DACE - A Matlab Kriging Toolbox
DEFF Research Database (Denmark)
2002-01-01
DACE, Design and Analysis of Computer Experiments, is a Matlab toolbox for working with kriging approximations to computer models.......DACE, Design and Analysis of Computer Experiments, is a Matlab toolbox for working with kriging approximations to computer models....
Turek, Kelly C.; Pegg, Mark A.; Pope, Kevin L.
2014-01-01
Laboratory and in-stream enclosure experiments were used to determine whether rainbow trout Oncorhynchus mykiss influence survival of longnose dace Rhinichthys cataractae. In the laboratory, adult rainbow trout preyed on longnose dace in 42% of trials and juvenile rainbow trout did not prey on longnose dace during the first 6 h after rainbow trout introduction. Survival of longnose dace did not differ in the presence of adult rainbow trout previously exposed to active prey and those not previously exposed to active prey ( = 0.28, P = 0.60). In field enclosures, the number of longnose dace decreased at a faster rate in the presence of rainbow trout relative to controls within the first 72 h, but did not differ between moderate and high densities of rainbow trout (F2,258.9 = 3.73, P = 0.03). Additionally, longnose dace were found in 7% of rainbow trout stomachs after 72 h in enclosures. Rainbow trout acclimated to the stream for longer periods had a greater initial influence on the number of longnose dace remaining in enclosures relative to those acclimated for shorter periods regardless of rainbow trout density treatment (F4,148.5 = 2.50, P = 0.04). More research is needed to determine how predation rates will change in natural environments, under differing amounts of habitat and food resources and in the context of whole assemblages. However, if rainbow trout are introduced into the habitat of longnose dace, some predation on longnose dace is expected, even when rainbow trout have no previous experience with active prey.
Perry, Russell W.; Jones, Edward; Scoppettone, G. Gary
2015-07-14
The primary goal of this research project was to evaluate the response of Moapa dace (Moapa coriacea) to the potential effects of changes in the amount of available habitat due to human influences such as ground water pumping, barriers to movement, and extirpation of Moapa dace from the mainstem Muddy River. To understand how these factors affect Moapa dace populations and to provide a tool to guide recovery actions, we developed a stochastic model to simulate Moapa dace population dynamics. Specifically, we developed an individual based model (IBM) to incorporate the critical components that drive Moapa dace population dynamics. Our model is composed of several interlinked submodels that describe changes in Moapa dace habitat as translated into carrying capacity, the influence of carrying capacity on demographic rates of dace, and the consequent effect on equilibrium population sizes. The model is spatially explicit and represents the stream network as eight discrete stream segments. The model operates at a monthly time step to incorporate seasonally varying reproduction. Growth rates of individuals vary among stream segments, with growth rates increasing along a headwater to mainstem gradient. Movement and survival of individuals are driven by density-dependent relationships that are influenced by the carrying capacity of each stream segment.
Turbidity affects foraging success of drift-feeding rosyide dace
Richard M. Zamor; Gary D. Grossman
2007-01-01
The effects of suspended sediment on nongame fishes are not well understood. We examined the effects of suspended sediment (i.e., turbidity) on reactive distance and prey capture success at springautumn (12°C) and summer (18°C) temperatures for royside dace Clinostomus funduloides in an artificial stream. Experimental turbidities ranged from 0 to 56...
DEFF Research Database (Denmark)
Gerds, Thomas Alexander
2016-01-01
Survival probabilities are not straightforward toobtain when observation periods of individuals differ in length. The Kaplan–Meier theatre is a classroom activity, which starts by a data collection exercise where students imagine sailing on the Titanic. Several students ‘fall in the water’ where....... The Kaplan–Meier method assumes that censored individuals have the same survival chances as the individuals who are still observed. During the Kaplan–Meier theatre, students perform a clever algorithm (Efron 1967), which translates the assumption into action and results in the Kaplan–Meier estimate...
Gary D. Grossman; Gary Sundin; Robert E. Ratajczak
2016-01-01
SummaryWe used long-term population data for rosyside dace (Clinostomus funduloides), a numerically dominant member of a stochastically organised fish assemblage, to evaluate the relative importance of density-dependent and density-independent processes to population...
Nowosad, Joanna; Targońska, Katarzyna; Chwaluczyk, Rafał; Kaszubowski, Rafał; Kucharczyk, Dariusz
2014-10-01
This study sought to determine the effect of water temperature on the effectiveness of artificial reproduction of dace brooders under laboratory and field conditions. Three temperatures were tested in the laboratory: 9.5, 12 and 14.5 °C (± 0.1 °C). The water temperature under field conditions was 11.0 ± 0.3 °C (Czarci Jar Fish Farm) and 13.2 ± 1.4 °C (Janowo Fish Farm). The study showed that artificial reproduction of dace is possible in all the temperature ranges under study and an embryo survival rate of over 87% can be achieved. Dace has also been found to be very sensitive to rapid temperature changes, even within the temperature ranges optimal for the species. Such changes have an adverse effect on the outcome of the reproduction process, such as a decrease in the percentage of reproducing females, a decrease in the pseudo-gonado-somatic index (PGSI) and a decrease in the embryo survival rate. Copyright © 2014 Elsevier Ltd. All rights reserved.
Peter D. Hazelton; Gary D. Grossman
2009-01-01
Habitat degradation and biological invasions are important threats to fish diversity worldwide. We experimentally examined the effects of turbidity, velocity and intra- and interspecific competition on prey capture location, reactive distance and prey capture success of native rosyside dace (Clinostomus funduloides) and invasive yellowfin shiners (Notropis lutipinnis)...
About an adaptively weighted Kaplan-Meier estimate.
Plante, Jean-François
2009-09-01
The minimum averaged mean squared error nonparametric adaptive weights use data from m possibly different populations to infer about one population of interest. The definition of these weights is based on the properties of the empirical distribution function. We use the Kaplan-Meier estimate to let the weights accommodate right-censored data and use them to define the weighted Kaplan-Meier estimate. The proposed estimate is smoother than the usual Kaplan-Meier estimate and converges uniformly in probability to the target distribution. Simulations show that the performances of the weighted Kaplan-Meier estimate on finite samples exceed that of the usual Kaplan-Meier estimate. A case study is also presented.
Munnik, S.A. de; Hoefsloot, E.H.; Roukema, J.; Schoots, J.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, E.M.H.F.
2015-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females
Directory of Open Access Journals (Sweden)
Joyce S. Evans
2012-01-01
Full Text Available We sampled an abundant, native minnow (Longnose dace—Rhinichthys cataractae throughout the Oldman River, Alberta, to determine physiological responses and possible population level consequences from exposure to compounds with hormone-like activity. Sex ratios varied between sites, were female-biased, and ranged from just over 50% to almost 90%. Histological examination of gonads revealed that at the sites with >60% females in the adult population, there was up to 38% occurrence of intersex gonads in fish identified through visual examination of the gonads as male. In the majority of intersex gonad cases, there was a large proportion (approx., 50% of oocytes within the testicular tissue. In male dace, vitellogenin mRNA expression generally increased with distance downstream. We analyzed river water for 28 endocrine disrupting compounds from eight functional classes, most with confirmed estrogen-like activity, including synthetic estrogens and hormone therapy drugs characteristic of municipal wastewater effluent, plus natural hormones and veterinary pharmaceuticals characteristic of livestock production. The spatial correlation between detected chemical residues and effects to dace physiology indicate that multiple land uses have a cumulative impact on dace in the Oldman River and effects range from altered gene regulation to severely female-biased sex ratios.
Koizumi, Noriyuki; Quinn, Thomas W.; Park, Myeongsoo; Fike, Jennifer A.; Nishida, Kazuya; Takemura, Takeshi; Watabe, Keiji; Mori, Atsushi
2011-01-01
Twenty one polymorphic microsatellite loci for the Japanese dace (Tribolodon hakonensis) were isolated and characterized. The number of observed alleles per locus in 32 individuals ranged from 3 to 30. The observed and expected heterozygosities ranged from 0.125 to 0.969 and from 0.175 to 0.973, respectively. All loci conformed to Hardy–Weinberg equilibrium, no linkage disequilibrium was observed between pairs of loci and no loci showed evidence of null alleles. These microsatellite loci will be useful for investigating the intraspecific genetic variation and population structure of this species.
Andrew Kinziger; Rodney Nakamoto; Eric Anderson; Bret Harvey
2011-01-01
Molecular evaluations of successful invaders are common, however studies of introduced species that have had limited invasion success, or have died out completely, are rare. We studied an introduced population of speckled dace (Rhinichthys osculus) from northern California, USA that has rapidly increased in abundance but remained restricted to a 25-km stretch of river...
de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F
2015-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia...
Gerds, Thomas A.
2016-01-01
Survival is difficult to estimate when observation periods of individuals differ in length. Students imagine sailing the Titanic and then recording whether they "live" or "die." A clever algorithm is performed which results in the Kaplan-Meier estimate of survival.
Genetics Home Reference: Meier-Gorlin syndrome
... Additional NIH Resources (1 link) National Institute of Neurological Disorders and Stroke: Microcephaly Information Page Educational Resources (10 links) Boston Children's Hospital: Growth Problems Disease InfoSearch: Meier-Gorlin syndrome ...
Meier-Gorlin syndrome Clinical genetics and genomics
S. de Munnik (Sonja); E.H. Hoefsloot (Lies); J. Roukema (Jolt); J. Schoots (Jeroen); N.V.A.M. Knoers (Nine); H.G. Brunner; A.P. Jackson (Andrew); E. Bongers (Ernie)
2015-01-01
textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia
Meier-Gorlin syndrome Clinical genetics and genomics
De Munnik, Sonja A.; Hoefsloot, Elisabeth H.; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine Vam; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie Mhf
2015-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females
The Kaplan-Meier Integral in the Presence of Covariates
DEFF Research Database (Denmark)
Gerds, Thomas A.; Beyersmann, Jan; Starkopf, Liis
2017-01-01
In a series of papers, Winfried Stute introduced and studied the Kaplan-Meier integral as an estimator of parameters of the joint distribution of survival times and covariates based on right censored survival times. We present a review of this work and show that his estimator has an inverse...... probability of censoring weighting (IPCW) representation. We further investigate large sample bias and efficiency. As a central application in a biostatistical context, Kaplan-Meier integrals are used to estimate transition probabilities in a non-Markov illness-death model. We extend already existing...
Meier-Gorlin syndrome Clinical genetics and genomics
Munnik, Sonja; Hoefsloot, Lies; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine; Brunner, H.G.; Jackson, Andrew; Bongers, Ernie
2015-01-01
textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-...
van Walraven, Carl; McAlister, Finlay A
2016-01-01
Risk estimates from Kaplan-Meier curves are well known to medical researchers, reviewers, and editors. In this study, we determined the proportion of Kaplan-Meier analyses published in prominent medical journals that are potentially biased because of competing events ("competing risk bias"). We randomly selected 100 studies that had at least one Kaplan-Meier analysis and were recently published in prominent medical journals. Susceptibility to competing risk bias was determined by examining the outcome and potential competing events. In susceptible studies, bias was quantified using a previously validated prediction model when the number of outcomes and competing events were given. Forty-six studies (46%) contained Kaplan-Meier analyses susceptible to competing risk bias. Sixteen studies (34.8%) susceptible to competing risk cited the number of outcomes and competing events; in six of these studies (6/16, 37.5%), the outcome risk from the Kaplan-Meier estimate (relative to the true risk) was biased upward by 10% or more. Almost half of Kaplan-Meier analyses published in medical journals are susceptible to competing risk bias and may overestimate event risk. This bias was found to be quantitatively important in a third of such studies. Copyright © 2016 Elsevier Inc. All rights reserved.
Kaplan-Meier Survival Analysis Overestimates the Risk of Revision Arthroplasty: A Meta-analysis.
Lacny, Sarah; Wilson, Todd; Clement, Fiona; Roberts, Derek J; Faris, Peter D; Ghali, William A; Marshall, Deborah A
2015-11-01
Although Kaplan-Meier survival analysis is commonly used to estimate the cumulative incidence of revision after joint arthroplasty, it theoretically overestimates the risk of revision in the presence of competing risks (such as death). Because the magnitude of overestimation is not well documented, the potential associated impact on clinical and policy decision-making remains unknown. We performed a meta-analysis to answer the following questions: (1) To what extent does the Kaplan-Meier method overestimate the cumulative incidence of revision after joint replacement compared with alternative competing-risks methods? (2) Is the extent of overestimation influenced by followup time or rate of competing risks? We searched Ovid MEDLINE, EMBASE, BIOSIS Previews, and Web of Science (1946, 1980, 1980, and 1899, respectively, to October 26, 2013) and included article bibliographies for studies comparing estimated cumulative incidence of revision after hip or knee arthroplasty obtained using both Kaplan-Meier and competing-risks methods. We excluded conference abstracts, unpublished studies, or studies using simulated data sets. Two reviewers independently extracted data and evaluated the quality of reporting of the included studies. Among 1160 abstracts identified, six studies were included in our meta-analysis. The principal reason for the steep attrition (1160 to six) was that the initial search was for studies in any clinical area that compared the cumulative incidence estimated using the Kaplan-Meier versus competing-risks methods for any event (not just the cumulative incidence of hip or knee revision); we did this to minimize the likelihood of missing any relevant studies. We calculated risk ratios (RRs) comparing the cumulative incidence estimated using the Kaplan-Meier method with the competing-risks method for each study and used DerSimonian and Laird random effects models to pool these RRs. Heterogeneity was explored using stratified meta-analyses and
Modified Weighted Kaplan-Meier Estimator
Directory of Open Access Journals (Sweden)
Mohammad Shafiq
2007-01-01
Full Text Available In many medical studies majority of the study subjects do not reach to the event of interest during the study period. In such situations survival probabilities can be estimated for censored observation by Kaplan Meier estimator. However in case of heavy censoring these estimates are biased and over estimate the survival probabilities. For heavy censoring a new method was proposed (Bahrawar Jan, 2005 to estimate the survival probabilities by weighting the censored observations by non-censoring rate. But the main defect in this weighted method is that it gives zero weight to the last censored observation. To over come this difficulty a new weight is proposed which also gives a non-zero weight to the last censored observation.
Understanding survival analysis: Kaplan-Meier estimate.
Goel, Manish Kumar; Khanna, Pardeep; Kishore, Jugal
2010-10-01
Kaplan-Meier estimate is one of the best options to be used to measure the fraction of subjects living for a certain amount of time after treatment. In clinical trials or community trials, the effect of an intervention is assessed by measuring the number of subjects survived or saved after that intervention over a period of time. The time starting from a defined point to the occurrence of a given event, for example death is called as survival time and the analysis of group data as survival analysis. This can be affected by subjects under study that are uncooperative and refused to be remained in the study or when some of the subjects may not experience the event or death before the end of the study, although they would have experienced or died if observation continued, or we lose touch with them midway in the study. We label these situations as censored observations. The Kaplan-Meier estimate is the simplest way of computing the survival over time in spite of all these difficulties associated with subjects or situations. The survival curve can be created assuming various situations. It involves computing of probabilities of occurrence of event at a certain point of time and multiplying these successive probabilities by any earlier computed probabilities to get the final estimate. This can be calculated for two groups of subjects and also their statistical difference in the survivals. This can be used in Ayurveda research when they are comparing two drugs and looking for survival of subjects.
The analysis of competing events like cause-specific mortality--beware of the Kaplan-Meier method
Verduijn, Marion; Grootendorst, Diana C.; Dekker, Friedo W.; Jager, Kitty J.; le Cessie, Saskia
2011-01-01
Kaplan-Meier analysis is a popular method used for analysing time-to-event data. In case of competing event analyses such as that of cardiovascular and non-cardiovascular mortality, however, the Kaplan-Meier method profoundly overestimates the cumulative mortality probabilities for each of the
Case Report: Meier-Gorlin syndrome: Report of an additional patient ...
African Journals Online (AJOL)
We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS), (microtia, absent patella and short stature). She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level.
Lacny, Sarah; Wilson, Todd; Clement, Fiona; Roberts, Derek J; Faris, Peter; Ghali, William A; Marshall, Deborah A
2018-01-01
Kaplan-Meier survival analysis overestimates cumulative incidence in competing risks (CRs) settings. The extent of overestimation (or its clinical significance) has been questioned, and CRs methods are infrequently used. This meta-analysis compares the Kaplan-Meier method to the cumulative incidence function (CIF), a CRs method. We searched MEDLINE, EMBASE, BIOSIS Previews, Web of Science (1992-2016), and article bibliographies for studies estimating cumulative incidence using the Kaplan-Meier method and CIF. For studies with sufficient data, we calculated pooled risk ratios (RRs) comparing Kaplan-Meier and CIF estimates using DerSimonian and Laird random effects models. We performed stratified meta-analyses by clinical area, rate of CRs (CRs/events of interest), and follow-up time. Of 2,192 identified abstracts, we included 77 studies in the systematic review and meta-analyzed 55. The pooled RR demonstrated the Kaplan-Meier estimate was 1.41 [95% confidence interval (CI): 1.36, 1.47] times higher than the CIF. Overestimation was highest among studies with high rates of CRs [RR = 2.36 (95% CI: 1.79, 3.12)], studies related to hepatology [RR = 2.60 (95% CI: 2.12, 3.19)], and obstetrics and gynecology [RR = 1.84 (95% CI: 1.52, 2.23)]. The Kaplan-Meier method overestimated the cumulative incidence across 10 clinical areas. Using CRs methods will ensure accurate results inform clinical and policy decisions. Copyright © 2017 Elsevier Inc. All rights reserved.
de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F
2015-09-17
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia. During ageing, a narrow, convex nose becomes more prominent. The diagnosis MGS should be considered in patients with at least two of the three features of the clinical triad of microtia, patellar anomalies, and pre- and postnatal growth retardation. In patients with short stature and/or microtia, the patellae should be assessed with care by ultrasonography before age 6 or radiography thereafter. Mutations in one of five genes (ORC1, ORC4, ORC6, CDT1, and CDC6) of the pre-replication complex, involved in DNA-replication, are detected in approximately 67-78% of patients with MGS. Patients with ORC1 and ORC4 mutations appear to have the most severe short stature and microcephaly. Management should be directed towards in-depth investigation, treatment and prevention of associated problems, such as growth retardation, feeding problems, hearing loss, luxating patellae, knee pain, gonarthrosis, and possible pulmonary complications due to congenital pulmonary emphysema with or without broncho- or laryngomalacia. Growth hormone treatment is ineffective in most patients with MGS, but may be effective in patients in whom growth continues to decrease after the first year of life (usually growth velocity normalizes after the first year) and with low levels of IGF1. At present, few data is available about reproduction of females with MGS, but the risk of premature labor might be increased. Here, we propose experience-based guidelines for the regular care and treatment of MGS patients.
Prita Meier, Swahili Port Cities: The Architecture of Elsewhere
Longair, Sarah
2018-01-01
Prita Meier’s Swahili Port Cities: the Architecture of Elsewhere is a highly original and important contribution to scholarship on East Africa, and more widely for scholars interested in complicating how we understand the formation of global cities and border zone societies. It is not a conventional architectural history, yet it places buildings, in particular the coral and lime stone constructions found on the Swahili coast, at its heart. Meier uses the “materiality of city life” to offer “a...
Hitt, Nathaniel P.; Floyd, Michael; Compton, Michael; McDonald, Kenneth
2016-01-01
Chrosomus cumberlandensis (Blackside Dace [BSD]) and Etheostoma spilotum (Kentucky Arrow Darter [KAD]) are fish species of conservation concern due to their fragmented distributions, their low population sizes, and threats from anthropogenic stressors in the southeastern United States. We evaluated the relationship between fish abundance and stream conductivity, an index of environmental quality and potential physiological stressor. We modeled occurrence and abundance of KAD in the upper Kentucky River basin (208 samples) and BSD in the upper Cumberland River basin (294 samples) for sites sampled between 2003 and 2013. Segmented regression indicated a conductivity change-point for BSD abundance at 343 μS/cm (95% CI: 123–563 μS/cm) and for KAD abundance at 261 μS/cm (95% CI: 151–370 μS/cm). In both cases, abundances were negligible above estimated conductivity change-points. Post-hoc randomizations accounted for variance in estimated change points due to unequal sample sizes across the conductivity gradients. Boosted regression-tree analysis indicated stronger effects of conductivity than other natural and anthropogenic factors known to influence stream fishes. Boosted regression trees further indicated threshold responses of BSD and KAD occurrence to conductivity gradients in support of segmented regression results. We suggest that the observed conductivity relationship may indicate energetic limitations for insectivorous fishes due to changes in benthic macroinvertebrate community composition.
de Munnik, Sonja A.; Otten, Barto J.; Schoots, Jeroen; Bicknell, Louise S.; Aftimos, Salim; Al-Aama, Jumana Y.; van Bever, Yolande; Bober, Michael B.; Borm, George F.; Clayton-Smith, Jill; Deal, Cheri L.; Edrees, Alaa Y.; Feingold, Murray; Fryer, Alan; van Hagen, Johanna M.; Hennekam, Raoul C.; Jansweijer, Maaike C. E.; Johnson, Diana; Kant, Sarina G.; Opitz, John M.; Ramadevi, A. Radha; Reardon, Willie; Ross, Alison; Sarda, Pierre; Schrander-Stumpel, Constance T. R. M.; Sluiter, A. Erik; Temple, I. Karen; Terhal, Paulien A.; Toutain, Annick; Wise, Carol A.; Wright, Michael; Skidmore, David L.; Samuels, Mark E.; Hoefsloot, Lies H.; Knoers, Nine V. A. M.; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie M. H. F.
2012-01-01
MeierGorlin syndrome (MGS) is a rare autosomal recessive disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recently, mutations in the ORC1, ORC4, ORC6, CDT1, and CDC6 genes, encoding components of the pre-replication complex, have been identified. This complex
de Munnik, S.A.; Otten, B.J.; Schoots, J.; Bicknell, L.S.; Aftimos, S.; Al-Aama, J.Y.; van Bever, Y.; Bober, M.B.; Borm, G.F.; Clayton-Smith, J.; Deal, C.L.; Edrees, A.Y.; Feingold, M.; Fryer, A.; van Hagen, J.M.; Hennekam, R.C.M.; Jansweijer, M.C.E.; Johnson, D.; Kant, S.G.; Opitz, J.M.; Ramadevi, A.R.; Reardon, W.; Ross, A.; Sarda, P.; Schrander-Stumpel, C.T.R.M.; Sluiter, A.E.; Temple, I.K.; Terhal, P.A.; Toutain, A.; Wise, C.A.; Wright, M.; Skidmore, D.L.; Samuels, M.E.; Hoefsloot, L.H.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, M.H.F.
2012-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recently, mutations in the ORC1, ORC4, ORC6, CDT1, and CDC6 genes, encoding components of the pre-replication complex, have been identified. This
International Nuclear Information System (INIS)
Ran, Zhang; Jun, He; Zeng-Hui, Peng; Li, Xuan
2009-01-01
This paper investigates the average dielectric permittivity (ε-bar ) in the Maier–Meier theory for calculating the dielectric anisotropy (Δε) of nematic liquid crystals. For the reason that ε-bar of nematics has the same expression as the dielectric permittivity of the isotropic state, the Onsager equation for isotropic dielectric was used to calculate it. The computed ε-bar shows reasonable agreement with the results of the numerical methods used in the literature. Molecular parameters, such as the polarizability and its anisotropy, the dipole moment and its angle with the molecular long axis, were taken from semi-empirical quantum chemistry (MOCPAC/AM1) modeling. The calculated values of Δε according to the Maier–Meier equation are in good agreement with the experimental results for the investigated compounds having different core structures and polar substituents. (condensed matter: structure, thermal and mechanical properties)
Meier-Gorlin syndrome: Report of an additional patient with congenital heart disease
Directory of Open Access Journals (Sweden)
Rabah M. Shawky
2014-10-01
Full Text Available We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS, (microtia, absent patella and short stature. She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level. She suffered from recurrent chest infection during the first year of life which improved gradually with age. Although congenital heart is rarely observed in MGS, our patient had in addition fenestrated interatrial septal defect.
Tipton, Michelle L; Gignoux-Wolfsohn, Sarah; Stonebraker, Phoebe; Chernoff, Barry
2011-11-01
During the last ice age, much of North America far south as 40°N was covered by glaciers (Hewitt 2000). About 20,000 years ago, as the glaciers retreated, the hydrologic landscape changed dramatically creating waterways for fish dispersal. The number of populations responsible for recolonization and the regions from which they recolonized are unknown for many freshwater fishes living in New England and southeastern Canada. The Blacknose Dace,Rhinichthys atratulus, is one of the freshwater fish species that recolonized this region. We hypothesize that the earliest deglaciated region, modern-day Connecticut, was recolonized byR. atratulusvia a single founding event by a single population. In this paper, we test this hypothesis phylogenetically with regard to the major drainage basins within Connecticut. The mitochondrial DNA exhibits low nucleotide diversity, high haplotype diversity, and a dominant haplotype found across the state. A small percentage of individuals in the Housatonic drainage basin, however, share a haplotype with populations in New York drainage basins, a haplotype not found elsewhere in Connecticut's drainage basins. We calculated a range for the rate of divergence for NADH dehydrogenase subunit 2 (nd2) and control region (ctr) of 4.43-6.76% and 3.84-8.48% per million years (my), respectively. While this range is higher than the commonly accepted rate of 2% for mitochondrial DNA, these results join a growing list of publications finding high rates of divergence for various taxa (Peterson and Masel 2009). The data support the conclusion that Connecticut as a whole was recolonized initially by a single founding event that came from a single refugium. Subsequently, the Housatonic basin alone experienced a secondary recolonization event.
TÜ, TPÜ ja EHI uusi magistreid / Eda Tursk, Hille Roots, Heidi Meier
Tursk, Eda
2004-01-01
Tartu ülikooli eesti ja soome-ugri keeleteaduse osakonnas ning kirjanduse ja rahvaluule osakonnas kaitsesid 2003.a. magistritööd Niina Aasmäe, Piret Voll, Larissa Degel, Reet Hendrikson, Tiina Pai, Petar Kehayov, Anna Baidullina, Katrin Ennus, Kristi Jõesaar, Ell Vahtramäe, Lauri Sommer, Andreas Kalkun, Mirjam Hinrikus, Kristel Nõlvak. Tallinna Pedagoogikaülikoolis kaitsesid 2003.a. magistritööd Sirje Nootre, Merike Mägedi, Tiiu Koovit, Heidi Meier, Jaanika Stackhouse, Lilian Ossi, Annika Vamper, Marika Mikkor, Piret Õunapuu, Helin Puksand, Taimi Rosenberg. Eesti Humanitaarinstituudis kaitses 2003.a. magistritööd Merilin Miljan
2012-12-26
...] Endangered and Threatened Wildlife and Plants; Draft Revised Recovery Plan for Kendall Warm Springs Dace... revised recovery plan for the Kendall Warm Springs dace (Rhinichthys osculus thermalis). This species is... recovery plan. The Kendall Warm Springs dace (Rhinichthys osculus thermalis), found only in one location in...
J. Szymszal; A. Gierek; J. Kliś
2010-01-01
The article evaluates the reliability of AlSi17CuNiMg alloys using Kaplan-Meier-based technique, very popular as a survival estimation tool in medical science. The main object of survival analysis is a group (or groups) of units for which the time of occurrence of an event (failure) taking place after some time of waiting is estimated. For example, in medicine, the failure can be patient’s death. In this study, the failure was the specimen fracture during a periodical fatigue test, while the ...
Gross, Arnd; Ziepert, Marita; Scholz, Markus
2012-01-01
Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups.
Directory of Open Access Journals (Sweden)
Arnd Gross
Full Text Available BACKGROUND: Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav, SAS export (xpt or text file (dat, which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. RESULTS: On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. CONCLUSIONS: We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups.
1980-12-22
purple- spined hedgehog cactus (Echinocereus engelmanii var. purpureus), the Siler pin- cushion cactus (Pediocactus sileri), and the dwarf bear poppy...WHITE RIVER SPINE DACE K WHITE RIVER DESERT SUCKER L WHITE RIVER SPRINGFISH M PAHRANAGAT ROUNDTAIL CHUB* N PAHRUMP KILLIFISH" O MOAPA DACE* P LAHONTAN
Evaluation of protected, threatened, and endangered fish species in Upper Bear Creek watershed
International Nuclear Information System (INIS)
Ryon, M.G.
1998-07-01
The East Bear Creek Site for the proposed centralized waste facility on the US Department of Energy's Oak Ridge Reservation was evaluated for potential rare, threatened or endangered (T and E) fish species in the six primary tributaries and the main stem of Bear Creek that are within or adjacent to the facility footprint. These tributaries and portion of Bear Creek comprise the upper Bear Creek watershed. One T and E fish species, the Tennessee dace (Phoxinus tennesseensis), was located in these streams. The Tennessee dace is listed by the State of Tennessee as being in need of management, and as such its habitat is afforded some protection. Surveys indicated that Tennessee dace occupy the northern tributaries NT-1, NT-4, and NT-5, as well as Bear Creek. Several specimens of the dace were gravid females, indicating that the streams may function as reproductive habitat for the species. The implications of impacts on the species are discussed and mitigation objectives are included
Gross, Arnd; Ziepert, Marita; Scholz, Markus
2012-01-01
Background Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. Results On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. Conclusions We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups. PMID:22723912
International Nuclear Information System (INIS)
Grybaeck, P.; Naeslund, E.; Hellstroem, P.M.; Jacobsson, H.; Backman, L.
1996-01-01
It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs
Energy Technology Data Exchange (ETDEWEB)
Grybaeck, P. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden); Naeslund, E. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden); Hellstroem, P.M. [Department of Internal Medicine, Karolinska Hospital, Stockholm (Sweden); Jacobsson, H. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden)]|[Department of Nuclear Medicine, Karolinska Hospital, Stockholm (Sweden); Backman, L. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden)
1996-12-01
It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs.
International Nuclear Information System (INIS)
Mould, Richard F.
1995-01-01
Purpose/Objective: To explain some of the most useful statistical calculation procedures which are relevant to radiation oncologists and to provide insights on what tests and procedures should be used in various situations such as when survival rates and their associated standard errors have to be determined. To describe some of the problems and pitfalls in clinical trial designs which have to be overcome if a trial is to have the possibility of reaching a successful conclusion. To review methods of computing criteria to quantitatively describe criteria of success (eg. quality of life, long-term survival, cure) of radiation oncology and to suggest possible future statistical improvements in this area. Chi-Squared Test: The chi-squared test is probably the most useful of the tests of statistical significance for the radiation oncologist. Applications will be described, including goodness of fit tests and 2x2 contingency tables which are the simplest of the generalized nxm contingency tables. Degrees of Freedom and P<0.05 for Significance Testing: An Introduction will be given to the meaning of P<0.05 in relation to significance testing and the use of tables of critical values of a test statistic (eg. chi-squared) which are given as a function of degrees of freedom and P-values. Survival Rate Calculations for Grouped and Ungrouped Data: The life-table method (sometimes termed the actuarial method) will be explained for both grouped data (eg. survival times grouped in annual intervals for patients who have died and for those who are still alive or lost to follow-up) and for ungrouped data (when individual survival times are used). The method for ungrouped data is variously termed the Kaplan-Meier or Product Limit method. Logrank Test: This is the most useful test for comparison of the survival experience of two groups of patients and its use will be explained. In part the computation is similar to that for the Kaplan-Meier/Product Limit method
Energy Technology Data Exchange (ETDEWEB)
Mould, Richard F
1995-07-01
Purpose/Objective: To explain some of the most useful statistical calculation procedures which are relevant to radiation oncologists and to provide insights on what tests and procedures should be used in various situations such as when survival rates and their associated standard errors have to be determined. To describe some of the problems and pitfalls in clinical trial designs which have to be overcome if a trial is to have the possibility of reaching a successful conclusion. To review methods of computing criteria to quantitatively describe criteria of success (eg. quality of life, long-term survival, cure) of radiation oncology and to suggest possible future statistical improvements in this area. Chi-Squared Test: The chi-squared test is probably the most useful of the tests of statistical significance for the radiation oncologist. Applications will be described, including goodness of fit tests and 2x2 contingency tables which are the simplest of the generalized nxm contingency tables. Degrees of Freedom and P<0.05 for Significance Testing: An Introduction will be given to the meaning of P<0.05 in relation to significance testing and the use of tables of critical values of a test statistic (eg. chi-squared) which are given as a function of degrees of freedom and P-values. Survival Rate Calculations for Grouped and Ungrouped Data: The life-table method (sometimes termed the actuarial method) will be explained for both grouped data (eg. survival times grouped in annual intervals for patients who have died and for those who are still alive or lost to follow-up) and for ungrouped data (when individual survival times are used). The method for ungrouped data is variously termed the Kaplan-Meier or Product Limit method. Logrank Test: This is the most useful test for comparison of the survival experience of two groups of patients and its use will be explained. In part the computation is similar to that for the Kaplan-Meier/Product Limit method.
Directory of Open Access Journals (Sweden)
Giuseppe Bonaccorso
2014-06-01
Full Text Available Il contributo proposto ha l’obiettivo di analizzare alcuni significativi brani del tessuto urbano della periferia est di Roma, adottando metodi interpretativi legati alla storia, alla società, alla programmazione urbanistica e alla costruzione. Gli aspetti salienti del quadrante orientale della periferia romana verranno così delineati partendo “dal di dentro”, sottolineandone i percorsi, gli spazi e i nuclei compositivi che sono all’origine della struttura e della forma stessa dei quartieri disposti a cavallo del Grande Raccordo Anulare. In questo ambito, si pone l’attenzione su alcuni episodi chiave che vedono protagoniste le nuove chiese che riescono a creare una centralità all’interno dei quartieri periferici sostituendo le biblioteche, le piazze e i centri commerciali. Analizzando da vicino questi esempi, si scopre come di recente sono state realizzate chiese firmate da architetti di fama internazionale proprio allo scopo di rafforzare, o meglio di costruire, un fattore identitario per ciascun quartiere ubicato nel settore orientale della città. Partendo quindi dal generale si arriva a indagare una chiesa e un quartiere che possono essere considerati un modello da seguire per tutta la periferia a ridosso del GRA: la chiesa giubilare di Dio Padre Misericordioso progettata da Richard Meier nel quartiere di Tor Tre Teste. La sequenzialità degli eventi che hanno contraddistinto il concorso per la progettazione della chiesa, la scelta della proposta di Richard Meier, la complessità del cantiere, l’analisi tecnica, stilistica e simbolica della realizzazione finale sono quindi analizzate nell’ambito del rapporto con il quartiere e del tentativo di realizzare (attraverso di essa un centro di attrazione per tutta la periferia. The article analyses some significant parts of the urban tissue at the eastern periphery of Rome, using the interpretative methods inherent to history, society, urban programming and construction
The question about paleoinformatics
Vartic, Andrei
2006-12-01
The author is treating questions about development of informatics in ancient Dacia during Y-th Century B.C. - 2-nd Century A.C. He is introducing a new terminology (paleoinformatics) in view of defining the interests of Daces in numbering, the elementary numbers theory and various aspects of numbers representation. A relation between elementary numbers theory and informatisation has been discussed. A particular interest has been given to calculation of the Circle length/Diameter ratio (number Pi), its calculation by Daces.
Dave, Anushree
2017-12-01
This is a review of Patrick Meier's 2015 book, Digital Humanitarians: How Big Data Is Changing the Face of Humanitarian Response. The book explores the role of technologies such as high-resolution satellite imagery, online social media, drones, and artificial intelligence in humanitarian responses during disasters such as the 2010 Haiti earthquake. In this analysis, the book is examined using a humanitarian health ethics perspective.
Guyot, Patricia; Ades, A E; Ouwens, Mario J N M; Welton, Nicky J
2012-02-01
The results of Randomized Controlled Trials (RCTs) on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios) with statistics based on repeated reconstructions by multiple observers. The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.
Burrage, Lindsay C; Charng, Wu-Lin; Eldomery, Mohammad K; Willer, Jason R; Davis, Erica E; Lugtenberg, Dorien; Zhu, Wenmiao; Leduc, Magalie S; Akdemir, Zeynep C; Azamian, Mahshid; Zapata, Gladys; Hernandez, Patricia P; Schoots, Jeroen; de Munnik, Sonja A; Roepman, Ronald; Pearring, Jillian N; Jhangiani, Shalini; Katsanis, Nicholas; Vissers, Lisenka E L M; Brunner, Han G; Beaudet, Arthur L; Rosenfeld, Jill A; Muzny, Donna M; Gibbs, Richard A; Eng, Christine M; Xia, Fan; Lalani, Seema R; Lupski, James R; Bongers, Ernie M H F; Yang, Yaping
2015-12-03
Meier-Gorlin syndrome (MGS) is a genetically heterogeneous primordial dwarfism syndrome known to be caused by biallelic loss-of-function mutations in one of five genes encoding pre-replication complex proteins: ORC1, ORC4, ORC6, CDT1, and CDC6. Mutations in these genes cause disruption of the origin of DNA replication initiation. To date, only an autosomal-recessive inheritance pattern has been described in individuals with this disorder, with a molecular etiology established in about three-fourths of cases. Here, we report three subjects with MGS and de novo heterozygous mutations in the 5' end of GMNN, encoding the DNA replication inhibitor geminin. We identified two truncating mutations in exon 2 (the 1(st) coding exon), c.16A>T (p.Lys6(∗)) and c.35_38delTCAA (p.Ile12Lysfs(∗)4), and one missense mutation, c.50A>G (p.Lys17Arg), affecting the second-to-last nucleotide of exon 2 and possibly RNA splicing. Geminin is present during the S, G2, and M phases of the cell cycle and is degraded during the metaphase-anaphase transition by the anaphase-promoting complex (APC), which recognizes the destruction box sequence near the 5' end of the geminin protein. All three GMNN mutations identified alter sites 5' to residue Met28 of the protein, which is located within the destruction box. We present data supporting a gain-of-function mechanism, in which the GMNN mutations result in proteins lacking the destruction box and hence increased protein stability and prolonged inhibition of replication leading to autosomal-dominant MGS. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Guyot Patricia
2012-02-01
Full Text Available Abstract Background The results of Randomized Controlled Trials (RCTs on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. Methods We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios with statistics based on repeated reconstructions by multiple observers. Results The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. Conclusion The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.
Bicknell, Louise S; Walker, Sarah; Klingseisen, Anna; Stiff, Tom; Leitch, Andrea; Kerzendorfer, Claudia; Martin, Carol-Anne; Yeyati, Patricia; Al Sanna, Nouriya; Bober, Michael; Johnson, Diana; Wise, Carol; Jackson, Andrew P; O'Driscoll, Mark; Jeggo, Penny A
2011-02-27
Studies into disorders of extreme growth failure (for example, Seckel syndrome and Majewski osteodysplastic primordial dwarfism type II) have implicated fundamental cellular processes of DNA damage response signaling and centrosome function in the regulation of human growth. Here we report that mutations in ORC1, encoding a subunit of the origin recognition complex, cause microcephalic primordial dwarfism resembling Meier-Gorlin syndrome. We establish that these mutations disrupt known ORC1 functions including pre-replicative complex formation and origin activation. ORC1 deficiency perturbs S-phase entry and S-phase progression. Additionally, we show that Orc1 depletion in zebrafish is sufficient to markedly reduce body size during rapid embryonic growth. Our data suggest a model in which ORC1 mutations impair replication licensing, slowing cell cycle progression and consequently impeding growth during development, particularly at times of rapid proliferation. These findings establish a novel mechanism for the pathogenesis of microcephalic dwarfism and show a surprising but important developmental impact of impaired origin licensing.
Dual Axis Controller for Extreme Environments, Phase II
National Aeronautics and Space Administration — The Dual Axis Controller for Extreme Environments (DACEE) addresses a critical need of NASA's future exploration plans to investigate extreme environments within our...
Uno, Hajime; Tian, Lu; Claggett, Brian; Wei, L J
2015-12-10
With censored event time observations, the logrank test is the most popular tool for testing the equality of two underlying survival distributions. Although this test is asymptotically distribution free, it may not be powerful when the proportional hazards assumption is violated. Various other novel testing procedures have been proposed, which generally are derived by assuming a class of specific alternative hypotheses with respect to the hazard functions. The test considered by Pepe and Fleming (1989) is based on a linear combination of weighted differences of the two Kaplan-Meier curves over time and is a natural tool to assess the difference of two survival functions directly. In this article, we take a similar approach but choose weights that are proportional to the observed standardized difference of the estimated survival curves at each time point. The new proposal automatically makes weighting adjustments empirically. The new test statistic is aimed at a one-sided general alternative hypothesis and is distributed with a short right tail under the null hypothesis but with a heavy tail under the alternative. The results from extensive numerical studies demonstrate that the new procedure performs well under various general alternatives with a caution of a minor inflation of the type I error rate when the sample size is small or the number of observed events is small. The survival data from a recent cancer comparative study are utilized for illustrating the implementation of the process. Copyright © 2015 John Wiley & Sons, Ltd.
Valmiera kunstnikud Viljandis / Guna Kalnaca
Kalnaca, Guna
1998-01-01
Valmiera kunsti päevadest Viljandis, kus osalevad 5 professionaalset kunstnikku Valmierast : Dace Bluma-portselan, Vineta Dzervite-graafika, Antra Galzons-maalid, Janis Galzons-maalid, Andris Varpa-skulptuurid. Kunstnike loomingu lühitutvustus.
Directory of Open Access Journals (Sweden)
Tom Stiff
Full Text Available Mutations in ORC1, ORC4, ORC6, CDT1, and CDC6, which encode proteins required for DNA replication origin licensing, cause Meier-Gorlin syndrome (MGS, a disorder conferring microcephaly, primordial dwarfism, underdeveloped ears, and skeletal abnormalities. Mutations in ATR, which also functions during replication, can cause Seckel syndrome, a clinically related disorder. These findings suggest that impaired DNA replication could underlie the developmental defects characteristic of these disorders. Here, we show that although origin licensing capacity is impaired in all patient cells with mutations in origin licensing component proteins, this does not correlate with the rate of progression through S phase. Thus, the replicative capacity in MGS patient cells does not correlate with clinical manifestation. However, ORC1-deficient cells from MGS patients and siRNA-mediated depletion of origin licensing proteins also have impaired centrosome and centriole copy number. As a novel and unexpected finding, we show that they also display a striking defect in the rate of formation of primary cilia. We demonstrate that this impacts sonic hedgehog signalling in ORC1-deficient primary fibroblasts. Additionally, reduced growth factor-dependent signaling via primary cilia affects the kinetics of cell cycle progression following cell cycle exit and re-entry, highlighting an unexpected mechanism whereby origin licensing components can influence cell cycle progression. Finally, using a cell-based model, we show that defects in cilia function impair chondroinduction. Our findings raise the possibility that a reduced efficiency in forming cilia could contribute to the clinical features of MGS, particularly the bone development abnormalities, and could provide a new dimension for considering developmental impacts of licensing deficiency.
78 FR 69374 - Endangered and Threatened Species; Take of Anadromous Fish
2013-11-19
... these species is captured dead or deemed nonviable, it would be retained for genetic analysis. The... Speckled Dace based on genetic and morphological data. The genetic sequence data would be used to better... salmonid populations. In addition, any new data regarding listed species presence would be used to inform...
Indigolapsed muudavad maailma / Moon Meier
Meier, Moon
2004-01-01
Kasvatusteadlased avastasid, et alates u 1980. a-st sündinud lapsed on hoopis teistsugused kui eelmised põlvkonnad. Senine haridussüsteem neile ei sobi, hariduses peaks rohkem pöörama tähelepanu emotsioonidele
An emergent multiple predator effect may enhance biotic resistance in a stream fish assemblage
Bret C. Harvey; Jason L. White; Rodney J. Nakamoto
2004-01-01
While two cyprinid fishes introduced from nearby drainages have become widespread and abundant in the Eel River of northwestern California, a third nonindigenous cyprinid has remained largely confined to <25 km of one major tributary (the Van Duzen River) for at least 15 years. The downstream limit of this species, speckled dace, does not appear to correspond...
Izumi, Mattashi; Yamamoto, Yasuyuki; Yataya, Kenichi; Kamiyama, Kohhei
Swimming experiments were conducted on wild fishes in a natural guidance system stamina tunnel (cylindrical pipe) installed in a fishway of a local river under high-velocity flow conditions (tunnel flow velocity : 211 to 279 cm·s-1). In this study, the swimming characteristics of fishes were observed. The results show that (1) the swimming speeds of Tribolodon hakonensis (Japanese dace), Phoxinus lagowshi steindachneri (Japanese fat-minnow), Plecoglossus altivelis (Ayu), and Zacco platypus (Pale chub) were in proportion to their body length under identical water flow velocity conditions; (2) the maximum burst speed of Japanese dace and Japanese fat-minnow (measuring 4 to 6 cm in length) was 262 to 319 cm·s-1 under high flow velocity conditions (225 to 230 cm·s-1), while the maximum burst speed of Ayu and Pale chub (measuring 5 cm to 12 cm in length) was 308 to 355 cm·s-1 under high flow velocity conditions (264 to 273 cm·s-1) ; (3) the 50cm-maximum swimming speed of swimming fishes was 1.07 times faster than the pipe-swimming speed; (4) the faster the flow velocity, the shorter the swimming distance became.
Geochemical pathways and biological uptake of radium in small Canadian Shield lakes
International Nuclear Information System (INIS)
Hesslein, R.H.; Slavicek, E.
1984-01-01
The sediment-water interactions and biological uptake of 226 Ra are described for four small Canadian Shield lakes at the Experimental Lakes Area, Kenora, Ontario. A single addition of 226 Ra was made to each lake between 1970 and 1976. Approximately 90 percent of the added 226 Ra initially sorbed to the sediments. Outflow from the lakes showed losses of only 5-11 percent 226 Ra per year. Models are proposed for adsorption and outflow of 226 Ra from lakes. Biological uptake and long-term 226 Ra concentrations were measured in three species of macrophytes, crayfish, and five species of fish. Bioaccumulation ranged from 1100 to 5000 in macrophytes, 705 in crayfish, from 30 to 80 in large trout (Salvelinus namaycush), white sucker (Catostomus commersoni), and lake whitefish (Coregonus clupeaformis), and from 230 to 1200 in fathead minnows (Pimephales promelas), pearl dace (Semotilus margarita), and northern redbelly dace (Chrosomus eos). The concept of Ra/Ca ratio in organisms versus water and food is used to explain the differences in bioaccumulation. 226 Ra is discriminated against versus calcium by fish but favoured by macrophytes and crayfish
Hereford, Mark E.
2016-07-22
The Amargosa River Canyon, located in the Mojave Desert of southeastern California, contains the longest perennial reach of the Amargosa River. Because of its diverse flora and fauna, it has been designated as an Area of Critical Environmental Concern and a Wild and Scenic River by the Bureau of Land Management. A survey of fishes conducted in summer 2010 indicated that endemic Amargosa River pupfish (Cyprinodon nevadensis amargosae) and speckled dace (Rhinichthys osculus spp.) were abundant and occurred throughout the Amargosa River Canyon. The 2010 survey reported non-native red swamp crayfish (Procambarus clarkii) and western mosquitofish (Gambusia affinis) captures were significantly higher, whereas pupfish captures were lower, in areas dominated by non-native saltcedar (Tamarix ssp.). Based on the 2010 survey, it was hypothesized that the invasion of saltcedar could result in a decrease in native species. In an effort to maintain and enhance native fish populations, the Bureau of Land Management removed saltcedar from a 1,550 meter reach of stream on the Amargosa River in autumn 2014 and autumn 2015. Prior to the removal of saltcedar, a survey of fishes and crayfish using baited minnow traps was conducted in the treatment reach to serve as a baseline for future comparisons with post-saltcedar removal surveys. During the 2014 survey, 1,073 pupfish and 960 speckled dace were captured within the treatment reach. Catch per unit effort of pupfish and speckled dace in the treatment reach was less in 2014 than in 2010, although differences could be owing to seasonal variation in capture probability. Non-native mosquitofish catch per unit effort decreased from 2010 to 2014; however, the catch per unit effort of crayfish increased from 2010 to 2014. Future monitoring efforts of this reach should be conducted at the same time period to account for potential seasonal fluctuations of abundance and distribution of fishes and crayfish. A more robust study design that
The BAH domain of ORC1 links H4K20me2 to DNA replication licensing and Meier-Gorlin syndrome
Energy Technology Data Exchange (ETDEWEB)
Kuo, Alex J; Song, Jikui; Cheung, Peggie; Ishibe-Murakami, Satoko; Yamazoe, Sayumi; Chen, James K; Patel, Dinshaw J; Gozani, Or [Stanford; (MSKCC); (Stanford-MED)
2012-07-11
The recognition of distinctly modified histones by specialized 'effector' proteins constitutes a key mechanism for transducing molecular events at chromatin to biological outcomes. Effector proteins influence DNA-templated processes, including transcription, DNA recombination and DNA repair; however, no effector functions have yet been identified within the mammalian machinery that regulate DNA replication. Here we show that ORC1 - a component of ORC (origin of replication complex), which mediates pre-DNA replication licensing - contains a bromo adjacent homology (BAH) domain that specifically recognizes histone H4 dimethylated at lysine 20 (H4K20me2). Recognition of H4K20me2 is a property common to BAH domains present within diverse metazoan ORC1 proteins. Structural studies reveal that the specificity of the BAH domain for H4K20me2 is mediated by a dynamic aromatic dimethyl-lysine-binding cage and multiple intermolecular contacts involving the bound peptide. H4K20me2 is enriched at replication origins, and abrogating ORC1 recognition of H4K20me2 in cells impairs ORC1 occupancy at replication origins, ORC chromatin loading and cell-cycle progression. Mutation of the ORC1 BAH domain has been implicated in the aetiology of Meier-Gorlin syndrome (MGS), a form of primordial dwarfism, and ORC1 depletion in zebrafish results in an MGS-like phenotype. We find that wild-type human ORC1, but not ORC1-H4K20me2-binding mutants, rescues the growth retardation of orc1 morphants. Moreover, zebrafish depleted of H4K20me2 have diminished body size, mirroring the phenotype of orc1 morphants. Together, our results identify the BAH domain as a novel methyl-lysine-binding module, thereby establishing the first direct link between histone methylation and the metazoan DNA replication machinery, and defining a pivotal aetiological role for the canonical H4K20me2 mark, via ORC1, in primordial dwarfism.
The Environmental Assessment and Management (TEAM) Guide: New Mexico Supplement
2010-03-01
dace, Phoxinus erythrogaster (j) Colorado pikeminnow, Ptychocheilus lucius (k) loach minnow, Tiaroga cobitis 5-13 Natural Resources Management...writing by the Department, off-site at a readily available location. ST.4.38.NM. Corrective actions must be ta ken u pon a release involving a...cause a public nuisance or threat to human health, safety and welfare, or the environment. Verify th at when c ontaminated s oil is ta ken o ff s ite
Applying Kaplan-Meier to Item Response Data
McNeish, Daniel
2018-01-01
Some IRT models can be equivalently modeled in alternative frameworks such as logistic regression. Logistic regression can also model time-to-event data, which concerns the probability of an event occurring over time. Using the relation between time-to-event models and logistic regression and the relation between logistic regression and IRT, this…
Lasteaiaõpetajate palk kerkis tibusammul / Jaanika Meier
Meier, Jaanika
2007-01-01
Aastaga on tõusnud pea kõigi Tartumaa lasteaiaõpetajate palk, kõige suurem on palgatõus olnud Kambja vallas, kus keskeriharidusega õpetajad saavad praegu palka minimaalselt 6600 ja kõrgharidusega õpetajad 7000 krooni kuus. Lisa: Lasteaiaõpetajate palk Tartumaal
Hakkaks maja värvima / Piret Meier
Meier, Piret, 1962-
2004-01-01
Ehitushoolde spetsialist Lea Täheväli-Stroh majade välimusest ja värvilahenduse valikutest. Lisaks Mirjam Peili kommentaar küsimusele, miks on Eestis saanud moeks värvida maamajad nn. Rootsi punaseks.
Dukowska, Małgorzata; Grzybkowska, Maria
2014-01-01
In the spring and summer of each year, large patches of submersed aquatic macrophytes overgrow the bottom of the alluvial Warta River downstream of a large dam reservoir owing to water management practices. Environmental variables, macroinvertebrates (zoobenthos and epiphytic fauna, zooplankton) and fish abundance and biomass were assessed at this biologically productive habitat to learn intraseasonal dynamics of food types, and their occurrence in the gut contents of small-sized roach, dace, perch, ruffe and three-spined stickleback. Gut fullness coefficient, niche breadth and niche overlap indicated how the fishes coexist in the macrophytes. Chironomidae dominated in the diet of the percids. However, ruffe consumed mostly benthic chironomids, while perch epiphytic chironomids and zooplankton. The diet of dace resembled that in fast flowing water although this rheophilic species occurred at unusual density there. The generalist roach displayed the lowest gut fullness coefficient values and widest niche breadth; consequently, intraspecific rather than interspecific competition decided the fate of roach. Three-spined stickleback differed from the other fishes by consuming epiphytic simuliids and fish eggs. The diet overlap between fishes reaching higher gut fullness coefficient values was rather low when the food associated with the submersed aquatic macrophytes was most abundant; this is congruent with the niche overlap hypothesis that maximal tolerable niche overlap can be higher in less intensely competitive conditions.
Vegetation and Grazing in the St. Katherine Protectorate, South ...
African Journals Online (AJOL)
5. Grazing pressure. 1. 2. 3. 4. 5. P lant health. Unk . La bita e. Le gu m ino s a e. Co m p o sita e. A m ara nthac ea e. B ora gin ace ae. C h en opo dia c e ae. E u ph orb iac ea e. S cro ph ula ria cea e. A sc lep id ac e ae. C a ry o phy lla cea e. R ese dace ae. C a pp arace ae. Cuc urb ita cea e. Cruc ife rae. Gram inae. U m be.
Kuidas Sander Saarmets kosmosest maailma vallutama kipub / Moon Meier
Meier, Moon
2007-01-01
Eesti Muusika- ja Teatriakadeemias elektronmuusika erialal õppivast Sander Saarmetsast kui noorest heliloojast, kes on siiani oma nime teinud ulmemuusika ringkondades. Kommenteerivad sõber, muusik, ulmeplaatide boss Aivar Tõnso ja Muschraumi kitarrist Kaur Garšnek
Meier-Gorlin syndrome: Report of an additional patient with ...
African Journals Online (AJOL)
Rabah M. Shawky
2014-05-16
May 16, 2014 ... which functions during replication can cause Seckel syndrome, a clinically related ... brain, and growth hormone provocation test were normal. Skeletal survey ... atrial defect with left–right shunt [17]. Also our patient suf-.
Lille mäele tuleb suveks Flauerpauer / Jaanika Meier
Meier, Jaanika
2008-01-01
Tartus Lille Maja hoovis avatakse suvekohvik Flauerpauer. Kohviku väliskujunduse autoriteks on Tartu kõrgema kunstikooli tudengid Tiit Joala ja Oliver Kuusmann, sisekujunduse autoriks Tallinna Ülikooli üliõpilane Kudrun Vunk. Selgitusi jagab Lille Maja direktor Hele Riit-Vällik
Noorteühenduste kogu tutvustab Euroopa Liitu / Jaanika Meier
Meier, Jaanika
2007-01-01
Tartu Noorteühenduste Kogu tutvustab projekti "Kodanikuna Euroopa Liidus. Eile. Täna. Homme" noortele Euroopa Liitu, selle toimemehhanisme, arengusuundi ja liidus noortele pakutavaid võimalusi. Lisa: Kas teate
Turek, Kelly C.; Pegg, Mark A.; Pope, Kevin L.; Schainost, Steve
2014-01-01
Non-native trout are currently stocked to support recreational fisheries in headwater streams throughout Nebraska. The influence of non-native trout introductions on native fish populations and their role in structuring fish assemblages in these systems is unknown. The objectives of this study were to determine (i) if the size structure or relative abundance of native fish differs in the presence and absence of non-native trout, (ii) if native fish-assemblage structure differs in the presence and absence of non-native trout and (iii) if native fish-assemblage structure differs across a gradient in abundances of non-native trout. Longnose dace Rhinichthys cataractae were larger in the presence of brown trout Salmo trutta and smaller in the presence of rainbow trout Oncorhynchus mykiss compared to sites without trout. There was also a greater proportion of larger white suckers Catostomus commersonii in the presence of brown trout. Creek chub Semotilus atromaculatus and fathead minnow Pimephales promelas size structures were similar in the presence and absence of trout. Relative abundances of longnose dace, white sucker, creek chub and fathead minnow were similar in the presence and absence of trout, but there was greater distinction in native fish-assemblage structure between sites with trout compared to sites without trout as trout abundances increased. These results suggest increased risk to native fish assemblages in sites with high abundances of trout. However, more research is needed to determine the role of non-native trout in structuring native fish assemblages in streams, and the mechanisms through which introduced trout may influence native fish populations.
Mees maalt ja merelt / Eerik Purje
Purje, Eerik, 1927-
2004-01-01
rets. rmt.: Meier, Martin Ottomar. Otto Meier, eestlane : Martin Ottomar Meier, kapten ja laevaomanik. Sündinud 10.11.1881 Heinastes. Surnud 1.08.1955 Pärnus : mälestused. Tallinn : SE&JS, 2004. 328 lk.
AKaplan-Meier estimators of distance distributions for spatial point processes
Baddeley, A.J.; Gill, R.D.
1997-01-01
When a spatial point process is observed through a bounded window, edge effects hamper the estimation of characteristics such as the empty space function $F$, the nearest neighbour distance distribution $G$, and the reduced second order moment function $K$. Here we propose and study product-limit
Pramana – Journal of Physics | Indian Academy of Sciences
Indian Academy of Sciences (India)
... for third-order aberration in the reconstructed wave front of point objects are established by Meier. But Smith, Neil Mohon, Sweatt independently reported that their results differ from that of Meier. We found that coefficients for spherical aberration, astigmatism, tally with Meier's while coefficients for distortion and coma differ.
Studies on water turbine runner which fish can pass through: In case of single stage axial runner
International Nuclear Information System (INIS)
Shimizu, Yukimari; Maeda, Takao; Nagoshi, Osamu; Ieda, Kazuma; Shinma, Hisako; Hagimoto, Michiko
1994-01-01
The relationship between water turbine runner design and operation and the safe passage of fish through the turbine is studied. The kinds of fish used in the tests are a dace, a sweet fish and a small salmon. A single stage axial runner is used. The velocity and pressure distributions were measured inside the turbine casing and along the casing wall. Many pictures showing fish passing through the rotating runner were taken and analyzed. The swimming speed of the fish was examined from video recordings. Fish pass through the runner more rapidly when they can determine and choose the easier path. Injury and mortality of fish are affected by the runner speed and the location of impact of the runner on the fish body
Meier–Gorlin syndrome: An additional Egyptian patient with ...
African Journals Online (AJOL)
Rabah M. Shawky
2016-01-23
Jan 23, 2016 ... 1. Introduction. The Meier–Gorlin syndrome (MGS) is a rare autosomal reces- ... was 81.5 cm, weight for stature (<3rd centile) and her skull circumference was ... Polycystic ovaries also were reported in ... moderate conductive hearing loss [4]. ... et al. Meier–Gorlin syndrome genotype-phenotype studies: 35.
Sindt, Anthony R.; Pierce, Clay; Quist, Michael C.
2012-01-01
Effective conservation of fish species of greatest conservation need (SGCN) requires an understanding of species–habitat relationships and distributional trends. Thus, modeling the distribution of fish species across large spatial scales may be a valuable tool for conservation planning. Our goals were to evaluate the status of 10 fish SGCN in wadeable Iowa streams and to test the effectiveness of Iowa Aquatic Gap Analysis Project (IAGAP) species distribution models. We sampled fish assemblages from 86 wadeable stream segments in the Mississippi River drainage of Iowa during 2009 and 2010 to provide contemporary, independent fish species presence–absence data. The frequencies of occurrence in stream segments where species were historically documented varied from 0.0% for redfin shiner Lythrurus umbratilis to 100.0% for American brook lampreyLampetra appendix, with a mean of 53.0%, suggesting that the status of Iowa fish SGCN is highly variable. Cohen's kappa values and other model performance measures were calculated by comparing field-collected presence–absence data with IAGAP model–predicted presences and absences for 12 fish SGCN. Kappa values varied from 0.00 to 0.50, with a mean of 0.15. The models only predicted the occurrences of banded darterEtheostoma zonale, southern redbelly dace Phoxinus erythrogaster, and longnose daceRhinichthys cataractae more accurately than would be expected by chance. Overall, the accuracy of the twelve models was low, with a mean correct classification rate of 58.3%. Poor model performance probably reflects the difficulties associated with modeling the distribution of rare species and the inability of the large-scale habitat variables used in IAGAP models to explain the variation in fish species occurrences. Our results highlight the importance of quantifying the confidence in species distribution model predictions with an independent data set and the need for long-term monitoring to better understand the
Man, Wang; Le, Luo; Xue-Qin, Chen; Lei, Li; Yue-Yi, Fang
2017-10-19
To understand the current status of the sanitation of freshwater aquaculture environments, and Clonorchis sinensis infection of freshwater fish in the aquaculture and market in a city of Pearl River Delta region, so as to provide the evidence for formulating the prevention and control strategy of clonorchiasis sinensis. In 2016, based on the distribution of freshwater aquaculture, 36 freshwater fish ponds among 14 towns were selected for sampling and investigation, and 10-20 pieces were collected from each pond. Besides, 3 aquatic product wholesale markets were included, among which 3-6 stalls were selected from each market, and 20-30 pieces were collected from each stall. The metacercaria in the fish was examined by the digestion method. In the 36 fish ponds, there were no toilets with the stool being drained into fish ponds directly, and there was only one pond with duck sheds with the stool being drained into fish ponds directly. Totally 437 pieces of freshwater fish from ponds were detected, with a metacercaria positive rate of 4.35% (19/437). The metacercaria positive fish were distributed in 50% (7/14) of towns and 25% (9/36) ponds. The positive rates of crucian carp, grass carp, dace, aristichthysnobilis, and tilapia were 13.95% (6/43), 4.76% (9/189), 4.44 (2/45), 1.55% (2/129), and 0 (0/31) respectively, with statistically significant difference ( χ 2 = 13.46, P = 0.01). Totally 307 pieces of freshwater fish were collected from the wholesale markets, with a total positive rate of 1.95% (6/307). The positive rate of grass carp and aristichthysnobilis were 3.20% (4/125) and 2.78% (2/72) respectively, and no positive samples were found in crucian carp, dace and tilapia, with no statistically significant difference among the different fish in the infection rate (Fisher exact P = 0.75). The sanitation of freshwater aquaculture environments in a city of Pearl River Delta region is relative good. However, there are different degrees of Clonorchis sinensis
Directory of Open Access Journals (Sweden)
Javier Llorca
2004-10-01
Full Text Available Objetivo: Mostrar el efecto de los riesgos competitivos de muerte en el análisis de supervivencia. Métodos: Se presenta un ejemplo sobre la supervivencia libre de rechazo tras un trasplante cardíaco, en el que la muerte antes de desarrollar el rechazo actúa como riesgo competitivo. Mediante una simulación se comparan el estimador de Kaplan-Meier y el modelo de decrementos múltiples. Resultados: El método de Kaplan-Meier sobrestima el riesgo de rechazo. A continuación, se expone la aplicación del modelo de decrementos múltiples para el análisis de acontecimientos secundarios (en el ejemplo, la muerte tras el rechazo. Finalmente, se discuten las asunciones propias del método de Kaplan-Meier y las razones por las que no puede ser aplicado en presencia de riesgos competitivos. Conclusiones: El análisis de supervivencia debe ajustarse por los riesgos competitivos de muerte para evitar la sobrestimación del riesgo de fallo que se produce con el método de Kaplan-Meier.Objective: To show the impact of competing risks of death on survival analysis. Method: We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. Results: The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection. Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Conclusions: Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.
A DACE study on a three stage metal forming process made of Sandvik Nanoflex
Post, J.; Klaseboer, G.; Stinstra, E.; Huetink, Han
2004-01-01
Sandvik NanoflexTM combines good corrosion resistance with high strength. The steel has good deformability in austenitic conditions. This material belongs to the group of metastable austenites, so during deformation a straininduced transformation into martensite takes place. After deformation, the
[Survival analysis with competing risks: estimating failure probability].
Llorca, Javier; Delgado-Rodríguez, Miguel
2004-01-01
To show the impact of competing risks of death on survival analysis. We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection). Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.
Kalvane, Dace
2008-01-01
Žürii liige Võru Tamula järve rannaala mahulise planeeringu rahvusvahelisest ideekonkursist, auhinnatud töödest. Võidutöö "Lust" autorid on Kaie Enno, Leles Luhse, Maria Zeleznova ja Rein Ailt (Kaie Enno Arhitektuuribüroo)
Connectivity and conditional models of access and abundance of species in stream networks.
Chelgren, Nathan D; Dunham, Jason B
2015-07-01
Barriers to passage of aquatic organisms at stream road crossings are a major cause of habitat fragmentation in stream networks. Accordingly, large investments have been made to restore passage at these crossings, but often without estimation of population-level benefits. Here, we describe a broad-scale approach to quantifying the effectiveness of passage restoration in terms interpretable at population levels, namely numbers of fish and length of stream gained through restoration, by sampling abundance in a study design that accounts for variable biogeographic species pools, variable stream and barrier configurations, and variable probabilities of capture and detectability for multiple species. We modified an existing zero-inflated negative-binomial model to estimate the probability of site access, abundance conditional on access, and capture probability of individual fish. Therein, we modeled probability of access as a function of gradient, stream road-crossing type, and downstream access by fish simultaneously with a predictive model for abundance at sites accessible to fish. Results indicated that replacement of barriers with new crossing designs intended to allow for greater movement was associated with dramatically higher probability of access for all fishes, including migratory Pacific salmon, trout, sculpin, and lamprey. Conversely, existing non-replaced crossings negatively impacted fish distributions. Assuming no downstream constraints on access, we estimated the potential length of stream restored by the program ranged between 7.33 (lamprey) and 15.28 km (small coastal cutthroat and rainbow trout). These contributions represented a fraction of the total length available upstream (187 km) of replaced crossings. When limited ranges of species were considered, the estimated contributions of culvert replacement were reduced (1.65-km range, for longnose dace to 12.31 km for small coastal cutthroat and rainbow trout). Numbers of fish contributed ranged from
Dzene, Dace
2017-01-01
Autore: Dace Dzene, stud.apl.nr. dd15034 Darba vadītājs: Dr.med. Igors Ivanovs Ar neatliekamās medicīniskās palīdzības brigādēm stacionārā nogādāto pacientu apmierinātība ar veselības aprūpi pirms stacionāra un stacionāra etapā. Maģistra darbs, Latvijas universitāte, Rīga, 2017. Darbs sastāv no teorētiskās un empīriskās daļas, 6 nodaļām, 66 lapām, 29 attēliem, 10 tabulām, 2 pielikumiem. Pētījuma mērķis ir noskaidrot pacientu apmierinātību ar saņemto veselības aprūpes kvalitāti pirms st...
Directory of Open Access Journals (Sweden)
Béranger Lueza
2016-03-01
Full Text Available Abstract Background The difference in restricted mean survival time ( rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , the area between two survival curves up to time horizon t ∗ $$ {t}^{\\ast } $$ , is often used in cost-effectiveness analyses to estimate the treatment effect in randomized controlled trials. A challenge in individual patient data (IPD meta-analyses is to account for the trial effect. We aimed at comparing different methods to estimate the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ from an IPD meta-analysis. Methods We compared four methods: the area between Kaplan-Meier curves (experimental vs. control arm ignoring the trial effect (Naïve Kaplan-Meier; the area between Peto curves computed at quintiles of event times (Peto-quintile; the weighted average of the areas between either trial-specific Kaplan-Meier curves (Pooled Kaplan-Meier or trial-specific exponential curves (Pooled Exponential. In a simulation study, we varied the between-trial heterogeneity for the baseline hazard and for the treatment effect (possibly correlated, the overall treatment effect, the time horizon t ∗ $$ {t}^{\\ast } $$ , the number of trials and of patients, the use of fixed or DerSimonian-Laird random effects model, and the proportionality of hazards. We compared the methods in terms of bias, empirical and average standard errors. We used IPD from the Meta-Analysis of Chemotherapy in Nasopharynx Carcinoma (MAC-NPC and its updated version MAC-NPC2 for illustration that included respectively 1,975 and 5,028 patients in 11 and 23 comparisons. Results The Naïve Kaplan-Meier method was unbiased, whereas the Pooled Exponential and, to a much lesser extent, the Pooled Kaplan-Meier methods showed a bias with non-proportional hazards. The Peto-quintile method underestimated the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , except with non-proportional hazards at t ∗ $$ {t}^{\\ast } $$ = 5 years. In the presence of treatment effect
Multiple myeloma in Nigeria: An insight to the clinical, laboratory ...
African Journals Online (AJOL)
The average percentage of bone marrow plasmacytosis at diagnosis ... of autologous stem cell transplantation (ASCT) for white, black, and ... Hospital Cancer Registry and Data Collation Institute. .... Figure 1: (a) Kaplan‑Meier survival curve for all myeloma patients, (b) Kaplan‑Meier survival curve for the different sexes b a ...
DEFF Research Database (Denmark)
Butts, Ian A.E.; Mokdad, A.; Trippel, E.A.
2013-01-01
of extirpation.We developed cryopreservation protocols by testing the effects of diluent (buffered sperm motility-inhibiting saline solution [BSMIS]; BSMIS + glycine; sucrose; and Hanks’ balanced salt solution [HBSS]), cryoprotectant (dimethyl sulfoxide [DMSO]; propylene glycol [PG]; N,N-dimethylacetamide [DMA...... rate was not significant for BSMIS + glycine or for HBSS, but an effect was detected for sucrose, with sperm frozen at 5◦C/min or 10◦C/min having higher motility than sperm frozen at 1◦C/min. The effect of extender was not significant at 1◦C/min or 5◦C/min, but an effect was detected at 10◦C...
