecting these populations is needed.

  3. Are neurology residents interested in headache?

    Science.gov (United States)

    Gago-Veiga, A B; Santos-Lasaosa, S; Viguera Romero, J; Pozo-Rosich, P

    The years of residency are the pillars of the subsequent practice in every medical specialty. The aim of our study is to evaluate the current situation, degree of involvement, main interests, and perceived quality of the training received by Spanish residents of neurology, specifically in the area of headache. A self-administered survey was designed by the Headache Study Group of the Spanish Society of Neurology (GECSEN) and was sent via e-mail to all residents who were members of the Society as of May 2015. Fifty-three residents completed the survey (N = 426, 12.4%): 6% were first year residents, 25.5% second year, 23.5% third year, and 45% fourth year residents, all from 13 different Spanish autonomous communities. The areas of greatest interest are, in this order: Vascular neurology, headache, and epilepsy. Of them, 85% believe that the area of headache is undervalued. More than half of residents (52.8%) do not rotate in specific Headache Units and only 35.8% complete their training dominating anaesthetic block and toxin infiltration techniques. Of them, 81.1% believe that research is scarce or absent; 69.8% have never made a poster/presentation, 79.3% have not published and only 15% collaborate on research projects in this area. Lastly, 40% believe that they have not received adequate training. Headache is among the areas that interest our residents the most; however, we believe that we must improve their training both at a patient healthcare level and as researchers. Thus, increasing the number of available courses, creating educational web pages, involving residents in research, and making a rotation in a specialised unit mandatory are among the fundamental objectives of the GECSEN. Copyright © 2016 Sociedad Española de Neurología. Publicado por Elsevier España, S.L.U. All rights reserved.

  4. Program for developing leadership in pharmacy residents.

    Science.gov (United States)

    Fuller, Patrick D

    2012-07-15

    An innovative, structured approach to incorporating leadership development activities into pharmacy residency training is described. The American Society of Health-System Pharmacists (ASHP) has called for increased efforts to make leadership development an integral component of the training of pharmacy students and new practitioners. In 2007, The Nebraska Medical Center (TNMC) took action to systematize leadership training in its pharmacy residency programs by launching a new Leadership Development Series. Throughout the residency year, trainees at TNMC participate in a variety of activities: (1) focused group discussions of selected articles on leadership concepts written by noted leaders of the past and present, (2) a two-day offsite retreat featuring trust-building exercises and physical challenges, (3) a self-assessment designed to help residents identify and use their untapped personal strengths, (4) training on the effective application of different styles of communication and conflict resolution, and (5) education on the history and evolution of health-system pharmacy, including a review and discussion of lectures by recipients of ASHP's Harvey A. K. Whitney Award. Feedback from residents who have completed the series has been positive, with many residents indicating that it has stimulated their professional growth and helped prepared them for leadership roles. A structured Leadership Development Series exposes pharmacy residents to various leadership philosophies and principles and, through the study of Harvey A. K. Whitney Award lectures, to the thoughts of past and present pharmacy leaders. Residents develop an increased self-awareness through a resident fall retreat, a StrengthsFinder assessment, and communication and conflict-mode assessment tools.

  5. 26 CFR 25.2702-5 - Personal residence trusts.

    Science.gov (United States)

    2010-04-01

    ... a portion of the residence is used in an activity meeting the requirements of section 280A(c) (1) or... provision of lodging (e.g. a hotel or a bed and breakfast). A residence is not a personal residence if... portion of their interests in the residence) to the same personal residence trust, provided that the...

  6. Perspectives of Residents of Mashhad School of Dentistry about the Curriculum of Residency Program

    Directory of Open Access Journals (Sweden)

    Javad Sarabadani

    2015-09-01

    Full Text Available Introduction: This study was carried out to analyze the viewpoint of the residents of school of dentistry about the curriculum presented in the residency program to students of Mashhad School of Dentistry. Methods: To evaluate the perspectives of residents of dental school about the curriculum and regulations of residency program, a questionnaire was designed whose validity and reliability were confirmed by the authorities of School of Dentistry and test-retest reliability, respectively. The questionnaire was distributed among 100 residents and 80 of them completed the questionnaires. The data were analyzed by SPSS software (version 11.5. Results: A total of 43% of residents were informed of the curriculum (e.g. academic leave, transfer, removal of semester, etc.. As for the ability to write research proposal, 42.7% of residents were reported to have a favorable status, i.e. they were able to write more than 80% of their proposal. From among the residents, 30.4% had specialized English language certificate. Most of them (77% were satisfied with the professional staff, faculty members, of the faculty. Many students liked to participate in the teaching method courses of the residency program. Conclusion: Residents maintained that the curriculum in such domains as educational and research issues and special capabilities had some weak points. Thus, appropriate strategies are recommended to be applied to revise the curriculum using the residents’ views on these programs.

  7. Confidence, knowledge, and skills at the beginning of residency. A survey of pathology residents.

    Science.gov (United States)

    Hsieh, Cindy M; Nolan, Norris J

    2015-01-01

    To document the pathology learning experiences of pathology residents prior to residency and to determine how confident they were in their knowledge and technical skills. An online survey was distributed to all pathology residency program directors in the United States, who were requested to forward the survey link to their residents. Data were obtained on pathology electives, grossing experience, and frozen section experience. Likert scale questions assessed confidence level in knowledge and skills. In total, 201 pathology residents responded (8% of residents in the United States). Prior to starting residency, most respondents had exposure to anatomic pathology through elective rotations. Few respondents had work-related experience. Most did not feel confident in their pathology-related knowledge or skills, and many did not understand what pathology resident duties entail. Respondents gained exposure to pathology primarily through elective rotations, and most felt the elective experience prepared them for pathology residency. However, elective time may be enhanced by providing opportunities for students to increase hands-on experience and understanding of resident duties. Copyright© by the American Society for Clinical Pathology.

  8. Changes in Personal Relationships During Residency and Their Effects on Resident Wellness: A Qualitative Study.

    Science.gov (United States)

    Law, Marcus; Lam, Michelle; Wu, Diana; Veinot, Paula; Mylopoulos, Maria

    2017-11-01

    Residency poses challenges for residents' personal relationships. Research suggests residents rely on family and friends for support during their training. The authors explored the impact of residency demands on residents' personal relationships and the effects changes in those relationships could have on their wellness. The authors used a constructivist grounded theory approach. In 2012-2014, they conducted semistructured interviews with a purposive and theoretical sample of 16 Canadian residents from various specialties and training levels. Data analysis occurred concurrently with data collection, allowing authors to use a constant comparative approach to explore emergent themes. Transcripts were coded; codes were organized into categories and then themes to develop a substantive theory. Residents perceived their relationships to be influenced by their evolving professional identity: Although personal relationships were important, being a doctor superseded them. Participants suggested they were forced to adapt their personal relationships, which resulted in the evolution of a hierarchy of relationships that was reinforced by the work-life imbalance imposed by their training. This poor work-life balance seemed to result in relationship issues and diminish residents' wellness. Participants applied coping mechanisms to manage the conflict arising from the adaptation and protect their relationships. To minimize the effects of identity dissonance, some gravitated toward relationships with others who shared their professional identity or sought social comparison as affirmation. Erosion of personal relationships could affect resident wellness and lead to burnout. Educators must consider how educational programs impact relationships and the subsequent effects on resident wellness.

  9. Emergency Medicine Residency Applicant Characteristics Associated with Measured Adverse Outcomes During Residency

    Directory of Open Access Journals (Sweden)

    Jesse Bohrer-Clancy

    2017-12-01

    Full Text Available Introduction Negative outcomes in emergency medicine (EM programs use a disproportionate amount of educational resources to the detriment of other residents. We sought to determine if any applicant characteristics identifiable during the selection process are associated with negative outcomes during residency. Methods Primary analysis consisted of looking at the association of each of the descriptors including resident characteristics and events during residency with a composite measure of negative outcomes. Components of the negative outcome composite were any formal remediation, failure to complete residency, or extension of residency. Results From a dataset of 260 residents who completed their residency over a 19-year period, 26 (10% were osteopaths and 33 (13% were international medical school graduates A leave of absence during medical school (p <.001, failure to send a thank-you note (p=.008, a failing score on United States Medical Licensing Examination Step I (p=.002, and a prior career in health (p=.034 were factors associated with greater likelihood of a negative outcome. All four residents with a “red flag” during their medicine clerkships experienced a negative outcome (p <.001. Conclusion “Red flags” during EM clerkships, a leave of absence during medical school for any reason and failure to send post-interview thank-you notes may be associated with negative outcomes during an EM residency.

  10. Effectiveness of resident as teacher curriculum in preparing emergency medicine residents for their teaching role.

    Science.gov (United States)

    Hosein Nejad, Hooman; Bagherabadi, Mehdi; Sistani, Alireza; Dargahi, Helen

    2017-01-01

    Over the past 30 years, recognizing the need and importance of training residents in teaching skills has resulted in several resident-as-teacher programs. The purpose of this study was to explore the impact of this teaching initiative and investigate the improvement in residents' teaching skills through evaluating their satisfaction and perceived effectiveness as well as assessing medical students' perception of the residents' teaching quality. This research is a quasi-experimental study with pre- and post-tests, continuing from Dec 2010 to May 2011 in Imam Hospital, Tehran University of Medical Sciences. In this survey, Emergency Medicine Residents (n=32) participated in an 8-hour workshop. The program evaluation was performed based on Kirkpatrick's model by evaluation of residents in two aspects: self-assessment and evaluation by interns who were trained by these residents. Content validity of the questionnaires was judged by experts and reliability was carried out by test re-test. The questionnaires were completed before and after the intervention. Paired sample t-test was applied to analyze the effect of RAT curriculum and workshop on the improvement of residents' teaching skills based on their self-evaluation and Mann-Whitney U test was used to identify significant differences between the two evaluator groups before and after the workshop. The results indicated that residents' attitude towards their teaching ability was improved significantly after participating in the workshop (pTeacher for emergency medicine residents resulted in favorable outcomes in the second evaluated level of Kirkpatrick's model, i.e. it showed measurable positive changes in the self-assessments of medical residents about different aspects of teaching ability and performance. However, implementing training sessions for resident physicians, although effective in improving their confidence and self-assessment of their teaching skills, seems to cause no positive change in the third

  11. Identifying Gaps and Launching Resident Wellness Initiatives: The 2017 Resident Wellness Consensus Summit

    Directory of Open Access Journals (Sweden)

    Nicole Battaglioli

    2018-02-01

    Full Text Available Introduction: Burnout, depression, and suicidality among residents of all specialties have become a critical focus for the medical education community, especially among learners in graduate medical education. In 2017 the Accreditation Council for Graduate Medical Education (ACGME updated the Common Program Requirements to focus more on resident wellbeing. To address this issue, one working group from the 2017 Resident Wellness Consensus Summit (RWCS focused on wellness program innovations and initiatives in emergency medicine (EM residency programs. Methods: Over a seven-month period leading up to the RWCS event, the Programmatic Initiatives workgroup convened virtually in the Wellness Think Tank, an online, resident community consisting of 142 residents from 100 EM residencies in North America. A 15-person subgroup (13 residents, two faculty facilitators met at the RWCS to develop a public, central repository of initiatives for programs, as well as tools to assist programs in identifying gaps in their overarching wellness programs. Results: An online submission form and central database of wellness initiatives were created and accessible to the public. Wellness Think Tank members collected an initial 36 submissions for the database by the time of the RWCS event. Based on general workplace, needs-assessment tools on employee wellbeing and Kern’s model for curriculum development, a resident-based needs-assessment survey and an implementation worksheet were created to assist residency programs in wellness program development. Conclusion: The Programmatic Initiatives workgroup from the resident-driven RWCS event created tools to assist EM residency programs in identifying existing initiatives and gaps in their wellness programs to meet the ACGME’s expanded focus on resident wellbeing.

  12. Anesthesiology resident personality type correlates with faculty assessment of resident performance.

    Science.gov (United States)

    Schell, Randall M; Dilorenzo, Amy N; Li, Hsin-Fang; Fragneto, Regina Y; Bowe, Edwin A; Hessel, Eugene A

    2012-11-01

    To study the association between anesthesiology residents' personality preference types, faculty evaluations of residents' performance, and knowledge. Convenience sample and prospective study. Academic department of anesthesiology. Consenting anesthesiology residents (n = 36). All participants completed the Myers Briggs Type Indicator® (MBTI®). All residents' 6-month summation of daily focal evaluations completed by faculty [daily performance score (DPS); 1 = unsatisfactory, 2 = needs improvement, 3 = meets expectations, 4 = exceeds expectations], as well as a global assessment of performance (GAP) score based on placement of each resident into perceived quartile compared with their peers (ie,1 = first, or top, quartile) by senior faculty (n = 7) who also completed the MBTI, were obtained. The resident MBTI personality preferences were compared with the DPS and GAP scores, the United States Medical Licensing Examination (USMLE) I and II scores, and faculty MBTI personality type. There was no association between personality preference type and performance on standardized examinations (USMLE I, II). The mean GAP score was better (higher quartile score) for Extraverts than Introverts (median 2.0 vs 2.6, P = 0.0047) and for Sensing versus Intuition (median 2.0 vs 2.6, P = 0.0206) preference. Faculty evaluator MBTI preference type did not influence the GAP scores they assigned residents. Like GAP, the DPS was better for residents with Sensing versus Intuition preference (median 3.5 vs 3.3, P = 0.0111). No difference in DPS was noted between Extraverts and Introverts. Personality preference type was not associated with resident performance on standardized examinations, but it was associated with faculty evaluations of resident performance. Residents with Sensing personality preference were evaluated more favorably on global and focal faculty evaluations than those residents who chose the Intuition preference. Extraverted residents were evaluated more favorably on

  13. General Surgery Resident Satisfaction on Cardiothoracic Rotations.

    Science.gov (United States)

    Lussiez, Alisha; Bevins, Jack; Plaska, Andrew; Rosin, Vadim; Reddy, Rishindra M

    2016-01-01

    General surgery residents' exposure to cardiothoracic (CT) surgery rotations has decreased, which may affect resident satisfaction. We surveyed general surgery graduates to assess the relationships among rotation satisfaction, CT disease exposure, rotation length, mentorship, and mistreatment. A survey assessing CT curriculum, exposure, mentorship, and satisfaction was forwarded to general surgery graduates from 17 residency programs. A Wilcoxon rank-sum test was used to assess statistical significance of ordinal level data. Statistical significance was defined as p surgery residency programs who graduated between the years of 1999 to 2014. A total of 94 responses were completed and received. Receiving adequate exposure to CT procedures and disease management was significantly associated with higher satisfaction ratings for all procedures, particularly thoracotomy incisions (p Surgery. Published by Elsevier Inc. All rights reserved.

  14. Introducing "optimal challenges" in resident training

    DEFF Research Database (Denmark)

    Sørensen, Anette Bagger; Christensen, Mette Krogh

    Background: Residents are often caught between two interests: the resident’s desire to participate in challenging learning situations and the department’s work planning. However, these interests may clash if they are not coordinated by the senior doctors, and challenging learning situations risk...... that the residents benefit from the intervention because they experienced more optimal challenges than before the intervention. However, the matching of resident and case seems to work against the established culture in the department: The daily work has for many years been organized so that senior doctors have...... relationships in order to meet the health system’s and the patients’ call for continuity in the treatment. Take-home message: The matching of resident and case stimulates optimal learning situations, but cultural and organizational values concerning the doctor-patient continuity are challenged....

  15. Drug target residence time: a misleading concept.

    Science.gov (United States)

    Folmer, Rutger H A

    2018-01-01

    Since the importance of drug target residence time was first highlighted more 10 years ago, slow binding kinetics has received much attention in the drug discovery literature, and indeed within pharmaceutical research. However, the residence concept as presented in most papers is supported by rather misleading simulations and arguments, and by examples where compounds are taken out of their pharmacokinetic context. Moreover, fast association is typically more desirable than slow, and advantages of long residence time, notably a potential disconnect between pharmacodynamics (PD) and pharmacokinetics (PK), would be partially or completely offset by slow on-rate. Therefore, plain potency is likely a better predictor of drug development success than is residence time. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Resident Station Contact Information for Application Developers

    Data.gov (United States)

    Social Security Administration — SSA provides a web service and downloadable file for SSA Resident Station locations, telephone numbers, and hours of operation. (Note: If you think an office might...

  17. Request by the Resident Representative of Iraq

    International Nuclear Information System (INIS)

    1990-01-01

    The attached clarification by a spokesman of the Iraqi Ministry of Foreign Affairs is being circulated for the information of Member States pursuant to a request made by the Resident Representative of Iraq

  18. Mainframe computer use and residency cohort data.

    Science.gov (United States)

    Hotch, D; Helford, M; Rivers, D

    1987-01-01

    This paper describes a computer based method that was developed to prepare a profile of the patient care experiences of a cohort in a three-year, university based family practice residency. Sample pages from the report produced by this method and a description of the computer program are presented. This method of presenting patient encounter information may be particularly useful for program-level evaluation and for monitoring resident training.

  19. Thoracic surgical resident education: a costly endeavor.

    Science.gov (United States)

    Calhoon, John H; Baisden, Clint; Holler, Ben; Hicks, George L; Bove, Ed L; Wright, Cameron D; Merrill, Walter H; Fullerton, Dave A

    2014-12-01

    We sought to define an accurate measure of thoracic surgical education costs. Program directors from six distinct and differently sized and geographically located thoracic surgical training programs used a common template to provide estimates of resident educational costs. These data were reviewed, clarifying questions or discrepancies when noted and using best estimates when exact data were unavailable. Subsequently, a composite of previously published cost-estimation products was used to capture accurate cost data. Data were then compiled and averaged to provide an accurate picture of all costs associated with thoracic surgical education. Before formal accounting was performed, the estimated average for all programs was approximately $250,000 per year per resident. However, when formal evaluations by the six programs were performed, the annual cost of resident education ranged from $330,000 to $667,000 per year per resident. The average cost of $483,000 per year was almost double the initial estimates. Variability was noted by region and size of program. Faculty teaching costs varied from $208,000 to $346,000 per year. Simulation costs ranged from $0 to $80,000 per year. Resident savings to program ranged from $0 to $135,000 per year and averaged $37,000 per year per resident. Thoracic surgical education costs are considerably higher than initial estimates from program directors and probably represent an unappreciated source of financial burden for cardiothoracic surgical educational programs. Copyright © 2014 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.

