WorldWideScience

Sample records for tulkojusi dace meiere

  1. DACE - A Matlab Kriging Toolbox

    DEFF Research Database (Denmark)

    2002-01-01

    DACE, Design and Analysis of Computer Experiments, is a Matlab toolbox for working with kriging approximations to computer models.......DACE, Design and Analysis of Computer Experiments, is a Matlab toolbox for working with kriging approximations to computer models....

  2. Meier-Gorlin syndrome

    NARCIS (Netherlands)

    Munnik, S.A. de; Hoefsloot, E.H.; Roukema, J.; Schoots, J.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, E.M.H.F.

    2015-01-01

    Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females

  3. Meier-Gorlin syndrome

    OpenAIRE

    de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F

    2015-01-01

    Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia...

  4. Meier-Gorlin syndrome.

    Science.gov (United States)

    de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F

    2015-09-17

    Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia. During ageing, a narrow, convex nose becomes more prominent. The diagnosis MGS should be considered in patients with at least two of the three features of the clinical triad of microtia, patellar anomalies, and pre- and postnatal growth retardation. In patients with short stature and/or microtia, the patellae should be assessed with care by ultrasonography before age 6 or radiography thereafter. Mutations in one of five genes (ORC1, ORC4, ORC6, CDT1, and CDC6) of the pre-replication complex, involved in DNA-replication, are detected in approximately 67-78% of patients with MGS. Patients with ORC1 and ORC4 mutations appear to have the most severe short stature and microcephaly. Management should be directed towards in-depth investigation, treatment and prevention of associated problems, such as growth retardation, feeding problems, hearing loss, luxating patellae, knee pain, gonarthrosis, and possible pulmonary complications due to congenital pulmonary emphysema with or without broncho- or laryngomalacia. Growth hormone treatment is ineffective in most patients with MGS, but may be effective in patients in whom growth continues to decrease after the first year of life (usually growth velocity normalizes after the first year) and with low levels of IGF1. At present, few data is available about reproduction of females with MGS, but the risk of premature labor might be increased. Here, we propose experience-based guidelines for the regular care and treatment of MGS patients.

  5. The Kaplan-Meier theatre

    DEFF Research Database (Denmark)

    Gerds, Thomas Alexander

    2016-01-01

    Survival probabilities are not straightforward toobtain when observation periods of individuals differ in length. The Kaplan–Meier theatre is a classroom activity, which starts by a data collection exercise where students imagine sailing on the Titanic. Several students ‘fall in the water’ where....... The Kaplan–Meier method assumes that censored individuals have the same survival chances as the individuals who are still observed. During the Kaplan–Meier theatre, students perform a clever algorithm (Efron 1967), which translates the assumption into action and results in the Kaplan–Meier estimate...

  6. The Kaplan-Meier Theatre

    Science.gov (United States)

    Gerds, Thomas A.

    2016-01-01

    Survival is difficult to estimate when observation periods of individuals differ in length. Students imagine sailing the Titanic and then recording whether they "live" or "die." A clever algorithm is performed which results in the Kaplan-Meier estimate of survival.

  7. Turbidity affects foraging success of drift-feeding rosyide dace

    Science.gov (United States)

    Richard M. Zamor; Gary D. Grossman

    2007-01-01

    The effects of suspended sediment on nongame fishes are not well understood. We examined the effects of suspended sediment (i.e., turbidity) on reactive distance and prey capture success at springautumn (12°C) and summer (18°C) temperatures for royside dace Clinostomus funduloides in an artificial stream. Experimental turbidities ranged from 0 to 56...