2017-08-01
28 weeks) to complete this study. Furthermore, using Kaplan - Meier survival curves, we have discovered that TR AMP; L ck-cre; Klf2fl/fl mice do...3 2 Thymus Spleen Thymus Spleen FoxP3 FoxP3 Figure 2. Kaplan -Meier survival curve. TRAMP (black) versus TRAMP; Lck-cre; Klf2fl/fl (red) survival
2017-10-01
of time for mutant mice to moribundity. We recorded numbers of subjects at risk at 0, 25, 50, 75, 100 days old and use the number to generate Kaplan ...Meier curve. We obtained Kaplan -Meier analysis data showed that time to moribundity doubled in Notch4iGOF- EC;RbpjiΔEC mice, as compared to
International Nuclear Information System (INIS)
Jardine, Timothy D.; Kidd, Karen A.; O’ Driscoll, Nelson
2013-01-01
Highlights: ► We examine biomagnification of Hg through stream food webs using δ15 N. ► Slopes of methyl Hg vs. trophic level were higher than total Hg vs. trophic level. ► Biomagnification from predatory insects to fish was related to pH of the water. ► Biomagnification at lower trophic levels was related to dietary concentrations. ► These trends can explain variation in field-measured Hg in food webs. -- Abstract: Biomagnification processes and the factors that govern them, including those for mercury (Hg), are poorly understood in streams. Total and methyl Hg concentrations and relative trophic position (using δ 15 N) were analyzed in biofilm and invertebrates from 21 streams in New Brunswick, Canada to assess food web biomagnification leading to the common minnow blacknose dace (Rhinichthys atratulus), a species known to have Hg concentrations that are higher in low pH waters. Biomagnification slopes within stream food webs measured using Hg vs. δ 15 N or corresponding trophic levels (TL) differed depending on the chemical species analyzed, with total Hg exhibiting increases of 1.3–2.5 per TL (mean slope of total Hg vs. δ 15 N = 0.14 ± 0.06 S.D., range = 0.06–0.20) and methyl Hg showing a more pronounced increase of 2.8 to 6.0 per TL (mean slope of methyl Hg vs. δ 15 N = 0.30 ± 0.08 S.D., range = 0.22–0.39). While Hg biomagnification slopes through the entire food web (Trophic Magnification Factors, TMFs) were not influenced by water chemistry (pH), dietary concentrations of methyl Hg strongly influenced biomagnification factors (BMFs) for consumer-diet pairs within the food web at lower trophic levels, and BMFs between dace and predatory invertebrates were significantly higher in low pH waters. These analyses, coupled with observations of higher Hg in primary producers in streams with low pH, suggest that pH influences both baseline concentrations and biomagnification of Hg in these systems. Because higher Hg concentrations in the diets
Energy Technology Data Exchange (ETDEWEB)
Jardine, Timothy D., E-mail: tim.jardine@usask.ca [Canadian Rivers Institute and Department of Biology, University of New Brunswick, Saint John, NB E2L 4L5 (Canada); Kidd, Karen A. [Canadian Rivers Institute and Department of Biology, University of New Brunswick, Saint John, NB E2L 4L5 (Canada); O’ Driscoll, Nelson [Department of Earth and Environmental Sciences, Acadia University, Wolfville, NS B4P 2R6 (Canada)
2013-05-15
Highlights: ► We examine biomagnification of Hg through stream food webs using δ15 N. ► Slopes of methyl Hg vs. trophic level were higher than total Hg vs. trophic level. ► Biomagnification from predatory insects to fish was related to pH of the water. ► Biomagnification at lower trophic levels was related to dietary concentrations. ► These trends can explain variation in field-measured Hg in food webs. -- Abstract: Biomagnification processes and the factors that govern them, including those for mercury (Hg), are poorly understood in streams. Total and methyl Hg concentrations and relative trophic position (using δ{sup 15}N) were analyzed in biofilm and invertebrates from 21 streams in New Brunswick, Canada to assess food web biomagnification leading to the common minnow blacknose dace (Rhinichthys atratulus), a species known to have Hg concentrations that are higher in low pH waters. Biomagnification slopes within stream food webs measured using Hg vs. δ{sup 15}N or corresponding trophic levels (TL) differed depending on the chemical species analyzed, with total Hg exhibiting increases of 1.3–2.5 per TL (mean slope of total Hg vs. δ{sup 15}N = 0.14 ± 0.06 S.D., range = 0.06–0.20) and methyl Hg showing a more pronounced increase of 2.8 to 6.0 per TL (mean slope of methyl Hg vs. δ{sup 15}N = 0.30 ± 0.08 S.D., range = 0.22–0.39). While Hg biomagnification slopes through the entire food web (Trophic Magnification Factors, TMFs) were not influenced by water chemistry (pH), dietary concentrations of methyl Hg strongly influenced biomagnification factors (BMFs) for consumer-diet pairs within the food web at lower trophic levels, and BMFs between dace and predatory invertebrates were significantly higher in low pH waters. These analyses, coupled with observations of higher Hg in primary producers in streams with low pH, suggest that pH influences both baseline concentrations and biomagnification of Hg in these systems. Because higher Hg
Cold Vacuum Drying (CVD) Facility Electrical System Captor and Dapper Study
International Nuclear Information System (INIS)
SINGH, G.
2000-01-01
The objective of this report is to Validate and as-build the Load and Fault hand calculations performed by Meier Associates. Perform a protective device coordination study, not performed by Meier's, and furnish any recommendations, including recommended device settings. Perform Transient Motor Starting (TMS) analysis for the chillers and also the motors on the standby generator system. Indicate any design problems or NEC Code Violations, if found
Meier, Kristel, 1966-
2002-01-01
Keskkonnaõiguse üldiseloomustus, eesmärk, põhiprintsiibid, ettevaatusprintsiibi ajalooline taust ja areng, Saksa õiguses, rahvusvaheline kohtupraktika, ettevaatusprintsiip Euroopa Ühenduse keskkonnaõiguses
Directory of Open Access Journals (Sweden)
Bender Ralf
2011-09-01
Full Text Available Abstract Background To assess the reporting of loss to follow-up (LTFU information in articles on randomised controlled trials (RCTs with time-to-event outcomes, and to assess whether discrepancies affect the validity of study results. Methods Literature survey of all issues of the BMJ, Lancet, JAMA, and New England Journal of Medicine published between 2003 and 2005. Eligible articles were reports of RCTs including at least one Kaplan-Meier plot. Articles were classified as "assessable" if sufficient information was available to assess LTFU. In these articles, LTFU information was derived from Kaplan-Meier plots, extracted from the text, and compared. Articles were then classified as "consistent" or "not consistent". Sensitivity analyses were performed to assess the validity of study results. Results 319 eligible articles were identified. 187 (59% were classified as "assessable", as they included sufficient information for evaluation; 140 of 319 (44% presented consistent LTFU information between the Kaplan-Meier plot and text. 47 of 319 (15% were classified as "not consistent". These 47 articles were included in sensitivity analyses. When various imputation methods were used, the results of a chi2-test applied to the corresponding 2 × 2 table changed and hence were not robust in about half of the studies. Conclusions Less than half of the articles on RCTs using Kaplan-Meier plots provide assessable and consistent LTFU information, thus questioning the validity of the results and conclusions of many studies presenting survival analyses. Authors should improve the presentation of both Kaplan-Meier plots and LTFU information, and reviewers of study publications and journal editors should critically appraise the validity of the information provided.
Martínez-Camblor, Pablo; Larrañaga, Nerea; Sarasqueta, Cristina; Mitxelena, María José; Basterretxea, Mikel
2009-01-01
To analyze time of disease-free survival and relative survival in women diagnosed with breast cancer in the province of Gipuzkoa within the context of competing risks by assessing differences between the direct use of the Kaplan-Meier estimator and the multiple decrement method on the one hand, and relative survival on the other. All registered breast cancer cases in Gipuzkoa in 1995 and 1996 with stages other than stage IV were included. An 8-year follow-up for recurrence and a 10-year follow-up for survival were performed. Time of disease-free survival was studied by the multiple decrement model. Observed survival and survival corrected by the expected mortality in the population (relative survival) were also studied. Estimation of the probability of recurrence at 8 years with the multiple decrement method was 8.8% lower than that obtained with the Kaplan-Meier method. The difference between the observed and relative survival rates at 10 years was 10.8%. Both results show how, in this case, the Kaplan-Meier estimator overestimates both the probability of recurrence and that of mortality from the disease. Two issues are often overlooked when performing survival analyses: firstly, because of the lack of independence between survival time and censoring time, the results obtained by the Kaplan-Meier estimator are uninterpretable; secondly, it is an incontrovertible fact that one way or another, everyone causes failures. In this approach, survival analyses must take into account the probability of failure in the general population of reference. The results obtained in this study show that superficial use of the Kaplan Meier estimator overestimates both the probability of recurrence and that of mortality caused by the disease.
DEFF Research Database (Denmark)
Kyndi, M.; Sorensen, F.B.; Alsner, J.
2008-01-01
-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue microarray......, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots...
pH tolerance of Daphnia pulex (leydig, emend. , richard)
Energy Technology Data Exchange (ETDEWEB)
Davis, P; Ozburn, G W
1969-01-01
The survival time and reproduction of female Daphnia pulex in solutions varying in pH have been observed. Dilute sodium hydroxide or sulfuric acid solutions were added to four different diluent waters: distilled water, aerated tap water, aerated and filtered tap water from an aquarium containing Dace minnows, and Mcintyre River water. D. Pulex (initially up to 72 hours old) survived for the duration of the experiment (32 hours) in river water within a pH range of 6.1 to 10.3; in aquarium water within a pH range of 4.3 to 10.4; only at pH 6.4 and pH 7.6 in distilled water; and in none of the solutions using aerated tap water. The dissolved oxygen content was measured at the beginning and end of every experiment and was found never to fall below 6.2 p.p.M. Those individuals which survived were cultured in the laboratory and parthenogenesis was observed at pH values between 7.0 and 8.7.
Heteronuclear long-range correlation, what’s new and how far can it take us?
DEFF Research Database (Denmark)
Sørensen, Ole W.
: A novel experiment for small-molecule and biomolecular NMR at natural isotopic abundance. Sebastian Meier, Andrew J. Benie, Jens Ø. Duus and Ole W. Sørensen, Journal of Magnetic Resonance, in press, doi:10.1016/j.jmr.2009.06.017 Recent progress in heteronuclear long-range NMR of complex carbohydrates: 3D...... H2BC and clean HMBC. Sebastian Meier, Bent O. Petersen, Jens Ø. Duus, Ole W. Sørensen. Carbohydrate Research, in press, doi:10.1016/j.carres.2009.08.013...
A Note on Some Characteristics and Correlates of the Meier Art Test of Aesthetic Perception.
Stallings, William M.; Anderson, Frances E.
The reliability and the predictive and concurrent validity of the MATAP were investigated with the implicit goal of improving the prediction of course grades in the College of Fine and Applied Arts. It was found that reliability and validity coefficients were low, and it was suggested that the scoring system was a source of error variance. (MS)
Deciphering the Adaptive Immune Response to Ovarian Cancer
2013-10-01
positive for CD8þ TIL. Conversely, of the cases that were positive for CD8þ TIL, approximately half also contained CD20þ TIL. By Kaplan –Meier analysis...and D). Scale bars: 100 mm (A and B) or 50 mm (C and D). Representative of 5 tumor samples. E, Kaplan –Meier curves showing that the presence of both...CH, Subramanian S, van de Rijn M, Turbin D, et al. Intraepithelial T cells and prognosis in ovarian carcinoma: novel associations with stage, tumor
Directory of Open Access Journals (Sweden)
Pablo Martínez-Camblor
2009-12-01
Full Text Available Objetivo: Analizar el tiempo de supervivencia libre de enfermedad y la supervivencia relativa en mujeres diagnosticadas de cáncer de mama en la provincia de Gipuzkoa en un contexto de riesgos competitivos, valorando las diferencias encontradas entre el uso directo del estimador de Kaplan-Meier y el método de decrementos múltiples por un lado y la supervivencia relativa por otro. Métodos: Se consideraron todos los casos de cáncer de mama registrados en la provincia de Gipuzkoa durante los años 1995 y 1996 en estadio distinto del IV, y se hizo un seguimiento de 8 años para la recidiva y de 10 años para la supervivencia. Se analizó el tiempo de supervivencia libre de enfermedad mediante el método de decrementos múltiples. Asimismo, también se analizó el tiempo de supervivencia observado y corregido por la mortalidad esperada de la población, conocido como supervivencia relativa. Resultados: La estimación de la probabilidad de recidiva a los 8 años por el método de decrementos múltiples es un 8,8% inferior a la obtenida por el método de Kaplan-Meier. La diferencia entre la supervivencia observada y la relativa a los 10 años es del 10,8%. Ambos resultados indican que, en este caso, el método de Kaplan-Meier sobrestima tanto la probabilidad de recaída como la de muerte por la enfermedad. Conclusiones: Dos cuestiones que muchas veces se obvian al realizar un análisis de supervivencia son, por un lado, que la no independencia entre el tiempo de supervivencia y el tiempo de censura hacen no interpretables los resultados obtenidos por el estimador de Kaplan-Meier, y por otro el hecho, hasta hora incuestionable, de que de una manera u otra todos causamos fallo y, desde este planteamiento, en el estudio del tiempo de supervivencia hay que tener presente la probabilidad de fallo en la población general de referencia. En los resultados obtenidos se observa que utilizar de manera superficial el estimador de Kaplan-Meier comporta una
DEFF Research Database (Denmark)
Meier, Ninna
2016-01-01
What academics or books have inspired you in your writing and research, or helped to make sense of the world around you? In this feature essay, Ninna Meier returns to her experience of reading Hannah Arendt as she sought to understand work and how it relates to value production in capitalist...... economies. Meier recounts how Arendt’s book On Revolution (1963) forged connective threads between the ‘smallest parts’ and the ‘largest wholes’ and showed how academic work is never fully relegated to the past, but can return in new iterations across time....
The development of a new algorithm to calculate a survival function in non-parametric ways
International Nuclear Information System (INIS)
Ahn, Kwang Won; Kim, Yoon Ik; Chung, Chang Hyun; Kim, Kil Yoo
2001-01-01
In this study, a generalized formula of the Kaplan-Meier method is developed. The idea of this algorithm is that the result of the Kaplan-Meier estimator is the same as that of the redistribute-to-the right algorithm. Hence, the result of the Kaplan-Meier estimator is used when we redistribute to the right. This can be explained as the following steps, at first, the same mass is distributed to all the points. At second, when you reach the censored points, you must redistribute the mass of that point to the right according to the following rule; to normalize the masses, which are located to the right of the censored point, and redistribute the mass of the censored point to the right according to the ratio of the normalized mass. Until now, we illustrate the main idea of this algorithm.The meaning of that idea is more efficient than PL-estimator in the sense that it decreases the mass of after that area. Just like a redistribute to the right algorithm, this method is enough for the probability theory
What kind of “Judean” was Jesus?
Directory of Open Access Journals (Sweden)
Markus Cromhout
2007-05-01
Full Text Available Reconstructions of the historical Jesus are analyzed in terms of a proposed socio-cultural model of Judean ethnicity. At first an overview is given of the work of Meier and Crossan to establish the content they assigned to Jesus’ Judean ethnicity. Drawing on the insights of ethnicity theory, biblical scholarship and the work of Berger and Luckmann, a socio-cultural model of Judean ethnicity is proposed and explained. The reconstructions of Meier and Crossan are then compared with the proposed model. It is argued that none of their reconstructions allow for Jesus to be seen as profoundly Judean.
Landy, Rebecca; Cheung, Li C; Schiffman, Mark; Gage, Julia C; Hyun, Noorie; Wentzensen, Nicolas; Kinney, Walter K; Castle, Philip E; Fetterman, Barbara; Poitras, Nancy E; Lorey, Thomas; Sasieni, Peter D; Katki, Hormuzd A
2018-06-01
Electronic health-records (EHR) are increasingly used by epidemiologists studying disease following surveillance testing to provide evidence for screening intervals and referral guidelines. Although cost-effective, undiagnosed prevalent disease and interval censoring (in which asymptomatic disease is only observed at the time of testing) raise substantial analytic issues when estimating risk that cannot be addressed using Kaplan-Meier methods. Based on our experience analysing EHR from cervical cancer screening, we previously proposed the logistic-Weibull model to address these issues. Here we demonstrate how the choice of statistical method can impact risk estimates. We use observed data on 41,067 women in the cervical cancer screening program at Kaiser Permanente Northern California, 2003-2013, as well as simulations to evaluate the ability of different methods (Kaplan-Meier, Turnbull, Weibull and logistic-Weibull) to accurately estimate risk within a screening program. Cumulative risk estimates from the statistical methods varied considerably, with the largest differences occurring for prevalent disease risk when baseline disease ascertainment was random but incomplete. Kaplan-Meier underestimated risk at earlier times and overestimated risk at later times in the presence of interval censoring or undiagnosed prevalent disease. Turnbull performed well, though was inefficient and not smooth. The logistic-Weibull model performed well, except when event times didn't follow a Weibull distribution. We have demonstrated that methods for right-censored data, such as Kaplan-Meier, result in biased estimates of disease risks when applied to interval-censored data, such as screening programs using EHR data. The logistic-Weibull model is attractive, but the model fit must be checked against Turnbull non-parametric risk estimates. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Sidenius, N; Sier, C.F.M.; Ullum, H
2000-01-01
levels of soluble uPAR (suPAR) in patients with advanced HIV-1 disease and whether the serum level of suPAR is predictive of clinical outcome. Using an enzyme-linked immunosorbent assay, the level of suPAR was measured retrospectively in serum samples from 314 patients with HIV-1 infection. By Kaplan......-Meier and Cox regression analyses, the serum suPAR levels were correlated to survival with AIDS-related death as the end point. High levels of serum suPAR (greater than median) were associated with poor overall survival, and Kaplan-Meier analysis on patients stratified by suPAR level demonstrated a continuous...
DEFF Research Database (Denmark)
Cannon, Christopher P; Husted, Steen; Harrington, Robert A
2007-01-01
, or clopidogrel 300-mg loading dose plus 75 mg once daily for up to 12 weeks. RESULTS: The primary end point, the Kaplan-Meier rate of major or minor bleeding through 4 weeks, was 8.1% in the clopidogrel group, 9.8% in the AZD6140 90-mg group, and 8.0% in the AZD6140 180-mg group (p = 0.43 and p = 0.......96, respectively, vs. clopidogrel); the major bleeding rates were 6.9%, 7.1%, and 5.1%, respectively (p = 0.91 and p = 0.35, respectively, vs. clopidogrel). Although not statistically significant, favorable trends were seen in the Kaplan-Meier rates of myocardial infarction (MI) over the entire study period (MI: 5...
Acute toxicity of zinc to several aquatic species native to the Rocky Mountains.
Brinkman, Stephen F; Johnston, Walter D
2012-02-01
National water-quality criteria for the protection of aquatic life are based on toxicity tests, often using organisms that are easy to culture in the laboratory. Species native to the Rocky Mountains are poorly represented in data sets used to derive national water-quality criteria. To provide additional data on the toxicity of zinc, several laboratory acute-toxicity tests were conducted with a diverse assortment of fish, benthic invertebrates, and an amphibian native to the Rocky Mountains. Tests with fish were conducted using three subspecies of cutthroat trout (Colorado River cutthroat trout Oncorhynchus clarkii pleuriticus, greenback cutthroat trout O. clarkii stomias, and Rio Grande cutthroat trout O. clarkii virginalis), mountain whitefish (Prosopium williamsoni), mottled sculpin (Cottus bairdi), longnose dace (Rhinichthys cataractae), and flathead chub (Platygobio gracilis). Aquatic invertebrate tests were conducted with mayflies (Baetis tricaudatus, Drunella doddsi, Cinygmula sp. and Ephemerella sp.), a stonefly (Chloroperlidae), and a caddis fly (Lepidostoma sp.). The amphibian test was conducted with tadpoles of the boreal toad (Bufo boreas). Median lethal concentrations (LC(50)s) ranged more than three orders of magnitude from 166 μg/L for Rio Grande cutthroat trout to >67,000 μg/L for several benthic invertebrates. Of the organisms tested, vertebrates were the most sensitive, and benthic invertebrates were the most tolerant.
DEFF Research Database (Denmark)
Mickley, H; Nielsen, J R; Berning, J
1995-01-01
infarction. MAIN OUTCOME MEASURES: Relation of ambulatory ST segment depression, exercise test variables, and left ventricular ejection fraction to subsequent objective (cardiac death or myocardial infarction) or subjective (need for coronary revascularisation) events. RESULTS: 23 of the 123 patients had...... an association between transient ST segment depression and an adverse long term outcome was found (Kaplan-Meier analysis; P = 0.004). The presence of exercise induced angina identified a similar proportion of patients with a poor prognosis (Kaplan-Meier analysis; P ... ST segment depression had high specificity but poor sensitivity. The presence of exercise induced ST segment depression was of no value in predicting combined cardiac events. Indeed, patients without exertional ST segment depression were at increased risk of future objective end points (Kaplan...
Lifescience Database Archive (English)
Full Text Available AUTHORS ... Meier FM, Frerix M, Hermann W, Muller-Ladner U ... TITLE ... Current immunotherapy in rheumatoid arthritis. ... JOURNAL ... Immunotherapy 5:955-74 (2013) DOI:10.2217/imt.13.94 ...
Censoring: a new approach for detection limits in total-reflection X-ray fluorescence
International Nuclear Information System (INIS)
Pajek, M.; Kubala-Kukus, A.; Braziewicz, J.
2004-01-01
It is shown that the detection limits in the total-reflection X-ray fluorescence (TXRF), which restrict quantification of very low concentrations of trace elements in the samples, can be accounted for using the statistical concept of censoring. We demonstrate that the incomplete TXRF measurements containing the so-called 'nondetects', i.e. the non-measured concentrations falling below the detection limits and represented by the estimated detection limit values, can be viewed as the left random-censored data, which can be further analyzed using the Kaplan-Meier (KM) method correcting for nondetects. Within this approach, which uses the Kaplan-Meier product-limit estimator to obtain the cumulative distribution function corrected for the nondetects, the mean value and median of the detection limit censored concentrations can be estimated in a non-parametric way. The Monte Carlo simulations performed show that the Kaplan-Meier approach yields highly accurate estimates for the mean and median concentrations, being within a few percent with respect to the simulated, uncensored data. This means that the uncertainties of KM estimated mean value and median are limited in fact only by the number of studied samples and not by the applied correction procedure for nondetects itself. On the other hand, it is observed that, in case when the concentration of a given element is not measured in all the samples, simple approaches to estimate a mean concentration value from the data yield erroneous, systematically biased results. The discussed random-left censoring approach was applied to analyze the TXRF detection-limit-censored concentration measurements of trace elements in biomedical samples. We emphasize that the Kaplan-Meier approach allows one to estimate the mean concentrations being substantially below the mean level of detection limits. Consequently, this approach gives a new access to lower the effective detection limits for TXRF method, which is of prime interest for
Stemmer, Salomon M; Steiner, Mariana; Rizel, Shulamith; Soussan-Gutman, Lior; Ben-Baruch, Noa; Bareket-Samish, Avital; Geffen, David B; Nisenbaum, Bella; Isaacs, Kevin; Fried, Georgeta; Rosengarten, Ora; Uziely, Beatrice; Svedman, Christer; McCullough, Debbie; Maddala, Tara; Klang, Shmuel H; Zidan, Jamal; Ryvo, Larisa; Kaufman, Bella; Evron, Ella; Karminsky, Natalya; Goldberg, Hadassah; Shak, Steven; Liebermann, Nicky
2017-01-01
The 21-gene Recurrence Score® (RS) assay is a validated prognostic/predictive tool in ER + early-stage breast cancer. However, clinical outcome data from prospective studies in RS ≥ 11 patients are lacking, as are relevant real-life clinical practice data. In this retrospective analysis of a prospectively designed registry, we evaluated treatments/clinical outcomes in patients undergoing RS-testing through Clalit Health Services. The analysis included N0 ER + HER2-negative breast cancer patients who were RS-tested from 1/2006 through 12/2010. Medical records were reviewed to verify treatments/recurrences/survival. The cohort included 1801 patients (median follow-up, 6.2 years). Median age was 60 years, 50.4% were grade 2 and 81.1% had invasive ductal carcinoma; 48.9% had RS < 18, 40.7% RS 18-30, and 10.4% RS ≥ 31, with chemotherapy use of 1.4, 23.7, and 87.2%, respectively. The 5-year Kaplan-Meier estimates for distant recurrence were 0.8, 3.0, and 8.6%, for patients with RS < 18, RS 18-30 and RS ≥ 31, respectively; the corresponding 5-year Kaplan-Meier estimates for breast cancer death were 0.0, 0.9, and 6.2%. Chemotherapy-untreated patients with RS < 11 ( n = 304) and 11-25 ( n = 1037) (TAILORx categorizatio n ) had 5-year Kaplan-Meier estimates for distant recurrence risk/breast cancer death of 1.0%/0.0% and 1.3%/0.4%, respectively. Our results extend those of the prospective TAILORx trial: the 5-year Kaplan-Meier estimates for distant recurrence and breast cancer death rate for the RS < 18 patients were very low supporting the use of endocrine therapy alone. Furthermore, in chemotherapy-untreated patients with RS 11-25 (where TAILORx patients were randomized to chemoendocrine or endocrine therapy alone), 5-year distant recurrence rates were also very low, suggesting that chemotherapy would not have conferred clinically meaningful benefit.
... days of life. Meier DE, et al. Hospice: Philosophy of care and appropriate utilization in the United ... Care Organization. http://www.nhpco.org/hospice-statistics-research-press-room/facts-hospice-and-palliative-care. Accessed ...
Cardiovascular Risk Factors and 5-year Mortality in the Copenhagen Stroke Study
DEFF Research Database (Denmark)
Kammersgaard, Lars Peter; Olsen, Tom Skyhøj
2005-01-01
population. METHODS: We studied 905 ischemic stroke patients from the community-based Copenhagen Stroke Study. Patients had a CT scan and stroke severity was measured by the Scandinavian Stroke Scale on admission. A comprehensive evaluation was performed by a standardized medical examination...... and questionnaire for cardiovascular risk factors, age, and sex. Follow-up was performed 5 years after stroke, and data on mortality were obtained for all, except 6, who had left the country. Five-year mortality was calculated by the Kaplan-Meier procedure and the influence of multiple predictors was analyzed...... by Cox proportional hazards analyses adjusted for age, gender, stroke severity, and risk factor profile. RESULTS: In Kaplan-Meier analyses atrial fibrillation (AF), ischemic heart disease, diabetes, and previous stroke were associated with increased mortality, while smoking and alcohol intake were...
Cardiovascular risk factors and 5-year mortality in the Copenhagen Stroke Study
DEFF Research Database (Denmark)
Kammersgaard, Lars Peter; Olsen, Tom Skyhøj
2005-01-01
population. METHODS: We studied 905 ischemic stroke patients from the community-based Copenhagen Stroke Study. Patients had a CT scan and stroke severity was measured by the Scandinavian Stroke Scale on admission. A comprehensive evaluation was performed by a standardized medical examination...... and questionnaire for cardiovascular risk factors, age, and sex. Follow-up was performed 5 years after stroke, and data on mortality were obtained for all, except 6, who had left the country. Five-year mortality was calculated by the Kaplan-Meier procedure and the influence of multiple predictors was analyzed...... by Cox proportional hazards analyses adjusted for age, gender, stroke severity, and risk factor profile. RESULTS: In Kaplan-Meier analyses atrial fibrillation (AF), ischemic heart disease, diabetes, and previous stroke were associated with increased mortality, while smoking and alcohol intake were...
DEFF Research Database (Denmark)
Kyndi, Marianne; Sørensen, Flemming Brandt; Knudsen, Helle
2008-01-01
-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......PURPOSE: To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). PATIENTS AND METHODS: The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue...... tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. RESULTS: p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan...
Histoplasmosis Risk and Prevention
... Huprikar S, Azie N, Quan SP, Meier-Kriesche HU, Horn DL. Clinical characteristics and outcomes in 303 HIV- ... Slama TG, Norton JA, Kohler RB, Eitzen HE, French ML, et al. Risk factors for disseminated or ...
Nested Cohort - R software package
NestedCohort is an R software package for fitting Kaplan-Meier and Cox Models to estimate standardized survival and attributable risks for studies where covariates of interest are observed on only a sample of the cohort.
Telenovela'de keel / Kaisa Karu
Karu, Kaisa
2007-01-01
Kolumbia telenovela "Luna" peategelasi kehastavad venetsueelalane Gaby Espino ja peruulane Christian Meier. Üheks raskuseks töö juures on erinevate aktsentide ühtlustamise vajadus. Lühidalt ka näitlejate varasemast karjäärist
ORIGINAL ARTICLES Antiretroviral treatment for children
African Journals Online (AJOL)
Kaplan-Meier survival estimate for 407 children at 1 year was. 84% (95% ... highly active antiretroviral therapy (HAART) to 3 million people living with HIV I AIDS in ... 5 Furthermore, improvements in growth and body composition parameters,.
Directory of Open Access Journals (Sweden)
Min-jie Mao
2017-01-01
Full Text Available Background. The pretreatment albumin and globulin ratio (AGR was an inflammation-associated factor which was related to the overall survival in various malignancies. The aim of this study was to evaluate the prognostic value of AGR in patients with gastric cancer. Method. This retrospective study included 862 cases pathologically diagnosed with gastric cancer. All patients were randomly divided into the testing group (431 cases and validation group (431 cases. The relationships of AGR with clinicopathologic characteristics and prognosis were analyzed by Kaplan-Meier and Cox regression methods. Results. In the testing group, the median overall survival was 26.90 months and the cutoff value of AGR was 1.50 based on R language. Kaplan-Meier analysis showed that lower AGR was correlated with poorer overall survival. Multivariate analysis demonstrated that AGR was an independent prognostic factor for overall survival (HR: 0.584, 95% CI = 0.351–0.973, and p = 0.039. In the validation group, the median overall survival was 24.10 months. Lower AGR (≤1.50 also had a significantly poorer overall survival by Kaplan-Meier analysis. According to multivariate analysis, the AGR was also confirmed to be an independent prognostic factor for overall survival (HR: 0.578, 95% CI = 0.373–0.897, and p = 0.015. Conclusions. Our study suggested that the pretreatment AGR could be a prognostic biomarker for overall survival in patients with gastric cancer.
Competing approaches to analysis of failure times with competing risks.
Farley, T M; Ali, M M; Slaymaker, E
2001-12-15
For the analysis of time to event data in contraceptive studies when individuals are subject to competing causes for discontinuation, some authors have recently advocated the use of the cumulative incidence rate as a more appropriate measure to summarize data than the complement of the Kaplan-Meier estimate of discontinuation. The former method estimates the rate of discontinuation in the presence of competing causes, while the latter is a hypothetical rate that would be observed if discontinuations for the other reasons could not occur. The difference between the two methods of analysis is the continuous time equivalent of a debate that took place in the contraceptive literature in the 1960s, when several authors advocated the use of net (adjusted or single decrement life table rates) rates in preference to crude rates (multiple decrement life table rates). A small simulation study illustrates the interpretation of the two types of estimate - the complement of the Kaplan-Meier estimate corresponds to a hypothetical rate where discontinuations for other reasons did not occur, while the cumulative incidence gives systematically lower estimates. The Kaplan-Meier estimates are more appropriate when estimating the effectiveness of a contraceptive method, but the cumulative incidence estimates are more appropriate when making programmatic decisions regarding contraceptive methods. Other areas of application, such as cancer studies, may prefer to use the cumulative incidence estimates, but their use should be determined according to the application. Copyright 2001 John Wiley & Sons, Ltd.
Review of fish diversity in the Lake Huron basin
Roseman, E.F.; Schaeffer, J.S.; Steen, P.J.
2009-01-01
Lake Huron has a rich aquatic habitat diversity that includes shallow embayments, numerous tributaries, shallow mid-lake reef complexes, archipelagos, and profundal regions. These habitats provide support for warm, cool, and cold water fish communities. Diversity of fishes in Lake Huron reflects post-glaciation colonization events, current climate conditions, accidental and intentional introductions of non-indigenous species, and extinctions. Most extinction events have been largely associated with habitat alterations, exploitation of fisheries, and interactions with non-indigenous species. The most recent historical survey of extirpated and imperiled species conducted in the late 1970s identified 79 fish species in Lake Huron proper and about 50 additional species in tributaries. Of those 129 species, 20 are now considered extirpated or imperiled. Extirpated species include Arctic grayling, paddlefish, weed shiner, deepwater cisco, blackfin cisco, shortnose cisco, and kiyi. Six species have declined appreciably due to loss of clear-water stream habitat: the river redhorse, river darter, black redhorse, pugnose shiner, lake chubsucker, redside dace, eastern sand darter, and channel darter. While numerous agencies, universities, and other organizations routinely monitor nearshore and offshore fish distribution and abundance, there is a need for more rigorous examination of the distribution and abundance of less-common species to better understand their ecology. This information is critical to the development of management plans aimed at ecosystem remediation and restoration.
Directory of Open Access Journals (Sweden)
Jennifer Drake
2016-05-01
Full Text Available The transportation of pollutants from impervious surfaces during runoff events to receiving water bodies is a serious environmental problem. Summer runoff is also heated by impervious surfaces, causing thermal enrichment in receiving water body systems and degradation of coldwater aquatic ecosystems. End-of-pipe stormwater management facilities that are open to the environment can result in further elevated temperatures due to exposure to solar radiation. Receiving water systems that provide coldwater habitat require cool water temperatures to sustain healthy conditions for cold water flora and fauna (e.g., trout, dace. Underground Stormwater Detention Chambers (USDC are a technology for the detention and treatment of stormwater runoff that can potentially solve the thermal issues associated with sun-exposed detention facilities while still providing an equivalent level of treatment services for stormwater pollutants. A field study of an USDC located in Southern Ontario was undertaken to characterize its treatment performance and effect on water temperature. The results were: the USDC was found to provide similar levels of stormwater treatment as wet detention ponds. On average, outlet maximum temperatures were 5 °C cooler than inlet maximum temperatures, and outlet water temperatures remained within the thermal regime for coldwater fish habitat throughout the evaluation period. There was little to no stratification of temperature, nor dissolved solids, but stratification of dissolved oxygen was observed mid-winter and into the spring.
A population-based study of survival and discharge status for survivors after head injury
DEFF Research Database (Denmark)
Engberg, Aase Worså; Teasdale, T W
2004-01-01
and cerebral lesion was described quantitatively through Kaplan-Meier survival distributions. Besides, patterns of severity, neurophysical and mental sequelae among survivors 5, 10 and 15 years post-injury were described. It was shown by examples how the study has been useful already for the planning......-Meier survival functions were calculated for these two categories. Hospital records for a random sample of 389 survivors in 1997 after cranial fracture, acute brain lesion or chronical subdural haematoma, which occurred in 1982, 1987 and 1992 in patients aged 15 years or more at injury, were reviewed. Survivors...... the decreasing incidence with time, the point prevalence of survivors in 1997 after brain lesions occurring in 1982, 1987 or 1992 was nearly the same, averaging 8.4 per 100 000 of the population above age 14. Half of them were severe, as defined by initial Glasgow Coma Score
African Journals Online (AJOL)
jen
This report is a review of our experience with STS over a 23 year period at a busy ... Hospital, Kaduna, with oral and maxillofacial malignancies between the years ..... LM, Mark K, Meier R, Calcaterra TC, Parker ... Cancer 1962;15:1028-1032.
Application of the standard lymphadenectomy in gastric adenocarcinoma
International Nuclear Information System (INIS)
Aguirre Fernandez, Roberto Eduardo; LLera Dominguez, Gerardo de la; Pennon Guerra, Maria; Alvarez Perez, Alvaro
2011-01-01
The 5-years postoperative survival of 132 patients operated on due to gastric adenocarcinoma that underwent lymphadenectomy of the two first ganglionic levels. The results of the epidemiological parameters were determined and the survival by Kaplan-Meier method was defined
Surface-wave tomography of Ireland and surroundings using ambient noise and teleseismic data
Bonadio, Raffaele; Arroucau, Pierre; Lebedev, Sergei; Meier, Thomas; Schaeffer, Andrew; Licciardi, Andrea; Piana Agostinetti, Nicola
2016-04-01
Ireland's geology is dominated by northeast-southwest structural trends and suture zones, mostly inferred from geological mapping and a few active source seismic experiments. However, their geometry and extent at depth and their continuity across the Irish Sea are still poorly known. Important questions also remain unanswered regarding the thickness and bulk properties of the sedimentary cover at the regional scale, the deformation and flow of the deep crust during the formation of Ireland, the thickness of Ireland's lithosphere today, and the thermal structure and dynamics of the asthenosphere beneath Ireland. In this work, we take advantage of abundant, newly available broadband data from temporary array deployments and permanent seismic networks in Ireland and Great Britain to produce high-resolution models of seismic velocity structure and anisotropy of the lithosphere. We combine Rayleigh and Love phase velocity measurements from waveform cross-correlation using both ambient noise and teleseismic data in order to produce high-quality dispersion curves for periods ranging from 1 to 300 s. The phase velocity measurement procedures are adapted from Meier et al.[2], Lebedev et al.[1] and Soomro et al.[3] and are automated in order to deal with the large amount of data and ensure consistency and reproducibility. For the nearly 200 stations used in this study, we obtain a very large number of dispersion curves from both ambient noise and teleseimic data. Dispersion measurements are then inverted in a tomographic procedure for surface-wave phase velocity maps in a very broad period range. The maps constrain the 3D seismic-velocity structure of the crust and upper mantle underlying Ireland and the Irish Sea. {9} Lebedev, S., T. Meier, R. D. van der Hilst. Asthenospheric flow and origin of volcanism in the Baikal Rift area, Earth Planet. Sci. Lett., 249, 415-424, 2006. Meier, T., K. Dietrich, B. Stockhert, H.P. Harjes, One-dimensional models of shear wave velocity for
Vulnerability Analysis of the MAVLink Protocol for Command and Control of Unmanned Aircraft
2013-03-27
Patton, Nikos Karapanos, Lorenz Meier, Peter Schwabe, Andrew Tridgell, Michael Oborne, Dr. Gareth Owen, and Capt Matthew Vincie, all of whom greatly...Frew and T. Brown . Networking Issues For Small Unmanned Aircraft Systems. In Unmanned Aircraft Systems : International Symposium on Unmanned Aerial
A Hybrid Analysis for Security Protocols with State
2014-07-16
http://www.mitre.org/publications/ technical-papers/completeness-of-cpsa. [19] Simon Meier, Cas Cremers , and David Basin. Efficient construction of...7] Cas Cremers and Sjouke Mauw. Operational semantics and verification of security protocols. Springer, 2012. [8] Anupam Datta, Ante Derek, John C
IJzerman, H.; Koole, S.L.
2011-01-01
What leads people to describe some of their interpersonal relationships as " close" and " warm" and others as " distant" and " cold" ? Landau, Meier, and Keefer (2010) proposed that conceptual metaphors facilitate social cognition by allowing people to use knowledge from a relatively concrete
Elevated plasma vitamin B12 levels and cancer prognosis: A population-based cohort study
DEFF Research Database (Denmark)
Arendt, Johan Frederik Håkonsen; Farkas, Dora Kormendine; Pedersen, Lars
2015-01-01
patients without a plasma Cbl measurement. Patients treated with Cbl were excluded. Survival probability was assessed using Kaplan-Meier curves. Mortality risk ratios (MRR) were computed using Cox proportional hazard regression, adjusted for age, sex, calendar year, cancer stage and comorbidity, scored...
DEFF Research Database (Denmark)
Wells, J Connor; Stukalin, Igor; Norton, Craig
2017-01-01
and were included in the analysis. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Patients were analyzed for overall survival (OS) and progression-free survival using Kaplan-Meier curves, and were evaluated for overall response. Cox regression analyses were used to determine the statistical association...
University of Hawaii Institute for Astronomy
2001-01-01
Thornton, Scott Sheppard, and Wei-Hao Wang. Visiting colleagues included Marcelo Emilio , Miwa Go- to, Olivier Guyon, Masatoshi Imanishi, Roland Meier...Univ. Nevada, Las Vegas ), and C. Deliyannis (Indiana Univ.). Spectroscopic observations at high spectral resolu- tion of unevolved stars in globular
Treatment of primary tracheal carcinoma. The role of external and endoluminal radiotherapy
International Nuclear Information System (INIS)
Harms, W.; Wannenmacher, M.; Becker, H.; Herth, F.; Gagel, B.
2000-01-01
Background and Purpose: In a retrospective study the role of radiation therapy for the treatment of primary tracheal carcinoma was investigated. Patients and Methods: Between 1984 and 1997, 25 patients with primary tracheal carcinoma were treated with external beam radiotherapy (17 squamous-cell carcinoma [SCC], 8 adenoid cystic carcinoma [ACC], median dose SCC 60 Gy, ACC 55 Gy). An additional brachytherapy boost was carried out in 10/25 patients (median dose SCC 18 Gy, ACC 15 Gy). Ten patients underwent operative treatment. Results: The median survival (Kaplan-Meier) for patients with SCC was 33 months (ACC 94.2). The 1-, 2- and 5-year survival rates (Kaplan-Meier) for patients with SCC were 64.7% (ACC 85.7%), 64.7% (ACC 85.7%), and 26% (ACC 85.7%). Patients with ACC and patients with a complete remission after treatment had a significantly better survival probability (log rank test, p [de
Saadat, Mostafa; Khalili, Maryam; Omidvari, Shahpour; Ansari-Lari, Maryam
2011-03-28
The main aim of the present study was investigating the association between parental consanguinity and clinical response to chemotherapy in females affected with locally advanced breast cancer. A consecutive series of 92 patients were prospectively included in this study. Clinical assessment of treatment was accomplished by comparing initial tumor size with preoperative tumor size using revised RECIST guideline (version 1.1). Clinical response defined as complete response, partial response and no response. The Kaplan-Meier survival analysis were used to evaluate the association of parental marriages (first cousin vs unrelated marriages) and clinical response to chemotherapy (complete and partial response vs no response). Number of courses of chemotherapy was considered as time, in the analysis. Kaplan-Meier analysis revealed that offspring of unrelated marriages had poorer response to chemotherapy (log rank statistic=5.10, df=1, P=0.023). Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Bowden, T J; Bricknell, I R; Preziosi, B M
2018-01-01
Juvenile Atlantic halibut (~100 mg, Hippoglossus hippoglossus) were exposed to Vibrio proteolyticus, a Vibrio spp. isolate, Photobacterium damselae ssp. damselae and five different isolates of Aeromonas salmonicida ssp. achromogenes via an hour-long bath immersion to ascertain their variation in pathogenicity to this fish species. Results were analysed using Kaplan-Meier survival analysis. Analysis of the data from challenges using A. salmonicida ssp. achromogenes revealed three survival values of zero and a spread of values from 0 to 28.43. Challenges using a Vibrio spp isolate, V. proteolyticus and P. damselae resulted in Kaplan-Meier survival estimates of 31.21, 50.41 and 57.21, respectively. As all bacterial species tested could induce juvenile halibut mortalities, they must all be considered as potential pathogens. However, the degree of pathogenicity of A. salmonicida is isolate dependent. © 2017 John Wiley & Sons Ltd.
Peritoneal drainage for newborn intestinal perforation: primary ...
African Journals Online (AJOL)
Keywords: intestinal perforation in newborn, necrotizing enterocolitis, primary peritoneal drainage. Department of Surgery, Paul L. Foster School of Medicine, Texas Tech University. HSC, El Paso, Texas, USA. Correspondence to Donald E. Meier, MD, Department of Surgery, Paul L. Foster. School of Medicine, Texas Tech ...
DEFF Research Database (Denmark)
Kyndi, M.; Sorensen, F.B.; Alsner, J.
2008-01-01
-points were loco-regional recurrence, distant metastases, disease-specific survival and overall survival. Statistical analyses included kappa statistics, chi(2) or exact tests, Kaplan-Meier probability plots, Log-rank test and Cox regression analyses. Results CA IX was assessable in 945 cores. The percentage...
Diskurskonflikte im 18. Jahrhundert
DEFF Research Database (Denmark)
Finsen, Hans Carl
2010-01-01
Georg Friedrich Meier will am Beispiel des Scherzes über den leichten geselligen Auftritt reden. Die Argumente bezieht er dabei aus zwei unterschiedlichen Registern, der Rhetorik und dem rationalistischen Wissenschaftsdenken. Das Wissen über das Ideal der leichten Geselligkeit wird von der Rhet...
Modelling the survivorship of Nigeria children in their first 10 years of ...
African Journals Online (AJOL)
Fagbamigbe
Conflict of Interest: Authors declared no conflict of interest ... Keywords: Survivorship, Nigeria, children mortality, Kaplan Meier, Brass Indirect method, Prediction ... variables or sex of older siblings, post- neonatal mortality is 12% higher and 2nd ... Relationship between maternal education and child survival in developing ...
Surgical Treatment as a Principle for Patients with High-Grade Pancreatic Neuroendocrine Carcinoma
DEFF Research Database (Denmark)
Haugvik, Sven-Petter; Janson, Eva Tiensuu; Österlund, Pia
2016-01-01
is uncertain. Methods: Data from patients with a diagnosis of hgPNEC determined between 1998 and 2012 were retrospectively registered at 10 Nordic university hospitals. Kaplan–Meier curves were used to compare the overall survival of different treatment groups, and Cox-regression analysis was used to evaluate...
Managerial strategies and behavior in networks
O'Toole, Laurence J.; Meier, Kenneth J.
2001-01-01
This manuscript provides the first systematic test of a formal theory of managing government programs in a network context (see O’Toole and Meier 1999). Using data from several hundred school districts in Texas, we create a measure of network management that reflects the time school superintendents
Fundamental Plane of FSRQs from SDSS DR5 Quasar Catalogue ...
Indian Academy of Sciences (India)
Introduction. The formation of relativistic jets in active galactic nuclei (AGNs) is still unclear due to fundamental problems in astrophysics (Meier et al. 2001). Although the jet formation remains unclear, the relationships explored between the jet emission and accretion processes have been explored by many authors ...
Absolute, Extreme-Ultraviolet Solar Spectral Irradiance Monitor (AESSIM)
1994-04-01
molecular constituents [Meier 1991]. This radiation is the principal source of energy for producing and maintaining the complex, time-dependent, thermal...158.4 nm emisions for interstellar wind studies. After -2005, there is unlikely to be sufficient power to provide the requisite heating of the scan
Survival analysis II: Cox regression
Stel, Vianda S.; Dekker, Friedo W.; Tripepi, Giovanni; Zoccali, Carmine; Jager, Kitty J.
2011-01-01
In contrast to the Kaplan-Meier method, Cox proportional hazards regression can provide an effect estimate by quantifying the difference in survival between patient groups and can adjust for confounding effects of other variables. The purpose of this article is to explain the basic concepts of the
STAT3 inhibitor enhances chemotherapy drug efficacy by ...
African Journals Online (AJOL)
Immunohistochemistry and Kaplan-Meier method of survival analysis were used to determine chemoresistance trends in patients. STAT3 inhibitor treatment, RNAi or ectopic overexpression of STAT3 or MUC1 in NSCLC cells were used to determine their inter-molecular relation and for modulating stemness-related genes.
The influence of obesity on response to tumour necrosis factor-α inhibitors in psoriatic arthritis
DEFF Research Database (Denmark)
Højgaard, Pil; Glintborg, Bente; Kristensen, Lars Erik
2016-01-01
OBJECTIVES: To investigate the impact of obesity on response to the first TNF-α inhibitor (TNFI) treatment course in patients with PsA followed in routine care. METHODS: We performed an observational cohort study based on the Danish and Icelandic biologics registries. Kaplan-Meier plots, Cox and ...
In Situ Bioremediation of Perchlorate in Vadose Zone Source Areas
2011-01-01
tinder the NJDEP lab certification program. (2) Not available as· a certified para meier 11nder tire. NJDEP lab certification program, ( ’ ) 110...paramaters wrder the NJDEP lab cerlijication program. (2) Not available us a certif>ed parameter Tinder thi! NJDEP lab url!fication pragrarn. ( ) no
Is there racial/ethnic variance in cervical cancer- specific survival of ...
African Journals Online (AJOL)
incident cervical carcinoma, between 1992 and 1999, in the Surveillance Epidemiology and End Results (SEER) Data was linked with Medicare to examine the impact of race/ethnicity on overall and cancer-specific survival, using Kaplan Meier survival estimates and multivariable Cox Regression model. Results: There was ...
Survival Analysis of Patients with End Stage Renal Disease
Urrutia, J. D.; Gayo, W. S.; Bautista, L. A.; Baccay, E. B.
2015-06-01
This paper provides a survival analysis of End Stage Renal Disease (ESRD) under Kaplan-Meier Estimates and Weibull Distribution. The data were obtained from the records of V. L. MakabaliMemorial Hospital with respect to time t (patient's age), covariates such as developed secondary disease (Pulmonary Congestion and Cardiovascular Disease), gender, and the event of interest: the death of ESRD patients. Survival and hazard rates were estimated using NCSS for Weibull Distribution and SPSS for Kaplan-Meier Estimates. These lead to the same conclusion that hazard rate increases and survival rate decreases of ESRD patient diagnosed with Pulmonary Congestion, Cardiovascular Disease and both diseases with respect to time. It also shows that female patients have a greater risk of death compared to males. The probability risk was given the equation R = 1 — e-H(t) where e-H(t) is the survival function, H(t) the cumulative hazard function which was created using Cox-Regression.
Amiri, Zohreh; Mohammad, Kazem; Mahmoudi, Mahmood; Parsaeian, Mahbubeh; Zeraati, Hojjat
2013-01-01
There are numerous unanswered questions in the application of artificial neural network models for analysis of survival data. In most studies, independent variables have been studied as qualitative dichotomous variables, and results of using discrete and continuous quantitative, ordinal, or multinomial categorical predictive variables in these models are not well understood in comparison to conventional models. This study was designed and conducted to examine the application of these models in order to determine the survival of gastric cancer patients, in comparison to the Cox proportional hazards model. We studied the postoperative survival of 330 gastric cancer patients who suffered surgery at a surgical unit of the Iran Cancer Institute over a five-year period. Covariates of age, gender, history of substance abuse, cancer site, type of pathology, presence of metastasis, stage, and number of complementary treatments were entered in the models, and survival probabilities were calculated at 6, 12, 18, 24, 36, 48, and 60 months using the Cox proportional hazards and neural network models. We estimated coefficients of the Cox model and the weights in the neural network (with 3, 5, and 7 nodes in the hidden layer) in the training group, and used them to derive predictions in the study group. Predictions with these two methods were compared with those of the Kaplan-Meier product limit estimator as the gold standard. Comparisons were performed with the Friedman and Kruskal-Wallis tests. Survival probabilities at different times were determined using the Cox proportional hazards and a neural network with three nodes in the hidden layer; the ratios of standard errors with these two methods to the Kaplan-Meier method were 1.1593 and 1.0071, respectively, revealed a significant difference between Cox and Kaplan-Meier (P neural network, and the neural network and the standard (Kaplan-Meier), as well as better accuracy for the neural network (with 3 nodes in the hidden layer
Age at sexual initiation and factors associated with it among youths ...
African Journals Online (AJOL)
Bernt Lindtjorn
Objective: The objective of the study was to determine the median age at first sexual intercourse and the associated .... Wollo Zone, Amhara National Regional State, North East ..... censored. Urba n. Rura l. Residence rural/urban. Fig 2: Kaplan Meier curve showing log survival for ..... renting and selling pornography films.
South African Gastroenterology Review - Vol 8, No 3 (2010)
African Journals Online (AJOL)
A clinical audit of inflammatory bowel disease in a South African tertiary institution · EMAIL FULL TEXT EMAIL FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. L Indiveri, R Berman, M Bhagowat, K Govender, W Meier, A Payne, P Poncana, C Pryce, S Seetahal, M Selela, AD Mahomed.
A NEW CLASSIFICATION OF OSTEOMYELITIS FOR DEVELOPING ...
African Journals Online (AJOL)
Kateee
2003-07-01
Jul 1, 2003 ... Background : The term osteomyelitis (OSM) was first coined by Nelaton in 1844. Waldvogel et al, Cierny-Mader, May et al classifications of OSM from developed countries and Meier et al's from Nigeria have been described. Objective:This new classification was developed to highlight significant pathology ...
Epilepsy in Rett syndrome--lessons from the Rett networked database
DEFF Research Database (Denmark)
Nissenkorn, Andreea; Levy-Drummer, Rachel S; Bondi, Ori
2015-01-01
collected. Statistical analysis was done using the IBM SPSS Version 21 software, logistic regression, and Kaplan-Meier survival curves. RESULTS: Epilepsy was present in 68.1% of the patients, with uncontrolled seizures in 32.6% of the patients with epilepsy. Mean age of onset of epilepsy was 4...
Survival of Root-filled Teeth in the Swedish Adult Population
DEFF Research Database (Denmark)
Fransson, Helena; Dawson, Victoria S; Frisk, Fredrik
2016-01-01
INTRODUCTION: The aim was to assess survival in the Swedish population of teeth treated by nonsurgical root canal treatment during 2009. METHODS: Data from the Swedish Social Insurance Agency were analyzed by Kaplan-Meier analysis to assess cumulative tooth survival during a period of 5-6 years o...
Cryptanalysis of the LAKE Hash Family
DEFF Research Database (Denmark)
Biryukov, Alex; Gauravaram, Praveen; Guo, Jian
2009-01-01
We analyse the security of the cryptographic hash function LAKE-256 proposed at FSE 2008 by Aumasson, Meier and Phan. By exploiting non-injectivity of some of the building primitives of LAKE, we show three different collision and near-collision attacks on the compression function. The first attac...
DEFF Research Database (Denmark)
Meier, Ninna
2016-01-01
In this feature essay, Ninna Meier explores the relationship between time, space and academic writing. She ponders the ‘portable magic’ of research: namely, the capacity for our thoughts to be both grounded in a particular point in time and space and yet simultaneously ‘free from these dimensions...
International Nuclear Information System (INIS)
Kyndi, M.; Alsner, J.; Nielsen, H.M.; Overgaard, J.; Soerensen, F.B.; Knudsen, H.; Overgaard, M.
2008-01-01
Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b and c studies. Tissue microarray sections were stained with immunohistochemistry for p53 and BCL2. Median potential follow-up was 17 years. Clinical endpoints were locoregional recurrence (LRR), distant metastases (DM), overall mortality, and overall survival (OS). Statistical analyses included Kappa statistics, χ2 or exact tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots showed reduced OS and improved DM and LRR probabilities after PMRT within subgroups of both p53 negative and p53 positive patients. Negative BCL2 expression was significantly associated with increased overall mortality, DM and LRR probability in multivariate Cox regression analyses. Kaplan-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2 and randomization status. Significant reductions in LRR probability after PMRT were recorded within both the BCL2 positive and BCL2 negative subgroups. Conclusion. p53 was not associated with survival after radiotherapy in high-risk breast cancer, but BCL2 might be
de Wit, R.; van den Berg, H.; Burghouts, J.; Nortier, J.; Slee, P.; Rodenburg, C.; Keizer, J.; Fonteyn, M.; Verweij, J.; Wils, J.
1998-01-01
We have reported previously that the anti-emetic efficacy of single agent 5HT3 antagonists is not maintained when analysed with the measurement of cumulative probabilities. Presently, the most effective anti-emetic regimen is a combination of a 5HT3 antagonist plus dexamethasone. We, therefore, assessed the sustainment of efficacy of such a combination in 125 patients, scheduled to receive cisplatin > or = 70 mg m(-2) either alone or in combination with other cytotoxic drugs. Anti-emetic therapy was initiated with 10 mg of dexamethasone and 3 mg of granisetron intravenously, before cisplatin. On days 1-6, patients received 8 mg of dexamethasone and 1 mg of granisetron twice daily by oral administration. Protection was assessed during all cycles and calculated based on cumulative probability analyses using the method of Kaplan-Meier and a model for transitional probabilities. Irrespective of the type of analysis used, the anti-emetic efficacy of granisetron/dexamethasone decreased over cycles. The initial complete acute emesis protection rate of 66% decreased to 30% according to the method of Kaplan-Meier and to 39% using the model for transitional probabilities. For delayed emesis, the initial complete protection rate of 52% decreased to 21% (Kaplan-Meier) and to 43% (transitional probabilities). In addition, we observed that protection failure in the delayed emesis period adversely influenced the acute emesis protection in the next cycle. We conclude that the anti-emetic efficacy of a 5HT3 antagonist plus dexamethasone is not maintained over multiple cycles of highly emetogenic chemotherapy, and that the acute emesis protection is adversely influenced by protection failure in the delayed emesis phase. PMID:9652766
Energy Technology Data Exchange (ETDEWEB)
Rieger, J.; Linsenmaier, U.; Fedorowski, A.; Pfeifer, K.J. [Ludwig-Maximilians-Universitaet Muenchen (Germany). Inst. fuer Klinische Radiologie; Hautmann, H.; Huber, R.M. [Klinikum Innenstadt der Ludwig-Maximilians-Universitaet Muenchen (Germany). Abteilung Pulmonologie, Medizinische Klinik
2002-08-01
Study objectives: Assessment of the therapeutic potential of tracheobronchial stenting for obstructive tracheobronchial disease, in-vivo comparison of different stent types and development of helpful criteria for choosing the suitable stent type. Material and Methods: Prospective case analysis. Between 1993 and 1999 53 stents were implanted into the tracheobronchial system of 39 consecutive patients with benign or malignant airway obstruction. Every single stent (26 Strecker Stents, 18 Wallstents, 6 Accuflex Nitinolstents, 1 Dumon-, 1 Ruesch- and 1 Palmazstent) was recorded in an unified database. Analysis comprised clinical effectiveness, lung function if possible, relevant complications and radiologic follow-up parameters. The probability of their remaining within the tracheobronchial system, of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for three stent types. Results: Stent placement proved itself to be an effective treatment in 86% of the patients. Resistance could be normalized in 9/9 patients. Kaplan-Meier analysis clearly revealed a higher probability for the Wall- and Nitinolstent to remain within the tracheobronchial system and to remain uncompressed. Dislocation also occurred more rarely. Explanation of the Wallstent, however, if desired, was much more difficult compared to the Strecker stent. The Wallstent also occasionally led to the formation of granulation tissue especially at the proximal stent end and, as such, required reintervention. (orig.) [German] Ziel: Erfassung des therapeutischen Potenzials der Stentbehandlung bei tracheobronchialen Stenosen, in-vivo Vergleich verschiedener Stenttypen und Erarbeitung von geeigneten Kriterien zur Stentwahl. Material und Methodik: Prospektive Fallanalyse. Zwischen 1993 und 1999 wurden insgesamt 53 Stents in das Tracheobronichalsystem von 39 konsekutiven Patienten implantiert. Jeder einzelne Stent (26 Streckerstents, 18 Wallstents, 6 Nitinolstents, ein Dumonstent
ASURV: Astronomical SURVival Statistics
Feigelson, E. D.; Nelson, P. I.; Isobe, T.; LaValley, M.
2014-06-01
ASURV (Astronomical SURVival Statistics) provides astronomy survival analysis for right- and left-censored data including the maximum-likelihood Kaplan-Meier estimator and several univariate two-sample tests, bivariate correlation measures, and linear regressions. ASURV is written in FORTRAN 77, and is stand-alone and does not call any specialized libraries.
Resources for Topics in Architecture.
Van Noate, Judith, Comp.
This guide for conducting library research on topics in architecture or on the work of a particular architect presents suggestions for utilizing four categories of resources: books, dictionaries and encyclopedias, indexes, and a periodicals and series list (PASL). Two topics are researched as examples: the contemporary architect Richard Meier, and…
First line chemotherapy plus trastuzumab in metastatic breast cancer ...
African Journals Online (AJOL)
First line chemotherapy plus trastuzumab in metastatic breast cancer HER2 positive - Observational institutional study. ... The progression free survival was estimated by the Kaplan-Meier method, from the date of first cycle to the date of progression or at the last consultation, and the median was 12.8 months. Trastuzumab ...
Influence of antiviral therapy on survival of patients with hepatitis B ...
African Journals Online (AJOL)
The mortality rates in two groups were evaluated with Kaplan-Meier estimate. ... 274 (76.9 %) died, with 89 patients belonging to the antiviral group while the ... TACE is different from systemic ... and identification of study participants was not ..... Table 3: Cox regression analysis to deteermine variables associated with overall ...
DEFF Research Database (Denmark)
Kirk, O; Mocroft, A; Pradier, C
2001-01-01
-up within the EuroSIDA study. METHODS: Changes in plasma viral load (pVL) and CD4 cell count from baseline were compared between treatment groups. Time to new AIDS-defining events and death were compared in Kaplan--Meier models, and Cox models were established to further assess differences in clinical...
Millele pöörate eluaseme ostmisel ja üürimisel tähelepanu?
2005-01-01
Küsimusele vastavad Brüsselis tööd otsiv Kadri Kuusk, Sampo Panga koolitusosakonna juhataja Külli Meier, finantsinspektsiooni osakonnajuhataja Andre Nõmm, Riigikogu liige Meelis Atonen, Palivere lastekodu juhataja Külle Saar, Helsingis töötav arst Jaak Kiviloog, Narva kooliõpetaja Julia Ivanova, maksu- ja tolliameti peaspetsialist Tiiu Kilk
Kirik aastaks 2000 / Triin Ojari
Ojari, Triin, 1974-
1998-01-01
Katoliku kirik tahab aasta 2000 kirikuga tähistada kolmanda kristliku aastatuhande algamist. Rooma äärelinna Tor Tre Testesse planeeritava kiriku konkursi võitis R. Meier. Lihtsa ristkülikulise saaliga kiriku dominandiks on kolm üksteise taga asuvat kaarduvat seina (kolmainsus!), mille klaasitud 'õhuvahed' toimivad valgusallikaina, klaasist on ka katus.
DEFF Research Database (Denmark)
Andersson, U.; Osterman, P.; Sjostrom, S.
2009-01-01
was analysed using Kaplan-Meier estimates and equality of survival distributions using the log-rank test and Cox proportional hazard ratios. The MNS16A genotype was not associated with risk of occurrence of glioma, glioblastoma (GBM) or meningioma. For GBM there were median survivals of 15.3, 11.0 and 10...
Birth interval and its predictors among married women in Dabat ...
African Journals Online (AJOL)
2008-12-30
Birth intervals (time between two successive live births) if short are associated with diverse complications. We assessed birth interval and its predictors among 613 married women who gave birth from January 1 to December 30, 2008. Data were collected in April 2012. Life table and Kaplan-Meier curve were used to ...
DEFF Research Database (Denmark)
Meier, Ninna
2016-01-01
In this feature essay, Ninna Meier reflects on the materiality of the writing – and re-writing – process in academic research. She explores the ways in which our ever-accummulating thoughts come to form layers on the material objects in which we write our notes and discusses the pleasures of co-authorship....
Long-Term Survivors Using Intraoperative Radiotherapy for Recurrent Gynecologic Malignancies
International Nuclear Information System (INIS)
Tran, Phuoc T.; Su Zheng; Hara, Wendy; Husain, Amreen; Teng, Nelson; Kapp, Daniel S.
2007-01-01
Purpose: To analyze the outcomes of therapy and identify prognostic factors for patients treated with surgery followed by intraoperative radiotherapy (IORT) for gynecologic malignancies at a single institution. Methods and Materials: We performed a retrospective review of 36 consecutive patients treated with IORT to 44 sites with mean follow-up of 50 months. The primary site was the cervix in 47%, endometrium in 31%, vulva in 14%, vagina in 6%, and fallopian tubes in 3%. Previous RT had failed in 72% of patients, and 89% had recurrent disease. Of 38 IORT sessions, 84% included maximal cytoreductive surgery, including 18% exenterations. The mean age was 52 years (range, 30-74), mean tumor size was 5 cm (range, 0.5-12), previous disease-free interval was 32 months (range, 0-177), and mean IORT dose was 1,152 cGy (range, 600-1,750). RT and systemic therapy after IORT were given to 53% and 24% of the cohort, respectively. The outcomes measured were locoregional control (LRC), distant metastasis-free survival (DMFS), disease-specific survival (DSS), and treatment-related complications. Results: The Kaplan-Meier 5-year LRC, DMFS, and DSS probability for the whole group was 44%, 51%, and 47%, respectively. For cervical cancer patients, the Kaplan-Meier 5-year LRC, DMFS, and DSS estimate was 45%, 60%, and 46%, respectively. The prognostic factors found on multivariate analysis (p ≤ 0.05) were the disease-free interval for LRC, tumor size for DMFS, and cervical primary, previous surgery, and locoregional relapse for DSS. Our cohort had 10 Grade 3-4 complications associated with treatment (surgery and IORT) and a Kaplan-Meier 5-year Grade 3-4 complication-free survival rate of 72%. Conclusions: Survival for pelvic recurrence of gynecologic cancer is poor (range, 0-25%). IORT after surgery seems to confer long-term local control in carefully selected patients
Assefa, Yibeltal; Worku, Alemayehu; Wouters, Edwin; Koole, Olivier; Haile Mariam, Damen; Van Damme, Wim
2012-01-01
Patient retention in care is a critical challenge for antiretroviral treatment programs. This is mainly because retention in care is related to adherence to treatment and patient survival. It is therefore imperative that health facilities and programs measure patient retention in care. However, the currently available tools, such as Kaplan Meier, for measuring retention in care have a lot of practical limitations. The objective of this study was to develop simplified tools for measuring retention in care. Retrospective cohort data were collected from patient registers in nine health facilities in Ethiopia. Retention in care was the primary outcome for the study. Tools were developed to measure "current retention" in care during a specific period of time for a specific "ART-age group" and "cohort retention" in care among patients who were followed for the last "Y" number of years on ART. "Probability of retention" based on the tool for "cohort retention" in care was compared with "probability of retention" based on Kaplan Meier. We found that the new tools enable to measure "current retention" and "cohort retention" in care. We also found that the tools were easy to use and did not require advanced statistical skills. Both "current retention" and "cohort retention" are lower among patients in the first two "ART-age groups" and "ART-age cohorts" than in subsequent "ART-age groups" and "ART-age cohorts". The "probability of retention" based on the new tools were found to be similar to the "probability of retention" based on Kaplan Meier. The simplified tools for "current retention" and "cohort retention" will enable practitioners and program managers to measure and monitor rates of retention in care easily and appropriately. We therefore recommend that health facilities and programs start to use these tools in their efforts to improve retention in care and patient outcomes.
Directory of Open Access Journals (Sweden)
Yibeltal Assefa
Full Text Available INTRODUCTION: Patient retention in care is a critical challenge for antiretroviral treatment programs. This is mainly because retention in care is related to adherence to treatment and patient survival. It is therefore imperative that health facilities and programs measure patient retention in care. However, the currently available tools, such as Kaplan Meier, for measuring retention in care have a lot of practical limitations. The objective of this study was to develop simplified tools for measuring retention in care. METHODS: Retrospective cohort data were collected from patient registers in nine health facilities in Ethiopia. Retention in care was the primary outcome for the study. Tools were developed to measure "current retention" in care during a specific period of time for a specific "ART-age group" and "cohort retention" in care among patients who were followed for the last "Y" number of years on ART. "Probability of retention" based on the tool for "cohort retention" in care was compared with "probability of retention" based on Kaplan Meier. RESULTS: We found that the new tools enable to measure "current retention" and "cohort retention" in care. We also found that the tools were easy to use and did not require advanced statistical skills. Both "current retention" and "cohort retention" are lower among patients in the first two "ART-age groups" and "ART-age cohorts" than in subsequent "ART-age groups" and "ART-age cohorts". The "probability of retention" based on the new tools were found to be similar to the "probability of retention" based on Kaplan Meier. CONCLUSION: The simplified tools for "current retention" and "cohort retention" will enable practitioners and program managers to measure and monitor rates of retention in care easily and appropriately. We therefore recommend that health facilities and programs start to use these tools in their efforts to improve retention in care and patient outcomes.
Cheung, Li C; Pan, Qing; Hyun, Noorie; Schiffman, Mark; Fetterman, Barbara; Castle, Philip E; Lorey, Thomas; Katki, Hormuzd A
2017-09-30
For cost-effectiveness and efficiency, many large-scale general-purpose cohort studies are being assembled within large health-care providers who use electronic health records. Two key features of such data are that incident disease is interval-censored between irregular visits and there can be pre-existing (prevalent) disease. Because prevalent disease is not always immediately diagnosed, some disease diagnosed at later visits are actually undiagnosed prevalent disease. We consider prevalent disease as a point mass at time zero for clinical applications where there is no interest in time of prevalent disease onset. We demonstrate that the naive Kaplan-Meier cumulative risk estimator underestimates risks at early time points and overestimates later risks. We propose a general family of mixture models for undiagnosed prevalent disease and interval-censored incident disease that we call prevalence-incidence models. Parameters for parametric prevalence-incidence models, such as the logistic regression and Weibull survival (logistic-Weibull) model, are estimated by direct likelihood maximization or by EM algorithm. Non-parametric methods are proposed to calculate cumulative risks for cases without covariates. We compare naive Kaplan-Meier, logistic-Weibull, and non-parametric estimates of cumulative risk in the cervical cancer screening program at Kaiser Permanente Northern California. Kaplan-Meier provided poor estimates while the logistic-Weibull model was a close fit to the non-parametric. Our findings support our use of logistic-Weibull models to develop the risk estimates that underlie current US risk-based cervical cancer screening guidelines. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.
Role of IKK-alpha in the EGFR Signaling Regulation
2014-09-01
expression. (E) Kaplan -Meier overall survival curves of IKKin breast cancer patient data set. 16 Reference 1. Lo, H. W., Xia, W., Wei, Y...150- 100- 50- 150- 100- Twist1 AKT1-p AKT-T C 250- 150- 100- N-cad P1 P2 P3 TGFβ - - - + + - + + - - + - - + + + - - + - - + + + 50- Vimentin 150- 100
It's Not Easy to Stand up to Cyberbullies, but We Must
O'Neil, Robert M.
2008-01-01
A decade ago, the Supreme Court was almost ready to confer First Amendment protection on the "Internet" believing that it was sufficiently benign. Little did everyone anticipate how different that rosy view might seem today. Several troubling developments have occurred within the past months. Megan Meier, a 13-year-old in Missouri, was apparently…
Energy Technology Data Exchange (ETDEWEB)
Pietrobon, Claudio E. [Universidade Estadual de Maringa, PR (Brazil). Dept. de Engenharia Civil]. E-mail: carmen@cybertelecom.com.br; Lamberts, Roberto [Santa Catarina Univ., Florianopolis, SC (Brazil). Dept. de Engenharia Civil]. E-mail: lamberts@ecv.ufsc.br; Pereira, Fernando O.R. [Santa Catarina Univ., Florianopolis, SC (Brazil). Dept. de Arquitetura e Urbanismo]. E-mail: feco@arq.ufsc.br
2000-07-01
This review paper presents the research made in USA, including studies made by the Lawrence Berkeley Laboratory - University of California and the review papers made by MEIER(1991) and GIVONI(1991). Also, it presents brazilian studies and research about landscaping strategies to climatic mitigation, visual comfort and electric energy conservation on the built environment. (author)
2012-07-27
56 stock solution and 75 ml of the 16 dilution buffer was mixed with 25 ml of the supernatant, incubated for 30 min at 65 oC to inactivate endogenous ...shock by staphylococcal pyrogenic exotoxin type C. Infect Immun 36: 123–128. Meier survival analysis and log-rank tests were performed to compare
[Application of Competing Risks Model in Predicting Smoking Relapse Following Ischemic Stroke].