  20. Ambulatory Care Skills: Do Residents Feel Prepared?

    Directory of Open Access Journals (Sweden)

    Denise Bonds

    2002-10-01

    Full Text Available Objective: To determine resident comfort and skill in performing ambulatory care skills. Methods: Descriptive survey of common ambulatory care skills administered to internal medicine faculty and residents at one academic medical center. Respondents were asked to rate their ability to perform 12 physical exam skills and 6 procedures, and their comfort in performing 7 types of counseling, and obtaining 6 types of patient history (4 point Likert scale for each. Self-rated ability or comfort was compared by gender, status (year of residency, faculty, and future predicted frequency of use of the skill. Results: Residents reported high ability levels for physical exam skills common to both the ambulatory and hospital setting. Fewer felt able to perform musculoskeletal, neurologic or eye exams easily alone. Procedures generally received low ability ratings. Similarly, residents’ comfort in performing common outpatient counseling was also low. More residents reported feeling very comfortable in obtaining history from patients. We found little variation by gender, year of training, or predicted frequency of use. Conclusion: Self-reported ability and comfort for many common ambulatory care skills is low. Further evaluation of this finding in other training programs is warranted.

  1. Informatics and Technology in Resident Education.

    Science.gov (United States)

    Niehaus, William

    2017-05-01

    Biomedical or clinical informatics is the transdisciplinary field that studies and develops effective uses of biomedical data, information technology innovations, and medical knowledge for scientific inquiry, problem solving, and decision making, with an emphasis on improving human health. Given the ongoing advances in information technology, the field of informatics is becoming important to clinical practice and to residency education. This article will discuss how informatics is specifically relevant to residency education and the different ways to incorporate informatics into residency education, and will highlight applications of current technology in the context of residency education. How informatics can optimize communication for residents, promote information technology use, refine documentation techniques, reduce medical errors, and improve clinical decision making will be reviewed. It is hoped that this article will increase faculty and trainees' knowledge of the field of informatics, awareness of available technology, and will assist practitioners to maximize their ability to provide quality care to their patients. This article will also introduce the idea of incorporating informatics specialists into residency programs to help practitioners deliver more evidenced-based care and to further improve their efficiency. Copyright © 2017 American Academy of Physical Medicine and Rehabilitation. Published by Elsevier Inc. All rights reserved.

  2. Canadian Plastic Surgery Resident Work Hour Restrictions: Practices and Perceptions of Residents and Program Directors.

    Science.gov (United States)

    McInnes, Colin W; Vorstenbosch, Joshua; Chard, Ryan; Logsetty, Sarvesh; Buchel, Edward W; Islur, Avinash

    2018-02-01

    The impact of resident work hour restrictions on training and patient care remains a highly controversial topic, and to date, there lacks a formal assessment as it pertains to Canadian plastic surgery residents. To characterize the work hour profile of Canadian plastic surgery residents and assess the perspectives of residents and program directors regarding work hour restrictions related to surgical competency, resident wellness, and patient safety. An anonymous online survey developed by the authors was sent to all Canadian plastic surgery residents and program directors. Basic summary statistics were calculated. Eighty (53%) residents and 10 (77%) program directors responded. Residents reported working an average of 73 hours in hospital per week with 8 call shifts per month and sleep 4.7 hours/night while on call. Most residents (88%) reported averaging 0 post-call days off per month and 61% will work post-call without any sleep. The majority want the option of working post-call (63%) and oppose an 80-hour weekly maximum (77%). Surgical and medical errors attributed to post-call fatigue were self-reported by 26% and 49% of residents, respectively. Residents and program directors expressed concern about the ability to master surgical skills without working post-call. The majority of respondents oppose duty hour restrictions. The reason is likely multifactorial, including the desire of residents to meet perceived expectations and to master their surgical skills while supervised. If duty hour restrictions are aggressively implemented, many respondents feel that an increased duration of training may be necessary.

  3. The Resident Academic Project Program: A Structured Approach to Inspiring Academic Development During Residency Training.

    Science.gov (United States)

    Eckert, Jill; Vaida, Sonia J; Bezinover, Dmitri; McCloskey, Diane E; Mets, Berend

    2016-02-15

    We report the successful implementation of structured resident academic projects in our Department of Anesthesiology at the Penn State Hershey Medical Center. Beginning with the graduating class of 2010, we adopted an expectation that each resident complete a project that results in a manuscript of publishable quality. Defining a clear timeline for all steps in the project and providing research education, as well as the necessary infrastructure and ongoing support, has helped grow the academic productivity of our anesthesia residents.

  4. Assessment of medical residents technology readiness for an online residents-as-teachers curriculum.

    Science.gov (United States)

    Silva, Débora; Lewis, Kadriye O

    2014-06-01

    The University of Puerto Rico School of Medicine has a need to expand the current Residents-as-Teachers workshops into a comprehensive curriculum. One way to do so is to implement an online curriculum, but prior to this, the readiness of the medical residents to participate in such a curriculum should be assessed. Our objective was to determine whether the residents at the University of Puerto Rico School of Medicine are prepared to engage in an online Residents-as-Teachers program. This was a descriptive, mixed-method-design study that collected qualitative and quantitative data using an online survey and a focus-group interview. The study was conducted with students from 11 of the residency programs at the University of Puerto Rico School of Medicine. More than 80% of the participating residents had the technical knowledge to engage in an online program; 90.5% thought an online Residents-as-Teachers course would be a good alternative to what was currently available; 87.5% would be willing to participate in an online program, and 68.6% of the residents stated that they preferred an online course to a traditional one. Determinants of readiness for online learning at the University of Puerto Rico School of Medicine were identified and discussed. Our results suggest that the majority of the residents who participated in this study are ready to engage in an online Residents-as-Teachers program. The only potential barrier found was that one-third of the residents still preferred a traditional curriculum, even when they thought an online Residents-as-Teachers curriculum was a good alternative and were willing to participate in the course or courses forming part of such a curriculum. Therefore, prior to wide-spread implementation of such a curriculum, a pilot test should be conducted to maximize the presumed and eventual success of that curriculum.

  5. Personal Therapy in Psychiatry Residency Training: A National Survey of Canadian Psychiatry Residents.

    Science.gov (United States)

    Hadjipavlou, George; Halli, Priyanka; Hernandez, Carlos A Sierra; Ogrodniczuk, John S

    2016-02-01

    The authors collected nationally representative data on Canadian residents' experiences with and perspectives on personal psychotherapy in their psychiatric training. A 43-item questionnaire was distributed electronically to all current psychiatry residents in Canada (N = 839). Four hundred residents from every program across Canada returned the survey (response rate 47.7%). The prevalence of personal therapy at any time was 55.3%, with 42.8% receiving personal therapy during residency. Of residents who undertook personal psychotherapy, 59.3% engaged in weekly therapy, 74.1% received psychodynamic psychotherapy, and 81.5% participated in long-term therapy (>1 year). Personal growth, self-understanding, and professional development were the most common reasons for engaging in personal therapy; however, one-third of residents did so to alleviate symptoms of depression, anxiety, or other mental health concerns. Time was the most important factor impeding residents from personal therapy; only 8.8% found stigma to act as a barrier. The vast majority of residents rated their experience with personal therapy as having a positive or very positive impact on their personal life (84.8%) and overall development as psychiatrists (81.8%). For 64% of respondents, personal therapy had an important or very important role in psychiatry residency training. Residents who received personal therapy rated themselves as better able to understand what happens moment by moment during therapy sessions, detect and deal with patients' emotional reactions, and constructively use their personal reactions to patients. Interest in personal therapy remains strong among psychiatry trainees in Canada. Residents who engaged in psychotherapy endorsed greater confidence in psychotherapy and rated their psychotherapy skills more favorably than those who had never been in the patient role, supporting the view of personal therapy as an important adjunct to psychotherapy training during residency.

  6. Local Determinants of Crime: Distinguishing Between Resident and Non-resident Offenders

    OpenAIRE

    Spengler, Hannes; Büttner, Thiess

    2003-01-01

    The paper revisits the local determinants of crime using a spatial model distinguishing between resident and non-resident offenders. Employing data for German municipalities, the model is estimated by means of a spatial GMM approach. Focusing on resident offenders legal earnings opportunities and the expected gain from offenses are found to be important determinants of crime. Also the socio-economic background in terms of unemployment, poverty, and inequality proves significant for both prope...

  7. Evaluation of otolaryngology residency program websites.

    Science.gov (United States)

    Svider, Peter F; Gupta, Amar; Johnson, Andrew P; Zuliani, Giancarlo; Shkoukani, Mahdi A; Eloy, Jean Anderson; Folbe, Adam J

    2014-10-01

    Prior to applying or interviewing, most prospective applicants turn to the Internet when evaluating residency programs, making maintenance of a comprehensive website critical. While certain "intangibles" such as reputation may not be communicated effectively online, residency websites are invaluable for conveying other aspects of a program. Prior analyses have reported that certain criteria such as research experience and didactics are important considerations for applicants. To evaluate the comprehensiveness of otolaryngology residency websites. Review of otolaryngology residency program websites. Websites of 99 civilian residency programs were searched for the presence of 23 criteria. Presence of 23 criteria for application process, incentives, instruction, research, clinical training, and other. Only 5 programs contained at least three-quarters of the criteria analyzed; on average programs reported less than 50% of information sought. Among the 99 residency program websites, a description of the following criteria was noted: comprehensive faculty listing (88%), didactics (80%), contact e-mail (77%), current residents (74%), description of facilities (70%), intern schedule (70%), research requirements (69%), otolaryngology rotation schedule (64%), other courses (61%), ERAS (Electronic Residency Application Service) link (55%), year-to-year responsibility progression (47%), call schedule (40%), active/past research projects (37%), area information (34%), message from the program director (33%) or chair (23%), selection criteria (30%), salary (directly on site) (23%), surgical statistics (18%), parking (9%), and meal allowance (7%). The mean (SD) percentage present of factors encompassing "clinical training" was 55% (23%), significantly higher than the mean (SD) percentage of factors covered under the "incentives" category (19% [11%]; P = .01). The proportion of overall criteria present on websites did not differ on organizing programs by region (range, 42

  8. Career Interests of Canadian Psychiatry Residents: What Makes Residents Choose a Research Career?

    Science.gov (United States)

    Laliberté, Vincent; Rapoport, Mark J; Andrew, Melissa; Davidson, Marla; Rej, Soham

    2016-02-01

    Training future clinician-researchers remains a challenge faced by Canadian psychiatry departments. Our objectives were to determine the prevalence of residents interested in pursuing research and other career options as part of their practice, and to identify the factors associated with interest in research. Data from a national online survey of 207 Canadian psychiatry residents from a total of 853 (24.3% response rate) were examined. The main outcome was interest in research as part of residents' future psychiatrist practice. Bivariate and multivariate analyses were performed to identify demographic and vocational variables associated with research interest. Interest in research decreases by 76% between the first and fifth year of psychiatry residency (OR 0.76 per year, 95% CI 0.60 to 0.97). Training in a department with a residency research track did not correlate with increased research interest (χ2 = 0.007, df = 1, P = 0.93). Exposing and engaging psychiatry residents in research as early as possible in residency training appears key to promoting future research interest. Psychiatry residency programs and research tracks could consider emphasizing research training initiatives and protected research time early in residency. © The Author(s) 2015.

  9. International Programs in the Education of Residents: Benefits for the Resident and the Home Program.

    Science.gov (United States)

    Rodriguez, Abigail; Ho, Trung; Verheyden, Charles

    2015-11-01

    There is a significant need for basic surgical care worldwide. In recent years, modest improvement in fulfilling this demand has been achieved through international medical mission trips from various organizations. These humanitarian endeavors and global health experiences have generated increasing interest in participating in international missions from surgical residents. However, many academic institutions currently do not have the infrastructure or desire to support surgical residents participating in medical missions. This paper aims to illustrate that careful, planned integration of medical mission trips into the residency curriculum will develop and enhance resident education and experience by fulfilling all six Accreditation Council for Graduate Medical Education (ACGME) core competencies and by benefitting the native program.

  10. Elective time during dermatology residency: A survey of residents and program directors.

    Science.gov (United States)

    Uppal, Pushpinder; Shantharam, Rohini; Kaufmann, Tara Lynn

    2017-12-15

    Elective time during residency training provides residents with exposure to different subspecialties. This opportunity gives residents the chance tonurture growth in particular areas of interest and broaden their knowledge base in certain topics in dermatology by having the chance to work withexperts in the field. The purpose of this study was to assess the views of residency program directors and dermatology residents on the value of elective time through a cross sectional survey. An eight-questionIRB exempt survey was sent out to 113 residency program directors via email through the American Professors of Dermatology (APD) program director listserv. Program directors were asked to forward a separate set of 9 questions to their residents. The majority of programs that responded allowed for some elective time within their schedule, often duringthe PGY 4 (3rd year of dermatology training), but the amount of time allowed widely varied among many residency programs. Overall, residents and program directors agree that elective is important in residencytraining, but no standardization is established across programs.

  11. Neuroscience and humanistic psychiatry: a residency curriculum.

    Science.gov (United States)

    Griffith, James L

    2014-04-01

    Psychiatry residencies with a commitment to humanism commonly prioritize training in psychotherapy, cultural psychiatry, mental health policy, promotion of human rights, and similar areas reliant upon dialogue and collaborative therapeutic relationships. The advent of neuroscience as a defining paradigm for psychiatry has challenged residencies with a humanistic focus due to common perceptions that it would entail constriction of psychiatric practice to diagnostic and psychopharmacology roles. The author describes a neuroscience curriculum that has taught psychopharmacology effectively, while also advancing effectiveness of language-based and relationship-based therapeutics. In 2000, the George Washington University psychiatry residency initiated a neuroscience curriculum consisting of (1) a foundational postgraduate year 2 seminar teaching cognitive and social neuroscience and its integration into clinical psychopharmacology, (2) advanced seminars that utilized a neuroscience perspective in teaching specific psychotherapeutic skill sets, and (3) case-based teaching in outpatient clinical supervisions that incorporated a neuroscience perspective into traditional psychotherapy supervisions. Curricular assessment was conducted by (1) RRC reaccreditation site visit feedback, (2) examining career trajectories of residency graduates, (3) comparing PRITE exam Somatic Treatments subscale scores for 2010-2012 residents with pre-implementation residents, and (4) postresidency survey assessment by 2010-2012 graduates. The 2011 RRC site visit report recommended a "notable practice" citation for "innovative neurosciences curriculum." Three of twenty 2010-2012 graduates entered neuroscience research fellowships, as compared to none before the new curriculum. PRITE Somatic Treatments subscale scores improved from the 23rd percentile to the 62nd percentile in pre- to post-implementation of curriculum (p neuroscience curriculum for a residency committed to humanistic psychiatry

  12. [Evaluation in medical residency training programs].

    Science.gov (United States)

    Kolokythas, O; Patzwahl, R; Straka, M; Binkert, C

    2016-01-01

    For resident doctors the acquisition of technical and professional competence is decisive for the successful practice of their activities. Competency and professional development of resident doctors benefit from regular self-reflection and assessment by peers. While often promoted and recommended by national educational authorities, the implementation of a robust evaluation process in the clinical routine is often counteracted by several factors. The aim of the study was to test a self-developed digital evaluation system for the assessment of radiology residents at our institute for practicality and impact with regard to the radiological training. The intranet-based evaluation system was implemented in January 2014, which allowed all Radiology consultants to submit a structured assessment of the Radiology residents according to standardized criteria. It included 7 areas of competency and 31 questions, as well as a self-assessment module, both of which were filled out electronically on a 3-month basis using a 10-point scale and the opportunity to make free text comments. The results of the mandatory self-evaluation by the residents were displayed beside the evaluation by the supervisor. Access to results was restricted and quarterly discussions with the residents were conducted confidentially and individually. The system was considered to be practical to use and stable in its functionality. The centrally conducted anonymous national survey of residents revealed a noticeable improvement of satisfaction with the institute assessment for the criterion "regular feedback"compared to the national average. Since its implementation the system has been further developed and extended and is now available for other institutions.

  13. Learning styles in two otolaryngology residency programs.

    Science.gov (United States)

    Laeeq, Kulsoom; Weatherly, Robert A; Carrott, Alice; Pandian, Vinciya; Cummings, Charles W; Bhatti, Nasir I

    2009-12-01

    Kolb portrays four learning styles depending on how an individual grasps or transforms experience: accommodating, assimilating, diverging, and converging. Past studies in surgery, medicine, and anesthesia identified the predominant learning style in each of these specialties. The prevalence of different learning styles and existence of a predominant style, if any, has not been reported for otolaryngology residency programs. The purpose of our study was to determine if otolaryngology residents have a preferred learning style that is different from the predominant learning styles reported for other specialties. We conducted a survey of the otolaryngology-head and neck surgery residents at two residency programs. Kolb's Learning Style Index (LSI) version 3.1 was administered to 46 residents from Johns Hopkins University and Kansas University Otolaryngology-Head and Neck Surgery programs. LSI is a widely used 12-item questionnaire, with each item followed by four options. The subjects graded the options depending on how the options applied to them. Forty-three otolaryngology residents completed the survey, with a response rate of 93.47%. The predominant learning style was converging (55.81%) followed by accommodating (18.61%), accounting for the learning styles of 74.42% of the total population. There were only 13.95% assimilating and 6.98% diverging learning styles. Two residents (4.65%) had their preference balanced across four learning styles. The predominant learning styles in otolaryngology were converging and accommodating, accounting for three fourths of the population. It would be desirable to modify our curriculum in a way that will optimize and facilitate learning.

  14. Use and utility of Web-based residency program information: a survey of residency applicants.

    Science.gov (United States)

    Embi, Peter J; Desai, Sima; Cooney, Thomas G

    2003-01-01

    The Internet has become essential to the residency application process. In recent years, applicants and residency programs have used the Internet-based tools of the National Residency Matching Program (NRMP, the Match) and the Electronic Residency Application Service (ERAS) to process and manage application and Match information. In addition, many residency programs have moved their recruitment information from printed brochures to Web sites. Despite this change, little is known about how applicants use residency program Web sites and what constitutes optimal residency Web site content, information that is critical to developing and maintaining such sites. To study the use and perceived utility of Web-based residency program information by surveying applicants to an internal medicine program. Our sample population was the applicants to the Oregon Health & Science University Internal Medicine Residency Program who were invited for an interview. We solicited participation using the group e-mail feature available through the Electronic Residency Application Service Post-Office application. To minimize the possibility for biased responses, the study was confined to the period between submission of National Residency Matching Program rank-order lists and release of Match results. Applicants could respond using an anonymous Web-based form or by reply to the e-mail solicitation. We tabulated responses, calculated percentages for each, and performed a qualitative analysis of comments. Of the 431 potential participants, 218 responded (51%) during the study period. Ninety-nine percent reported comfort browsing the Web; 52% accessed the Web primarily from home. Sixty-nine percent learned about residency Web sites primarily from residency-specific directories while 19% relied on general directories. Eighty percent found these sites helpful when deciding where to apply, 69% when deciding where to interview, and 36% when deciding how to rank order programs for the Match. Forty

  15. The "resident's dilemma"? Values and strategies of medical residents for education interactions: a cellular automata simulation.