  8. A stochastic population model to evaluate Moapa dace (Moapa coriacea) population growth under alternative management scenarios

    Science.gov (United States)

    Perry, Russell W.; Jones, Edward; Scoppettone, G. Gary

    2015-07-14

    The primary goal of this research project was to evaluate the response of Moapa dace (Moapa coriacea) to the potential effects of changes in the amount of available habitat due to human influences such as ground water pumping, barriers to movement, and extirpation of Moapa dace from the mainstem Muddy River. To understand how these factors affect Moapa dace populations and to provide a tool to guide recovery actions, we developed a stochastic model to simulate Moapa dace population dynamics. Specifically, we developed an individual based model (IBM) to incorporate the critical components that drive Moapa dace population dynamics. Our model is composed of several interlinked submodels that describe changes in Moapa dace habitat as translated into carrying capacity, the influence of carrying capacity on demographic rates of dace, and the consequent effect on equilibrium population sizes. The model is spatially explicit and represents the stream network as eight discrete stream segments. The model operates at a monthly time step to incorporate seasonally varying reproduction. Growth rates of individuals vary among stream segments, with growth rates increasing along a headwater to mainstem gradient. Movement and survival of individuals are driven by density-dependent relationships that are influenced by the carrying capacity of each stream segment.

  9. Experimental evaluation of rainbow trout Oncorhynchus mykiss predation on longnose dace Rhinichthys cataractae

    Science.gov (United States)

    Turek, Kelly C.; Pegg, Mark A.; Pope, Kevin L.

    2014-01-01

    Laboratory and in-stream enclosure experiments were used to determine whether rainbow trout Oncorhynchus mykiss influence survival of longnose dace Rhinichthys cataractae. In the laboratory, adult rainbow trout preyed on longnose dace in 42% of trials and juvenile rainbow trout did not prey on longnose dace during the first 6 h after rainbow trout introduction. Survival of longnose dace did not differ in the presence of adult rainbow trout previously exposed to active prey and those not previously exposed to active prey ( = 0.28, P = 0.60). In field enclosures, the number of longnose dace decreased at a faster rate in the presence of rainbow trout relative to controls within the first 72 h, but did not differ between moderate and high densities of rainbow trout (F2,258.9 = 3.73, P = 0.03). Additionally, longnose dace were found in 7% of rainbow trout stomachs after 72 h in enclosures. Rainbow trout acclimated to the stream for longer periods had a greater initial influence on the number of longnose dace remaining in enclosures relative to those acclimated for shorter periods regardless of rainbow trout density treatment (F4,148.5 = 2.50, P = 0.04). More research is needed to determine how predation rates will change in natural environments, under differing amounts of habitat and food resources and in the context of whole assemblages. However, if rainbow trout are introduced into the habitat of longnose dace, some predation on longnose dace is expected, even when rainbow trout have no previous experience with active prey.

  10. Genetics Home Reference: Meier-Gorlin syndrome

    Science.gov (United States)

    ... Additional NIH Resources (1 link) National Institute of Neurological Disorders and Stroke: Microcephaly Information Page Educational Resources (10 links) Boston Children's Hospital: Growth Problems Disease InfoSearch: Meier-Gorlin syndrome ...

  11. Long-term persistence, density dependence and effects of climate change on rosyside dace (Cyprinidae)

    Science.gov (United States)

    Gary D. Grossman; Gary Sundin; Robert E. Ratajczak

    2016-01-01

    SummaryWe used long-term population data for rosyside dace (Clinostomus funduloides), a numerically dominant member of a stochastically organised fish assemblage, to evaluate the relative importance of density-dependent and density-independent processes to population...

  12. Understanding survival analysis: Kaplan-Meier estimate.

    Science.gov (United States)

    Goel, Manish Kumar; Khanna, Pardeep; Kishore, Jugal

    2010-10-01

    Kaplan-Meier estimate is one of the best options to be used to measure the fraction of subjects living for a certain amount of time after treatment. In clinical trials or community trials, the effect of an intervention is assessed by measuring the number of subjects survived or saved after that intervention over a period of time. The time starting from a defined point to the occurrence of a given event, for example death is called as survival time and the analysis of group data as survival analysis. This can be affected by subjects under study that are uncooperative and refused to be remained in the study or when some of the subjects may not experience the event or death before the end of the study, although they would have experienced or died if observation continued, or we lose touch with them midway in the study. We label these situations as censored observations. The Kaplan-Meier estimate is the simplest way of computing the survival over time in spite of all these difficulties associated with subjects or situations. The survival curve can be created assuming various situations. It involves computing of probabilities of occurrence of event at a certain point of time and multiplying these successive probabilities by any earlier computed probabilities to get the final estimate. This can be calculated for two groups of subjects and also their statistical difference in the survivals. This can be used in Ayurveda research when they are comparing two drugs and looking for survival of subjects.