Hou, Li-Sha; Li, Ji-Jie; Du, Xu-Dong; Yan, Pei-Jing; Zhu, Cai-Rong
2017-07-01
To determine factors associated with smoking relapse in men who survived from their first stroke. Data were collected through face to face interviews with stroke patients in the hospital, and then repeated every three months via telephone over the period from 2010 to 2014. Kaplan-Meier method and competing risk model were adopted to estimate and predict smoking relapse rates. The Kaplan-Meier method estimated a higher relapse rate than the competing risk model. The four-year relapse rate was 43.1% after adjustment of competing risk. Exposure to environmental tobacco smoking outside of home and workplace (such as bars and restaurants) ( P =0.01), single ( P <0.01), and prior history of smoking at least 20 cigarettes per day ( P =0.02) were significant predictors of smoking relapse. When competing risks exist, competing risks model should be used in data analyses. Smoking interventions should give priorities to those without a spouse and those with a heavy smoking history. Smoking ban in public settings can reduce smoking relapse in stroke patients.
Duration of Psoriatic Skin Disease as Risk Factor for Subsequent Onset of Psoriatic Arthritis
DEFF Research Database (Denmark)
Egeberg, Alexander; Skov, Lone; Zachariae, Claus
2018-01-01
It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA). Survival analysis and Kaplan-Meier life table techniques were used. The study comprised 10,011 psoria......It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA). Survival analysis and Kaplan-Meier life table techniques were used. The study comprised 10......,011 psoriasis patients (severe n = 4,618), and 1,269 patients also had PsA. Incidence of PsA increased with duration of cutaneous symptoms (p = 0.0001). Psoriasis diagnosed before age 20 or 30 years, respectively, suggested a lower risk of PsA than psoriasis diagnosed after age 50 years, yet age at first...... cutaneous symptoms did not predict development of PsA. No clear association with disease severity was found. PsA incidence appeared stable with longer duration of psoriasis, but further data are needed to firmly establish the relationship with age of psoriasis onset....
Leybovitz-Haleluya, Noa; Wainstock, Tamar; Landau, Daniella; Sheiner, Eyal
2018-06-01
Cigarette smoke is a well-known reproductive toxicant. We aimed to study the long-term effect of cigarette smoking during pregnancy on the risk for childhood cardiovascular morbidity of the offspring. A population-based cohort analysis was performed comparing total and subtypes of cardiovascular related pediatric hospitalizations among offspring of smoking mothers versus offspring of non-smoking mothers. The analysis included all singletons born between the years 1999-2014.A Kaplan-Meier survival curve was used to compare the cumulative cardiovascular morbidity, and a Cox proportional hazards model was constructed to adjust for confounders. The study population included 242,342 newborns which met inclusion criteria; among them 2861 were born to smoking mothers. Offspring of smoking mothers had higher rates of cardiovascular-related hospitalizations (1.3% vs. 0.6%, OR 2.1, 95% CI 1.5-2.9; p < 0.001; Kaplan-Meier log-rank test p < 0.001). Smoking exposure during pregnancy is associated with an increased risk for long-term pediatric cardiovascular morbidity of the offspring. Copyright © 2018 Elsevier Inc. All rights reserved.
ÜRO peakorterile otsitakse naabrit / Maria-Kristiina Soomre
Soomre, Maria-Kristiina, 1978-
2001-01-01
New Yorki, ÜRO peakorterist lõunasse hakatakse ehitama uut hoonet. Arhitektuurikonkursist on kutsutud osalema: David Childs, Richard Meier ja Peter Eisenmann; Schuman Lichtenstein Claman Efron ja HOK arhitektid; Kohn Pederson Fox, Davis Brody Bond, Toyo Ito ja Rem Koolhaas; Henry Cobb, James Ingo Freed ja Machado & Silvetti Associates; Christian de Portzamparc ja Gary Edward Handel & Associates
Fish freshness estimation using eye image processing under white and UV lightings
Kanamori, Katsuhiro; Shirataki, Yuri; Liao, Qiuhong; Ogawa, Yuichi; Suzuki, Tetsuhito; Kondo, Naoshi
2017-05-01
A non-destructive method of estimating the freshness of fish is required for appropriate price setting and food safety. In particular, for determining the possibility of eating raw fish (sashimi), freshness estimation is critical. We studied such an estimation method by capturing images of fish eyes and performing image processing using the temporal changes of the luminance of pupil and iris. To detect subtle non-visible changes of these features, we used UV (375 nm) light illumination in addition to visible white light illumination. Polarization and two-channel LED techniques were used to remove strong specular reflection from the cornea of the eye and from clear-plastic wrap used to cover the fish to maintain humidity. Pupil and iris regions were automatically detected separately by image processing after the specular reflection removal process, and two types of eye contrast were defined as the ratio of mean and median pixel values of each region. Experiments using 16 Japanese dace (Tribolodon hakonensis) at 23° and 85% humidity for 24 hours were performed. The eye contrast of raw fish increase non-linearly in the initial period and then decreased; however, that of frozen-thawed fish decreased linearly throughout 24 hours, regardless of the lighting. Interestingly, the eye contrast using UV light showed a higher correlation with time than that using white light only in the case of raw fish within the early 6- hour period postmortem. These results show the possibility of estimating fish freshness in the initial stage when fish are eaten raw using white and UV lightings.
Creating an isotopically similar Earth–Moon system with correct ...
Indian Academy of Sciences (India)
Bryant M. Wyatt
2018-03-13
Mar 13, 2018 ... SCOTT A. COOK1, JOHN H. GRESHAM1, MICHAEL F. HIBBS3 and. SHAUKAT N. ... ical impact (Benz et al. 1986 ... the impactor (Meier 2012; Zhang et al. 2012). .... (B–G) Snap shots 0.49, 1.95, 3.82, 5.13, 9.28, and 15.32 hours into the collision. (H) Two ... funding; Robert W. Muth for insightful remarks and.
Montessori-skole: die ander kant
Directory of Open Access Journals (Sweden)
Monica Viljoen
1995-03-01
Full Text Available Na aanleiding van die artikel “Die invloed van die New Age-beweging op die onderwysagenda van die toekoms” deur Lien van Niekerk en Corinne Meier van die Departement Historiese Opvoedkunde van Unisa (vgl. Koers, 59 (1 1994:69-84 wil ek graag ’n ander sy van Montessori-skole onder die aandag van Koers lesers bring.
Maximilien Brice
2010-01-01
tirage 01-07: From left to right: Organiser M. Prola-Tessaur;Atelier Brückner Managing Director S. Brückner; Ambassador of Switzerland to the UN D. Martinelli; Rolex SA Director-General B. Meier; CERN Director-General R. Heuer; State Councillor of the Republic and Canton of Geneva in charge of the Department of PUblic Instruction, culture en sport C. Beer.
Naised, kes toovad naeratuse näole / Katrin Oja
Oja, Katrin
2006-01-01
Heast teenindusest räägivad Eesti Gaasi juhatuse esimehe assistent, Aasta Sekretär 2005 Tiivi Lind, lounge 8 baaridaam Kadri Kask ja Sampo Panga koolitusspetsialist, Aasta Teenindaja 2006 Aires Rühka. Kommenteerivad nende ülemused - Sampo Panga koolitusosakonna juhataja Külli Meier, Eesti Gaasi juhatuse esimees Aarne Saar ja lounge 8 mänedžer Heinar Õispuu
Can Video Games Be Educational?
Criswell, Chad
2009-01-01
One of the biggest debates among music educators today is about whether or not video games are a valid educational tool. As far back as the early 1990s, teachers were using games such as Sid Meier's Civilization to reinforce history and social studies concepts, but until recently games that dealt with areas of music education have been few and far…
Undusk, Jaan, 1958-
2005-01-01
Teksti aluseks on ettekanne 8. Balti vaimse koostöö konverentsil 16. juunil 2001 Tallinnas: Are we Basques of Baltic? The problem of how to be represented. Eesti k.: Looming, 2002, nr. 9. Orig.: Kas meist saavad balti baskid ehk kuidas olla esindatud?
Panasiti, V; Curzio, M; Roberti, V; Lieto, P; Devirgiliis, V; Gobbi, S; Naspi, A; Coppola, R; Lopez, T; di Meo, N; Gatti, A; Trevisan, G; Londei, P; Calvieri, S
2013-01-01
The last melanoma staging system of the 2009 American Joint Committee on Cancer takes into account, for stage IV disease, the serum levels of lactate dehydrogenase (LDH) and the site of distant metastases. Our aim was to compare the significance of metastatic volume, as evaluated at the time of stage IV melanoma diagnosis, with other clinical predictors of prognosis. We conducted a retrospective multicentric study. To establish which variables were statistically correlated both with death and survival time, contingency tables were evaluated. The overall survival curves were compared using the Kaplan-Meier method. Metastatic volume and number of affected organs were statistically related to death. In detail, patients with a metastatic volume >15 cm(3) had a worse prognosis than those with a volume lower than this value (survival probability at 60 months: 6.8 vs. 40.9%, respectively). The Kaplan-Meier method confirmed that survival time was significantly related to the site(s) of metastases, to elevated LDH serum levels and to melanoma stage according to the latest system. Our results suggest that metastatic volume may be considered as a useful prognostic factor for survival among melanoma patients.
MEKK1 is a Novel Regulator of the Dmp1-Arf-p53 Pathway and Prognostic Indicator in Breast Cancer
2012-12-01
hDMP1, INK4a/ARF, p53 or Hdm2 amplification. Kaplan -Meier analyses have been conducted to study the impact for the impact of loss or gain of each locus on...Palma P, Pellegrini S, Fina P et al. Mdm2 gene alterations and mdm2 protein expression in breast carcinomas. J Pathol 1995; 175: 31–38. 21 Turbin DA
2008-05-06
Ben-Amotz, A., 1985. Lipid and lipopoly- saccharide constituents of cyanobacterium Spirulina platensis (Cyanophyceae, Nostocales). Mar. Ecol. Prog...only been confirmed in liver and brain cells (Fischer et al., 2005; Meier- Abt et al., 2007). Once inside cells, microcystins and nodularins inhibit... assay ) or PPIA (protein phosphatase inhibition assay ) but the actual toxin responsible was not confirmed (i.e., confirmation by LC-MS, MALDI, or HPLC is
Application of Enlisted Force Retention Levels and Career Field Stability
2017-03-23
APPLICATION OF ENLISTED FORCE RETENTION LEVELS AND CAREER FIELD STABILITY THESIS Presented to the Faculty Department of Operational Sciences ...Fulfillment of the Requirements for the Degree of Master of Science in Operations Research Jamie T. Zimmermann, MS, BS Captain, USAF March 2017...Appendix B. The function proc lifetest is a nonparametric estimate of the survivor function using either the Kaplan-Meier method or the actuarial
Mawency Vergel Ortega; José Joaquín Martínez Lozano; Eduardo Ibargüen Mondragón
2016-01-01
The article shows factors associated with college desertion. The survival analysis technique allowed to perform a study with students from different programs at the Francisco de Paula Santander University, considering the events: semester, abandonment, punishment, punishment - abandonment. Using the Kaplan-Meier estimator [1], the survival function for each event of interest was estimated and desertion models whose variables were significant at 10% using the semi-parametric met...
Resultado do tratamento cirúrgico das neoplasias do seio piriforme
Directory of Open Access Journals (Sweden)
Costa Claudiney C.
2003-01-01
Full Text Available Os tumores da laringe e hipofaringe apresentam alta incidência no Brasil, sendo o sexto sítio mais comum entre os tumores malignos no sexo masculino. O diagnóstico inicial geralmente é realizado com lesões em estadio clínicos avançados diminuindo o sucesso do tratamento instituído. OBJETIVOS: Avaliar a evolução de 60 pacientes com carcinoma epidermóide de seio piriforme, considerando tratamento instituído, complicações e sobrevida estimada em 5 anos. FORMA DE ESTUDO: Estudo retrospectivo. MÉTODO: Os testes estatístico utilizados foram o método de Kaplan-Meier e o teste exato de Fisher. RESULTADOS: Dos 60 pacientes, 43 foram submetidos a tratamento cirúrgico seguido de radioterapia. Atualmente 27,9% estão vivos sem doença, 11,6% vivos com doença, 9,4% mortos sem doença, 34,8% mortos com doença e perda de seguimento de 16,3%. A complicação pós-operatória mais freqüente foi a fístula cutânea. A recidiva local ocorreu em 5 pacientes, regional em 6, loco-regional em 3 e metástase à distância em 6. Não houve correlação entre margem cirúrgica comprometida e sobrevida em 20 pacientes com recidiva tumoral (Teste de Fisher. Aplicando a curva de sobrevida atuarial pelo método Kaplan-Meier, obtivemos média de sobrevida em 5 anos de 23,2 meses. CONCLUSÃO: A principal complicação pós-operatória foi a fístula cutânea, sendo tratada clinicamente. A margem cirúrgica comprometida não alterou o prognóstico, apesar de ser sempre um dos princípios da cirurgia oncológica. A principal falha no tratamento foi a recidiva locorregional. A curva de sobrevida atuarial (Kaplan-Meier em cinco anos apresentou média de 23,2 meses.
Gustavsson, Mikael; Kreuger, Jenny; Bundschuh, Mirco; Backhaus, Thomas
2017-11-15
This paper presents the ecotoxicological assessment and environmental risk evaluation of complex pesticide mixtures occurring in freshwater ecosystems in southern Sweden. The evaluation is based on exposure data collected between 2002 and 2013 by the Swedish pesticide monitoring program and includes 1308 individual samples, detecting mixtures of up to 53 pesticides (modal=8). Pesticide mixture risks were evaluated using three different scenarios for non-detects (best-case, worst-case and using the Kaplan-Meier method). The risk of each scenario was analyzed using Swedish Water Quality Objectives (WQO) and trophic-level specific environmental thresholds. Using the Kaplan-Meier method the environmental risk of 73% of the samples exceeded acceptable levels, based on an assessment using Concentration-Addition and WQOs for the individual pesticides. Algae were the most sensitive organism group. However, analytical detection limits, especially for insecticides, were insufficient to analyze concentrations at or near their WQO's. Thus, the risk of the analyzed pesticide mixtures to crustaceans and fish is systematically underestimated. Treating non-detects as being present at their individual limit of detection increased the estimated risk by a factor 100 or more, compared to the best-case or the Kaplan-Meier scenario. Pesticide mixture risks are often driven by only 1-3 compounds. However, the risk-drivers (i.e., individual pesticides explaining the largest share of potential effects) differ substantially between sites and samples, and 83 of the 141 monitored pesticides need to be included in the assessment to account for 95% of the risk at all sites and years. Single-substance oriented risk mitigation measures that would ensure that each individual pesticide is present at a maximum of 95% of its individual WQO, would also reduce the mixture risk, but only from a median risk quotient of 2.1 to a median risk quotient of 1.8. Also, acceptable total risk levels would still
Role of IKK-alpha in EGFR Signaling Regulation
2013-09-01
heatmap. (B) Low expression of ΙΚΚα in TNBC cell lines. (C) Low expression of ΙΚΚα in TNBC cell lines. (D) Kaplan -Meier overall survival curves of...0.2 150- 100- 50- 150- 100- 0.5 50- 50- - - + + - + - + Vimentin E-cad N-cad 150- 100- 50- 150- 100- Twist1 AKT-p AKT-T C 250- 150- 100- N-cad P1 P2 P3
DEFF Research Database (Denmark)
Heeran, Mel C; Rask, Lene; Høgdall, Claus K
2015-01-01
of the disease. Using tissue arrays we analysed the expression levels in tissues from 166 women with borderline ovarian tumours (BOTs) and 592 women with ovarian cancer (OC). A panel of three antibodies was used for immunohistochemistry: a polyclonal and two monoclonal antibodies. Serum TN was measured using...... found to imply longer OS (p Kaplan-Meier survival analysis performed on all OC cases showed a significantly longer OS (p = 0...
Short-term mortality in patients with myocardial injury and myocardial infarction type 1 and type 2
DEFF Research Database (Denmark)
Sarkisian, Laura; Saaby, L.; Poulsen, T. S.
2015-01-01
-year period we prospectively studied hospitalized patients having cardiac troponin I (cTnI) measured on clinical indication. The diagnosis of type 1 and type 2 MI was according to the universal definition involving a rising and/or falling pattern of cTnI values above the decision limit of 30 ng/L. c....... The results are depicted in the figure (Kaplan-Meier curves, log-rank-test; p-value...
Directory of Open Access Journals (Sweden)
Muge Akmansu
2010-12-01
Full Text Available We presented 9 recurrent head and neck carcinoma patients. Priorly all of them had received radiochemotherapy. We used cetuximab and irradiation concomitantly. Overall survival analysis of the patients was performed using the Kaplan-Meier method on SPSS version 15.0. Based on this calculation, mean follow-up duration is 12.8 months. Mean survival time is 19.8 months and annual mean survival rate is 59.3%.
8TH International Laser Physics Workshop Lphys Budapest, July 2-6, 1999, Program
1999-07-05
Gerhard J. MUller (Germany) Rudolf Steiner (Germany) Symposium Status and Future Directions of High-Power Laser Installations Co-Chairs: See Leang...Sciences, Kazan. Russia I.A. Shcherbakov General Physics Institute. Russian Academy of Sciences. Moscow, Russia R. Steiner Institute of Laser Technologies...14.50-15.15 R. Steiner , A. Pohl, A. Bentele, T. Meier (Ulm, Germany) Laser Doppler sensor for laser assisted injection 30 SEMINAR 5 --- LASER METHODS IN
The Feeding Behaviour of Fish from the Upper Lake Baikal Watershed of the Eroo River in Mongolia
Directory of Open Access Journals (Sweden)
Sudeep Chandra
2005-06-01
Full Text Available The upper Selenge watershed in Mongolia is home to some of the world’s unique fish species. In this study we determined the feeding behaviour of selected fish species collected from the main stream of the Eroo River and two of its upstream tributaries, the Sharlan and Bar Chuluut rivers. Using stable isotope (carbon and nitrogen measurements combined with qualitative and literature information, we determined that taimen ( Hucho taimen and pike ( Esox luceus were the top predators in the Eroo River. They received a substantial amount of their energy from other fish species as well as terrestrial derived sources. Percent presence of biota in lenok ( Brachymystax lenok stomachs demonstrated they eat zoobenthos, invertebrates, fish, and terrestrial rodents. Siberian dace ( Leuciscus baicalensis , a small forage fish collected from the Sharlan and Bar Chuluut rivers demonstrate these fish eat periphyton, zoobenthos and terrestrial invertebrates. In the Bar Chuluut tributary, lenok eat a combination of foods including zoobenthos and other fish species, while arctic grayling ( Thymallus arcticus fed primarily on zoobenthos. Percent frequency analysis showed the two game fish species collected from the Bar Chuluut tributary fed primarily on zoobenthos (85 % for lenok and 80 % for grayling, with 28 families and 10 orders represented in their stomachs. Interviews with families suggested local people fish for a variety of species and that there has been a decline in the catch of taimen and sturgeon ( Acipenser baeri baicalensis over time. Since fishing was poor below highly disturbed areas (e.g. mine sites, local people fished above mine locations or in areas least impacted by these anthropogenic impacts.
Interdisciplinary interventional therapy for tracheobronchial stenosis with modern metal net stents
International Nuclear Information System (INIS)
Rieger, J.; Linsenmaier, U.; Fedorowski, A.; Pfeifer, K.J.; Hautmann, H.; Huber, R.M.
2002-01-01
Study objectives: Assessment of the therapeutic potential of tracheobronchial stenting for obstructive tracheobronchial disease, in-vivo comparison of different stent types and development of helpful criteria for choosing the suitable stent type. Material and Methods: Prospective case analysis. Between 1993 and 1999 53 stents were implanted into the tracheobronchial system of 39 consecutive patients with benign or malignant airway obstruction. Every single stent (26 Strecker Stents, 18 Wallstents, 6 Accuflex Nitinolstents, 1 Dumon-, 1 Ruesch- and 1 Palmazstent) was recorded in an unified database. Analysis comprised clinical effectiveness, lung function if possible, relevant complications and radiologic follow-up parameters. The probability of their remaining within the tracheobronchial system, of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for three stent types. Results: Stent placement proved itself to be an effective treatment in 86% of the patients. Resistance could be normalized in 9/9 patients. Kaplan-Meier analysis clearly revealed a higher probability for the Wall- and Nitinolstent to remain within the tracheobronchial system and to remain uncompressed. Dislocation also occurred more rarely. Explanation of the Wallstent, however, if desired, was much more difficult compared to the Strecker stent. The Wallstent also occasionally led to the formation of granulation tissue especially at the proximal stent end and, as such, required reintervention. (orig.) [de
Radiologic Placement of Tunneled Central Venous Catheters in Pediatric Patients
International Nuclear Information System (INIS)
Kim, Eun Ji; Song, Soon Young; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Jeong, Woo Kyoung; Lee, Yong Ho
2010-01-01
We evaluated the technical success and complication rates associated with the radiological placement of tunneled central venous catheters in pediatric patients. Between May 1, 2005 and March 31, 2008, a total of 46 tunneled central venous catheters were placed in 34 children (M:F = 22:12; mean age, 9.9 years [9 months to 16.8 years]). All procedures were performed under ultrasonographic and fluoroscopic guidance. Follow-up data were obtained through the retrospective review of the medical records. We used the Kaplan-Meier survival method for the evaluation of survival rate of the catheters. All procedures were technically successful. The observed periprocedural complications included hematoma formation in three patients. The mean catheter life was 189.3 days (total, 8710 days; range, 7-810). Catheters were removed due to death (n=9), the end of treatment (n=8), catheter sepsis (n=4), malfunction (n=8), and accidental removal (n=4). The rate of catheter sepsis and malfunction was 0.459 and 0.919 for every 1000 catheter days, respectively. The expected mean catheter life was 479.6 days as per the Kaplan- Meier analysis. The results suggest that the radiologic placement of a tunneled central venous catheter is an effective technique with a high technical success rate and low complication rate
International Nuclear Information System (INIS)
Wu, Jianing; Yan, Shaoze; Zuo, Ming J.
2016-01-01
Mechanism reliability is defined as the ability of a certain mechanism to maintain output accuracy under specified conditions. Mechanism reliability is generally assessed by the classical direct probability method (DPM) derived from the first order second moment (FOSM) method. The DPM relies strongly on the analytical form of the dynamic solution so it is not applicable to multi-body mechanisms that have only numerical solutions. In this paper, an indirect probability model (IPM) is proposed for mechanism reliability evaluation of multi-body mechanisms. IPM combines the dynamic equation, degradation function and Kaplan–Meier estimator to evaluate mechanism reliability comprehensively. Furthermore, to reduce the amount of computation in practical applications, the IPM is simplified into the indirect probability step model (IPSM). A case study of a crank–slider mechanism with clearance is investigated. Results show that relative errors between the theoretical and experimental results of mechanism reliability are less than 5%, demonstrating the effectiveness of the proposed method. - Highlights: • An indirect probability model (IPM) is proposed for mechanism reliability evaluation. • The dynamic equation, degradation function and Kaplan–Meier estimator are used. • Then the simplified form of indirect probability model is proposed. • The experimental results agree well with the predicted results.
High serum uric acid concentration predicts poor survival in patients with breast cancer.
Yue, Cai-Feng; Feng, Pin-Ning; Yao, Zhen-Rong; Yu, Xue-Gao; Lin, Wen-Bin; Qian, Yuan-Min; Guo, Yun-Miao; Li, Lai-Sheng; Liu, Min
2017-10-01
Uric acid is a product of purine metabolism. Recently, uric acid has gained much attraction in cancer. In this study, we aim to investigate the clinicopathological and prognostic significance of serum uric acid concentration in breast cancer patients. A total of 443 female patients with histopathologically diagnosed breast cancer were included. After a mean follow-up time of 56months, survival was analysed using the Kaplan-Meier method. To further evaluate the prognostic significance of uric acid concentrations, univariate and multivariate Cox regression analyses were applied. Of the clinicopathological parameters, uric acid concentration was associated with age, body mass index, ER status and PR status. Univariate analysis identified that patients with increased uric acid concentration had a significantly inferior overall survival (HR 2.13, 95% CI 1.15-3.94, p=0.016). In multivariate analysis, we found that high uric acid concentration is an independent prognostic factor predicting death, but insufficient to predict local relapse or distant metastasis. Kaplan-Meier analysis indicated that high uric acid concentration is related to the poor overall survival (p=0.013). High uric acid concentration predicts poor survival in patients with breast cancer, and might serve as a potential marker for appropriate management of breast cancer patients. Copyright © 2017 Elsevier B.V. All rights reserved.
Grosenbaugh, Deborah A; Leard, A Timothy; Bergman, Philip J; Klein, Mary K; Meleo, Karri; Susaneck, Steven; Hess, Paul R; Jankowski, Monika K; Jones, Pamela D; Leibman, Nicole F; Johnson, Maribeth H; Kurzman, Ilene D; Wolchok, Jedd D
2011-12-01
To evaluate the safety and efficacy of a vaccine containing plasmid DNA with an insert encoding human tyrosinase (ie, huTyr vaccine) as adjunctive treatment for oral malignant melanoma (MM) in dogs. 111 dogs (58 prospectively enrolled in a multicenter clinical trial and 53 historical controls) with stage II or III oral MM (modified World Health Organization staging scale, I to IV) in which locoregional disease control was achieved. 58 dogs received an initial series of 4 injections of huTyr vaccine (102 μg of DNA/injection) administered transdermally by use of a needle-free IM vaccination device. Dogs were monitored for adverse reactions. Surviving dogs received booster injections at 6-month intervals thereafter. Survival time for vaccinates was compared with that of historical control dogs via Kaplan-Meier survival analysis for the outcome of death. Kaplan-Meier analysis of survival time until death attributable to MM was determined to be significantly improved for dogs that received the huTyr vaccine, compared with that of historical controls. However, median survival time could not be determined for vaccinates because dogs as adjunctive treatment for oral MM. Response to DNA vaccination in dogs with oral MM may be useful in development of plasmid DNA vaccination protocols for human patients with similar disease.
Censoring approach to the detection limits in X-ray fluorescence analysis
International Nuclear Information System (INIS)
Pajek, M.; Kubala-Kukus, A.
2004-01-01
We demonstrate that the effect of detection limits in the X-ray fluorescence analysis (XRF), which limits the determination of very low concentrations of trace elements and results in appearance of the so-called 'nondetects', can be accounted for using the statistical concept of censoring. More precisely, the results of such measurements can be viewed as the left random censored data, which can further be analyzed using the Kaplan-Meier method correcting the data for the presence of nondetects. Using this approach, the results of measured, detection limit censored concentrations can be interpreted in a nonparametric manner including the correction for the nondetects, i.e. the measurements in which the concentrations were found to be below the actual detection limits. Moreover, using the Monte Carlo simulation technique we show that by using the Kaplan-Meier approach the corrected mean concentrations for a population of the samples can be estimated within a few percent uncertainties with respect of the simulated, uncensored data. This practically means that the final uncertainties of estimated mean values are limited in fact by the number of studied samples and not by the correction procedure itself. The discussed random-left censoring approach was applied to analyze the XRF detection-limit-censored concentration measurements of trace elements in biomedical samples
Evaluation of the TRPM2 channel as a biomarker in breast cancer using public databases analysis.
Sumoza-Toledo, Adriana; Espinoza-Gabriel, Mario Iván; Montiel-Condado, Dvorak
Breast cancer is one of the most common malignancies affecting women. Recent investigations have revealed a major role of ion channels in cancer. The transient receptor potential melastatin-2 (TRPM2) is a plasma membrane and lysosomal channel with important roles in cell migration and cell death in immune cells and tumor cells. In this study, we investigated the prognostic value of TRPM2 channel in breast cancer, analyzing public databases compiled in Oncomine™ (Thermo Fisher, Ann Arbor, MI) and online Kaplan-Meier Plotter platforms. The results revealed that TRPM2 mRNA overexpression is significant in situ and invasive breast carcinoma compared to normal breast tissue. Furthermore, multi-gene validation using Oncomine™ showed that this channel is coexpressed with proteins related to cellular migration, transformation, and apoptosis. On the other hand, Kaplan-Meier analysis exhibited that low expression of TRPM2 could be used to predict poor outcome in ER- and HER2+ breast carcinoma patients. TRPM2 is a promising biomarker for aggressiveness of breast cancer, and a potential target for the development of new therapies. Copyright © 2016 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.
[Expression and clinical significance of 5hmC in bladder urothelial carcinoma].
Li, Jie; Xu, Yuqiao; Zhang, Zhiwen; Zhang, Ming; Zhang, Zhekai; Zhang, Feng; Li, Qing
2016-02-01
To investigate the expression of 5-hydroxymethylcytosine (5hmC) in bladder urothelial carcinoma (UC) and its clinical significance. The expression of 5hmC in 21 cases of UC tissues and pericarcinous urinary tract epithelium was detected by immunohistochemical staining. Then the expression of 5hmC in the surgical resection of UC tissues in 92 cases was also surveyed. Non parametric U Mann-Whitney test was used to analyze the correlation between 5hmC expression and clinical data. Single factor survival analysis was performed by Kaplan-Meier test. The expression of 5hmC in normal urinary tract epithelium and UC tissues was significantly different, but there was no significant difference in the expression of 5hmC between low and high grades of UC tissues as well as between different TNM grades. Kaplan-Meier single factor survival analysis showed that there was no significant correlation between the 5hmC expression level and the survival rate or the recurrence-free survival of UC patients. The expression level of 5hmC in UC tissues is significantly lower than that in pericarcinous urinary tract epithelium. There is no correlation between the 5hmC expression and the progression, prognosis and recurrence of UC.
Talent in Female Gymnastics: a Survival Analysis Based upon Performance Characteristics.
Pion, J; Lenoir, M; Vandorpe, B; Segers, V
2015-11-01
This study investigated the link between the anthropometric, physical and motor characteristics assessed during talent identification and dropout in young female gymnasts. 3 cohorts of female gymnasts (n=243; 6-9 years) completed a test battery for talent identification. Performance-levels were monitored over 5 years of competition. Kaplan-Meier and Cox Proportional Hazards analyses were conducted to determine the survival rate and the characteristics that influence dropout respectively. Kaplan-Meier analysis indicated that only 18% of the female gymnasts that passed the baseline talent identification test survived at the highest competition level 5 years later. The Cox Proportional Hazards Model indicated that gymnasts with a score in the best quartile for a specific characteristic significantly increased chances of survival by 45-129%. These characteristics being: basic motor skills (129%), shoulder strength (96%), leg strength (53%) and 3 gross motor coordination items (45-73%). These results suggest that tests batteries commonly used for talent identification in young female gymnasts may also provide valuable insights into future dropout. Therefore, multidimensional test batteries deserve a prominent place in the selection process. The individual test results should encourage trainers to invest in an early development of basic physical and motor characteristics to prevent attrition. © Georg Thieme Verlag KG Stuttgart · New York.
Toro, Jorge R.; Blake, Patrick W.; Björkholm, Magnus; Kristinsson, Sigurdur Y.; Wang, Zhuoqiao; Landgren, Ola
2009-01-01
We investigated whether a previous diagnosis of non-melanoma skin cancer among chronic lymphocytic leukemia patients is a predictor of poor outcome. Using the Swedish Cancer Registry, we conducted a population-based study to evaluate the survival patterns among chronic lymphocytic leukemia patients with and without non-melanoma skin cancer. Cox proportional hazards regression models were used and Kaplan-Meier curves were constructed. Of a total of 12,041 chronic lymphocytic leukemia cases identified, 236 cases, including 111 squamous cell cancer, had a prior history of non-melanoma skin cancer. Chronic lymphocytic leukemia patients with a prior history of non-melanoma skin cancer had a 1.29-fold (95% CI 1.10–1.52; p=0.0024) increased risk of dying; and those with a history of squamous cell cancer had a further elevated 1.86-fold (95% CI 1.46–2.36; p<0.0001) risk of dying. Kaplan-Meier plots showed that patients with a history of non-melanoma skin cancer, particularly those with squamous cell cancer, had significantly poorer survival than chronic lymphocytic leukemia patients without non-melanoma skin cancer (p<0.0001; log-rank test). Non-melanoma skin cancer may be a novel clinical predictor of worse chronic lymphocytic leukemia outcome. PMID:19794092
Radiologic Placement of Tunneled Central Venous Catheters in Pediatric Patients
Energy Technology Data Exchange (ETDEWEB)
Kim, Eun Ji; Song, Soon Young; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Jeong, Woo Kyoung; Lee, Yong Ho [Hanyang University College of Medicine, Seoul (Korea, Republic of)
2010-08-15
We evaluated the technical success and complication rates associated with the radiological placement of tunneled central venous catheters in pediatric patients. Between May 1, 2005 and March 31, 2008, a total of 46 tunneled central venous catheters were placed in 34 children (M:F = 22:12; mean age, 9.9 years [9 months to 16.8 years]). All procedures were performed under ultrasonographic and fluoroscopic guidance. Follow-up data were obtained through the retrospective review of the medical records. We used the Kaplan-Meier survival method for the evaluation of survival rate of the catheters. All procedures were technically successful. The observed periprocedural complications included hematoma formation in three patients. The mean catheter life was 189.3 days (total, 8710 days; range, 7-810). Catheters were removed due to death (n=9), the end of treatment (n=8), catheter sepsis (n=4), malfunction (n=8), and accidental removal (n=4). The rate of catheter sepsis and malfunction was 0.459 and 0.919 for every 1000 catheter days, respectively. The expected mean catheter life was 479.6 days as per the Kaplan- Meier analysis. The results suggest that the radiologic placement of a tunneled central venous catheter is an effective technique with a high technical success rate and low complication rate.
Wan, Xiaomin; Peng, Liubao; Li, Yuanjian
2015-01-01
In general, the individual patient-level data (IPD) collected in clinical trials are not available to independent researchers to conduct economic evaluations; researchers only have access to published survival curves and summary statistics. Thus, methods that use published survival curves and summary statistics to reproduce statistics for economic evaluations are essential. Four methods have been identified: two traditional methods 1) least squares method, 2) graphical method; and two recently proposed methods by 3) Hoyle and Henley, 4) Guyot et al. The four methods were first individually reviewed and subsequently assessed regarding their abilities to estimate mean survival through a simulation study. A number of different scenarios were developed that comprised combinations of various sample sizes, censoring rates and parametric survival distributions. One thousand simulated survival datasets were generated for each scenario, and all methods were applied to actual IPD. The uncertainty in the estimate of mean survival time was also captured. All methods provided accurate estimates of the mean survival time when the sample size was 500 and a Weibull distribution was used. When the sample size was 100 and the Weibull distribution was used, the Guyot et al. method was almost as accurate as the Hoyle and Henley method; however, more biases were identified in the traditional methods. When a lognormal distribution was used, the Guyot et al. method generated noticeably less bias and a more accurate uncertainty compared with the Hoyle and Henley method. The traditional methods should not be preferred because of their remarkable overestimation. When the Weibull distribution was used for a fitted model, the Guyot et al. method was almost as accurate as the Hoyle and Henley method. However, if the lognormal distribution was used, the Guyot et al. method was less biased compared with the Hoyle and Henley method.
Survival of Patients With Cervical Cancer in Rural India
Vinoda Thulaseedharan, Jissa; Malila, Nea; Swaminathan, Rajaraman; Esmy Pulikottil, Okuru; Hakama, Matti; Muwonge, Richard; Sankaranarayanan, Rengaswamy
2015-01-01
Background: Patients’ survival after diagnosis of cervical cancer is indirectly influenced by socio-economic factors. We evaluated this survival and its socio-economic determinants in a rural population in south India. Methods: We assessed 165 women diagnosed with cervical cancer from the routine care control arm of a randomized screening trial conducted in rural south India. Kaplan-Meier curves were plotted to illustrate the observed survival of cancer patients. The effect of socio-econom...
Assessment of the Air Force Materiel Command Reorganization: Report for Congress
2013-01-01
8 Mintzberg, 1979. 9 Richard L. Daft , Organization Theory and Design, 9th ed., Mason, Ohio: Thomson South-Western, 2007. 27 areas.10 An...MIT Press, 1962. 11 Daft , 2007; Duncan, 1979. 12 Williamson, 1983; Chandler, 1962. 13 Daft , 2007; Duncan, 1979. 14 D. S. Pugh, D. J. Hickson, C...1965. 19 Bohte and Meier, 2001. 20 See, for example, Bell, 1967. 21 Daft , 2007. 22 Galbraith, 1977. 23 Daft , 2007. 24 Galbraith, 1977. 25
1989-09-01
THE LIQUID- VAPOR CRITICAL POINT" P.A. Thompson, J.E. Shepherd, H.J. Cho, S.Can Gulen (Troy). Non-euilibrium in dinamic systems , critical phenomena...IN LIQUID-VAPOR SYSTEMS G~ttingen: 28. August - 1. September 1989 Chairmen: Gerd E.A. Meier & Philip A. Thompson Secretary: Tomasz A. Kowalewski...is a great pleasure to welcome you on behalf of the Organizing Committee to the IUTAM Symposium on Adiabatic Waves in Liquid Vapor Systems . We are
2014-06-02
associated coagulopathy.32 The presence of a coagulopathy was found to nearly double the mortality in patients with traumatic subdural hematoma .125 The...375. 125. Lemcke J, Al-Zain F, Brelie CvD, Meier U. The influence of coagulopathy on outcome after traumatic subdural hematoma : a retrospective...of a subdural mass. Anesthesiology. 1991;75:319–327. 165. Stanford G, Patterson C, Payne L, Fabian T. Hypertonic saline resuscitation in a porcine
Weide, Benjamin; Faller, Christine; Els?sser, Margrit; B?ttner, Petra; Pflugfelder, Annette; Leiter, Ulrike; Eigentler, Thomas Kurt; Bauer, J?rgen; Meier, Friedegund; Garbe, Claus
2013-01-01
BACKGROUND: A direct comparison of prognosis between patients with regional lymph node metastases (LNM) detected synchronously with the primary melanoma (primary LNM), patients who developed their first LNM subsequently (secondary LNM) and those with initial LNM in melanoma with unknown primary site (MUP) is missing thus far. PATIENTS AND METHODS: Survival of 498 patients was calculated from the time point of the first macroscopic LNM using Kaplan Meier and multivariate Cox hazard regression ...
International Nuclear Information System (INIS)
Badwe, R.A.
1999-01-01
The primary endpoint in the majority of the studies has been either disease recurrence or death. This kind of analysis requires a special method since all patients in the study experience the endpoint. The standard method for estimating such survival distribution is Kaplan Meier method. The survival function is defined as the proportion of individuals who survive beyond certain time. Multi-variate comparison for survival has been carried out with Cox's proportional hazard model
International Nuclear Information System (INIS)
Carlson, Matthew L.; Glasgow, Amy E.; Jacob, Jeffrey T.; Habermann, Elizabeth B.; Link, Michael J.
2016-01-01
Purpose: To determine the incidence of second intracranial neoplasms after the diagnosis and treatment of sporadic vestibular schwannoma (VS). Methods and Materials: Analysis of the Surveillance, Epidemiology, and End Results (SEER) database including all patients identified with a diagnosis of VS and a second intracranial tumor. The Kaplan-Meier method was used to determine the incidence of second tumors while allowing for censoring at loss to follow-up or death. Multivariable associations between treatment modality and second tumor formation were explored using Cox proportional hazards regression analysis. Two illustrative cases are also presented. Results: In all, 9460 patients with unilateral VS were identified between 2004 and 2012. Overall, 66 (0.7%) patients experienced a separate intracranial tumor, benign or malignant, after treatment of VS. Kaplan-Meier estimates for time to second neoplasm at 1, 3, and 5 years were 0.3%, 0.7%, and 0.8%, respectively. Multivariable comparison between VS treatment modalities revealed that the risk of second tumor formation was similar between radiation and surgery (hazard ratio [HR] 0.74; 95% confidence interval [CI] 0.36-1.51; P=.93) but greater for tumors managed with observation alone compared with radiation (HR 2.48; 95% CI 1.31-4.71; P<.01). A total of 6 (0.06%) intracranial malignancies were diagnosed after VS treatment. Kaplan-Meier estimates for time to malignancy at 1, 3, and 5 years were 0%, 0.1%, and 0.1%, respectively. After adjustment for age at diagnosis, sex, and treatment modality, the probability of malignancy after radiation was not greater than after observation alone or microsurgery (HR 4.88; 95% CI 0.85-28.14; P=.08) during the study period. Conclusions: The risk for the development of a second intracranial neoplasm, benign or malignant, at 5 years after treatment of unilateral VS is approximately 0.8%, whereas the risk of acquiring a separate malignancy is 0.1%, or approximately 1 per 1000 cases
Análisis de la recurrencia de cáncer de lengua considerando la presencia de eventos competitivos.
Directory of Open Access Journals (Sweden)
Raúl Vicente Mantilla Quispe
2008-10-01
Full Text Available Objetivo: Estimar la probabilidad de recurrencia en pacientes con cáncer de lengua según la edad, el estado ganglionar patológico y el tipo de tratamiento de los pacientes considerando la muerte antes de la recurrencia como evento competitivo. Material y métodos: Serie de casos retrospectiva de 290 pacientes con cáncer de lengua, con tratamiento en el INEN, entre los años 1977 y 2000. Se excluyeron del estudio 29 pacientes tratados solo con radioterapia. De los 261 pacientes, 31 solo tuvieron tratamiento del tumor primario. Resultados: La recurrencia fue 36,8%, la recurrencia local fue la más frecuente. La incidencia acumulada de la recurrencia a los 5 años, con el método de Kaplan Meier, se estimó en 44,7%, y según el análisis de riesgos competitivos en 42,4%. En el análisis univariado considerando riesgos competitivos, las incidencias acumuladas fueron: 56,8 y 38,9% en pacientes menores o iguales que 45 y mayores que 45 años respectivamente (p = 0,1556, 29,4% y 50,5% en pacientes con ganglios patológicos negativos y positivos, respectivamente (p = 0,0002, y 37,5% en pacientes con cirugía, y 47,4% con radioterapia (p = 0,03. En el análisis multivariado, con regresión de riesgos competitivos, no se encontró diferencia entre los tipos de tratamiento sobre la recurrencia (RR = 1,146, p = 0,620. Conclusiones: La pequeña diferencia entre los resultados del método Kaplan Meier y el que toma en cuenta eventos competitivos se debe a la baja tasa del evento competitivo, más aún por que se trata de muerte no relacionada con la enfermedad. La tasa de recurrencia fue similar al reportado en la literatura. Sólo se encontró diferencia significativa en la tasa de recurrencia en el grupo con compromiso ganglionar positivo. Aunque la comparación con los métodos estándar, Kaplan Meier y Regresión de Cox, muestra resultados similares se deben tener en cuenta los eventos competitivos. (Rev Med Hered 2008;19: 145-151.
Energy Technology Data Exchange (ETDEWEB)
Carlson, Matthew L., E-mail: carlson.matthew@mayo.edu [Department of Otorhinolaryngology, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Glasgow, Amy E. [Division of Health Care Policy and Research and the Robert D. and Patricia E. Kern Center for the Science of Health Care Delivery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Jacob, Jeffrey T. [Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Habermann, Elizabeth B. [Division of Health Care Policy and Research and the Robert D. and Patricia E. Kern Center for the Science of Health Care Delivery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Link, Michael J. [Department of Otorhinolaryngology, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States)
2016-07-15
Purpose: To determine the incidence of second intracranial neoplasms after the diagnosis and treatment of sporadic vestibular schwannoma (VS). Methods and Materials: Analysis of the Surveillance, Epidemiology, and End Results (SEER) database including all patients identified with a diagnosis of VS and a second intracranial tumor. The Kaplan-Meier method was used to determine the incidence of second tumors while allowing for censoring at loss to follow-up or death. Multivariable associations between treatment modality and second tumor formation were explored using Cox proportional hazards regression analysis. Two illustrative cases are also presented. Results: In all, 9460 patients with unilateral VS were identified between 2004 and 2012. Overall, 66 (0.7%) patients experienced a separate intracranial tumor, benign or malignant, after treatment of VS. Kaplan-Meier estimates for time to second neoplasm at 1, 3, and 5 years were 0.3%, 0.7%, and 0.8%, respectively. Multivariable comparison between VS treatment modalities revealed that the risk of second tumor formation was similar between radiation and surgery (hazard ratio [HR] 0.74; 95% confidence interval [CI] 0.36-1.51; P=.93) but greater for tumors managed with observation alone compared with radiation (HR 2.48; 95% CI 1.31-4.71; P<.01). A total of 6 (0.06%) intracranial malignancies were diagnosed after VS treatment. Kaplan-Meier estimates for time to malignancy at 1, 3, and 5 years were 0%, 0.1%, and 0.1%, respectively. After adjustment for age at diagnosis, sex, and treatment modality, the probability of malignancy after radiation was not greater than after observation alone or microsurgery (HR 4.88; 95% CI 0.85-28.14; P=.08) during the study period. Conclusions: The risk for the development of a second intracranial neoplasm, benign or malignant, at 5 years after treatment of unilateral VS is approximately 0.8%, whereas the risk of acquiring a separate malignancy is 0.1%, or approximately 1 per 1000 cases
Aldo-keto Reductase Family 1 B10 as a Novel Target for Breast Cancer Treatment
2010-08-01
overexpressed in tested human breast cancer tissues and mediates acetyl-CoA carboxylase-α ( ACCA ) stability, affecting fatty acid de novo synthesis and...9703; Fax. 217-545-3227; E-mail: dcao@siumed.edu Running title: AKR1B10 as a new risk factor for breast cancer Abbreviations used: ACCA , acetyl...The effect of AKR1B10 expression in cancer tissue on patient survival was evaluated with Kaplan - Meier plots, and results showed that AKR1B10
Impact of Comorbidities on Tumor Necrosis Factor Inhibitor Therapy in Psoriatic Arthritis
DEFF Research Database (Denmark)
Ballegaard, Christine; Højgaard, Pil; Dreyer, Lene
2017-01-01
characteristics, disease activity and treatment response and persistence was obtained from the DANBIO registry. Information on comorbidities according to the Charlson Comorbidity Index (CCI) was obtained through linkage with the Danish National Patient Register. Kaplan-Meier plots and Cox proportional hazard...... compared with patients without comorbidities (hazard ratio 1.72, [1.26 to 2.37], p = 0.001). A smaller proportion of patients with a CCI score ≥ 2 achieved European League Against Rheumatism (EULAR) good response (p
Measuring survival time: a probability-based approach useful in healthcare decision-making.
2011-01-01
In some clinical situations, the choice between treatment options takes into account their impact on patient survival time. Due to practical constraints (such as loss to follow-up), survival time is usually estimated using a probability calculation based on data obtained in clinical studies or trials. The two techniques most commonly used to estimate survival times are the Kaplan-Meier method and the actuarial method. Despite their limitations, they provide useful information when choosing between treatment options.
Energy Technology Data Exchange (ETDEWEB)
Chlosta, J
1941-01-01
Meier-Grolman and others have deduced from experimental studies of the vapor pressure of solutions of benzene in paraffin oil and Solway oil-paraffin oil mixtures that the higher the proportion of aliphatic compounds in a wash oil, the less suitable it is for benzene scrubbing. This generalization is not supported. Paraffin oils from brown-coal tar and low viscous oils from the Fischer-Tropsch hydrocarbon synthesis process are both being successfully used for benzene scrubbing.
A Model of Medical Countermeasures for Vesicant Exposure
2015-10-01
lipophilic, can diffuse readily through the intracellular spaces of the stratum corneum, which are filled with lipids such as sebum, oils , waxes, as...does not decontaminate his skin or his eyes. The resulting injury to the eyes, lungs, and skin are shown in Figure 8-1. Figure 8-1. Eye, Lung, and...R.Vijayaraghavan, & S.C.Pant. (2011). Designing of mouse model: A new approach for studying sulphur mustard-induced skin lesions. Burns . Meier, H. M. (1998
DEFF Research Database (Denmark)
Agerbo, Esben
2007-01-01
longitudinal data on income, labor market affiliation, educational attainment, and marital and cohabitational status (96,369 patients, 256,619 admissions, and 2727 suicides). MAIN OUTCOME MEASURES: Suicide risks after hospital discharge were depicted using Kaplan-Meier product-limit methods. Hazard ratios (HRs...... is generally associated with low income, unemployment, educational underachievement, and singleness, but this study suggests that the opposite is true among psychiatric patients. However, loss of income, labor market status, and marriage increase the suicide risk....
Improve T Cell Therapy in Neuroblastoma
2015-09-01
bioluminescence was then measured overtime. The graph is representative of one of 4 experiments using CMV-CTLs from 4 donors. Panel E. Kaplan-Meier...whole-cell vaccine expressing the iC9 gene and labeled with an enhanced firefly luciferase. Tumor growth was measured by in vivo imaging. Panel E...down regulation in LTE -T cells is not caused by specific culture conditions. T lymphocytes were activated with immobilized OKT3 (1 μg ml) and
Protective Role of Comfrey Leave Extracts on UV-induced Zebrafish Fin Damage
Cheng, Chien-Chung; Chou, Chi-Yuan; Chang, Yao-Chin; Wang, Hsuan-Wen; Wen, Chi-Chung; Chen, Yau-Hung
2014-01-01
In zebrafish, UV exposure leads to fin malformation phenotypes including fin reduction or absence. The present study evaluated UV-protective activities of comfrey leaves extracts in a zebrafish model by recording fin morphological changes. Chemopreventive effects of comfrey leave extracts were evaluated using Kaplan-Meier analysis and Cox proportional hazards regression. The results showed that (1) the mean times of return to normal fin in the UV+comfrey (50 and 100 ppm) groups were 3.43 and ...
Low concentrations of selenium in stream food webs of eastern Canada
International Nuclear Information System (INIS)
Jardine, Timothy D.; Kidd, Karen A.
2011-01-01
Herbivorous and predatory invertebrates and two species of fish (brook trout and blacknose dace) were collected from 49 streams in New Brunswick, Canada to determine whether concentrations of selenium (Se) in the biota were affected by a point source (a coal-fired power plant), and stream water chemistry (pH, sulphate, conductivity, and total organic carbon), and to determine the trophic transfer of Se through these food webs. Total Se concentrations in the biota were generally low (0.2 to 4.8 μg g -1 dry weight) across sites and there was no relationship between distance from the coal-fired power plant and Se concentrations in invertebrates or fishes. Water chemistry was an equally poor predictor of Se concentrations in invertebrates and fish. Trophic position (determined using δ 15 N) was a significant predictor of Se concentrations in only five of the stream food webs, and two of these had negative slopes, indicating little or no trophic magnification across most systems; many fishes had lower concentrations than their invertebrate prey and trophic transfer was higher at sites with low invertebrate Se concentrations. Variability in Se concentrations in fishes was explained more by site of capture than microhabitat use within the site (as measured with δ 13 C), suggesting among-site differences in geological sources of Se. Because concentrations were below known toxicity thresholds for fish and other consumers, these results suggest that Se is not an environmental issue in New Brunswick streams that do not receive direct inputs from mining activities. - Research Highlights: → Se concentrations in stream invertebrates and fishes in eastern Canada are low. → Concentrations were not related to water chemistry or distance from a point source. → Se did not biomagnify in the food web, yet was almost always in excess of Hg.
Fish biodiversity of the Gabcikovo waterworks
International Nuclear Information System (INIS)
Kirka, A.
1997-01-01
The historical full list of fish species of the Danube between mouth of the Morava and Ipel rivers had been prepared through decades. It consisted of 66-69 species, which never appear here all at the same time. After 1971, since the Iron Gate on the Yugoslavia-Romania border had been put in function the migration of the big acipenserids was fully stopped. On the other side introduction of new species of fish continuously increased. However, the number of original species consisted of 57 species. In the Danube the occurrence of 45 species from 50 and in the Slovak side arms system 31 species from 56 species were confirmed since 1992 after damming of the Danube. The new full list of species will be achieved only gradually and no species occurring before the damming will be absent. Up to the present time there are no evidence about extinction of any species. In opposite, there is no doubt, that the old - new species like trouts, danube salmon and others are occurring now again in the main channel of the river namely. New micro-habitats as rocky chutes and submerge weirs have created very convenient living conditions together with very reach sources of food (gammarids) and clear substrate on depositing their eggs when spawning. The Cunovo rocky chute is fully inhabited with common rheofils like: trouts, barb, chub, dace, burbot, and with rare and by law protected: bulkhead, streber, zingel, and and long whiskered gudgeon which during last 50 years was found only three times at the Slovak-Hungarian stretch of the Danube river. After finishing the Danube - Main - Rhine canal, the Black Sea and the Atlantic systems have been connected. Despite that the ship locks are considered top be insurmountable barriers for fish, some experts, believe in equalization of the species potentials of fish of these systems within next 50 years. (author)
Wu, Dongping; Chen, Xiaoying; Xu, Yan; Wang, Haiyong; Yu, Guangmao; Jiang, Luping; Hong, Qingxiao; Duan, Shiwei
2017-04-01
The DNA mismatch repair (MMR) gene MutL homolog 1 ( MLH1 ) is critical for the maintenance of genomic integrity. Methylation of the MLH1 gene promoter was identified as a prognostic marker for numerous types of cancer including glioblastoma, colorectal, ovarian and gastric cancer. The present study aimed to determine whether MLH1 promoter methylation was associated with survival in male patients with esophageal squamous cell carcinoma (ESCC). Formalin-fixed, paraffin-embedded ESCC tissues were collected from 87 male patients. MLH1 promoter methylation was assessed using the methylation-specific polymerase chain reaction approach. Kaplan-Meier survival curves and log-rank tests were used to evaluate the association between MLH1 promoter methylation and overall survival (OS) in patients with ESCC. Cox regression analysis was used to obtain crude and multivariate hazard ratios (HR), and 95% confidence intervals (CI). The present study revealed that MLH1 promoter methylation was observed in 53/87 (60.9%) of male patients with ESCC. Kaplan-Meier survival analysis demonstrated that MLH1 promoter hypermethylation was significantly associated with poorer prognosis in patients with ESCC (P=0.048). Multivariate survival analysis revealed that MLH1 promoter hypermethylation was an independent predictor of poor OS in male patients with ESCC (HR=1.716; 95% CI=1.008-2.921). Therefore, MLH1 promoter hypermethylation may be a predictor of prognosis in male patients with ESCC.
International Nuclear Information System (INIS)
Hoskin, Peter; Rojas, Ana; Ostler, Peter; Hughes, Robert; Alonzi, Roberto; Lowe, Gerry; Bryant, Linda
2014-01-01
Background: To evaluate late urinary (GU) and gastrointestinal (GI) adverse events (AEs) and biochemical control of disease after high-dose rate brachytherapy (HDR-BT) in locally advanced prostate cancer. Patients and methods: 227 consecutive patients were treated with 3 × 10.5 Gy (n = 109) or 2 × 13 Gy (n = 118) HDR-BT alone. Biochemical failure was assessed using the Phoenix definition of PSA nadir + 2 μg/l and late AEs using the RTOG scoring system and the International Prostate Symptom Score (IPSS). Results: Kaplan–Meier estimates and prevalence of late events indicate that urinary, bowel and IPSS symptoms are higher after 31.5 Gy than after 26 Gy, however differences are significant only for Grade 1 and 2 urinary toxicity. Kaplan–Meier estimates of morbidity are consistently and considerably higher than time-point estimates of prevalence; which reflects the transient nature of most symptoms. At 3 years 93% and 97% of patients treated with 26 and 31.5 Gy, respectively, were free from biochemical relapse (p = 0.5) and 91% for the latter regimen at 5 years. In univariate and multivariate analysis risk-category was the only significant predictor of relapse (p < 0.03). Conclusion: These HDR-BT schedules achieved high levels of biochemical control of disease in patients with advanced prostate cancer with few severe complications seen throughout the first 3 years
Varadarajan, Padmini; Gandhi, Siddharth; Sharma, Sanjay; Umakanthan, Branavan; Pai, Ramdas G
2006-10-01
Previous studies have shown low hemoglobin (Hb) to have an adverse effect on survival in patients with congestive heart failure (CHF) and reduced left ventricular (LV) ejection fraction (EF); but its effect on survival in patients with CHF and normal EF is not known. This study sought to determine whether low Hb has an effect on survival in patients with both CHF and normal EF. Detailed chart reviews were performed by medical residents on 2,246 patients (48% with normal EF) with a discharge diagnosis of CHF in a large tertiary care hospital from 1990 to 1999. The CHF diagnosis was validated using the Framingham criteria. Mortality data were obtained from the National Death Index. Survival analysis was performed using Kaplan-Meier and Cox regression models. By Kaplan-Meier analysis, low Hb (< 12 gm/dl) compared with normal hemoglobin was associated with a lower 5-year survival in patients with CHF and both normal (38 vs. 50%, p = 0.0008) and reduced (35 vs. 48%, p = 0.0009) EF. Using the Cox regression model, low Hb was an independent predictor of mortality after adjusting for age, gender, renal dysfunction, diabetes mellitus, hypertension, and EF in both groups of patients. Low Hb has an independent adverse effect on survival in patients with CHF and both normal and reduced EF in both groups of patients.
Locke, S; Osborne, M; O'Rourke, P
2011-02-01
The objective of this paper is to measure the clinical course (months) in young athletes with persistent fatigue and to identify any covariates affecting the duration of recovery. This was a prospective longitudinal study of 68 athletes; 87% were elite (42 males, 26 females), aged 20.5±3.74 years (SD), who presented with the symptom of persistent fatigue. The collective duration to full clinical recovery was estimated using Kaplan-Meier product-limit curves, and covariates associated with prolonging recovery were identified from Cox proportional hazard models. The median recovery was 5 months (range 1-60 months). The range of presenting symptom duration was 0.5-36 months. The covariates identified were an increased duration of presenting symptoms [hazard ratio (HR), 1.06; 95% confidence interval (CI), 1.02-1.12; P=0.005] and the response of serum cortisol concentration to a standard exercise challenge (HR, 1.92; 95% CI, 1.09-3.38; P=0.03). Delay in recovery was not associated with categories of fatigue that included medical, training-related diagnoses, or other causes. In conclusion, the fatigued athlete represents a significant clinical problem with a median recovery of 5 months, whose collective clinical course to recovery can be estimated by Kaplan-Meier curves and appears to be a continuum. © 2009 John Wiley & Sons A/S.
Glioblastoma: does the pre-treatment geometry matter? A postcontrast T1 MRI-based study
International Nuclear Information System (INIS)
Perez-Beteta, Julian; Martinez-Gonzalez, Alicia; Molina, David; Amo-Salas, Mariano; Luque, Belen; Perez-Garcia, Victor M.; Arregui, Elena; Calvo, Manuel; Borras, Jose M.; Lopez, Carlos; Claramonte, Marta; Barcia, Juan A.; Iglesias, Lidia; Avecillas, Josue; Albillo, David; Navarro, Miguel; Villanueva, Jose M.; Paniagua, Juan C.; Perez-Romasanta, Luis; Martino, Juan; Velasquez, Carlos; Asenjo, Beatriz; Benavides, Manuel; Herruzo, Ismael; Delgado, Maria del Carmen; Valle, Ana del; Falkov, Anthony; Schucht, Philippe; Arana, Estanislao
2017-01-01
The potential of a tumour's volumetric measures obtained from pretreatment MRI sequences of glioblastoma (GBM) patients as predictors of clinical outcome has been controversial. Mathematical models of GBM growth have suggested a relation between a tumour's geometry and its aggressiveness. A multicenter retrospective clinical study was designed to study volumetric and geometrical measures on pretreatment postcontrast T1 MRIs of 117 GBM patients. Clinical variables were collected, tumours segmented, and measures computed including: contrast enhancing (CE), necrotic, and total volumes; maximal tumour diameter; equivalent spherical CE width and several geometric measures of the CE ''rim''. The significance of the measures was studied using proportional hazards analysis and Kaplan-Meier curves. Kaplan-Meier and univariate Cox survival analysis showed that total volume [p = 0.034, Hazard ratio (HR) = 1.574], CE volume (p = 0.017, HR = 1.659), spherical rim width (p = 0.007, HR = 1.749), and geometric heterogeneity (p = 0.015, HR = 1.646) were significant parameters in terms of overall survival (OS). Multivariable Cox analysis for OS provided the later two parameters as age-adjusted predictors of OS (p = 0.043, HR = 1.536 and p = 0.032, HR = 1.570, respectively). Patients with tumours having small geometric heterogeneity and/or spherical rim widths had significantly better prognosis. These novel imaging biomarkers have a strong individual and combined prognostic value for GBM patients. (orig.)
Huaman, Moises A; Vilchez, Valery; Mei, Xiaonan; Shah, Malay B; Daily, Michael F; Berger, Jonathan; Gedaly, Roberto
2017-06-01
Liver transplantation using blood culture positive donors (BCPD) has allowed a significant expansion of the donor pool. We aimed to characterize BCPD and assess the outcomes of BCPD liver transplant recipients. We retrieved data from the United Network for Organ Sharing (UNOS) registry on all adults who underwent primary, single-organ deceased-donor liver transplantation in the USA between 2008 and 2013. Patients were classified into two cohorts: the BCPD cohort and the non-BCPD cohort. One-year graft and patient survival were compared between cohorts using Kaplan-Meier estimates and Cox models. A total of 28 961 patients were included. There were 2316 (8.0%) recipients of BCPD. BCPD were more likely to be older, female, black, diabetic, hypertensive, and obese compared to non-BCPD. Graft survival was significantly lower in BCPD recipients compared to non-BCPD recipients (Kaplan-Meier, 0.85 vs. 0.87; P = 0.009). Results remained significant in propensity-matched analysis (P = 0.038). BCPD was independently associated with decreased graft survival (adjusted HR; 1.10, 95% CI 1.01-1.20; P = 0.04). There were no significant differences in patient survival between study groups. BCPD was associated with decreased graft survival in liver transplant recipients. Studies are needed to identify subgroups of BCPD with the highest risk of graft failure and characterize the underlying pathogenic mechanisms. © 2016 Steunstichting ESOT.
Stent placement with the monorail technique for treatment of mesenteric artery stenosis.
Schaefer, Philipp J; Schaefer, Fritz K W; Hinrichsen, Holger; Jahnke, Thomas; Charalambous, Nikolas; Heller, Martin; Mueller-Huelsbeck, Stefan
2006-04-01
To analyze the immediate and midterm success of stenting of mesenteric arteries by a monorail technique in patients with chronic mesenteric ischemia. In this prospective case series, 19 patients (11 male, 8 female; mean age, 62.9 +/- 10.4 y; range, 36-82 y) with 23 symptomatic stenoses of mesenteric arteries were treated with stent placement by a monorail technique in a radiologic intervention center over a period of 4.5 years. Clinical examinations and duplex sonography were used to evaluate the stents' patency and clinical success. Kaplan-Meier graphs were calculated to analyze the patency and freedom-from-symptom rate. Initial technical success rate was 22/23 (96%). Mean follow-up was 17 months (range, 1-58 mo). Primary patency and primary clinical success rates were 82% and 78%, respectively. According to Kaplan-Meier tables, the patency rates were 96%, 87%, 76%, and 61% at 0, 1, 15, and 24 months, respectively, and the freedom-from-symptom rates were 95%, 90%, 72%, and 54% at 0, 1, 24, and 30 months, respectively. No peri-interventional complications occurred. Two patients died of cardiac failure in the hospital within 30 days after intervention; deaths were not related to the intervention. Stent placement by a monorail technique in mesenteric arteries is an effective and safe treatment for symptomatic stenoses in patients with chronic mesenteric ischemia after a mean follow-up of 17 months.
Elevated Serum IL-17 Expression at Cessation Associated with Graves’ Disease Relapse
Directory of Open Access Journals (Sweden)
Jianhui Li
2018-01-01
Full Text Available Background. Antithyroid drug (ATD treatment occupies the cornerstone therapeutic modality of Graves’ disease (GD with a high relapse rate after discontinuation. This study aimed to assess potential risk factors for GD relapse especially serum interleukin-17 (IL-17 expression. Methods. Consecutive newly diagnosed GD patients who were scheduled to undergo ATD therapy from May 2011 to May 2014 were prospectively enrolled. Risk factors for GD relapse were analyzed by univariate and multivariate Cox proportional hazard analyses. The association between serum IL-17 expression at cessation and GD relapse was analyzed with relapse-free survival (RFS by the Kaplan–Meier survival analysis and log-rank test. Results. Of the 117 patients, 72 (61.5% maintained a remission for 12 months after ATD withdrawal and 45 (38.5% demonstrated GD relapse. The final multivariate Cox analysis indicated elevated IL-17 expression at cessation to be an independent risk factor for GD relapse within 12 months after ATD withdrawal (HR: 3.04, 95% CI: 1.14–7.67, p=0.021. Patients with higher expressions of IL-17 (≥median value at cessation demonstrated a significantly higher RFS than those with lower levels by the Kaplan–Meier analysis and log-rank test (p=0.028. Conclusions. This present study indicated elevated serum IL-17 expression at cessation to be a predictor for GD relapse within 12 months.
Directory of Open Access Journals (Sweden)
Xiangxue Lu
2018-03-01
Full Text Available Background/Aims: Chronic inflammation is associated with increased risk of cardiovascular death in patients with end-stage renal disease (ESRD. Although elevated neutrophil-to-lymphocyte ratio (NLR, a novel inflammatory marker, has been shown to predict cardiovascular disease and all-cause mortality in the general population, limited evidence is available for its role in ESRD. Methods: We enrolled 86 patients undergoing peritoneal dialysis (PD for a 36-month follow-up to investigate the association between the NLR and arterial stiffness markers, namely, carotid-femoral pulse wave velocity (cfPWV and carotid augmentation index (AIx, and mortality in PD patients. The primary endpoints were cardiovascular mortality and all-cause mortality. Kaplan–Meier curves were used to show the cumulative incidence of cardiovascular mortality and all-cause mortality. Results: High NLR was found to be a predictor of increased cfPWV (β = 1.150; P < 0.001 and AIx (β = 3.945; P < 0.001 in patients on PD. Patients with higher NLR had lower survival during follow-up. Kaplan–Meier curves showed that the cumulative incidences of both cardiovascular mortality and all-cause mortality were significantly higher in patients with NLR ≥ 4.5 (both P < 0.01. Conclusion: Our results suggest that high NLR is independently associated with arterial stiffness and predicts cardiovascular and all-cause mortality in PD patients.
Molecular genetics analysis of hereditary breast and ovarian cancer patients in India
Soumittra, Nagasamy; Meenakumari, Balaiah; Parija, Tithi; Sridevi, Veluswami; Nancy, Karunakaran N; Swaminathan, Rajaraman; Rajalekshmy, Kamalalayam R; Majhi, Urmila; Rajkumar, Thangarajan
2009-01-01
Abstract Background Hereditary cancers account for 5–10% of cancers. In this study BRCA1, BRCA2 and CHEK2*(1100delC) were analyzed for mutations in 91 HBOC/HBC/HOC families and early onset breast and early onset ovarian cancer cases. Methods PCR-DHPLC was used for mutation screening followed by DNA sequencing for identification and confirmation of mutations. Kaplan-Meier survival probabilities were computed for five-year survival data on Breast and Ovarian cancer cases separately, and differe...
The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer
2014-03-01
8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression
Syncytin immunoreactivity in colorectal cancer
DEFF Research Database (Denmark)
Larsen, Julie Mou; Christensen, Ib Jarle; Nielsen, Hans Jørgen
2009-01-01
monoclonal syncytin antibody we have assessed syncytin expression in a retrospective series of 140 colorectal cancer patients. Variable degrees of syncytin expression were detected in both colonic and rectal tumors and the prognostic impact of such expression was analysed with the Kaplan-Meier method...... and the Cox proportional hazard model. Interestingly, increased syncytin expression was associated with decreased overall survival in rectal but not in colonic cancer patients. Thus, the prognostic impact of syncytin expression appears to vary with the tumor type....
On the Materiality of Writing in Academia or Remembering Where I Put My Thoughts
DEFF Research Database (Denmark)
Meier, Ninna
2016-01-01
In this feature essay, Ninna Meier reflects on the materiality of the writing – and re-writing – process in academic research. She explores the ways in which our ever-accumulating thoughts come to form layers on the material objects in which we write our notes and discusses the pleasures of co......-authorship. This essay originally appeared on LSE Review of Books and is the first in a new series examining the material cultures of academic research, reading and writing....
Prognostic role of syncytin expression in breast cancer
DEFF Research Database (Denmark)
Larsson, Lars-Inge; Holck, Susanne; Christensen, Ib Jarle
2007-01-01
Breast cancer cells were recently found to produce syncytin, an endogenous retroviral protein implicated in cell fusion, immune regulation, and nitric oxide synthase expression. To determine whether syncytin has a prognostic role in breast cancer, we investigated a series of 165 premenopausal lymph...... node-negative women for syncytin expression using an immunocytochemical scoring system. Results were analyzed with the Kaplan-Meier method and with the Cox proportional hazard model. Syncytin expression was observed in 38% of the patients, and the degree of syncytin expression constituted a positive...
Association of versican turnover with all-cause mortality in patients on haemodialysis
DEFF Research Database (Denmark)
Genovese, Federica; Karsdal, Morten A; Leeming, Diana J
2014-01-01
with cardiovascular diseases. The objective of the study was to investigate the association of versican turnover assessed in plasma with survival in haemodialysis patients. METHODS: A specific matrix metalloproteinase-generated neo-epitope fragment of versican (VCANM) was measured in plasma of 364 haemodialysis...... patients with a 5-years follow-up, using a robust competitive enzyme-linked immunosorbent assays. Association between VCANM plasma concentration and survival was assessed by Kaplan-Meier analysis and adjusted Cox model. RESULTS: Haemodialysis patients with plasma VCANM concentrations in the lowest quartile...