    Science.gov (United States)

    Heckerling, P S; Gerber, B S; Weiner, S J

    2006-01-01

    Medical residents engage in formal and informal education interactions with fellow residents during the working day, and can choose whether to spend time and effort on such interactions. Time and effort spent on such interactions can bring learning and personal satisfaction to residents, but may also delay completion of clinical work. Using hypothetical cases, we assessed the values and strategies of internal medicine residents at one hospital for both cooperative and non-cooperative education interactions with fellow residents. We then used these data and cellular automata models of two-person games to simulate repeated interactions between residents, and to determine which strategies resulted in greatest accrued value. We conducted sensitivity analyses on several model parameters, to test the robustness of dominant strategies to model assumptions. Twenty-nine of the 57 residents (50.9%) valued cooperation more than non-cooperation no matter what the other resident did during the current interaction. Similarly, thirty-six residents (63.2%) endorsed an unconditional always-cooperate strategy no matter what the other resident had done during their previous interaction. In simulations, an always-cooperate strategy accrued more value (776.42 value units) than an aggregate of strategies containing non-cooperation components (675.0 value units, p = 0.052). Only when the probability of strategy errors reached 50%, or when values were re-ordered to match those of a Prisoner's Dilemma, did non-cooperation-based strategies accrue the most value. Cooperation-based values and strategies were most frequent among our residents, and dominated in simulations of repeated education interactions between them.

  16. Pregnancy during otolaryngology residency: experience and recommendations.

    Science.gov (United States)

    Cole, Stephanie; Arnold, Michelle; Sanderson, Alicia; Cupp, Craig

    2009-05-01

    Pregnancy during graduate medical training became a pertinent issue in the United States during the 10-year interval between 1992 and 2002 as the number of female residents trended steadily upward to over 25 per cent. Surgical training programs characteristically present unique challenges and stressors for all trainees, and pregnancy introduces additional physical, professional, and emotional demands for the pregnant woman and her coworkers. A qualitative study was performed using in-person interviews of female otolaryngology residents who had given birth within the previous 12 months. Items addressed included the pregnancy course and its complications, specific stressors during and after pregnancy, and solutions implemented by the resident and her program director. Reactions and level of support from coworkers were also discussed. Five pregnancies were reported among three residents interviewed. One resident experienced preterm delivery, which necessitated a week-long stay in the neonatal intensive care unit for her infant. Another had chorioamnionitis during delivery of two infants. One child had low birth weight. The third resident had a miscarriage during the first trimester of her first pregnancy and sustained a minor head injury after fainting in the operating room during her second pregnancy. Overall, long hours, unpredictable work demands, and guilt over colleagues' increased workloads and altered schedules were noted as significant sources of stress among these residents; the women also described high expectations of themselves, along with misgivings over their ability to balance pregnancy and parenthood with career demands. The most significant postpartum stress indicator was the matter of child care, especially as it related to finding adequate coverage for on-call periods ranging from 3 to 14 days per month. Maintaining breastfeeding was an additional concern in the postpartum period. Pregnancy during surgical residency is a significant source of

  17. Teacher in Residence: Bringing Science to Students

    CERN Multimedia

    Daisy Yuhas

    CERN welcomes its first Teacher in Residence, Terrence Baine of the University of Oslo. Baine, who originally hails from Canada, will be concurrently completing his PhD in Physics Education during his time at CERN. Like CERN’s High School Teacher Programme (HST), of which Baine is an alumnus, the Teacher in Residence position is designed to help educators spread the science of CERN in a form that is accessible to students and can encourage them to pursue physics throughout their education.   Terrence Baine, first 'teacher in residence' at CERN Baine explains, “It’s very important to have a teacher present who can be that middle person between the young peoplecoming here, whom we are trying to enlighten, and the physicists who work at CERN. The Teacher in Residence can act as an on-site educational consultant.” As Teacher in Residence, Baine’s primary project will be to develop teaching modules, or a series of lesson plans, that can help high schoo...

  18. Factors influencing resident's decision to reside in gated and guarded community

    Science.gov (United States)

    Shamsudin, Zarina; Shamsudin, Shafiza; Zainal, Rozlin

    2017-10-01

    Gated communities are residential areas developed with restricted access with strictly controlled entrances and surrounded by a close perimeter of wall or fences. Developers, conscious of the need to fulfill the requirement of living in modern and sophisticated lifestyle and gated properties become the trend and mushroomed over the past decade. Nowadays, it is obvious that gated and guarded communities become almost a dominant feature of Malaysia housing development projects. The focus of this paper is to identify the factors contribute resident's decision to reside in gated and guarded community and to study social interaction among gated communities' residents. 150 questionnaires were distributed to the residents of selected gated and guarded community area in order to achieve the objectives and analyzed by using Statistical Package for Social Science (SPSS) and descriptive analysis. The result was tabulated and presented in charts and graphs for a clear and better understanding. The five main factors contribute to resident decision to reside in gated communities were identified and ranked; there are privacy, security, location, lifestyle and prestige. Besides, the residents are feeling neutral towards the facilities and services provided in their gated and guarded residential area. A comprehensive improvement towards the facilities and services is needed to reach higher satisfaction from the residents.

  19. Four Residents' Narratives on Abortion Training: A Residency Climate of Reflection, Support, and Mutual Respect.

    Science.gov (United States)

    Singer, Janet; Fiascone, Stephen; Huber, Warren J; Hunter, Tiffany C; Sperling, Jeffrey

    2015-07-01

    The decision on the part of obstetrics and gynecology residents to opt in or out of abortion training is, for many, a complex one. Although the public debate surrounding abortion can be filled with polarizing rhetoric, residents often discover that the boundaries between pro-choice and pro-life beliefs are not so neatly divided. We present narratives from four residents, training at a 32-resident program in the Northeast, who have a range of views surrounding abortion. Their stories reveal how some struggle with the real-life experience of providing abortions, while others feel angst over lacking the skills to terminate a life-threatening pregnancy. These residents have found that close relationships with coworkers from all sides of this issue, along with a residency program that encourages open conversation, have fostered understanding. Their narratives demonstrate that reasonable providers can disagree fundamentally and still work effectively with one another and that the close relationships formed in residency can allow both sides to see beyond the black and white of the public abortion debate. Our objectives in this commentary are to encourage a more nuanced discussion of abortion among obstetrician-gynecologists, to describe the aspects of our residency program that facilitate open dialogue and respect across diverse viewpoints, and to demonstrate that the clear distinction between being pro-life and pro-choice often breaks down when one is immediately responsible for the care of pregnant women.

  20. Career Interests of Canadian Psychiatry Residents: What Makes Residents Choose a Research Career?

    Science.gov (United States)

    Laliberté, Vincent; Rapoport, Mark J.; Andrew, Melissa; Davidson, Marla

    2016-01-01

    Objectives: Training future clinician-researchers remains a challenge faced by Canadian psychiatry departments. Our objectives were to determine the prevalence of residents interested in pursuing research and other career options as part of their practice, and to identify the factors associated with interest in research. Method: Data from a national online survey of 207 Canadian psychiatry residents from a total of 853 (24.3% response rate) were examined. The main outcome was interest in research as part of residents’ future psychiatrist practice. Bivariate and multivariate analyses were performed to identify demographic and vocational variables associated with research interest. Results: Interest in research decreases by 76% between the first and fifth year of psychiatry residency (OR 0.76 per year, 95% CI 0.60 to 0.97). Training in a department with a residency research track did not correlate with increased research interest (χ2 = 0.007, df = 1, P = 0.93). Conclusions: Exposing and engaging psychiatry residents in research as early as possible in residency training appears key to promoting future research interest. Psychiatry residency programs and research tracks could consider emphasizing research training initiatives and protected research time early in residency. PMID:27253699

  1. Sleep pattern in medical students and residents.

    Science.gov (United States)

    Nojomi, Marzieh; Ghalhe Bandi, Mir Farhad; Kaffashi, Siyamak

    2009-11-01

    Sleep disturbances is a distressing and disabling condition that affects many people, and can affect on quality of work and education of medical students and residents. The objective of this study was to determine the prevalence of sleep disorders in medical students and residents. A representative sample of medical students and residents of Iran University of medical students in Teharn, Iran, were assessed by a self-administered questionnaire. This study covers 400 medical students from the first to seventh year and residents from the first to the last year between December 2007 and February 2008. The questionnaire includes questions on demographic characteristics (6 questions), sleep/wake habits (6 questions), insomnia-related symptoms (4 questions), symptoms of parasomnia (6 questions), cognitive and psychomotor behaviors (6 questions), lifestyle (4 questions), self-perception of sleep satisfaction, and use of sleeping pills (2 questions). The sample included 135 (33.8%) pre-internship students, 150 (37.5%) interns, and 115 (28.7%) medical residents. Sleep satisfaction was reported as "perfect" in only 14%. 44% and 30% reported "good" and "fair" satisfaction. The use of sleeping pills in the previous 30 days was reported by only 3.3% of respondents. One hundred and three (25.7%) participants reported working while studying (sometimes to full-time). Between 43% and 48% of participants had gone to bed later than usual one to three times a week. About 14% of subjects reported snoring. The mean+/-SD of insomnia and parasomnia scales were 7.0+/-2.3 and 6.8+/-1.2, respectively. The mean of insomnia were more among females, subjects with noise in their living place, and students who worked full-time while studying, and was less in person who did exercise (PSleep disturbances are an important issue among medical students and residents and associated with age, gender, living conditions, doing exercise, and workload.

  2. 31 CFR 515.335 - Permanent resident alien.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Permanent resident alien. 515.335... Definitions § 515.335 Permanent resident alien. As used in § 515.208, the term permanent resident alien means an alien lawfully admitted for permanent residence into the United States. [61 FR 37386, July 18...

  3. 22 CFR 42.22 - Returning resident aliens.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Returning resident aliens. 42.22 Section 42.22... Returning resident aliens. (a) Requirements for returning resident status. An alien shall be classifiable as... presented that: (1) The alien had the status of an alien lawfully admitted for permanent residence at the...

  4. Features of residency training and psychological distress among ...

    African Journals Online (AJOL)

    To investigate perceptions of the residency training programme and levels of psychological distress among residents. Methods. All 250 resident doctors at UCH were invited to complete questionnaires about their residency training and general health as part of a cross-sectional study. Data were analysed using SPSS 16.

  5. Common Factors Among Family Medicine Residents Who Encounter Difficulty.

    Science.gov (United States)

    Binczyk, Natalia M; Babenko, Oksana; Schipper, Shirley; Ross, Shelley

    2018-04-01

    Residents in difficulty are costly to programs in both time and resources, and encountering difficulty can be emotionally harmful to residents. Approximately 10% of residents will encounter difficulty at some point in training. While there have been several studies looking at common factors among residents who encounter difficulty, some of the findings are inconsistent. The objective of this study was to determine whether there are common factors among the residents who encounter difficulty during training in a large Canadian family medicine residency program. Secondary data analysis was performed on archived resident files from a Canadian family medicine residency program. Residents who commenced an urban family medicine residency program between the years of 2006 and 2014 were included in the study. Five hundred nine family medicine residents were included in data analysis. Residents older than 30 years were 2.33 times (95% CI: 1.27-4.26) more likely to encounter difficulty than residents aged 30 years or younger. Nontransfer residents were 8.85 times (95% CI: 1.17-66.67) more likely to encounter difficulty than transfer residents. The effects of sex, training site, international medical graduate status, and rotation order on the likelihood of encountering difficulty were nonsignificant. Older and nontransfer residents may be facing unique circumstances and may benefit from additional support from the program.

  6. 24 CFR 902.50 - Resident service and satisfaction assessment.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Resident service and satisfaction... URBAN DEVELOPMENT PUBLIC HOUSING ASSESSMENT SYSTEM PHAS Indicator #4: Resident Service and Satisfaction § 902.50 Resident service and satisfaction assessment. (a) Objective. The objective of the Resident...

  7. Effects of a Short Video-Based Resident-as-Teacher Training Toolkit on Resident Teaching.

    Science.gov (United States)

    Ricciotti, Hope A; Freret, Taylor S; Aluko, Ashley; McKeon, Bri Anne; Haviland, Miriam J; Newman, Lori R

    2017-10-01

    To pilot a short video-based resident-as-teacher training toolkit and assess its effect on resident teaching skills in clinical settings. A video-based resident-as-teacher training toolkit was previously developed by educational experts at Beth Israel Deaconess Medical Center, Harvard Medical School. Residents were recruited from two academic hospitals, watched two videos from the toolkit ("Clinical Teaching Skills" and "Effective Clinical Supervision"), and completed an accompanying self-study guide. A novel assessment instrument for evaluating the effect of the toolkit on teaching was created through a modified Delphi process. Before and after the intervention, residents were observed leading a clinical teaching encounter and scored using the 15-item assessment instrument. The primary outcome of interest was the change in number of skills exhibited, which was assessed using the Wilcoxon signed-rank test. Twenty-eight residents from two academic hospitals were enrolled, and 20 (71%) completed all phases of the study. More than one third of residents who volunteered to participate reported no prior formal teacher training. After completing two training modules, residents demonstrated a significant increase in the median number of teaching skills exhibited in a clinical teaching encounter, from 7.5 (interquartile range 6.5-9.5) to 10.0 (interquartile range 9.0-11.5; Pteaching skills assessed, there were significant improvements in asking for the learner's perspective (P=.01), providing feedback (P=.005), and encouraging questions (P=.046). Using a resident-as-teacher video-based toolkit was associated with improvements in teaching skills in residents from multiple specialties.

  8. Ontario Radiation Oncology Residents' Needs in the First Postgraduate Year-Residents' Perspective Survey

    International Nuclear Information System (INIS)

    Szumacher, Ewa; Warner, Eiran; Zhang Liying; Kane, Gabrielle; Ackerman, Ida; Nyhof-Young, Joyce; Agboola, Olusegun; Metz, Catherine de; Rodrigues, George; Voruganti, Sachi; Rappolt, Susan

    2007-01-01

    Purpose: To assess radiation oncology residents' needs and satisfaction in their first postgraduate year (PGY-1) in the province of Ontario. Methods and Materials: Of 62 radiation oncology residents, 58 who had completed their PGY-1 and were either enrolled or had graduated in 2006 were invited to participate in a 31-item survey. The questionnaire explored PGY-1 residents' needs and satisfaction in four domains: clinical workload, faculty/learning environment, stress level, and discrimination/harassment. The Fisher's exact and Wilcoxon nonparametric tests were used to determine relationships between covariate items and summary scores. Results: Of 58 eligible residents, 44 (75%) responded. Eighty-four percent of residents felt that their ward and call duties were appropriate. More than 50% of respondents indicated that they often felt isolated from their radiation oncology program. Only 77% agreed that they received adequate feedback, and 40% received sufficient counseling regarding career planning. More than 93% of respondents thought that faculty members had contributed significantly to their learning experience. Approximately 50% of residents experienced excessive stress and inadequate time for leisure or for reading the medical literature. Less than 10% of residents indicated that they had been harassed or experienced discrimination. Eighty-three percent agreed or strongly agreed that their PGY-1 experience had been outstanding. Conclusions: Most Ontario residents were satisfied with their PGY-1 training program. More counseling by radiation oncology faculty members should be offered to help residents with career planning. The residents might also benefit from more exposure to 'radiation oncology' and an introduction to stress management strategies

  9. An Evidence-based, Longitudinal Curriculum for Resident Physician Wellness: The 2017 Resident Wellness Consensus Summit

    Directory of Open Access Journals (Sweden)

    Jacob Arnold

    2018-02-01

    Full Text Available Introduction: Physicians are at much higher risk for burnout, depression, and suicide than their non-medical peers. One of the working groups from the May 2017 Resident Wellness Consensus Summit (RWCS addressed this issue through the development of a longitudinal residency curriculum to address resident wellness and burnout. Methods: A 30-person (27 residents, three attending physicians Wellness Curriculum Development workgroup developed the curriculum in two phases. In the first phase, the workgroup worked asynchronously in the Wellness Think Tank – an online resident community – conducting a literature review to identify 10 core topics. In the second phase, the workgroup expanded to include residents outside the Wellness Think Tank at the live RWCS event to identify gaps in the curriculum. This resulted in an additional seven core topics. Results: Seventeen foundational topics served as the framework for the longitudinal resident wellness curriculum. The curriculum includes a two-module introduction to wellness; a seven-module “Self-Care Series” focusing on the appropriate structure of wellness activities and everyday necessities that promote physician wellness; a two-module section on physician suicide and self-help; a four-module “Clinical Care Series” focusing on delivering bad news, navigating difficult patient encounters, dealing with difficult consultants and staff members, and debriefing traumatic events in the emergency department; wellness in the workplace; and dealing with medical errors and shame. Conclusion: The resident wellness curriculum, derived from an evidence-based approach and input of residents from the Wellness Think Tank and the RWCS event, provides a guiding framework for residency programs in emergency medicine and potentially other specialties to improve physician wellness and promote a culture of wellness.