Contemporaneous VLBA 5 GHz Observations of Large Area Telescope Detected Blazars
2012-01-10
on board the Fermi Gamma-ray Space Telescope is a wide-field telescope covering the energy range from about 20 MeV to more than 300 GeV. It has been... energies via inverse Compton processes (e.g., Björnsson 2010; Tavecchio et al. 2011; Abdo et al. 2011). Meier (2005) expected several reconnection...Astrophys. Space Sci. Libr ., 285, 109 Healey, S. E., Romani, R. W., Cotter, G., et al. 2008, ApJS, 175, 97 Healey, S. E., Romani, R. W., Taylor, G. B
Assessment of cerebral blood flow by means of non-diffusible tracers
Energy Technology Data Exchange (ETDEWEB)
Bagni, B; Carraro, P L; Candini, G; Feggi, L M
1985-01-01
A program for the evaluation of cerebral blood flow based on the analysis of the time activity curves is presented. The method is based on the Meier and Zierler formula, applying the partition coefficients suggested by Lassen et al. for the corrections deriving from the use of non-diffusible indicators (Technetium-99m-DTPA). Particular attention is given to the smoothing of the time-activity curve (using Legendre's polynomials) and to the correction function for reflux. The computation procedures and their validity are discussed.
DEFF Research Database (Denmark)
Schnack, Tine H; Sørensen, Rie D; Nedergaard, Lotte
2014-01-01
OBJECTIVES: Invasive serous adenocarcinomas may present as primary ovarian (POC), primary fallopian tube (PFC) or primary peritoneal (PPC) carcinomas. Whether they are variants of the same malignancy or develop through different pathways is debated. METHODS: Population-based prospectively collected...... data on POC (n=1443), PPC (n=268) and PFC (n=171) cases was obtained from the Danish Gynecological Cancer Database (2005-2013). Chi-square, Fisher's or Wilcoxon-Mann-Whitney test, multivariate logistic regression, Kaplan-Meier and multivariate Cox-regression were used as appropriate. Statistical tests...
United States Air Force Research Initiation Program. 1984 Research Reports. Volume 2.
1986-05-01
differential determination of adrenaline and noradrenaline in plasma." Clinica Chemica Acta. Vol. 30, pp. 373-376, 1970. 37. Stegemann, J., U. Meier, W...34%" . 1. Agh-anian, G. K. and R. Y. Wang. Physiology and Pharma - coloay cf central serotonergic neurons. In: Psych ph cl . j aGe tion A of P M...34, AIAA Journal, Vol. 18, No. 1, January 1980,"[ ’ "<. .’ip p . 1 1 - 1 5 . 39. Rotta, J.C., "Temperaturverteilungen in der Turbulenten Grenzschicht an
Human milk: medicine for premature babies.
Hilton, Sioned
2011-12-01
Following years of research there have been some significant developments in the understanding and subsequent support being offered to Neonatal Intensive Care Unit (NICU) families. In addition, ground breaking advances in the treatment of premature infants, with specific interest in the role of human milk, are now available. New information was presented by leading international researcher, Professor Meier, at an international symposium earlier this year. This article seeks to share this insightful information and provide support to those working in or around the NICU.
Simple Unawareness in Dynamic Psychological Games
DEFF Research Database (Denmark)
Nielsen, Carsten Søren; Sebald, Alexander Christopher
2017-01-01
Building on Battigalli and Dufwenberg (2009)’s framework of dynamic psychological games and the progress in the modeling of dynamic unawareness by Heifetz, Meier, and Schipper (2013a) we model and analyze the impact of asymmetric awareness in the strategic interaction of players motivated...... by reciprocity and guilt. Specifically we characterize extensive-form games with psychological payoffs and simple unawareness, define extensive-form rationalizability and, using this, show that unawareness has a pervasive impact on the strategic interaction of psychologically motivated players. Intuitively...
Report of Case Studies on Gender Equality as a Focus Point of National and Nativist Discourses
DEFF Research Database (Denmark)
Siim, Birte; Krizsán, Andrea; Gruziel, Dominika
Cosmopolitanism, Oxford: Oxford University Press.Fraser, N. (2013). Fortunes of Feminism: From State-Managed Capitalism to Neoliberal Crisis, London: VersoKymlicka, Will (1995). Multicultural Citizenship. A Liberal Theory of Minority Rights, Oxford, Oxford University Press.Lombardo, E., P. Meier & M. Verloo (eds....... Scholars have proposed a notion of rooted cosmopolitan citizenship (Benhabib 2006) beyond the national state. The recent political and economic crisis has inspired debates about gender equality and gender justice within and beyond the nation state. Feminist scholarship has started to explore intersections...
Kaden, Jürgen; May, Gottfried; Völp, Andreas; Wesslau, Claus
2009-01-01
In organ grafts donor-specific sensitization is initiated immediately after revascularization. Therefore, in 1990 we introduced the intra-operative single high-dose ATG-Fresenius (ATG-F) induction in addition to standard triple drug therapy (TDT) consisting of steroids, azathioprine and cyclosporin. A total of 778 first renal transplantations from deceased donors, performed between 1987 and 1998, were included in this evaluation. This retrospective analysis of clinic records and electronic databases presents data of all recipients of first kidney grafts who received two different ATG-F inductions (1(st) group: 9 mg/kg body weight as single high-dose intra-operatively, n=484; 2(nd) group: 3 mg/kg body weight on 7 or 8 consecutive days as multiple-dose starting also intra-operatively, n=78) and standard TDT alone (3(rd) group: TDT alone, n=216). The 10-year patient survival rates were 72.6+/-2.6% (TDT + ATG-F single high-dose), 79.5+/-5.1% (TDT + ATG-F multiple-dose) and 67.2+/-3.7%% (TDT alone; Kaplan-Meier estimates with standard errors; ATG-F vs TDT alone, p=0.001). The 10-year graft survival rates with censoring of patients that died with a functioning graft were 73.8+/-2.4%, 57.7+/-5.8% and 58.4+/-3.6% (Kaplan-Meier estimates with standard errors; 1(st) vs 2(nd )and 3(rd) group, respectively, p<0.001) and the 10-year graft survival rates with patient death counted as graft failure were 58.3+/-2.7%, 55.7+/-5.8% and 48.2+/-3.5% (Kaplan-Meier estimates with standard errors; ATG-F single high-dose vs TDT, p=0.023). In pre-sensitized recipients there were also significant differences in favour of ATG-F, more notably in the single high-dose ATG-F induction. A total of 69% of the patients in the two cohorts receiving ATG-F did not experience any transplant rejections compared to 56% in patients undergoing TDT alone (p=0.018). The incidence of infectious complications was comparable across all groups. According to evidence obtained from the routine documentation of 778
Directory of Open Access Journals (Sweden)
Marisa Aparecida Amaro Malvestio
2008-08-01
Full Text Available OBJETIVO: Analisar as variáveis clínicas e pré-hospitalares associadas à sobrevivência de vítimas de acidente de trânsito. MÉTODOS: Estudo realizado no município de São Paulo, SP, de 1999 a 2003. Foram analisados dados de 175 pacientes, entre 12 e 65 anos, vitimados por acidente de trânsito. A Análise de Sobrevivência de Kaplan-Meier foi utilizada na abordagem dos resultados na cena do acidente com as vítimas de escore OBJETIVO: Analizar las variables clínicas y pre hospitalarias asociadas a la sobrevida de víctimas de accidentes del tránsito. MÉTODOS: Estudio realizado en el municipio de São Paulo (Sudeste de Brasil, de 1999 a 2003. Fueron analizados datos de 175 pacientes, entre 12 y 65 años, victimas de accidentes de tránsito. El análisis de Sobrevida de Kaplan-Meier fue utilizado en el abordaje de los resultados en la escena del accidente con las víctimas de score OBJECTIVE: To assess clinical and prehospital variables associated with survival of motor vehicle crash victims. METHODS: Study carried out in the city of São Paulo (Southeastern Brazil, from 1999 to 2003. Data from 175 patients, who were aged between 12 and 65 years and had been motor vehicle crash victims, were analyzed. Kaplan-Meier Survival Analysis was used to approach the results at the accident scene with victims scoring <11, according to the Revised Trauma Score. Variables analyzed were: sex, age, injury mechanisms, basic and advanced support procedures, Revised Trauma Score parameters and fluctuations, time elapsed in the prehospital phase and trauma severity according to the Injury Severity Score and Maximum Abbreviated Injury Scale. RESULTS: Analysis revealed that victims who were less likely to survive during the hospitalization period showed serious lesions in the abdomen, thorax, or lower limbs, with negative fluctuation of respiratory frequency and Revised Trauma Score in the prehospital phase. In addition, they needed specialized
Comparison of colorectal and gastric cancer: Survival and prognostic factors
International Nuclear Information System (INIS)
Moghimi-Dehkordi, Bijan; Safaee, Azadeh; Zali, Mohammad R
2009-01-01
Gastric and colorectal cancers are the most common gastrointestinal malignancies in Iran. We aim to compare the survival rates and prognostic factors between these two cancers. We studied 1873 patients with either gastric or colorectal cancer who were registered in one referral cancer registry center in Tehran, Iran. All patients were followed from their time of diagnosis until December 2006 (as failure time). Survival curves were calculated according to the Kaplan-Meier Method and compared by the Log-rank test. Multivariate analysis of prognostic factors was carried out using the Cox proportional hazard model. Of 1873 patients, there were 746 with gastric cancer and 1138 with colorectal cancer. According to the Kaplan-Meier method 1, 3, 5, and 7-year survival rates were 71.2, 37.8, 25.3, and 19.5%, respectively, in gastric cancer patients and 91.1, 73.1, 61, and 54.9%, respectively, in patients with colorectal cancer. Also, univariate analysis showed that age at diagnosis, sex, grade of tumor, and distant metastasis were of prognostic significance in both cancers ( P < 0.0001). However, in multivariate analysis, only distant metastasis in colorectal cancer and age at diagnosis, grade of tumor, and distant metastasis in colorectal cancer were identified as independent prognostic factors influencing survival. According to our findings, survival is significantly related to histological differentiation of tumor and distant metastasis in colorectal cancer patients and only to distant metastasis in gastric cancer patients. (author)
Garcia Vicente, A M; Soriano Castrejón, A; Amo-Salas, M; Lopez Fidalgo, J F; Muñoz Sanchez, M M; Alvarez Cabellos, R; Espinosa Aunion, R; Muñoz Madero, V
2016-01-01
To explore the relationship between basal (18)F-FDG uptake in breast tumors and survival in patients with breast cancer (BC) using a molecular phenotype approach. This prospective and multicentre study included 193 women diagnosed with BC. All patients underwent an (18)F-FDG PET/CT prior to treatment. Maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N), and the N/T index was obtained in all the cases. Metabolic stage was established. As regards biological prognostic parameters, tumors were classified into molecular sub-types and risk categories. Overall survival (OS) and disease free survival (DFS) were obtained. An analysis was performed on the relationship between semi-quantitative metabolic parameters with molecular phenotypes and risk categories. The effect of molecular sub-type and risk categories in prognosis was analyzed using Kaplan-Meier and univariate and multivariate tests. Statistical differences were found in both SUVT and SUVN, according to the molecular sub-types and risk classifications, with higher semi-quantitative values in more biologically aggressive tumors. No statistical differences were observed with respect to the N/T index. Kaplan-Meier analysis revealed that risk categories were significantly related to DFS and OS. In the multivariate analysis, metabolic stage and risk phenotype showed a significant association with DFS. High-risk phenotype category showed a worst prognosis with respect to the other categories with higher SUVmax in primary tumor and lymph nodes. Copyright © 2015 Elsevier España, S.L.U. and SEMNIM. All rights reserved.
Lundgren, Sebastian; Warfvinge, Carl Fredrik; Elebro, Jacob; Heby, Margareta; Nodin, Björn; Krzyzanowska, Agnieszka; Bjartell, Anders; Leandersson, Karin; Eberhard, Jakob; Jirström, Karin
2016-01-01
Natural killer (NK) cells and NK T cells (NKT) are vital parts of tumour immunosurveillance. However, their impact on prognosis and chemotherapy response in periampullary adenocarcinoma, including pancreatic cancer, has not yet been described. Immune cell-specific expression of CD56, CD3, CD68 and CD1a was analysed by immunohistochemistry on tissue microarrays with tumours from 175 consecutive cases of periampullary adenocarcinoma, 110 of pancreatobiliary type (PB-type) and 65 of intestinal type (I-type) morphology. Kaplan-Meier and Cox regression analysis were applied to determine the impact of CD56+ NK/NKT cells on 5-year overall survival (OS). High density of CD56+ NK/NKT cells correlated with low N-stage and lack of perineural, lymphatic vessel and peripancreatic fat invasion. High density of CD56+ NK/NKT cells was associated with prolonged OS in Kaplan-Meier analysis (p = 0.003), and in adjusted Cox regression analysis (HR = 0.49; 95% CI 0.29-0.86). The prognostic effect of high CD56+ NK/NKT cell infiltration was only evident in cases not receiving adjuvant chemotherapy in PB-type tumours (p for interaction = 0.014). This study demonstrates that abundant infiltration of CD56+ NK/NKT cells is associated with a prolonged survival in periampullary adenocarcinoma. However, the negative interaction with adjuvant treatment is noteworthy. NK cell enhancing strategies may prove to be successful in the management of these cancers.
Song, Kyung-Jin; Choi, Byung-Wan; Kim, Jong-Kil
2014-12-01
Retrospective study. To analyze the incidence and prevalence of clinical adjacent segment pathology (CASP) following anterior decompression and fusion with cage and plate augmentation for degenerative cervical diseases. No long-term data on the use of cage and plate augmentation have been reported. The study population consisted of 231 patients who underwent anterior cervical discectomy and fusion (ACDF) with cage and plate for degenerative cervical spinal disease. The incidence and prevalence of CASP was determined by using the Kaplan-Meier survival analysis. To analyze the factors that influence CASP, data on preoperative and postoperative sagittal alignment, spinal canal diameter, the distance between the plate and adjacent disc, extent of fusion level, and the presence or absence of adjacent segment degenerative changes by imaging studies were evaluated. CASP occurred in 15 of the cases, of which 9 required additional surgery. At 8-year follow-up, the average yearly incidence was 1.1%. The rate of disease-free survival based on Kaplan-Meier survival analysis was 93.6% at 5 years and 90.2% at 8 years. No statistically significant differences in CASP incidence based on radiological analysis were observed. Significantly high incidence of CASP was observed in the presence of increased adjacent segment degenerative changes (pdegenerative cervical disease is associated with a lower incidence in CSAP by 1.1% per year, and the extent of preoperative adjacent segment degenerative changes has been shown as a risk factor for CASP.
Wen, Jiahuai; Yang, Yanning; Ye, Feng; Huang, Xiaojia; Li, Shuaijie; Wang, Qiong; Xie, Xiaoming
2015-12-01
Previous studies have suggested that plasma fibrinogen contributes to tumor cell proliferation, progression and metastasis. The current study was performed to evaluate the prognostic relevance of preoperative plasma fibrinogen in breast cancer patients. Data of 2073 consecutive breast cancer patients, who underwent surgery between January 2002 and December 2008 at the Sun Yat-sen University Cancer Center, were retrospectively evaluated. Plasma fibrinogen levels were routinely measured before surgeries. Participants were grouped by the cutoff value estimated by the receiver operating characteristic (ROC) curve analysis. Overall survival (OS) was assessed using Kaplan-Meier analysis, and multivariate Cox proportional hazards regression model was performed to evaluate the independent prognostic value of plasma fibrinogen level. The optimal cutoff value of preoperative plasma fibrinogen was determined to be 2.83 g/L. The Kaplan-Meier analysis showed that patients with high fibrinogen levels had shorter OS than patients with low fibrinogen levels (p factor for OS in breast cancer patients (HR = 1.475, 95% confidence interval (CI): 1.177-1.848, p = 0.001). Subgroup analyses revealed that plasma fibrinogen level was an unfavorable prognostic parameter in stage II-III, Luminal subtypes and triple-negative breast cancer patients. Elevated preoperative plasma fibrinogen was independently associated with poor prognosis in breast cancer patients and may serve as a valuable parameter for risk assessment in breast cancer patients. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Glioblastoma: does the pre-treatment geometry matter? A postcontrast T1 MRI-based study
Energy Technology Data Exchange (ETDEWEB)
Perez-Beteta, Julian; Martinez-Gonzalez, Alicia; Molina, David; Amo-Salas, Mariano; Luque, Belen; Perez-Garcia, Victor M. [Universidad de Castilla-La Mancha, Laboratory of Mathematical Oncology, Edificio Politecnico, Instituto de Matematica Aplicada a la Ciencia y la Ingenieria, Ciudad Real (Spain); Arregui, Elena; Calvo, Manuel; Borras, Jose M.; Lopez, Carlos; Claramonte, Marta [Hospital General de Ciudad Real, Ciudad Real (Spain); Barcia, Juan A.; Iglesias, Lidia; Avecillas, Josue [Hospital Clinico San Carlos, Madrid (Spain); Albillo, David; Navarro, Miguel; Villanueva, Jose M.; Paniagua, Juan C.; Perez-Romasanta, Luis [Hospital Universitario de Salamanca, Salamanca (Spain); Martino, Juan; Velasquez, Carlos [Hospital Marques de Valdecilla, Santander (Spain); Asenjo, Beatriz; Benavides, Manuel; Herruzo, Ismael [Hospital Carlos Haya, Malaga (Spain); Delgado, Maria del Carmen; Valle, Ana del [Universidad de Sevilla, Facultad de Matematicas, Sevilla (Spain); Falkov, Anthony [Auckland Radiation Oncology, Auckland (New Zealand); Schucht, Philippe [Bern Inselspital, Neurosurgery Department, Bern (Switzerland); Arana, Estanislao [Instituto Valenciano de Oncologia, Valencia (Spain)
2017-03-15
The potential of a tumour's volumetric measures obtained from pretreatment MRI sequences of glioblastoma (GBM) patients as predictors of clinical outcome has been controversial. Mathematical models of GBM growth have suggested a relation between a tumour's geometry and its aggressiveness. A multicenter retrospective clinical study was designed to study volumetric and geometrical measures on pretreatment postcontrast T1 MRIs of 117 GBM patients. Clinical variables were collected, tumours segmented, and measures computed including: contrast enhancing (CE), necrotic, and total volumes; maximal tumour diameter; equivalent spherical CE width and several geometric measures of the CE ''rim''. The significance of the measures was studied using proportional hazards analysis and Kaplan-Meier curves. Kaplan-Meier and univariate Cox survival analysis showed that total volume [p = 0.034, Hazard ratio (HR) = 1.574], CE volume (p = 0.017, HR = 1.659), spherical rim width (p = 0.007, HR = 1.749), and geometric heterogeneity (p = 0.015, HR = 1.646) were significant parameters in terms of overall survival (OS). Multivariable Cox analysis for OS provided the later two parameters as age-adjusted predictors of OS (p = 0.043, HR = 1.536 and p = 0.032, HR = 1.570, respectively). Patients with tumours having small geometric heterogeneity and/or spherical rim widths had significantly better prognosis. These novel imaging biomarkers have a strong individual and combined prognostic value for GBM patients. (orig.)
An improved method for calculation of interface pressure force in PLIC-VOF methods
International Nuclear Information System (INIS)
Sefollahi, M.; Shirani, E.
2004-08-01
Conventional methods for the modeling of surface tension force in Piecewise Linear Interface Calculation-Volume of Fluid (PLIC-VOF) methods, such as Continuum Surface Force (CSF), Continuum Surface Stress (CSS) and also Meier's method, convert the surface tension force into a body force. Not only do they include the force in the interfacial cells but also in the neighboring cells. Thus they produce spurious currents. Also the pressure jump, due to the surface tension, is not calculated accurately in these methods. In this paper a more accurate method for the application of interface force in the computational modeling of free surfaces and interfaces which use PLIC-VOF methods is developed. This method is based on the evaluation of the surface tension force only in the interfacial cells and not the neighboring cells. Also the normal and the interface surface area needed for the calculation of the surface tension force is calculated more accurately. The present method is applied to a two-dimensional motionless drop of liquid and a bubble of gas as well as a non-circular two-dimensional drop, which oscillates due to the surface tension force, in an initially stagnant fluid with no gravity force. The results are compared with the results of the cases when CSF, CSS and Meier's methods are used. It is shown that the present method calculates pressure jump at the interface more accurately and produces less spurious currents comparing to CSS an CSF models. (author)
High Rab27A expression indicates favorable prognosis in CRC.
Shi, Chuanbing; Yang, Xiaojun; Ni, Yijiang; Hou, Ning; Xu, Li; Zhan, Feng; Zhu, Huijun; Xiong, Lin; Chen, Pingsheng
2015-06-13
Rab27A is a peculiar member in Rab family and has been suggested to play essential roles in the development of human cancers. However, the association between Rab27A expression and clinicopathological characteristics of colorectal cancer (CRC) has not been elucidated yet. One-step quantitative real-time polymerase chain reaction (qPCR) test with 18 fresh-frozen CRC samples and immunohistochemistry (IHC) analysis in 112 CRC cases were executed to evaluate the relationship between Rab27A expression and the clinicopathological features of CRC. Cox regression and Kaplan-Meier survival analyses were performed to identify the prognostic factors for 112 CRC patients. The results specified that the expression levels of Rab27A mRNA and protein were significantly higher in CRC tissues than that in matched non-cancerous tissues, in both qPCR test (p = 0.029) and IHC analysis (p = 0.020). The IHC data indicated that the Rab27A protein expression in CRC was statistically correlated with lymph node metastasis (p = 0.022) and TNM stage (p = 0.026). Cox multi-factor analysis and Kaplan-Meier method suggested Rab27A protein expression (p = 0.012) and tumor differentiation (p = 0.004) were significantly associated with the overall survival of CRC patients. The data indicated the differentiate expression of Rab27A in CRC tissues and matched non-cancerous tissues. Rab27A may be used as a valuable prognostic biomarker for CRC patients.
Ti, Lianping; Richardson, Lindsey; DeBeck, Kora; Nguyen, Paul; Montaner, Julio; Wood, Evan; Kerr, Thomas
2014-08-01
Despite the growing prevalence of illicit stimulant drug use internationally, and the widespread involvement of people who inject drugs (IDU) within street-based drug markets, little is known about the impact of different types of street-based income generation activities on the cessation of stimulant use among IDU. Data were derived from an open prospective cohort of IDU in Vancouver, Canada. We used Kaplan-Meier methods and Cox proportional hazards regression to examine the effect of different types of street-based income generation activities (e.g., sex work, drug dealing, and scavenging) on time to cessation of stimulant use. Between December, 2005 and November, 2012, 887 IDU who use stimulant drugs (cocaine, crack cocaine, or crystal methamphetamine) were prospectively followed-up for a median duration of 47 months. In Kaplan-Meier analyses, compared to those who did not engage in street-based income generation activities, participants who reported sex work, drug dealing, scavenging, or more than one of these activities were significantly less likely to report stimulant drug use cessation (all pstreet-based income generation activity remained significantly associated with a slower time to stimulant drug cessation (all p<0.005). Our findings highlight the urgent need for strategies to address stimulant dependence, including novel pharmacotherapies. Also important, structural interventions, such as low-threshold employment opportunities, availability of supportive housing, legal reforms regarding drug use, and evidence-based approaches that reduce harm among IDU are urgently required. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Joseph A
2016-03-01
Full Text Available Alain Joseph,1 Martin Cloutier,2 Annie Guérin,2 Roy Nitulescu,2 Vanja Sikirica3 1Global HEOR and Epidemiology, Shire, Zählerweg, Zug, Switzerland; 2Analysis Group, Inc., Montreal, Quebec, Canada; 3Global HEOR and Epidemiology, Shire, Wayne, PA, USA Purpose: To compare treatment adherence, discontinuation, add-on, and daily average consumption (DACON among adults with attention-deficit/hyperactivity disorder receiving second-line lisdexamfetamine dimesylate (LDX or atomoxetine (ATX, following methylphenidate.Patients and methods: A retrospective cohort study using US commercial claims databases (Q2/2009–Q3/2013.Results: At month 12, the LDX cohort (N=2,718 had a higher adherence level (proportion of days covered: 0.48 versus 0.30, P<0.001 and was less likely to discontinue (Kaplan–Meier estimate: 63% versus 85%, P<0.001 than the ATX cohort (N=674. There were no statistical differences in treatment add-on rates between cohorts (Kaplan–Meier estimate: 26% versus 25%, P=0.297. The LDX cohort had a lower DACON (1.10 versus 1.31, P<0.001 and was less likely to have a DACON >1 (adjusted odds ratio: 0.20, 95% confidence interval: 0.15–0.25, P<0.001 than the ATX cohort.Conclusion: Adults with attention-deficit/hyperactivity disorder treated with LDX following methylphenidate had a higher treatment adherence and lower discontinuation and DACON relative to those treated with ATX following methylphenidate. Keywords: ADHD, adult, adherence, lisdexamfetamine dimesylate, atomoxetine
Phosphorus-32 therapy for cystic craniopharyngiomas
International Nuclear Information System (INIS)
Barriger, Robert Bryan; Chang, Andrew; Lo, Simon S.; Timmerman, Robert D.; DesRosiers, Colleen; Boaz, Joel C.; Fakiris, Achilles J.
2011-01-01
Background and purpose: To examine control rates for predominantly cystic craniopharyngiomas treated with intracavitary phosphorus-32 (P-32). Material and methods: 22 patients with predominantly cystic craniopharyngiomas were treated at Indiana University between October 1997 and December 2006. Nineteen patients with follow-up of at least 6 months were evaluated. The median patient age was 11 years, median cyst volume was 9 ml, a median dose of 300 Gy was prescribed to the cyst wall, and median follow-up was 62 months. Results: Overall cyst control rate after the initial P-32 treatment was 67%. Complete tumor control after P-32 was 42%. Kaplan-Meier 1-, 3-, and 5-year initial freedom-from-progression rates were 68%, 49%, and 31%, respectively. Following salvage therapy, the Kaplan-Meier 1-, 3-, and 5-year ultimate freedom-from-progression rates were 95%, 95%, and 86%, respectively. All patients were alive at the last follow-up. Visual function was stable or improved in 81% when compared prior to P-32 therapy. Pituitary function remained stable in 74% of patients following P-32 therapy. Conclusions: Intracystic P-32 can be an effective and tolerable treatment for controlling cystic components of craniopharyngiomas as a primary treatment or after prior therapies, but frequently allows for progression of solid tumor components. Disease progression in the form of solid tumor progression, re-accumulation of cystic fluid, or development of new cysts may require further radiotherapy or surgical intervention for optimal long-term disease control.
Wu, Gang; Zhang, Dai-Yang; Duan, Yu-Han; Zhang, Ying-Qiong; Cui, Xian-Nian; Luo, Zheng
2017-05-23
BACKGROUND This study was designed to explore the correlations of hemoglobin level (Hb) and perioperative blood transfusion with the prognosis of gastric cancer (GC). MATERIAL AND METHODS Our study consisted of 210 patients with GC who all received a D2 radical operation. These patients were assigned into three groups: 68 cases in group A (blood transfusion >5 U); 59 cases in group B (blood transfusion blood transfusion). A 5-year follow-up was conducted to evaluate the disease-free survival of the patients. Univariate analysis was performed to reveal the relationship between the indicators and the patients with GC. Kaplan-Meier method was employed to analyze the survival rate of patients, and Cox regression analysis was applied to determine the independent prognostic factors of GC. RESULTS The univariate analysis indicated that age, perioperative blood transfusion amount, TNM staging, maximal tumor diameter, differentiation degree and invasion degree were associated with the prognosis of GC. The Kaplan-Meier curve showed that the disease-free survival rate was declined in the patients who were older, those received more amount of blood transfusion, those in advanced TNM staging, those had larger tumor diameter, and those with decreased degree of differentiation and invasion. Cox regression analysis indicated that perioperative blood transfusion, maximal tumor diameter and invasion degree were the independent factors affecting disease-free survival of the GC. CONCLUSIONS Our study revealed that large amount of perioperative blood transfusion leads to poor prognosis of GC.
An electronic health record-enabled obesity database
Directory of Open Access Journals (Sweden)
Wood G
2012-05-01
Full Text Available Abstract Background The effectiveness of weight loss therapies is commonly measured using body mass index and other obesity-related variables. Although these data are often stored in electronic health records (EHRs and potentially very accessible, few studies on obesity and weight loss have used data derived from EHRs. We developed processes for obtaining data from the EHR in order to construct a database on patients undergoing Roux-en-Y gastric bypass (RYGB surgery. Methods Clinical data obtained as part of standard of care in a bariatric surgery program at an integrated health delivery system were extracted from the EHR and deposited into a data warehouse. Data files were extracted, cleaned, and stored in research datasets. To illustrate the utility of the data, Kaplan-Meier analysis was used to estimate length of post-operative follow-up. Results Demographic, laboratory, medication, co-morbidity, and survey data were obtained from 2028 patients who had undergone RYGB at the same institution since 2004. Pre-and post-operative diagnostic and prescribing information were available on all patients, while survey laboratory data were available on a majority of patients. The number of patients with post-operative laboratory test results varied by test. Based on Kaplan-Meier estimates, over 74% of patients had post-operative weight data available at 4 years. Conclusion A variety of EHR-derived data related to obesity can be efficiently obtained and used to study important outcomes following RYGB.
Directory of Open Access Journals (Sweden)
Dong-dong Cheng
2015-07-01
Full Text Available Background/Aims: This aim of the present study was to identify specific markers determining the recurrence of the giant cell tumor of bone (GCTB. Methods: This study involved the clinicopathological analysis of 80 cases. All of the clinical features, pathological fracture, Campanacci grade, histological features and surgical methods were reviewed. Immunohistochemistry was used to detect the expression of Ki-67, CD147, mutant p53 and p63 in GCTB. Comparisons between different groups were performed using the Chi-square test. The risk factors affecting recurrence were analyzed using a binary logistic model. Kaplan-Meier analysis was employed for the survival analysis between the groups. Cell proliferation assays, migration and invasion assays were used to detect the function of CD147 on GCTB in vitro. Results: The univariate analysis showed that Ki-67 and CD147 expression, pathological fracture, Campanacci grade and surgical method were associated with recurrence. The multivariate analysis revealed that CD147 expression, Campanacci grade and surgical method were the factors affecting GCTB recurrence. In addition, the Kaplan-Meier analysis revealed that these factors affected tumor-free survival time. In vitro study revealed that the CD147 knockdown by small interfering RNA (siRNA technique dramatically reduced the proliferation, migration and invasion of GCTB. Conclusion: Our results suggest that CD147 may serve as an adequate marker for GCTB recurrence. Campanacci grade is a risk factor for GCTB recurrence, which is also affected by the surgical method used.
Factors affecting commencement and cessation of smoking behaviour in Malaysian adults
Directory of Open Access Journals (Sweden)
Ghani Wan
2012-03-01
Full Text Available Abstract Background Tobacco consumption peak in developed countries has passed, however, it is on the increase in many developing countries. Apart from cigarettes, consumption of local hand-rolled cigarettes such as bidi and rokok daun are prevalent in specific communities. Although factors associated with smoking initiation and cessation has been investigated elsewhere, the only available data for Malaysia is on prevalence. This study aims to investigate factors associated with smoking initiation and cessation which is imperative in designing intervention programs. Methods Data were collected from 11,697 adults by trained recording clerks on sociodemographic characteristics, practice of other risk habit and details of smoking such as type, duration and frequency. Smoking commencement and cessation were analyzed using the Kaplan-Meier estimates and log-rank tests. Univariate and multivariate Cox proportional hazard regression models were used to calculate the hazard rate ratios. Results Males had a much higher prevalence of the habit (61.7% as compared to females (5.8%. Cessation was found to be most common among the Chinese and those regularly consuming alcoholic beverages. Kaplan-Meier plot shows that although males are more likely to start smoking, females are found to be less likely to stop. History of betel quid chewing and alcohol consumption significantly increase the likelihood of commencement (p Conclusions Gender, ethnicity, history of quid chewing and alcohol consumption have been found to be important factors in smoking commencement; while ethnicity, betel quid chewing and type of tobacco smoked influences cessation.
Roy, Laurent-Olivier; Poirier, Marie-Belle; Fortin, David
2018-04-08
Glioblastoma (GBM) represents the most common and aggressive malignant primary brain tumors in adults. Response to standard treatment is transitory and the survival of clinical trial cohorts are little more than 14 months. GBM are characterized by excessive proliferation, invasiveness, and radio-/chemoresistance features; which are strongly upregulated by transforming growth factor-beta (TGF-β). We hypothesized that TGF-β gene expression could correlate with overall survival (OS) and serve as a prognostic biomarker. TGF-β₁ and -β₂ expression were analyzed by qPCR in 159 GBM tumor specimens. Kaplan-Meier and multivariate analyses were used to correlate expression with OS and progression-free survival (PFS). In GBM, TGF-β₁ and -β₂ levels were 33- and 11-fold higher respectively than in non-tumoral samples. Kaplan-Meier and multivariate analyses revealed that high to moderate expressions of TGF-β₁ significantly conferred a strikingly poorer OS and PFS in newly diagnosed patients. Interestingly, at relapse, neither isoforms had meaningful impact on clinical evolution. We demonstrate that TGF-β₁ is the dominant isoform in newly diagnosed GBM rather than the previously acknowledged TGF-β₂. We believe our study is the first to unveil a significant relationship between TGF-β₁ expression and OS or PFS in newly diagnosed GBM. TGF-β₁ could serve as a prognostic biomarker or target affecting treatment planning and patient follow-up.
Directory of Open Access Journals (Sweden)
Laurent-Olivier Roy
2018-04-01
Full Text Available Glioblastoma (GBM represents the most common and aggressive malignant primary brain tumors in adults. Response to standard treatment is transitory and the survival of clinical trial cohorts are little more than 14 months. GBM are characterized by excessive proliferation, invasiveness, and radio-/chemoresistance features; which are strongly upregulated by transforming growth factor-beta (TGF-β. We hypothesized that TGF-β gene expression could correlate with overall survival (OS and serve as a prognostic biomarker. TGF-β1 and -β2 expression were analyzed by qPCR in 159 GBM tumor specimens. Kaplan–Meier and multivariate analyses were used to correlate expression with OS and progression-free survival (PFS. In GBM, TGF-β1 and -β2 levels were 33- and 11-fold higher respectively than in non-tumoral samples. Kaplan–Meier and multivariate analyses revealed that high to moderate expressions of TGF-β1 significantly conferred a strikingly poorer OS and PFS in newly diagnosed patients. Interestingly, at relapse, neither isoforms had meaningful impact on clinical evolution. We demonstrate that TGF-β1 is the dominant isoform in newly diagnosed GBM rather than the previously acknowledged TGF-β2. We believe our study is the first to unveil a significant relationship between TGF-β1 expression and OS or PFS in newly diagnosed GBM. TGF-β1 could serve as a prognostic biomarker or target affecting treatment planning and patient follow-up.
Directory of Open Access Journals (Sweden)
Køber Lars
2010-01-01
Full Text Available Abstract Background The optimal duration of clopidogrel treatment after percutaneous coronary intervention (PCI is unclear. We studied the risk of death or recurrent myocardial infarction (MI in relation to 6- and 12-months clopidogrel treatment among MI patients treated with PCI. Methods Using nationwide registers of hospitalizations and drug dispensing from pharmacies we identified 11 680 patients admitted with MI, treated with PCI and clopidogrel. Clopidogrel treatment was categorized in a 6-months and a 12-months regimen. Rates of death, recurrent MI or a combination of both were analyzed by the Kaplan Meier method and Cox proportional hazards models. Bleedings were compared between treatment regimens. Results The Kaplan Meier analysis indicated no benefit of the 12-months regimen compared with the 6-months in all endpoints. The Cox proportional hazards analysis confirmed these findings with hazard ratios for the 12-months regimen (the 6-months regimen used as reference for the composite endpoint of 1.01 (confidence intervals 0.81-1.26 and 1.24 (confidence intervals 0.95-1.62 for Day 0-179 and Day 180-540 after discharge. Bleedings occurred in 3.5% and 4.1% of the patients in the 6-months and 12-months regimen (p = 0.06. Conclusions We found comparable rates of death and recurrent MI in patients treated with 6- and 12-months' clopidogrel. The potential benefit of prolonged clopidogrel treatment in a real-life setting remains uncertain.
Directory of Open Access Journals (Sweden)
Jaya M. Satagopan
2017-06-01
Full Text Available The data presented in this article are related to the research article entitled “Measuring differential treatment benefit across marker specific subgroups: the choice of outcome scale” (Satagopan and Iasonos, 2015 [1]. These data were digitally reconstructed from figures published in Larkin et al. (2015 [2]. This article describes the steps to digitally reconstruct patient-level data on time-to-event outcome and treatment and biomarker groups using published Kaplan-Meier survival curves. The reconstructed data set and the corresponding computer programs are made publicly available to enable further statistical methodology research.
DEFF Research Database (Denmark)
Charlot, Mette; Grove, Erik; Hansen, Peter Riis
2011-01-01
: All aspirin treated patients surviving 30 days after a first myocardial infarction from 1997 to 2006, with follow-up for one year. Patients treated with clopidogrel were excluded. MAIN OUTCOME MEASURES: The risk of the combined end point of cardiovascular death, myocardial infarction, or stroke...... associated with use of proton pump inhibitors was analysed using Kaplan-Meier analysis, Cox proportional hazard models, and propensity score matched Cox proportional hazard models. Results 3366 of 19 925 (16.9%) aspirin treated patients experienced recurrent myocardial infarction, stroke, or cardiovascular...
DEFF Research Database (Denmark)
Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, Jesper
1999-01-01
for folate biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP. METHODS: We studied bronchoalveolar samples collected in 1989-99 from a prospective cohort of HIV-1-infected patients who had PCP. In 144...... patients with 152 episodes of PCP, we analysed portions of DHPS using PCR and direct sequencing. The relation between survival, P. carinii DHPS mutations, and other predictors of treatment failure was assessed by Kaplan-Meier and multivariate Cox regression analysis. FINDINGS: P. carinii DHPS mutations...
Duración del desempleo y canales de búsqueda de empleo en Colombia
Carlos Augusto Viáfara L; José Ignacio Uribe G
2009-01-01
Este artículo estudia la duración del desempleo en Colombia como indicador de la efectividad de los canales de búsqueda de empleo, con información de la Encuesta Continua de Hogares (ECH) del segundo trimestre de 2006. Se estiman modelos de duración paramétricos (Weibull de riesgos proporcionales) y no paramétricos (Kaplan-Meier). Los resultados indican que en la duración del desempleo influye considerablemente el canal de búsqueda que usan los empleados para conseguir empleo y los desocupado...
DEFF Research Database (Denmark)
Lange, Jeppe; Troelsen, Anders; Solgaard, Søren
2018-01-01
was re-revision performed due to infection and was evaluated by competing risk analysis, with death and aseptic revision as competing events. All-cause mortality was evaluated by Kaplan-Meier survival analysis. Oxford Hip Score (OHS) was used as disease-specific patient-reported outcome measure. RESULTS......BACKGROUND: Cementless 1-stage revision in chronic periprosthetic hip joint infections is limited evaluated. The purpose of this study was to evaluate a specific treatment protocol in this patient group. METHODS: The study was performed as a multicenter, proof-of-concept, observational study...
DEFF Research Database (Denmark)
Pantalone, Gaetano Restivo; Maggio, Aurelio; Vitrano, Angela
2011-01-01
In β-thalassemia major (β-TM) patients, iron chelation therapy is mandatory to reduce iron overload secondary to transfusions. Recommended first line treatment is deferoxamine (DFO) from the age of 2 and second line treatment after the age of 6 is deferiprone (L1). A multicenter randomized open...... thalassemia patients were randomized and underwent intention-to-treat analysis. Statistically, a decrease of serum ferritin level was significantly higher in alternating sequential L1-DFO patients compared with L1 alone patients (p = 0.005). Kaplan-Meier survival analysis for the two chelation treatments did...
DEFF Research Database (Denmark)
Pereira, Michele C; Oliveira, Denise T; Olivieri, Eloísa H R
2010-01-01
OBJECTIVE: The aim of this study was to investigate the prevalence of the Eosinophil cationic protein (ECP)-gene polymorphism 434(G>C) in oral squamous cell carcinoma (OSCC) patients and its association with tumor-associated tissue eosinophilia (TATE), demographic, clinical, and microscopic...... of ECP-gene polymorphism 434(G>C) with TATE, demographic, clinical, and microscopic variables in OSCC patients. Disease-free survival and overall survival were calculated by the Kaplan-Meier product-limit actuarial method and the comparison of the survival curves were performed using log rank test...
DEFF Research Database (Denmark)
Andersen, Kim Francis; Fuglo, Hanna Maria; Rasmussen, Sine Hvid
2015-01-01
analysis. Kaplan-Meier survival estimates and log-rank test were used to compare the degree of equality of survival distributions. Prognostic variables with related hazard ratios (HR) were assessed using Cox proportional hazards regression analysis.Forty-one of 92 patients died during follow-up (45%; 12 BS.......05, HR 3.37 [95% CI 1.02-11.11]). No significant results were demonstrated for MTV40%.Volume-based F-18 FDG PET/CT imaging markers in terms of pretreatment estimation of TLG provide supplemental prognostic information to histologic grading, with significant independent properties for prediction...
DEFF Research Database (Denmark)
Badawy, Mona; Fenstad, Anne M.; Bartz-Johannessen, Christoffer A.
2017-01-01
Background: High procedure volume and dedication to unicompartmental knee arthroplasty (UKA) has been suggested to improve revision rates. This study aimed to quantify the annual hospital volume effect on revision risk in Oxfordu? nicompartmental knee arthroplasty in the Nordic countries. Methods......). The outcome was revision risk after 2 and 10 years calculated using Kaplan Meier method. Multivariate Cox regression analysis was used to assess the Hazard Ratio (HR) of any revision due to specific reasons with 95% confidence intervals (CI). Results: The implant survival was 80% at 10 years in the volume...
DEFF Research Database (Denmark)
Rosendahl, Mikkel; Høgdall, Claus Kim; Mosgaard, Berit Jul
2016-01-01
OBJECTIVE: With the 2013 International Federation of Gynecology and Obstetrics (FIGO) staging for ovarian, fallopian tube, and primary peritoneal cancer, the number of substages changed from 10 to 14. Any classification of a malignancy should easily assign patients to prognostic groups, refer....... MATERIALS AND METHODS: Demographic, surgical, histological, and survival data from 4036 ovarian cancer patients were used in the analysis. Five-year survival rates (5YSR) and hazard ratios for the old and revised FIGO staging were calculated using Kaplan-Meier curves and Cox regression. RESULTS: A total...
DEFF Research Database (Denmark)
van Keimpema, Loes; Nevens, Frederik; Adam, René
2011-01-01
Patients with end-stage isolated polycystic liver disease (PCLD) suffer from incapacitating symptoms because of very large liver volumes. Liver transplantation (LT) is the only curative option. This study assesses the feasibility of LT in PCLD. We used the European Liver Transplant Registry (ELTR......) database to extract demographics and outcomes of 58 PCLD patients. We used Kaplan-Meier survival analysis for survival rates. Severe abdominal pain (75%) was the most prominent symptom, while portal hypertension (35%) was the most common complication in PCLD. The explantation of the polycystic liver...
Reexamining trends in premarital sex in the United States
Lawrence L. Wu; Steven Martin; Paula England
2018-01-01
Background: In a heavily cited paper, Finer (2007) asserted that by age 30, 82Š of US women born 1939-1948 engaged in premarital sex, increasing to 94Š for those born 1969-1978. Using the same data, our age 30 estimates are 55Š and 87Š for women born 1939-1948 and 1969-1978. Our analyses thus document strikingly different levels and trends. Methods: We replicate Finer's single-decrement Kaplan-Meier estimates of premarital sex using Cycles 3-6 of the National Survey of Family Growth, the s...
Christian J Díaz
2009-01-01
Se analizó la deserción estudiantil universitaria, en estudiantes de carreras de ingeniería de la cohorte del año 2004 hasta enero del año 2007. Se evaluó la retención utilizando un modelo de Kaplan-Meier, y se determinaron factores de la deserción con un modelo de riesgos proporcionales de Cox. Los resultados muestran que la mayor probabilidad de desertar se presenta en los tres primeros semestres, y en estudiantes que provienen de colegios financiados por el estado. Son factores determinant...
Influence of Body Mass Index on Tumor Pathology and Survival in Uterine Cancer
DEFF Research Database (Denmark)
Bjerrum Kristensen, Anne; Hare-Bruun, Helle; Høgdall, Claus Kim
2017-01-01
OBJECTIVE: To evaluate the influence of body mass index (BMI) on endometrial tumor pathology, stage and complication rate and to identify individual prognostic factors, such as BMI, in types I and II endometrial cancer. DESIGN: Register study included all Danish women who underwent surgery...... I and II endometrial cancer were retrieved. Kaplan-Meier plot was used to illustrate differences in survival in relation to BMI. Log-rank test was used to demonstrate difference between the curves. Cox regression hazard model was used to estimate hazard ratios (HR) of the effect of BMI on overall...
Polymorphous low-grade adenocarcinoma: A Danish national study
DEFF Research Database (Denmark)
Elhakim, Mohammad Talal; Breinholt, Helle; Godballe, Christian
2016-01-01
. Histological slides were reviewed and data concerning demographics, tumour site, clinical stage, treatment profiles and follow-up were retrieved. Survival estimates and prognostic factors were evaluated by comparing Kaplan–Meier plots using the Mantel–Haenszel log-rank test. Results Of the 73 patients, 47 (64......%) were female. Median age was 58 years. The most common location was the palate (73%). Median latency was five months. Recurrence was seen in 13% of patients. Overall survival (OS), disease-specific survival (DSS) and recurrence-free survival (RFS) rates after 10 years were 73%, 99% and 83%, respectively...
Clinical Features in a Danish Population-Based Cohort of Probable Multiple System Atrophy Patients
DEFF Research Database (Denmark)
Starhof, Charlotte; Korbo, Lise; Lassen, Christina Funch
2016-01-01
Background: Multiple system atrophy (MSA) is a rare, sporadic and progressive neurodegenerative disorder. We aimed to describe the clinical features of Danish probable MSA patients, evaluate their initial response to dopaminergic therapy and examine mortality. Methods: From the Danish National...... the criteria for probable MSA. We recorded clinical features, examined differences by MSA subtype and used Kaplan-Meier survival analysis to examine mortality. Results: The mean age at onset of patients with probable MSA was 60.2 years (range 36-75 years) and mean time to wheelchair dependency was 4.7 years...
Impact of Marital Status on Tumor Stage at Diagnosis and on Survival in Male Breast Cancer
Adekolujo, Orimisan Samuel; Tadisina, Shourya; Koduru, Ujwala; Gernand, Jill; Smith, Susan Jane; Kakarala, Radhika Ramani
2016-01-01
The effect of marital status (MS) on survival varies according to cancer type and gender. There has been no report on the impact of MS on survival in male breast cancer (MBC). This study aims to determine the influence of MS on tumor stage at diagnosis and survival in MBC. Men with MBC ≥18 years of age in the SEER database from 1990 to 2011 were included in the study. MS was classified as married and unmarried (including single, divorced, separated, widowed). Kaplan–Meier method was used to e...
Digital outlines and topography of the glaciers of the American West
Fountain, Andrew G.; Hoffman, Matthew; Jackson, Keith; Basagic, Hassan; Nylen, Thomas; Percy, David
2007-01-01
Alpine glaciers have generally receded during the past century (post-“Little Ice Age”) because of climate warming (Oerlemans and others, 1998; Mann and others, 1999; Dyurgerov and Meier, 2000; Grove, 2001). This general retreat has accelerated since the mid 1970s, when a shift in atmospheric circulation occurred (McCabe and Fountain, 1995; Dyurgerov and Meier, 2000). The loss in glacier cover has had several profound effects. First, the shrinkage of glaciers results in a net increase in stream flow, typically in late summer when water supplies are at the lowest levels (Fountain and Tangborn, 1985). This additional water is important to ecosystems (Hall and Fagre, 2003) and to human water needs (Tangborn, 1980). However, if shrinkage continues, the net contribution to stream flow will diminish, and the effect upon these benefactors will be adverse. Glacier shrinkage is also a significant factor in current sea level rise (Meier, 1984; Dyurgerov and Meier, 2000). Second, many of the glaciers in the West Coast States are located on stratovolcanoes, and continued recession will leave oversteepened river valleys. These valleys, once buttressed by ice are now subject to failure, creating conditions for lahars (Walder and Driedger, 1994; O’Connor and others, 2001). Finally, reduction or loss of glaciers reduce or eliminate glacial activity as an important geomorphic process on landscape evolution and alters erosion rates in high alpine areas (Hallet and others, 1996). Because of the importance of glaciers to studies of climate change, hazards, and landscape modification, glacier inventories have been published for Alaska (Manley, in press), China (http://wdcdgg.westgis.ac.cn/DATABASE/Glacier/Glacier.asp), Nepal (Mool and others, 2001), Switzerland (Paul and others, 2002), and the Tyrolian Alps of Austria (Paul, 2002), among other locales. To provide the necessary data for assessing the magnitude and rate of glacier change in the American West, exclusive of Alaska
International Nuclear Information System (INIS)
Scorticati, Carlos; Aguilar, Jorge A.; Gonzalez Granda, Pablo; Mendez, Fernando; Montiel, Raul; Rege, Eduardo; Alvarez, Patricio; Lopez, Miguel A.; Rizzi, Alfredo; Mazza, Osvaldo
2009-01-01
Introduction and Objectives: To analyze the results of the treatment in patients with cancer of prostate of high risk. Material and Method: Retrospective and observational analysis of 130 patients operated by CAP of high risk (criteria of D'Amico) average 41,48 months, divided in form nonrandomized in three groups 1: radical prostatectomy, 2: neoadjuvant hormonoterapy (BAC) + PR, 3: BAC + PR + x-ray (RT). Statistical analysis: multivaried, test of curved Chi2 and p statistical and of Kaplan Meier. Results: Biochemical relapse 68 patients (52.3%), average 23,37 months. Without differences according to therapeutic modality (p: 0.043). In the multivaried analysis of the 3 factors of presurgical, single risk we found a statistically significant relation in the coexistence of the 3 factors with the presence of positive margin in the PR piece. (p: 0,002). The analysis to make or not, neoadjuvant BAC without significant difference (p: 0,403) evaluating in such the rate of M+, actuarial global survival according to curves of Kaplan Meier to 5 and 10 years (P: 0,5257) and survival 5 actuarial specific cancer to and 10a (P: 0,2165). Conclusions: Without significant differences in: RB, clinical progression, pathological relapse, global and specific survival, rate of positive surgical margins. The 3 criteria of D'Amico were predictive of positive surgical margins and RB, the patients with RB in group 2 presented/displayed greater risk of clinical progression, the PR demonstrated a global survival and specify actuarial to 10 years greater to 50%, considering it therapeutic an option been worth. (authors) [es
Huang, Si-Si; Xie, Dong-Mei; Cai, Yi-Jing; Wu, Jian-Min; Chen, Rui-Chong; Wang, Xiao-Dong; Song, Mei; Zheng, Ming-Hua; Wang, Yu-Qun; Lin, Zhuo; Shi, Ke-Qing
2017-04-01
Hepatitis B virus (HBV) infection remains a major health problem and HBV-related-decompensated cirrhosis (HBV-DC) usually leads to a poor prognosis. Our aim was to determine the utility of inflammatory biomarkers in predicting mortality of HBV-DC. A total of 329 HBV-DC patients were enrolled. Survival estimates for the entire study population were generated using the Kaplan-Meier method. The prognostic values for model for end-stage liver disease (MELD) score, Child-Pugh score, and inflammatory biomarkers neutrophil/lymphocyte ratio, C-reactive protein-to-albumin ratio (CAR), and lymphocyte-to-monocyte ratio (LMR) for HBV-DC were compared using time-dependent receiver operating characteristic curves and time-dependent decision curves. The survival time was 23.1±15.8 months. Multivariate analysis identified age, CAR, LMR, and platelet count as prognostic independent risk factors. Kaplan-Meier analysis indicated that CAR of at least 1.0 (hazard ratio, 7.19; 95% confidence interval, 4.69-11.03), and LMR less than 1.9 (hazard ratio, 2.40; 95% confidence interval, 1.69-3.41) were independently associated with mortality of HBV-DC. The time-dependent receiver operating characteristic indicated that CAR showed the best performance in predicting mortality of HBV-DC compared with LMR, MELD score, and Child-Pugh score. The results were also confirmed by time-dependent decision curves. CAR and LMR were associated with the prognosis of HBV-DC. CAR was superior to LMR, MELD score, and Child-Pugh score in HBV-DC mortality prediction.
International Nuclear Information System (INIS)
Ganeshan, B.; Miles, K.A.; Shortman, R.; Afaq, A.; Ardeshna, K.M.; Groves, A.M.; Kayani, I.; Babikir, S.
2017-01-01
The purpose of this study was to investigate the ability of computed tomography texture analysis (CTTA) to provide additional prognostic information in patients with Hodgkin's lymphoma (HL) and high-grade non-Hodgkin's lymphoma (NHL). This retrospective, pilot-study approved by the IRB comprised 45 lymphoma patients undergoing routine 18F-FDG-PET-CT. Progression-free survival (PFS) was determined from clinical follow-up (mean-duration: 40 months; range: 10-62 months). Non-contrast-enhanced low-dose CT images were submitted to CTTA comprising image filtration to highlight features of different sizes followed by histogram-analysis using kurtosis. Prognostic value of CTTA was compared to PET FDG-uptake value, tumour-stage, tumour-bulk, lymphoma-type, treatment-regime, and interim FDG-PET (iPET) status using Kaplan-Meier analysis. Cox regression analysis determined the independence of significantly prognostic imaging and clinical features. A total of 27 patients had aggressive NHL and 18 had HL. Mean PFS was 48.5 months. There was no significant difference in pre-treatment CTTA between the lymphoma sub-types. Kaplan-Meier analysis found pre-treatment CTTA (medium feature scale, p=0.010) and iPET status (p<0.001) to be significant predictors of PFS. Cox analysis revealed that an interaction between pre-treatment CTTA and iPET status was the only independent predictor of PFS (HR: 25.5, 95% CI: 5.4-120, p<0.001). Specifically, pre-treatment CTTA risk stratified patients with negative iPET. CTTA can potentially provide prognostic information complementary to iPET for patients with HL and aggressive NHL. (orig.)
Combination therapy with hormonal, radiation and chemotherapy for stage C prostate cancer
International Nuclear Information System (INIS)
Iwasawa, Toshihisa; Matsumoto, Hidetsugu
1996-01-01
To improve the effectiveness of treatment for patients with stage C prostate cancer, therapy in combination with hormonal, radiation and chemotherapy was given for the initial period, and there after, hormonal therapy was continuously administered to 18 patients with chemotherapy and three patients without it. At the Social Health Insurance Medical Center, between May 1988 and August 1991, 21 patients were diagnosed to have stage C histologically confirmed adenocarcinoma of the prostate. The average age of the patients was 69.0 years. The tumor was well, moderate and poorly differentiated in 5, 6 and 10 patients, respectively. As hormonal therapy, orchiectomy was performed on 19 of the 21 patients. Furthermore, 11 patients were administered estramustine phosphate, 9 chlormadinone acetate, and one diethylstilbesterol diphosphate. As, radiation therapy, all patients were treated with AP-PA parallel opposing technique to small pelvis with a 12 cm x 12 cm treatment field (44-45 Gy) combined with conformation radiotherapy to prostate (20-26 Gy). Chemotherapy was performed using either one or a combination of the following; cis-diamminedichloroplatinum, adriamycin, cyclophosphamide, 5-fluorouracil, methotrexate and etoposide. The observation period was 54.5 months on the average. Recurrence was observed in 3 patients, for all of which the sites were at bone. The 5-year non-recurrence rate was 90.4% by Kaplan-Meier's method. There were 4 deaths, three were due to prostate cancer and one to gastric cancer. The 5-year cumulative survival rate by Kaplan-Meier's method was 90.5%. In conclusion, this treatment was effective for stage C cases of prostate cancer. (author)
International Nuclear Information System (INIS)
Tai, Bee-Choo; Grundy, Richard G.; Machin, David
2010-01-01
Purpose: In trials designed to delay or avoid irradiation among children with malignant brain tumor, although irradiation after disease progression is an important event, patients who have disease progression may decline radiotherapy (RT), or those without disease progression may opt for elective RT. To accurately describe the cumulative need for RT in such instances, it is crucial to account for these distinct events and to evaluate how each contributes to the delay or advancement of irradiation via a competing risks analysis. Methods and Materials: We describe the summary of competing events in such trials using competing risks methods based on cumulative incidence functions and Gray's test. The results obtained are contrasted with standard survival methods based on Kaplan-Meier curves, cause-specific hazard functions and log-rank test. Results: The Kaplan-Meier method overestimates all event-specific rates. The cause-specific hazard analysis showed reduction in hazards for all events (A: RT after progression; B: no RT after progression; C: elective RT) among children with ependymoma. For event A, a higher cumulative incidence was reported for ependymoma. Although Gray's test failed to detect any difference (p = 0.331) between histologic subtypes, the log-rank test suggested marginal evidence (p = 0.057). Similarly, for event C, the log-rank test found stronger evidence of reduction in hazard among those with ependymoma (p = 0.005) as compared with Gray's test (p = 0.086). Conclusions: To evaluate treatment differences, failing to account for competing risks using appropriate methodology may lead to incorrect interpretations.
Thanapprapasr, Kamolrat; Nartthanarung, Adisak; Thanapprapasr, Duangmani; Jinawath, Artit
2017-01-01
Focal adhesion kinase (FAK) is important for tumor cell survival and metastasis in various cancers. However, its expression and prognostic value in patients with metastatic osteosarcoma remain unknown. We investigated the expression of FAK and its phosphorylated form (pFAK-Y397) in osteosarcoma tissues from 53 patients by immunohistochemistry and evaluated their correlations with clinicopathologic characteristics and outcomes. The prognostic values were assessed using Kaplan-Meier survival and Cox regression analyses. Total FAK and pFAK-Y397 were overexpressed in 48 (90.6%) and 33 (62.3%) cases, respectively. pFAK-Y397 overexpression was correlated with poor histologic response after neoadjuvant chemotherapy in patients with osteosarcoma regardless of the presence of metastasis or not. Kaplan-Meier curve showed that patients with metastatic osteosarcoma with pFAK-Y397 overexpression had significantly worse overall survival (OS) than those with non-overexpression (P = 0.044). Multivariate Cox regression analysis confirmed pFAK-Y397 overexpression as an independent prognostic predictor for OS and post metastases OS (PMOS) (P = 0.017, P = 0.006, respectively). Age at diagnosis was also an independent indicator for PMOS (P = 0.003). However, total FAK expression was not correlated with any clinicopathologic characteristics or OS in patients with metastatic osteosarcoma. In conclusion, our findings identified FAK as a common aberrant protein overexpression in various subtypes of osteosarcoma. pFAK-Y397 overexpression can be used as a prognostic biomarker predicting poor OS for patients with metastatic osteosarcoma, and the expression of pFAK-Y397 differentiated good and poor responders to neoadjuvant chemotherapy.
Iverson, Shawn M; Spierer, Oriel; Papachristou, George C; Feuer, William J; Shi, Wei; Greenfield, David S; O'Brien, Terrence P
2018-02-01
To compare corneal graft survival rates after penetrating keratoplasty (PK) and Descemet's stripping endothelial keratoplasty (DSEK) in patients with a glaucoma drainage device (GDD) or medically managed glaucoma. A retrospective chart review was conducted on consecutive patients who underwent primary PK or primary DSEK. Inclusion criteria consisted of eyes with a diagnosis of glaucoma prior to corneal transplantation and a minimum of 6 months of follow-up. Graft failure was defined as an edematous cornea with failure to maintain deturgescence lasting beyond a period of 1 month of intense steroid therapy or vascularization and scarring resulting in irreversible loss of central graft clarity. Corneal graft survival was calculated using Kaplan-Meier survival analysis. Patients were divided into four groups: GDD-PK, GDD-DSEK, medical-PK and medical-DSEK. Fifty-six eyes of 56 patients were identified as meeting inclusion criteria. Among eyes with a GDD, there was no difference in the proportion of failures between PK grafts (48%) and DSEK grafts (50%) (p = 0.90). Failure occurred earlier in DSEK recipients compared to PK recipients, 5.82 ± 6.77 months versus 14.40 ± 7.70 months, respectively (p = 0.04). A Kaplan-Meier analysis did not identify a difference between the four groups with respect to graft failure (p = 0.52). There is no significant difference in graft survival rates between medically and surgically treated glaucoma patients for either PK or DSEK grafts. In patients with GDD, graft failure occurs earlier in DSEK compared to PK.
Zhang, Li-Min; Li, Rui; Zhao, Xiao-Chun; Zhang, Qian; Luo, Xing-Liao
2017-08-01
The fresh frozen plasma (FFP) transfusion threshold and timing for traumatic brain injury (TBI)-associated coagulopathy are controversial. Thus, a multicenter retrospective study was conducted to determine whether or not FFP transfusion is associated with poor outcomes after severe TBI. Data from decompressive craniotomy after blunt force trauma that took place between December 2013 and June 2016 were collected in a multicenter chart. The primary outcomes were mortality and survival, as well as worse outcomes (defined as a Glasgow Outcome Scale [GOS] score ≤3) and better outcomes (GOS score ≥4). Secondary outcomes included 90-day survival rates in all patients with or without FFP transfusion, as well as length of hospital stay in patients with a better prognosis (GOS score ≥4). Univariate analysis, bivariate logistic regression, Spearman rank correlation, and Kaplan-Meier analysis were performed to account for the association between perioperative FFP transfusion and different outcomes. Bivariate logistic analysis showed that mortality and worse outcomes were correlated with FFP transfusion and Glasgow Coma Scale score (P < 0.05). Kaplan-Meier analysis suggested that mortality was statistically higher in the FFP transfusion groups compared with the no FFP transfusion groups, regardless of the severity of TBI (P < 0.05). The overall complications, acute respiratory distress syndrome, and pneumonia rate were significantly higher for patients receiving FFP transfusion (P < 0.05). Increased perioperative FFP infusion was independently associated with mortality or worse outcomes across a spectrum of surgical risk profiles. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Rieger, Johannes; Hautmann, Hubert; Linsenmaier, Ulrich; Weber, Cristoph; Treitl, Markus; Huber, R.M.; Pfeifer, Klaus-Juergen
2004-01-01
Over the last few years various types of metal wire stents have been increasingly employed in the treatment of both malignant and benign tracheobronchial obstruction. To date, however, few studies have investigated the in vivo properties of different stent types. We implanted 26 balloon-expandable tantalum Strecker stents (18 patients) and 18 self-expandable Wallstents (16 patients) into the tracheobronchial system of 30 patients with combined stenting in 4 patients. Mean age was 51 years (range: 0.5-79 years). Malignant disease was present in 23 patients, benign disease in seven patients. Both patients and individual stents were monitored clinically and radiographically. The probability of stents remaining within the tracheobronchial system, and of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for both stent types. Average stent follow-up time was 112 days until explantation and 115 days until patients' death or discharge. Kaplan-Meier analysis revealed a higher probability for the Wallstent to remain within the tracheobronchial system. Dislocation and compression occurred more rarely. Explantation, however, if desired, was more difficult compared to the Strecker stent. The Wallstent also led to the formation of granulation tissue, especially at the proximal stent end, frequently requiring reintervention. Both stent types proved to be effective therapeutic options in the management of obstructive tracheobronchial disease. The mechanical properties of the Strecker stent seem to be less favorable compared to the Wallstent but removal is easy. For benign disease, however, the Wallstent reveals limitations due to significant side effects
International Nuclear Information System (INIS)
Zhu Wanqi; Yu Jinming; Sun Xiaorong; Xing Ligang; Xie Peng; Sun Xindong; Guo Hongbo; Yang Guoren; Kong Li
2011-01-01
Objective: To evaluate the prognostic value of MTV on 18 F-FDG PET/CT in patients with esophageal cancer. Methods: Forty-nine patients with esophageal cancer underwent 18 F-FDG PET/CT scan before surgery. The median follow-up time for the patients was 29 months (range, 8-57 months). The prognostic significance of MTV, age, sex, histologic grade, SUV max of the primary tumor, tumor size measured on PET/CT, T stage, N stage, M stage, American Joint Committee on Cancer (AJCC) stage, number and location of lymph nodes metastases were assessed by Kaplan-Meier analysis and multivariate Cox model. Results: In the univariate analysis, AJCC stage (χ 2 =16.206, hazard ratio (HR)=1.177, P<0.001), N stage (χ 2 =9.536, HR=10.833, P=0.002), T stage (χ 2 =5.810, HR=2.397, P=0.016), number of lymph nodes metastases (χ 2 =11.423, HR=1.567, P=0.001), and MTV (χ 2 =3.872, HR=2.433, P=0.049) were significant predictors of survival.Multivariate analysis showed that MTV and AJCC stage were independent predictors of survival (χ 2 =4.525, HR 1.170, P=0.033; χ 2 =4.875, HR=3.071, P=0.027). Kaplan-Meier survival curves revealed longer survival time of low-MTV group as compared to high-MTV group (Log-rank, χ 2 =4.186, P=0.041). Conclusion: MTV on 18 F-FDG PET/CT may be an independent prognostic factor in patients with esophageal cancer. (authors)
Metagenes Associated with Survival in Non-Small Cell Lung Cancer
Urgard, Egon; Vooder, Tõnu; Võsa, Urmo; Välk, Kristjan; Liu, Mingming; Luo, Cheng; Hoti, Fabian; Roosipuu, Retlav; Annilo, Tarmo; Laine, Jukka; Frenz, Christopher M.; Zhang, Liqing; Metspalu, Andres
2011-01-01
NSCLC (non-small cell lung cancer) comprises about 80% of all lung cancer cases worldwide. Surgery is most effective treatment for patients with early-stage disease. However, 30%–55% of these patients develop recurrence within 5 years. Therefore, markers that can be used to accurately classify early-stage NSCLC patients into different prognostic groups may be helpful in selecting patients who should receive specific therapies. A previously published dataset was used to evaluate gene expression profiles of different NSCLC subtypes. A moderated two-sample t-test was used to identify differentially expressed genes between all tumor samples and cancer-free control tissue, between SCC samples and AC/BC samples and between stage I tumor samples and all other tumor samples. Gene expression microarray measurements were validated using qRT-PCR. Bayesian regression analysis and Kaplan-Meier survival analysis were performed to determine metagenes associated with survival. We identified 599 genes which were down-regulated and 402 genes which were up-regulated in NSCLC compared to the normal lung tissue and 112 genes which were up-regulated and 101 genes which were down-regulated in AC/BC compared to the SCC. Further, for stage Ib patients the metagenes potentially associated with survival were identified. Genes that expressed differently between normal lung tissue and cancer showed enrichment in gene ontology terms which were associated with mitosis and proliferation. Bayesian regression and Kaplan-Meier analysis showed that gene-expression patterns and metagene profiles can be applied to predict the probability of different survival outcomes in NSCLC patients. PMID:21695068
Energy Technology Data Exchange (ETDEWEB)
Ganeshan, B.; Miles, K.A.; Shortman, R.; Afaq, A.; Ardeshna, K.M.; Groves, A.M.; Kayani, I. [University College London, Institute of Nuclear Medicine, London (United Kingdom); Babikir, S. [International Atomic Energy Agency (IAEA), Human Health Division, Nuclear Medicine and Diagnostic Imaging Section, Vienna (Austria)
2017-03-15
The purpose of this study was to investigate the ability of computed tomography texture analysis (CTTA) to provide additional prognostic information in patients with Hodgkin's lymphoma (HL) and high-grade non-Hodgkin's lymphoma (NHL). This retrospective, pilot-study approved by the IRB comprised 45 lymphoma patients undergoing routine 18F-FDG-PET-CT. Progression-free survival (PFS) was determined from clinical follow-up (mean-duration: 40 months; range: 10-62 months). Non-contrast-enhanced low-dose CT images were submitted to CTTA comprising image filtration to highlight features of different sizes followed by histogram-analysis using kurtosis. Prognostic value of CTTA was compared to PET FDG-uptake value, tumour-stage, tumour-bulk, lymphoma-type, treatment-regime, and interim FDG-PET (iPET) status using Kaplan-Meier analysis. Cox regression analysis determined the independence of significantly prognostic imaging and clinical features. A total of 27 patients had aggressive NHL and 18 had HL. Mean PFS was 48.5 months. There was no significant difference in pre-treatment CTTA between the lymphoma sub-types. Kaplan-Meier analysis found pre-treatment CTTA (medium feature scale, p=0.010) and iPET status (p<0.001) to be significant predictors of PFS. Cox analysis revealed that an interaction between pre-treatment CTTA and iPET status was the only independent predictor of PFS (HR: 25.5, 95% CI: 5.4-120, p<0.001). Specifically, pre-treatment CTTA risk stratified patients with negative iPET. CTTA can potentially provide prognostic information complementary to iPET for patients with HL and aggressive NHL. (orig.)
Directory of Open Access Journals (Sweden)
Orlei Ribeiro de Araujo
Full Text Available Antibiotic restriction can be useful in maintaining bacterial susceptibility. The objective of this study was verify if restriction of cefepime, the most frequently used cephalosporin in our neonatal intensive care unit (NICU, would ameliorate broad-spectrum susceptibility of Gram-negative isolates. Nine hundred and ninety-five premature and term newborns were divided into 3 cohorts, according to the prevalence of cefepime use in the unit: Group 1 (n=396 comprised patients admitted from January 2002 to December 2003, period in which cefepime was the most used broad-spectrum antibiotic. Patients in Group 2 (n=349 were admitted when piperacillin/tazobactam replaced cefepime (January to December 2004 and in Group 3 (n=250 when cefepime was reintroduced (January to September 2005. Meropenem was the alternative third-line antibiotic for all groups. Multiresistance was defined as resistance to 2 or more unrelated antibiotics, including necessarily a third or fourth generation cephalosporin, piperacillin/tazobactam or meropenem. Statistics involved Kruskal-Wallis, Mann-Whitney and logrank tests, Kaplan-Meier analysis. Groups were comparable in length of stay, time of mechanical ventilation, gestational age and birth weight. Ninety-eight Gram-negative isolates were analyzed. Patients were more likely to remain free of multiresistant isolates by Kaplan-Meier analysis in Group 2 when compared to Group 1 (p=0.017 and Group 3 (p=0.003. There was also a significant difference in meropenem resistance rates. Cefepime has a greater propensity to select multiresistant Gram-negative pathogens than piperacillin/tazobactam and should not be used extensively in neonatal intensive care.
Predicting long-term graft survival in adult kidney transplant recipients
Directory of Open Access Journals (Sweden)
Brett W Pinsky
2012-01-01
Full Text Available The ability to accurately predict a population′s long-term survival has important implications for quantifying the benefits of transplantation. To identify a model that can accurately predict a kidney transplant population′s long-term graft survival, we retrospectively studied the United Network of Organ Sharing data from 13,111 kidney-only transplants completed in 1988- 1989. Nineteen-year death-censored graft survival (DCGS projections were calculated and com-pared with the population′s actual graft survival. The projection curves were created using a two-part estimation model that (1 fits a Kaplan-Meier survival curve immediately after transplant (Part A and (2 uses truncated observational data to model a survival function for long-term projection (Part B. Projection curves were examined using varying amounts of time to fit both parts of the model. The accuracy of the projection curve was determined by examining whether predicted sur-vival fell within the 95% confidence interval for the 19-year Kaplan-Meier survival, and the sample size needed to detect the difference in projected versus observed survival in a clinical trial. The 19-year DCGS was 40.7% (39.8-41.6%. Excellent predictability (41.3% can be achieved when Part A is fit for three years and Part B is projected using two additional years of data. Using less than five total years of data tended to overestimate the population′s long-term survival, accurate prediction of long-term DCGS is possible, but requires attention to the quantity data used in the projection method.
Energy Technology Data Exchange (ETDEWEB)
Uebleis, Christopher; Hellweger, Stefan; Lehner, Sebastian; Haug, Alexander; Bartenstein, Peter; Cumming, Paul; Hacker, Marcus [Ludwig-Maximilians University, Department of Nuclear Medicine, Munich (Germany); Laubender, Ruediger Paul [Ludwig-Maximilians University, Institute of Medical Informatics, Biometry, and Epidemiology (IBE), Munich (Germany); Becker, Alexander [Ludwig-Maximilians University, Medical Department I, Munich (Germany); Sohn, Hae-Young [Ludwig-Maximilians University, Medical Department Innenstadt, Munich (Germany); Van Kriekinge, Serge D.; Slomka, Piotr J. [Cedars-Sinai Medical Center, Los Angeles, CA (United States); UCLA, David Geffen School of Medicine, Los Angeles, CA (United States)
2012-10-15
Left ventricular (LV) mechanical dyssynchrony (LVMD) was assessed by gated single-photon emission CT myocardial perfusion imaging (MPI) as an independent predictor of death from any cause in patients with known coronary artery disease (CAD) and reduced LV function. Between 2001 and 2010, 135 patients (64 {+-} 11 years of age, 84 % men) with known CAD, reduced LV ejection fraction (LVEF, 38 {+-} 15 %) and without an implanted cardiac resynchronization therapy device underwent gated MPI at rest. LV functional evaluation, which included phase analysis, was conducted to identify patients with LVMD. Kaplan-Meier survival curves were calculated for death of any cause during a mean follow-up of 2.0 {+-} 1.7 years. Uni- and multivariate Cox proportional hazards regression models were calculated to identify independent predictors of death from any cause. Of the 135 patients, 30 (22 %) died during follow-up (18 cardiac deaths and 12 deaths from other causes). Kaplan-Meier curves showed a significantly shorter survival time in the patients with severely reduced LVEF (<30 %, n = 45) or with LVMD (n = 81, log-rank test P <0.005). Cox models identified LVMD, LVEF <30 % and a total perfusion deficit at rest of {>=}20 % as independent predictors of death from any cause. While patients with LVEF <30 % in conjunction with LVMD had similar survival times irrespective of whether they had early revascularization or medical therapy, those patients with LVEF {>=}30% and LVMD who underwent revascularization had significantly longer survival. In patients with known CAD and reduced LV function, dyssynchrony of the LV is an independent predictor of death from any cause. (orig.)
Sobouti, Farhad; Rakhshan, Vahid; Saravi, Mahdi Gholamrezaei; Zamanian, Ali; Shariati, Mahsa
2016-03-01
Traditional retainers (both metal and fiber-reinforced composite [FRC]) have limitations, and a retainer made from more flexible ligature wires might be advantageous. We aimed to compare an experimental design with two traditional retainers. In this prospective preliminary clinical trial, 150 post-treatment patients were enrolled and randomly divided into three groups of 50 patients each to receive mandibular canine-to-canine retainers made of FRC, flexible spiral wire (FSW), and twisted wire (TW). The patients were monitored monthly. The time at which the first signs of breakage/debonding were detected was recorded. The success rates of the retainers were compared using chi-squared, Kaplan-Meier, and Cox proportional-hazard regression analyses (α = 0.05). In total, 42 patients in the FRC group, 41 in the FSW group, and 45 in the TW group completed the study. The 2-year failure rates were 35.7% in the FRC group, 26.8% in the FSW group, and 17.8% in the TW group. These rates differed insignificantly (chi-squared p = 0.167). According to the Kaplan-Meier analysis, failure occurred at 19.95 months in the FRC group, 21.37 months in the FSW group, and 22.36 months in the TW group. The differences between the survival rates in the three groups were not significant (Cox regression p = 0.146). Although the failure rate of the experimental retainer was two times lower than that of the FRC retainer, the difference was not statistically significant. The experimental TW retainer was successful, and larger studies are warranted to verify these results.
1997 DOE technical standards program workshop: Proceedings
Energy Technology Data Exchange (ETDEWEB)
NONE
1997-10-01
The Department of Energy held its annual Technical Standards Program Workshop on July 8--10, 1997, at the Loews L`Enfant Plaza Hotel in Washington, DC. The workshop focused on aspects of implementation of the National Technology Transfer and Advancement Act of 1995 [Public Law (PL) 104-113] and the related revision (still pending) to OMB Circular A119 (OMB A119), Federal Participation in the Development and Use of Voluntary Standards. It also addressed DOE`s efforts in transitioning to a standards-based operating culture, and, through this transition, to change from a developer of internal technical standards to a customer of external technical standards. The workshop was designed to provide a forum to better understand how the new law is affecting Department activities. Panel topics such as ``Public Law 104-113 and Its Influence on Federal Agency Standards Activities`` and ``Update on Global Standards Issues`` provided insight on both the internal and external effects of the new law. Keynote speaker Richard Meier of Meadowbrook International (and formerly the Deputy Assistant US Trade Representative) addressed the subject of international trade balance statistics. He pointed out that increases in US export figures do not necessarily indicate increases in employment. Rather, increased employment results from product growth. Mr Meier also discussed issues such as the US migration to the sue of the metric system, the impact of budget limitations on Government participation in voluntary standards organizations, international standards ISO 9000 and ISO 14000, and DOE`s role in the worldwide transition from weapons production to cleanup.
Compliance with Supportive Periodontal Treatment in Patients with Dental Implants.
Hu, Kai-Fang; Lin, Ying-Chu; Ho, Kun-Yen; Chou, Yu-Hsiang
The need for dental implants is increasing, and supportive periodontal treatment can achieve long-term success and prevent peri-implantitis. Contributing factors to noncompliance with long-term scheduled supportive periodontal treatment remain unclear. To investigate whether demographic and clinical characteristics are associated with noncompliance, the authors analyzed data for patients who had received dental implants. The authors recruited patients participating in a supportive periodontal treatment program after receiving permanent prostheses on implants placed from 2005 to 2013. Demographic data and dental treatment histories were collected. Compliance was defined as a record of participation in a standard supportive periodontal treatment program for at least 1 year. The chi-square test, log-rank test, Kaplan-Meier survival curve, and Cox proportional hazards model were used for statistical analysis. The study included 120 patients (259 implants, 60% compliance). The two groups (compliant and noncompliant) differed significantly in frequency distributions for sex (P = .0017), educational level (P = .0325), and histories of substance use (P = .0016), periodontitis (P = .0005), and root planing or flap surgery (P = .0002). The Kaplan-Meier survival curves and log-rank test showed that increases in cumulative continuation rates were significantly associated with male sex (P = .0025); body mass index ≥ 24 kg/m² (P = .0093); and a history of periodontitis (P implant placement, root planing or flap surgery was the crucial factor in determining compliance with supportive periodontal treatment. However, well-designed large-scale studies with a larger sample size are needed to confirm the findings of this study.
Choi, Ji Young; Kim, Miso; Keam, Bhumsuk; Kim, Tae Min; Kim, Dong-Wan; Heo, Dae Seog; Jo, Seong Jin
2018-04-05
Despite the successful use of tyrosine kinase inhibitors (TKIs) in cancer patients, their effect on herpes zoster development has not been studied. The aim of this study was to evaluate and compare the effects of epidermal growth factor receptor (EGFR) TKI and cytotoxic chemotherapy on the risk of herpes zoster development in non-small cell lung cancer (NSCLC) patients. We conducted a medical review of all eligible NSCLC patients in Seoul National University hospital between 2002 and 2015. We classified patients based on whether they previously underwent EGFR TKI therapy into either the TKI group or the cytotoxic group. We compared the incidence rates of herpes zoster during TKI therapy and cytotoxic chemotherapy. Additionally, the longitudinal risk of herpes zoster from TKIs was analyzed using the incidence rate ratio (IRR) of the TKI group to the cytotoxic group and the log-rank test of the Kaplan-Meier method. Of the 2,981 NSCLC patients, 54 patients (1.54%) developed herpes zoster. In the TKI group (2,002 patients), the IRR of herpes zoster during TKI therapy compared to that during cytotoxic chemotherapy was 1.05 (95% confidence interval [CI], 0.53 to 2.09). The IRR of the TKI group compared to the cytotoxic group was 1.33 (95% CI, 0.64 to 2.76). The Kaplan-Meier cumulative risk of both groups was not significantly different. Our results show that the incidence rate of herpes zoster in the TKI group was not statistically different from the incidence in the cytotoxic group during and after chemotherapy in NSCLC patients.
Wang, Qin; Hu, Ke-Jie; Ren, Ye-Ping; Dong, Jie; Han, Qing-Feng; Zhu, Tong-Ying; Chen, Jiang-Hua; Zhao, Hui-Ping; Chen, Meng-Hua; Xu, Rong; Wang, Yue; Hao, Chuan-Ming; Zhang, Xiao-Hui; Wang, Mei; Tian, Na; Wang, Hai-Yan
2016-01-01
♦ Research indicates that the socioeconomic status (SES) of individuals and the area where they live are related to initial peritonitis and outcomes in peritoneal dialysis (PD). We conducted a retrospective, multi-center cohort study in China to examine these associations. ♦ Data on 2,171 PD patients were collected from 7 centers, including baseline demographic, socioeconomic, and laboratory data. We explored the potential risk factors for initial peritonitis and outcomes using univariate Cox regression and unadjusted binary logistic regression. Then, we used propensity score matching to balance statistically significant risk factors for initial peritonitis and outcomes, and Kaplan-Meier survival analysis to compare differences in peritonitis-free rates between different groups of participants after matching. ♦ A total of 563 (25.9%) initial episodes of peritonitis occurred during the study period. The Kaplan-Meier peritonitis-free rate curve showed high-income patients had a significantly lower risk than low-income patients (p = 0.007) after matching for age, hemoglobin, albumin, and regional SES and PD center. The risk of treatment failure was significantly lower in the high-income than the low-income group after matching for the organism causing peritonitis and PD center: odds ratio (OR) = 0.27 (0.09 - 0.80, p = 0.018). Regional SES and education were not associated with initial peritonitis and outcomes. ♦ Our study demonstrates low individual income is a risk factor for the initial onset of peritonitis and treatment failure after initial peritonitis. Copyright © 2016 International Society for Peritoneal Dialysis.
Extraneural metastases of medulloblastoma: desmoplastic variants may have prolonged survival.
Young, Robert J; Khakoo, Yasmin; Yhu, Stephen; Wolden, Suzanne; De Braganca, Kevin C; Gilheeney, Stephen W; Dunkel, Ira J
2015-04-01
Extraneural metastases from CNS medulloblastoma are rare and poorly described. The purpose of this study is to describe the clinical and radiological characteristics of a large single institution series of patients with medulloblastoma who developed extraneural metastases. We retrospectively reviewed a departmental database over a 20 year period for all patients with medulloblastoma who developed extraneural metastases. Chart and imaging reviews were performed, and overall survival (OS) estimated by the Kaplan-Meier method. We found 14 patients with medulloblastoma and extraneural metastases. The median age at initial diagnosis was 16.3 years (range, 3.2-44.2), and the most common subtype was desmoplastic (n = 6, 42.9%). After initial gross total resection, most patients received radiation therapy alone (n = 10, 71.4%). Metastases to bone were most common (n = 11, 78.6%) followed by metastases to bone marrow (n = 6, 42.9%), usually to the spine. The median time from initial diagnosis to first extraneural metastasis was 1.5 years (range, 0.2-17.4), and the median OS from extraneural metastasis to death was 3.3 years (range, 0-18). The Kaplan-Meier estimate of 5 year OS from extraneural metastasis diagnosis was 40.0% (95% CI, 20.2-79.2). Extraneural metastases from medulloblastoma may rarely develop after initial diagnosis to involve bone and bone marrow. We found that desmoplastic variant extraneural tumors had longer survival than nondesmoplastic variants, suggesting that histopathological and more recent molecular subtyping have important roles in determining the prognosis of medulloblastoma patients. © 2014 Wiley Periodicals, Inc.
DEFF Research Database (Denmark)
Bellinazzi, Vera R; Cipolli, José A; Pimenta, Marcio V
2015-01-01
AD) greater than the median value presented the worst clinical outcome compared to those with isolated sFV less than the median value or sAD greater than the median value, suggesting an additive effect of these two variables. Further, Kaplan-Meier analysis demonstrated worse outcome for individuals with s...... intima-media thickness and clinically defined high cardiovascular risk did not. Furthermore, area under the receiver-operating characteristic curve for sFV/sAD was higher than that for Framingham risk score (0.77 versus 0.64; P = 0.045), whereas adding sFV/sAD to the Framingham risk factors resulted...
Reverse hybrid total hip arthroplasty
DEFF Research Database (Denmark)
Wangen, Helge; Havelin, Leif I.; Fenstad, Anne M
2017-01-01
Background and purpose - The use of a cemented cup together with an uncemented stem in total hip arthroplasty (THA) has become popular in Norway and Sweden during the last decade. The results of this prosthetic concept, reverse hybrid THA, have been sparsely described. The Nordic Arthroplasty....... Patients and methods - From the NARA, we extracted data on reverse hybrid THAs from January 1, 2000 until December 31, 2013. 38,415 such hips were studied and compared with cemented THAs. The Kaplan-Meier method and Cox regression analyses were used to estimate the prosthesis survival and the relative risk...
Growth pattern of colorectal liver metastasis as a marker of recurrence risk
DEFF Research Database (Denmark)
Eefsen, R L; Vermeulen, P B; Christensen, I J
2015-01-01
from patient and pathology records. Histological GP were evaluated and related to recurrence free and OS. Kaplan-Meier curves, log-rank test and Cox regression analysis were used. The 5-year OS was 41.8% (95% CI 33.8-49.8%). Growth pattern evaluation of the largest liver metastasis was possible in 224...... free survival (RFS) than patients resected for non-desmoplastic liver metastases (p=0.05). When patients were stratified according to neo-adjuvant treatment in the multivariate Cox regression model, hazard ratios for RFS compared to desmoplastic were: pushing (HR=1.37, 95% CI 0.93-2.02, p=0...
Renal replacement therapy for autosomal dominant polycystic kidney disease (ADPKD) in Europe
DEFF Research Database (Denmark)
Spithoven, Edwin M; Kramer, Anneke; Meijer, Esther
2014-01-01
on RRT prevalence and survival on RRT in 12 European countries with 208 million inhabitants. We studied four 5-year periods (1991-2010). Survival analysis was performed by the Kaplan-Meier method and by Cox proportional hazards regression. RESULTS: From the first to the last study period, the prevalence...... for non-ADPKD subjects. Improved survival was noted for all RRT modalities: haemodialysis [adjusted hazard ratio for mortality during the last versus first time period 0.75 (95% confidence interval 0.61-0.91), peritoneal dialysis 0.55 (0.38-0.80) and transplantation 0.52 (0.32-0.74)]. Cardiovascular...
Directory of Open Access Journals (Sweden)
Michelle Eisenhardt
2013-10-01
Full Text Available Backgound and Objectives: Colorectal cancer (CRC has high incidence, is often treatable and curable if diagnosed early. This study aimed to identify the epidemiological characteristic and assess overall survival in patients with CRC treated at a center specializing in oncology. Methods: Medical records of 127 patients with CRC were retrospectively evaluated. Clinical and epidemiological characteristics, in addition to treatment protocols and adverse reactions presented by patients were reviewed. The association of significance was assessed by chi-square and Fisher exact tests. The survival analyses were performed using the Kaplan-Meier method. The confidence interval was of 95% (p
DEFF Research Database (Denmark)
Kronborg, Mads Brix; Johansen, Jens Brock; Haarbo, Jens
2017-01-01
/mid-ventricular/apical for the LV-LP, and as apical/non-apical for the RV-LP. Appropriate and inappropriate therapies were registered during follow-up via remote monitoring or at device interrogations. Time to event was summarized with Kaplan-Meier plots, and competed risk regression analysis was used to calculate adjusted hazard...... with an apical. We observed no significant association between appropriate therapy and LV-LP in left anterior oblique or right anterior oblique views or inappropriate therapy between any lead positions. Conclusion: An apical RV-LP is associated with an increased risk of appropriate therapy for ventricular...
Effect of darapladib on major coronary events after an acute coronary syndrome
DEFF Research Database (Denmark)
O'Donoghue, Michelle L; Braunwald, Eugene; White, Harvey D
2014-01-01
]) at 868 sites in 36 countries. INTERVENTIONS: Patients were randomized to either once-daily darapladib (160 mg) or placebo on a background of guideline-recommended therapy. Patients were followed up for a median of 2.5 years between December 7, 2009, and December 6, 2013. MAIN OUTCOMES AND MEASURES......: The primary end point (major coronary events) was the composite of coronary heart disease (CHD) death, MI, or urgent coronary revascularization for myocardial ischemia. Kaplan-Meier event rates are reported at 3 years. RESULTS: During a median duration of 2.5 years, the primary end point occurred in 903...
Epidemiology of Massive Transfusion
DEFF Research Database (Denmark)
Halmin, Märit; Chiesa, Flaminia; Vasan, Senthil K
2016-01-01
in Sweden from 1987 and in Denmark from 1996. A total of 92,057 patients were included. Patients were followed until the end of 2012. MEASUREMENTS AND MAIN RESULTS: Descriptive statistics were used to characterize the patients and indications. Post transfusion mortality was expressed as crude 30-day...... mortality and as long-term mortality using the Kaplan-Meier method and using standardized mortality ratios. The incidence of massive transfusion was higher in Denmark (4.5 per 10,000) than in Sweden (2.5 per 10,000). The most common indication for massive transfusion was major surgery (61.2%) followed...
DEFF Research Database (Denmark)
Schneider, Uffe; Nielsen, Rikke; Pedersen, Court
2007-01-01
. METHODS: DNA samples were collected retrospectively from 145 Danes infected with HIV-1 with known seroconversion times. In addition, plasma was collected retrospectively from 81 of these participants for use in the suPAR analysis. Survival was analysed using Kaplan Meier analysis. RESULTS: Survival...... to A transition at -118 and an A to G transition at -465 comparative to the transcription start site. These promoter transitions did not influence neither the suPAR levels nor patient survival. CONCLUSION: Plasma suPAR levels, as measured by the suPARnosticTM assay, were strongly predictive of survival in ART...
DEFF Research Database (Denmark)
Ewertz, M.; Kempel, M.M.; During, M.
2008-01-01
patients in Denmark. PATIENTS AND METHODS: To evaluate the results of this treatment, we performed a nationwide population-based follow-up study of patients aged less than 75 years treated in Denmark from 1989 to 1998 based on the database of Danish Breast Cancer Cooperative Group. RESULTS: At 15 years...... of follow-up, the Kaplan-Meier estimate of overall survival was 69% among 3 758 patients who received the recommended treatment. Within the first 10 years of follow-up, the cumulative incidences of loco-regional recurrences, distant metastases or other malignant disease, or death as a first event were 9...
Mesalazine in treating diverticular disease of the colon.
Tursi, Antonio
2013-07-01
Evaluation of: Kruis W, Meier E, Schumacher M, Mickisch O, Greinwald R, Mueller R; German SAG-20 Study Group. Randomised clinical trial: mesalazine (Salofalk granules) for uncomplicated diverticular disease of the colon - a placebo-controlled study. Aliment. Pharmacol. Ther. 37(7), 680-690 (2013). Although diverticular disease (DD) is one of the commonest diseases in the western world, robust evidences about its treatment are lack so far. A recent, placebo-controlled study found mesalazine effective in obtaining pain relief in patients suffering from DD. A brief comment is provided herein in order to assess the rationale of this drug in treating DD.
Notion of Prejudice in the Works of Immanuel Kant
Directory of Open Access Journals (Sweden)
Pedro Jesús Teruel
2014-02-01
Full Text Available The notion of prejudice occupies a not very visible place in the Kantian works. In fact it has been seldom treated in Kantian studies in German, English, French, Italian or Spanish. But it connects with relevant key notes of the Critique of Pure Reason (1781, 1787 as well as from the Critique of Practical Reason (1788 and the Critique of Judgement (1790. The aim of this paper consists in the analysis of the Kantian notion of prejudice, its systematic place and its sources (among these particularly the works of Georg Friedrich Meier and the thought of Christian Thomasius.
DEFF Research Database (Denmark)
Schnack, Tine H; Høgdall, Estrid; Nedergaard, Lotte
2016-01-01
-based prospectively collected data on oCCC (n = 179) and oSAC (n = 2363) cases were obtained from the Danish Gynecological Cancer Database. χ, Fischer or Wilcoxon-Mann-Whitney, multivariate logistic regression, univariate Kaplan-Meier, and multivariate Cox regression tests were used. Statistical tests were 2-sided. P......, 0.62; 95% confidence interval, 0.37-0.92).Although more oSAC than oCCC cases diagnosed in stage III or IV were referred to neoadjuvant chemotherapy, a higher proportion of oCCC achieved complete cytoreduction at primary debulking surgery and/or had lymphadenectomy performed; overall survival were...
DEFF Research Database (Denmark)
Meier, Ninna
2016-01-01
Academic work may have impact in a variety of ways, depending on purpose, audience and field, but this is most likely to happen when your work resonates in meaningful ways with people. Ninna Meier encourages a more systematic investigation of the role of writing in achieving impact. Impact through...... writing means getting your readers to understand and remember your message and leave the reading experience changed. The challenge is to make what you write resonate with an audience’s reservoir of experiential knowledge. If the words do not connect to anything tangible, interest can be quickly lost....
DEFF Research Database (Denmark)
Egerod, Frederikke N S Lihme; Bartels, Annette; Fristrup, Niels
2009-01-01
bladder cancer. RESULTS: The frequency of tumor cells with nuclear Egr-1 immunolabelling correlated to bladder cancer stage, grade and to later progression to muscle-invasive bladder cancer (T2-4). Stage T1 tumors exhibited significantly higher frequencies of tumor cells with nuclear Egr-1 immunolabelling...... than Ta tumors (P = 0.001). Furthermore, Kaplan-Meier survival analysis showed that a high frequency of tumor cells with nuclear Egr-1 immunolabelling was significantly associated with a higher risk of progression to stage T2-4 (log-rank test, P = 0.035). Tumor cells with nuclear Egr-1 immunolabelling...
Increased 30-day mortality in patients with diabetes undergoing surgery for colorectal cancer
DEFF Research Database (Denmark)
Fransgaard, T; Thygesen, L C; Gögenur, I
2016-01-01
with the use of antidiabetic drugs identified through the Danish National Prescription Registry and DCCG. The 30-day mortality was examined by the Kaplan-Meier method with the log-rank test and the Cox regression model used to test statistical significance. RESULTS: The study included 29 353 patients, of whom...... 3250 had preexisting diabetes. The 30-day mortality was significantly increased in patients with CRC and preexisting diabetes (adjusted hazard ratio 1.17, 95% CI 1.01-1.35, P = 0.03). The type of antidiabetic medication used was not associated with 30-day mortality. CONCLUSION: Preexisting diabetes...
DEFF Research Database (Denmark)
Søgaard, Mette; Nørgaard, Mette; Sørensen, Henrik Toft
2009-01-01
for age, gender, coexisting chronic diseases, marital status, use of immunosuppressives, and calendar period. Further, we conducted analyses restricted to patients a discharge diagnose of infectious diseases (ICD-10 codes A00-B99). Results: In total, 1,665 (8.2%) patients had positive blood culture...... System. We computed Kaplan-Meier curves and product limit estimates for the main study variables. Next, time-dependent Cox regression analyses was used to compare the risk of death in patients with positive blood cultures and patients with negative cultures at days 0-7, 8-30, and 31-180, controlling...
Estimating a population cumulative incidence under calendar time trends
DEFF Research Database (Denmark)
Hansen, Stefan N; Overgaard, Morten; Andersen, Per K
2017-01-01
BACKGROUND: The risk of a disease or psychiatric disorder is frequently measured by the age-specific cumulative incidence. Cumulative incidence estimates are often derived in cohort studies with individuals recruited over calendar time and with the end of follow-up governed by a specific date....... It is common practice to apply the Kaplan-Meier or Aalen-Johansen estimator to the total sample and report either the estimated cumulative incidence curve or just a single point on the curve as a description of the disease risk. METHODS: We argue that, whenever the disease or disorder of interest is influenced...
Directory of Open Access Journals (Sweden)
Rivinius R
2016-02-01
Full Text Available Rasmus Rivinius,1 Matthias Helmschrott,1 Arjang Ruhparwar,2 Bastian Schmack,2 Christian Erbel,1 Christian A Gleissner,1 Mohammadreza Akhavanpoor,1 Lutz Frankenstein,1 Fabrice F Darche,1 Patrick A Schweizer,1 Dierk Thomas,1 Philipp Ehlermann,1 Tom Bruckner,3 Hugo A Katus,1 Andreas O Doesch1 1Department of Cardiology, Angiology and Pneumology, 2Department of Cardiac Surgery, Heidelberg University Hospital, 3Institute for Medical Biometry and Informatics, University of Heidelberg, Heidelberg, Germany Background: Amiodarone is a frequently used antiarrhythmic drug in patients with end-stage heart failure. Given its long half-life, pre-transplant use of amiodarone has been controversially discussed, with divergent results regarding morbidity and mortality after heart transplantation (HTX.Aim: The aim of this study was to investigate the effects of long-term use of amiodarone before HTX on early post-transplant atrial fibrillation (AF and mortality after HTX.Methods: Five hundred and thirty patients (age ≥18 years receiving HTX between June 1989 and December 2012 were included in this retrospective single-center study. Patients with long-term use of amiodarone before HTX (≥1 year were compared to those without long-term use (none or <1 year of amiodarone. Primary outcomes were early post-transplant AF and mortality after HTX. The Kaplan–Meier estimator using log-rank tests was applied for freedom from early post-transplant AF and survival.Results: Of the 530 patients, 74 (14.0% received long-term amiodarone therapy, with a mean duration of 32.3±26.3 months. Mean daily dose was 223.0±75.0 mg. Indications included AF, Wolff–Parkinson–White syndrome, ventricular tachycardia, and ventricular fibrillation. Patients with long-term use of amiodarone before HTX had significantly lower rates of early post-transplant AF (P=0.0105. Further, Kaplan–Meier analysis of freedom from early post-transplant AF showed significantly lower rates of AF in this
Bioaccumulation of radionuclides in fertilized Canadian Shield lake basins
International Nuclear Information System (INIS)
Bird, G.A.; Schwartz, W.J.; Hesslein, R.H.; Mills, K.H.; Turner, M.A.
1998-01-01
Radionuclide tracers of heavy metals ( 59 Fe, 60 Co, 65 Zn, 75 Se 85 Sr, 134 Cs and 203 Hg) representing potential contamination from nuclear power plants, industry and agriculture were added to separate basins of Lake 226, Experimental Lakes Area, northwestern Ontario. The two basins were part of a eutrophication experiment and differed in their trophic status; the north basin (L226N) was eutrophic whereas the south basin (L226S) was mesotrophic. Our objective was to determine the uptake of the radionuclides by biota and the effect of lake trophic status on their bioaccumulation. The trophic status of the lakes did not appear to have a marked effect on the accumulation of radionuclides by the biota. This may have been because of a mid-summer leakage of nutrients between the basins which enhanced primary production in L226S, because there is a time lag between primary production and the availability of the radionuclides to the fishes or because trophic status does not affect the uptake of at least some of these radionuclides. However, there was a tendency for faster uptake of the radionuclides in L226N by fish than L226S, but the differences were not significant. Concentrations in the biota generally decreased in the order: fathead minnow>pearl dace>tadpoles>slimy sculpin>leeches. Concentrations in biota generally decreased in the order: 65 Zn> 203 Hg> 75 Se> 134 Cs> 60 Co> 85 Sr= 59 Fe. Cobalt-60 concentrations in tadpoles were greater than in the other biota. Radionuclide concentrations in the tissues of lake whitefish indicated that uptake was predominately from food. Radionuclide concentrations were usually higher in the posterior gut, liver and kidney than in other tissues, whereas body burdens were generally high in the muscle for 75 Se, 134 Cs and 203 Hg; kidney and gut for 60 Co; and bone for 65 Zn and 75 Se. Mercury-203 burdens were also high in the bone and gut
Spatial and temporal (1963-2012 variability of ichthyofauna in the large lowland Warta River, Poland
Directory of Open Access Journals (Sweden)
Andrzej Kruk
2015-11-01
Full Text Available The Warta River is a tributary of the Odra (Oder River. It is 795.2 km long. In 1986 the large Jeziorsko dam reservoir was constructed in the 306th km of its course. In the late 1980s, the river pollution assumed its highest level and stopped increasing as the former political system collapsed and many industrial plants went bankrupt. Unified fish electrocatches have been performed along the Warta River since the 1960s. During the last sampling, in 2011-2012, fish fauna in the middle course of the river was in the poorest condition due to the destabilizing upstream impact of the Jeziorsko dam reservoir, large amounts of wastewater input to the river, and the lack of unpolluted tributaries that could serve as sources of recolonizers. The weakest human pressure was reported for the upper and lower courses, which resulted in higher numbers of species significantly preferring them, and the higher species richness. Species richness significantly increased in comparison with the previous sampling occasions (in 1963-66, 1986-88, and 1996-98. Significant increases in the stability of occurrence, abundance or biomass were recorded for many species including burbot, chub, dace, ide, gudgeon, bleak, bitterling, perch and spined loach. Significant declines in the above mentioned population parameters were rare and related mainly to European eel (a migratory species. The previously recorded strong negative trend (declines in rheophils, increase in the dominance of roach and perch has been reversed. However, regenerated fish assemblages were not recorded in 1996-98 (i.e. several years after the beginning of the improvement in water quality but in 2011-2012 (i.e. about one decade later. We have noticed a similar delay in ichthyofauna recovery also in the Pilica River (Vistula system. This is why we believe that about 15 years are necessary to observe a considerable improvement in fish fauna in larger degraded rivers.
Directory of Open Access Journals (Sweden)
P. Wang
2007-07-01
Full Text Available Transitional cell carcinoma (TCC of the urothelium is often multifocal and subsequent tumors may occur anywhere in the urinary tract after the treatment of a primary carcinoma. Patients initially presenting a bladder cancer are at significant risk of developing metachronous tumors in the upper urinary tract (UUT. We evaluated the prognostic factors of primary invasive bladder cancer that may predict a metachronous UUT TCC after radical cystectomy. The records of 476 patients who underwent radical cystectomy for primary invasive bladder TCC from 1989 to 2001 were reviewed retrospectively. The prognostic factors of UUT TCC were determined by multivariate analysis using the COX proportional hazards regression model. Kaplan-Meier analysis was also used to assess the variable incidence of UUT TCC according to different risk factors. Twenty-two patients (4.6%. developed metachronous UUT TCC. Multiplicity, prostatic urethral involvement by the bladder cancer and the associated carcinoma in situ (CIS were significant and independent factors affecting the occurrence of metachronous UUT TCC (P = 0.0425, 0.0082, and 0.0006, respectively. These results were supported, to some extent, by analysis of the UUT TCC disease-free rate by the Kaplan-Meier method, whereby patients with prostatic urethral involvement or with associated CIS demonstrated a significantly lower metachronous UUT TCC disease-free rate than patients without prostatic urethral involvement or without associated CIS (log-rank test, P = 0.0116 and 0.0075, respectively. Multiple tumors, prostatic urethral involvement and associated CIS were risk factors for metachronous UUT TCC, a conclusion that may be useful for designing follow-up strategies for primary invasive bladder cancer after radical cystectomy.
Fasano, Serena; Pierro, Luciana; Pantano, Ilenia; Iudici, Michele; Valentini, Gabriele
2017-07-01
Systemic lupus erythematosus (SLE) is associated with an increased risk of cardiovascular disease (CVD). Thromboprophylaxis with low-dose aspirin (ASA) and hydroxychloroquine (HCQ) seems promising in SLE. We investigated the effects of HCQ cumulative dosages (c-HCQ) and the possible synergistic efficacy of ASA and HCQ in preventing a first CV event (CVE) in patients with SLE. Patients consecutively admitted to our center who, at admission, satisfied the 1997 American College of Rheumatology and/or 2012 Systemic Lupus Collaborating Clinics classification criteria for SLE, and had not experienced any CVE, were enrolled. The occurrence of a thrombotic event, use of ASA, and c-HCQ were recorded. Kaplan-Meier analysis was performed to determine the c-HCQ associated with a lower incidence of CVE. Cox regression analysis served to identify factors associated with a first CVE. For the study, 189 patients with SLE were enrolled and monitored for 13 years (median). Ten CVE occurred during followup. At Kaplan-Meier analysis, the CVE-free rate was higher in ASA-treated patients administered a c-HCQ > 600 g (standard HCQ dose for at least 5 yrs) than in patients receiving ASA alone, or with a c-HCQ dose < 600 g (log-rank test chi-square = 4.01, p = 0.04). Multivariate analysis showed that antimalarials plus ASA protected against thrombosis (HR 0.041 and HR 0.047, respectively), while antiphospholipid antibodies (HR 17.965) and hypertension (HR 18.054) increased the risk of a first CVE. Our results suggest that prolonged use of HCQ plus ASA is thromboprotective in SLE and provides additional evidence for its continued use in patients with SLE.
International Nuclear Information System (INIS)
Craighead, Peter S.; Smulian, Hubert G.; Groot, Henk J. de; Toit, Pierre F.M. du
1997-01-01
Purpose: To compare patient demographics, treatment resources, practice patterns, and outcome results for squamous cell carcinoma of the uterine cervix (SCC) between the 1978 and 1983 Patterns of Care studies (PCS) in the United States of America (USA) and a nonacademic center within a developing country. Methods and Materials: Patient details (race, age, stage, and number per year), treatment used, and treatment outcome were retrieved from the charts of the 1160 cases registered at this center with SCC of the cervix between 1976 and 1985. Demographic variables and Kaplan-Meier survival estimates were calculated and compared with results from published PCS reviews. Results: There is a significant difference in the racial group presentation of cervix cancer at this center compared with the PCS reviews (p < 0.005), and median ages are significantly lower at this center (t = p < 0.001). The proportion of patients with Stage III or more was significantly higher at this center than the PCS centers (24 vs. 47%, p < 0.001). There were also vast differences in facility resources. Fewer cases at this center underwent intracavitary insertions than at PCS centers. Mean Point A doses were significantly reduced for this center compared with the PCS reviews. Kaplan-Meier estimates were similar for Stage I and II in PCS centers and this center, but were inferior for this center in Stage III patients (p < 0.05 for OS and p < 0.01 for LC). Late morbidity rates were similar for both PCS centers and this center. Conclusion: PCS recommendations may be applicable to nonacademic centers within developing countries, if the latter use staging techniques that are consistent with the PCS staging guidelines
Cai, Shao-Hang; Lu, Shi-Xun; Liu, Li-Li; Zhang, Chris Zhiyi; Yun, Jing-Ping
2017-10-01
Hepatocyte nuclear factor 4 alpha (HNF4α) plays an important role in tumourigenesis. There is growing evidence indicating that HNF4α transcribed by promoter 1 (P1-HNF4α) is expressed at relatively low levels in HCC and its presence predicts a favourable outcome for hepatocellular carcinoma (HCC) patients. However, the role of HNF4α transcribed by promoter 2 (P2-HNF4α) in HCC remains unclear. A total of 615 HCC specimens were obtained to construct tissue microarrays and perform immunohistochemistry. The relationship between P2-HNF4α and clinical features of HCC patients were analysed. Kaplan-Meier analysis was conducted to assess the prognostic value of P2-HNF4α. The results showed that the expression of P2-HNF4α in HCC was noticeably increased in HCC tissues compared with the nontumourous tissues. In addition, P1-HNF4α expression was negatively correlated with P2-HNF4α expression ( p = 0.023). High P2-HNF4α expression was significantly associated with poor differentiation of HCC ( p = 0.002) and vascular invasion ( p = 0.017). Kaplan-Meier analysis showed that P2-HNF4α expression was closely correlated with overall survival in the training group ( p = 0.01), validation group ( p = 0.034), and overall group of patients with HCC ( p P2-HNF4α, different from P1-HNF4α, is markedly upregulated and serves as an oncogene-associated protein in HCC. Our study therefore provides a promising biomarker for prognostic prediction and a potential therapeutic target for HCC.
Setting standards and monitoring quality in the NHS 1999–2013: a classic case of goal conflict
Knight, Alec; Littlejohns, Anna; Poole, Tara‐Lynn; Kieslich, Katharina
2016-01-01
Abstract 2013 saw the National Health Service (NHS) in England severely criticized for providing poor quality despite successive governments in the previous 15 years, establishing a range of new institutions to improve NHS quality. This study seeks to understand the contributions of political and organizational influences in enabling the NHS to deliver high‐quality care through exploring the experiences of two of the major new organizations established to set standards and monitor NHS quality. We used a mixed method approach: first a cross‐sectional, in‐depth qualitative interview study and then the application of principal agent modeling (Waterman and Meier broader framework). Ten themes were identified as influencing the functioning of the NHS regulatory institutions: socio‐political environment; governance and accountability; external relationships; clarity of purpose; organizational reputation; leadership and management; organizational stability; resources; organizational methods; and organizational performance. The organizations could be easily mapped onto the framework, and their transience between the different states could be monitored. We concluded that differing policy objectives for NHS quality monitoring resulted in central involvement and organizational change. This had a disruptive effect on the ability of the NHS to monitor quality. Constant professional leadership, both clinical and managerial, and basing decisions on best evidence, both technical and organizational, helped one institution to deliver on its remit, even within a changing political/policy environment. Application of the Waterman–Meier framework enabled an understanding and description of the dynamic relationship between central government and organizations in the NHS and may predict when tensions will arise in the future. © 2016 The Authors. The International Journal of Health Planning and Management Published by John Wiley & Sons Ltd. PMID:27435020
Boynton, Grace E; Raoof, Duna; Niziol, Leslie M; Hussain, Munira; Mian, Shahzad I
2015-07-01
To evaluate the safety and efficacy of topical loteprednol etabonate (LE) 0.5% compared with cyclosporine A (CsA) 0.05% for the prophylaxis and treatment of dry eye syndrome (DES) after hematopoietic stem cell transplantation (HSCT). Seventy-five patients were randomized to LE (n = 76 eyes of 38 patients) or CsA (n = 74 eyes of 37 patients) pre-HSCT. Lissamine green and fluorescein staining, tear break-up time, tear osmolarity (Osm), Schirmer score (Sch), intraocular pressure, visual acuity, and Ocular Surface Disease Index were assessed pre-HSCT, 3, 6, 9, and 12 months post-HSCT. There were no differences in DES incidence (P = 0.22; log-rank test) or progression (P = 0.41; log-rank test) between the 2 treatment arms during the course of the study. Among eyes with no DES at enrollment, the Kaplan-Meier analysis yielded a 90% rate of DES development in cyclosporine-treated eyes and a 79% rate of DES development in LE-treated eyes by 12 months post-HSCT. The Kaplan-Meier analysis of eyes with DES at enrollment demonstrated a 38% rate of disease progression among cyclosporine-treated eyes and a 26% rate of disease progression among loteprednol-treated eyes by 12 months. No patient in either group had an elevation of 10 mm Hg or greater from baseline at any study visit, and no patients had their treatment discontinued for elevation in intraocular pressure. Pre-HSCT initiation of LE 0.5% appears to be safe and may be as effective as CsA 0.5% for the treatment and prophylaxis of DES following HSCT.
Shah, Saloni; Kim, Jane P; Park, Dong Yeon; Kim, Hyun; Yuen, Laura D; Do, Dennis; Dell'Osso, Bernardo; Hooshmand, Farnaz; Miller, Shefali; Wang, Po W; Ketter, Terence A
2017-09-01
To assess differential relationships between lifetime anxiety disorder/current anxiety symptoms and longitudinal depressive severity in bipolar disorder (BD). Stanford BD Clinic outpatients enrolled during 2000-2011 were assessed with the Systematic Treatment Enhancement Program for BD (STEP-BD) Affective Disorders Evaluation and followed with the STEP-BD Clinical Monitoring Form while receiving naturalistic treatment for up to two years. Baseline unfavorable illness characteristics/current mood symptoms and times to depressive recurrence/recovery were compared in patients with versus without lifetime anxiety disorder/current anxiety symptoms. Among 105 currently recovered patients, lifetime anxiety disorder was significantly associated with 10/27 (37.0%) demographic/other unfavorable illness characteristics/current mood symptoms/current psychotropics, hastened depressive recurrence (driven by earlier onset age), and a significantly (> two-fold) higher Kaplan-Meier estimated depressive recurrence rate, whereas current anxiety symptoms were significantly associated with 10/27 (37.0%) demographic/other unfavorable illness characteristics/current mood symptoms/current psychotropics and hastened depressive recurrence (driven by lifetime anxiety disorder), but only a numerically higher Kaplan-Meier estimated depressive recurrence rate. In contrast, among 153 currently depressed patients, lifetime anxiety disorder/current anxiety symptoms were not significantly associated with time to depressive recovery or depressive recovery rate. American tertiary BD clinic referral sample, open naturalistic treatment. Research is needed regarding differential relationships between lifetime anxiety disorder and current anxiety symptoms and hastened/delayed depressive recurrence/recovery - specifically whether lifetime anxiety disorder versus current anxiety symptoms has marginally more robust association with hastened depressive recurrence, and whether both have marginally more robust
Vogl, Vanessa; Hiller, Karl-Anton; Buchalla, Wolfgang; Federlin, Marianne; Schmalz, Gottfried
2016-12-01
A new universal adhesive with corresponding luting composite was recently marketed which can be used both, in a self-etch or in an etch-and-rinse mode. In this study, the clinical performance of partial ceramic crowns (PCCs) inserted with this adhesive and the corresponding luting material used in a self-etch or selective etch approach was compared with a self-adhesive universal luting material. Three PCCs were placed in a split-mouth design in 50 patients. Two PCCs were luted with a combination of a universal adhesive/resin cement (Scotchbond Universal/RelyX Ultimate, 3M ESPE) with (SB+E)/without (SB-E) selective enamel etching. Another PCC was luted with a self-adhesive resin cement (RelyX Unicem 2, 3M ESPE). Forty-eight patients were evaluated clinically according to FDI criteria at baseline and 6, 12 and 18 months. For statistical analyses, the chi-square test (α = 0.05) and Kaplan-Meier analysis were applied. Clinically, no statistically significant differences between groups were detected over time. Within groups, clinically significant increase for criterion "marginal staining" was detected for SB-E over 18 months. Kaplan-Meier analysis revealed significantly higher retention rates for SB+E (97.8 %) and SB-E (95.6 %) in comparison to RXU2 (75.6 %). The 18-month clinical performance of a new universal adhesive/composite combination showed no differences with respect to bonding strategy and may be recommended for luting PCCs. Longer-term evaluation is needed to confirm superiority of SB+E over SB-E. At 18 months, the new multi-mode adhesive, Scotchbond Universal, showed clinically reliable results when used for luting PCCs.
Wang, Lu; Wang, Cong; Wang, Jiangfeng; Huang, Xiaochen; Cheng, Yufeng
2017-10-01
A novel systemic immune-inflammation index (SII) based on platelet (P), neutrophil (N), and lymphocyte (L) counts has been reported to be associated with clinical outcomes in several solid tumors. We aimed to investigate its prognostic value in esophageal squamous cell carcinoma (ESCC) and the potential relationship with quality of life (QOL). A total of 280 ESCC patients who underwent esophagectomy were enrolled. SII (SII = P × N/L) was calculated on the basis of data obtained within 1 week before surgery. An optimal cut-off value stratified patients into high (≥560) and low (<560) preoperative SII groups. The widely used EORTC QLQ-C30 and QLQ-OES18 were utilized to assess QOL at cancer diagnosis and 36 months after surgery. Generalized estimating equations (GEEs) were used to evaluate the association of SII with QOL. Kaplan-Meier method and Cox proportional regression were used to analyze the prognostic value of SII. Kaplan-Meier analyses revealed that higher SII correlated significantly with poorer overall survival (OS) (p < 0.001) and disease-free survival (DFS) (p < 0.001) in patients with ESCC. Multivariate analysis identified SII as an independent prognostic factor for OS (p < 0.001; HR 2.578; 95% CI 1.625-4.088) and DFS (p < 0.001; HR 2.699; 95% CI 1.726-4.223). In addition, patients with high SII exhibited notably deteriorating QOL (p < 0.05). The preoperative SII is a promising biomarker for predicting survival and QOL of patients with ESCC. It may help to identify the high-risk patients for treatment strategy decisions.
Energy Technology Data Exchange (ETDEWEB)
Ulyte, Agne [Vilnius University, Faculty of Medicine, Vilnius (Lithuania); Katsaros, Vasileios K. [General Anticancer and Oncological Hospital ' ' St. Savvas' ' , Department of Advanced Imaging Modalities - CT and MRI, Athens (Greece); University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); Liouta, Evangelia; Stranjalis, Georgios [University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); Boskos, Christos [University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); General Anticancer and Oncological Hospital ' ' St. Savvas' ' , Department of Radiation Oncology, Athens (Greece); Papanikolaou, Nickolas [Champalimaud Foundation, Department of Radiology, Centre for the Unknown, Lisbon (Portugal); Usinskiene, Jurgita [National Cancer Institute, Vilnius (Lithuania); Affidea Lietuva, Vilnius (Lithuania); Bisdas, Sotirios [University College London Hospitals, Department of Neuroradiology, The National Hospital for Neurology and Neurosurgery, London (United Kingdom)
2016-12-15
The prognostic value of the dynamic contrast-enhanced (DCE) MRI perfusion and its histogram analysis-derived metrics is not well established for high-grade glioma (HGG) patients. The aim of this prospective study was to investigate DCE perfusion transfer coefficient (K{sup trans}), vascular plasma volume fraction (v{sub p}), extracellular volume fraction (v{sub e}), reverse transfer constant (k{sub ep}), and initial area under gadolinium concentration time curve (IAUGC) as predictors of progression-free (PFS) and overall survival (OS) in HGG patients. Sixty-nine patients with suspected anaplastic astrocytoma or glioblastoma underwent preoperative DCE-MRI scans. DCE perfusion whole tumor region histogram parameters, clinical details, and PFS and OS data were obtained. Univariate, multivariate, and Kaplan-Meier survival analyses were conducted. Receiver operating characteristic (ROC) curve analysis was employed to identify perfusion parameters with the best differentiation performance. On univariate analysis, v{sub e} and skewness of v{sub p} had significant negative impacts, while k{sub ep} had significant positive impact on OS (P < 0.05). v{sub e} was also a negative predictor of PFS (P < 0.05). Patients with lower v{sub e} and IAUGC had longer median PFS and OS on Kaplan-Meier analysis (P < 0.05). K{sup trans} and v{sub e} could also differentiate grade III from IV gliomas (area under the curve 0.819 and 0.791, respectively). High v{sub e} is a consistent predictor of worse PFS and OS in HGG glioma patients. v{sub p} skewness and k{sub ep} are also predictive for OS. K{sup trans} and v{sub e} demonstrated the best diagnostic performance for differentiating grade III from IV gliomas. (orig.)
Directory of Open Access Journals (Sweden)
Hee Jin Lee
Full Text Available Several methods are used to assess the pathologic response of breast cancer after neoadjuvant chemotherapy (NAC to predict clinical outcome. However, the clinical utility of these systems for each molecular subtype of breast cancer is unclear. Therefore, we applied six pathologic response assessment systems to specific subtypes of breast cancer and compared the results.Five hundred and eighty eight breast cancer patients treated with anthracycline with/without taxane-based NAC were retrospectively analyzed, and the ypTNM stage, residual cancer burden (RCB, residual disease in breast and nodes (RDBN, tumor response ratio, Sataloff's classification, and Miller-Payne grading system were evaluated. The results obtained for each assessment system were analyzed in terms of patient survival.In triple-negative tumors, all systems were significantly associated with disease-free survival and Kaplan-Meier survival curves for disease-free survival were clearly separated by all assessment methods. For HR+/HER2- tumors, systems assessing the residual tumor (ypTNM stage, RCB, and RDBN had prognostic significance. However, for HER2+ tumors, the association between patient survival and the pathologic response assessment results varied according to the system used, and none resulted in distinct Kaplan-Meier curves.Most of the currently available pathologic assessment systems used after anthracycline with/without taxane-based NAC effectively classified triple-negative breast cancers into groups showing different prognoses. The pathologic assessment systems evaluating residual tumors only also had prognostic significance in HR+/HER2- tumors. However, new assessment methods are required to effectively evaluate the pathologic response of HR+/HER2+ and HR-/HER2+ tumors to anthracycline with/without taxane-based NAC.
International Nuclear Information System (INIS)
Barney, Brandon M.; Petersen, Ivy A.; Mariani, Andrea; Dowdy, Sean C.; Bakkum-Gamez, Jamie N.; Haddock, Michael G.
2013-01-01
Objectives: The optimal adjuvant therapy for International Federation of Gynecology and Obstetrics (FIGO) stage I papillary serous (UPSC) or clear cell (CC) endometrial cancer is unknown. We report on the largest single-institution experience using adjuvant high-dose-rate vaginal brachytherapy (VBT) for surgically staged women with FIGO stage I UPSC or CC endometrial cancer. Methods and Materials: From 1998-2011, 103 women with FIGO 2009 stage I UPSC (n=74), CC (n=21), or mixed UPSC/CC (n=8) endometrial cancer underwent total abdominal hysterectomy with bilateral salpingo-oophorectomy followed by adjuvant high-dose-rate VBT. Nearly all patients (n=98, 95%) also underwent extended lymph node dissection of pelvic and paraortic lymph nodes. All VBT was performed with a vaginal cylinder, treating to a dose of 2100 cGy in 3 fractions. Thirty-five patients (34%) also received adjuvant chemotherapy. Results: At a median follow-up time of 36 months (range, 1-146 months), 2 patients had experienced vaginal recurrence, and the 5-year Kaplan Meier estimate of vaginal recurrence was 3%. The rates of isolated pelvic recurrence, locoregional recurrence (vaginal + pelvic), and extrapelvic recurrence (including intraabdominal) were similarly low, with 5-year Kaplan-Meier estimates of 4%, 7%, and 10%, respectively. The estimated 5-year overall survival was 84%. On univariate analysis, delivery of chemotherapy did not affect recurrence or survival. Conclusions: VBT is effective at preventing vaginal relapse in women with surgical stage I UPSC or CC endometrial cancer. In this cohort of patients who underwent comprehensive surgical staging, the risk of isolated pelvic or extrapelvic relapse was low, implying that more extensive adjuvant radiation therapy is likely unnecessary.
Dowen, Frances; Sidhu, Karishma; Broadbent, Elizabeth; Pilmore, Helen
2017-09-21
Mortality in end stage renal disease (ESRD) is higher than many malignancies. There is no data about the optimal way to present information about projected survival to patients with ESRD. In other areas, graphs have been shown to be more easily understood than narrative. We examined patient comprehension and perspectives on graphs in communicating projected survival in chronic kidney disease (CKD). One hundred seventy-seven patients with CKD were shown 4 different graphs presenting post transplantation survival data. Patients were asked to interpret a Kaplan Meier curve, pie chart, histogram and pictograph and answer a multi-choice question to determine understanding. We measured interpretation, usefulness and preference for the graphs. Most patients correctly interpreted the graphs. There was asignificant difference in the percentage of correct answers when comparing different graph types (p = 0.0439). The pictograph was correctly interpreted by 81% of participants, the histogram by 79%, pie chart by 77% and Kaplan Meier by 69%. Correct interpretation of the histogram was associated with educational level (p = 0.008) and inversely associated with age > 65 (p = 0.008). Of those who interpreted all four graphs correctly, there was an association with employment (p = 0.001) and New Zealand European ethnicity (p = 0.002). 87% of patients found the graphs useful. The pie chart was the most preferred graph (p 0.002). The readability of the graphs may have been improved with an alternative colour choice, especially in the setting of visual impairment. Visual aids, can be beneficial adjuncts to discussing survival in CKD.
Rao, Zilong; Zheng, Huaguang; Wang, Fei; Wang, Anxin; Liu, Liping; Dong, Kehui; Zhao, Xingquan; Wang, Yilong; Cao, Yibin
2017-08-01
To evaluate the role of HTPR in predicting early recurrence of ischemic events in patients with minor ischemic stroke or high-risk TIA. From January 2014 to September 2014, a single center continuously enrolled patients with minor ischemic stroke or high-risk TIA and gave them antiplatelet therapy consisting of aspirin with clopidogrel. HTPR was assessed by TEG after 7 days of antiplatelet therapy and detected CYP2C19 genotype. The incidence of recurrent ischemic events was assessed 3 months after onset. The incidence of recurrent ischemic events was compared between the HTPR and NTPR groups with the Kaplan-Meier method, and multivariate Cox proportional hazards models were used to determine the risk factors associated with recurrent ischemic events. We enrolled 278 eligible patients with minor ischemic stroke or high-risk TIA. Through TEG testing, patients with HTPR were 22.7%, and carriers were not associated with HTPR to ADP by TEG-ADP(%) (p = 0.193). A total of 265 patients completed 3 months of follow-up, and Kaplan-Meier analysis showed that patients with HTPR had a higher percentage of recurrent ischemic events compared with patients with NTPR (p = 0.002). In multivariate Cox proportional hazards models, history of ischemic stroke or TIA (HR 4.45, 95% CI 1.77-11.16, p = 0.001) and HTPR (HR 3.34, 95% CI 1.41-7.91, p = 0.006) was independently associated with recurrent ischemic events. In patients with minor stroke or TIA, the prevalence of HTPR was 22.7%, and HTPR was independently associated with recurrent ischemic events.
Cruz-Oliver, D M; Malmstrom, T K; Allen, C M; Tumosa, N; Morley, J E
2012-07-01
To evaluate predictive validity of cognitive dysfunction of the Saint Louis University mental status (SLUMS) exam or mini-mental state exam (MMSE) for institutionalization and mortality after 7.5-years. Longitudinal study. Geriatric Research, Education and Clinical Center Veterans Affairs Hospital St. Louis, MO. Patients (N=705) were screened for cognitive dysfunction in 2003 using the SLUMS exam and MMSE, and mortality and institutionalization up to 7.5-years later were evaluated as outcome measures. The associations between outcome measures and MMSE and SLUMS exam total scores, and cognitive status were examined using Kaplan-Meier curves and Cox proportional-hazards regression. Five hundred thirty-three charts were reviewed, 176/533(33%) patients had died and 31/526 (6%) were institutionalized during 7.5-year follow-up period. All subjects were male with a mean age of 75 years and most had high school education or greater (71%). MMSE dementia, SLUMS dementia (ps<.001) and MCI (p<.05) groups had significantly lower survival rates than normal cognition group in the Kaplan-Meier curves. Scores classified as dementia on SLUMS (HR=2.4, 95% CI 1.6-3.7; p <.001) or MMSE (HR=2.3, 95% CI 1.5-3.6; p <.001) both predicted mortality and, also, institutionalization (SLUMS: HR=3.5, 95% CI 1.3-9.1; p <.01; MMSE: HR=3.8, 95% CI 1.6-9.0; p <.001) after adjustment for covariates. Unadjusted SLUMS exam MCI predicted morality (HR=1.5, 95% CI 1.1-2.2; p <.019) but not institutionalization. The SLUMS exam and MMSE both predict mortality and institutionalization for male patients screened as positive for dementia.
Evaluation of success after second Ahmed glaucoma valve implantation.
Nilforushan, Naveed; Yadgari, Maryam; Jazayeri, Anis Alsadat; Karimi, Nasser
2016-03-01
To evaluate the outcome of the second Ahmed glaucoma valve (AGV) surgery in eyes with failed previous AGV surgery. Retrospective case series. Following chart review, 36 eyes of 34 patients with second AGV implantation were enrolled in this study. The primary outcome measure was surgical success defined in terms of intraocular pressure (IOP) control using two criteria: Success was defined as IOP ≤21 mmHg (criterion 1) and IOP ≤16 mmHg (criterion 2), with at least 20% reduction in IOP, either with no medication (complete success) or with no more than two medications (qualified success). Kaplan-Meier survival analysis was used to determine the probability of surgical success. The average age of the patients was 32.7 years (range 4-65), and the mean duration of follow-up was 21.4 months (range 6-96). Preoperatively, the mean IOP was 26.94 mmHg (standard deviation [SD] 7.03), and the patients were using 2.8 glaucoma medications on average (SD 0.9). The mean IOP decreased significantly to 13.28 mmHg (SD 3.59) at the last postoperative visit (P = 0.00) while the patients needed even fewer glaucoma medications on average (1.4 ± 1.1, P = 0.00). Surgical success of second glaucoma drainage devices (Kaplan-Meier analysis), according to criterion 1, at 6, 12, 18, and 42 months was 94%, 85%, 80%, and 53% respectively, and according to criterion 2, was 94%, 85%, 75%, and 45%, respectively. Repeated AGV implantation seems to be a safe modality of treatment with acceptable success rate in cases with failed previous AGV surgery.
International Nuclear Information System (INIS)
Hanks, Gerald E.; Hanlon, Alexandra L. M.S.; Schultheiss, Timothy E.; Pinover, Wayne H.; Movsas, Benjamin; Epstein, Barry E.; Hunt, Margie
1998-01-01
Purpose: To report the 5-year outcomes of dose escalation with 3D conformal treatment (3DCRT) of prostate cancer. Methods and Materials: Two hundred thirty-two consecutive patients were treated with 3DCRT alone between 6/89 and 10/92 with ICRU reporting point dose that increased from 63 to 79 Gy. The median follow-up was 60 months, and any patient free of clinical or biochemical evidence of disease was termed bNED. Biochemical failure was defined as prostate-specific antigen (PSA) rising on two consecutive recordings and exceeding 1.5 ng/ml. Morbidity was reported by the Radiation Therapy Oncology Group (RTOG) scale, the Late Effects Normal Tissue (LENT) scale, and a Fox Chase modification of the latter (FC-LENT). All patients were treated with a four-field technique with a 1 cm clinical target volume (CTV) to planning target volume (PTV) margin to the prostate or prostate boost; the CTV and gross tumor volume (GTV) were the same. Actuarial rates of outcome were calculated by Kaplan-Meier and cumulative incidence methods and compared using the log rank and Gray's test statistic, respectively. Cox regression models were used to establish prognostic factors predictive of the various measures of outcome. Five-year Kaplan-Meier bNED rates were utilized by dose group to estimate logit response models for bNED and late morbidity. Results: PSA 10 ng/ml based on 5-year bNED results. No dose response was observed for patients with pretreatment PSA 10 ng/ml strongly suggests that clinical trials employing radiation should investigate the use of 3DCRT and prostate doses of 76-80 Gy
Directory of Open Access Journals (Sweden)
Asaho Nishizawa
Full Text Available To evaluate the influence of phacoemulsification after trabeculectomy on the postoperative intraocular pressure (IOP in eyes with uveitic glaucoma (UG.Kumamoto University Hospital, Kumamoto, Japan.A retrospective cohort study.The medical records of patients with UG who had trabeculectomy with mitomycin-C (MMC were reviewed. Complete and qualified surgical failures were defined by an IOP of ≥21 mmHg (condition A, ≥18 mmHg (condition B, or ≥15 mmHg (condition C without and with glaucoma eye drops, respectively. Kaplan-Meier survival analysis, generalized by the Wilcoxon test, and the Cox proportional hazards model analysis were conducted. Post-trabeculectomy phacoemulsification was treated as a time-dependent variable. In 24 (30% of the included 80 eyes, phacoemulsification was included, and they were divided into two groups: groups I (8 eyes with phacoemulsification within 1 year after trabeculectomy and group II (16 eyes after 1 year following trabeculectomy.Multivariable Cox proportional hazards model analysis showed post-trabeculectomy phacoemulsification was a significant factor in both complete success and qualified success based upon condition C (P = 0.0432 and P = 0.0488, respectively, but not for the other conditions. Kaplan-Meier survival analyses indicated significant differences in success probabilities between groups I and group II for complete success and qualified success based upon condition C (P = 0.020 and P = 0.013, respectively. There was also a significant difference for qualified success based upon condition B (P = 0.034, while there was no significant difference for the other conditions.Post-trabeculectomy phacoemulsification, especially within 1 year, can cause poor prognosis of IOP control of UG eyes after trabeculectomy with MMC.
Sammour, Tarik; Malakorn, Songphol; Bednarski, Brian K; Kaur, Harmeet; Shin, Ui Sup; Messick, Craig; You, Yi-Qian Nancy; Chang, George J
2018-03-01
The aim of this study is to evaluate the oncological outcomes of robotic total mesorectal excision (TME) at an NCI designated cancer center. The effectiveness of laparoscopic TME could not be established, but the robotic-assisted approach may hold some promise, with improved visualization and ergonomics for pelvic dissection. Oncological outcome data is presently lacking. Patients who underwent total mesorectal excision or tumor-specific mesorectal excision for rectal cancer between April 2009 and April 2016 via a robotic approach were identified from a prospective single-institution database. The circumferential resection margin (CRM), distal resection margin, and TME completeness rates were determined. Kaplan-Meier analysis of disease-free survival and overall survival was performed for all patients treated with curative intent. A total of 276 patients underwent robotic proctectomy during the study period. Robotic surgery was performed initially by 1 surgeon with 3 additional surgeons progressively transitioning from open to robotic during the study period with annual increase in the total number of cases performed robotically. Seven patients had involved circumferential resection margins (2.5%), and there were no positive distal or proximal resection margins. One hundred eighty-six patients had TME quality assessed, and only 1 patient (0.5%) had an incomplete TME. Eighty-three patients were followed up for a minimum of 3 years, with a local recurrence rate of 2.4%, and a distant recurrence rate of 16.9%. Five-year disease-free survival on Kaplan-Meier analysis was 82%, and 5-year overall survival was 87%. Robotic proctectomy for rectal cancer can be performed with good short and medium term oncological outcomes in selected patients.
Directory of Open Access Journals (Sweden)
Anissa Gramatges Ortiz
2002-08-01
Full Text Available Se realizó una actualización sobre el análisis de supervivencia en las investigaciones clínicas. Se expusieron algunos de los conceptos más generales sobre este tipo de análisis y las características de los tiempos de supervivencia.Se abordan temas relacionados con los diferentes métodos que facilitan la estimación de las probabilidades de supervivencia para uno o más grupos de individuos, con la ejemplificación del cálculo de las probabilidades para el método de Kaplan-Meier. Se destaca la comparación de la supervivencia de varios grupos atendiendo a distintos factores que los diferencian, así como también se enuncian algunas de las pruebas estadísticas que nos posibilitan la comparación, como son la prueba log rank y la Breslow, como alternativa de esta cuando se evidencia una divergencia del azar proporcional, es decir, cuando las curvas de supe DE SUPERVI rvivencia se cruzanconcepts of this type of analyses and the characteristics of survival times were presented. Aspects related with the different methods facilitating the estimation of survival probabilities for one or more groups of subjects, including the example of calculation of Kaplan Meier method´s probabilities were dealt with . The survival rates of several groups were compared, taking into consideration various factors that differentiate them. Some of the statistical tests making the comparison possible such as log rank test, and the Breslow test as an alternative of the former when there is a proportional random divergence, that is, when survival curves cross were stated
Albu, Silviu; Babighian, Gregorio; Amadori, Maurizio; Trabalzini, Franco
2015-12-01
This study aims to compare the outcomes of patients with Meniere's disease submitted to either endolymphatic mastoid shunt (ES) or tenotomy of the stapedius and tensor tympani muscles (TSTM). This is a retrospective chart review of patients treated with ES or TSTM between 2000 and 2010 and followed up for at least 12 months. The main outcomes were represented by: (1) vertigo class, hearing stage and functional level according to the American Academy of Otolaryngology-Head and Neck Surgery criteria; (2) adjustment of dizziness handicap inventory (DHI) and (3) complete and substantial vertigo control using the Kaplan-Meier survival method. Sixty-three patients met the inclusion criteria: 34 underwent ES and 29 TSTM. The baseline demographic characteristics, the hearing stage, the functional level, the DHI and hearing levels were not different between the two groups. No significant difference in vertigo class was demonstrated: 66 % of TSTM patients attained class A compared to 44 % in the ES group (p = 0.14). Kaplan-Meier survival curves specific to class A showed significant differences, favoring TSTM (log-rank test, p = 0.022). TSTM patients demonstrated significantly improved functional level (p = 0.0004) and improved DHI scores (p = 0.001). Eight ES patients (25 %) demanded a second surgical attempt compared to none in the TSTM. Aural fullness was significantly improved in TSTM group (p = 0.01), while the difference in tinnitus improvement was non-significant. Hearing preservation was significantly better in TSTM group (p = 0.001). TSTM is a safe surgical procedure, with significant vertigo control rates, and important hearing preservation rates. More patients and longer follow-up are needed to support our preliminary findings.
International Nuclear Information System (INIS)
Garcia Vicente, Ana Maria; Soriano Castrejon, Angel; Lopez-Fidalgo, Jesus Fernando; Amo-Salas, Mariano; Mar Munoz Sanchez, Maria del; Alvarez Cabellos, Ruth; Espinosa Aunion, Ruth
2015-01-01
To explore the relationship between basal 18 F-FDG PET/CT information in breast tumours and survival in locally advanced breast cancer (LABC). This prospective, multicentre study included 198 women diagnosed with LABC. All patients underwent 18 F-FDG PET/CT prior to treatment. The maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N) and the N/T ratio was obtained in all cases. Stage according to PET/CT imaging (metabolic stage) and conventional imaging techniques (clinical stage) was established. During follow-up, patient status was established (disease free status or not). The relationship between all the variables and overall survival (OS) and disease-free survival (DFS) was analysed using the Kaplan-Meier and Cox regression methods. A ROC analysis was performed to obtain a cut-off value of SUVmax that was useful in the prediction of outcome. The mean SUVmax ± SD values in the primary tumour, lymph nodes and the SUVmax N/T index were 7.40 ± 5.57, 4.17 ± 4.74 and 0.73 ± 1.20, respectively. Higher semiquantitative metabolic values were found in more advanced metabolic and clinical stages. During follow-up, 78.4 % of patients were free of disease. Significant relationships were observed between SUVT and SUVN and patient status. With respect to OS and DFS, significant differences were detected for the metabolic stage. Kaplan-Meier analysis revealed that using the cut-off values, a primary-tumour SUVmax ≥ 6.05 or a nodal SUVmax ≥2.25 were significantly correlated with DFS and OS. PET imaging with 18 F-FDG offers prognostic information for LABC that can be obtained preoperatively and noninvasively. (orig.)
Adjuvant Ab Interno Tumor Treatment After Proton Beam Irradiation.
Seibel, Ira; Riechardt, Aline I; Heufelder, Jens; Cordini, Dino; Joussen, Antonia M
2017-06-01
This study was performed to show long-term outcomes concerning globe preservation in uveal melanoma patients after proton beam therapy with the main focus on outcomes according to different adjuvant ab interno surgical procedures. Retrospective cohort study. All patients treated with primary proton beam therapy for choroidal or ciliary body melanoma between June 1998 and June 2015 were included. A total of 2499 patients underwent primary proton beam therapy, with local tumor control and globe preservation rates of 95.9% and 94.8% after 5 years, respectively. A total of 110 (4.4%) patients required secondary enucleation. Unresponsive neovascular glaucoma was the leading cause of secondary enucleation in 78 of the 2499 patients (3.1%). The 5-year enucleation-free survival rate was 94.8% in the endoresection group, 94.3% in the endodrainage group, and 93.5% in the comparator group. The log-rank test showed P = .014 (comparator group vs endoresection group) and P = .06 (comparator group vs endodrainage-vitrectomy group). Patients treated with endoresection or endodrainage-vitrectomy developed less radiation retinopathy (30.5% and 37.4% after 5 years, P = .001 and P = .048 [Kaplan-Meier], respectively) and less neovascular glaucoma (11.6% and 21.3% after 5 years, P = .001 and P = .01 [Kaplan-Meier], respectively) compared with the comparator group (52.3% radiation retinopathy and 57.8% neovascular glaucoma after 5 years). This study suggests that in larger tumors the enucleation and neovascular glaucoma rates might be reduced by adjuvant surgical procedures. Although endoresection is the most promising adjuvant treatment option, the endodrainage-vitrectomy is recommended in patients who are ineligible for endoresection. Copyright © 2017 Elsevier Inc. All rights reserved.
Adjuvant Medications That Improve Survival after Locoregional Therapy.