  10. Equipping Residents to Address Alcohol and Drug Abuse: The National SBIRT Residency Training Project

    Science.gov (United States)

    Pringle, Janice L.; Kowalchuk, Alicia; Meyers, Jessica Adams; Seale, J. Paul

    2012-01-01

    Background The Screening, Brief Intervention and Referral to Treatment (SBIRT) service for unhealthy alcohol use has been shown to be one of the most cost-effective medical preventive services and has been associated with long-term reductions in alcohol use and health care utilization. Recent studies also indicate that SBIRT reduces illicit drug use. In 2008 and 2009, the Substance Abuse Mental Health Service Administration funded 17 grantees to develop and implement medical residency training programs that teach residents how to provide SBIRT services for individuals with alcohol and drug misuse conditions. This paper presents the curricular activities associated with this initiative. Methods We used an online survey delivery application (Qualtrics) to e-mail a survey instrument developed by the project directors of 4 SBIRT residency programs to each residency grantee's director. The survey included both quantitative and qualitative data. Results All 17 (100%) grantees responded. Respondents encompassed residency programs in emergency medicine, family medicine, pediatrics, obstetrics-gynecology, psychiatry, surgery, and preventive medicine. Thirteen of 17 (76%) grantee programs used both online and in-person approaches to deliver the curriculum. All 17 grantees incorporated motivational interviewing and validated screening instruments in the curriculum. As of June 2011, 2867 residents had been trained, and project directors reported all residents were incorporating SBIRT into their practices. Consistently mentioned challenges in implementing an SBIRT curriculum included finding time in residents' schedules for the modules and the need for trained faculty to verify resident competence. Conclusions The SBIRT initiative has resulted in rapid development of educational programs and a cohort of residents who utilize SBIRT in practice. Skills verification, program dissemination, and sustainability after grant funding ends remain ongoing challenges. PMID:23451308

  11. Global Health Imaging in Radiology Residency: A Survey of Canadian Radiology Residents.

    Science.gov (United States)

    Zener, Rebecca; Ross, Ian

    2017-11-01

    The study sought to determine Canadian radiology resident perception of and interest in global health imaging (GHI) and the barriers they encounter in pursuing GHI experiences during residency training. A peer-reviewed, online, anonymous, multiple-choice survey was distributed to Canadian radiology residents at English-language programs. Fifty residents responded to the survey (∼16% response rate); 72% of respondents perceived an unmet need for medical imaging in the developing world. A majority of residents (60%) would have been likely to participate in a GHI experience if one had been available during their residency; 65% planned on pursuing international outreach work as future radiologists, 81% of whom with on-site collaboration in education and training of local staff. However, 82% of respondents were uncertain or believed they would not be adequately prepared to help improve access and availability of medical imaging services in developing countries upon completion of residency. Overall, residents believed a GHI program would increase their knowledge of infectious diseases, increase their exposure to diseases at advanced stage presentation, enhance their knowledge of basic imaging modalities, and improve their cultural competence. Lack of information about opportunities, lack of funding, and lack of infrastructure were ranked as the most important barriers to participating in a radiology rotation in a developing country during residency. While many Canadian radiology residents are interested in participating in GHI, their preparation to do so may be inadequate. Formalizing international GHI rotations may alleviate barriers impeding their pursuit. Copyright © 2017 Canadian Association of Radiologists. Published by Elsevier Inc. All rights reserved.

  12. The "hidden curriculum" and residents' attitudes about medical error disclosure: comparison of surgical and nonsurgical residents.

    Science.gov (United States)

    Martinez, William; Lehmann, Lisa Soleymani

    2013-12-01

    The "hidden curriculum" and role models for responding to medical errors might play a central role in influencing residents' attitudes about disclosure. We sought to compare surgical and nonsurgical residents' exposure to role modeling for responding to medical errors and their attitudes about error disclosure. We conducted a cross-sectional, electronic survey of surgical and nonsurgical residents at 2 large academic medical centers. The questionnaire asked respondents about personal experience with medical errors; training for responding to errors; frequency of exposure to role modeling related to disclosure; and attitudes about disclosure. Descriptive statistics were used to describe frequencies. Chi-square and Fisher's exact test were used to compare proportions between surgical and nonsurgical trainees. The response rate was 58% (253 of 435). Surgical residents reported more frequently observing a colleague be treated harshly (eg, humiliated or verbally abused) for an error than nonsurgical residents (sometimes or often, 39% [26 of 66] vs 20% [37 of 187]; p = 0.002). Surgical residents were more likely than nonsurgical residents to believe they would be treated harshly by others if they acknowledged making a medical error (35% [23 of 66] vs 12% [23 of 187]; p medical errors at their institution (11% [7 of 66] vs 2% [4 of 187]; p = 0.008). Surgical residents were less likely than nonsurgical residents to feel free to express concerns to other members of the team about medical errors in patient care (70% [46 of 66] vs 83% [115 of 187]; p = 0.02). The punitive response to error by senior members of the health care team might be an impediment to the transparent disclosure of errors among residents that might disproportionally affect surgical training programs. Copyright © 2013 American College of Surgeons. Published by Elsevier Inc. All rights reserved.

  13. Deprivation of Dignity in Nursing Home Residents

    DEFF Research Database (Denmark)

    Høy, Bente

    2016-01-01

    deepened knowledge in how to maintain and promote dignity in nursing home residents. The purpose of this paper is to present results concerning the question: How is nursing home residents’ dignity maintained or deprived from the perspective of close family caregivers? In this presentation we only focus...... on deprivation of dignity. Methodology: The overall design of this study is modified clinical application research. The study took place at six different nursing home residences in Sweden, Denmark and Norway. Data collection methods were individual research interviews. All together the sample consisted of 28...

  14. Emergency Medicine Resident Perceptions of Medical Professionalism

    Directory of Open Access Journals (Sweden)

    Joshua Jauregui

    2016-05-01

    Full Text Available Introduction: Medical professionalism is a core competency for emergency medicine (EM trainees; but defining professionalism remains challenging, leading to difficulties creating objectives and performing assessment. Because professionalism is dynamic, culture-specific, and often taught by modeling, an exploration of trainees’ perceptions can highlight their educational baseline and elucidate the importance they place on general conventional professionalism domains. To this end, our objective was to assess the relative value EM residents place on traditional components of professionalism. Methods: We performed a cross-sectional, multi-institutional survey of incoming and graduating EM residents at four programs. The survey was developed using the American Board of Internal Medicine’s “Project Professionalism” and the Accreditation Council of Graduate Medical Education definition of professionalism competency. We identified 27 attributes within seven domains: clinical excellence, humanism, accountability, altruism, duty and service, honor and integrity, and respect for others. Residents were asked to rate each attribute on a 10-point scale. We analyzed data to assess variance across attributes as well as differences between residents at different training levels or different institutions. Results: Of the 114 residents eligible, 100 (88% completed the survey. The relative value assigned to different professional attributes varied considerably, with those in the altruism domain valued significantly lower and those in the “respect for others” and “honor and integrity” valued significantly higher (p<0.001. Significant differences were found between interns and seniors for five attributes primarily in the “duty and service” domain (p<0.05. Among different residencies, significant differences were found with attributes within the “altruism” and “duty and service” domains (p<0.05. Conclusion: Residents perceive differences in

  15. Discharge residence of TLD tagged fish

    International Nuclear Information System (INIS)

    Romberg, G.P.; Prepejchal, W.

    1974-01-01

    Although visual observations suggested that fish remained in the discharge for considerable periods, temperature-sensitive tags indicated the majority of fish spend less than 50 hr or 10 percent of the time at discharge temperatures. During 1974 a second fish tagging study was conducted, using temperature-sensitive tags to yield discharge residence times of Lake Michigan salmonids at Point Beach thermal discharge. Preliminary results revealed that many fish tag values were close to Unit I line indicating that calculated maximum discharge residence times for these fish will be nearly 100 percent of the elapsed time

  16. Ultrafine particle exposure in Danish residencies

    DEFF Research Database (Denmark)

    Bekö, Gabriel; Karottki, Dorina Gabriela; Wierzbicka, Aneta

    2016-01-01

    We measured ultrafine particle concentrations in 56 Danish residences, estimated the daily integrated exposure of the occupants and apportioned this exposure to source events. The residential daily integrated particle number (PN) exposure in the homes was substantial and source events, especially...... candle burning, cooking, toasting and unknown activities, were responsible on average for ∼65% of the residential integrated exposure. Residents of another 60 homes were then asked to carry a backpack equipped with a GPS recorder and a portable monitor to measure real-time individual exposure over ~48 h...

  17. Analysis of a Resident Aesthetic Clinic: Process for Rhinoplasty, Resident Experience, and Patient Satisfaction.

    Science.gov (United States)

    Brandel, Michael G; DʼSouza, Gehaan F; Reid, Christopher M; Dobke, Marek K; Gosman, Amanda A

    2017-05-01

    Plastic surgery residents often desire additional training in rhinoplasty than what is provided by their residency program. The goal of this study was to define and evaluate a specific process used to structure preoperative, intraoperative, and postoperative protocols for rhinoplasty patients in the resident aesthetic clinic (RAC) to enhance qualitative and quantitative experience. Complication rates and patient/resident satisfaction scores were also examined. Resident clinic rhinoplasty patients underwent a well-defined and established process that included patient education and informed consent, preoperative planning in a conference-based session, specific adherence to established surgical techniques, and structured postoperative management and follow-up. This process also included supervision criteria for residents in the operating room and clinical setting. Patient and resident satisfaction at the RAC was evaluated by a Web-based survey. A database of procedural complications and methods was compiled and evaluated. Between June 2012 and June 2015, 146 aesthetic resident cases were completed through the University of California, San Diego Residency Aesthetic Surgery Program. Of these cases, 34 (17%) were rhinoplasty procedures. Residents at our institution assisted on an average of 55 rhinoplasty procedures with the faculty and performed an average of 12 rhinoplasty procedures as primary surgeons. The residents surveyed felt that they had a good autonomous experience (P < 0.001), and 90% reported confidence with rhinoplasty. Postoperative complications were recorded and included asymmetry (n = 4, 10.5%), septal perforation (n = 1, 2.6%), and difficulty in breathing (n = 6, 15.8%). There were no patients who experienced infections, and the complication rate requiring revision in the operating room was 0%. Optimizing protocols in rhinoplasty in an RAC has allowed for the RAC to flourish in the breadth and complexity of rhinoplasty operations. This has enabled

  18. Reformulating corporate residence: a coherent response to international tax avoidance

    OpenAIRE

    Geoffrey Loomer

    2011-01-01

    This thesis analyzes the concept of corporate residence, with particular reference to the law in the UK and Canada. It explores why corporate residence is relevant in tax policy, how corporate residence is understood in law, and how revenue authorities respond to the use and alleged 'abuse' of residence rules. Part I argues that the residence of taxpayers generally (individual or corporate) remains a relevant factor in international tax design, that taxation of corporations on the basis of re...

  19. 26 CFR 1.82-1 - Payments for or reimbursements of expenses of moving from one residence to another residence...

    Science.gov (United States)

    2010-04-01

    ... moving from one residence to another residence attributable to employment or self-employment. 1.82-1... TAX (CONTINUED) INCOME TAXES (CONTINUED) Items Specifically Included in Gross Income § 1.82-1 Payments for or reimbursements of expenses of moving from one residence to another residence attributable to...

  20. Development and implementation of a residency project advisory board.

    Science.gov (United States)

    Dagam, Julie K; Iglar, Arlene; Kindsfater, Julie; Loeb, Al; Smith, Chad; Spexarth, Frank; Brierton, Dennis; Woller, Thomas

    2017-06-15

    The development and implementation of a residency project advisory board (RPAB) to manage multiple pharmacy residents' yearlong projects across several residency programs are described. Preceptor and resident feedback during our annual residency program review and strategic planning sessions suggested the implementation of a more-coordinated approach to the identification, selection, and oversight of all components of the residency project process. A panel of 7 department leaders actively engaged in residency training and performance improvement was formed to evaluate the residency project process and provide recommendations for change. These 7 individuals would eventually constitute the RPAB. The primary objective of the RPAB at Aurora Health Care is to provide oversight and a structured framework for the selection and execution of multiple residents' yearlong projects across all residency programs within our organization. Key roles of the RPAB include developing expectations, coordinating residency project ideas, and providing oversight and feedback. The development and implementation of the RPAB resulted in a significant overhaul of our entire yearlong resident project process. Trends toward success were realized after the first year of implementation, including consistent expectations, increased clarity and engagement in resident project ideas, and more projects meeting anticipated endpoints. The development and implementation of an RPAB have provided a framework to optimize the organization, progression, and outcomes of multiple pharmacy resident yearlong projects in all residency programs across our pharmacy enterprise. Copyright © 2017 by the American Society of Health-System Pharmacists, Inc. All rights reserved.

  1. Benefits of externships with pediatric dentistry programs for potential residents: program directors' and current residents' perceptions.

    Science.gov (United States)

    Klein, Ulrich; Storey, Bryan; Hanson, Peter D

    2014-03-01

    This study's goal was to understand the extent, framework, and benefits of externships with prospective residency programs undertaken by predoctoral dental students or dentists interested in applying for a residency program. In 2012, a questionnaire was sent to all pediatric dentistry residents and program directors in the United States (63 percent and 74 percent return rate, respectively). Externships were offered by fifty-seven of the seventy-six programs. Most program directors (95 percent) agreed that externships are beneficial and compensate at least partially for the lack of numerical National Board Dental Examination scores or class rankings. Among the responding residents, 61 percent were female. The top reasons given by residents for choosing to extern with a certain program were its location and perceived reputation. Of the 249 respondents who did an externship, 47 percent externed with their current program. The acceptance rate into the number one choice of program was similar among those who did an externship vs. those who did not (73 percent vs. 75 percent). No relationship was found between gender and externships among the 341 respondents who were accepted into their top choice. Most of the residents (98.8 percent) felt that completing an externship was beneficial, and 88 percent got an increased understanding for the differences between university- and non-university-based residency programs.

  2. DETERMINANTS OF SPECIALTY CHOICE OF RESIDENT DOCTORS; CASE STUDY--AMONG RESIDENT DOCTORS IN NIGERIA.

    Science.gov (United States)

    Osuoji, Roland I; Adebanji, Atinuke; Abdulsalam, Moruf A; Oludara, Mobolaji A; Abolarinwa, Abimbola A

    2015-01-01

    This study examined medical specialty selection by Nigerian resident doctors using a marketing research approach to determine the selection criteria and the role of perceptions, expected remuneration, and job placement prospects of various specialties in the selection process. Data were from the Community of residents from April 2014 to July 2014. The cohort included 200 residents, but only 171 had complete information. Data were obtained from a cross section of resident doctors in the Lagos State University Teaching Hospital and at the 2014 Ordinary General Meeting of the National Association of Resident Doctors(NARD) where representatives from over 50 Teaching hospitals in Nigeria attended. Using a client behaviour model as a framework, a tripartite questionnaire was designed and administered to residents to deduce information on their knowledge about and interests in various specialties, their opinions of sixteen specialties, and the criteria they used in specialty selection. A total of 171 (85.5%) questionnaires were returned. ln many instances, consistency between selection criteria and perceptions of a specialty were accompanied by interest in pursuing the specialty. Job security, job availability on completion of programme, duration of training and qualifying examinations were highly correlated with p value job security and financial remuneration related variables. Using marketing research concepts for medical specialty selection (Weissmanet al 2012) stipulates that choice of speciality is influenced by criteria and perception. This study shows that job security expected financial remuneration, and examination requirements for qualification are major determinants of the choice of speciality for residents.

  3. Automated medical resident rotation and shift scheduling to ensure quality resident education and patient care.

    Science.gov (United States)

    Smalley, Hannah K; Keskinocak, Pinar

    2016-03-01

    At academic teaching hospitals around the country, the majority of clinical care is provided by resident physicians. During their training, medical residents often rotate through various hospitals and/or medical services to maximize their education. Depending on the size of the training program, manually constructing such a rotation schedule can be cumbersome and time consuming. Further, rules governing allowable duty hours for residents have grown more restrictive in recent years (ACGME 2011), making day-to-day shift scheduling of residents more difficult (Connors et al., J Thorac Cardiovasc Surg 137:710-713, 2009; McCoy et al., May Clin Proc 86(3):192, 2011; Willis et al., J Surg Edu 66(4):216-221, 2009). These rules limit lengths of duty periods, allowable duty hours in a week, and rest periods, to name a few. In this paper, we present two integer programming models (IPs) with the goals of (1) creating feasible assignments of residents to rotations over a one-year period, and (2) constructing night and weekend call-shift schedules for the individual rotations. These models capture various duty-hour rules and constraints, provide the ability to test multiple what-if scenarios, and largely automate the process of schedule generation, solving these scheduling problems more effectively and efficiently compared to manual methods. Applying our models on data from a surgical residency program, we highlight the infeasibilities created by increased duty-hour restrictions placed on residents in conjunction with current scheduling paradigms.

  4. Facebook Use between College Resident Advisors' and Their Residents: A Mixed Methods Approach.

    Science.gov (United States)

    Kacvinsky, Lauren E; Moreno, Megan A

    2014-01-01

    Facebook use is nearly ubiquitous among college students. Studies have shown links between Facebook displays of depression or problem drinking and risk of these problems. This project aimed to determine whether Facebook could be used to help Resident Advisors (RAs) identify college students at risk for depression or problem drinking. Interviews were conducted with college freshmen to investigate whether they were Facebook "friends" with their RA. Focus groups were conducted with RAs to determine their views on Facebook friending their dormitory residents and using Facebook to help identify at-risk students. 72 freshmen were interviewed and 25 RAs participated in focus groups; both agreed it is common for RAs and residents to be Facebook friends. RAs commonly noted references to depression and problem drinking on residents' Facebook pages, which often led to in-person discussions with the resident. This study provides support that RAs use Facebook to identify issues that may impact their student residents. RAs emphasized benefits of in-person interactions in order to provide support and obtain additional details about the situation. Universities could consider whether providing RA education about Facebook interactions with residents merits encouragement within their existing RA training programs.

  5. Results of the 2005-2008 Association of Residents in Radiation Oncology Survey of Chief Residents in the United States: Clinical Training and Resident Working Conditions

    International Nuclear Information System (INIS)

    Gondi, Vinai; Bernard, Johnny Ray; Jabbari, Siavash; Keam, Jennifer; Amorim Bernstein, Karen L. de; Dad, Luqman K.; Li, Linna; Poppe, Matthew M.; Strauss, Jonathan B.; Chollet, Casey T.

    2011-01-01

    Purpose: To document clinical training and resident working conditions reported by chief residents during their residency. Methods and Materials: During the academic years 2005 to 2006, 2006 to 2007, and 2007 to 2008, the Association of Residents in Radiation Oncology conducted a nationwide survey of all radiation oncology chief residents in the United States. Chi-square statistics were used to assess changes in clinical training and resident working conditions over time. Results: Surveys were completed by representatives from 55 programs (response rate, 71.4%) in 2005 to 2006, 60 programs (75.9%) in 2006 to 2007, and 74 programs (93.7%) in 2007 to 2008. Nearly all chief residents reported receiving adequate clinical experience in commonly treated disease sites, such as breast and genitourinary malignancies; and commonly performed procedures, such as three-dimensional conformal radiotherapy and intensity-modulated radiotherapy. Clinical experience in extracranial stereotactic radiotherapy increased over time (p < 0.001), whereas clinical experience in endovascular brachytherapy (p <0.001) decreased over time. The distribution of gynecologic and prostate brachytherapy cases remained stable, while clinical case load in breast brachytherapy increased (p = 0.006). A small but significant percentage of residents reported receiving inadequate clinical experience in pediatrics, seeing 10 or fewer pediatric cases during the course of residency. Procedures involving higher capital costs, such as particle beam therapy and intraoperative radiotherapy, and infrequent clinical use, such as head and neck brachytherapy, were limited to a minority of institutions. Most residency programs associated with at least one satellite facility have incorporated resident rotations into their clinical training, and the majority of residents at these programs find them valuable experiences. The majority of residents reported working 60 or fewer hours per week on required clinical duties

  6. Judicious Leadership for Residence Hall Living.

    Science.gov (United States)

    Gathercoal, Forrest

    This book presents a theory of judicious leadership for residence hall management that advocates the creation of an ethical and educational perspective based on the U.S. Bill of Rights. It argues that by recognizing college students' citizenship rights, providing them an opportunity to experience individual liberties, and helping them to…

  7. Knowledge and Utilization of Electrocardiogram among Resident ...

    African Journals Online (AJOL)

    Background: Electrocardiogram (ECG) is a simple, readily affordable, and noninvasive tool for the evaluation of cardiac disorders. There is a dearth of information on the utility of ECG in general practice in Nigeria. We assessed the knowledge and utilization of ECG among family medicine residents in Nigeria. Materials and ...

  8. Otolaryngology Training for Family Practice Residents.

    Science.gov (United States)

    And Others; Rood, Stewart R.

    1980-01-01

    The faculty of the Department of Otolaryngology, University of Pittsburgh School of Medicine, has designed a rotation in the otolaryngology service, that is a basic clinical orientation to ear, nose and throat medicine, to fit the one-month block committed by the local family practice residency training program. The program is described and its…

  9. Experiencing Architecture: Teacher Residency at Fallingwater.

    Science.gov (United States)

    Mims, Sandra K.

    1993-01-01

    Describes a one-week residency program for art educators at Fallingwater, a Frank Lloyd Wright-designed retreat in western Pennsylvania. Discusses the significance of the architecture on the goals and outcomes of the program. Asserts that the experience encouraged the participants to include architecture education in their art education programs.…

  10. Knowledge and Utilization of Electrocardiogram among Resident ...

    African Journals Online (AJOL)

    2017-10-26

    Oct 26, 2017 ... knowledge and utilization of ECG among family medicine residents in Nigeria. Materials and Methods: A cross-sectional evaluation was conducted between. November 2011 and May 2012 in four family ..... study on ECG interpretative skills and challenges among family physicians. The utilization of ECG ...

  11. [Motivation and learning strategies in pediatric residents].

    Science.gov (United States)

    Sepúlveda-Vildósola, Ana Carolina; Carrada-Legaria, Sol; Reyes-Lagunes, Isabel

    2015-01-01

    Motivation is an internal mood that moves individuals to act, points them in certain directions, and maintains them in activities, playing a very important role in self-regulated learning and academic performance. Our objective was to evaluate motivation and self-regulation of knowledge in pediatric residents in a third-level hospital, and to determine if there are differences according to the type of specialty and sociodemographic variables. All residents who agreed to participate responded to the Motivated Strategies for Learning Questionnaire. Cronbach alpha was performed to determine reliability. The mean value of each subscale was compared with Student's t test or ANOVA, correlation of subscales with Pearson test. A value of p≤0.05 was considered significant. We included 118 residents. The questionnaire was highly reliable (α=0.939). There were no significant differences in motivation or learning strategies according to sex, marital status, or age. Those residents studying a second or third specialization had significantly higher scores in elaboration, critical thinking, and peer learning. There were significant correlations between intrinsic motivation and self-efficacy with the development of knowledge strategies such as elaboration, critical thinking, and metacognitive self-regulation. Our students present average-to-high scores of motivation and knowledge strategies, with a significant difference according to type of specialization. There is a high correlation between motivation and knowledge strategies.

  12. Improving Health Care for Assisted Living Residents

    Science.gov (United States)

    Kane, Robert L.; Mach, John R., Jr.

    2007-01-01

    Purpose: The purpose of this article is to explore how medical care is delivered to older people in assisted living (AL) settings and to suggest ways for improving it. Design and Methods: We present a review of the limited research available on health care for older AL residents and on building testable models of better ways to organize primary…

  13. Interior moisture design loads for residences

    Science.gov (United States)

    Anton TenWolde; Iain S. Walker

    2001-01-01

    This paper outlines a methodology to obtain design values for indoor boundary conditions for moisture design calculations for residences. This is part of a larger effort by ASHRAE Standard Project Committee 160P, Design Criteria for Moisture Control in Buildings, to formulate criteria for moisture design loads, analysis techniques, and material and building performance...

  14. Educational contracts in family medicine residency training.

    OpenAIRE

    Mahood, S.; Rojas, R.; Andres, D.; Zagozeski, C.; White, G.; Bradel, T.

    1994-01-01

    An educational contract for family medicine residency training and evaluation addresses many of the difficulties and challenges of current postgraduate medical education. This article identifies important principles for developing a contractual approach; describes the contract used in one program and its implementation; and discusses its theory, advantages, and limitations.

  15. Training in radiological protection of residents

    International Nuclear Information System (INIS)

    Vicent, M. D.; Fernandez, M. J.; Olmos, C.; Isidoro, B.; Espana, M. L.; Arranz, L.

    2013-01-01

    In compliance with the current laws, radiation protection (RP) training is required during the formative programs of certain Health Sciences specialties. Laws entrust to official bodies in specialized training the adoption of necessary measures to coordinate and ensure a correct implementation. The aim of this study is to describe Community of Madrid experience in RP training to specialists during their formative programs, and to determine the number of residents trained and analyze their satisfaction level with the training. A descriptive cross-sectional study was performed, including all training specialists from the Community of Madrid during the 2007-2011 period. We determined the number of residents trained per year and we evaluated their satisfaction level with the training through a survey. A total of 55 training courses were carried out and 5820 residents have been trained during the 2007-2011 period. the student satisfaction level with the training has increased gradually from 6.1 points in 2007 to 7.0 points in 2011. The development of the RP formative program for residents in the Community of Madrid has meant the start up o the necessary official mechanisms to ensure the quality and adequacy of training in this area, covering the formative needs of the collective. (Author)

  16. Correlates of Burnout Among Family Practice Residents.

    Science.gov (United States)

    Lemkau, Jeanne P.; And Others

    1988-01-01

    A study of burnout among 67 residents in four programs found little relationship between burnout scores and situational and background factors, but numerous relationships were found among personality measures, burnout scores, and measures of regret about career choice, indicating the importance of interpersonal skills and comfort in mitigating…

  17. Mobbing Exposure of Anaesthesiology Residents in Turkey.

    Science.gov (United States)

    Aykut, Gülnihal; Efe, Esra Mercanoğlu; Bayraktar, Selcan; Şentürk, Sinem; Başeğmez, İrem; Özkumit, Özlem; Kabak, Elmas; Yavaşçaoğlu, Belgin; Bilgin, Hülya

    2016-08-01

    In recent years, psychological problems that are caused by working conditions, like burn out syndrome, are more commonly observed. In our study, we aimed to evaluate mobbing exposure, factors causing mobbing and precautions for mobbing in residency students who are educated in anaesthesiology and reanimation clinics in Turkey. After obtaining consent from the ethics committee, we sent our questionnaires to the secretariats of the departments by postal mail. Completed questionnaires were collected in our department's secretariat blindly and randomly mixed. One hundred and one participants were returned the questionnaires. Data was statistically analysed in SPSS 21.0 software programme. During residency programme, sated to have experienced mobbing one or more time. Interestingly, 5.9% participants complained of physical mobbing. Mobbing exposure was more common in females. The most serious new onset psychosomatic symptoms stated during residency were committing suicide (2%), addiction (16%), severe depression (18%), panic attack (8%), more accidents (7%) and tendency of violence (15%). In mobbing group there was statistically significant dissatisfaction rate. In professions where mobbing is common, incidences of psychiatric diseases and suicide attempts are high are increased. Who are under risk for experiencing mobbing should be noticed carefully to ensure good judgement and problems should be inspected objectively in a detailed manner. Anesthesiology societies and other medical professional societies should establish mobbing committees. Thus, mobbing problems can be resolved and healthy career oppurtunities can be presented to residents.

  18. Research in Psychiatry: Residents' Attitudes and Use.

    Science.gov (United States)

    Hershberg, Richard I.; And Others

    1980-01-01

    Results of a survey are reported that sought to obtain information on the attitudes of psychiatric residents towards research, their backgrounds in research training, their assessment of their departments and their own personal research activities, and the role of psychiatric research in their future careers. (JMD)

  19. Relationships among residence environment and individual levels ...

    African Journals Online (AJOL)

    The present study explored the relationship among urban and rural residence living and level of exercise in the Republic of Korea. The study analysed the data from the 2012 Korean Survey of Citizens' Sports Participation project with a total of 4,479 males and 4,521 females participating. The sampling method used the ...

  20. 38 CFR 51.110 - Resident assessment.

    Science.gov (United States)

    2010-07-01

    ... Medicaid Services (CMS) Resident Assessment Instrument Minimum Data Set, Version 2.0; and (ii) Describing... Set, Version 2.0 must be submitted electronically to VA at the IP address provided by VA to the State... information collection requirements in this section under control number 2900-0160) [65 FR 968, Jan. 6, 2000...

  1. 2009 Canadian Radiation Oncology Resident Survey

    International Nuclear Information System (INIS)

    Debenham, Brock; Banerjee, Robyn; Fairchild, Alysa; Dundas, George; Trotter, Theresa; Yee, Don

    2012-01-01

    Purpose: Statistics from the Canadian post-MD education registry show that numbers of Canadian radiation oncology (RO) trainees have risen from 62 in 1999 to approximately 150 per year between 2003 and 2009, contributing to the current perceived downturn in employment opportunities for radiation oncologists in Canada. When last surveyed in 2003, Canadian RO residents identified job availability as their main concern. Our objective was to survey current Canadian RO residents on their training and career plans. Methods and Materials: Trainees from the 13 Canadian residency programs using the national matching service were sought. Potential respondents were identified through individual program directors or chief resident and were e-mailed a secure link to an online survey. Descriptive statistics were used to report responses. Results: The eligible response rate was 53% (83/156). Similar to the 2003 survey, respondents generally expressed high satisfaction with their programs and specialty. The most frequently expressed perceived weakness in their training differed from 2003, with 46.5% of current respondents feeling unprepared to enter the job market. 72% plan on pursuing a postresidency fellowship. Most respondents intend to practice in Canada. Fewer than 20% of respondents believe that there is a strong demand for radiation oncologists in Canada. Conclusions: Respondents to the current survey expressed significant satisfaction with their career choice and training program. However, differences exist compared with the 2003 survey, including the current perceived lack of demand for radiation oncologists in Canada.

  2. The Role of Regional Conferences in Research Resident Career Development: The California Psychiatry Research Resident Retreat.

    Science.gov (United States)

    Besterman, Aaron D; Williams, Jody K; Reus, Victor I; Pato, Michele T; Voglmaier, Susan M; Mathews, Carol A

    2017-04-01

    For psychiatry research resident career development, there is a recognized need for improved cross-institutional mentoring and networking opportunities. One method to address this need is via regional conferences, open to current and recently graduated research residents and their mentors. With this in mind, we developed the biennial California Psychiatry Research Resident Retreat (CPRRR) and collected feedback from participants to 1) Assess resident satisfaction, 2) Determine the utility of the retreat as a networking and mentorship tool, and 3) Identify areas for improvement. We gathered survey data from resident attendees at the two first CPRRRs. We analyzed the data to look for trends in satisfaction as well as areas that need improvement. Thirty-two residents from five California training programs attended the CPRRR in 2013 while 33 attended from six programs in 2015. The residents were from all years of training, but concentrated in their second and third years. Approximately 41% and 49% of the attendees were female and 53% and 39% had an MD/PhD in 2013 and 2015, respectively. Twenty-four and 32 residents provided anonymous feedback in 2013 and 2015, respectively. Mean feedback scores were very high (> 4/5) for overall satisfaction, peer- and faculty-networking, the keynote speaker and the flash talks for both years. Mean feedback scores for the ethics debates and mentoring sessions were somewhat lower (≤ 4/5), however, both showed significant improvement from 2013 to 2015. The CPRRRs appear to be an effective mechanism for providing psychiatry research residents with a meaningful cross-institutional opportunity for networking and mentorship. Feedback-driven changes to the CPRRRs improved participant satisfaction for several components of the conference. Future efforts will be aimed at broadening mentorship and networking opportunities, optimizing teaching approaches for research ethics, and considering different feedback-gathering approaches to allow for

  3. Measuring resident well-being: impostorism and burnout syndrome in residency.

    Science.gov (United States)

    Legassie, Jenny; Zibrowski, Elaine M; Goldszmidt, Mark A

    2008-07-01

    Assessing resident well-being is becoming increasingly important from a programmatic standpoint. Two measures that have been used to assess this are the Clance Impostor Scale (CIS) and the Maslach Burnout Inventory-Human Services Survey (MBI-HSS). However, little is known about the relationship between the two phenomena. To explore the prevalence and association between impostorism and burnout syndrome in a sample of internal medicine residents. Anonymous, cross-sectional postal survey. Forty-eight internal medicine residents (postgraduate year [PGY] 1-3) at the Schulich School of Medicine & Dentistry (62.3% response rate). Short demographic questionnaire, CIS and MBI-HSS. Impostorism and burnout syndrome were identified in 43.8% and 12.5% of residents, respectively. With the exception of a negative correlation between CIS scores and the MBI's personal accomplishment subscale (r = -.30; 95% CI -.54 to -.02), no other significant relations were identified. Foreign-trained residents were more likely to score as impostors (odds ratio [OR] 10.7; 95% CI 1.2 to 98.2) while senior residents were more likely to experience burnout syndrome (OR 16.5 95% CI 1.6 to 168.5). Both impostorism and burnout syndrome appear to be threats to resident well-being in our program. The lack of relationship between the two would suggest that programs and researchers wishing to address the issue of resident distress should consider using both measures. The finding that foreign-trained residents appear to be more susceptible to impostorism warrants further study.

  4. Measuring the intensity of resident supervision in the department of veterans affairs: the resident supervision index.

    Science.gov (United States)

    Byrne, John M; Kashner, Michael; Gilman, Stuart C; Aron, David C; Cannon, Grant W; Chang, Barbara K; Godleski, Linda; Golden, Richard M; Henley, Steven S; Holland, Gloria J; Kaminetzky, Catherine P; Keitz, Sheri A; Kirsh, Susan; Muchmore, Elaine A; Wicker, Annie B

    2010-07-01

    To develop a survey instrument designed to quantify supervision by attending physicians in nonprocedural care and to assess the instrument's feasibility and reliability. In 2008, the Department of Veterans Affairs (VA) Office of Academic Affiliations convened an expert panel to adopt a working definition of attending supervision in nonprocedural patient care and to construct a survey to quantify it. Feasibility was field-tested on residents and their supervising attending physicians at primary care internal medicine clinics at the VA Loma Linda Healthcare System in their encounters with randomly selected outpatients diagnosed with either major depressive disorder or diabetes. The authors assessed both interrater concurrent reliability and test-retest reliability. The expert panel adopted the VA's definition of resident supervision and developed the Resident Supervision Index (RSI) to measure supervision in terms of residents' case understanding, attending physicians' contributions to patient care through feedback to the resident, and attending physicians' time (minutes). The RSI was field-tested on 60 residents and 37 attending physicians for 148 supervision episodes from 143 patient encounters. Consent rates were 94% for residents and 97% for attending physicians; test-retest reliability intraclass correlations (ICCs) were 0.93 and 0.88, respectively. Concurrent reliability between residents' and attending physicians' reported time was an ICC of 0.69. The RSI is a feasible and reliable measure of resident supervision that is intended for research studies in graduate medical education focusing on education outcomes, as well as studies assessing quality of care, patient health outcomes, care costs, and clinical workload.

  5. Medical residency: factors relating to "difficulty in helping" in the resident physician-patient relationship

    Directory of Open Access Journals (Sweden)

    Mario Alfredo De Marco

    2011-01-01

    Full Text Available CONTEXT AND OBJECTIVE: Previous studies have attempted to understand what leads physicians to label patients as 'difficult'. Understanding this process is particularly important for resident physicians, who are developing attitudes that may have long-term impact on their interactions with patients. The aim of this study was to distinguish between patients' self-rated emotional state (anxiety and depression and residents' perceptions of that state as a predictor of patients being considered difficult. DESIGN AND SETTING: Cross-sectional survey conducted in the hospital of Universidade Federal de São Paulo (Unifesp. METHODS: The residents completed a sociodemographic questionnaire and rated their patients using the Hospital Anxiety and Depression Scale (HADS and Difficulty in Helping the Patient Questionnaire (DTH. The patients completed HADS independently and were rated using the Karnofsky Performance Status scale. RESULTS: On average, the residents rated the patients as presenting little difficulty. The residents' ratings of difficulty presented an association with their ratings for patient depression (r = 0.35, P = 0.03 and anxiety (r = 0.46, P = 0.02, but not with patients' self-ratings for depression and anxiety. Residents from distant cities were more likely to rate patients as difficult to help than were residents from the city of the hospital (mean score of 1.93 versus 1.07; P = 0.04. CONCLUSIONS: Understanding what leads residents to label patients as having depression and anxiety problems may be a productive approach towards reducing perceived difficulty. Residents from distant cities may be more likely to find their patients difficult

  6. Burnout during residency training: a literature review.

    Science.gov (United States)

    Ishak, Waguih William; Lederer, Sara; Mandili, Carla; Nikravesh, Rose; Seligman, Laurie; Vasa, Monisha; Ogunyemi, Dotun; Bernstein, Carol A

    2009-12-01

    Burnout is a state of mental and physical exhaustion related to work or care giving activities. Burnout during residency training has gained significant attention secondary to concerns regarding job performance and patient care. This article reviews the relevant literature on burnout in order to provide information to educators about its prevalence, features, impact, and potential interventions. Studies were identified through a Medline and PsychInfo search from 1974 to 2009. Fifty-one studies were identified. Definition and description of burnout and measurement methods are presented followed by a thorough review of the studies. An examination of the burnout literature reveals that it is prevalent in medical students (28%-45%), residents (27%-75%, depending on specialty), as well as practicing physicians. Psychological distress and physical symptoms can impact work performance and patient safety. Distress during medical school can lead to burnout, which in turn can result in negative consequences as a working physician. Burnout also poses significant challenges during early training years in residency. Time demands, lack of control, work planning, work organization, inherently difficult job situations, and interpersonal relationships, are considered factors contributing to residents' burnout. Potential interventions include workplace-driven and individual-driven measures. Workplace interventions include education about burnout, workload modifications, increasing the diversity of work duties, stress management training, mentoring, emotional intelligence training, and wellness workshops. Individual-driven behavioral, social, and physical activities include promoting interpersonal professional relations, meditation, counseling, and exercise. Educators need to develop an active awareness of burnout and ought to consider incorporating relevant instruction and interventions during the process of training resident physicians.