Boas, F Edward; Ziv, Etay; Yarmohammadi, Hooman; Brown, Karen T; Erinjeri, Joseph P; Sofocleous, Constantinos T; Harding, James J; Solomon, Stephen B
2017-07-01
To determine if outpatient medications taken at the time of liver tumor embolization or ablation affect survival. A retrospective review was done of 2,032 liver tumor embolization, radioembolization, and ablation procedures performed in 1,092 patients from June 2009 to April 2016. Pathology, hepatocellular carcinoma (HCC) stage (American Joint Committee on Cancer), neuroendocrine tumor (NET) grade, initial locoregional therapy, overall survival after initial locoregional therapy, Child-Pugh score, Eastern Cooperative Oncology Group performance status, Charlson Comorbidity Index, and outpatient medications taken at the time of locoregional therapy were analyzed for each patient. Kaplan-Meier survival curves were calculated for patients taking 29 medications or medication classes (including prescription and nonprescription medications) for reasons unrelated to their primary cancer diagnosis. Kaplan-Meier curves were compared using the log-rank test. For patients with HCC initially treated with embolization (n = 304 patients), the following medications were associated with improved survival when taken at the time of embolization: beta-blockers (P = .0007), aspirin (P = .0008) and other nonsteroidal antiinflammatory drugs (P = .009), proton pump inhibitors (P = .004), and antivirals for hepatitis B or C (P = .01). For colorectal liver metastases initially treated with ablation (n = 172 patients), beta-blockers were associated with improved survival when taken at the time of ablation (P = .02). Aspirin and beta-blockers are associated with significantly improved survival when taken at the time of embolization for HCC. Aspirin was not associated with survival differences after locoregional therapy for NET or colorectal liver metastases, suggesting an HCC-specific effect. Copyright © 2017 SIR. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Yuh-Fang Chen
Full Text Available PURPOSE: To study the association between retinitis pigmentosa (RP and the progression of diabetic retinopathy (DR. METHODS: Using the Longitudinal Health Insurance Database 2000 of Taiwan, we identified individuals with an initial diagnosis for RP during the period of 1997-2008. A non-RP comparison group, 10-fold frequency matched by sex, age, index year and the year of diabetes diagnosed, were randomly selected from the same database. The occurrence of DR was observed for all subjects until the end of 2009. The Kaplan-Meier curves were used to illustrate the cumulative probability of developing DR for the RP group and comparison groups. The hazard ratio (HR of DR for the RP group relative to the comparison group was estimated using Cox proportional hazards model after adjusting for potential confounders. RESULTS: The Kaplan-Meier curves were not statistically significant different between the RP group and the comparison group. However, the RP group had a higher cumulative probability of developing DR during the first six to seven years. The cumulative probability kept increasing and became higher in the comparison group but remained unchanged in the RP group. The HR for the RP patients comparing with the comparison group was 0.96 (95% confidence interval (CI = 0.43-2.14. Stratified by severity, RP was associated with a non-statistically significant reduced risk of proliferative DR (PDR (HR = 0.70, 95% CI = 0.16-3.14. The HR for non-proliferative DR (NPDR was 1.08 (95% CI = 0.40-2.86. CONCLUSION: In this study, RP was not statistically significant associated with the incidence of DR.
High Expression of PHGDH Predicts Poor Prognosis in Non–Small Cell Lung Cancer
Directory of Open Access Journals (Sweden)
Jinhong Zhu
2016-12-01
Full Text Available Tumors have exceptionally high demands for energy and anabolism because of their rapid growth. The de novo serine synthesis pathway initiated by phosphoglycerate dehydrogenase (PHGDH has been recognized as a hallmark of metabolic adaption in carcinogenesis. The oncogenic role and prognostic value of PHGDH have been investigated in multiple cancer types, including breast cancer, melanoma, cervical cancer, and colon cancer. Due to the importance of PHGDH in cancer, we attempted to determine the clinical significance of PHGDH in 319 patients with non–small cell lung cancer (NSCLC. We evaluated the mRNA and protein expression levels of PHGDH gene, using quantitative reverse transcriptase polymerase chain reaction and tissue array–based immunohistochemistry, respectively. Significantly increased PHGDH expression in mRNA and protein levels was identified in tumor tissues versus matched adjacent nontumor tissues. More interestingly, immunohistochemical expression of PHGDH was significantly associated with lymph node metastasis (P = .021 and TNM stage (P = .016. Kaplan-Meier survival analysis indicated that NSCLC patients with low levels of PHGDH outperformed patients with high levels of PHGDH regarding 5-year overall survival. Significantly longer survival in the former suggested the prognostic implication of PHGDH in NSCLC. Multivariate survival analysis using Cox regression model demonstrated that high PHGDH levels and advanced TNM stage (III + IV were independent predictors of prognosis in NSCLC. Moreover, bioinformatics analysis confirmed the increase in PHGDH transcripts (data from The Cancer Genome Atlas and its prognostic value (Kaplan-Meier plotter in NSCLC. In conclusion, this study suggested the clinical implication of PHGDH in NSCLC. PHGDH may be a promising therapeutic target in NSCLC.
Energy Technology Data Exchange (ETDEWEB)
Garcia Vicente, Ana Maria; Soriano Castrejon, Angel [University General Hospital, Nuclear Medicine Department, Ciudad Real (Spain); Lopez-Fidalgo, Jesus Fernando; Amo-Salas, Mariano [University of Castilla-La Mancha, Department of Mathematics, Ciudad Real (Spain); Mar Munoz Sanchez, Maria del [Virgen de la Luz Hospital, Oncology Department, Cuenca (Spain); Alvarez Cabellos, Ruth [Virgen de la Salud Hospital, Oncology Department, Toledo (Spain); Espinosa Aunion, Ruth [La Mancha Centro Hospital, Oncology Department, Ciudad Real (Spain)
2015-11-15
To explore the relationship between basal {sup 18}F-FDG PET/CT information in breast tumours and survival in locally advanced breast cancer (LABC). This prospective, multicentre study included 198 women diagnosed with LABC. All patients underwent {sup 18}F-FDG PET/CT prior to treatment. The maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N) and the N/T ratio was obtained in all cases. Stage according to PET/CT imaging (metabolic stage) and conventional imaging techniques (clinical stage) was established. During follow-up, patient status was established (disease free status or not). The relationship between all the variables and overall survival (OS) and disease-free survival (DFS) was analysed using the Kaplan-Meier and Cox regression methods. A ROC analysis was performed to obtain a cut-off value of SUVmax that was useful in the prediction of outcome. The mean SUVmax ± SD values in the primary tumour, lymph nodes and the SUVmax N/T index were 7.40 ± 5.57, 4.17 ± 4.74 and 0.73 ± 1.20, respectively. Higher semiquantitative metabolic values were found in more advanced metabolic and clinical stages. During follow-up, 78.4 % of patients were free of disease. Significant relationships were observed between SUVT and SUVN and patient status. With respect to OS and DFS, significant differences were detected for the metabolic stage. Kaplan-Meier analysis revealed that using the cut-off values, a primary-tumour SUVmax ≥ 6.05 or a nodal SUVmax ≥2.25 were significantly correlated with DFS and OS. PET imaging with {sup 18}F-FDG offers prognostic information for LABC that can be obtained preoperatively and noninvasively. (orig.)
Retrospective analysis of dental implants placed and restored by advanced prosthodontic residents.
Barias, Pamela A; Lee, Damian J; Yuan, Judy Chia-Chun; Sukotjo, Cortino; Campbell, Stephen D; Knoernschild, Kent L
2013-02-01
The purposes of this retrospective clinical review were to: (1) describe the demographics of implant patients, types of implant treatment and implant-supported prostheses in an Advanced Education in Prosthodontic Program, (2) evaluate the survival rate of dental implants placed by prosthodontic residents from 2006 to 2008, and (3) analyze the relationship between resident year of training and implant survival rate. All patients who received dental implants placed by prosthodontic residents from January 2006 to October of 2008 in the Advanced Prosthodontic Program at the University of Illinois at Chicago College of Dentistry were selected for this study. Age, gender, implant diameter, length, implant locations, surgical and restorative detail, and year of prosthodontic residency training were collected and analyzed. Life-table and Kaplan-Meier survival analyses were performed based on implants overall, locations, year of training, and use of a computer-generated surgical guide. A Logrank statistic was performed between implant survival and year of prosthodontic residency training, location, and use of computer-generated surgical guide (α= 0.05). Three hundred and six implants were placed, and of these, seven failed. Life-table and Kaplan-Meier analyses computed a cumulative survival rate (CSR) of 97% for overall implants and implants placed with a computer-generated surgical guide. No statistical difference was found in implant survival rates as a function of year of training (P= 0.85). Dental implants placed by prosthodontic residents had a CSR comparable to previously published studies by other specialties. The year of prosthodontic residency training and implant failure rate did not have any significant relationship. © 2012 by the American College of Prosthodontists.
Miners’ return to work following injuries in coal mines
Directory of Open Access Journals (Sweden)
Ashis Bhattacherjee
2016-12-01
Full Text Available Background: The occupational injuries in mines are common and result in severe socio-economical consequences. Earlier studies have revealed the role of multiple factors such as demographic factors, behavioral factors, health-related factors, working environment, and working conditions for mine injuries. However, there is a dearth of information about the role of some of these factors in delayed return to work (RTW following a miner’s injury. These factors may likely include personal characteristics of injured persons and his or her family, the injured person’s social and economic status, and job characteristics. This study was conducted to assess the role of some of these factors for the return to work following coal miners’ injuries. Material and Methods: A study was conducted for 109 injured workers from an underground coal mine in the years 2000–2009. A questionnaire, which was completed by the personnel interviews, included among others age, height, weight, seniority, alcohol consumption, sleeping duration, presence of diseases, job stress, job satisfaction, and injury type. The data was analyzed using the Kaplan-Meier estimates and the Cox proportional hazard model. Results: According to Kaplan-Meier estimate it was revealed that a lower number of dependents, longer sleep duration, no job stress, no disease, no alcohol addiction, and higher monthly income have a great impact on early return to work after injury. The Cox regression analysis revealed that the significant risk factors which influenced miners’ return to work included presence of disease, job satisfaction and injury type. Conclusions: The mine management should pay attention to significant risk factors for injuries in order to develop effective preventive measures. Med Pr 2016;67(6:729–742
Xing, Jian; Spradling, Philip R; Moorman, Anne C; Holmberg, Scott D; Teshale, Eyasu H; Rupp, Loralee B; Gordon, Stuart C; Lu, Mei; Boscarino, Joseph A; Schmidt, Mark A; Trinacty, Connie M; Xu, Fujie
2017-11-01
Risk of hepatocellular carcinoma (HCC) may be difficult to determine in the clinical setting. Develop a scoring system to forecast HCC risk among patients with chronic hepatitis C. Using data from the Chronic Hepatitis Cohort Study collected during 2005-2014, we derived HCC risk scores for males and females using an extended Cox model with aspartate aminotransferase-to-platelet ratio index (APRI) as a time-dependent variables and mean Kaplan-Meier survival functions from patient data at two study sites, and used data collected at two separate sites for external validation. For model calibration, we used the Greenwood-Nam-D'Agostino goodness-of-fit statistic to examine differences between predicted and observed risk. Of 12,469 patients (1628 with a history of sustained viral response [SVR]), 504 developed HCC; median follow-up was 6 years. Final predictors in the model included age, alcohol abuse, interferon-based treatment response, and APRI. Point values, ranging from -3 to 14 (males) and -3 to 12 (females), were established using hazard ratios of the predictors aligned with 1-, 3-, and 5-year Kaplan-Meier survival probabilities of HCC. Discriminatory capacity was high (c-index 0.82 males and 0.84 females) and external calibration demonstrated no differences between predicted and observed HCC risk for 1-, 3-, and 5-year forecasts among males (all p values >0.97) and for 3- and 5-year risk among females (all p values >0.87). This scoring system, based on age, alcohol abuse history, treatment response, and APRI, can be used to forecast up to a 5-year risk of HCC among hepatitis C patients before and after SVR.
LENUS (Irish Health Repository)
Gonzalez-Angulo, Ana M
2011-03-01
To investigate the incidence of germline and somatic BRCA1\\/2 mutations in unselected patients with triple-negative breast cancer (TNBC) and determine the prognostic significance of carrying a mutation. Methods: DNA was obtained from 77 TNBC and normal tissues. BRCA1\\/2 exons\\/flanking regions were sequenced from tumor and patients classified as mutant or wild type (WT). Sequencing was repeated from normal tissue to identify germline and somatic mutations. Patient characteristics were compared with chi-square. Survival was estimated by Kaplan-Meier method and compared with log-rank. Cox proportional hazards models were fit to determine the independent association of mutation status with outcome.
International Nuclear Information System (INIS)
Hawighorst, H.; Knopp, M.V.; Schoenberg, S.O.; Essig, M.; Kaick, G. van; Schaeffer, U.; Knapstein, P.G.; Weikel, W.
1998-01-01
Purpose: Purpose of this study is to compare functional MRI parameters with histomorphological markers of tumor microvessel density (MVD) and permeability (vascular endothelial growth factor) and to determine the ultimate value of both approaches by correlation with disease outcome in patients with primary cancer of the uterine cervix. Method: Pharmacokinetic parameters were calculated from contrast-enhanced dynamic MR imaging series in 37 patients with biopsy-proven primary cervical cancer. On the operative whole mount specimens, histomorphological markers of tumor angiogenesis (MVD, VEGF) were compared with the MRI-derived parameters. For MRI and histomorphological data, Kaplan-Meier survival curves were calculated and compared using logrank statistics. Results: Significant (p [de
The new Wuerzburg data base for radiation therapy
International Nuclear Information System (INIS)
Richter, J.; Richter, E.; Tausch, J.
1991-01-01
Conception, structure and realisation of a new data base for radiation therapy are present. The data base utilizes the commercial data base system ORACLE and the data base language SQL. A program package for statistical analyses including Kaplan-Meier-calculations, logrank test and Gehan/Breslow test was elaborated. The input of the data recorded on form sheets is carried out on a data base of the Tumor Centre in the first instance. From there the data are transfered to the ORACLE data base. Up to now the courses of disease of about 13 000 patients are stored. Therefore, extensive and detailed statistical analyses are practicable. (orig.) [de
Simpson's atherectomy in peripheral arteries
International Nuclear Information System (INIS)
Kueffer, G.; Spengel, F.A.; Hansen, R.; Pfluger, T.; Nathrath, W.; Muenchen Univ.; Muenchen Univ.
1990-01-01
Over a seventeen-month period, a percutaneous transluminal removal of stenosing plaque material from leg and pelvic arteries was performed successfully and without complication in 43 patients. A complete atherectomy in the femoropopliteal vessels succeeded in 99% of cases. In the pelvic region, the primary results were much lower (58%). After six months, the angiographically checked restenosis rate was 17% for femoropopliteal vessels and 11% for iliac arteries, and the corresponding Kaplan-Meier cumulative patency rates were 73.8 and 78.7% respectively. Simpson's atherectomy is the only method of its kind that is therapeutically effective and diagnostically significant, since the removed plaque can be used for further tests. (orig.) [de
DEFF Research Database (Denmark)
Inzitari, Domenico; Pracucci, Giovanni; Poggesi, Anna
2009-01-01
cerebral infarcts and atrophy. MAIN OUTCOME MEASURE: Transition from no disability (defined as a score of 0 or 1 on the instrumental activities of daily living scale) to disability (score >/=2) or death over three year follow-up. Secondary outcomes were incident dementia and stroke. RESULTS: Over a mean...... follow-up period of 2.42 years (SD 0.97, median 2.94 years), information on the main outcome was available for 633 patients. The annual rate of transition or death was 10.5%, 15.1%, and 29.5%, respectively, for patients with mild, moderate, or severe age related changes in white matter (Kaplan-Meier log...
Magnitude of bacteraemia predicts one-year mortality
DEFF Research Database (Denmark)
Gradel, Kim Oren; Schønheyder, Henrik Carl; Søgaard, Mette
Objectives: All hospitals in our region use the BacT/Alert® blood culture (BC) system with a 3-bottle BC set for adults. We hypothesized that the magnitude of bacteremia (i.e., number of positive bottles in the initial BC set) predicted one-year mortality. Methods In a population-based study we...... with a BC index of 1 (i.e., one positive bottle) were chosen as the reference group. We computed Kaplan-Meier curves and performed Cox regression analyses to estimate mortality rate ratios (MRRs) with 95 % confidence intervals [CIs] 30 and 365 days after the initial BC sampling date, first in crude analyses...... mortality....
Markov chains and semi-Markov models in time-to-event analysis.
Abner, Erin L; Charnigo, Richard J; Kryscio, Richard J
2013-10-25
A variety of statistical methods are available to investigators for analysis of time-to-event data, often referred to as survival analysis. Kaplan-Meier estimation and Cox proportional hazards regression are commonly employed tools but are not appropriate for all studies, particularly in the presence of competing risks and when multiple or recurrent outcomes are of interest. Markov chain models can accommodate censored data, competing risks (informative censoring), multiple outcomes, recurrent outcomes, frailty, and non-constant survival probabilities. Markov chain models, though often overlooked by investigators in time-to-event analysis, have long been used in clinical studies and have widespread application in other fields.
Gonzalez-Bermejo, Jésus; Morelot-Panzini, Capucine; Arnol, Nathalie; Meininger, Vincent; Kraoua, Salah; Salachas, François; Similowski, Thomas
2013-09-01
Abstract NIV adherence ('quantity' of ventilation) has a prognostic impact in amyotrophic lateral sclerosis (ALS). We hypothesized that NIV effectiveness ('quality') could also have a similar impact. NIV effectiveness was evaluated in 82 patients within the first month (M1) and every three months (symptoms, arterial blood bases, and nocturnal pulsed oxygen saturation - SpO2). Kaplan-Meier survival and risk factors for mortality one year after NIV initiation were evaluated. Forty patients were considered 'correctly ventilated' at M1 (Group 1, less than 5% of nocturnal oximetry time with an SpO2NIV effectiveness to correct nocturnal desaturations is an independent prognostic factor.
Energy Technology Data Exchange (ETDEWEB)
Bouchbika, Z.; Benchakroun, N.; Sellai, N.; Jouhadi, H.; Tawfiq, N.; Sahraoui, S.; Benider, A. [Service radiotherapie-oncologie, CHU Ibn-Rochd, Casablanca (Morocco)
2011-10-15
The authors report the assessment of the local control, global survival and survival without recurrence, and also late complications, based on retrospective study over 8 years of 169 cases Hodgkin lymphoma in patients older than 18 (average age of 34) and who had been submitted to radiotherapy. Survival has been computed according to the Kaplan-Meier method. The authors notice that the recurrence rate is slightly higher than in the literature. During the considered period, radiotherapy was two-dimensional with higher doses than those corresponding to current standards. The improvement of radiotherapy techniques and the decrease of doses within the standards should improve the therapeutic results. Short communication
Rodríguez Alonso, A.; Pita Fernández, S.; González Carreró, J.; Nogueira March, J.L.
2003-01-01
OBJETIVO: Establecer los factores pronósticos de recidiva y progresión en el carcinoma de células transicionales de vejiga en estadio T1, prestando especial atención al valor pronóstico de p53 y ki67. MATERIAL Y MÉTODOS: 175 pacientes con tumor vesical incidente de la categoría T1. El estudio inmunohistoquímico fue realizado con los anticuerpos monoclonales DO7, para p53 y MIB-1, para ki67. Se utilizó la metodología de Kaplan-Meier y se realizó un análisis multivariado de regresión de Cox, pa...
Exposure-response relationship of regorafenib efficacy in patients with hepatocellular carcinoma.
Solms, Alexander; Reinecke, Isabel; Fiala-Buskies, Sabine; Keunecke, Anne; Drenth, Henk-Jan; Bruix, Jordi; Meinhardt, Gerold; Cleton, Adriaan; Ploeger, Bart
2017-11-15
To explore the relationship between regorafenib exposure and efficacy in patients with hepatocellular carcinoma (HCC) who had disease progression during sorafenib treatment (RESORCE). Exposure-response (ER) analyses for regorafenib were performed using data from a phase 3, randomized, placebo-controlled trial (RESORCE). Patients received 160mg regorafenib or placebo once daily (3weeks on/1week off in a 4-week cycle) with best supportive care until disease progression, death, or unacceptable toxicity. Kaplan-Meier analyses for overall survival (OS) and time-to-progression (TTP) were performed in which regorafenib-treated patients were grouped into four categories according to their estimated average exposure over 4weeks in cycle 1. While this analysis primarily focused on efficacy, a potential correlation between exposure and treatment-emergent adverse events (TEAEs) was also evaluated. If any differences were observed between Kaplan-Meier plots, the ER analysis continued with a multivariate Cox regression analysis to evaluate the correlation between exposure quartile categories and the efficacy and safety parameters while taking into consideration the effect of the predefined clinically relevant demographic and baseline covariates. The functional form of the ER relationship within the regorafenib treatment group was subsequently evaluated. Based on visual assessment of the Kaplan-Meier plots, no meaningful relationship between the exposure categories and TEAEs were observed, although median OS and TTP tended to be longer in the higher exposure categories. Further ER analyses, which considered the effects of predefined covariates and the different shapes of the ER relationship, focused on efficacy. The baseline risk factors Eastern Cooperative Oncology Group (ECOG) performance status ≥1, alpha-fetoprotein levels ≥400ng/ml, and aspartate transaminase or alanine transaminase levels >3×upper limit of normal were significantly associated with OS (Pregorafenib
Directory of Open Access Journals (Sweden)
Keroulay Estebanez Roque
2011-09-01
Full Text Available O objetivo do estudo foi estimar o efeito do tempo e das características individuais na ocorrência de evento adverso a medicamentos em pacientes com afecções cardiológicas. Trata-se de um estudo avaliativo sobre a ocorrência de evento adverso a medicamentos realizado em um hospital público e cardiológico, localizado no Município do Rio de Janeiro. Para análise da sobrevida utilizou-se o método de Kaplan-Meier. A probabilidade de sobreviver livre de evento adverso a medicamentos até 30, 60 e 100 dias foi respectivamente de 96%, 93% e 73%. Os eventos adversos a medicamentos representam condições marcadoras que descrevem o desempenho dos serviços de saúde. A detecção de eventos adversos nas instituições hospitalares possibilita conhecer as falhas que ocorrem no sistema de medicação e ainda implementar estratégias para reduzi-las.El objetivo del estudio fue estimar el efecto del tiempo y de las diferencias individuales en la ocurrencia de eventos adversos por medicamentos en pacientes con enfermedades cardíacas. Este es un estudio de evaluación sobre la presencia de evento adverso a cabo en un hospital público y cardiología, ubicado en Río de Janeiro. Para el análisis de supervivencia se utilizó el método de Kaplan-Meier. La probabilidad de supervivencia libre de eventos adversos por medicamentos por 30, 60 y 100 días fueron respectivamente del 96%, 93% y 73%. Los eventos adversos por medicamentos representan condiciones marcadoras que describen el desempeño de los servicios de salud. La detección de eventos adversos en los hospitales hace que sea posible conocer los errores que ocurren en el sistema de medicación, así como aplicar estrategias para reducirlos.The objective of the study was to estimate the time effect and the individual characteristics in the occurrence of an adverse event to drugs in patients with cardiac diseases. It is an evaluative study about the occurrence of an adverse event to drugs that
Chan, H. M.; van der Velden, B. H. M.; E Loo, C.; Gilhuijs, K. G. A.
2017-08-01
We present a radiomics model to discriminate between patients at low risk and those at high risk of treatment failure at long-term follow-up based on eigentumors: principal components computed from volumes encompassing tumors in washin and washout images of pre-treatment dynamic contrast-enhanced (DCE-) MR images. Eigentumors were computed from the images of 563 patients from the MARGINS study. Subsequently, a least absolute shrinkage selection operator (LASSO) selected candidates from the components that contained 90% of the variance of the data. The model for prediction of survival after treatment (median follow-up time 86 months) was based on logistic regression. Receiver operating characteristic (ROC) analysis was applied and area-under-the-curve (AUC) values were computed as measures of training and cross-validated performances. The discriminating potential of the model was confirmed using Kaplan-Meier survival curves and log-rank tests. From the 322 principal components that explained 90% of the variance of the data, the LASSO selected 28 components. The ROC curves of the model yielded AUC values of 0.88, 0.77 and 0.73, for the training, leave-one-out cross-validated and bootstrapped performances, respectively. The bootstrapped Kaplan-Meier survival curves confirmed significant separation for all tumors (P < 0.0001). Survival analysis on immunohistochemical subgroups shows significant separation for the estrogen-receptor subtype tumors (P < 0.0001) and the triple-negative subtype tumors (P = 0.0039), but not for tumors of the HER2 subtype (P = 0.41). The results of this retrospective study show the potential of early-stage pre-treatment eigentumors for use in prediction of treatment failure of breast cancer.
Prevalence and mortality of cancer among HIV-infected inpatients in Beijing, China.
Yang, Jun; Su, Shu; Zhao, Hongxin; Wang, Dennis; Wang, Jiali; Zhang, Fujie; Zhao, Yan
2016-02-16
Cancer is responsible for elevated HIV-related morbidity and mortality. Research on HIV-infected patients with concurrent cancer is rare in China. The purpose of our study was to investigate the prevalence and risk factors associated with cancer among HIV-infected inpatients in Beijing, and to investigate the mortality and risk factors among HIV-infected inpatients with cancer. Hospital records from a total of 1946 HIV-infected patients were collected from the Beijing Ditan Hospital. The data, from 2008 to 2013, were collected retrospectively. The cancer diagnoses included AIDS-defining cancers (ADC) and non-AIDS defining cancers (NADC). Logistic regression was used to identify risk factors predicting the concurrence of cancer with HIV. Mortality was examined using Kaplan-Meier estimates and Cox proportional hazards models. 7.7 % (149 cases) of all HIV-infected inpatients had concurrent cancer at their first hospital admission; of those, 33.6 % (50 cases) had ADCs, and 66.4 % (99 cases) had NADCs. The most prevalent NADCs were Hodgkin's lymphoma, gastrointestinal cancer, liver cancer, and lung cancer. Patients who did not accept antiretroviral therapy (ART) were more likely to suffer from cancer [AOR = 2.07 (1.42-3.01), p = 0.001]. Kaplan-Meier curves indicated that the survival probability of HIV-positive cancer patients was significantly lower than that of HIV-positive cancer-free patients (log-rank test, p cancer, the mortality was also higher among those who did not receive ART [AHR = 2.19 (1.84-2.61), p cancer concurrence among hospitalized HIV-infected patients was 7.7 %. Concurrent cancer also increased mortality among HIV-infected patients. ART was protective against concurrent cancer as well as mortality among HIV-infected cancer patients. These results highlight the importance of promoting cancer screening and early ART initiation among HIV-infected patients.
Donati, Gabriele; Cianciolo, Giuseppe; Mauro, Raffaella; Rucci, Paola; Scrivo, Anna; Marchetti, Antonio; Giampalma, Emanuela; Golfieri, Rita; Panicali, Laura; Iorio, Mario; Stella, Andrea; La Manna, Gaetano; Stefoni, Sergio
2015-02-01
Vascular access-related complications are still one of the leading causes of morbidity in hemodialysis patients. The aim of this study was to compare polytetrafluoroethylene (PTFE) grafts versus tunneled cuffed permanent catheters (TCCs) in terms of vascular access and patients' survival. An observational study was carried out with a 2-year follow-up. Eighty-seven chronic hemodialysis patients were enrolled: 31 with a PTFE graft as vascular access for hemodialysis versus 56 with a TCC. Patients' mean age was 63.8 ± 14.6 (grafts) versus 73.5 ± 11.3 years (TCCs), P = 0.001. Significantly more patients with TCC had atrial fibrillation than patients with grafts (30.3% versus 6.5%, P = 0.01). In an unadjusted Kaplan-Meier analysis, median TCC survival at 24 months was 5.4 months longer than that of PTFE grafts but not significantly (log-rank test = 1.3, P = ns). In a Cox regression analysis adjusted for age, gender, number of previous vascular accesses, diabetes, atrial fibrillation, smoking, and any complication, this lack of significant difference in survival of the vascular access between TCC and PTFE groups was confirmed and diabetes proved to be an independent risk factor for the survival of both vascular accesses considered (P = 0.02). In an unadjusted Kaplan-Meier analysis, a higher mortality was found in the TCC group than in the PTFE group at 24 months (log-rank test = 10.07, P PTFE grafts. When an arteriovenous fistula (AVF) is not possible, PTFE grafts can be considered the vascular access of second choice, whereas TCCs can be used when an AVF or PTFE graft are not feasible or as a bridge to AVF or PTFE graft creation. Copyright © 2014 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.
Mwango, Albert; Stringer, Jeffrey; Ledergerber, Bruno; Mulenga, Lloyd; Bucher, Heiner C.; Westfall, Andrew O.; Calmy, Alexandra; Boulle, Andrew; Chintu, Namwinga; Egger, Matthias; Chi, Benjamin H.
2011-01-01
Background Loss to follow-up (LTFU) is common in antiretroviral therapy (ART) programmes. Mortality is a competing risk (CR) for LTFU; however, it is often overlooked in cohort analyses. We examined how the CR of death affected LTFU estimates in Zambia and Switzerland. Methods and Findings HIV-infected patients aged ≥18 years who started ART 2004–2008 in observational cohorts in Zambia and Switzerland were included. We compared standard Kaplan-Meier curves with CR cumulative incidence. We calculated hazard ratios for LTFU across CD4 cell count strata using cause-specific Cox models, or Fine and Gray subdistribution models, adjusting for age, gender, body mass index and clinical stage. 89,339 patients from Zambia and 1,860 patients from Switzerland were included. 12,237 patients (13.7%) in Zambia and 129 patients (6.9%) in Switzerland were LTFU and 8,498 (9.5%) and 29 patients (1.6%), respectively, died. In Zambia, the probability of LTFU was overestimated in Kaplan-Meier curves: estimates at 3.5 years were 29.3% for patients starting ART with CD4 cells Switzerland since only few patients died. The results from Cox and Fine and Gray models were similar: in Zambia the risk of loss to follow-up and death increased with decreasing CD4 counts at the start of ART, whereas in Switzerland there was a trend in the opposite direction, with patients with higher CD4 cell counts more likely to be lost to follow-up. Conclusions In ART programmes in low-income settings the competing risk of death can substantially bias standard analyses of LTFU. The CD4 cell count and other prognostic factors may be differentially associated with LTFU in low-income and high-income settings. PMID:22205933
Directory of Open Access Journals (Sweden)
M.D. Mohebi
2015-04-01
Full Text Available Introduction & Objectives: Substance abuse and opioid dependency refers to hazardous use of psychoactive substance .Prevention and treatment of opiate dependence has not been success-ful. Most effective drug in agonist treatment of opiates is methadone maintenance therapy (MMT.But the lack of cooperation of addicts in methadone maintenance therapy has always been a big problem to continue. The purpose of this study is to investigate the retention in the MMT. Materials & Methods: This historical cohort study analyzed the medical records of patients of Baharan hospital in Zahedan. All 912 cases of methadone maintenance clinic of Baharan hos-pital in Zahedan 2011-2012 were studied and the data were analyzed using SPSS. Tables and indexes were analyzed by the Chi-square test and survival curves were plotted using Kaplan–Meier method and analyzed by Log-Rank test. Results: This study reviewed records from 912 patients with a mean age of 34.67% and stan-dard deviation of 10.88 and the range of 15-86 years. 735 were male and 177 ware female. 1-moth retention rate was 71%, 3 months was 59%, 6 months was 47%, 1 year was 30% and 2 years was 17%. Kaplan-Meier median survival time of 8 months was estimated by relation-ship. Doses higher than 60 mg/d of methadone was associated with increased survival on MMT. Conclusion: Age increase, increase of employment time, increasing of the duration of drug abuse, increasing the daily dose of methadone, oral substance abuse increased retention rate and heroin abuse and smoking were associated with decrease retention rate of methadone maintenance therapy. So, with an emphasis on each of these factors effective steps can be taken to improve the cooperation of patients in MMT. (Sci J Hamadan Univ Med Sci 2015; 22 (1:30-36
Directory of Open Access Journals (Sweden)
Jung Kwon Kim
Full Text Available There have been conflicting reports regarding the association of perioperative blood transfusion (PBT with oncologic outcomes including recurrence rates and survival outcomes in prostate cancer. We aimed to evaluate whether perioperative blood transfusion (PBT affects biochemical recurrence-free survival (BRFS, cancer-specific survival (CSS, and overall survival (OS following radical prostatectomy (RP for patients with prostate cancer.A total of 2,713 patients who underwent RP for clinically localized prostate cancer between 1993 and 2014 were retrospectively analyzed. We performed a comparative analysis based on receipt of transfusion (PBT group vs. no-PBT group and transfusion type (autologous PBT vs. allogeneic PBT. Univariate and multivariate Cox-proportional hazard regression analysis were performed to evaluate variables associated with BRFS, CSS, and OS. The Kaplan-Meier method was used to calculate survival estimates for BRFS, CSS, and OS, and log-rank test was used to conduct comparisons between the groups.The number of patients who received PBT was 440 (16.5%. Among these patients, 350 (79.5% received allogeneic transfusion and the other 90 (20.5% received autologous transfusion. In a multivariate analysis, allogeneic PBT was found to be statistically significant predictors of BRFS, CSS, and OS; conversely, autologous PBT was not. The Kaplan-Meier survival analysis showed significantly decreased 5-year BRFS (79.2% vs. 70.1%, log-rank, p = 0.001, CSS (98.5% vs. 96.7%, log-rank, p = 0.012, and OS (95.5% vs. 90.6%, log-rank, p < 0.001 in the allogeneic PBT group compared to the no-allogeneic PBT group. In the autologous PBT group, however, none of these were statistically significant compared to the no-autologous PBT group.We found that allogeneic PBT was significantly associated with decreased BRFS, CSS, and OS. This provides further support for the immunomodulation hypothesis for allogeneic PBT.
The prognostic value of family history among patients with urinary bladder cancer.
Egbers, Lieke; Grotenhuis, Anne J; Aben, Katja K; Alfred Witjes, J; Kiemeney, Lambertus A; Vermeulen, Sita H
2015-03-01
A history of urinary bladder cancer (UBC) in first-degree relatives increases UBC risk by twofold. The influence of positive family history on UBC prognosis is unknown. Here, we investigated association of first-degree UBC family history with clinicopathological characteristics and prognosis of UBC patients. Detailed clinical data of 1,465 non-muscle-invasive bladder cancer (NMIBC) and 250 muscle-invasive or metastatic bladder cancer (MIBC) patients, diagnosed from 1995 to 2010, were collected through medical file review. Competing risk analyses were used to compare recurrence-free survival (RFS) and progression-free survival (PFS) of NMIBC patients according to self-reported UBC family history. Overall survival in MIBC patients was estimated using Kaplan-Meier analysis. The added value of family history in prediction of NMIBC prognosis was quantified with Harrell's concordance-index. Hundred (6.8%) NMIBC and 14 (5.6%) MIBC patients reported UBC in first-degree relatives. Positive family history was statistically significantly associated with smaller tumor size and non-significantly with more favorable distribution of other tumor characteristics. In univariable analyses, positive family history correlated with longer RFS (p = 0.11) and PFS (p = 0.04). Hazard ratios for positive vs. negative family history after adjustment for clinicopathological characteristics were 0.75 (95% CI = 0.53-1.07) and 0.45 (95% CI = 0.18-1.12) for RFS and PFS, respectively. Five familial and 48 sporadic MIBC patients (Kaplan-Meier 10-year risk: 41% and 25%) died within 10 years. Family history did not improve the c-index of prediction models. This study shows that a first-degree family history of UBC is not clearly associated with NMIBC prognosis. Family history does not aid in prediction of NMIBC recurrence or progression. © 2014 The Authors. Published by Wiley Periodicals, Inc. on behalf of UICC.
Mortality, Causes of Death and Associated Factors Relate to a Large HIV Population-Based Cohort.
Garriga, César; García de Olalla, Patricia; Miró, Josep M; Ocaña, Inma; Knobel, Hernando; Barberá, Maria Jesús; Humet, Victoria; Domingo, Pere; Gatell, Josep M; Ribera, Esteve; Gurguí, Mercè; Marco, Andrés; Caylà, Joan A
2015-01-01
Antiretroviral therapy has led to a decrease in HIV-related mortality and to the emergence of non-AIDS defining diseases as competing causes of death. This study estimates the HIV mortality rate and their risk factors with regard to different causes in a large city from January 2001 to June 2013. We followed-up 3137 newly diagnosed HIV non-AIDS cases. Causes of death were classified as HIV-related, non-HIV-related and external. We examined the effect of risk factors on survival using mortality rates, Kaplan-Meier plots and Cox models. Finally, we estimated survival for each main cause of death groups through Fine and Gray models. 182 deaths were found [14.0/1000 person-years of follow-up (py); 95% confidence interval (CI):12.0-16.1/1000 py], 81.3% of them had a known cause of death. Mortality rate by HIV-related causes and non-HIV-related causes was the same (4.9/1000 py; CI:3.7-6.1/1000 py), external was lower [1.7/1000 py; (1.0-2.4/1000 py)]. Kaplan-Meier estimate showed worse survival in intravenous drug user (IDU) and heterosexuals than in men having sex with men (MSM). Factors associated with HIV-related causes of death include: IDU male (subHazard Ratio (sHR):3.2; CI:1.5-7.0) and causes of death include: ageing (sHR:1.5; CI:1.4-1.7) and heterosexual female (sHR:2.8; CI:1.1-7.3) versus MSM. Factors associated with external causes of death were IDU male (sHR:28.7; CI:6.7-123.2) and heterosexual male (sHR:11.8; CI:2.5-56.4) versus MSM. There are important differences in survival among transmission groups. Improved treatment is especially necessary in IDUs and heterosexual males.
Exclusive breastfeeding duration and determinants among Brazilian children under two years of age
Directory of Open Access Journals (Sweden)
Sarah Warkentin
2013-06-01
Full Text Available OBJECTIVE: The present study described the duration and identified the determinants of exclusive breastfeeding. METHODS: The study used data from the Pesquisa Nacional de Demografia e Saúde da Criança e da Mulher 2006 (National Demographic and Health Survey on Women and Children 2006. Data were collected using questionnaires administered by trained professionals and refer to a subsample of 1,704 children aged less than 24 months. The estimated durations of exclusive breastfeeding are presented according to socioeconomic, demographic and epidemiological variables. Kaplan Meier estimator curves were used to produce valid estimates of breastfeeding duration and the Cox's proportional hazards model was fitted to identify risks. RESULTS: The median estimated duration of exclusive breastfeeding was 60 days. The final Cox model consisted of mother's age <20 years (hazard ratio=1.53, 95% confidence interval=1.11-1.48, use of pacifier (hazard ratio=1.53, 95% confidence interval=1.37-1.71, not residing in the country's southeast region (hazard ratio=1.22, 95% confidence interval=1.07-1.40 and socioeconomic status (hazard ratio=1.28, 95% confidence interval=1.06-1.55. CONCLUSION: The Kaplan Meier estimator corrected the underestimated duration of breastfeeding in the country when calculated by the current status methodology. Despite the national efforts done in the last decades to promote breastfeeding, the results indicate that the duration of exclusive breastfeeding is still half of that recommended for this dietary practice to promote health. Ways to revert this situation would be ongoing educational activities involving the educational and health systems, associated with advertising campaigns on television and radio mainly targeting young mothers with low education level and low income, identified as those at high risk of weaning their children early.
Setting the stage for medieval plague: Pre-black death trends in survival and mortality.
DeWitte, Sharon N
2015-11-01
The 14(th) -century Black Death was one of the most devastating epidemics in human history, killing tens of millions of people in a short period of time. It is not clear why mortality rates during the epidemic were so high. One possibility is that the affected human populations were particularly stressed in the 14(th) century, perhaps as a result of repeated famines in areas such as England. This project examines survival and mortality in two pre-Black Death time periods, 11-12(th) centuries vs 13(th) century CE, to determine if demographic conditions were deteriorating before the epidemic occurred. This study is done using a sample of individuals from several London cemeteries that have been dated, in whole or in part, either to the 11-12(th) centuries (n = 339) or 13(th) century (n = 258). Temporal trends in survivorship and mortality are assessed via Kaplan-Meier survival analysis and by modeling time period as a covariate affecting the Gompertz hazard of adult mortality. The age-at-death distributions from the two pre-Black Death time periods are significantly different, with fewer older adults in 13(th) century. The results of Kaplan-Meier survival analysis indicate reductions in survival before the Black Death, with significantly lower survival in the 13(th) century (Mantel Cox p < 0.001). Last, hazard analysis reveals increases in mortality rates before the Black Death. Together, these results suggest that health in general was declining in the 13(th) century, and this might have led to high mortality during the Black Death. This highlights the importance of considering human context to understand disease in past and living human populations. © 2015 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Li X
2014-10-01
Full Text Available Xin Li, Zhiyu Han, Zhigang Cheng, Jie Yu, Xiaoling Yu, Ping Liang Department of Interventional Ultrasound, Chinese PLA General Hospital, Beijing, People's Republic of China Purpose: To investigate the prognostic value of preoperative absolute lymphocyte count (ALC in recurrent hepatocellular carcinoma (RHCC following thermal ablation. Materials and methods: We retrospectively analyzed the relationship between preoperative ALC and the clinicopathologic factors and long-term prognosis in 423 RHCC patients who underwent curative thermal ablation. Correlation analysis, receiver operating characteristic (ROC calculation, Kaplan–Meier curves, and multivariate regression were used for statistical analysis. Results: The median time to recurrence was 12 months for RHCC patients after thermal ablation. On multivariate Cox regression analysis, preoperative ALC was an independent risk factor for cancer recurrence, along with tumor differentiation and α-fetoprotein level. ALC ≥1.64×109/L defined by ROC calculation was associated with prolonged survival (area under the curve 0.741, P<0.001. Patients with ALC ≥1.64×109/L showed a mean survival of 20.2 months versus 11.6 months for patients with ALC <1.64×109/L (P<0.001. Patients were stratified into high and low groups according to ALC status. After excluding the basic parameters between groups, the 1- and 3-year recurrence rates in the high group were 20.9% and 29.5%, respectively, which were significantly lower than those of the low group (58.4% and 71.9%, respectively; P<0.001. The recurrence-free survival rates in the two groups analyzed by Kaplan–Meier curves were significantly different (P<0.001. Conclusion: Preoperative ALC is a powerful prognostic factor for RHCC recurrence after thermal ablation, which suggests that maintaining a high ALC in RHCC patients might improve cancer outcomes. Keywords: absolute lymphocyte count, recurrent hepatocellular carcinoma, thermal ablation, recurrence
Heart transplant outcomes in recipients of Centers for Disease Control (CDC) high risk donors.
Tsiouris, Athanasios; Wilson, Lynn; Sekar, Rajesh B; Mangi, Abeel A; Yun, James J
2016-12-01
A lack of donor hearts remains a major limitation of heart transplantation. Hearts from Centers for Disease Control (CDC) high-risk donors can be utilized with specific recipient consent. However, outcomes of heart transplantation with CDC high-risk donors are not well known. We sought to define outcomes, including posttransplant hepatitis and human immunodeficiency virus (HIV) status, in recipients of CDC high-risk donor hearts at our institution. All heart transplant recipients from August 2010 to December 2014 (n = 74) were reviewed. Comparison of 1) CDC high-risk donor (HRD) versus 2) standard-risk donor (SRD) groups were performed using chi-squared tests for nominal data and Wilcoxon two-sample tests for continuous variables. Survival was estimated with Kaplan-Meier curves. Of 74 heart transplant recipients reviewed, 66 (89%) received a SRD heart and eight (11%) received a CDC HRD heart. We found no significant differences in recipient age, sex, waiting list 1A status, pretransplant left ventricular assist device (LVAD) support, cytomegalovirus (CMV) status, and graft ischemia times (p = NS) between the HRD and SRD groups. All of the eight HRD were seronegative at the time of transplant. Postoperatively, there was no significant difference in rejection rates at six and 12 months posttransplant. Importantly, no HRD recipients acquired hepatitis or HIV. Survival in HRD versus SRD recipients was not significantly different by Kaplan-Meier analysis (log rank p = 0.644) at five years posttransplant. Heart transplants that were seronegative at the time of transplant had similar posttransplant graft function, rejection rates, and five-year posttransplant survival versus recipients of SRD hearts. At our institution, no cases of hepatitis or HIV occurred in HRD recipients in early follow-up. © 2016 Wiley Periodicals, Inc.
Simone, Giuseppe; Tuderti, Gabriele; Misuraca, Leonardo; Anceschi, Umberto; Ferriero, Mariaconsiglia; Minisola, Francesco; Guaglianone, Salvatore; Gallucci, Michele
2018-04-17
In this study, we compared perioperative and oncologic outcomes of patients treated with either open or robot-assisted radical cystectomy and intracorporeal neobladder at a tertiary care center. The institutional prospective bladder cancer database was queried for "cystectomy with curative intent" and "neobladder". All patients underwent robot-assisted radical cystectomy and intracorporeal neobladder or open radical cystectomy and orthotopic neobladder for high-grade non-muscle invasive bladder cancer or muscle invasive bladder cancer with a follow-up length ≥2 years were included. A 1:1 propensity score matching analysis was used. Kaplan-Meier method was performed to compare oncologic outcomes of selected cohorts. Survival rates were computed at 1,2,3 and 4 years after surgery and the log rank test was applied to assess statistical significance between the matched groups. Overall, 363 patients (299 open and 64 robotic) were included. Open radical cystectomy patients were more frequently male (p = 0.08), with higher pT stages (p = 0.003), lower incidence of urothelial histologies (p = 0.05) and lesser adoption of neoadjuvant chemotherapy (open radical cystectomy cases (all p ≥ 0.22). Open cohort showed a higher rate of perioperative overall complications (91.3% vs 42.2%, p 0.001). At Kaplan-Meier analysis robotic and open cohorts displayed comparable disease-free survival (log-rank p = 0.746), cancer-specific survival (p = 0.753) and overall-survival rates (p = 0.909). Robot-assisted radical cystectomy and intracorporeal neobladder provides comparable oncologic outcomes of open radical cystectomy and orthotopic neobladder at intermediate term survival analysis. Copyright © 2018 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical Oncology. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Gkretsi, Vasiliki; Stylianou, Andreas; Stylianopoulos, Triantafyllos, E-mail: tstylian@ucy.ac.cy
2017-03-15
A hallmark of cancer cells is their ability to invade surrounding tissues and form metastases. Cell-extracellular matrix (ECM)-adhesion proteins are crucial in metastasis, connecting tumor ECM with actin cytoskeleton thus enabling cells to respond to mechanical cues. Vasodilator-stimulated phosphoprotein (VASP) is an actin-polymerization regulator which interacts with cell-ECM adhesion protein Migfilin, and regulates cell migration. We compared VASP expression in MCF-7 and MDA-MB-231 breast cancer (BC) cells and found that more invasive MDA-MB-231 cells overexpress VASP. We then utilized a 3-dimensional (3D) approach to study metastasis in MDA-MB-231 cells using a system that considers mechanical forces exerted by the ECM. We prepared 3D collagen I gels of increasing concentration, imaged them by atomic force microscopy, and used them to either embed cells or tumor spheroids, in the presence or absence of VASP. We show, for the first time, that VASP silencing downregulated Migfilin, β-catenin and urokinase plasminogen activator both in 2D and 3D, suggesting a matrix-independent mechanism. Tumor spheroids lacking VASP demonstrated impaired invasion, indicating VASP’s involvement in metastasis, which was corroborated by Kaplan-Meier plotter showing high VASP expression to be associated with poor remission-free survival in lymph node-positive BC patients. Hence, VASP may be a novel BC metastasis biomarker. - Highlights: • More invasive MDA-MB-231 overexpress VASP compared to MCF-7 breast cancer cells. • We prepared 3D collagen I gels of increasing concentration and characterized them. • VASP silencing downregulated Migfilin, β-catenin and uPA both in 2D and 3D culture. • Tumor spheroids lacking VASP demonstrated impaired invasion. • Kaplan-Meier plotter shows association of high VASP expression with poor survival.
Tinkle, Christopher L; Fernandez-Pineda, Israel; Sykes, April; Lu, Zhaohua; Hua, Chia-Ho; Neel, Michael D; Bahrami, Armita; Shulkin, Barry L; Kaste, Sue C; Pappo, Alberto; Spunt, Sheri L; Krasin, Matthew J
2017-11-15
Indications for and delivery of adjuvant therapies for pediatric nonrhabdomyosarcoma soft tissue sarcoma (NRSTS) have been derived largely from adult studies; therefore, significant concern remains regarding radiation exposure to normal tissue. The authors report long-term treatment outcomes and toxicities for pediatric and young adult patients with high-grade NRSTS who were treated on a prospective trial using limited-margin radiotherapy. Sixty-two patients (ages 3-22 years) with predominantly high-grade NRSTS requiring radiation were treated on a phase 2 institutional study of conformal external-beam radiotherapy and/or brachytherapy using a 1.5-cm to 2-cm anatomically constrained margin. The estimated cumulative incidence of local failure, Gray's method estimated cumulative incidence of local failure, Kaplan-Meier method estimated survival, competing-risk regression model determined predictors of disease outcome, and toxicity was reported according to CTCAE v2.0. At a median follow-up of 5.1 years (range, 0.2-10.9 years), 9 patients had experienced local failure. The 5-year overall cumulative incidence of local failure was 14.8% (95% confidence interval [CI], 7.2%-25%), and all but 1 local failure occurred outside the highest-dose irradiation volume. The 5-year Kaplan-Meier estimates for event-free and overall survival were 49.3% (95% CI, 36.3%-61.1%) and 67.9% (95% CI, 54.2%-78.3%), respectively. Multivariable analysis indicated that younger age was the only independent predictor of local recurrence (P = .004). The 5-year cumulative incidence of grade 3 or 4 late toxicity was 15% (95% CI, 7.2%-25.3%). The delivery of limited-margin radiotherapy using conformal external-beam radiotherapy or brachytherapy provides a high rate of local tumor control without an increase in marginal failures and with acceptable treatment-related morbidity. Cancer 2017;123:4419-29. © 2017 American Cancer Society. © 2017 American Cancer Society.
SAMSN1 is highly expressed and associated with a poor survival in glioblastoma multiforme.
Directory of Open Access Journals (Sweden)
Yong Yan
Full Text Available OBJECTIVES: To study the expression pattern and prognostic significance of SAMSN1 in glioma. METHODS: Affymetrix and Arrystar gene microarray data in the setting of glioma was analyzed to preliminarily study the expression pattern of SAMSN1 in glioma tissues, and Hieratical clustering of gene microarray data was performed to filter out genes that have prognostic value in malignant glioma. Survival analysis by Kaplan-Meier estimates stratified by SAMSN1 expression was then made based on the data of more than 500 GBM cases provided by The Cancer Genome Atlas (TCGA project. At last, we detected the expression of SAMSN1 in large numbers of glioma and normal brain tissue samples using Tissue Microarray (TMA. Survival analysis by Kaplan-Meier estimates in each grade of glioma was stratified by SAMSN1 expression. Multivariate survival analysis was made by Cox proportional hazards regression models in corresponding groups of glioma. RESULTS: With the expression data of SAMSN1 and 68 other genes, high-grade glioma could be classified into two groups with clearly different prognoses. Gene and large sample tissue microarrays showed high expression of SAMSN1 in glioma particularly in GBM. Survival analysis based on the TCGA GBM data matrix and TMA multi-grade glioma dataset found that SAMSN1 expression was closely related to the prognosis of GBM, either PFS or OS (P<0.05. Multivariate survival analysis with Cox proportional hazards regression models confirmed that high expression of SAMSN1 was a strong risk factor for PFS and OS of GBM patients. CONCLUSION: SAMSN1 is over-expressed in glioma as compared with that found in normal brains, especially in GBM. High expression of SAMSN1 is a significant risk factor for the progression free and overall survival of GBM.
Vos, Janet R; Hsu, Li; Brohet, Richard M; Mourits, Marian J E; de Vries, Jakob; Malone, Kathleen E; Oosterwijk, Jan C; de Bock, Geertruida H
2015-08-10
Recommendations for treating patients who carry a BRCA1/2 gene are mainly based on cumulative lifetime risks (CLTRs) of breast cancer determined from retrospective cohorts. These risks vary widely (27% to 88%), and it is important to understand why. We analyzed the effects of methods of risk estimation and bias correction and of population factors on CLTRs in this retrospective clinical cohort of BRCA1/2 carriers. The following methods to estimate the breast cancer risk of BRCA1/2 carriers were identified from the literature: Kaplan-Meier, frailty, and modified segregation analyses with bias correction consisting of including or excluding index patients combined with including or excluding first-degree relatives (FDRs) or different conditional likelihoods. These were applied to clinical data of BRCA1/2 families derived from our family cancer clinic for whom a simulation was also performed to evaluate the methods. CLTRs and 95% CIs were estimated and compared with the reference CLTRs. CLTRs ranged from 35% to 83% for BRCA1 and 41% to 86% for BRCA2 carriers at age 70 years width of 95% CIs: 10% to 35% and 13% to 46%, respectively). Relative bias varied from -38% to +16%. Bias correction with inclusion of index patients and untested FDRs gave the smallest bias: +2% (SD, 2%) in BRCA1 and +0.9% (SD, 3.6%) in BRCA2. Much of the variation in breast cancer CLTRs in retrospective clinical BRCA1/2 cohorts is due to the bias-correction method, whereas a smaller part is due to population differences. Kaplan-Meier analyses with bias correction that includes index patients and a proportion of untested FDRs provide suitable CLTRs for carriers counseled in the clinic. © 2015 by American Society of Clinical Oncology.
Proton Beam Radiotherapy for Uveal Melanomas at Nice Teaching Hospital: 16 Years' Experience
International Nuclear Information System (INIS)
Caujolle, Jean-Pierre; Mammar, Hamid; Chamorey, Emmanuel Phar; Pinon, Fabien; Herault, Joel; Gastaud, Pierre
2010-01-01
Purpose: To present the results of uveal melanomas treated at Nice Teaching Hospital. Methods and Materials: This retrospective study included 886 consecutive patients referred to our clinic for the treatment of uveal melanomas by proton beam radiotherapy from June 1991 to December 2007. Survival rates were determined by using Kaplan-Meier estimates, and prognostic factors were evaluated using the log-rank test or Cox model. Results: The number (percent total) of subjects staged according to the TNM classification system (6th edition) of malignant tumors included 39 stage T1 (4.4%), 420 stage T2 (47.40%), 409 stage T3 (46.16%), and 18 stage T4 (2.03%) patients. The median follow-up was 63.7 months. The Kaplan-Meier overall survival rate at 5 years according to the sixth edition TNM classification was 92% for T1, 89% for T2, 67% for T3, and 62% for T4; and at 10 years, 86% for T1, 78% for T2, 43% for T3, and 41% for T4. Five factors were found to be associated with an increased death rate: advanced age, tumor thickness, largest tumor basal diameter, tumor volume, and tumor volume-to-eyeball volume ratio. The metastasis-free survival rates were 88.3 % at 5 years and 76.4 % at 10 years. The local control rates were 93.9% at 5 years and 92.1% at 10 years. The ocular conservation rates were 91.1% at 5 years and 87.3% at 10 years. Conclusions: We report the results of a large series of patients treated for uveal melanomas with a very long follow-up. Despite the large tumor volume treated, our results were similar to previously published findings relating to proton beam therapy.
Intraoperative Radiation Therapy for Locally Advanced and Recurrent Soft-Tissue Sarcomas in Adults
International Nuclear Information System (INIS)
Tran, Phuoc T.; Hara, Wendy; Su Zheng; Lin, H. Jill; Bendapudi, Pavan K.; Norton, Jeffrey; Teng, Nelson; King, Christopher R.; Kapp, Daniel S.
2008-01-01
Purpose: To analyze the outcomes of and identify prognostic factors for patients treated with surgery and intraoperative radiotherapy (IORT) for locally advanced and recurrent soft-tissue sarcoma in adults from a single institution. Methods and Materials: We retrospectively reviewed 50 consecutive patients treated with IORT to 62 sites of disease. Primary sites included retroperitoneum-pelvis (78%), extremity (8%), and other (14%). Seventy percent of patients had recurrent disease failing prior surgery (70%) and/or radiation (32%). Mean disease-free interval (DFI) before IORT was 1.9 years (range, 2 weeks-5.4 years). The IORT was delivered with orthovoltage X-rays using individually sized beveled cone applicators. Clinical characteristics were as follows: mean tumor size, 10 cm (range, 1-25 cm); high-grade histologic subtype (72%); and mean dose, 1,159 cGy (range, 600-1,600 cGy). Postoperative radiation or chemotherapy was administered to 37% of IORT Sites and 32% of patients, respectively. Outcomes measured were infield control (IFC), locoregional control (LRC), distant metastasis-free survival (DMFS), disease-specific survival (DSS), and treatment-related complications. Mean and median follow-up of alive patients were 59 and 35 months, respectively. Results: Kaplan-Meier 5-year IFC, LRC, DMFS, and DSS probabilities for the entire group were 55%, 26%, 51%, and 25%, respectively. Prognostic factors found to be significant (p < 0.05) on multivariate analysis were prior DFI and tumor size for LRC, extremity location and leiomyosarcoma histologic subtype for DMFS, and prior DFI for DSS. Our cohort had five Grade 3/4 complications associated with treatment or a 5-year Kaplan-Meier Grade 3/4 complication-free survival rate of 85%. Conclusions: IORT after tumor reductive surgery is well tolerated and seems to confer IFC in carefully selected patients
Armstrong, James; Forrest, Helen; Crawford, Mark W
2015-10-01
Discharge criteria based on physiological scoring systems can be used in the postanesthesia care unit (PACU) to fast-track patients after ambulatory surgery; however, studies comparing physiological scoring systems with traditional time-based discharge criteria are lacking. The purpose of this study was to compare PACU discharge readiness times using physiological vs time-based discharge criteria in pediatric ambulatory surgical patients. We recorded physiological observations from consecutive American Society of Anesthesiologists physical status I-III patients aged 1-18 yr who were admitted to the PACU after undergoing ambulatory surgery in a tertiary academic pediatric hospital. The physiological score was a combination of the Aldrete and Chung systems. Scores were recorded every 15 min starting upon arrival in the PACU. Patients were considered fit for discharge once they attained a score ≥12 (maximum score, 14), provided no score was zero, with the time to achieve a score ≥12 defining the criteria-based discharge (CBD) time. Patients were discharged from the PACU when both the CBD and the existing time-based discharge (TBD) criteria were met. The CBD and TBD data were compared using Kaplan-Meier and log-rank analysis. Observations from 506 children are presented. Median (interquartile range [IQR]) age was 5.5 [2.8-9.9] yr. Median [IQR] CBD and TBD PACU discharge readiness times were 30 [15-45] min and 60 [45-60] min, respectively. Analysis of Kaplan-Meier curves indicated a significant difference in discharge times using the different criteria (hazard ratio, 5.43; 95% confidence interval, 4.51 to 6.53; P < 0.001). All patients were discharged home without incident. This prospective study suggests that discharge decisions based on physiological criteria have the potential for significantly speeding the transit of children through the PACU, thereby enhancing PACU efficiency and resource utilization.
Energy Technology Data Exchange (ETDEWEB)
Barney, Brandon M., E-mail: barney.brandon@mayo.edu [Department of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States); Petersen, Ivy A. [Department of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States); Dowdy, Sean C.; Bakkum-Gamez, Jamie N. [Division of Gynecologic Surgery, Mayo Clinic, Rochester, Minnesota (United States); Haddock, Michael G. [Department of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States)
2012-05-01
Purpose: To report our institutional experience with intraoperative radiotherapy (IORT) as a component of treatment for women with locally advanced or recurrent uterine sarcoma. Methods and Materials: From 1990 to 2010, 16 women with primary (n = 3) or locoregionally recurrent (n = 13) uterine sarcoma received IORT as a component of combined modality treatment. Tumor histology studies found leiomyosarcoma (n = 9), endometrial stromal sarcoma (n = 4), and carcinosarcoma (n = 3). Surgery consisted of gross total resection in 2 patients, subtotal resection in 6 patients, and resection with close surgical margins in 8 patients. The median IORT dose was 12.5 Gy (range, 10-20 Gy). All patients received perioperative external beam radiotherapy (EBRT; median dose, 50.4 Gy; range, 20-62.5 Gy), and 6 patients also received perioperative systemic therapy. Results: Seven of the 16 patients are alive at a median follow-up of 44 months (range, 11-203 months). The 3-year Kaplan-Meier estimate of local relapse (within the EBRT field) was 7%, and central control (within the IORT field) was 100%. No local failures occurred in any of the 6 patients who underwent subtotal resection. The 3-year freedom from distant relapse was 48%, with failures occurring most frequently in the lungs or mediastinum. Median survival was 18 months, and 3-year Kaplan-Meier estimates of cause-specific and overall survival were 58% and 53%, respectively. Three patients (19%) experienced late Grade 3 toxicity. Conclusions: A combined modality approach with perioperative EBRT, surgery, and IORT for locally advanced or recurrent uterine sarcoma resulted in excellent local disease control with acceptable toxicity, even in patients with positive resection margins. With this approach, some patients were able to experience long-term freedom from recurrence.
Directory of Open Access Journals (Sweden)
Graefen M
1999-01-01
Full Text Available Die radikale Prostatektomie scheint die zur Zeit effektivste Therapie des klinisch lokalisierten Prostatakarzinoms zu sein. Dennoch liegt die Rezidivrate bei bis zu 40 % der operierten Patienten. Mit dieser Arbeit wurde anhand präoperativer Befunde ein Algorithmus entwickelt, mit welchem die Prognose des klinisch lokalisierten Prostatakarzinoms bereits vor einer operativen Therapie abgeschätzt werden kann. Hierzu wurden multiple präoperative Befunde, welche bei der Diagnose des Prostatakarzinoms erhoben werden, bezüglich ihres Einflusses auf einen PSA-Progress nach radikaler Prostatektomie geprüft. Dies erfolgte mittels einer univariaten Kaplan-Meier Analyse sowie einer multivariaten Statistik (Cox-Regression und CART-Analyse. Schwerpunkt bildete hierbei die Einbeziehung der Ergebnisse der systematischen Sextanten-Biopsie der Prostata. Alle präoperativen Befunde haben in der univariaten Kaplan-Meier Analyse einen signifikanten Einfluß auf ein PSA-Rezidiv. In der Cox-Regression hatte der Anteil an niedrigdifferenziertem Prostatakarzinom den größten Einfluß auf das Auftreten eines Tumorprogresses, gefolgt von der Anzahl der positiven Stanzen in der Biopsie und dem präoperativen PSA-Wert; alle anderen Parameter hatten keinen unabhängig signifikanten Einfluß auf den Tumorprogress. Mittels der zusätzlich durchgeführten CART Analyse konnten verschiedene Risikogruppen definiert werden, deren Rezidivrisiko bei 3 % für Patienten mit geringem Rezidivrisiko sowie 80 % für solche mit einem hohen Rezidivrisiko 2 Jahre nach der Operation betrug. Der niedrigdifferenzierte Tumoranteil hat somit den größten Einfluß auf die Prognose eines klinisch lokalisierten Prostatakarzinoms. Anhand der präsentierten CART-Analysen wurden einfach anwendbare Entscheidungsbäume entwickelt, mit denen eine Abschätzung des Therapieerfolges des klinisch lokalisierten Prostatakarzinoms bereits vor einer Operation möglich ist.
International Nuclear Information System (INIS)
Barney, Brandon M.; Petersen, Ivy A.; Dowdy, Sean C.; Bakkum-Gamez, Jamie N.; Haddock, Michael G.
2012-01-01
Purpose: To report our institutional experience with intraoperative radiotherapy (IORT) as a component of treatment for women with locally advanced or recurrent uterine sarcoma. Methods and Materials: From 1990 to 2010, 16 women with primary (n = 3) or locoregionally recurrent (n = 13) uterine sarcoma received IORT as a component of combined modality treatment. Tumor histology studies found leiomyosarcoma (n = 9), endometrial stromal sarcoma (n = 4), and carcinosarcoma (n = 3). Surgery consisted of gross total resection in 2 patients, subtotal resection in 6 patients, and resection with close surgical margins in 8 patients. The median IORT dose was 12.5 Gy (range, 10–20 Gy). All patients received perioperative external beam radiotherapy (EBRT; median dose, 50.4 Gy; range, 20–62.5 Gy), and 6 patients also received perioperative systemic therapy. Results: Seven of the 16 patients are alive at a median follow-up of 44 months (range, 11–203 months). The 3-year Kaplan-Meier estimate of local relapse (within the EBRT field) was 7%, and central control (within the IORT field) was 100%. No local failures occurred in any of the 6 patients who underwent subtotal resection. The 3-year freedom from distant relapse was 48%, with failures occurring most frequently in the lungs or mediastinum. Median survival was 18 months, and 3-year Kaplan-Meier estimates of cause-specific and overall survival were 58% and 53%, respectively. Three patients (19%) experienced late Grade 3 toxicity. Conclusions: A combined modality approach with perioperative EBRT, surgery, and IORT for locally advanced or recurrent uterine sarcoma resulted in excellent local disease control with acceptable toxicity, even in patients with positive resection margins. With this approach, some patients were able to experience long-term freedom from recurrence.
Chang, Wei-Chin; Lin, Chun-Shu; Yang, Cheng-Yu; Lin, Chih-Kung; Chen, Yuan-Wu
2018-04-01
Lymph node metastasis in oral squamous cell carcinoma (OSCC) is a poor prognostic factor. The histopathologic stage (e.g., pN) is used to evaluate the severity of lymph node metastasis; however, the current staging system insufficiently predicts survival and recurrence. We investigated clinical outcomes and lymph node density (LND) in betel nut-chewing individuals. We retrospectively analyzed 389 betel nut-exposed patients with primary OSCC who underwent surgical resection in 2002-2015. The prognostic significance of LND was evaluated by overall survival (OS) and disease-free survival (DFS) using the Kaplan-Meier method. Kaplan-Meier analyses showed that the 5-year OS and DFS rates in all patients were 60.9 and 48.9%, respectively. Multivariate analysis showed that variables independently prognostic for OS were aged population (hazard ratio [HR] = 1.6, 95% confidence interval [95% CI] = 1.1-2.5; P = .025), and cell differentiation classification (HR = 2.4, 95% CI = 1.4-4.2; P = .002). In pathologic N-positive patients, a receiver operating characteristic (ROC) curve for OS was used and indicated the best cutoff of 0.05, and the multivariate analysis showed that LND was an independent predictor of OS (HR = 2.2, 95% CI = 1.3-3.7; P = .004). Lymph node density, at a cutoff of 0.05, was an independent predictor of OS and DFS. OS and DFS underwent multiple analyses, and LND remained significant. The pathologic N stage had no influence in the OS analysis. LND is a more reliable predictor of survival in betel nut-chewing patients for further post operation adjuvant treatment, such as reoperation or adjuvant radiotherapy.
Rutten, I J G; Ubachs, J; Kruitwagen, R F P M; van Dijk, D P J; Beets-Tan, R G H; Massuger, L F A G; Olde Damink, S W M; Van Gorp, T
2017-04-01
Sarcopenia, severe skeletal muscle loss, has been identified as a prognostic factor in various malignancies. This study aims to investigate whether sarcopenia is associated with overall survival (OS) and surgical complications in patients with advanced ovarian cancer undergoing primary debulking surgery (PDS). Ovarian cancer patients (n = 216) treated with PDS were enrolled retrospectively. Total skeletal muscle surface area was measured on axial computed tomography at the level of the third lumbar vertebra. Optimum stratification was used to find the optimal skeletal muscle index cut-off to define sarcopenia (≤38.73 cm 2 /m 2 ). Cox-regression and Kaplan-Meier analysis were used to analyse the relationship between sarcopenia and OS. The effect of sarcopenia on the development of major surgical complications was studied with logistic regression. Kaplan-Meier analysis showed a significant survival disadvantage for patients with sarcopenia compared to patients without sarcopenia (p = 0.010). Sarcopenia univariably predicted OS (HR 1.536 (95% CI 1.105-2.134), p = 0.011) but was not significant in multivariable Cox-regression analysis (HR 1.362 (95% CI 0.968-1.916), p = 0.076). Significant predictors for OS in multivariable Cox-regression analysis were complete PDS, treatment in a specialised centre and the development of major complications. Sarcopenia was not predictive of major complications. Sarcopenia was not predictive of OS or major complications in ovarian cancer patients undergoing primary debulking surgery. However a strong trend towards a survival disadvantage for patients with sarcopenia was seen. Future prospective studies should focus on interventions to prevent or reverse sarcopenia and possibly increase ovarian cancer survival. Complete cytoreduction remains the strongest predictor of ovarian cancer survival. Copyright © 2017 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical Oncology. All rights
Miners' return to work following injuries in coal mines.
Bhattacherjee, Ashis; Kunar, Bijay Mihir
2016-12-22
The occupational injuries in mines are common and result in severe socio-economical consequences. Earlier studies have revealed the role of multiple factors such as demographic factors, behavioral factors, health-related factors, working environment, and working conditions for mine injuries. However, there is a dearth of information about the role of some of these factors in delayed return to work (RTW) following a miner's injury. These factors may likely include personal characteristics of injured persons and his or her family, the injured person's social and economic status, and job characteristics. This study was conducted to assess the role of some of these factors for the return to work following coal miners' injuries. A study was conducted for 109 injured workers from an underground coal mine in the years 2000-2009. A questionnaire, which was completed by the personnel interviews, included among others age, height, weight, seniority, alcohol consumption, sleeping duration, presence of diseases, job stress, job satisfaction, and injury type. The data was analyzed using the Kaplan-Meier estimates and the Cox proportional hazard model. According to Kaplan-Meier estimate it was revealed that a lower number of dependents, longer sleep duration, no job stress, no disease, no alcohol addiction, and higher monthly income have a great impact on early return to work after injury. The Cox regression analysis revealed that the significant risk factors which influenced miners' return to work included presence of disease, job satisfaction and injury type. The mine management should pay attention to significant risk factors for injuries in order to develop effective preventive measures. Med Pr 2016;67(6):729-742. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.
Yang, Ya-Hsu; Teng, Hao-Wei; Lai, Yen-Ting; Li, Szu-Yuan; Lin, Chih-Ching; Yang, Albert C; Chan, Hsiang-Lin; Hsieh, Yi-Hsuan; Lin, Chiao-Fan; Hsu, Fu-Ying; Liu, Chih-Kuang; Liu, Wen-Sheng
2015-01-01
Patients with late-onset depression (LOD) have been reported to run a higher risk of subsequent dementia. The present study was conducted to assess whether statins can reduce the risk of dementia in these patients. We used the data from National Health Insurance of Taiwan during 1996-2009. Standardized Incidence Ratios (SIRs) were calculated for LOD and subsequent dementia. The criteria for LOD diagnoses included age ≥65 years, diagnosis of depression after 65 years of age, at least three service claims, and treatment with antidepressants. The time-dependent Cox proportional hazards model was applied for multivariate analyses. Propensity scores with the one-to-one nearest-neighbor matching model were used to select matching patients for validation studies. Kaplan-Meier curve estimate was used to measure the group of patients with dementia living after diagnosis of LOD. Totally 45,973 patients aged ≥65 years were enrolled. The prevalence of LOD was 12.9% (5,952/45,973). Patients with LOD showed to have a higher incidence of subsequent dementia compared with those without LOD (Odds Ratio: 2.785; 95% CI 2.619-2.958). Among patients with LOD, lipid lowering agent (LLA) users (for at least 3 months) had lower incidence of subsequent dementia than non-users (Hazard Ratio = 0.781, 95% CI 0.685-0.891). Nevertheless, only statins users showed to have reduced risk of dementia (Hazard Ratio = 0.674, 95% CI 0.547-0.832) while other LLAs did not, which was further validated by Kaplan-Meier estimates after we used the propensity scores with the one-to-one nearest-neighbor matching model to control the confounding factors. Statins may reduce the risk of subsequent dementia in patients with LOD.