  7. Eating disorder training and attitudes among primary care residents.

    Science.gov (United States)

    Banas, David A; Redfern, Roberta; Wanjiku, Stephen; Lazebnik, Rina; Rome, Ellen S

    2013-04-01

    The ability to diagnose eating disorders (ED) is important and difficult for primary care physicians (PCPs). Previous reports suggest that PCPs feel their training is inadequate. To explore residents' interest and comfort diagnosing and treating ED. An internet survey was sent to primary care residencies. Logistic regression models were fitted to identify factors correlated with residents' interest and comfort in diagnosing and treating ED. Family Medicine and Internal Medicine residents had higher interest in ED than Pediatric residents, as did female residents and residents exposed to teenagers with unexplained weight loss. Residents in programs with an ED program and faculty interested in ED were more comfortable diagnosing ED. Interest in, and comfort diagnosing and treating ED are associated with specialty type, presence of an ED program, presence of faculty interested in ED, and resident exposure to ED outpatients and teenagers with unexplained weight loss.

  8. Improving applicant selection: identifying qualities of the unsuccessful otolaryngology resident.

    Science.gov (United States)

    Badran, Karam W; Kelley, Kanwar; Conderman, Christian; Mahboubi, Hossein; Armstrong, William B; Bhandarkar, Naveen D

    2015-04-01

    To identify the prevalence and management of problematic residents. Additionally, we hope to identify the factors associated with successful remediation of unsuccessful otolaryngology residents. Self-reported Internet and paper-based survey. An anonymous survey was distributed to 152 current and former program directors (PDs) in 2012. The factors associated with unsuccessful otolaryngology residents and those associated with the successful remediation of problematic residents were investigated. An unsuccessful resident is defined as one who quit or was removed from the program for any reason, or one whose actions resulted in criminal action or citation against their medical license after graduation from residency. Remediation is defined as an individualized program implemented to correct documented weaknesses. The overall response rate was 26% (40 PDs). Seventy-three unsuccessful or problematic residents were identified. Sixty-six problematic or unsuccessful residents were identified during residency, with 58 of 66 (88%) undergoing remediation. Thirty-one (47%) residents did not graduate. The most commonly identified factors of an unsuccessful resident were: change in specialty (21.5%), interpersonal and communication skills with health professionals (13.9%), and clinical judgment (10.1%). Characteristics of those residents who underwent successful remediation include: poor performance on in-training examination (17%, P otolaryngology PDs in this sample identified at least one unsuccessful resident. Improved methods of applicant screening may assist in optimizing otolaryngology resident selection. © 2014 The American Laryngological, Rhinological and Otological Society, Inc.

  9. Defining and implementing a model for pharmacy resident research projects

    Directory of Open Access Journals (Sweden)

    Dick TB

    2015-09-01

    Full Text Available Objective: To describe a standard approach to provide a support structure for pharmacy resident research that emphasizes self-identification of a residency research project. Methods: A subcommittee of the residency advisory committee was formed at our institution. The committee was initially comprised of 2 clinical pharmacy specialists, 1 drug information pharmacist, and 2 pharmacy administrators. The committee developed research guidelines that are distributed to residents prior to the residency start that detail the research process, important deadlines, and available resources. Instructions for institutional review board (IRB training and deadlines for various assignments and presentations throughout the residency year are clearly defined. Residents conceive their own research project and emphasis is placed on completing assignments early in the residency year. Results: In the 4 years this research process has been in place, 15 of 16 (94% residents successfully identified their own research question. All 15 residents submitted a complete research protocol to the IRB by the August deadline. Four residents have presented the results of their research at multi-disciplinary national professional meetings and 1 has published a manuscript. Feedback from outgoing residents has been positive overall and their perceptions of their research projects and the process are positive. Conclusion: Pharmacy residents selecting their own research projects for their residency year is a feasible alternative to assigning or providing lists of research projects from which to select a project.

  10. Association of General Surgery Resident Remediation and Program Director Attitudes With Resident Attrition.

    Science.gov (United States)

    Schwed, Alexander C; Lee, Steven L; Salcedo, Edgardo S; Reeves, Mark E; Inaba, Kenji; Sidwell, Richard A; Amersi, Farin; Are, Chandrakanth; Arnell, Tracey D; Damewood, Richard B; Dent, Daniel L; Donahue, Timothy; Gauvin, Jeffrey; Hartranft, Thomas; Jacobsen, Garth R; Jarman, Benjamin T; Melcher, Marc L; Mellinger, John D; Morris, Jon B; Nehler, Mark; Smith, Brian R; Wolfe, Mary; Kaji, Amy H; de Virgilio, Christian

    2017-12-01

    Previous studies of resident attrition have variably included preliminary residents and likely overestimated categorical resident attrition. Whether program director attitudes affect attrition has been unclear. To determine whether program director attitudes are associated with resident attrition and to measure the categorical resident attrition rate. This multicenter study surveyed 21 US program directors in general surgery about their opinions regarding resident education and attrition. Data on total resident complement, demographic information, and annual attrition were collected from the program directors for the study period of July 1, 2010, to June 30, 2015. The general surgery programs were chosen on the basis of their geographic location, previous collaboration with some coauthors, prior work in surgical education and research, or a program director willing to participate. Only categorical surgical residents were included in the study; thus, program directors were specifically instructed to exclude any preliminary residents in their responses. Five-year attrition rates (2010-2011 to 2014-2015 academic years) as well as first-time pass rates on the General Surgery Qualifying Examination and General Surgery Certifying Examination of the American Board of Surgery (ABS) were collected. High- and low-attrition programs were compared. The 21 programs represented different geographic locations and 12 university-based, 3 university-affiliated, and 6 independent program types. Programs had a median (interquartile range [IQR]) number of 30 (20-48) categorical residents, and few of those residents were women (median [IQR], 12 [5-17]). Overall, 85 of 966 residents (8.8%) left training during the study period: 15 (17.6%) left after postgraduate year 1, 34 (40.0%) after postgraduate year 2, and 36 (42.4%) after postgraduate year 3 or later. Forty-four residents (51.8%) left general surgery for another surgical discipline, 21 (24.7%) transferred to a different surgery

  11. Blended Learning in Obstetrics and Gynecology Resident Education: Impact on Resident Clinical Performance.

    Science.gov (United States)

    Ghareeb, Allen; Han, Heeyoung; Delfino, Kristin; Taylor, Funminiyi

    2016-01-01

    Effects of residents' blended learning on their clinical performance have rarely been reported. A blended learning pilot program was instituted at Southern Illinois University School of Medicine's Obstetrics and Gynecology program. One of the modules was chronic hypertension in pregnancy. We sought to evaluate if the resident blended learning was transferred to their clinical performance six months after the module. A review of patient charts demonstrated inadequate documentation of history, evaluation, and counseling of patients with chronic hypertension at the first prenatal visit by Obstetrics and Gynecology (OB/GYN) residents. A blended learning module on chronic hypertension in pregnancy was then provided to the residents. A retrospective chart review was then performed to assess behavioral changes in the OB/GYN residents. This intervention was carried out at the Department of Obstetrics and Gynecology, Southern Illinois University. All 16 OB/GYN residents were enrolled in this module as part of their educational curriculum. A query of all prenatal patients diagnosed with chronic hypertension presenting to the OB/GYN resident clinics four months prior to the implementation of the blended learning module (March 2015-June 2015) and six months after (July 20, 2015-February 2016) was performed. Data were collected from outpatient charts utilizing the electronic medical record. Data were abstracted from resident documentation at the first prenatal visit. The residents thought that the blended learning module was applicable to performance improvement in the real-world setting. Patients evaluated before ( n = 10) and after ( n = 7) the intervention were compared. After the intervention, there was an increase in assessment of baseline liver enzymes, referral for electrocardiogram, and early assessment for diabetes in the obese patients. More patients were provided a blood pressure cuff after the module (71.4% vs. 20%). Data were provided to the residents in an

  12. [Competency-based Neurosurgery Residency Programme].

    Science.gov (United States)

    Lobato, Ramiro D; Jiménez Roldan, Luis; Alen, José F; Castaño, Ana M; Munarriz, Pablo M; Cepeda, Santiago; Lagares, Alfonso

    2016-01-01

    A programme proposal for competency-based Neurosurgery training adapted to the specialization project is presented. This proposal has been developed by a group of neurosurgeons commissioned by the SENEC (Spanish Society of Neurosurgery) and could be modified to generate a final version that could come into force coinciding with the implementation of the specialization programme. This document aims to facilitate the test of the new programme included in the online version of our journal. Total training period is 6 years; initial 2 years belong to the surgery specialization and remaining 4 years belong to core specialty period. It is a competency-based programmed based on the map used by the US Accreditation Council for Graduate Medical Education (ACGME) including the following domains of clinical competency: Medical knowledge, patient care, communication skills, professionalism, practice-based learning and improvement, health systems, interprofessional collaboration and professional and personal development. Subcompetencies map in the domains of Knowledge and Patient care (including surgical competencies) was adapted to the one proposed by AANS and CNS (annex 1 of the programme). A subcompetency map was also used for the specialization rotations. Resident's training is based on personal study (self-learning) supported by efficient use of information sources and supervised clinical practice, including bioethical instruction, clinical management, research and learning techniques. Resident evaluation proposal includes, among other instruments, theoretical knowledge tests, objective and structured evaluation of the level of clinical competency with real or standardised patients, global competency scales, 360-degree evaluation, clinical record audits, milestones for residents progress and self-assessment (annex 2). Besides, residents periodically assess the teaching commitment of the department's neurosurgeons and other professors participating in rotations, and annually

  13. Neurosurgical Resident Error: A Survey of U.S. Neurosurgery Residency Training Program Directors' Perceptions.

    Science.gov (United States)

    Gupta, Raghav; Moore, Justin M; Adeeb, Nimer; Griessenauer, Christoph J; Schneider, Anna M; Gandhi, Chirag D; Harsh, Griffith R; Thomas, Ajith J; Ogilvy, Christopher S

    2018-01-01

    Efforts to address resident errors and to enhance patient safety have included systemic reforms, such as the Accreditation Council for Graduate Medical Education's (ACGME's) mandated duty-hour restrictions, and specialty-specific initiatives such as the neurosurgery Milestone Project. However, there is currently little data describing the basis for these errors or outlining trends in neurosurgical resident error. An online questionnaire was distributed to program directors of 108 U.S. neurosurgery residency training programs to assess the frequency, most common forms and causes of resident error, the resulting patient outcomes, and the steps taken by residency programs to address these errors. Thirty-one (28.7%) responses were received. Procedural/surgical error was the most commonly observed type of error. Transient injury and no injury to the patient were perceived to be the 2 most frequent outcomes. Inexperience or resident mistake despite adequate training were cited as the most common causes of error. Twenty-three (74.2%) respondents stated that a lower post graduate year level correlated with an increased incidence of errors. There was a trend toward an association between an increased number of residents within a program and the number of errors attributable to a lack of supervision (r = 0.36; P = 0.06). Most (93.5%) program directors do not believe that mandated duty-hour restrictions reduce error frequency. Program directors believe that procedural error is the most commonly observed form of error, with post graduate year level believed to be an important predictor of error frequency. The perceived utility of systemic reforms that aim to reduce the incidence of resident error remains unclear. Copyright © 2017. Published by Elsevier Inc.

  14. Preparedness of Entering Pediatric Dentistry Residents: Advanced Pediatric Program Directors' and First-Year Residents' Perspectives.

    Science.gov (United States)

    Rutkauskas, John; Seale, N Sue; Casamassimo, Paul; Rutkauskas, John S

    2015-11-01

    For children to receive needed oral health care, adequate training at both the predoctoral and postdoctoral levels of dental education is required, but previous studies have found inadequacies in predoctoral education that lead to general dentists' unwillingness to treat certain young populations. As another way of assessing predoctoral preparation, the aim of this study was to determine the perspectives of first-year residents and pediatric program directors about residents' preparedness to enter advanced education programs in pediatric dentistry. Surveys were sent to all 74 U.S. program directors and 360 first-year residents. The survey focused on procedures related to prevention, behavior management, restorative procedures, pulp therapy, sedation, and surgery, as well as treating patients funded by Medicaid and with special health care needs. Among the first-year residents, 173 surveys were returned for a 48% response rate; 61 directors returned surveys for an 82% response rate. Only half of the residents (55%) reported feeling adequately prepared for their first year in residency; less than half cited adequate preparation to place stainless steel crowns (SSCs) (42%) and perform pulpotomies (45%). Far fewer felt adequately prepared to provide treatment for children six months to three years of age, including examinations (29%), infant oral exams (27%), and children with severe caries (37%). The program directors were even less positive about the adequacy of residents' preparation. Only 17% deemed them adequately prepared to place SSCs and 13% to perform pulpotomies. Approximately half reported their first-year residents were inadequately prepared to treat very young children and children with severe caries (55% each). This study found that the perceived inadequacy of predoctoral education in pediatric dentistry was consistent at both the learner and educator levels, supporting previous studies identifying inadequacies in this area.

  15. Using Reflections of Recent Resident Graduates and their Pediatric Colleagues to Evaluate a Residency Program

    Directory of Open Access Journals (Sweden)

    Robert K. Kamei, M.D.

    2003-01-01

    Full Text Available Background and Purposes: In response to the new Accreditation Council for Graduate Medical Education (ACGME mandate for residency programs to use feedback to improve its educational program, we piloted a novel evaluation strategy of a residency program using structured interviews of resident graduates working in a primary care practice and their physician associates. Methods: A research assistant performed a structured telephone interview. Quantitative data assessing the graduate’s self-assessment and the graduate’s clinical practice by the associate were analyzed. In addition, we performed a qualitative analysis of the interviews. Results: Thirteen resident graduates in primary care practice and seven physician practice associates participated in the study. Graduate self-assessment revealed high satisfaction with their residency training and competency. The associates judged our graduates as highly competent and mentioned independent decision-making and strong interpersonal skills (such as teamwork and communication as important. They specifically cited the graduate’s skills in intensive care medicine and adolescent medicine as well as communication and teamwork skills as important contributions to their practice. Conclusions: The ACGME Outcomes Project, which increases the emphasis on educational outcomes in the accreditation of residency education programs, requires programs to provide evidence of its effectiveness in preparing residents for practice. Direct assessment of the competency of our physician graduates in practice using structured interviews of graduates and their practice associates provide useful feedback information to a residency program as part of a comprehensive evaluation plan of our program’s curriculum and can be used to direct future educational initiatives of our training program

  16. Well-being in residency training: a survey examining resident physician satisfaction both within and outside of residency training and mental health in Alberta

    Directory of Open Access Journals (Sweden)

    Patten Scott

    2005-06-01

    Full Text Available Abstract Background Despite the critical importance of well-being during residency training, only a few Canadian studies have examined stress in residency and none have examined well-being resources. No recent studies have reported any significant concerns with respect to perceived stress levels in residency. We investigated the level of perceived stress, mental health and understanding and need for well-being resources among resident physicians in training programs in Alberta, Canada. Methods A mail questionnaire was distributed to the entire resident membership of PARA during 2003 academic year. PARA represents each of the two medical schools in the province of Alberta. Results In total 415 (51 % residents participated in the study. Thirty-four percent of residents who responded to the survey reported their life as being stressful. Females reported stress more frequently than males (40% vs. 27%, p Residents highly valued their colleagues (67%, program directors (60% and external psychiatrist/psychologist (49% as well-being resources. Over one third of residents wished to have a career counselor (39% and financial counselor (38%. Conclusion Many Albertan residents experience significant stressors and emotional and mental health problems. Some of which differ among genders. This study can serve as a basis for future resource application, research and advocacy for overall improvements to well-being during residency training.

  17. [Assessment of a residency training program in endocrinology and nutrition: results of a resident survey].

    Science.gov (United States)

    Gutiérrez-Alcántara, Carmen; Moreno-Fernández, Jesús; Palomares-Ortega, Rafael; García-Manzanares, Alvaro; Benito-López, Pedro

    2011-12-01

    In 2006, a new training program was approved for resident physicians in endocrinology and nutrition (EN). A survey was conducted to EN residents to assess their training, their depth of knowledge, and compliance with the new program, as well as potential changes in training, and the results obtained were compared to those from previous surveys. A survey previously conducted in 2000 and 2005 was used for this study. The survey included demographic factors, questions about the different rotations, scientific and practical training, assessment of their training departments and other aspects. Results of the current survey were compared to those of the 2005 survey. The survey was completed by 40 residents. Mandatory rotations are mainly fulfilled, except for neurology. Some rotations removed from the program, such as radiology and nuclear medicine, still are frequently performed and popular among residents, who would include them back into the program. There was a low compliance with practical training in the endocrinology area. Forty percent of residents were not aware of the new program, but 60% thought that it was fulfilled. A total of 82.5% of residents thought that their departments fulfilled the training objectives. Few differences were found in rotations as compared to the data collected in 2005 despite changes in the training program, and there was still a lack of practical training. By contrast, rating of training received from departments and senior physicians was improved as compared to prior surveys. Copyright © 2011 SEEN. Published by Elsevier Espana. All rights reserved.

  18. Resident-to-resident relational aggression and subjective well-being in assisted living facilities.

    Science.gov (United States)

    Trompetter, Hester; Scholte, Ron; Westerhof, Gerben

    2011-01-01

    Research in settings similar to assisted living facilities suggests that relational aggression, an indirect and mature form of aggression, might occur in assisted living facilities. This empirical study investigates the existence of relational aggression in a sample of residents and the relationship between relational aggression and resident's subjective well-being. 121 residents from six assisted living facilities completed questionnaires assessing personal experiences as victims of relational aggression and subjective well-being. Also nurses reported on victimization of relational aggression for every participant. Linear regression models were used to examine the association between both reports of relational aggression and subjective well-being. Relational aggression was shown to exist in assisted living facilities according to both residents (prevalence: 19%) and nurses (prevalence: 41%). Chi-square testing revealed no association between ratings by nurses and residents. Self-reports of victimization of relational aggression were related to depression, anxiety, satisfaction with life and social loneliness, but not to emotional loneliness. Nurse-reports of victimization of relational aggression were not related to subjective well-being. Self-reports of relational aggression seem to be better predictors of resident's well-being than nurse-reports of relational aggression. Awareness of these findings and the discrepancy between nurse-reports and self-reports are important for practice and for future research regarding social dynamics and living arrangements in elderly care settings.