Han, Tianci; Shu, Tianci; Dong, Siyuan; Li, Peiwen; Li, Weinan; Liu, Dali; Qi, Ruiqun; Zhang, Shuguang; Zhang, Lin
2017-05-01
Decreased expression of human chemokine-like factor-like MARVEL transmembrane domain-containing 3 (CMTM3) has been identified in a number of human tumors and tumor cell lines, including gastric and testicular cancer, and PC3, CAL27 and Tca-83 cell lines. However, the association between CMTM3 expression and the clinicopathological features and prognosis of esophageal squamous cell carcinoma (ESCC) patients remains unclear. The aim of the present study was to investigate the correlation between CMTM3 expression and clinicopathological parameters and prognosis in ESCC. CMTM3 mRNA and protein expression was analyzed in ESCC and paired non-tumor tissues by quantitative real-time polymerase chain reaction, western blotting and immunohistochemical analysis. The Kaplan-Meier method was used to plot survival curves and the Cox proportional hazards regression model was also used for univariate and multivariate survival analysis. The results revealed that CMTM3 mRNA and protein expression levels were lower in 82.5% (30/40) and 75% (30/40) of ESCC tissues, respectively, when compared with matched non-tumor tissues. Statistical analysis demonstrated that CMTM3 expression was significantly correlated with lymph node metastasis (P=0.002) and clinical stage (P<0.001) in ESCC tissues. Furthermore, the survival time of ESCC patients exhibiting low CMTM3 expression was significantly shorter than that of ESCC patients exhibiting high CMTM3 expression (P=0.01). In addition, Kaplan-Meier survival analysis revealed that the overall survival time of patients exhibiting low CMTM3 expression was significantly decreased compared with patients exhibiting high CMTM3 expression (P=0.010). Cox multivariate analysis indicated that CMTM3 protein expression was an independent prognostic predictor for ESCC after resection. This study indicated that CMTM3 expression is significantly decreased in ESCC tissues and CMTM3 protein expression in resected tumors may present an effective prognostic
Directory of Open Access Journals (Sweden)
Vogt A
2011-11-01
Full Text Available Alexander Vogt1, Anke Schoelmerich1, Franziska Pollner1, Manuela Schlitt1, Uwe Raaz1, Lars Maegdefessel2, Iris Reindl1, Michael Buerke1, Karl Werdan1, Axel Schlitt11Department of Medicine III, Martin Luther-University, Halle, Germany; 2Division of Cardiovascular Medicine, Stanford University School of Medicine, Stanford, CA, USAPurpose: The aim of this study was to determine the long-term safety of drug-eluting stent (DES versus bare metal stent (BMS implantation in a “real-world” setting.Patients and methods: A total of 1809 patients who were treated with implantation of either BMS or DES were assessed. Kaplan-Meier and multivariate Cox regression analyses concerning primary endpoint of cardiac mortality were performed.Results: A total of 609 patients received DES. Mean age was 66.2 ± 11.3 years, 69.4% were male, and 1517 (83.8% were treated for acute coronary syndrome (unstable angina 510 [28.2%], non-ST-elevation myocardial infarction [NSTEMI] 506 [28.0%], and ST-elevation myocardial infarction [STEMI] 501 [27.7%]. Mean follow-up was 34 ± 15 months. During follow-up, 268 patients died of cardiac causes (DES 42 [7.3%]; BMS 226 [19.6%]; P < 0.001. Univariate Kaplan-Meier analysis showed an advantage of DES over BMS concerning the primary endpoint (P < 0.001. When adjusting for classic risk factors and additional factors that affect the progression of coronary heart disease (CHD, DES was not found to be superior to BMS (hazard ratio 0.996, 95% confidence interval 0.455–2.182, P = 0.993. Severely impaired renal function was an independent predictor for cardiac mortality after stent implantation.Conclusion: Treatment with DES is safe in the long term, also in patients presenting with STEMI. However, in multivariate analyses it is not superior to BMS treatment.Keywords: coronary stent, outcome, renal insufficiency, myocardial infarction, STEMI
Intravitreal chemotherapy in retinoblastoma: expanded use beyond intravitreal seeds.
Abramson, David H; Ji, Xunda; Francis, Jasmine H; Catalanotti, Federica; Brodie, Scott E; Habib, Larissa
2018-06-06
Ophthalmic artery chemosurgery (OAC) has changed the face of retinoblastoma treatment and led to a higher rate of globe salvage. The introduction of intravitreal chemotherapy (IVitC) has further enhanced globe salvage with increased success in treatment of intravitreal seeds. Our group has seen success at treating non-vitreous disease that is refractory to OAC using IVitC. This study was undertaken to quantify and report on this success. A retrospective review was used to identify patients treated with IVitC for indications other than vitreous seeds from two centres. The indication, prior and concurrent treatment, response time and duration of treatment were documented. Kaplan-Meier estimates were used to evaluate ocular and recurrence-free survival. Ocular toxicity was evaluated using the 30 Hz flicker electroretinogram (ERG). Continuous and categorical variables were compared with Student's t-test and χ 2 test, respectively. Fifty-six eyes from 52 retinoblastoma patients were identified. There were no disease-related or treatment-related deaths. One patient developed a second primary malignancy (pinealoblastoma) and subsequent leptomeningeal spread. Ninety-eight per cent of the eyes showed clinical regression. Recurrence was seen in 14.3%. Of the recurrences, five occurred in retinal tumours and three in subretinal seeds. The Kaplan-Meier estimated risk of recurrence in all patients treated was 83.5% (95% CI 7.9 to 14.1) at 10 months. The mean change in ERG over treatment course was -17.7 μV. Intravitreal chemotherapy is successful for the treatment of subretinal seeds and recurrent retinal tumours and could be considered as adjunctive therapy in globe-sparing treatment of retinoblastoma. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Rechazo y retrasplante corneal Corneal rejection and re-transplantation
Directory of Open Access Journals (Sweden)
Miguel O Mokey Castellanos
2007-06-01
Full Text Available Se efectuó una investigación observacional análítica retrospectiva, sobre los transplantes corneales efectuados en el Servicio de Oftalmología del Hospital "Hermanos Ameijeiras. Rechazaron 76 pacientes, que se compararon con un control de 89 pacientes, que en un período similar no tuvieron rechazo. El queratocono fue la afección corneal que predominó. El primer lugar en los rechazos correspondió a queratoherpes (43,5 %. El menor índice de rechazo fue para el queratocono (8,8 %. Se analizó la multiplicidad de rechazos; y fue frecuente que se presentara un solo rechazo, aunque sí hubo congruencia entre el número de rechazos y la necesidad de retrasplantes. Se encontró que los resultados de la conducta médica o quirúrgica se relacionaban con la causa. Se calcula un índice de supervivencia (Kaplan-Meier, que concluye que en los primeros dos años existe menos posibilidad de aparición de rechazoAn retrospective observational analytical research was conducted on corneal transplants performed at Ophthalmological Service in “Hermanos Ameijeiras” hospital . Seventy six patients had graft rejection and were compared to a control group of 89 patients that did not present rejection in the same period of time. Keratoconus was the prevailing corneal problem. The highest rejection rate corresponded to keratoherpes (43,5% whereas the lowest rate was for keratoconus (8,8%. Multiplicity of rejections was analyzed and it was found that mostly one graft rejection occured, but number of rejections was associated with the need of re-transplantation. It was found that the results of medical or surgical performance were related to the cause of graft rejection. A survival index (Kaplan-Meier was estimated, which showed that occurence of graf rejection is less probable in the first two years
Directory of Open Access Journals (Sweden)
Vaia D. Raikou
2016-11-01
Full Text Available Background: Metabolic acidosis, a common condition particularly in the end-stage of renal disease patients, results in malnutrition, inflammation and oxidative stress. In this study, we focused on the association between low serum bicarbonate and cardiovascular disease in patients on intermittent dialysis. Methods: We studied 52 on-line-pre-dilution hemodiafiltration (on-l HDF patients, 32 males and 20 females, with a mean age of 58.01 ± 15.4 years old. Metabolic acidosis was determined by serum bicarbonate concentrations less than 22 mmol/L. Residual renal function (RRF was defined by interdialytic urine volume. Kaplan–Meier curves and Cox regression models were performed to predict coronary artery disease (CAD, defined by ejection fraction <50%, or diastolic dysfunction congestive heart failure (CHF and peripheral vascular disease (PVD. Results: Kaplan–Meier analyses showed that a lower or higher than 22 mmol/L serum bicarbonate metabolic acidosis status was significantly associated with both PVD and diastolic dysfunction (log-rank = 5.07, p = 0.02 and log-rank = 5.84, p = 0.01, respectively. A similar prevalence of serum bicarbonate on CAD or CHF by low ejection fraction was not shown. The RRF was associated with PVD event and serum bicarbonate less than 22 mmol/L (log-rank = 5.49, p = 0.01 and log-rank = 3.9, p = 0.04, respectively. Cox regression analysis revealed that serum bicarbonate and RRF were significant risk factors for PVD after adjustment for confounders. Furthermore, RRF adjusted for covariates was shown to be a significant risk factor for diastolic dysfunction. Conclusion: Low serum bicarbonate was associated with peripheral vascular disease and diastolic dysfunction in intermittent dialysis. The residual renal function may impact patients’ outcomes through its relationship with metabolic acidosis status, particularly for peripheral vascular disease manifestation.
Energy Technology Data Exchange (ETDEWEB)
Lo, Andrea C., E-mail: andrealo@gmail.com [Department of Radiation Oncology, British Columbia Cancer Agency Vancouver Centre, Vancouver, British Columbia (Canada); Department of Surgery, University of British Columbia, Vancouver, British Columbia (Canada); Howard, A. Fuchsia [School of Population and Public Health, University of British Columbia, Vancouver, British Columbia (Canada); Nichol, Alan; Sidhu, Keerat; Abdulsatar, Farah [Department of Radiation Oncology, British Columbia Cancer Agency Vancouver Centre, Vancouver, British Columbia (Canada); Department of Surgery, University of British Columbia, Vancouver, British Columbia (Canada); Hasan, Haroon [Department of Radiation Oncology, British Columbia Cancer Agency Vancouver Centre, Vancouver, British Columbia (Canada); Goddard, Karen [Department of Radiation Oncology, British Columbia Cancer Agency Vancouver Centre, Vancouver, British Columbia (Canada); Department of Surgery, University of British Columbia, Vancouver, British Columbia (Canada)
2014-04-01
Purpose: We report long-term outcomes and complications of craniopharyngioma patients referred to our institution. Methods and Materials: Between 1971 and 2010, 123 consecutive patients received primary treatment for craniopharyngioma in British Columbia and were referred to our institution. The median age was 30 years (range, 2-80 years). Thirty-nine percent of patients were treated primarily with subtotal resection (STR) and radiation therapy (RT), 28% with STR alone, 15% with gross total resection, 11% with cyst drainage (CD) alone, 5% with CD+RT, and 2% with RT alone. Eight percent of patients received intracystic bleomycin (ICB) therapy. Results: Median follow-up was 8.9 years, and study endpoints were reported at 10 years. Ten-year Kaplan-Meier progression-free survival (PFS) was 46%. Patients treated with STR+RT or CD+RT had the highest PFS (82% and 83%, respectively). There were no significant differences between PFS after adjuvant versus salvage RT (84% vs 74%, respectively; P=.6). Disease-specific survival (DSS) was 88%, and overall survival (OS) was 80%. Primary treatment modality did not affect DSS or OS, while older age was a negative prognostic factor for OS but not DSS. Kaplan-Meier rates for visual deterioration, anterior pituitary hormone deficiency, diabetes insipidus, seizure disorder, and cerebrovascular events (CVE) due to treatment, not tumor progression, were 27%, 76%, 45%, 16%, and 11%, respectively. The CVE rate was 29% in patients who received ICB compared to 10% in those who did not (P=.07). Conclusions: We report favorable PFS in patients with craniopharyngioma, especially in those who received RT after surgery. DSS and OS rates were excellent regardless of primary treatment modality. We observed a high incidence of hypopituitarism, visual deterioration, and seizure disorder. Eleven percent of patients experienced CVEs after treatment. There was a suggestion of increased CVE risk in patients treated with ICB.
2D and 3D CT Radiomics Features Prognostic Performance Comparison in Non-Small Cell Lung Cancer
Directory of Open Access Journals (Sweden)
Chen Shen
2017-12-01
Full Text Available OBJECTIVE: To compare 2D and 3D radiomics features prognostic performance differences in CT images of non-small cell lung cancer (NSCLC. METHOD: We enrolled 588 NSCLC patients from three independent cohorts. Two sets of 463 patients from two different institutes were used as the training cohort. The remaining cohort with 125 patients was set as the validation cohort. A total of 1014 radiomics features (507 2D features and 507 3D features correspondingly were assessed. Based on the dichotomized survival data, 2D and 3D radiomics indicators were calculated for each patient by trained classifiers. We used the area under the receiver operating characteristic curve (AUC to assess the prediction performance of trained classifiers (the support vector machine and logistic regression. Kaplan–Meier and Cox hazard survival analyses were also employed. Harrell's concordance index (C-Index and Akaike's information criteria (AIC were applied to assess the trained models. RESULTS: Radiomics indicators were built and compared by AUCs. In the training cohort, 2D_AUC = 0.653, 3D_AUC = 0.671. In the validation cohort, 2D_AUC = 0.755, 3D_AUC = 0.663. Both 2D and 3D trained indicators achieved significant results (P < .05 in the Kaplan-Meier analysis and Cox regression. In the validation cohort, 2D Cox model had a C-Index = 0.683 and AIC = 789.047; 3D Cox model obtained a C-Index = 0.632 and AIC = 799.409. CONCLUSION: Both 2D and 3D CT radiomics features have a certain prognostic ability in NSCLC, but 2D features showed better performance in our tests. Considering the cost of the radiomics features calculation, 2D features are more recommended for use in the current study.
Tabbaa, Zaid M; Janco, Jo Marie T; Mariani, Andrea; Dowdy, Sean C; McGree, Michaela E; Weaver, Amy L; Cliby, William A
2014-06-01
The aim of this study is to estimate the overall rates of significant incontinent conduit-related complications and compare rates between conduit types. This was a retrospective review of 166 patients who underwent incontinent urinary diversion from April 1993 through April 2013. Patients were categorized by conduit type-ileal, sigmoid colon, and transverse colon. Significant conduit-related complications were assessed at 30 and 90days after surgery. Significant conduit-related complication was defined as any of the following: ureteral stricture, conduit leak, conduit obstruction, conduit ischemia, ureteral anastomotic leak, stent obstruction requiring intervention via interventional radiology procedure or reoperation, and renal failure. A total of 166 patients underwent formation of an incontinent urinary conduit, most commonly during exenteration for gynecologic malignancy. There were 129 ileal, 11 transverse colon, and 26 sigmoid conduits. The overall significant conduit-related complication rate within 30days was 15.1%. Complication rates for ileal, transverse and sigmoid conduits were 14.7%, 0%, and 23.1%, respectively (Fisher's exact test, p=0.24). By 90days, the Kaplan-Meier estimated rates of significant complications were 21.8% overall, and 22.3%, 0%, and 28.9%, respectively, by conduit type (log-rank test, p=0.19). The most common significant conduit-related complications were conduit or ureteral anastomotic leaks and conduit obstructions. By 1 and 2years following surgery, the Kaplan-Meier estimated overall rate of significant conduit-related complication increased to 26.5% and 30.1%, respectively. Our study suggests that there are multiple appropriate tissue sites for use in incontinent conduit formation, and surgical approach should be individualized. Most significant conduit-related complications occur within 90days after surgery. Copyright © 2014 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Baumann, Brian C.; He, Jiwei; Hwang, Wei-Ting; Tucker, Kai N.; Bekelman, Justin E.; Herr, Harry W.; Lerner, Seth P.; Guzzo, Thomas J.; Malkowicz, S. Bruce; Christodouleas, John P.
2016-01-01
Purpose: To inform prospective trials of adjuvant radiation therapy (adj-RT) for bladder cancer after radical cystectomy, a locoregional failure (LF) risk stratification was proposed. This stratification was developed and validated using surgical databases that may not reflect the outcomes expected in prospective trials. Our purpose was to assess sources of bias that may affect the stratification model's validity or alter the LF risk estimates for each subgroup: time bias due to evolving surgical techniques; trial accrual bias due to inclusion of patients who would be ineligible for adj-RT trials because of early disease progression, death, or loss to follow-up shortly after cystectomy; bias due to different statistical methods to estimate LF; and subgrouping bias due to different definitions of the LF subgroups. Methods and Materials: The LF risk stratification was developed using a single-institution cohort (n=442, 1990-2008) and the multi-institutional SWOG 8710 cohort (n=264, 1987-1998) treated with radical cystectomy with or without chemotherapy. We evaluated the sensitivity of the stratification to sources of bias using Fine-Gray regression and Kaplan-Meier analyses. Results: Year of radical cystectomy was not associated with LF risk on univariate or multivariate analysis after controlling for risk group. By use of more stringent inclusion criteria, 26 SWOG patients (10%) and 60 patients from the single-institution cohort (14%) were excluded. Analysis of the remaining patients confirmed 3 subgroups with significantly different LF risks with 3-year rates of 7%, 17%, and 36%, respectively (P<.01), nearly identical to the rates without correcting for trial accrual bias. Kaplan-Meier techniques estimated higher subgroup LF rates than competing risk analysis. The subgroup definitions used in the NRG-GU001 adj-RT trial were validated. Conclusions: These sources of bias did not invalidate the LF risk stratification or substantially change the model's LF estimates.
Satisfactory Results of the Exeter Revision Femoral Stem Used for Primary Total Hip Arthroplasty.
Desy, Nicholas M; Johnson, Joshua D; Sierra, Rafael J
2017-02-01
The Exeter cemented femoral stem has demonstrated excellent clinical and radiographic outcomes as well as long-term survivorship free from aseptic loosening. A shorter revision stem (125 mm) with a 44 offset became available for the purpose of cement-in-cement revision situations. In certain cases, this shorter revision stem may be used for various primary total hip arthroplasties (THAs) where the standard length stem would require distally reaming the femoral canal. We sought to report on the early to midterm results of this specific stem when used for primary THA regarding (1) clinical and radiographic outcomes, (2) complications, and (3) survivorship. Twenty-nine patients (33 hips) underwent a hybrid THA using the smaller revision Exeter cemented femoral stem. Twenty-five patients (28 hips) had at least 2 years of follow-up and were assessed for clinical and radiographic outcomes. All 33 hips were included in the analysis of complications and survivorship. The Kaplan-Meier survivorship was performed using revision for all causes and for aseptic loosening as the end points. The average clinical follow-up was 4 years (range, 2-7). Harris Hip Scores improved from a mean preoperative value of 56 (range, 23-96) to 90 (range, 51-100) at the latest follow-up. All patients demonstrated superior cement mantles with no signs of loosening. One patient suffered a B2 periprosthetic fracture and 1 patient experienced 2 episodes of instability. The 5-year Kaplan-Meier survivorship was 96.7% for all causes of revision and was 100% using aseptic loosening as the end point. The shorter Exeter revision cemented femoral stem has favorable early to midterm clinical and radiographic outcomes when used for primary THA with a low complication rate and is a viable option in patients with narrow femoral canals where uncemented stem fixation is not desired. Copyright © 2016 Elsevier Inc. All rights reserved.
Investigation of Prognostic Factors and Survival without Recurrence in Patients with Breast Cancer
Directory of Open Access Journals (Sweden)
Ahmad Abdollahi
2017-01-01
Full Text Available Background: One of the major consequences of breast cancer is the recurrence of the disease. The objective of present study was to estimate the 7-year survival without recurrence as well as the effective prognostic factors in recurrence. Materials and Methods: This historical cohort survival analysis was conducted on 1329 patients diagnosed with breast cancer in Motahari Breast Clinic, Shiraz, Iran between 2004 and 2011. We estimated the rate of survival without recurrence through the Kaplan–Meier method and the difference between the survival curves was investigated using the log-rank test. Furthermore, Cox regression model was used to model the effective factors in local recurrence as well as metastasis. Results: The mean age of the patients was 54.8 ± 11.4 years. Estrogen receptor positive, progesterone receptor positive, and human epidermal growth factor receptor-2 positive were observed in 70.6%, 66.6%, and 34.4% of the cases, respectively. The mean of the follow-up period was 3.7 ± 1.8 years in all patients. The results of the Kaplan–Meier method revealed 1-, 3-, 5-, and 7-year rate of survival without recurrence as 96.4%, 78.4%, 66.3%, and 54.8%, respectively. There was a significant relationship between survival without recurrence and histology grade (hazard ratio [HR] = 1.66, P = 0.009, neural invasion (HR = 1.74, P = 0.006, and progesterone receptors (HR = 0.69, P = 0.031. Conclusion: In this study, the rate of survival without recurrence in breast cancer was 54.8%. Among factors, histology grade and neural involvement at the time of diagnosis increased the chance of recurrence and progesterone receptors caused a longer interval between diagnosis and recurrence.
Setting standards and monitoring quality in the NHS 1999-2013: a classic case of goal conflict.
Littlejohns, Peter; Knight, Alec; Littlejohns, Anna; Poole, Tara-Lynn; Kieslich, Katharina
2017-04-01
2013 saw the National Health Service (NHS) in England severely criticized for providing poor quality despite successive governments in the previous 15 years, establishing a range of new institutions to improve NHS quality. This study seeks to understand the contributions of political and organizational influences in enabling the NHS to deliver high-quality care through exploring the experiences of two of the major new organizations established to set standards and monitor NHS quality. We used a mixed method approach: first a cross-sectional, in-depth qualitative interview study and then the application of principal agent modeling (Waterman and Meier broader framework). Ten themes were identified as influencing the functioning of the NHS regulatory institutions: socio-political environment; governance and accountability; external relationships; clarity of purpose; organizational reputation; leadership and management; organizational stability; resources; organizational methods; and organizational performance. The organizations could be easily mapped onto the framework, and their transience between the different states could be monitored. We concluded that differing policy objectives for NHS quality monitoring resulted in central involvement and organizational change. This had a disruptive effect on the ability of the NHS to monitor quality. Constant professional leadership, both clinical and managerial, and basing decisions on best evidence, both technical and organizational, helped one institution to deliver on its remit, even within a changing political/policy environment. Application of the Waterman-Meier framework enabled an understanding and description of the dynamic relationship between central government and organizations in the NHS and may predict when tensions will arise in the future. © 2016 The Authors. The International Journal of Health Planning and Management Published by John Wiley & Sons Ltd. © 2016 The Authors. The International Journal of Health
Red cell distribution width and its association with mortality in neonatal sepsis.
Martin, Snehal L; Desai, Saumil; Nanavati, Ruchi; Colah, Roshan B; Ghosh, Kanjaksha; Mukherjee, Malay B
2018-01-08
Neonatal sepsis is a major cause of mortality in the developing countries. However, with current severity scores and laboratory parameters, predicting outcomes of neonatal sepsis is a serious challenge. Red cell distribution width (RDW) is a readily available pragmatic means to predict outcomes of various comorbidities in adults and children, without causing any additional blood loss. However, its utility in neonates remains unexplored. Hence, the objective of the present study was to evaluate the association of RDW with neonatal sepsis and its role as a predictive marker for mortality. This Prospective observational study was carried out in a Level IIIB NICU for a period of 3 years. It involved comparison of RDW values of septic neonates with those of controls (matched for gestational age and birth weight) with an equal allocation ratio. A total of 251 septic neonates along with 251 controls >28 weeks of gestational age were enrolled. The RDW was derived from complete blood count done within first 6 hours of life. After arranging the RDW (median; interquartile range (IQR)), the values were categorized as those above the 50th percentile i.e. ≥20% and those below the 50th percentile i.e. rates of the above two groups were assessed using the Kaplan-Meier curve and the log rank test. RDW levels were significantly higher among the neonatal sepsis cases (19.90%) as compared to the controls (18.90%) with a p value of < .001. RDW was significantly higher amongst the nonsurvivors than survivors (p < .003). Kaplan-Meier curve showed that septic neonates having RDW values ≥20% had significantly increased mortality (p < .02) with a hazard ratio of 0.5. High RDW is associated with neonatal sepsis and is an independent outcome predictor for mortality associated with neonatal sepsis.
International Nuclear Information System (INIS)
Nagata, Masaki; Takahashi, Katsu; Kodama, Naoki; Kawase, Tomoyuki; Hoshina, Hideyuki; Ikeda, Nobuyuki; Shingaki, Susumu; Takagi, Ritsuo; Noman, Arhab A; Suzuki, Kenji; Kurita, Hiroshi; Ohnishi, Makoto; Ohyama, Tokio; Kitamura, Nobutaka; Kobayashi, Takanori; Uematsu, Kohya
2013-01-01
Molecular biomarkers are essential for monitoring treatment effects, predicting prognosis, and improving survival rate in oral squamous cell carcinoma. This study sought to verify the effectiveness of two integrin gene expression ratios as biomarkers. Gene expression analyses of integrin α3 (ITGA3), integrin β4 (ITGB4), CD9 antigen (CD9), and plakoglobin (JUP) by quantitative real-time PCR were conducted on total RNA from 270 OSCC cases. The logrank test, Cox proportional hazards model, and Kaplan-Meier estimates were performed on the gene expression ratios of ITGA3/CD9 and ITGB4/JUP and on the clinicopathological parameters for major clinical events. A high rate (around 80%) of lymph node metastasis was found in cases with a high ITGA3/CD9 ratio (high-ITGA3/CD9) and invasive histopathology (YK4). Primary site recurrence (PSR) was associated with high-ITGA3/CD9, T3-4 (TNM class), and positive margin, indicating that PSR is synergistically influenced by treatment failure and biological malignancy. A high ITGB4/JUP ratio (high-ITGB4/JUP) was revealed to be a primary contributor to distant metastasis without the involvement of clinicopathological factors, suggesting intervention of a critical step dependent on the function of the integrin β4 subunit. Kaplan-Meier curves revealed positive margin as a lethal treatment consequence in high-ITGA3/CD9 and YK4 double-positive cases. Two types of metastatic trait were found in OSCC: locoregional dissemination, which was reflected by high-ITGA3/CD9, and distant metastasis through hematogenous dissemination, uniquely distinguished by high-ITGB4/JUP. The clinical significance of the integrin biomarkers implies that biological mechanisms such as cancer cell motility and anchorage-independent survival are vital for OSCC recurrence and metastasis
McAuley, Paul A; Keteyian, Steven J; Brawner, Clinton A; Dardari, Zeina A; Al Rifai, Mahmoud; Ehrman, Jonathan K; Al-Mallah, Mouaz H; Whelton, Seamus P; Blaha, Michael J
2018-05-03
To assess the influence of exercise capacity and body mass index (BMI) on 10-year mortality in patients with heart failure (HF) and to synthesize these results with those of previous studies. This large biracial sample included 774 men and women (mean age, 60±13 years; 372 [48%] black) with a baseline diagnosis of HF from the Henry Ford Exercise Testing (FIT) Project. All patients completed a symptom-limited maximal treadmill stress test from January 1, 1991, through May 31, 2009. Patients were grouped by World Health Organization BMI categories for Kaplan-Meier survival analyses and stratified by exercise capacity (<4 and ≥4 metabolic equivalents [METs] of task). Associations of BMI and exercise capacity with all-cause mortality were assessed using multivariable-adjusted Cox proportional hazards models. During a mean follow-up of 10.1±4.6 years, 380 patients (49%) died. Kaplan-Meier survival plots revealed a significant positive association between BMI category and survival for exercise capacity less than 4 METs (log-rank, P=.05), but not greater than or equal to 4 METs (P=.76). In the multivariable-adjusted models, exercise capacity (per 1 MET) was inversely associated, but BMI was not associated, with all-cause mortality (hazard ratio, 0.89; 95% CI, 0.85-0.94; P<.001 and hazard ratio, 0.99; 95% CI, 0.97-1.01; P=.16, respectively). Maximal exercise capacity modified the relationship between BMI and long-term survival in patients with HF, upholding the presence of an exercise capacity-obesity paradox dichotomy as observed over the short-term in previous studies. Copyright © 2018 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.
Teófilo, Eugénio; Rocha-Pereira, Nuno; Kuhlmann, Birger; Antela, Antonio; Knechten, Heribert; Santos, Jesús; Jiménez-Expósito, Maria Jesús
2016-02-01
Boosted protease inhibitors (PIs), including ritonavir-boosted atazanavir (ATV/r), are a recommended option for the initial treatment of HIV-1 infection based upon clinical trial data; however, long-term real-life clinical data are limited. We evaluated the long-term use of ATV/r as a component of antiretroviral combination therapy in the real-life setting in the REMAIN study. This was an observational cohort study conducted at sites across Germany, Portugal, and Spain. Retrospective historical and prospective longitudinal follow-up data were extracted every six months from medical records of HIV-infected treatment-naïve patients aged ≥ 18 years initiating a first-line ATV/r-containing regimen. Eligible patients (n = 517) were followed up for a median of 3.4 years. The proportion remaining on ATV/r at 5 years was 51.5% with an estimated Kaplan-Meier median time to treatment discontinuation of 4.9 years. Principal reasons for discontinuation were adverse events (15.9%; 8.9% due to hyperbilirubinemia) and virologic failure (6.8%). The Kaplan-Meier probability of not having virologic failure (HIV-1 RNA treatment-emergent major PI resistance occurred. ATV/r was generally well tolerated during long-term treatment with no significant changes in estimated glomerular filtration rate over five years. In a real-life clinical setting over five years, treatment-naïve patients with HIV-1 infection initiating an ATV/r-based regimen showed sustained virologic suppression, an overall treatment persistence rate of 51.5%, an absence of treatment-emergent major PI resistance mutations at virologic failure, a long-term safety profile consistent with that observed in clinical trials, and no significant decline in renal function.
Approaches and perioperative management in periacetabular osteotomy surgery
DEFF Research Database (Denmark)
Søballe, Kjeld; Troelsen, Anders
2012-01-01
.9 to 8.1 years) of 209 PAOs performed using this approach have shown Kaplan-Meier survivorship rates of 94.7% at 5 years and 88.6% at 8.1 years, with conversion to total hip arthroplasty as the end point. Perioperative management includes a patient education program, optimized pain treatment strategies...... (local infiltration analgesia), and a progressive mobilization and exercise program. The transsartorial approach coupled with a specific perioperative management program has proved successful for PAO surgery.......In the early days of periacetabular osteotomy (PAO), surgical approaches were characterized by extensive soft-tissue dissection. The Smith-Petersen approach (and iliofemoral modifications) and the ilioinguinal approach have traditionally been used for PAO. The optimal surgical approach for PAO...
Al Shemmari, Salem; Sankaranarayanan, Sreedharan P; Krishnan, Yamini
2014-07-01
PMBCL is a distinct type of nonhodgkins lymphoma with specific clinicopathological features. To clarify clinical features, treatment alternatives and outcomes, we evaluated 28 Arab patients treated with chemotherapy or radiotherapy between 2006 and 2011. PMBCL lymphoma patients identified according to WHO classification and treated at KCCC between 2006 and 2011 were included in this study. Demographic and clinical data are presented as means or medians. Overall survival was estimated using the Kaplan-Meier method. Survival rates were compared using the log-rank test. A P lymphoma entity seen in the young with good survival. The role of PET scan for response evaluation and the type of consolidation therapy needs to be further clarified.
Estimation of Unemployment Duration in Botoşani County Using Survival Analysis
Directory of Open Access Journals (Sweden)
Darabă Gabriel
2017-01-01
Full Text Available In this paper we aim at estimating the unemployment duration in Botosani County in order tostudy the impact of individual characteristics (gender, age, place of residence, unemploymentbenefit, etc. on the length of unemployment spells. We use Cox regression model to measure theeffects of gender, age, residential environment, etc. on the hazard rate of leaving unemploymentandKaplan-Meier estimator to compare survival probabilities among different categories ofunemployed persons. The study is carried out on a sample of 200 unemployment spellsregisteredwith the Employment Agency of Botoşani County from January 2012 to December 2015. Theresults reveal that place of residence, unemployment benefit and unemployed category have asignificant impact on unemployment spells.
Disciplinary action against physicians: who is likely to get disciplined?
Khaliq, Amir A; Dimassi, Hani; Huang, Chiung-Yu; Narine, Lutchmie; Smego, Raymond A
2005-07-01
We sought to determine the characteristics of disciplined physicians at-large and the risk of disciplinary action over time and to report the type and frequency of complaints and the nature of disciplinary actions against allopathic physicians in Oklahoma. Descriptive statistics, Kaplan-Meier analysis, and Cox proportional hazards modeling of publicly available data on physicians licensed by the Oklahoma Board of Medical Licensure and Supervision. Among 14,314 currently or previously licensed physicians, 396 (2.8%) had been disciplined. Using univariate proportional hazards analysis, men (P disciplinary action compared to US medical graduates (P disciplinary action, medical schools and residency training programs must continue to emphasize both patient care and medical professionalism as critical core competencies.
Freeman, Randall J; Li, Yuanzhang; Niebuhr, David W
2011-05-01
The estimated incidence of idiopathic venous thromboembolism (IVTE) cases in the United States ranges from 24,000 to 282,000/year. This analysis explores the incidence and prevalence of IVTE in the military and if cases experience increased attrition. The Defense Medical Surveillance System was searched for incident IVTE cases from 1998 through 2007. Enlisted cases were each matched to 3 controls. Kaplan-Meier survival analysis and Cox proportional hazard modeling were performed. We matched 463 cases to 1,389 controls. Outpatient IVTE rates have increased markedly from 1998 through 2007. Cases of all-cause attrition risk (0.56 [95% CI = 0.44, 0.72]) and rates were significantly less than controls (p readiness, and medical costs.
Survival analysis in hematologic malignancies: recommendations for clinicians
Delgado, Julio; Pereira, Arturo; Villamor, Neus; López-Guillermo, Armando; Rozman, Ciril
2014-01-01
The widespread availability of statistical packages has undoubtedly helped hematologists worldwide in the analysis of their data, but has also led to the inappropriate use of statistical methods. In this article, we review some basic concepts of survival analysis and also make recommendations about how and when to perform each particular test using SPSS, Stata and R. In particular, we describe a simple way of defining cut-off points for continuous variables and the appropriate and inappropriate uses of the Kaplan-Meier method and Cox proportional hazard regression models. We also provide practical advice on how to check the proportional hazards assumption and briefly review the role of relative survival and multiple imputation. PMID:25176982
Uriarte-Duque, Juan; Hernández-Riverab, Gabriela
2006-01-01
Survival in patients with acquired immunodeficiency syndrome (AIDS) related non-Hodgkin's Lymphoma has improved with the use of High Active Antiretroviral Therapy (HAART) and less toxic chemotherapy. Clinical characteristics and outcome among patients treated for AIDS related non-Hodgkin's Lymphoma are described. Nine patients were studied retrospectively. Overall survival (OS) and Free Disease Survival (FDS) using a Kaplan-Meier model were analyzed. Patients received (DA-EPOCH) etoposide, prednisone, vincristine, doxorubicin and cyclophosphamide. The overall Survival was 18 months and 13 month Free Disease Survival with a median follow-up of 16 months showing full response in 8/9 patients was observed. A very satisfactory treatment response in this group of patients expressed as an increased Overall Survival was noted.
International Nuclear Information System (INIS)
Kulcinski, G.L.
2002-01-01
A cradle-to-grave net energy and greenhouse gas emissions analysis of a modern photovoltaic facility that produces electricity has been performed and compared to a similar analysis on fusion. A summary of the work has been included in a Ph.D. thesis titled ''Life-cycle assessment of electricity generation systems and applications for climate change policy analysis'' by Paul J. Meier, and a synopsis of the work was presented at the 15th Topical meeting on Fusion Energy held in Washington, DC in November 2002. In addition, a technical note on the effect of the introduction of fusion energy on the greenhouse gas emissions in the United States was submitted to the Office of Fusion Energy Sciences (OFES)
A 10-year cohort analysis of routine paediatric ART data in a rural South African setting.
Lilian, R R; Mutasa, B; Railton, J; Mongwe, W; McINTYRE, J A; Struthers, H E; Peters, R P H
2017-01-01
South Africa's paediatric antiretroviral therapy (ART) programme is managed using a monitoring and evaluation tool known as TIER.Net. This electronic system has several advantages over paper-based systems, allowing profiling of the paediatric ART programme over time. We analysed anonymized TIER.Net data for HIV-infected children aged ART in a rural district of South Africa between 2005 and 2014. We performed Kaplan-Meier survival analysis to assess outcomes over time. Records of 5461 children were available for analysis; 3593 (66%) children were retained in care. Losses from the programme were higher in children initiated on treatment in more recent years (P ART programme and highlights interventions to improve programme performance.
Niesvizky, Ruben; Naib, Tara; Christos, Paul J; Jayabalan, David; Furst, Jessica R; Jalbrzikowski, Jessica; Zafar, Faiza; Mark, Tomer; Lent, Richard; Pearse, Roger N; Ely, Scott; Leonard, John P; Mazumdar, Madhu; Chen-Kiang, Selina; Coleman, Morton
2007-09-01
Data on 72 patients receiving lenalidomide/dexamethasone for multiple myeloma (MM) was used to determine the factors that are associated with lenalidomide-induced myelosuppression. Eight of 14 patients with grade > or =3 myelosuppression had baseline creatinine clearance (CrCl) < or =0.67 ml/s. Kaplan-Meier analysis by log-rank test demonstrated a significant association (P < 0.0001) between renal insufficiency and time to myelosuppression (hazard ratio = 8.4; 95% confidence interval 2.9-24.7, P = 0.0001). Therefore, CrCl is inversely associated with significant myelosuppression. Caution should be exercised when lenalidomide therapy is commenced and CrCl should be incorporated as a determinant of the initial dosing of lenalidomide in MM patients.
Directory of Open Access Journals (Sweden)
Claudio Calazan do Carmo
2011-08-01
Full Text Available OBJECTIVE: To assess overall survival of women with cervical cancer and describe prognostic factors associated. METHODS: A total of 3,341 cases of invasive cervical cancer diagnosed at the Brazilian Cancer Institute, Rio de Janeiro, southeastern Brazil, between 1999 and 2004 were selected. Clinical and pathological characteristics and follow-up data were collected. There were performed a survival analysis using Kaplan-Meier curves and a multivariate analysis through Cox model. RESULTS: Of all cases analyzed, 68.3% had locally advanced disease at the time of diagnosis. The 5-year overall survival was 48%. After multivariate analysis, tumor staging at diagnosis was the single variable significantly associated with prognosis (pOBJETIVO: Evaluar la sobrevida global de mujeres con cáncer de cuello uterino e identificar factores pronósticos relacionados. MÉTODOS: Todos los 3.341 casos tratados en el Instituto Nacional de Cáncer, Rio de Janeiro, Sureste de Brasil, entre 1999 y 2004 fueron seleccionados y sus datos clínicos, anatomo-patológicos y de seguimiento fueron colectados. Se utilizaron la curva de Kaplan-meier y el modelo de Cox par evaluación de la sobrevida y para análisis logística múltiple, respectivamente. RESULTADOS: De los casos estudiados, 68,3% presentaban enfermedad localmente avanzada. La sobrevida en cinco años fue de 48%. Posterior al análisis múltiple, el estadio clínico al diagnóstico fue la única variable significativamente asociada con el pronóstico (pOBJETIVO: Avaliar a sobrevida global de mulheres com câncer de colo uterino e identificar fatores prognósticos relacionados. MÉTODOS: Todos os 3.341 casos tratados no Instituto Nacional de Câncer, Rio de Janeiro, RJ, entre 1999 e 2004 foram selecionados e seus dados clínicos, anatomo-patológicos e de seguimento foram coletados. Foram utilizados a curva de Kaplan-Meier e o modelo de Cox para avaliação da sobrevida e para análise logística m
RARE COMPONENT OF THE FISH FAUNA OF THE 'SULINSKY' NATIONAL LANDSCAPE RESERVE
Directory of Open Access Journals (Sweden)
N. Ja. Rudik-Leuska
2014-06-01
authorities should focus attention on their protection and restoration of abundance. Keywords: Sulinsky Reserve, Sula Bay, conservation lists, sterlet (Acipenser ruthenus L., Crucian carp (Carassius carassius L., Common dace (Leuciscus leuciscus L., Wels catfish (Silurus glanis L., Asp (Aspius aspius L., Bitterling (Rhodeus sericeus Pall., Spined loach (Cobitis taenia L..
Cravotta, Charles A.; Brightbill, Robin A.; Langland, Michael J.
2010-01-01
Acidic mine drainage (AMD) from legacy anthracite mines has contaminated Swatara Creek in eastern Pennsylvania. Intermittently collected base-flow data for 1959–1986 indicate that fish were absent immediately downstream from the mined area where pH ranged from 3.5 to 7.2 and concentrations of sulfate, dissolved iron, and dissolved aluminum were as high as 250, 2.0, and 4.7 mg/L, respectively. However, in the 1990s, fish returned to upper Swatara Creek, coinciding with the implementation of AMD treatment (limestone drains, limestone diversion wells, limestone sand, constructed wetlands) in the watershed. During 1996–2006, as many as 25 species of fish were identified in the reach downstream from the mined area, with base-flow pH from 5.8 to 7.6 and concentrations of sulfate, dissolved iron, and dissolved aluminum as high as 120, 1.2, and 0.43 mg/L, respectively. Several of the fish taxa are intolerant of pollution and low pH, such as river chub (Nocomis icropogon) and longnose dace (Rhinichthys cataractae). Cold-water species such as brook trout (Salvelinus fontinalis) and warm-water species such as rock bass (Ambloplites rupestris) varied in predominance depending on stream flow and stream temperature. Storm flow data for 1996–2007 indicated pH, alkalinity, and sulfate concentrations decreased as the stream flow and associated storm-runoff component increased, whereas iron and other metal concentrations were poorly correlated with stream flow because of hysteresis effects (greater metal concentrations during rising stage than falling stage). Prior to 1999, pH\\5.0 was recorded during several storm events; however, since the implementation of AMD treatments, pH has been maintained near neutral. Flow-adjusted trends for1997–2006 indicated significant increases in calcium; decreases in hydrogen ion, dissolved aluminum, dissolved and total manganese, and total iron; and no change in sulfate or dissolved iron in Swatara Creek immediately downstream from the
DEFF Research Database (Denmark)
Morgen, Søren Schmidt; Nielsen, Dennis Hallager; Larsen, Claus Falck
2014-01-01
and compared to the observed survival. We assessed how precise the scoring systems predicted survival with McNemar's test. The prognostic value was illustrated with Kaplan-Meier curves, and the individual prognostic components were analyzed with Cox regression analysis. RESULTS: The mean age was 65 years...... (range 20-95), and 57 % of the patients were men. The majority of tumors were lung (23 %), prostate (21 %), and breast tumors (18 %). The overall precision of predicted survival was 58.7 % for the Tokuhashi Revised score and 52.9 % for the Tomita score. The observed survival in each of the scoring groups...... was most precise in predicting survival. However, due to the relatively low precision, we suggest that a modification of both scoring systems is necessary....
DEFF Research Database (Denmark)
Haaverstad, Rune; Vitale, Nicola; Karevold, Asbjørn
2006-01-01
OBJECTIVE: The aim of this report is the prospective, multicentre evaluation of clinical results and haemodynamic performance of the Medtronic Advantage aortic valve prosthesis. METHODS: From April 2001 to June 2003, 166 patients (male:female 125:41; mean (SD) age 61.8 (11.8) years) received...... an aortic advantage valve prosthesis. Complete cumulative follow-up was 242.7 patient-years (maximum 3.2; mean 1.6 years). Postoperatively, patients underwent early (within 30 days) and 1 year transthoracic echocardiography. RESULTS: 30 day mortality was 2.4% (n = 4). Kaplan-Meier estimates of freedom from...... echocardiography. CONCLUSIONS: Haemodynamic performance and early clinical results of Medtronic advantage in the aortic position were satisfactory and comparable with those of other bileaflet valves in current clinical use....
Equity and improvement in outcome of breast cancer in Denmark
DEFF Research Database (Denmark)
Andreasen, A H; Mouridsen, H T; Andersen, K W
1994-01-01
The trend in the prognosis for female breast cancer patients was investigated by comparing Kaplan-Meier survival curves of different patient cohorts diagnosed during the period 1948-87. The study is based on 71,448 patients from the Danish Cancer Registry. The cohorts were defined by age...... in other parts of Denmark. For patients diagnosed in 1978-87 the prognosis, however, reached an equal level in all parts of the country. Thus, it is reasonable to assume that the national programme introduced in 1977 by the Danish Breast Cancer Cooperative Group (DBCG) has played an important role...... and not only brought about therapeutic improvements in breast cancer treatment in Denmark, but also ensured equity in the outcome on a national scale....
DEFF Research Database (Denmark)
Vladimirov, B S; Schiødt, Morten
2009-01-01
smokers at the time of diagnosis and were treated surgically. Patients were advised to quit smoking at each visit. The change of smoking habits and occurrence of unfavorable events were noted during follow-up. Descriptive statistics, Fischer's exact test, Kaplan-Meier curves with log-rank test, and Cox......The aim of this study was to examine if cessation of smoking after surgical excision of oral potentially malignant lesions in smokers reduced the risk of recurrences, development of new lesions or malignancies. 51 patients with oral leukoplakia or erythroplakia were included. They were daily...... proportional hazards model were used for analysis. 16 patients (31%) quit smoking during the observation period. Only one quitter (6%) developed recurrence compared with 11 continuing smokers (33%) (p
Prognostic value of body mass index before treatment for laryngeal squamous cell carcinoma
International Nuclear Information System (INIS)
Li, Zhao-Qu; Zou, Lan; Liu, Tian-Run; Yang, An-Kui
2015-01-01
Patients with head and neck cancer often suffer from malnutrition. This study aims to investigate the influence of body mass index (BMI) on the prognosis of laryngeal squamous cell carcinoma (LSCC). A total of 473 patients with LSCC initially treated at Sun Yat-sen University Cancer Center between January 2005 and July 2009 were retrospectively reviewed. Survival analysis was performed by the Kaplan-Meier method and Cox regression model. Low BMI before treatment was significantly associated with poor overall survival in patients with LSCC (P<0.001). BMI was an independent prognostic factor for patients with LSCC. Leanness before treatment was associated with poor prognosis in patients with LSCC. Good nutritional status is favorable to improve survival in patients with LSCC
Zhou, K; Yan, Y; Zhao, S; Li, B
2014-01-01
To explore the correlation between serum levels of Tumor Associated Materials (TAM) and clinicopathological parameters and prognosis in patients with esophageal cancer (EC). The levels of TAM were determined by chemical colorimetry in 100 EC patients and 100 healthy controls. Serum TAM levels were significantly higher in patients with esophageal carcinoma than in the control group (p TAM were associated with tumor size (p = 0.004), tumor depth (p TAM (p = 0.001). Kaplan-Meier analysis showed patients with increased levels of TAM after operation had an lower overall survival (p TAM may be an independent factor affecting the overall survival and disease-free survival (p TAM could be used to screen for tumor and assess unfavorable prognosis in patients with EC.
Prognostic impact of tumor MET expression among patients with stage IV gastric cancer
DEFF Research Database (Denmark)
Erichsen, Rune; Kelsh, Michael A; Oliner, Kelly S
2016-01-01
PURPOSE: We aimed to investigate the prevalence and prognostic impact of tumor mesenchymal epithelial transition factor (MET) expression in stage IV gastric cancers in a real-world clinical setting because existing evidence is sparse. METHODS: The study included archived cancer specimens from 103...... stage IV gastric cancer patients (2003-2010). We analyzed MET-protein expression by immunohistochemistry (MET-positive if ≥25% of tumor cells showed MET expression). We calculated overall survival using the Kaplan-Meier method and hazard ratios comparing mortality among MET-positive and MET.......6 months), corresponding to an adjusted hazard ratio of 2.2 (95% confidence interval, 1.3-3.7). CONCLUSIONS: Tumor MET expression is prevalent and has substantial prognostic impact in stage IV gastric cancer patients....
DEFF Research Database (Denmark)
Lindebjerg, J; Spindler, Karen-Lise Garm; Ploen, J
2009-01-01
to the tumour regression grade system and lymph node status in the surgical specimen was assessed. The prognostic value of clinico-pathological parameters was analysed using univariate analysis and Kaplan-Meier methods for comparison of groups. RESULTS: All patients responded to treatment and 47% had a major......OBJECTIVE: The purpose of the present study was to investigate the impact of tumour regression and the post-treatment lymph node status on the prognosis of rectal cancer treated by preoperative neoadjuvant chemoradiotherapy. METHOD: One hundred and thirty-five patients with locally advanced T3.......01). CONCLUSION: The combined assessment of lymph-node status and tumour response has strong prognostic value in locally advanced rectal cancer patient treated with preoperative long-course chemoradiation....
Cholecystokinin in plasma predicts cardiovascular mortality in elderly females
DEFF Research Database (Denmark)
Gøtze, Jens P.; Rehfeld, Jens F; Alehagen, Urban
2016-01-01
BACKGROUND: Cholecystokinin (CCK) and gastrin are related gastrointestinal hormones with documented cardiovascular effects of exogenous administration. It is unknown whether measurement of endogenous CCK or gastrin in plasma contains information regarding cardiovascular mortality. METHODS......: Mortality risk was evaluated using Cox proportional hazard regression and Kaplan-Meier analyses. Elderly patients in a primary care setting with symptoms of cardiac disease, i.e. shortness of breath, peripheral edema, and/or fatigue, were evaluated (n=470). Primary care patients were followed for 13years...... information was obtained from 4th quartile gastrin concentrations on 5-year cardiovascular mortality risk. CONCLUSIONS: CCK in plasma is an independent marker of cardiovascular mortality in elderly female patients. The study thus introduces measurement of plasma CCK in gender-specific cardiovascular risk...
DEFF Research Database (Denmark)
Møller, Henrik; Coupland, Victoria H; Tataru, Daniela
2018-01-01
INTRODUCTION: Lung cancer outcomes in England are inferior to comparable countries. Patient or disease characteristics, healthcare-seeking behaviour, diagnostic pathways, and oncology service provision may contribute. We aimed to quantify associations between geographic variations in treatment...... and survival of patients in England. METHODS: We retrieved detailed cancer registration data to analyse the variation in survival of 176,225 lung cancer patients, diagnosed 2010-2014. We used Kaplan-Meier analysis and Cox proportional hazards regression to investigate survival in the two-year period following...... to statistical adjustments for age, sex, socio-economic status, performance status and co-morbidity. CONCLUSION: The extent of use of different treatment modalities varies between geographical areas in England. These variations are not attributable to measurable patient and tumour characteristics, and more...
DEFF Research Database (Denmark)
Schnack, Tine H; Høgdall, Estrid; Thomsen, Lotte Nedergaard
2017-01-01
OBJECTIVES: Women with endometriosis carry an increased risk for ovarian clear cell adenocarcinomas (CCCs). Clear cell adenocarcinoma may develop from endometriosis lesions. Few studies have compared clinical and prognostic factors and overall survival in patients diagnosed as having CCC according...... to endometriosis status. METHODS: Population-based prospectively collected data on CCC with coexisting pelvic (including ovarian; n = 80) and ovarian (n = 46) endometriosis or without endometriosis (n = 95) were obtained through the Danish Gynecological Cancer Database. χ Test, independent-samples t test, logistic...... regression, Kaplan-Meier test, and Cox regression were used. Statistical tests were 2 sided. P values less than 0.05 were considered statistically significant. RESULTS: Patients with CCC and pelvic or ovarian endometriosis were significantly younger than CCC patients without endometriosis, and a higher...
Fatigue, General Health, and Ischemic Heart Disease in Older Adults
DEFF Research Database (Denmark)
Ekmann, Anette; Petersen, Inge; Mänty, Minna Regina
2013-01-01
Backgrounds.Fatigue has been shown to predict ischemic heart disease (IHD) and mortality in nonsmoking middle-aged men free of cardiovascular disease. The aim of this study was to investigate the predictive value of fatigue for IHD and general health in nondisabled individuals free...... of cardiovascular disease and older than 70 years. METHODS: The study population was drawn from The Longitudinal Study of Aging Danish Twins. In total, 1,696 participants were followed up for 2-10 years by questionnaires and 10-16 years through registries. Kaplan Meier, Cox Proportional Hazard and logistic.......08-2.00) compared with participants without fatigue. CONCLUSION: We concluded that fatigue in nondisabled older adults free of cardiovascular disease is an early predictor for development of subsequent poor general health and IHD....
Smooth conditional distribution function and quantiles under random censorship.
Leconte, Eve; Poiraud-Casanova, Sandrine; Thomas-Agnan, Christine
2002-09-01
We consider a nonparametric random design regression model in which the response variable is possibly right censored. The aim of this paper is to estimate the conditional distribution function and the conditional alpha-quantile of the response variable. We restrict attention to the case where the response variable as well as the explanatory variable are unidimensional and continuous. We propose and discuss two classes of estimators which are smooth with respect to the response variable as well as to the covariate. Some simulations demonstrate that the new methods have better mean square error performances than the generalized Kaplan-Meier estimator introduced by Beran (1981) and considered in the literature by Dabrowska (1989, 1992) and Gonzalez-Manteiga and Cadarso-Suarez (1994).
Directory of Open Access Journals (Sweden)
Coco Claudio
2012-09-01
Full Text Available Abstract Background Expression levels of CD133, a cancer stem cell marker, and of the α-subunit of the dystroglycan (α-DG complex, have been previously reported to be altered in colorectal cancers. Methods Expression levels of CD133 and α-DG were assessed by immunohistochemistry in a series of colon cancers and their prognostic significance was evaluated. Results Scattered cells positive for CD133 were rarely detected at the bases of the crypts in normal colonic mucosa while in cancer cells the median percentage of positive cells was 5% (range 0–80. A significant correlation was observed with pT parameter and tumor stage but not with tumor grade and N status. Recurrence and death from disease were significantly more frequent in CD133-high expressing tumors and Kaplan-Meier curves showed a significant separation between high vs low expressor groups for both disease-free (p = 0.002 and overall (p = 0.008 survival. Expression of α-DG was reduced in a significant fraction of tumors but low α-DG staining did not correlate with any of the classical clinical-pathological parameters. Recurrence and death from the disease were significantly more frequent in α-DG-low expressing tumors and Kaplan-Meier curves showed a significant separation between high vs low expressor tumors for both disease-free (p = 0.02 and overall (p = 0.02 survival. Increased expression of CD133, but not loss of α-DG, confirmed to be an independent prognostic parameters at a multivariate analysis associated with an increased risk of recurrence (RR = 2.4; p = 0.002 and death (RR = 2.3; p = 0.003. Conclusions Loss of α-DG and increased CD133 expression are frequent events in human colon cancer and evaluation of CD133 expression could help to identify high-risk colon cancer patients.
Concurrent chemoradiation for vaginal cancer.
Directory of Open Access Journals (Sweden)
David T Miyamoto
Full Text Available BACKGROUND: It is not known whether the addition of chemotherapy to radiation therapy improves outcomes in primary vaginal cancer. Here, we review clinical outcomes in patients with primary vaginal cancer treated with radiation therapy (RT or concurrent chemoradiation therapy (CRT. METHODS: Seventy-one patients with primary vaginal cancer treated with definitive RT with or without concurrent chemotherapy at a single institution were identified and their records reviewed. A total of 51 patients were treated with RT alone; 20 patients were treated with CRT. Recurrences were analyzed. Overall survival (OS and disease-free survival (DFS rates were estimated using the Kaplan-Meier method. Cox regression analysis was performed. RESULTS: The median age at diagnosis was 61 years (range, 18-92 years and the median follow-up time among survivors was 3.0 years. Kaplan-Meier estimates for OS and DFS differed significantly between the RT and CRT groups (3-yr OS = 56% vs. 79%, log-rank p = 0.037; 3-yr DFS = 43% vs. 73%, log-rank p = 0.011. Twenty-three patients (45% in the RT group had a relapse at any site compared to 3 (15% in the CRT group (p = 0.027. With regard to the sites of first relapse, 10 patients (14% had local only, 4 (6% had local and regional, 9 (13% had regional only, 1 (1% had regional and distant, and 2 (3% had distant only relapse. On univariate analysis, the use of concurrent chemotherapy, FIGO stage, tumor size, and date of diagnosis were significant predictors of DFS. On multivariate analysis, the use of concurrent chemotherapy remained a significant predictor of DFS (hazard ratio 0.31 (95% CI, 0.10-0.97; p = 0.04. CONCLUSIONS: Vaginal cancer results in poor outcomes. Adequate radiation dose is essential to ensure curative management. Concurrent chemotherapy should be considered for vaginal cancer patients.
International Nuclear Information System (INIS)
Harms, W.; Wannenmacher, M.; Becker, H.; Herth, F.; Fritz, P.
2000-01-01
Aim: To assess effect an toxicity of high-dose-rate afterloading (HDR) alone or in combination with external beam radiotherapy (EBRT) in centrally located tumors of the upper respiratory tract. Patients and Methods: From 1987 to 1996, 55 patients were treated. Twenty-one patients (group A1: 17 non-small-cell lung cancer [NSCLC], A2: 4 metastases from other malignancies) were treated using HDR alone due to a relapse after external beam irradiation. In 34 previously untreated and inoperable patients (group B1: 27 NSCLC, B2: 7 metastases from other malignancies) HDR was given as a boost after EBRT (30 to 60 Gy, median 50). HDR was carried out with a 192 Ir source (370 GBq). The brachytherapy dose (group A: 5 to 27 Gy, median 20; B: 10 to 20 Gy, median 15) was prescribed to 1 cm distance from the source axis. A distanciable applicator was used in 39/55 patients. Results: In group A1, a response rate (CR, PR) of 53% (group B1: 77%) was reached. The median survival (Kaplan-Meier) was 5 months in group A1 (B1: 20 months). The 1-, 3- and 5-year local progression free survival rates (Kaplan-Meier) were 66% (15%), 52% (0%), and 37% (0%) in group B1 (group A1). Prognostic favorable factors in group B1 were a tumor diameter 70. Grade-1 or 2 toxicity (RTOG/EORTC) occurred in 0% in group A and in 6% in group B. We observed no Grad-3 or 4 toxicity. Complications caused by persistent or progressive local disease occurred in 3 patients in goup A (fatal hemorrhage, tracheomediastinal fistula, hemoptysis) and in 2 patients in group B (fatal hemorrhage, hemoptysis). Conclusions: HDR brachytherapy is an effective treatment with moderate side effects. In combination with external beam irradiation long-term remissions can be reached in one third of the patients. (orig.) [de
International Nuclear Information System (INIS)
Garsa, Adam A.; Badiyan, Shahed N.; DeWees, Todd; Simpson, Joseph R.; Huang, Jiayi; Drzymala, Robert E.; Barani, Igor J.; Dowling, Joshua L.; Rich, Keith M.; Chicoine, Michael R.; Kim, Albert H.; Leuthardt, Eric C.; Robinson, Clifford G.
2014-01-01
Purpose: To evaluate local control rates and predictors of individual tumor local control for brain metastases from non-small cell lung cancer (NSCLC) treated with stereotactic radiosurgery (SRS). Methods and Materials: Between June 1998 and May 2011, 401 brain metastases in 228 patients were treated with Gamma Knife single-fraction SRS. Local failure was defined as an increase in lesion size after SRS. Local control was estimated using the Kaplan-Meier method. The Cox proportional hazards model was used for univariate and multivariate analysis. Receiver operating characteristic analysis was used to identify an optimal cutpoint for conformality index relative to local control. A P value <.05 was considered statistically significant. Results: Median age was 60 years (range, 27-84 years). There were 66 cerebellar metastases (16%) and 335 supratentorial metastases (84%). The median prescription dose was 20 Gy (range, 14-24 Gy). Median overall survival from time of SRS was 12.1 months. The estimated local control at 12 months was 74%. On multivariate analysis, cerebellar location (hazard ratio [HR] 1.94, P=.009), larger tumor volume (HR 1.09, P<.001), and lower conformality (HR 0.700, P=.044) were significant independent predictors of local failure. Conformality index cutpoints of 1.4-1.9 were predictive of local control, whereas a cutpoint of 1.75 was the most predictive (P=.001). The adjusted Kaplan-Meier 1-year local control for conformality index ≥1.75 was 84% versus 69% for conformality index <1.75, controlling for tumor volume and location. The 1-year adjusted local control for cerebellar lesions was 60%, compared with 77% for supratentorial lesions, controlling for tumor volume and conformality index. Conclusions: Cerebellar tumor location, lower conformality index, and larger tumor volume were significant independent predictors of local failure after SRS for brain metastases from NSCLC. These results warrant further investigation in a prospective
International Nuclear Information System (INIS)
Trovo, Marco; Minatel, Emilio; Durofil, Elena; Polesel, Jerry; Avanzo, Michele; Baresic, Tania; Bearz, Alessandra; Del Conte, Alessandro; Franchin, Giovanni; Gobitti, Carlo; Rumeileh, Imad Abu; Trovo, Mauro G.
2014-01-01
Purpose: To retrospectively assess toxicity and outcome of re-irradiation with stereotactic body radiation therapy (SBRT) in patients with recurrent or persistent non-small cell lung cancer (NSCLC), who were previously treated with radical radiation therapy (50-60 Gy). The secondary endpoint was to investigate whether there are dosimetric parameter predictors of severe radiation toxicity. Methods and Materials: The analysis was conducted in 17 patients with “in-field” recurrent/persistent centrally located NSCLC, who underwent re-irradiation with SBRT. SBRT consisted of 30 Gy in 5 to 6 fractions; these prescriptions would be equivalent for the tumor to 37.5 to 40 Gy, bringing the total 2-Gy-per-fraction cumulative dose to 87 to 100 Gy, considering the primary radiation therapy treatment. Actuarial analyses and survival were calculated by the Kaplan-Meier method, and P values were estimated by the log-rank test, starting from the date of completion of SBRT. Dosimetric parameters from the subgroups with and without grade ≥3 pulmonary toxicity were compared using a 2-tailed Student t test. Results: The median follow-up was 18 months (range, 4-57 months). Only 2 patients had local failure, corresponding to a local control rate of 86% at 1 year. The Kaplan-Meier estimates of overall survival (OS) rates at 1 and 2 years were 59% and 29%, respectively; the median OS was 19 months. Four patients (23%) experienced grade 3 radiation pneumonitis, and 1 patient developed fatal pneumonitis. One patient died of fatal hemoptysis 2 months after the completion of SBRT. Unexpectedly, heart maximum dose, D5 (minimum dose to at least 5% of the heart volume), and D10 were correlated with risk of radiation pneumonitis (P<.05). Conclusions: Re-irradiation with SBRT for recurrent/persistent centrally located NSCLC achieves excellent results in terms of local control. However, the high rate of severe toxicity reported in our study is of concern
International Nuclear Information System (INIS)
Ng, Francesca; Kozarski, Robert; Ganeshan, Balaji; Goh, Vicky
2013-01-01
Objective: To determine if there is a difference between contrast enhanced CT texture features from the largest cross-sectional area versus the whole tumor, and its effect on clinical outcome prediction. Methods: Entropy (E) and uniformity (U) were derived for different filter values (1.0–2.5: fine to coarse textures) for the largest primary tumor cross-sectional area and the whole tumor of the staging contrast enhanced CT in 55 patients with primary colorectal cancer. Parameters were compared using non-parametric Wilcoxon test. Kaplan–Meier analysis was performed to determine the relationship between CT texture and 5-year overall survival. Results: E was higher and U lower for the whole tumor indicating greater heterogeneity at all filter levels (1.0–2.5): median (range) for E and U for whole tumor versus largest cross-sectional area of 7.89 (7.43–8.31) versus 7.62 (6.94–8.08) and 0.005 (0.004–0.01) versus 0.006 (0.005–0.01) for filter 1.0; 7.88 (7.22–8.48) versus 7.54 (6.86–8.1) and 0.005 (0.003–0.01) versus 0.007 (0.004–0.01) for filter 1.5; 7.88 (7.17–8.54) versus 7.48 (5.84–8.25) and 0.005 (0.003–0.01) versus 0.007 (0.004–0.02) for filter 2.0; and 7.83 (7.03–8.57) versus 7.42 (5.19–8.26) and 0.005 (0.003–0.01) versus 0.006 (0.004–0.03) for filter 2.5 respectively (p ≤ 0.001). Kaplan–Meier analysis demonstrated better separation of E and U for whole tumor analysis for 5-year overall survival. Conclusion: Whole tumor analysis appears more representative of tumor heterogeneity
Sayers, Adrian; Crowther, Michael J; Judge, Andrew; Whitehouse, Michael R; Blom, Ashley W
2017-08-28
The use of benchmarks to assess the performance of implants such as those used in arthroplasty surgery is a widespread practice. It provides surgeons, patients and regulatory authorities with the reassurance that implants used are safe and effective. However, it is not currently clear how or how many implants should be statistically compared with a benchmark to assess whether or not that implant is superior, equivalent, non-inferior or inferior to the performance benchmark of interest.We aim to describe the methods and sample size required to conduct a one-sample non-inferiority study of a medical device for the purposes of benchmarking. Simulation study. Simulation study of a national register of medical devices. We simulated data, with and without a non-informative competing risk, to represent an arthroplasty population and describe three methods of analysis (z-test, 1-Kaplan-Meier and competing risks) commonly used in surgical research. We evaluate the performance of each method using power, bias, root-mean-square error, coverage and CI width. 1-Kaplan-Meier provides an unbiased estimate of implant net failure, which can be used to assess if a surgical device is non-inferior to an external benchmark. Small non-inferiority margins require significantly more individuals to be at risk compared with current benchmarking standards. A non-inferiority testing paradigm provides a useful framework for determining if an implant meets the required performance defined by an external benchmark. Current contemporary benchmarking standards have limited power to detect non-inferiority, and substantially larger samples sizes, in excess of 3200 procedures, are required to achieve a power greater than 60%. It is clear when benchmarking implant performance, net failure estimated using 1-KM is preferential to crude failure estimated by competing risk models. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No
Directory of Open Access Journals (Sweden)
Wang J
2016-11-01
Full Text Available Jie Wang,1,* Shengzi Wang,1 Xinmao Song,1,* Wenjiao Zeng,2 Shuyi Wang,3 Fu Chen,1 Hao Ding1 1Department of Radiation Oncology, Eye, Ear, Nose, and Throat Hospital, Fudan University, 2Department of Pathology, Shanghai Medical School, Fudan University, 3Department of Pathology, Eye, Ear, Nose, and Throat Hospital, Fudan University, Shanghai, People’s Republic of China *These authors contributed equally to this work Background: Cancer-related systemic inflammation has been demonstrated to be associated with poor outcome in multiple types of cancers. Meanwhile, the local inflammation, which is characterized by dense intratumoral immune infiltrate, is a favorable predictor of survival outcome. Purpose: To evaluate the role of systemic and local inflammation in predicting outcome in patients with laryngeal squamous cell carcinoma. Patients and methods: In this retrospective study, 120 patients who had undergone postoperative radiotherapy were enrolled. Neutrophil-to-lymphocyte ratio (NLR and platelet-to-lymphocyte ratio (PLR, as calculated from pretreatment whole blood counts, were used to indicate systemic inflammation. The optimal cutoff values of NLR and PLR were determined using receiver operating characteristic curve analysis. Tumor infiltrating lymphocytes (TILs density, as assessed by pathologist review of hematoxylin and eosin-stained slides, was used to represent local inflammation. Overall survival (OS and recurrence-free survival (RFS were assessed using the Kaplan–Meier method and multivariate Cox regression analysis. Results: The best cutoff was 2.79 for NLR and 112 for PLR. Kaplan–Meier analysis revealed that high NLR, high PLR, and low TILs density were significantly correlated with inferior OS and RFS, respectively (all P<0.05. The Cox proportional multivariate hazard model showed that a high pretreatment PLR and a low TILs density were both independently correlated with poor OS and RFS, respectively (all P<0.05. Conclusion
Diekmann, Theresa; Schrems-Hoesl, Laura M; Mardin, Christian Y; Laemmer, Robert; Horn, Folkert K; Kruse, Friedrich E; Schrems, Wolfgang A
2018-02-01
The purpose of this study was to compare the ability of scanning laser polarimetry (SLP) and spectral-domain optical coherence tomography (SD-OCT) to predict future visual field conversion of subjects with ocular hypertension and early glaucoma. All patients were recruited from the Erlangen glaucoma registry and examined using standard automated perimetry, 24-hour intraocular pressure profile, and optic disc photography. Peripapillary retinal nerve fiber layer thickness (RNFL) measurements were obtained by SLP (GDx-VCC) and SD-OCT (Spectralis OCT). Positive and negative predictive values (PPV, NPV) were calculated for morphologic parameters of SLP and SD-OCT. Kaplan-Meier survival curves were plotted and log-rank tests were performed to compare the survival distributions. Contingency tables and Venn-diagrams were calculated to compare the predictive ability. The study included 207 patients-75 with ocular hypertension, 85 with early glaucoma, and 47 controls. Median follow-up was 4.5 years. A total of 29 patients (14.0%) developed visual field conversion during follow-up. SLP temporal-inferior RNFL [0.667; 95% confidence interval (CI), 0.281-0.935] and SD-OCT temporal-inferior RNFL (0.571; 95% CI, 0.317-0.802) achieved the highest PPV; nerve fiber indicator (0.923; 95% CI, 0.876-0.957) and SD-OCT mean (0.898; 95% CI, 0.847-0.937) achieved the highest NPV of all investigated parameters. The Kaplan-Meier curves confirmed significantly higher survival for subjects within normal limits of measurements of both devices (P<0.001). Venn diagrams tested with McNemar test statistics showed no significant difference for PPV (P=0.219) or NPV (P=0.678). Both GDx-VCC and SD-OCT demonstrate comparable results in predicting future visual field conversion if taking typical scans for GDx-VCC. In addition, the likelihood ratios suggest that GDx-VCC's nerve fiber indicator<30 may be the most useful parameter to confirm future nonconversion. (http://www.ClinicalTrials.gov number, NTC
Energy Technology Data Exchange (ETDEWEB)
Yamamoto, Masaaki, E-mail: BCD06275@nifty.com [Katsuta Hospital Mito GammaHouse, Hitachi-naka (Japan); Department of Neurosurgery, Tokyo Women' s Medical University Medical Center E, Tokyo (Japan); Kawabe, Takuya [Katsuta Hospital Mito GammaHouse, Hitachi-naka (Japan); Department of Neurosurgery, Kyoto Prefectural University of Medicine Graduate School of Medical Sciences, Kyoto (Japan); Higuchi, Yoshinori [Department of Neurosurgery, Chiba University Graduate School of Medicine, Chiba (Japan); Sato, Yasunori [Clinical Research Center, Chiba University Graduate School of Medicine, Chiba (Japan); Barfod, Bierta E. [Katsuta Hospital Mito GammaHouse, Hitachi-naka (Japan); Kasuya, Hidetoshi [Department of Neurosurgery, Tokyo Women' s Medical University Medical Center E, Tokyo (Japan); Urakawa, Yoichi [Katsuta Hospital Mito GammaHouse, Hitachi-naka (Japan)
2012-12-01
Purpose: We tested the validity of 3 recently proposed prognostic indexes for breast cancer patients with brain metastases (METs) treated radiosurgically. The 3 indexes are Diagnosis-Specific Graded Prognostic Assessment (DS-GPA), New Breast Cancer (NBC)-Recursive Partitioning Analysis (RPA), and our index, sub-classification of RPA class II patients into 3 sub-classes (RPA class II-a, II-b and II-c) based on Karnofsky performance status, tumor number, original tumor status, and non-brain METs. Methods and Materials: This was an institutional review board-approved, retrospective cohort study using our database of 269 consecutive female breast cancer patients (mean age, 55 years; range, 26-86 years) who underwent Gamma Knife radiosurgery (GKRS) alone, without whole-brain radiation therapy, for brain METs during the 15-year period between 1996 and 2011. The Kaplan-Meier method was used to estimate the absolute risk of each event. Results: Kaplan-Meier plots of our patient series showed statistically significant survival differences among patients stratified into 3, 4, or 5 groups based on the 3 systems (P<.001). However, the mean survival time (MST) differences between some pairs of groups failed to reach statistical significance with all 3 systems. Thus, we attempted to regrade our 269 breast cancer patients into 3 groups by modifying our aforementioned index along with the original RPA class I and III, (ie, RPA I+II-a, II-b, and II-c+III). There were statistically significant MST differences among these 3 groups without overlap of 95% confidence intervals (CIs) between any 2 pairs of groups: 18.4 (95% CI = 14.0-29.5) months in I+II-a, 9.2 in II-b (95% CI = 6.8-12.9, P<.001 vs I+II-a) and 5.0 in II-c+III (95% CI = 4.2-6.8, P<.001 vs II-b). Conclusions: As none of the new grading systems, DS-GPS, BC-RPA and our system, was applicable to our set of radiosurgically treated patients for comparing survivals after GKRS, we slightly modified our system for breast cancer
Yamamoto, Tetsuya; Sawada, Akira; Mayama, Chihiro; Araie, Makoto; Ohkubo, Shinji; Sugiyama, Kazuhisa; Kuwayama, Yasuaki
2014-05-01
To report the 5-year incidence of bleb-related infection after mitomycin C-augmented glaucoma filtering surgery and to investigate the risk factors for infections. Prospective, observational cohort study. A total of 1098 eyes of 1098 glaucoma patients who had undergone mitomycin C-augmented trabeculectomy or trabeculectomy combined with phacoemulsification and intraocular lens implantation performed at 34 clinical centers. Patients were followed up at 6-month intervals for 5 years, with special attention given to bleb-related infections. The follow-up data were analyzed via Kaplan-Meier survival analysis and the Cox proportional hazards model. Incidence of bleb-related infection over 5 years and risk factors for infections. Of the 1098 eyes, a bleb-related infection developed in 21 eyes. Kaplan-Meier survival analysis revealed that the incidence of bleb-related infection was 2.2±0.5% (cumulative incidence ± standard error) at the 5-year follow-up for all cases, whereas it was 7.9±3.1% and 1.7±0.4% for cases with and without a history of bleb leakage, respectively (P = 0.000, log-rank test). When only eyes with a well-functioning bleb were counted, it was 3.9±1.0%. No differences were found between the trabeculectomy cases and the combined surgery cases (P = 0.398, log-rank test) or between cases with a fornix-based flap and those with a limbal-based flap (P = 0.651, log-rank test). The Cox model revealed that a history of bleb leakage and younger age were risk factors for infections. The 5-year cumulative incidence of bleb-related infection was 2.2±0.5% in eyes treated with mitomycin C-augmented trabeculectomy or trabeculectomy combined with phacoemulsification and intraocular lens implantation in our prospective, multicenter study. Bleb leakage and younger age were the main risk factors for infections. Copyright © 2014 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Zhu Yueqi; Li Minghua; Fang Chun; Wang Wu; Zhang Peilei; Cheng Yingsheng; Tan Huaqiao; Wang Jianbo
2010-01-01
Objective: Complicated aneurysms located in the cisternal segment of the internal carotid artery(ICA-CSA) present unique therapeutic difficulties. This study is to discuss the feasibility of the Willis stent-graft in treating complicated ICA-CSA by comparing its effect with that of coiling therapy. Methods: Willis covered stents were employed in 19 complicated ICA-CSAs (group A), while coils were used in 17 complicated ICA-CSAs (group B). Follow-up angiography was performed to investigate aneurysm recurrence, endoleak and parent artery (PA) stenosis. Kaplan-Meier curves were constructed to compare the recurrence-free and PA stenosis-free rate in both groups. Results: Total exclusion was immediately achieved in 13 ICA-CSAs and minor endoleaks presented in 5 cases in group A. Total or near-total occlusion was achieved in 7 ICA-CSAs, subtotal occlusion in 8 and partial occlusion in 2 cases in group B after coiling. Acute thrombosis occurred in 1 patient in either group and re-hemorrhage happened in 1 patient after coiling. Follow-up angiography in group A revealed that 16 ICA-CSAs were completely isolated, with two parent arteries showing mild in-stent stenosis. Eighteen months after the procedure, Kaplan-Meier analysis showed that the recurrence-free rate was 93.3% and 50%, while the stenosis-free rate of parent artery was 87.5% and 100% in group A and in Group B, respectively. In group A and group Bthe clinical neurological symptoms were fully recovered in 9 and 9, obviously improved in 3 and 5, unchanged in 2 and 2, and aggravated in one and 0 patients, respectively. Conclusion: The implantation of Willis stent-graft is a feasible endovascular therapy for complicated ICA-CSAs. When the parent artery is very tortuous or when the risk that a main collateral branch may be wrongly covered and occluded is present, the implantation of Willis covered stent can not be taken as the treatment of first choice. (authors)
Directory of Open Access Journals (Sweden)
Abhishek A Solanki
Full Text Available PURPOSE: Radiation therapy (RT is commonly used as definitive treatment for early-stage nodular lymphocyte-predominant Hodgkin's lymphoma (NLPHL. We evaluated the cause-specific survival (CSS, overall survival (OS, and second malignancy (SM rates in patients with early-stage NLPHL treated with RT. METHODS AND MATERIALS: Patients with stage I-II NLPHL between 1988 and 2009 who underwent RT were selected from the Surveillance, Epidemiology and End Results database. Univariate analysis (UVA for CSS and Os was performed using the Kaplan-Meier method and included age, gender, involved site, year of diagnosis, presence of B-symptoms, and extranodal involvement (ENI. Multivariable analysis (MVA was performed using Cox Proportional Hazards modeling and included the above clinical variables. SM were classified as RT-related or non-RT-related. Freedom from SM and freedom from RT-related SM were determined using the Kaplan-Meier method. RESULTS: The study cohort included 469 patients. Median age was 37 years. The most common involved sites were the head and neck (36%, axilla/arm (26%, and multiple lymph node regions (18%. Sixty-eight percent had stage I disease, 70% were male, 4% had ENI, and 7% had B-symptoms. Median follow-up was 6 years. Ten-year CSS and Os were 98% and 88%, respectively. On UVA, none of the covariates was associated with CSS. Increasing age (p<0.01 and female gender (p<0.01 were associated with worse Os. On MVA, older age (p<0.01, female gender (p=0.04, multiple regions of involvement (p=0.03, stage I disease (p=0.02, and presence of B-symptoms (p=0.02 were associated with worse Os. Ten-year freedom from SM and freedom from RT-related SM were 89% and 99%, respectively. CONCLUSIONS: This is the largest series to evaluate the outcomes of stage I-II NLPHL patients treated with RT and found that this patient population has an excellent long-term prognosis and a low rate of RT-related second malignancies.
Spies, Benedikt Christopher; Witkowski, Siegbert; Butz, Frank; Vach, Kirstin; Kohal, Ralf-Joachim
2016-10-01
The aim of this study was to determine the success and survival rate of all-ceramic bi-layered implant-supported three-unit fixed dental prostheses (IS-FDPs) 3 years after implant placement. Thirteen patients (seven males, six females; age: 41-78 years) received two one-piece ceramic implants (alumina-toughened zirconia) each in the region of the premolars or the first molar and were finally restored with adhesively cemented bi-layered zirconia-based IS-FDPs (3 in the maxilla, 10 in the mandible) composed of CAD/CAM-fabricated zirconia frameworks pressed-over with fluor-apatite glass-ceramic ingots. At prosthetic delivery and the follow-ups after 1, 2 and 3 years, the restorations were evaluated using modified United States Public Health Service (USPHS) criteria. Restorations with minor veneer chippings, a small-area occlusal roughness, slightly soundable restoration margins, minimal contour deficiencies and tolerable color deviations were regarded as success. In case of more distinct defects that could, however, be repaired to a clinically acceptable level, IS-FDPs were regarded as surviving. Kaplan-Meier plots were used for the success/survival analyses. To verify an impact on subjective patients' perceptions, satisfaction was evaluated by visual analog scales (VAS). All patients were seen 3 years after implant installation. No IS-FDP had to be replaced, resulting in 100% survival after a mean observation period of 29.5 months (median: 30.7). At the 3-year follow-up, 7/13 IS-FDPs showed a veneer chipping, 13/13 an occlusal roughness and 12/13 minimal deficiencies of contour/color. Since six restorations showed a major chipping and/or a major occlusal roughness, the Kaplan-Meier success rate was 53.8%. However, patients' significantly improved perceptions of function, esthetics, sense, and speech at prosthetic delivery remained stable over time. Bi-layered zirconia/fluor-apatite IS-FDPs entirely survived the observation period but showed a high frequency of
Jain, Mamta K; Seremba, Emmanuel; Bhore, Rafia; Dao, Doan; Joshi, Reeti; Attar, Nahid; Yuan, He-Jun; Lee, William M
2012-02-01
Noninvasive markers of liver fibrosis, measured at baseline, have been shown to predict liver-related mortality. It remains unknown if a change in the value of the scores over time predicts mortality in patients with HIV and viral hepatitis. In this retrospective study, survival in HIV/hepatitis B virus (HBV; n = 67), HIV/hepatitis C virus (HCV; n = 43), and HIV/HBV/HCV (n = 41) patients was examined using Kaplan-Meier life table analysis. Aspartate aminotransferase (AST)-to-platelet ratio index (APRI) and FIB-4 scores, two noninvasive markers of liver fibrosis, were calculated at baseline and at last available clinical follow-up to determine the change in fibrosis score. Factors associated with mortality were assessed by Cox proportional hazards, including the change in the noninvasive marker score between the two time points. All-cause mortality was determined by Social Security Death Index and chart review. Sixty-seven were coinfected with HIV/HBV, 43 with HIV/HCV, and 41 were triply infected (HIV/HBV/HCV). Kaplan-Meier analysis showed similar survival for the three groups at 7 years of follow-up (p = 0.10). However, median length of follow-up was lower in HIV/HCV (60.5; range 0-102) compared to HIV/HBV (75.7; 12.3-126.5) and HIV/HBV/HCV (80.0; 2.7-123) months, respectively, p = 0.02. Baseline fibrosis score (p = 0.002), an increase in the value for noninvasive measurements for fibrosis (p < 0.001), and the presence of HIV/HCV coinfection (p = 0.041) were each associated with higher risk for mortality. Baseline fibrosis score (p = 0.03) and an increase in FIB-4 score (p = 0.05) were independent predictors of all-cause mortality, but liver-related mortality was not evaluated. In this study, baseline fibrosis score was predictive of 7-year all-cause mortality. Further studies are needed in a prospective cohort to evaluate the predictive value of monitoring changes in fibrosis scores over time to predict mortality in patients with viral hepatitis.
Labhardt, Niklaus Daniel; Keiser, Olivia; Sello, Motlalepula; Lejone, Thabo Ishmael; Pfeiffer, Karolin; Davies, Mary-Ann; Egger, Matthias; Ehmer, Jochen; Wandeler, Gilles
2013-11-21
Lesotho was among the first countries to adopt decentralization of care from hospitals to nurse-led health centres (HCs) to scale up the provision of antiretroviral therapy (ART). We compared outcomes between patients who started ART at HCs and hospitals in two rural catchment areas in Lesotho. The two catchment areas comprise two hospitals and 12 HCs. Patients ≥16 years starting ART at a hospital or HC between 2008 and 2011 were included. Loss to follow-up (LTFU) was defined as not returning to the facility for ≥180 days after the last visit, no follow-up (no FUP) as not returning after starting ART, and retention in care as alive and on ART at the facility. The data were analysed using logistic regression, competing risk regression and Kaplan-Meier methods. Multivariable analyses were adjusted for sex, age, CD4 cell count, World Health Organization stage, catchment area and type of ART. All analyses were stratified by gender. Of 3747 patients, 2042 (54.5%) started ART at HCs. Both women and men at hospitals had more advanced clinical and immunological stages of disease than those at HCs. Over 5445 patient-years, 420 died and 475 were LTFU. Kaplan-Meier estimates for three-year retention were 68.7 and 69.7% at HCs and hospitals, respectively, among women (p=0.81) and 68.8% at HCs versus 54.7% at hospitals among men (phospitals among women (odds ratio (OR): 0.89, 95% confidence interval (CI): 0.73-1.09) and higher retention at HCs among men (OR: 1.53, 95% CI: 1.20-1.96). The latter result was mainly driven by a lower proportion of patients LTFU at HCs (OR: 0.68, 95% CI: 0.51-0.93). In rural Lesotho, overall retention in care did not differ significantly between nurse-led HCs and hospitals. However, men seemed to benefit most from starting ART at HCs, as they were more likely to remain in care in these facilities compared to hospitals.
Energy Technology Data Exchange (ETDEWEB)
Gill, Beant; Oermann, Eric; Ju, Andrew; Suy, Simeng; Yu, Xia; Rabin, Jennifer [Department of Radiation Medicine, Georgetown University Hospital,, Washington, DC (United States); Kalhorn, Christopher; Nair, Mani N.; Voyadzis, Jean-Marc [Department of Neurosurgery, Georgetown University Hospital,, Washington, DC (United States); Unger, Keith; Collins, Sean P.; Harter, K. W.; Collins, Brian T., E-mail: collinsb@gunet.georgetown.edu [Department of Radiation Medicine, Georgetown University Hospital,, Washington, DC (United States)
2012-04-26
This retrospective analysis examines the local control and toxicity of five-fraction fiducial-free CyberKnife stereotactic body radiation therapy (SBRT) for single vertebral body (VB) metastases. All patients had favorable performance status (ECOG 0–1), oligometastatic disease, and no prior spine irradiation. A prescribed dose of 30–35 Gy was delivered in five fractions to the planning target volume (PTV) using the CyberKnife with X-sight spine tracking. Suggested maximum spinal cord and esophagus point doses were 30 and 40 Gy, respectively. A median 30 Gy (IQR, 30–35 Gy) dose was delivered to a median prescription isodose line of 70% (IQR, 65–77%) to 20 patients. At 34 months median follow-up (IQR, 25–40 months) for surviving patients, the 1- and 2-year Kaplan–Meier local control estimates were 80 and 73%, respectively. Two of the five local failures were infield in patients who had received irradiation to the gross tumor volume and three were paravertebral failures just outside the PTV in patients with prior corpectomy. No local failures occurred in patients who completed VB radiation alone. The 1- and 2-year Kaplan–Meier overall survival estimates were 80 and 57%, respectively. Most deaths were attributed to metastatic disease; one death was attributed to local recurrence. The mean maximum point doses were 26.4 Gy (SD, 5.1 Gy) to the spinal cord and 29.1 Gy (SD, 8.9 Gy) to the esophagus. Patients receiving maximum esophagus point doses greater than 35 Gy experienced acute dysphagia (Grade I/II). No spinal cord toxicity was documented. Five-fraction fiducial-free CyberKnife SBRT is an acceptable treatment option for newly diagnosed VB metastases with promising local control rates and minimal toxicity despite the close proximity of such tumors to the spinal cord and esophagus. A prospective study aimed at further enhancing local control by targeting the intact VB and escalating the total dose is planned.
Dang, Chau; Iyengar, Neil; Datko, Farrah; D'Andrea, Gabriella; Theodoulou, Maria; Dickler, Maura; Goldfarb, Shari; Lake, Diana; Fasano, Julie; Fornier, Monica; Gilewski, Theresa; Modi, Shanu; Gajria, Devika; Moynahan, Mary Ellen; Hamilton, Nicola; Patil, Sujata; Jochelson, Maxine; Norton, Larry; Baselga, Jose; Hudis, Clifford
2015-02-10
The CLEOPATRA (Clinical Evaluation of Trastuzumab and Pertuzumab) study demonstrated superior progression-free survival (PFS) and overall survival when pertuzumab was added to trastuzumab and docetaxel. Paclitaxel given once per week is effective and less toxic than docetaxel. We performed a phase II study to evaluate the efficacy and safety of pertuzumab and trastuzumab with paclitaxel given once per week. Patients with metastatic human epidermal growth factor receptor 2-positive breast cancer with zero to one prior therapy were enrolled. Treatment consisted of paclitaxel 80 mg/m(2) once per week plus trastuzumab (8 mg/kg loading dose → 6 mg/kg) once every 3 weeks plus pertuzumab (840 mg loading dose → 420 mg) once every 3 weeks, all given intravenously. The primary end point was 6-month PFS assessed by Kaplan-Meier methods. From January 2011 to December 2013, we enrolled 69 patients: 51 (74%) and 18 (26%) treated in first- and second-line metastatic settings, respectively. At a median follow-up of 21 months (range, 3 to 38 months), 6-month PFS was 86% (95% CI, 75% to 92%). The median PFS was 19.5 months (95% CI, 14 to 26 months) overall. PFS was 24.2 months (95% CI, 14 months to not reached [NR]) and 16.4 months (95% CI, 8.5 months to NR) for those without and with prior treatment, respectively. At 1 year, Kaplan-Meier PFS was 70% (95% CI, 56% to 79%) overall, 71% (95% CI, 55% to 82%) for those without prior therapy, and 66% (95% CI, 40% to 83%) for those with prior therapy. Treatment was well-tolerated; there was no febrile neutropenia or symptomatic left ventricular systolic dysfunction. Paclitaxel given once per week with trastuzumab and pertuzumab is highly active and well tolerated and seems to be an effective alternative to docetaxel-based combination therapy. © 2014 by American Society of Clinical Oncology.
Dang, Chau; Iyengar, Neil; Datko, Farrah; D'Andrea, Gabriella; Theodoulou, Maria; Dickler, Maura; Goldfarb, Shari; Lake, Diana; Fasano, Julie; Fornier, Monica; Gilewski, Theresa; Modi, Shanu; Gajria, Devika; Moynahan, Mary Ellen; Hamilton, Nicola; Patil, Sujata; Jochelson, Maxine; Norton, Larry; Baselga, Jose; Hudis, Clifford
2015-01-01
Purpose The CLEOPATRA (Clinical Evaluation of Trastuzumab and Pertuzumab) study demonstrated superior progression-free survival (PFS) and overall survival when pertuzumab was added to trastuzumab and docetaxel. Paclitaxel given once per week is effective and less toxic than docetaxel. We performed a phase II study to evaluate the efficacy and safety of pertuzumab and trastuzumab with paclitaxel given once per week. Patients and Methods Patients with metastatic human epidermal growth factor receptor 2–positive breast cancer with zero to one prior therapy were enrolled. Treatment consisted of paclitaxel 80 mg/m2 once per week plus trastuzumab (8 mg/kg loading dose → 6 mg/kg) once every 3 weeks plus pertuzumab (840 mg loading dose → 420 mg) once every 3 weeks, all given intravenously. The primary end point was 6-month PFS assessed by Kaplan-Meier methods. Results From January 2011 to December 2013, we enrolled 69 patients: 51 (74%) and 18 (26%) treated in first- and second-line metastatic settings, respectively. At a median follow-up of 21 months (range, 3 to 38 months), 6-month PFS was 86% (95% CI, 75% to 92%). The median PFS was 19.5 months (95% CI, 14 to 26 months) overall. PFS was 24.2 months (95% CI, 14 months to not reached [NR]) and 16.4 months (95% CI, 8.5 months to NR) for those without and with prior treatment, respectively. At 1 year, Kaplan-Meier PFS was 70% (95% CI, 56% to 79%) overall, 71% (95% CI, 55% to 82%) for those without prior therapy, and 66% (95% CI, 40% to 83%) for those with prior therapy. Treatment was well-tolerated; there was no febrile neutropenia or symptomatic left ventricular systolic dysfunction. Conclusion Paclitaxel given once per week with trastuzumab and pertuzumab is highly active and well tolerated and seems to be an effective alternative to docetaxel-based combination therapy. PMID:25547504
MicroRNA-224 targets ERG2 and contributes to malignant progressions of meningioma
International Nuclear Information System (INIS)
Wang, Maomao; Deng, Xiaodong; Ying, Qi; Jin, Tingyan; Li, Ming; Liang, Chong
2015-01-01
MicroRNA-224 is overexpressed in various malignant tumors with poor prognosis, which plays a critical role in biological processes including cell proliferation, apoptosis and several developmental and physiological progressions. However, the potential association between miR-224 and clinical outcome in patients with meningiomas remains unknown. Here, we investigate miR-224 expression and biological functions in meningiomas. MiR-224 expression was measured by Northern blot analysis and quantitative reverse transcription-polymerase chain reaction (qRT-PCR) in meningioma and normal brain tissues. Kaplan–Meier analysis and Cox regression analysis were used to exam its correlation with clinicopathological features and prognostic value. The biological effects of miR-224 on the cell proliferation and apoptosis in meningioma cells were examined by MTT assay and apoptosis assay. We found the expression levels of miR-224 were significantly higher in meningioma tissues than that in normal brain, positively correlated with advanced pathological grade. Kaplan–Meier analysis indicated that meningioma patients with low miR-224 expression exhibited significantly prolonged overall and recurrence-free survival. Furthermore, we demonstrated that ERG2 was an identical candidate target gene of MiR-224 in vitro. Our results indicated that downregulation of miR-224 suppressed cell growth and resulted in the enhancement of cell apoptosis through activation of the ERG2-BAK-induced apoptosis pathway. Our findings imply the miR-224 expression could predict the overall survival and recurrence-free survival of patients with meningioma and it might be a promising therapeutic target for treating malignant meningiomas. - Highlights: • MiR-224 expression is correlates with prognosis in meningioma patients. • ERG2 is a novel downstream target of miR-224. • MiR-224 suppressed cell growth and enhanced apoptosis in IOMM-Lee and CH157 cells. • MiR-224 is an upstream regulator of the ERG2
International Nuclear Information System (INIS)
Hyun, Seung Hyup; Choi, Joon Young; Lee, Kyung-Han; Eo, Jae Seon; Lee, Jeong Won; Na, Sae Jung; Hong, Il Ki; Oh, Jin Kyoung; Chung, Yong An; Song, Bong-Il; Kim, Tae-Sung; Kim, Kyung Sik; Moon, Dae Hyuk; Yun, Mijin
2016-01-01
We evaluated the prognostic value of pretreatment 18 F-fluorodeoxyglucose positron emission tomography with computed tomography (FDG PET/CT) in patients with Barcelona Clinic Liver Cancer (BCLC) stage 0 or A hepatocellular carcinoma (HCC) who had received curative treatment or transarterial chemoembolization (TACE). Between 2009 and 2010, 317 patients diagnosed with HCC at seven hospitals were enrolled. Among these, 195 patients underwent curative treatments including resection, liver transplantation, and radiofrequency ablation. TACE was performed in 122 patients. The tumor-to-normal liver standardized uptake value ratio (TLR) of the primary tumor was measured using pretreatment FDG PET/CT. The prognostic significance of TLR and other clinical variables was assessed using Cox regression models. Differences in the overall survival (OS) associated with TLR or other significant clinical factors were examined using the Kaplan-Meier method. Over a median follow-up period of 46 months, 77 patients died from cancer. In the curative cohort, higher TLR (≥2) was significantly associated with death (hazard ratio [HR] = 2.68; 95 % CI, 1.16-6.15; P = 0.020) in multivariable analysis. Patients with a higher TLR had significantly worse OS than patients with a lower TLR (5-year overall survival, 61 % vs. 79.4 %; P = 0.006). In the TACE cohort, the Model for End-Stage Liver Disease (MELD) score (≥8) was a significant independent prognostic factor for OS (HR = 3.34; 95 % CI, 1.49-7.48; P = 0.003), whereas TLR was not associated with OS. The Kaplan-Meier curves showed significantly poorer OS in patients with higher MELD scores (≥8) than in those with lower MELD scores (5-year survival rate, 33.1 % vs. 79.6 %; P < 0.001). Pretreatment TLR measured using FDG PET/CT was an independent prognostic factor for OS in patients with BCLC stage 0 or A HCC undergoing curative treatment. In contrast, underlying liver function appeared to be important in predicting the prognosis of patients
Cao, Bangrong; Luo, Liping; Feng, Lin; Ma, Shiqi; Chen, Tingqing; Ren, Yuan; Zha, Xiao; Cheng, Shujun; Zhang, Kaitai; Chen, Changmin
2017-12-13
The clinical benefit of adjuvant chemotherapy for stage II colorectal cancer (CRC) is controversial. This study aimed to explore novel gene signature to predict outcome benefit of postoperative 5-Fu-based therapy in stage II CRC. Gene-expression profiles of stage II CRCs from two datasets with 5-Fu-based adjuvant chemotherapy (training dataset, n = 212; validation dataset, n = 85) were analyzed to identify the indicator. A systemic approach by integrating gene-expression and protein-protein interaction (PPI) network was implemented to develop the predictive signature. Kaplan-Meier curves and Cox proportional hazards model were used to determine the survival benefit of adjuvant chemotherapy. Experiments with shRNA knock-down were carried out to confirm the signature identified in this study. In the training dataset, we identified 44 PPI sub-modules, by which we separate patients into two clusters (1 and 2) having different chemotherapeutic benefit. A predictor of 11 PPI sub-modules (11-PPI-Mod) was established to discriminate the two sub-groups, with an overall accuracy of 90.1%. This signature was independently validated in an external validation dataset. Kaplan-Meier curves showed an improved outcome for patients who received adjuvant chemotherapy in Cluster 1 sub-group, but even worse survival for those in Cluster 2 sub-group. Similar results were found in both the training and the validation dataset. Multivariate Cox regression revealed an interaction effect between 11-PPI-Mod signature and adjuvant therapy treatment in the training dataset (RFS, p = 0.007; OS, p = 0.006) and the validation dataset (RFS, p = 0.002). From the signature, we found that PTGES gene was up-regulated in CRC cells which were more resistant to 5-Fu. Knock-down of PTGES indicated a growth inhibition and up-regulation of apoptotic markers induced by 5-Fu in CRC cells. Only a small proportion of stage II CRC patients could benefit from adjuvant therapy. The 11-PPI-Mod as
International Nuclear Information System (INIS)
Xue Bo; Zhang Peilei; Wang Jue; Li Minghua; Zhao Jungong; Zhu Yueqi; Tan Huaqiao; Wang Jianbo
2011-01-01
Objective: To evaluate batroxobin in preventing vascular restenosis in diabetic patients after infrapopliteal arterial angioplasty through comparing the clinical results of the combination use of batroxobin and aspirin with that of simple use of aspirin. Methods: After a successful angioplasty, fifty-two diabetic patients with symptomatic infrapopliteal obstructions were randomly divided into the study group (n=26) and the control group (n=26). Patients in both groups received 100 aspirin everyday, but the patients in study group additionally received 5 IU batroxobin intravenous drip every day for six times. At the end of the follow-up period lasting for 12 months, magnetic resonance angiography (MRA) or Doppler ultrasonic angiography was performed to check the vessels to see if there was any restenosis or reocclusion. The relief degree of clinical symptoms were observed, and both preoperative and postoperative ankle-brachial index (ABI) were regularly determined and compared. Kaplan-Meier curves were constructed to evaluate restenosis/reocclusion-free rate, limb salvage rate and amputation-free rate. Results: During the follow-up period the occurrence of restenosis/reocclusion in study group and control group was 22.0% and 34.5% respectively (P=0.0307). Statistically significant difference in ABI existed between two groups both after the procedure (P<0.05) and at 12 months after the treatment (P=0.0094). Clinical improvement and tissue healing in study group and control group were observed in 23 and 19 patients respectively (P=0.0544). Twelve months after angioplasty, Kaplan-Meier analysis showed that the restenosis/reocclusion-free rate, the limb salvage rate and the amputation-free rate for study group were 74.0%, 96.2% and 84.6% respectively, while they was 54.8%, 92.3% and 84.6% respectively for control group. Conclusion: The results of this study indicate that the use of the clinical therapeutic efficacy and markedly relieve the symptoms, although this
Mortality, Causes of Death and Associated Factors Relate to a Large HIV Population-Based Cohort.
Directory of Open Access Journals (Sweden)
César Garriga
Full Text Available Antiretroviral therapy has led to a decrease in HIV-related mortality and to the emergence of non-AIDS defining diseases as competing causes of death. This study estimates the HIV mortality rate and their risk factors with regard to different causes in a large city from January 2001 to June 2013.We followed-up 3137 newly diagnosed HIV non-AIDS cases. Causes of death were classified as HIV-related, non-HIV-related and external. We examined the effect of risk factors on survival using mortality rates, Kaplan-Meier plots and Cox models. Finally, we estimated survival for each main cause of death groups through Fine and Gray models.182 deaths were found [14.0/1000 person-years of follow-up (py; 95% confidence interval (CI:12.0-16.1/1000 py], 81.3% of them had a known cause of death. Mortality rate by HIV-related causes and non-HIV-related causes was the same (4.9/1000 py; CI:3.7-6.1/1000 py, external was lower [1.7/1000 py; (1.0-2.4/1000 py].Kaplan-Meier estimate showed worse survival in intravenous drug user (IDU and heterosexuals than in men having sex with men (MSM. Factors associated with HIV-related causes of death include: IDU male (subHazard Ratio (sHR:3.2; CI:1.5-7.0 and <200 CD4 at diagnosis (sHR:2.7; CI:1.3-5.7 versus ≥500 CD4. Factors associated with non-HIV-related causes of death include: ageing (sHR:1.5; CI:1.4-1.7 and heterosexual female (sHR:2.8; CI:1.1-7.3 versus MSM. Factors associated with external causes of death were IDU male (sHR:28.7; CI:6.7-123.2 and heterosexual male (sHR:11.8; CI:2.5-56.4 versus MSM.There are important differences in survival among transmission groups. Improved treatment is especially necessary in IDUs and heterosexual males.
Hung, Kuo-Feng; Hsu, Ching-Ping; Chiang, Jen-Huai; Lin, Hung-Jen; Kuo, Yi-Ting; Sun, Mao-Feng; Yen, Hung-Rong
2017-03-06
Many patients with gastric cancer seek traditional medicine consultations in Asian countries. This study aimed to investigate the prescription of Chinese herbal medicine (CHM) and its benefits for the patients with gastric cancer in Taiwan. From the Registry for Catastrophic Illness Patients Database, we included all patients with gastric cancer whose age at diagnosis was ≥18 from 1997 to 2010 in Taiwan. We used 1:1 frequency matching by age, sex, Charlson comorbidity score, treatment and index year to compare the CHM users and non-CHM users. We used the Cox regression model to compare the hazard ratios (HR) for the risk of mortality and the Kaplan-Meier curve for the survival time. There was a total of 1333 patients in the CHM-cohort and 44786 patients in the non-CHM cohort. After matching, we compared 962 newly diagnosed CHM users and 962 non-CHM users. Adjusted HRs (aHR) were higher among patients of above 60-year-old group, with a Charlson Comorbidity Index score ≥2 before the index date, and those who need surgery combined with chemotherapy or radiotherapy. CHM users had a lower HR of mortality risk (adjusted HR: 0.55, 95% CI: 0.48-0.62). Compared to the non-CHM users, the aHR among CHM-users is 0.37 (95% CI:0.2-0.67) for those who used CHM more than 180 days annually. The Kaplan-Meier curve revealed that the survival probability was higher for complementary CHM-users. Bai-Hua-She-She-Cao (Herba Hedyotidis Diffusae) was the most commonly used single herb and Xiang-Sha-Liu-Jun-Zi-Tang was the most commonly used herbal formula among CHM prescriptions. Complementary CHM improves the overall survival among patients with gastric cancer in Taiwan. Further ethnopharmacological investigations and clinical trials are required to validate the efficacy and safety. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.
Spiess, Philippe E; Levy, David A; Mouraviev, Vladimir; Pisters, Louis L; Jones, J Stephen
2013-08-01
What's known on the subject? and what does the study add?: Previous studies have identified the most important prognostic factors of the likely outcomes of salvage prostate whole-gland ablation, including initial clinical stage, biopsy Gleason score, and PSA (total and doubling time). There is potential for further optimization of candidate selection for salvage cryoablation with curative intent and nadir PSA achieved after whole-gland cryotherapy may provide additional prognostic value. The study shows that the most important prognostic factors of biochemical progression-free survival for patients who have undergone whole-gland salvage prostate cryotherapy are nadir PSA achieved after therapy and pre-therapy biopsy Gleason score. Based on these two prognostic variables, we have identified risk stratification groups (low, intermediate and high) which help predict the expected outcomes of salvage whole-gland prostate cryotherapy in a given patient. This risk stratification constitutes a useful clinical tool in defining which patients maybe best suited for this local salvage treatment method. To assess the prognostic variables predicting the risk of biochemical progression-free survival (bPFS) after salvage prostate whole-gland cryotherapy using the Phoenix definition of bPFS. A total of 132 patients underwent prostate whole-gland salvage cryotherapy with curative intent. No patient underwent neoadjuvant/adjuvant hormonal ablative therapy, and all had extended post-salvage prostate-specific antigen (PSA) follow-up data. Cox univariate and multivariate logistic regression analyses of potential predictors of bPFS were conducted. Kaplan-Meier analyses of bPFS was also performed. At a mean (range) follow-up of 4.3 (0.9-12.7) years, the median (range) post-cryotherapy nadir PSA achieved was 0.17 (0-33.9) ng/mL. On multivariate analysis, predictors of bPFS were nadir PSA post-cryotherapy and pre-salvage biopsy Gleason score (P 2.5 ng/mL or biopsy Gleason score ≥ 7, with
Directory of Open Access Journals (Sweden)
Strazzullo Viviana
2006-12-01
Full Text Available Abstract Background A large number of renal cancer patients shows poor or partial response to chemotherapy and the mechanisms have not been still understood. Multi-drug resistance is the principal mechanism by which many cancers develop resistance to chemotherapic drugs. The role of the multi-drug resistant transporter (MDR-1/P-glycoprotein, the gene product of MDR-1, and that one of the so-called multi-drug resistance associated protein (MRP, two energy-dependent efflux pumps, are commonly known to confer drug resistance. We studied MDR-1 expression in selected cases of renal cell carcinoma (RCC, clear cell type, with long-term follow-up, in order to establish its prognostic role and its possible contribution in the choice of post-surgical therapy. Methods MDR-1 has been studied by standard LSAB-HRP immunohistochemical technique, in paraffin embedded RCC samples. Protein expression has been compared to clinical and histopathological data and to disease specific survival of RCC patients, by Kaplan-Meier curve and Cox multivariate regression analyses. Results Two groups of RCCs were obtained by esteeming MDR-1 expression and disease specific survival (obtained with Kaplan-Meier curve and Cox multivariate regression analyses: the first one presents low or absent MDR-1 expression and good survival; the second one is characterized by high MDR-1 expression and significant poor outcome (p p p p Conclusion In our opinion, the results of this study well prove the relationship between MDR-1 expression and worse clinical prognosis in RCC, because MDR-1 over-expressing RCCs can be considered a group of tumours with a more aggressive behavior. This finding outlines a possible role of MDR-1 as prognostic factor, dependent and independent of multidrug resistance. These results could be useful to predict cancer evolution and to choose the appropriate treatment: this is another step that can stimulate further promising and interesting investigations on broader
Hyperfractionation in carcinoma of the cervix: tumor control and late bowel complications
International Nuclear Information System (INIS)
Viswanathan, Faith Rangad; Varghese, Cherian; Peedicayil, Abraham; Lakshmanan, Jeyaseelan; Narayan, Viswanathan Perungulam
1999-01-01
Purpose: Hyperfractionation has been advocated to improve local tumor control by increasing radiation dose without increasing late normal tissue complications. The aim of this study was to determine if hyperfractionation decreased late bowel complications. Methods and Materials: Thirty patients with Stage II and III cervical cancer were randomized to receive either hyperfractionation or conventional fractionation. Patients were followed for 5 years and monitored for tumor control, recurrence, and bowel complications. The relative risks of tumor control and bowel complications were computed at 1 year and 5 years of follow-up. Kaplan-Meier survival curves were plotted to determine probabilities of being tumor-free and bowel complication-free. Results: There were 15 patients in each group. At 1 year of follow-up, 2 patients in the hyperfractionation group (13%) and 7 patients in the conventional treatment group (45%) had tumor (relative risk [RR] 0.3; 95% confidence interval [CI] 0.1, 1.1; p = 0.054). Delayed bowel complications were seen in 8 patients in the hyperfractionation group and 1 patient in the conventional treatment group (RR 7.5; 95% CI 1.1, 52; p = 0.014). At 5 years, 2 patients in the hyperfractionation group and 8 patients in the conventional treatment group had tumor (RR 0.3; 95% CI 0.1, 1.1; p = 0.04). Delayed bowel complications (Grades 2 and 3) occurred in 9 women in the hyperfractionation group and 2 patients in the conventional group (RR 5.4; 95% CI 1.5, 19.5; p 0.0006). Kaplan-Meier analysis showed that the hyperfractionation group had significantly more bowel complications over the 5 years of follow-up (p 0.024). Conclusion: Hyperfractionation may result in better tumor control both at 1 year and at 5 years following treatment of cervical cancer. However, hyperfractionation could lead to increased late bowel complications and must be used judiciously in the treatment of cervical cancer
International Nuclear Information System (INIS)
Scarsbrook, Andrew; Vaidyanathan, Sriram; Chowdhury, Fahmid; Patel, Chirag; Swift, Sarah; Cooper, Rachel
2017-01-01
To evaluate the utility of a standardized qualitative scoring system for treatment response assessment at 18F-FDG PET-CT in patients undergoing chemoradiotherapy for locally advanced cervical carcinoma and correlate this with subsequent patient outcome. Ninety-six consecutive patients with locally advanced cervical carcinoma treated with radical chemoradiotherapy (CRT) in a single centre between 2011 and 2014 underwent 18F-FDG PET-CT approximately 3 months post-treatment. Tumour metabolic response was assessed qualitatively using a 5-point scale ranging from background level activity only through to progressive metabolic disease. Clinical and radiological (MRI pelvis) follow-up was performed in all patients. Progression-free (PFS) and overall survival (OS) was calculated using the Kaplan-Meier method (Mantel-Cox log-rank) and correlated with qualitative score using Chi-squared test. Forty patients (41.7 %) demonstrated complete metabolic response (CMR) on post-treatment PET-CT (Score 1/2) with 38 patients (95.0 %) remaining disease free after a minimum follow-up period of 18 months. Twenty-four patients (25.0 %) had indeterminate residual uptake (ID, Score 3) at primary or nodal sites after treatment, of these eight patients (33.3 %) relapsed on follow-up, including all patients with residual nodal uptake (n = 4). 11 of 17 patients (64.7 %) with significant residual uptake (partial metabolic response, PMR, Score 4) subsequently relapsed. In 15 patients (15.6 %) PET-CT demonstrated progressive disease (PD, Score 5) following treatment. Kaplan-Meier analysis showed a highly statistically significant difference in PFS and OS between patients with CMR, indeterminate uptake, PMR and PD (Log-rank, P < 0.0001). Chi-squared test demonstrated a highly statistically significant association between increasing qualitative score and risk of recurrence or death (P < 0.001). Use of a 5-point qualitative scoring system to assess metabolic response to CRT in locally advanced
International Nuclear Information System (INIS)
Huang, Wei; Liu, Bo; Fan, Min; Zhou, Tao; Fu, Zheng; Zhang, Zicheng; Li, Hongsheng; Li, Baosheng
2015-01-01
Highlights: •The patients underwent the second FDG PET during the early stage of concurrent chemoradiotherapy (CCRT). •To our knowledge, this could be the first study showing that the repeated FDG PET during the early stage of CCRT has added value by being a prognostic factor for recurrence of the locally advanced NSCLC patients. •This is a result of continuous research. •The decrease of MTV was the only significant risk factor for recurrence. -- Abstract: Purpose: The aim of this study is to investigate the value of [ 18 F] fluorodeoxyglucose positron emission tomography/computed tomography ( 18 F FDG PET/CT) to predict recurrence of patients with locally advanced non-small cell lung cancer (NSCLC) during the early stage of concurrent chemoradiotherapy (CCRT). Methods: A total of 53 stage III NSCLC patients without diabetics or undergoing surgery were enrolled in the prospective study. Those patients were evaluated by FDG PET before and following 40 Gy radiotherapy (RT) with a concurrent cisplatin-based heterogeneous chemotherapy regimen. Semiquantitative assessment was used to determine maximum and mean SUVs (SUVmax/SUVmean) and metabolic tumor volume (MTV) of the primary tumor. The prognostic significance of PET/CT parameters and other clinical variables was assessed using Cox regression analyses. The cutoffs of PET/CT parameters which have been determined by the previous study were used to separate the groups with Kaplan–Meier curves. Results: Recurrence rates at 1- and 2-years were 18.9% (10/53) and 50.9% (27/53) for all patients, respectively. Cox regression analysis showed that the only prognostic factor for recurrence was a decrease of MTV. Using the cutoff of 29.7%, a decrease of MTV can separate the patients into 2 groups with Kaplan–Meier curve successfully. Conclusion: The prospective study has reinforced the early predictive value of MTV in repeated 18 F-FDG PET/CT for recurrence in a subgroup of locally advanced NSCLC who underwent CCRT. A
Graft survival rate of renal transplantation during a period of 10 years in Iran
Directory of Open Access Journals (Sweden)
Fatemeh Shahbazi
2015-01-01
Full Text Available Background: Kidney transplantation is a preferred treatment for many patients with end-stage renal disease (ESRD and is far more profitable than hemodialysis. Analyzing renal transplantation data can help to evaluate the effectiveness of transplantation interventions. The aim of this study was to determine the organ survival rate after kidney transplantation during a period of 10 years (March 2001-March 2011 among transplanted patients in Arak, Markazi Province, Iran. Materials and Methods: In this historical cohort study, all recipients of kidney transplantation from Arak, Markazi Province, Iran who had medical records in Valiasr Hospital and "charity for kidney patients" of Arak, Markazi Province, Iran during a period of 10 years from March 2001 to March 2011 were included. Data collected by using checklists were completed from patients′ hospital records. Kaplan-Meier method was used to determine the graft cumulative survival rate, log-rank test to compare survival curves in subgroups, and Cox regression model to define the hazard ratio and for ruling out the intervening factors. Statistical analysis was conducted by Statistical Package for the Social Sciences (SPSS 20 and Stata 11. Results: Mean duration of follow-up was 55.43 ± 42.02 months. By using the Kaplan-Meier method, the cumulative probability of graft survival at 1, 3, 5, 7, and 10 years was 99.1, 97.7, 94.3, 85.7, and 62.1%, respectively. The number of dialysis by controlling the effect of other variables had a significant association with the risk of graft failure [hazard ratios and 95% confidence interval (CI: 1.47 (1.02-2.13]. Conclusion: This study showed that the graft survival rate was satisfactory in this community and was similar to the results of single-center studies in the world. Dialysis time after transplantation was a significant predictor of survival in the recipients of kidney transplantation that should be considered.
Energy Technology Data Exchange (ETDEWEB)
Scarsbrook, Andrew [Leeds Teaching Hospitals NHS Trust, Department of Radiology, Leeds (United Kingdom); Leeds Teaching Hospitals NHS Trust, Department of Nuclear Medicine, Level 1, Bexley Wing, St James' s University Hospital, Leeds (United Kingdom); University of Leeds, Leeds Institute of Cancer and Pathology, Leeds (United Kingdom); Vaidyanathan, Sriram; Chowdhury, Fahmid; Patel, Chirag [Leeds Teaching Hospitals NHS Trust, Department of Radiology, Leeds (United Kingdom); Leeds Teaching Hospitals NHS Trust, Department of Nuclear Medicine, Level 1, Bexley Wing, St James' s University Hospital, Leeds (United Kingdom); Swift, Sarah [Leeds Teaching Hospitals NHS Trust, Department of Radiology, Leeds (United Kingdom); Cooper, Rachel [Leeds Teaching Hospitals NHS Trust, Department of Clinical Oncology, Leeds (United Kingdom)
2017-04-15
To evaluate the utility of a standardized qualitative scoring system for treatment response assessment at 18F-FDG PET-CT in patients undergoing chemoradiotherapy for locally advanced cervical carcinoma and correlate this with subsequent patient outcome. Ninety-six consecutive patients with locally advanced cervical carcinoma treated with radical chemoradiotherapy (CRT) in a single centre between 2011 and 2014 underwent 18F-FDG PET-CT approximately 3 months post-treatment. Tumour metabolic response was assessed qualitatively using a 5-point scale ranging from background level activity only through to progressive metabolic disease. Clinical and radiological (MRI pelvis) follow-up was performed in all patients. Progression-free (PFS) and overall survival (OS) was calculated using the Kaplan-Meier method (Mantel-Cox log-rank) and correlated with qualitative score using Chi-squared test. Forty patients (41.7 %) demonstrated complete metabolic response (CMR) on post-treatment PET-CT (Score 1/2) with 38 patients (95.0 %) remaining disease free after a minimum follow-up period of 18 months. Twenty-four patients (25.0 %) had indeterminate residual uptake (ID, Score 3) at primary or nodal sites after treatment, of these eight patients (33.3 %) relapsed on follow-up, including all patients with residual nodal uptake (n = 4). 11 of 17 patients (64.7 %) with significant residual uptake (partial metabolic response, PMR, Score 4) subsequently relapsed. In 15 patients (15.6 %) PET-CT demonstrated progressive disease (PD, Score 5) following treatment. Kaplan-Meier analysis showed a highly statistically significant difference in PFS and OS between patients with CMR, indeterminate uptake, PMR and PD (Log-rank, P < 0.0001). Chi-squared test demonstrated a highly statistically significant association between increasing qualitative score and risk of recurrence or death (P < 0.001). Use of a 5-point qualitative scoring system to assess metabolic response to CRT in locally advanced
Directory of Open Access Journals (Sweden)
Wan-Chen Yu
Full Text Available We evaluated effects of the interrelationship between physical disability and cognitive impairment on long-term mortality of men aged 80 years and older living in a retirement community in Taiwan.This prospective cohort study enrolled older men aged 80 and older living in a Veterans Care Home. Those with confirmed diagnosis of dementia were excluded. All participants received comprehensive geriatric assessment, including sociodemographic data, Charlson's Comorbidity Index (CCI, geriatric syndromes, activities of daily living (ADL using the Barthel index and cognitive function using the Mini-Mental State Examination (MMSE. Subjects were categorized into normal cognitive function, mild cognitive deterioration, and moderate-to-severe cognitive impairment and were further stratified by physical disability status. Kaplan-Meier log-rank test was used for survival analysis. After adjusting for sociodemographic characteristics and geriatric syndromes, Cox proportional hazards model was constructed to examine associations between cognitive function, disability and increased mortality risk.Among 305 male subjects aged 85.1 ± 4.1 years, 89 subjects died during follow-up (mean follow-up: 1.87 ± 0.90 years. Kaplan-Meier unadjusted analysis showed reduced survival probability associated with moderate-to-severe cognitive status and physical disability. Mortality risk increased significantly only for physically disabled subjects with simultaneous mild cognitive deterioration (adjusted HR 1.951, 95% CI 1.036-3.673, p = 0.038 or moderate-to-severe cognitive impairment (aHR 2.722, 95% CI 1.430-5.181, p = 0.002 after adjusting for age, BMI, education levels, smoking status, polypharmacy, visual and hearing impairment, urinary incontinence, fall history, depressive symptoms and CCI. Mortality risk was not increased among physically independent subjects with or without cognitive impairment, and physically disabled subjects with intact cognition.Physical disability
Yu, Wan-Chen; Chou, Ming-Yueh; Peng, Li-Ning; Lin, Yu-Te; Liang, Chih-Kuang; Chen, Liang-Kung
2017-01-01
We evaluated effects of the interrelationship between physical disability and cognitive impairment on long-term mortality of men aged 80 years and older living in a retirement community in Taiwan. This prospective cohort study enrolled older men aged 80 and older living in a Veterans Care Home. Those with confirmed diagnosis of dementia were excluded. All participants received comprehensive geriatric assessment, including sociodemographic data, Charlson's Comorbidity Index (CCI), geriatric syndromes, activities of daily living (ADL) using the Barthel index and cognitive function using the Mini-Mental State Examination (MMSE). Subjects were categorized into normal cognitive function, mild cognitive deterioration, and moderate-to-severe cognitive impairment and were further stratified by physical disability status. Kaplan-Meier log-rank test was used for survival analysis. After adjusting for sociodemographic characteristics and geriatric syndromes, Cox proportional hazards model was constructed to examine associations between cognitive function, disability and increased mortality risk. Among 305 male subjects aged 85.1 ± 4.1 years, 89 subjects died during follow-up (mean follow-up: 1.87 ± 0.90 years). Kaplan-Meier unadjusted analysis showed reduced survival probability associated with moderate-to-severe cognitive status and physical disability. Mortality risk increased significantly only for physically disabled subjects with simultaneous mild cognitive deterioration (adjusted HR 1.951, 95% CI 1.036-3.673, p = 0.038) or moderate-to-severe cognitive impairment (aHR 2.722, 95% CI 1.430-5.181, p = 0.002) after adjusting for age, BMI, education levels, smoking status, polypharmacy, visual and hearing impairment, urinary incontinence, fall history, depressive symptoms and CCI. Mortality risk was not increased among physically independent subjects with or without cognitive impairment, and physically disabled subjects with intact cognition. Physical disability is a major
Energy Technology Data Exchange (ETDEWEB)
Trovo, Marco, E-mail: marcotrovo33@hotmail.com [Department of Radiation Oncology, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Minatel, Emilio; Durofil, Elena [Department of Radiation Oncology, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Polesel, Jerry [Department of Epidemiology and Biostatistics, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Avanzo, Michele [Department of Medical Physics, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Baresic, Tania [Department of Nuclear Medicine, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Bearz, Alessandra [Department of Medical Oncology, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Del Conte, Alessandro [Department of Medical Oncology, Pordenone General Hospital, Aviano, Pordenone (Italy); Franchin, Giovanni; Gobitti, Carlo; Rumeileh, Imad Abu; Trovo, Mauro G. [Department of Radiation Oncology, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy)
2014-04-01
Purpose: To retrospectively assess toxicity and outcome of re-irradiation with stereotactic body radiation therapy (SBRT) in patients with recurrent or persistent non-small cell lung cancer (NSCLC), who were previously treated with radical radiation therapy (50-60 Gy). The secondary endpoint was to investigate whether there are dosimetric parameter predictors of severe radiation toxicity. Methods and Materials: The analysis was conducted in 17 patients with “in-field” recurrent/persistent centrally located NSCLC, who underwent re-irradiation with SBRT. SBRT consisted of 30 Gy in 5 to 6 fractions; these prescriptions would be equivalent for the tumor to 37.5 to 40 Gy, bringing the total 2-Gy-per-fraction cumulative dose to 87 to 100 Gy, considering the primary radiation therapy treatment. Actuarial analyses and survival were calculated by the Kaplan-Meier method, and P values were estimated by the log-rank test, starting from the date of completion of SBRT. Dosimetric parameters from the subgroups with and without grade ≥3 pulmonary toxicity were compared using a 2-tailed Student t test. Results: The median follow-up was 18 months (range, 4-57 months). Only 2 patients had local failure, corresponding to a local control rate of 86% at 1 year. The Kaplan-Meier estimates of overall survival (OS) rates at 1 and 2 years were 59% and 29%, respectively; the median OS was 19 months. Four patients (23%) experienced grade 3 radiation pneumonitis, and 1 patient developed fatal pneumonitis. One patient died of fatal hemoptysis 2 months after the completion of SBRT. Unexpectedly, heart maximum dose, D5 (minimum dose to at least 5% of the heart volume), and D10 were correlated with risk of radiation pneumonitis (P<.05). Conclusions: Re-irradiation with SBRT for recurrent/persistent centrally located NSCLC achieves excellent results in terms of local control. However, the high rate of severe toxicity reported in our study is of concern.
Energy Technology Data Exchange (ETDEWEB)
Young, M; Craft, D [Massachusetts General Hospital and Harvard Medical School, Boston, MA (United States)
2016-06-15
Purpose: To develop an efficient, pathway-based classification system using network biology statistics to assist in patient-specific response predictions to radiation and drug therapies across multiple cancer types. Methods: We developed PICS (Pathway Informed Classification System), a novel two-step cancer classification algorithm. In PICS, a matrix m of mRNA expression values for a patient cohort is collapsed into a matrix p of biological pathways. The entries of p, which we term pathway scores, are obtained from either principal component analysis (PCA), normal tissue centroid (NTC), or gene expression deviation (GED). The pathway score matrix is clustered using both k-means and hierarchical clustering, and a clustering is judged by how well it groups patients into distinct survival classes. The most effective pathway scoring/clustering combination, per clustering p-value, thus generates various ‘signatures’ for conventional and functional cancer classification. Results: PICS successfully regularized large dimension gene data, separated normal and cancerous tissues, and clustered a large patient cohort spanning six cancer types. Furthermore, PICS clustered patient cohorts into distinct, statistically-significant survival groups. For a suboptimally-debulked ovarian cancer set, the pathway-classified Kaplan-Meier survival curve (p = .00127) showed significant improvement over that of a prior gene expression-classified study (p = .0179). For a pancreatic cancer set, the pathway-classified Kaplan-Meier survival curve (p = .00141) showed significant improvement over that of a prior gene expression-classified study (p = .04). Pathway-based classification confirmed biomarkers for the pyrimidine, WNT-signaling, glycerophosphoglycerol, beta-alanine, and panthothenic acid pathways for ovarian cancer. Despite its robust nature, PICS requires significantly less run time than current pathway scoring methods. Conclusion: This work validates the PICS method to improve
Martínez-Pastor, Juan C.; Muñoz-Mahamud, Ernesto; Vilchez, Félix; García-Ramiro, Sebastián; Bori, Guillem; Sierra, Josep; Martínez, José A.; Font, Lluis; Mensa, Josep; Soriano, Alex
2009-01-01
The aim of our study was to evaluate the outcome of acute prosthetic joint infections (PJIs) due to gram-negative bacilli (GNB) treated without implant removal. Patients with an acute PJI due to GNB diagnosed from 2000 to 2007 were prospectively registered. Demographics, comorbidity, type of implant, microbiology data, surgical treatment, antimicrobial therapy, and outcome were recorded. Classification and regression tree analysis, the Kaplan-Meier survival method, and the Cox regression model were applied. Forty-seven patients were included. The mean age was 70.7 years, and there were 15 hip prostheses and 32 knee prostheses. The median number of days from the time of arthroplasty was 20. The most frequent pathogens were members of the Enterobacteriaceae family in 41 cases and Pseudomonas spp. in 20 cases. Among the Enterobacteriaceae, 14 were resistant to ciprofloxacin, while all Pseudomonas aeruginosa isolates were susceptible to ciprofloxacin. The median durations of intravenous and oral antibiotic treatment were 14 and 64 days, respectively. A total of 35 (74.5%) patients were in remission after a median follow-up of 463 days (interquartile range, 344 to 704) days. By use of the Kaplan-Meier survival curve, a C-reactive protein (CRP) concentration of ≤15 mg/dl (P = 0.03) and receipt of a fluoroquinolone, when all GNB isolated were susceptible (P = 0.0009), were associated with a better outcome. By use of a Cox regression model, a CRP concentration of ≤15 mg/dl (odds ratio [OR], 3.57; 95% confidence interval [CI], 1.05 to 12.5; P = 0.043) and receipt of a fluoroquinolone (OR, 9.09; 95% CI, 1.96 to 50; P = 0.005) were independently associated with better outcomes. Open debridement without removal of the implant had a success rate of 74.5%, and the factors associated with good prognosis were a CRP concentration at the time of diagnosis ≤15 mg/dl and treatment with a fluoroquinolone. PMID:19687237
Results of revision anterior shoulder stabilization surgery in adolescent athletes.
Blackman, Andrew J; Krych, Aaron J; Kuzma, Scott A; Chow, Roxanne M; Camp, Christopher; Dahm, Diane L
2014-11-01
The purpose of this study was to determine failure rates, functional outcomes, and risk factors for failure after revision anterior shoulder stabilization surgery in high-risk adolescent athletes. Adolescent athletes who underwent primary anterior shoulder stabilization were reviewed. Patients undergoing subsequent revision stabilization surgery were identified and analyzed. Failure rates after revision surgery were assessed by Kaplan-Meier analysis. Failure was defined as recurrent instability requiring reoperation. Functional outcomes included the Marx activity score; American Shoulder and Elbow Surgeons score; and University of California, Los Angeles score. The characteristics of patients who required reoperation for recurrent instability after revision surgery were compared with those of patients who required only a single revision to identify potential risk factors for failure. Of 90 patients who underwent primary anterior stabilization surgery, 15 (17%) had failure and underwent revision surgery (mean age, 16.6 years; age range, 14 to 18 years). The mean follow-up period was 5.5 years (range, 2 to 12 years). Of the 15 revision patients, 5 (33%) had recurrent dislocations and required repeat revision stabilization surgery at a mean of 50 months (range, 22 to 102 months) after initial revision. No risk factors for failure were identified. The Kaplan-Meier reoperation-free estimates were 86% (95% confidence interval, 67% to 100%) at 24 months and 78% (95% confidence interval, 56% to 100%) at 48 months after revision surgery. The mean final Marx activity score was 14.8 (range, 5 to 20); American Shoulder and Elbow Surgeons score, 82.1 (range, 33 to 100); and University of California, Los Angeles score, 30.8 (range, 16 to 35). At 5.5 years' follow-up, adolescent athletes had a high failure rate of revision stabilization surgery and modest functional outcomes. We were unable to convincingly identify specific risk factors for failure of revision surgery. Level IV
The long-term outcomes of epilepsy surgery
Keller, Simon; Nicolson, Andrew; Biswas, Shubhabrata; Smith, David; Osman Farah, Jibril; Eldridge, Paul; Wieshmann, Udo
2018-01-01
Objective Despite modern anti-epileptic drug treatment, approximately 30% of epilepsies remain medically refractory and for these patients, epilepsy surgery may be a treatment option. There have been numerous studies demonstrating good outcome of epilepsy surgery in the short to median term however, there are a limited number of studies looking at the long-term outcomes. The aim of this study was to ascertain the long-term outcome of resective epilepsy surgery in a large neurosurgery hospital in the U.K. Methods This a retrospective analysis of prospectively collected data. We used the 2001 International League Against Epilepsy (ILAE) classification system to classify seizure freedom and Kaplan-Meier survival analysis to estimate the probability of seizure freedom. Results We included 284 patients who underwent epilepsy surgery (178 anterior temporal lobe resections, 37 selective amygdalohippocampectomies, 33 temporal lesionectomies, 36 extratemporal lesionectomies), and had a prospective median follow-up of 5 years (range 1–27). Kaplan-Meier estimates showed that 47% (95% CI 40–58) remained seizure free (apart from simple partial seizures) at 5 years and 38% (95% CI 31–45) at 10 years after surgery. 74% (95% CI 69–80) had a greater than 50% seizure reduction at 5 years and 70% (95% CI 64–77) at 10 years. Patients who had an amygdalohippocampectomy were more likely to have seizure recurrence than patients who had an anterior temporal lobe resection (p = 0.006) and temporal lesionectomy (p = 0.029). There was no significant difference between extra temporal and temporal lesionectomies. Hippocampal sclerosis was associated with a good outcome but declined in relative frequency over the years. Conclusion The vast majority of patients who were not seizure free experienced at least a substantial and long-lasting reduction in seizure frequency. A positive long-term outcome after epilepsy surgery is possible for many patients and especially those with
Outcome of endovascular treatment in symptomatic intracranial vascular stenosis
Energy Technology Data Exchange (ETDEWEB)
Suh, Dae Chul; Kim, Sang Joon; Lee, Duk Hee; Kim, Won; Choi, Choong Gon; Lee, Jeong Hyun; Kwon, Sun Uck; Kim, Jong Sung [Asan Medical Center, University of Ulsan College of Medicine, Seoul (Korea, Republic of); Kim, Hyun Jeong [Daejeon Catholic Hospital, Daejeon (Korea, Republic of)
2005-03-15
The outcome evaluation for the revascularization of intracranial vascular stenoses has not been fully described due to the highly technical nature of the procedure. We report here on the early and late clinical outcome of angioplasty and/or stenting of symptomatic severe intracranial vascular stenoses at a single institute. Since 1995, we have treated 35 patients with symptomatic intracranial vascular stenosis (more than 70% stenosis, mean stenosis: 78.6% {+-} 6.2%). Angioplasty (n = 19) was performed for the horizontal segment of the middle cerebral artery (M1) (n = 16) and the basilar artery (BA) (n = 1), the intradural vertebral artery (VA) (n = 1), and the cavernous internal carotid artery (ICA) (n = 1). Stenting (n = 16) was performed for the cavernous or petrous ICAs (n = 9), the intradural VA (n = 3), BA (n = 2), and M1 (n = 2) artery. We assessed the angiographic success (defined as residual stenosis < 50%) rate, the periprocedural complications during the 30-day periprocedural period, the symptomatic recurrence and restenosis during a mean 22-month follow-up (FU) period. The Kaplan-Meier estimate of the cumulative even-free rate of the major cerebrovascular events, i.e. death, stroke or restenosis, was also done. Angiographic success was achieved in 97% of our patients (34/35). There were four procedure-related complications (11%) including a death and a minor stroke. During the mean 22-month FU, the asymptomatic restenosis rate was 9% and the symptomatic restenosis rate was 6% in the target lesion and 9% in all the vascular territories. The Kaplan-Meier estimate was 70.6% (95% confidence interval = 46.5-94.7) after 33 month of FU. In addition to a high angiographic success rate and an acceptable periprocedural complication rate, intracranial angioplasty and/or stenting revealed a relatively low symptomatic recurrence rate. Hemorrhage is a rare, but the physician must aware that potentially fatal periprocedural complications can occur.
Timaran, C H; Stevens, S L; Freeman, M B; Goldman, M H
2001-12-01
Iliac artery angioplasty (IAA) is an effective adjunct when combined with infrainguinal arterial reconstructions (IARs) in appropriate patients with multilevel occlusive disease. However, the effect of iliac artery stenting (IAS) on the outcome of patients undergoing distal bypass procedures is not defined. The purpose of this study was to estimate the influence of previous IAS for iliac occlusive disease on the outcome of IARs, compared with those after IAA alone or aortofemoral bypass grafting procedures (AFBs). During a 5-year period (1995-2000), 105 patients with previous intervention for iliac occlusive disease underwent 120 IARs. The criteria prepared by the Ad Hoc Committee on Reporting Standards (Society for Vascular Surgery/International Society for Cardiovascular Surgery) were followed to define the variables. The TransAtlantic Inter-Society Consensus classification was used to characterize the type of iliac lesions. Univariate (Kaplan-Meier) and multivariate analyses (Cox proportional hazards model) were used to determine the association between preoperative variables and cumulative primary patency. Forty-five IARs were performed in patients with an earlier IAS repair, 33 in patients with an earlier IAA repair, and 42 in patients with an earlier AFB repair. There were not significant differences between patients in the IAS and IAA groups, except for a more frequent use of polytetrafluoroethylene grafts for IARs in the IAS group (40% vs 15%; chi(2) test, P = .03). The 5-year primary patency rate for IARs was 68% in the IAS group, 46% in the IAA group, and 61% in the AFB group. Univariate analyses revealed that primary patency rates for IARs in patients with previous IAS were significantly higher than those in the IAA group (Kaplan-Meier, log-rank test, P = .02). Previous IAA repair was associated with a two-fold increased risk of IAR graft failure (relative risk, 2.2; 95% CI, 1.1-4.8; P = .04). IARs in patients with previous IAS have significantly
DEFF Research Database (Denmark)
Møller, Henrik; Coupland, Victoria H; Tataru, Daniela
2018-01-01
INTRODUCTION: Lung cancer outcomes in England are inferior to comparable countries. Patient or disease characteristics, healthcare-seeking behaviour, diagnostic pathways, and oncology service provision may contribute. We aimed to quantify associations between geographic variations in treatment...... and survival of patients in England. METHODS: We retrieved detailed cancer registration data to analyse the variation in survival of 176,225 lung cancer patients, diagnosed 2010-2014. We used Kaplan-Meier analysis and Cox proportional hazards regression to investigate survival in the two-year period following...... diagnosis. RESULTS: Survival improved over the period studied. The use of active treatment varied between geographical areas, with inter-quintile ranges of 9%-17% for surgical resection, 4%-13% for radical radiotherapy, and 22%-35% for chemotherapy. At 2 years, there were 188 potentially avoidable deaths...
PAM50 breast cancer intrinsic subtypes and effect of gemcitabine in advanced breast cancer patients
DEFF Research Database (Denmark)
Jørgensen, Charlotte Levin Tykjær; Nielsen, Torsten O; Bjerre, Karsten D
2014-01-01
BACKGROUND: In vitro studies suggest basal breast cancers are more sensitive to gemcitabine relative to other intrinsic subtypes. The main objective of this study was to use specimens from a randomized clinical trial to evaluate whether the basal-like subtype identifies patients with advanced...... breast cancer who benefit from gemcitabine plus docetaxel (GD) compared to single agent docetaxel (D). MATERIAL AND METHODS: From patients randomly assigned to GD or D, RNA was isolated from archival formalin-fixed, paraffin-embedded primary breast tumor tissue and used for PAM50 intrinsic subtyping...... chemotherapy were analyzed by the Kaplan-Meier method, and Cox proportional hazards regression models. Data analysis was performed independently by the Danish Breast Cancer Cooperative Group (DBCG) statistical core and all statistical tests were two-sided. RESULTS: RNA from 270 patients was evaluable; 84...
DEFF Research Database (Denmark)
Kongsted, Per; Svane, Inge M; Lindberg, Henriette
2016-01-01
To compare treatment outcomes in patients with metastatic castration-resistant prostate cancer treated with cabazitaxel (CA) as second-line or third-line therapy in the everyday clinical setting. Charts from 94 patients treated with CA as second-line (n=28) or third-line therapy (n=66) were...... evaluated. Common Terminology Criteria for Adverse Events were used to register grade 3-4 nonhematological toxicity during treatment with CA. Baseline metastatic castration-resistant prostate cancer-related prognostic factors, duration of therapy, and maximum prostate-specific antigen (PSA) percentage...... change were registered during treatment with CA and previous/subsequent novel androgen receptor targeting therapies. Progression-free survival (PFS) and overall survival (OS) were calculated using the Kaplan-Meier method. A median of 6 versus 5 treatment cycles was administered in patients treated...
A nationwide study of serous “borderline” ovarian tumors in Denmark 1978–2002
DEFF Research Database (Denmark)
Hannibal, Charlotte Gerd; Vang, Russell; Junge, Jette
2014-01-01
OBJECTIVE: To describe the study population and estimate overall survival of women with a serous "borderline" ovarian tumor (SBT) in Denmark over 25 years relative to the general population. METHODS: The Danish Pathology Data Bank and the Danish Cancer Registry were used to identify 1487 women...... as noninvasive or invasive. Medical records were collected from hospital departments and reviewed. Data were analyzed using Kaplan-Meier and relative survival was estimated with follow-up through September 2, 2013. RESULTS: A cohort of 1042 women with a confirmed SBT diagnosis was identified. Women with stage I...... had an overall survival similar to the overall survival expected from the general population (p=0.3), whereas women with advanced stage disease had a poorer one (pwomen with noninvasive (pwomen with advanced stage...
DEFF Research Database (Denmark)
Alehagen, Urban; Dahlström, Ulf; Carstensen, John
2012-01-01
and all mortality was registered. Cardiovascular mortality was evaluated using Kaplan–Meier plots and multivariate Cox proportional hazard regression analyses. Results: Copeptin, HS-TnT, and NT-proBNP measurements provided independent prognostic information in a multivariate setting over 5 years (hazard......Objectives: A multimarker strategy for the handling of patients with heart failure has been suggested in the literature. Therefore, the potential prognostic relevance of combined copeptin, high-sensitivity troponin T (HS-TnT), and N-terminal proBNP (NT-proBNP) measurement in plasma from elderly...... patients with symptoms of heart failure was evaluated. Methods: This study included 470 elderly patients (mean age 73 years) from a rural municipality with symptoms of heart failure. Clinical examination, echocardiography, and biomarker measurements were performed. All patients were followed for 13 years...
Measuring quality indicators in the operating room: cleaning and turnover time.
Jericó, Marli de Carvalho; Perroca, Márcia Galan; da Penha, Vivian Colombo
2011-01-01
This exploratory-descriptive study was carried out in the Surgical Center Unit of a university hospital aiming to measure time spent with concurrent cleaning performed by the cleaning service and turnover time and also investigated potential associations between cleaning time and the surgery's magnitude and specialty, period of the day and the room's size. The sample consisted of 101 surgeries, computing cleaning time and 60 surgeries, computing turnover time. The Kaplan-Meier method was used to analyze time and Pearson's correlation to study potential correlations. The time spent in concurrent cleaning was 7.1 minutes and turnover time was 35.6 minutes. No association between cleaning time and the other variables was found. These findings can support nurses in the efficient use of resources thereby speeding up the work process in the operating room.