  19. The role of the resid solvent in coprocessing

    Energy Technology Data Exchange (ETDEWEB)

    Curtis, C.W. [Auburn Univ., AL (United States)

    1995-12-31

    The objective of this project is to determine the role of petroleum resid in coprocessing of coal and resid. The question being asked is whether the resid is a reactant in the system or whether the resid is a merely a diluent that is being simultaneously upgraded? To fulfill the objective the hydrogen transfer from model compounds, naphthenes that represent petroleum resids to model acceptors is being determined. The specificity of different catalytic systems for promoting the hydrogen transfer from naphthenes to model acceptors and to coal is also being determined. In addition the efficacy of hydrogen transfer from and solvancy of whole and specific resid fractions under coprocessing conditions is being determined.

  20. Dolphin interactions with the mullet artisanal fishing on Southern Brazil: a qualitative and quantitative approach

    Directory of Open Access Journals (Sweden)

    Paulo C. Simões-Lopes

    1998-01-01

    Full Text Available A detailed analysis of the interactions between Tursiops truncatus (Montagu, 1821 and the artisanal fishing of mullets (Mugil spp. is presented at two localities in the south of Brazil: Laguna (Santa Catarina and Inibé/Tramandaí (Rio Grande do Sul. Its behavioral strategies and the advantages of their association are re-described and quantified based on the success of the capture and on the selectivity of the prey sizes. The mullets are the main resource involved (92% to 75% both at numerical level and as biomass. Twenty individuals of Tursiops truncatus participated in the interactions in Laguna and 9 in Imbé/Tramandaí. The participation and learning of calves is also reported.

  1. An Innovative Approach to Resident Scheduling: Use of a Point-Based System to Account for Resident Preferences

    Science.gov (United States)

    Chow, Robert Tao-Ping; Tamhane, Shrikant; Zhang, Manling; Fisher, Lori-Ann; Yoon, Jenni; Sehgal, Sameep; Lumbres, Madel; Han, Ma Ai Thanda; Win, Tiffany

    2015-01-01

    Background The scheduling of residents for rotation assignments and on-call responsibilities is a time-consuming process that challenges the resources of residency programs. Assignment of schedules is traditionally done by chief residents or program administration with variable input from the residents involved. Intervention We introduced an innovative point-based scheduling system to increase transparency in the scheduling process, foster a sense of fairness and equality in scheduling, and increase resident ownership for making judicious scheduling choices. Methods We devised a point-based system in which each resident in our 40-member program was allocated an equal number of points. The residents assigned these points to their preferred choices of rotations. Residents were then surveyed anonymously on their perceptions of this new scheduling system and were asked to compare it with their traditional scheduling system. Results The schedule was successfully implemented, and it allowed residents to express their scheduling preferences using an innovative point-based approach. Residents were generally satisfied with the new system, would recommend it to other programs, and perceived a greater sense of involvement. However, resident satisfaction with the new system was not significantly greater compared with the previous approach to scheduling (P = .20). Chief residents expressed satisfaction with the new scheduling model. Conclusions Residents were equally satisfied with the traditional preference-based scheduling approach and the new point-based system. Chief residents' feedback on the new system reflected reduced stress and time commitment in the new point-based system. PMID:26457154

  2. Therapeutic kitchens for residents with dementia.

    Science.gov (United States)

    Marsden, J P; Meehan, R A; Calkins, M P

    2001-01-01

    Long-term care facilities are increasingly incorporating some sort of kitchen, often referred to as a therapeutic kitchen, for resident, staff, and family use through remodeling efforts or new construction. A study, consisting of five site visits and a questionnaire mailed to 631 facilities providing dementia care, was conducted to identify physical features that are typically included in therapeutic kitchen design and to explore how these features support daily use in relation to activities programming and food service systems. Findings indicate that universal design features should be incorporated to a greater extent and certain features are more common, reinforce homelike imagery, or enhance safety. Results also suggest that a higher number of residents participate in more recreational activities, such as baking, than they do in household chores, such as meal set-up, and therapeutic kitchens are not always linked to food service systems.

  3. Global health education in emergency medicine residency programs.

    Science.gov (United States)

    Havryliuk, Tatiana; Bentley, Suzanne; Hahn, Sigrid

    2014-06-01

    Interest in global health and international electives is growing among Emergency Medicine (EM) residents in the United States (US). The majority of EM residency programs offer opportunities for international electives. The degree of participation among residents and type of support provided by the residency program, however, remains unclear. To explore the current state of global health education among EM residents who participate in international electives. A 12-question survey was e-mailed to the program directors of the 192 EM residency programs in the US. The survey included questions about the number of residents participating in international electives and the types of preparation, project requirements, supervision, and feedback participating residents receive. The response rate was 53% with 102 responses. Seventy-five of 102 (74%) programs reported that at least one resident participated in an international elective in the 2010-2011 academic year. Forty-three programs (42%) report no available funding to support any resident on an international elective. Residents receive no preparation for international work in 41 programs (40%). Only 25 programs (26%) required their residents to conduct a project while abroad. Forty-nine programs (48%) reported no formal debriefing session, and no formal feedback was collected from returning residents in 57 of 102 (59%) programs. The majority of EM residencies have residents participating in international electives. However, the programs report variable preparation, requirements, and resident supervision. These results suggest a need for an expanded and more structured approach to international electives undertaken by EM residents. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Variable Operative Experience in Hand Surgery for Plastic Surgery Residents.

    Science.gov (United States)

    Silvestre, Jason; Lin, Ines C; Levin, Lawrence Scott; Chang, Benjamin

    Efforts to standardize hand surgery training during plastic surgery residency remain challenging. We analyze the variability of operative hand experience at U.S. plastic surgery residency programs. Operative case logs of chief residents in accredited U.S. plastic surgery residency programs were analyzed (2011-2015). Trends in fold differences of hand surgery case volume between the 10th and 90th percentiles of residents were assessed graphically. Percentile data were used to calculate the number of residents achieving case minimums in hand surgery for 2015. Case logs from 818 plastic surgery residents were analyzed of which a minority were from integrated (35.7%) versus independent/combined (64.3%) residents. Trend analysis of fold differences in case volume demonstrated decreasing variability among procedure categories over time. By 2015, fold differences for hand reconstruction, tendon cases, nerve cases, arthroplasty/arthrodesis, amputation, arterial repair, Dupuytren release, and neoplasm cases were below 10-fold. Congenital deformity cases among independent/combined residents was the sole category that exceeded 10-fold by 2015. Percentile data suggested that approximately 10% of independent/combined residents did not meet case minimums for arterial repair and congenital deformity in 2015. Variable operative experience during plastic surgery residency may limit adequate exposure to hand surgery for certain residents. Future studies should establish empiric case minimums for plastic surgery residents to ensure hand surgery competency upon graduation. Copyright © 2017 Association of Program Directors in Surgery. Published by Elsevier Inc. All rights reserved.

  5. Teaching strategies used by internal medicine residents on the wards.

    Science.gov (United States)

    Smith, Dustin T; Kohlwes, R Jeffrey

    2011-01-01

    Residents serve as teachers to interns and students in most internal medicine residency programs. The purpose of our study is to explore what internal medicine residents perceive as effective teaching strategies in the inpatient setting and to formulate a guideline for preparing residents to lead their ward teams. Housestaff identified as excellent teaching residents were recruited from a large internal medicine residency program. Focus groups were formed and interviews were conducted using open-ended questions. Transcripts of the interviews were reviewed, analyzed, and compared for accuracy by two investigators. The transcripts were then coded to categorize data into similar subjects from which recurrent themes in resident teaching were identified. Twenty-two residents participated in four focus group interviews held in 2008. We identified five principal themes for effective teaching by residents: (T)aking advantage of teaching opportunities, (E)mpowering learners, (A)ssuming the role of leader, (C)reating a learning environment, and (H)abituating the practice of teaching. Strategies for effective teaching by residents exist. The TEACH mnemonic is a resident-identified method of instruction. Use of this tool could enable residency programs to create instructional curricula to prepare their residents and interns to take on the roles of team leaders and teachers.

  6. Implementation of a "Flipped Classroom" for Neurosurgery Resident Education.

    Science.gov (United States)

    Girgis, Fady; Miller, Jonathan P

    2018-01-01

    Engaging residents across a multiyear training spectrum is challenging given the heterogeneity of experience and limited time available for educational activities. A "flipped classroom" model, in which residents prepare ahead of time for mentored topic discussions, has potential advantages. We implemented a curriculum consisting of topics distributed across the specialty. Weekly, each resident was randomly assigned to research a specific aspect of an assigned topic appropriate to his or her level of experience: junior residents about what characterizes each clinical entity, midlevel residents about when to intervene, and chief residents about how to administer treatment. Residents completed an anonymous survey 6 months after implementation. Board examination performance was assessed before and after implementation. A total of 12 residents participated in the program. Weekly, 1.75±0.40 hours were spent in preparation, with senior residents reporting less time than junior residents. All residents indicated that the accumulation of experience across 7 years of residency was a major advantage of this program, and all preferred it to lectures. Performance on the board examination significantly increased after implementation (from 316±36 to 468±45, pflipped classroom is a viable approach to resident education and is associated with increased engagement and improved performance using validated knowledge-assessment tools.

  7. Leadership for All: An Internal Medicine Residency Leadership Development Program.

    Science.gov (United States)

    Moore, Jared M; Wininger, David A; Martin, Bryan

    2016-10-01

    Developing effective leadership skills in physicians is critical for safe patient care. Few residency-based models of leadership training exist. We evaluated residents' readiness to engage in leadership training, feasibility of implementing training for all residents, and residents' acceptance of training. In its fourth year, the Leadership Development Program (LDP) consists of twelve 90-minute modules (eg, Team Decision Making and Bias, Leadership Styles, Authentic Leadership) targeting all categorical postgraduate year (PGY) 1 residents. Modules are taught during regularly scheduled educational time. Focus group surveys and discussions, as well as annual surveys of PGY-1s assessed residents' readiness to engage in training. LDP feasibility was assessed by considering sustainability of program structures and faculty retention, and resident acceptance of training was assessed by measuring attendance, with the attendance goal of 8 of 12 modules. Residents thought leadership training would be valuable if content remained applicable to daily work, and PGY-1 residents expressed high levels of interest in training. The LDP is part of the core educational programming for PGY-1 residents. Except for 2 modules, faculty presenters have remained consistent. During academic year 2014-2015, 45% (13 of 29) of categorical residents participated in at least 8 of 12 modules, and 72% (21 of 29) participated in at least 7 of 12. To date, 125 categorical residents have participated in training. Residents appeared ready to engage in leadership training, and the LDP was feasible to implement. The attendance goal was not met, but attendance was sufficient to justify program continuation.

  8. Assessment of otolaryngic knowledge in primary care residents.

    Science.gov (United States)

    Error, Marc E; Wilson, Kevin F; Ward, P Daniel; Gale, Derrick C; Meier, Jeremy D

    2013-03-01

    (1) Determine the amount of exposure to otolaryngology in medical training of non-otolaryngology residents. (2) Evaluate the general otolaryngic knowledge in these residents. Cross-sectional survey. Academic medical center. A 10-question multiple-choice quiz was given to residents in family practice, pediatrics, emergency medicine, and internal medicine during scheduled educational conferences. Residents were also asked if they ever participated in an otolaryngology rotation during medical school or residency. Medical students and otolaryngology residents completed the quiz to act as controls. A total of 98 examinations were analyzed (49 non-otolaryngology residents, 10 otolaryngology residents, and 39 second-year medical students). Only 24% of the non- otolaryngology residents had an otolaryngology rotation during medical school. The same amount (24%) had a rotation during residency. The average percentage correct on the quiz was 48%, 56%, and 92% for medical students, non-otolaryngology, and otolaryngology residents, respectively (P medical school or residency. This nonvalidated questionnaire also suggested significant deficiencies in basic otolaryngic knowledge in these residents. Identifying mechanisms to improve exposure to otolaryngology in the medical training curriculum is needed.

  9. Research Experience in Psychiatry Residency Programs Across Canada: Current Status

    Science.gov (United States)

    Shanmugalingam, Arany; Ferreria, Sharon G; Norman, Ross M G; Vasudev, Kamini

    2014-01-01

    Objective: To determine the current status of research experience in psychiatry residency programs across Canada. Method: Coordinators of Psychiatric Education (COPE) resident representatives from all 17 psychiatry residency programs in Canada were asked to complete a survey regarding research training requirements in their programs. Results: Among the 17 COPE representatives, 15 completed the survey, representing 88% of the Canadian medical schools that have a psychiatry residency program. Among the 15 programs, 11 (73%) require residents to conduct a scholarly activity to complete residency. Some of these programs incorporated such a requirement in the past 5 years. Ten respondents (67%) reported availability of official policy and (or) guidelines on resident research requirements. Among the 11 programs that have a research requirement, 10 (91%) require residents to complete 1 scholarly activity; 1 requires completion of 2 scholarly activities. Eight (53%) residency programs reported having a separate research track. All of the programs have a research coordinator and 14 (93%) programs provide protected time to residents for conducting research. The 3 most common types of scholarly activities that qualify for the mandatory research requirement are a full independent project (10 programs), a quality improvement project (8 programs), and assisting in a faculty project (8 programs). Six programs expect their residents to present their final work in a departmental forum. None of the residency programs require publication of residents’ final work. Conclusions: The current status of the research experience during psychiatry residency in Canada is encouraging but there is heterogeneity across the programs. PMID:25565474

  10. [Experiences of bullying in medical residents].

    Science.gov (United States)

    Ortiz-León, Silvia; Jaimes-Medrano, Aurora Leonila; Tafoya-Ramos, Silvia Aracely; Mujica-Amaya, María Luisa; Olmedo-Canchola, Víctor Hugo; Carrasco-Rojas, José Antonio

    2014-01-01

    Harassment and abuse are forms of persistent intimidating behavior against a person and in medical practice those are accepted and justified at all levels of education and are considered specific to the hospital culture. To identify the frequency of harassment and some factors related to its existence on residents of medical specialties in Mexico City. A linear study was carried out in which a total of 260 interns pertaining to the following medical specialties: surgery, internal medicine, gynecology and obstetrics, and pediatrics participated. The study took place in three general hospitals in Mexico City. Two evaluations with Leymann Inventory of Psychological-Terrorization (LIPT-60) with 6 months between assessments were performed. Comparison between the first and second evaluations did not show differences in any of the harassment measurements obtained. Of all residents, 265 (98.5%) claimed to have experienced some type of harassing behavior against them at least once during the previous 6 months, with a 1.4 (±0.5) average intensity, showing no difference between men and women. Women received a higher grade than men on the communication block scale. Harassing behaviors that obtained the highest average values were evident intimidation and occupational discredit. Among all harassment measurements, the specialty of gynecology and obstetrics showed the highest grade. The hospital influenced the reported harassment. The most common harassing behaviors were occupational discredit, verbal threats, shouting, and mockery. The high frequency of harassment that medical residents experience during their hospital training deserves our attention.

  11. Tickborne Powassan virus infections among Wisconsin residents.

    Science.gov (United States)

    Johnson, Diep K Hoang; Staples, J Erin; Sotir, Mark J; Warshauer, David M; Davis, Jeffrey P

    2010-04-01

    Powassan virus (POWV) is a tickborne Flavivirus that causes a rare but potentially life-threatening illness. The first reported case of POWV infection in a Wisconsin resident occurred in 2003. Enhanced surveillance and testing detected 2 additional cases. Patient specimens with a positive or equivocal immunoglobulin M (IgM) antibody to an arbovirus were sent from commercial laboratories to the Wisconsin State Laboratory of Hygiene and forwarded to the Centers for Disease Control and Prevention (CDC) for confirmatory testing. Patients with laboratory confirmed POWV infections were interviewed to obtain demographic, clinical, and epidemiologic information. POWV infections were confirmed in 3 adult Wisconsin residents in 2003, 2006, and 2007; illness onsets occurred during May and June. Two patients were hospitalized and all survived. One patient had a dual infection with POWV and Anaplasma phaghocytophilum. Specimens from all 3 patients were initially reported as positive for IgM antibody to either St Louis encephalitis or California serogroup viruses; POWV-specific antibody was detected during confirmatory testing at the CDC. Each patient had exposures to known or likely tick habitats in different counties within 30 days before illness onset. These are the first diagnosed human POWV infections in Wisconsin. Because all 3 patients were initially identified as having other arboviral infections using commercial screening kits, routine confirmatory testing is essential for proper diagnosis of most arboviral infections. Wisconsin residents should be educated regarding risks of acquiring and ways to prevent POWV infection and other tickborne diseases when spending time outdoors.

  12. [Snacks consumption among residents in Shenzhen City].

    Science.gov (United States)

    Shang, Qinggang; Cao, Keke; Xu, Jiazhang; Yuan, Xueli; Zhuo, Zhipeng; Xu, Jian; Pan, Peng

    2014-07-01

    To describe the status of snacks consumption among residents in Shenzhen. By a multiple stage probability proportionate to size sampling, 12 communities were randomly selected from 8 districts of Shenzhen based on population proportion. In the second stage, 30 households were randomly selected from each community. In each household, 2 years or older were invited to take dietary survey. There were 66.1% residents consuming snacks. More girls ate snacks than boys (chi2 = 11.552, P snacks than adults (chi2 = 27.207, P snacks were 107.8 kcal (451.5 kJ), 1.7 g, 0.8 g, 22.0 g, 1.1 g, 23.1 microg, 8.3 mg, 1.1 mg,17.0 mg, 9.3 mg, 21.0 mg, 0.8 mg and 0.4 mg. Food categories the most frequently consumed as snacks were fruit, pastry, milk and products, beverages and grains. It's important to strengthen the diet education among residents in Shenzhen, especially the knowledge how to select snacks correctly and rationally.

  13. Perspectives on healthy eating among Appalachian residents.

    Science.gov (United States)

    Schoenberg, Nancy E; Howell, Britteny M; Swanson, Mark; Grosh, Christopher; Bardach, Shoshana

    2013-08-01

    Extensive attention has been focused on improving the dietary intake of Americans. Such focus is warranted due to increasing rates of overweight, obesity, and other dietary-related disease. To address suboptimal dietary intake requires an improved, contextualized understanding of the multiple and intersecting influences on healthy eating, particularly among those populations at greatest risk of and from poor diet, including rural residents. During 8 focus groups (N = 99) and 6 group key informant interviews (N = 20), diverse Appalachian rural residents were queried about their perceptions of healthy eating, determinants of healthy food intake, and recommendations for improving the dietary intake of people in their communities. Participants included church members and other laypeople, public health officials, social service providers, health care professionals, and others. Participants offered insights on healthy eating consistent with the categories of individual, interpersonal, community, physical, environmental, and society-level influences described in the socioecological model. Although many participants identified gaps in dietary knowledge as a persistent problem, informants also identified extraindividual factors, including the influence of family, fellow church members, and schools, policy, advertising and media, and general societal trends, as challenges to healthy dietary intake. We highlight Appalachian residents' recommendations for promoting healthier diets, including support groups, educational workshops, cooking classes, and community gardening. We discuss the implications of these findings for programmatic development in the Appalachian context. © 2013 National Rural Health Association.

  14. Blended Learning in Obstetrics and Gynecology Resident Education: Impact on Resident Clinical Performance

    Directory of Open Access Journals (Sweden)

    Allen Ghareeb

    2016-01-01

    Full Text Available Problem Effects of residents’ blended learning on their clinical performance have rarely been reported. A blended learning pilot program was instituted at Southern Illinois University School of Medicine's Obstetrics and Gynecology program. One of the modules was chronic hypertension in pregnancy. We sought to evaluate if the resident blended learning was transferred to their clinical performance six months after the module. Intervention A review of patient charts demonstrated inadequate documentation of history, evaluation, and counseling of patients with chronic hypertension at the first prenatal visit by Obstetrics and Gynecology (OB/GYN residents. A blended learning module on chronic hypertension in pregnancy was then provided to the residents. A retrospective chart review was then performed to assess behavioral changes in the OB/GYN residents. Context This intervention was carried out at the Department of Obstetrics and Gynecology, Southern Illinois University. All 16 OB/GYN residents were enrolled in this module as part of their educational curriculum. A query of all prenatal patients diagnosed with chronic hypertension presenting to the OB/GYN resident clinics four months prior to the implementation of the blended learning module (March 2015–June 2015 and six months after (July 20, 2015–February 2016 was performed. Data were collected from outpatient charts utilizing the electronic medical record. Data were abstracted from resident documentation at the first prenatal visit. Outcome The residents thought that the blended learning module was applicable to performance improvement in the real-world setting. Patients evaluated before ( n = 10 and after ( n = 7 the intervention were compared. After the intervention, there was an increase in assessment of baseline liver enzymes, referral for electrocardiogram, and early assessment for diabetes in the obese patients. More patients were provided a blood pressure cuff after the module (71

  15. In Pursuit of Meaningful Use of Learning Goals in Residency: A Qualitative Study of Pediatric Residents.

    Science.gov (United States)

    Lockspeiser, Tai M; Li, Su-Ting T; Burke, Ann E; Rosenberg, Adam A; Dunbar, Alston E; Gifford, Kimberly A; Gorman, Gregory H; Mahan, John D; McKenna, Michael P; Reed, Suzanne; Schwartz, Alan; Harris, Ilene; Hanson, Janice L

    2016-06-01

    Medical education aims to equip physicians for lifelong learning, an objective supported by the conceptual framework of self-regulated learning (SRL). Learning goals have been used to develop SRL skills in learners across the medical education continuum. This study's purpose was to elicit residents' perspectives on learning goal use and to develop explanations suggesting how aspects of the learning environment may facilitate or hinder the meaningful use of learning goals in residency. Resident focus groups and program director interviews were conducted in 2012-2013, audio-recorded, and transcribed. Programs were selected to maximize diversity of size, geographic location, type of program, and current use of learning goals. Data were analyzed using the constant comparative method associated with grounded theory. Further analysis compared themes frequently occurring together to strengthen the understanding of relationships between the themes. Through iterative discussions, investigators built a grounded theory. Ninety-five third-year residents and 12 program directors at 12 pediatric residency programs participated. The analysis identified 21 subthemes grouped into 5 themes: program support, faculty roles, goal characteristics and purposes, resident attributes, and accountability and goal follow-through. Review of relationships between the themes revealed a pyramid of support with program support as the foundation that facilitates the layers above it, leading to goal follow-through. Program support facilitates each step of the SRL process that leads to meaningful use of learning goals in residency. A strong foundation of program support should include attention to aspects of the implicit curriculum as well as the explicit curriculum.

  16. Inequality in healthcare costs between residing and non-residing patients: evidence from Vietnam.

    Science.gov (United States)

    Nguyen, Hieu M

    2017-05-12

    Place of residence has been shown to impact health. To date, however, previous studies have only focused on the variability in health outcomes and healthcare costs between urban and rural patients. This study takes a different approach and investigates cost inequality facing non-residing patients - patients who do not reside in the regions in which the hospitals are located. Understanding the sources for this inequality is important, as they are directly related to healthcare accessibility in developing countries. The causal impact of residency status on individual healthcare spending is documented with a quasi-experimental design. The propensity score matching method is applied to a unique patient-level dataset (n = 900) collected at public general and specialist hospitals across North Vietnam. Propensity score matching shows that Vietnamese patients who do not reside in the regions in which the hospitals are located are expected to pay about 15 million Vietnamese dongs (approximately 750 USD) more than those who do, a sizable gap, given the distribution of total healthcare costs for the overall sample. This estimate is robust to alternative matching specifications. The obtained discrepancy is empirically attributable to the differences in three potential contributors, namely spending on accompanying relatives, "courtesy funds," and days of hospitalization. The present study finds that there is significant inequality in healthcare spending between residing and non-residing patients at Vietnamese hospitals and that this discrepancy can be partially explained by both institutional and non-institutional factors. These factors signal practical channels through which policymakers can improve healthcare accessibility.

  17. What Laboratory Research has Told Us about Dolphin Cognition

    OpenAIRE

    Herman, Louis M.

    2010-01-01

    Studies of sensory, cognitive, and communicative skills of bottlenose dolphins (Tursiops truncatus) were carried out over a 34-year period at the Kewalo Basin Marine Mammal Laboratory in Honolulu. Findings on sensory skills included fine discrimination of auditory frequency differences andauditory duration, good visual resolution capabilities in water and in air, and sharing of object recognition across the senses of vision and echolocation. Short-term memory for auditory and visual materials...

  18. Sex Difference in Bottlenose Dolphin Sightings during a Long-term Bridge Construction Project

    OpenAIRE

    Ann Weaver

    2015-01-01

    Almost nothing is known about the effect of long-term bridge construction on free-ranging bottlenose dolphins (Tursiops truncatus). The species’ natural history predicts that there should be sex differences in reaction to construction because bottlenose dolphins show sex differences in most of their behaviors. A 5-year bridge construction project over a narrow but important dolphin corridor at John’s Pass tidal inlet, St. Petersburg FL, brought chronic environmental changes. The purpose of th...

  19. Ecological segregation inferred using chemical tracers and contamination assessment of five toothed whales in the Northwest Iberian Peninsula

    OpenAIRE

    Méndez Fernandez, Paula

    2012-01-01

    Tese de doutoramento em Ciências (ramo de conhecimento em Biologia) The first objective of this PhD was to determine the degree of ecological segregation between five sympatric species of toothed whales (i.e. common dolphin Delphinus delphis, harbour porpoise Phocoena phocoena, bottlenose dolphin Tursiops truncatus, striped dolphin Stenella coeruleoalba and long finned pilot whale Globicephala melas) inhabiting a restricted and highly productive area, the North West Iberian Pen...

  20. Ségrégation écologique déterminée par des traceurs chimiques et estimation de la contamination de cinq cétacés odontocètes du nord-ouest de la pénisule ibérique

    OpenAIRE

    Mendez Fernandez, Paula

    2012-01-01

    The first objective of this PhD was to determine the degree of ecological segregation between five sympatric species of toothed whales (i.e. common dolphin Delphinus delphis, harbour porpoise Phocoena phocoena, bottlenose dolphin Tursiops truncatus, striped dolphin Stenella coeruleoalba and long finned pilot whale Globicephala melas) inhabiting a restricted and highly productive area, the North West Iberian Peninsula (NWIP). To this end, chemical parameters analyses were used as an “alternati...

  1. Biennial Conference on the Biology of Marine Mammals (10th), Held in Galveston, Texas on November 11-15, 1993

    Science.gov (United States)

    1993-11-15

    A., John I. Brueggeman, Richard A. Grotefmsdt, C. Edward Bowlby , BOWHEAD WHALES Michael L. Bonnell and Kenneth C. Balcoesh, 111.2. EMasco...INTEGRATED EXPERIMENTAL PLAYBACK OF LOW FREQUENCY NOISE TO BOTTLENOSE UNDERSEA SURVEILLANCE SYSTEM (IUSS) DOLPHINS, TURSIOPS TRUNCATUS. Liechty, John D...DETERMINANTS OF OTARIID MATING SYSTEMS Francis, John M. CONNOR, R.C. Department of Zoological Research, National Zoological Park, SmithsonianMuseum

  2. Development of Automated Whistle and Click Classifiers for Odontocete Species in the Northwest Atlantic Ocean and the Waters Surrounding the Hawaiian Islands

    Science.gov (United States)

    2014-09-30

    multiple reasons. Some species or populations are listed as threatened or endangered (ex. insular false killer whales in Hawaii) and thus it is...information regarding marine mammal occurrence, distribution and behavior in Naval exercise areas. However, it is not possible with current technology to...clicks of melon-headed whales (Peponocephala electra), bottlenose dolphins (Tursiops truncatus), and Grayʼs spinner dolphins (Stenella longirostris

  3. Acoustic Behavior, Baseline Ecology and Habitat use of Pelagic Odontocete Species of Concern

    Science.gov (United States)

    2013-09-30

    signals of Hawaiian insular false killer whales (FKWs) and melon-headed whales (MHWs). 2) Determine baseline acoustic behavior , basic activities...of false killer whales and other species (funded to Cascadia Research Collective). This had the advantage of distributing tagging operational costs...location and (2) how the receiver’s head shapes that signal. A bottlenose dolphin (Tursiops truncatus), the signaler, and a false killer whale , the receiver

  4. Validating the Novel Method of Measuring Cortisol Levels in Cetacean Skin by use of an ACTH Challenge in Bottlenose Dolphins

    Science.gov (United States)

    2015-09-30

    in Cetacean Skin by use of an ACTH Challenge in Bottlenose Dolphins Thea Bechshoft Aarhus University Bioscience Roskilde Frederiksborgvej...using skin samples collected from bottlenose dolphins (Tursiops truncatus). The dolphins will be sampled as part of an ongoing out-of water stress test...N000141110436. The stress test in brief: Each dolphin is asked to perform a routine, voluntary beach into a padded beaching tray. Immediately following

  5. A survey of perfluorinated compounds in surface water and biota including dolphins from the Ganges River and in other waterbodies in India

    Digital Repository Service at National Institute of Oceanography (India)

    Yeung, L.W.Y.; Yamashita, N.; Taniyasu, S.; Lam, P.K.S.; Sinha, R.K.; Borole, D.V.; Kannan, K.

    compounds have been implemented in the EU (Directive 76/769), Canada (http://canadagazette.gc.ca/partII/2008/20080611/html/sor178-e.html), USA (the New Jersey, the Department of Environmental Protection), and Japan (under the Rule of Regulation... of perfluoroalkyl compounds in the bottlenose dolphin (Tursiops truncatus) food web Environ. Sci. & Tech. 2006, 40, 4138-4144. 13    13    ISO25101 (The International Organization for Standardization) "Water quality - Determination of perfluorooctanesulfonate...

  6. A NACURH White Paper on Residence Hall Government.

    Science.gov (United States)

    Wyatt, Kevin W.; Stoner, Kenneth L.

    1984-01-01

    Presents a white paper on residence hall government, summarizing fundamental principles in organizing and maintaining a residence hall association on campus. These include determining needs, identifying support, obtaining income, ensuring effective leadership, and developing system maintenance. (JAC)

  7. Cosmetic Surgery Training in Plastic Surgery Residency Programs

    Directory of Open Access Journals (Sweden)

    Colton H. L. McNichols, MD

    2017-09-01

    Conclusions:. There is an increase in dedicated cosmetic surgery rotations and fewer residents believe they need a fellowship to practice cosmetic surgery. However, the comfort level of performing facial aesthetic and body contouring procedures remains low particularly among independent residents.

  8. Features of residency training and psychological distress among ...

    African Journals Online (AJOL)

    Features of residency training and psychological distress among residents in a Nigerian teaching hospital. O Esan, A Adeoye, P Onakoya, O Opeodu, K Owonikoko, D Olulana, M Bello, A Adeyemo, L Onigbogi, O Idowu, T Akute ...

  9. Residency training in the United States: What foreign medical ...

    African Journals Online (AJOL)

    FMGs) planning to pursue post-graduate residency training in the United States of America (USA). While the number of residency training positions is shrinking, and the number of United States graduates has steadily declined over the past ...

  10. U.S. Legal Permanent Residents: Fiscal Year 2012

    Data.gov (United States)

    Department of Homeland Security — A legal permanent resident (LPR) or “green card” recipient is defined by immigration law as a person who has been granted lawful permanent residence in the United...

  11. U.S. Legal Permanent Residents: Fiscal Year 2011

    Data.gov (United States)

    Department of Homeland Security — A legal permanent resident (LPR) or “green card” recipient is defined by immigration law as a person who has been granted lawful permanent residence in the United...

  12. U.S. Legal Permanent Residents: Fiscal Year 2007

    Data.gov (United States)

    Department of Homeland Security — A legal permanent resident (LPR) or “green card” recipient is defined by immigration law as a person who has been granted lawful permanent residence in the United...

  13. U.S. Legal Permanent Residents: Fiscal Year 2009

    Data.gov (United States)

    Department of Homeland Security — A legal permanent resident (LPR) or “green card” recipient is defined by immigration law as a person who has been granted lawful permanent residence in the United...

  14. U.S. Lawful Permanent Residents: Fiscal Year 2013

    Data.gov (United States)

    Department of Homeland Security — A lawful permanent resident (LPR) or 'green card' recipient is defined by immigration law as a person who has been granted lawful permanent residence in the United...

  15. U.S. Legal Permanent Residents: Fiscal Year 2010

    Data.gov (United States)

    Department of Homeland Security — A legal permanent resident (LPR) or “green card” recipient is defined by immigration law as a person who has been granted lawful permanent residence in the United...

  16. U.S. Legal Permanent Residents: Fiscal Year 2008

    Data.gov (United States)

    Department of Homeland Security — A legal permanent resident (LPR) or “green card” recipient is defined by immigration law as a person who has been granted lawful permanent residence in the United...

  17. Results of the 2003 Association of Residents in Radiation Oncology (ARRO) surveys of residents and chief residents in the United States

    International Nuclear Information System (INIS)

    Jagsi, Reshma; Buck, David A.; Singh, Anurag K.; Engleman, Mark; Thakkar, Vipul; Frank, Steven J.; Flynn, Daniel

    2005-01-01

    Purpose: To document demographic characteristics of current residents, career motivations and aspirations, and training program policies and resources. Methods: In 2003, the Association of Residents in Radiation Oncology (ARRO) conducted two nationwide surveys: one of all U.S. radiation oncology residents and one of chief residents. Results: The Chief Residents' Survey was completed by representatives from all 77 programs (response rate, 100%). The Residents' Survey was returned by 229 respondents (response rate, 44%). In each, 32% of respondents were female. The most popular career after residency was private practice (46%), followed by permanent academic practice (28%). Changes that would entice those choosing private practice to consider an academic career included more research experience as a resident (76%), higher likelihood of tenure (69%), lesser time commitment (66%), and higher salary (54%). Although the majority of respondents were satisfied with educational experience overall, a number of programs were reported to provide fewer resources than required. Conclusions: Median program resources and numbers of outliers are documented to allow residents and program directors to assess the relative adequacy of experience in their own programs. Policy-making bodies and individual programs should consider these results when developing interventions to improve educational experiences of residents and to increase retention of radiation oncologists in academic practice

  18. Text messaging among residents and faculty in a university general surgery residency program: prevalence, purpose, and patient care.

    Science.gov (United States)

    Shah, Dhruvil R; Galante, Joseph M; Bold, Richard J; Canter, Robert J; Martinez, Steve R

    2013-01-01

    There is little information about the use of text messaging (texting) devices among resident and faculty physicians for patient-related care (PRC). To determine the prevalence, frequency, purpose, and concerns regarding texting among resident and attending surgeons and to identify factors associated with PRC texting. E-mail survey. University medical center and its affiliated hospitals. Surgery resident and attending staff. Prevalence, frequency, purpose, and concerns regarding patient-related care text messaging. Overall, 73 (65%) surveyed physicians responded, including 45 resident (66%) and 28 attending surgeons (62%). All respondents owned a texting device. Majority of surgery residents (88%) and attendings (71%) texted residents, whereas only 59% of residents and 65% of attendings texted other faculty. Most resident to resident text occurred at a frequency of 3-5 times/d (43%) compared with most attending to resident texts, which occurred 1-2 times/d (33%). Most resident to attending (25%) and attending to attending (30%) texts occurred 1-2 times/d. Among those that texted, PRC was the most frequently reported purpose for resident to resident (46%), resident to attending (64%), attending to resident (82%), and attending to other attending staff (60%) texting. Texting was the most preferred method to communicate about routine PRC (47% of residents vs 44% of attendings). Age (OR: 0.86, 95% CI: 0.79-0.95; p = 0.003), but not sex, specialty/clinical rotation, academic rank, or postgraduate year (PGY) level predicted PRC texting. Most resident and attending staff surveyed utilize texting, mostly for PRC. Texting was preferred for communicating routine PRC information. Our data may facilitate the development of guidelines for the appropriate use of PRC texting. Copyright © 2013 Association of Program Directors in Surgery. Published by Elsevier Inc. All rights reserved.

  19. Longitudinal Outcomes of an Institutionally Developed Nurse Residency Program.

    Science.gov (United States)

    Cline, Debbie; La Frentz, Kelly; Fellman, Bryan; Summers, Barbara; Brassil, Kelly

    Nurse residency programs are widely implemented to enhance integration of new graduate nurses entering the workforce. This article presents a retrospective analysis of 10 years of residency data from an internally developed residency program that used the Casey-Fink Graduate Nurse Experience Survey. Outcomes of this program were similar to those from studies using commercially available products, suggesting that an internally developed residency curricula may be equally beneficial to the development of new graduate nurses.

  20. Pediatric Oncology Branch - training- resident electives | Center for Cancer Research

    Science.gov (United States)

    Resident Electives Select pediatric residents may be approved for a 4-week elective rotation at the Pediatric Oncology Branch. This rotation emphasizes the important connection between research and patient care in pediatric oncology. The resident is supervised directly by the Branch’s attending physician and clinical fellows. Residents attend daily in-patient and out-patient rounds, multiple weekly Branch conferences, and are expected to research relevant topics and present a 30-minute talk toward the end of their rotation.