  13. The effects of turbidity and an invasive species on foraging success of rosyside dace (Clinostomus funduloides)

    Science.gov (United States)

    Peter D. Hazelton; Gary D. Grossman

    2009-01-01

    Habitat degradation and biological invasions are important threats to fish diversity worldwide. We experimentally examined the effects of turbidity, velocity and intra- and interspecific competition on prey capture location, reactive distance and prey capture success of native rosyside dace (Clinostomus funduloides) and invasive yellowfin shiners (Notropis lutipinnis)...

  14. Modified Weighted Kaplan-Meier Estimator

    Directory of Open Access Journals (Sweden)

    Mohammad Shafiq

    2007-01-01

    Full Text Available In many medical studies majority of the study subjects do not reach to the event of interest during the study period. In such situations survival probabilities can be estimated for censored observation by Kaplan Meier estimator. However in case of heavy censoring these estimates are biased and over estimate the survival probabilities. For heavy censoring a new method was proposed (Bahrawar Jan, 2005 to estimate the survival probabilities by weighting the censored observations by non-censoring rate. But the main defect in this weighted method is that it gives zero weight to the last censored observation. To over come this difficulty a new weight is proposed which also gives a non-zero weight to the last censored observation.

  15. About an adaptively weighted Kaplan-Meier estimate.

    Science.gov (United States)

    Plante, Jean-François

    2009-09-01

    The minimum averaged mean squared error nonparametric adaptive weights use data from m possibly different populations to infer about one population of interest. The definition of these weights is based on the properties of the empirical distribution function. We use the Kaplan-Meier estimate to let the weights accommodate right-censored data and use them to define the weighted Kaplan-Meier estimate. The proposed estimate is smoother than the usual Kaplan-Meier estimate and converges uniformly in probability to the target distribution. Simulations show that the performances of the weighted Kaplan-Meier estimate on finite samples exceed that of the usual Kaplan-Meier estimate. A case study is also presented.

  16. Isolation and characterization of 21 polymorphic microsatellite loci in the Japanese dace (Tribolodon hakonensis)

    Science.gov (United States)

    Koizumi, Noriyuki; Quinn, Thomas W.; Park, Myeongsoo; Fike, Jennifer A.; Nishida, Kazuya; Takemura, Takeshi; Watabe, Keiji; Mori, Atsushi

    2011-01-01

    Twenty one polymorphic microsatellite loci for the Japanese dace (Tribolodon hakonensis) were isolated and characterized. The number of observed alleles per locus in 32 individuals ranged from 3 to 30. The observed and expected heterozygosities ranged from 0.125 to 0.969 and from 0.175 to 0.973, respectively. All loci conformed to Hardy–Weinberg equilibrium, no linkage disequilibrium was observed between pairs of loci and no loci showed evidence of null alleles. These microsatellite loci will be useful for investigating the intraspecific genetic variation and population structure of this species.

  17. Meier-Gorlin syndrome Clinical genetics and genomics

    NARCIS (Netherlands)

    De Munnik, Sonja A.; Hoefsloot, Elisabeth H.; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine Vam; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie Mhf

    2015-01-01

    Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females

  18. Meier-Gorlin syndrome Clinical genetics and genomics

    NARCIS (Netherlands)

    S. de Munnik (Sonja); E.H. Hoefsloot (Lies); J. Roukema (Jolt); J. Schoots (Jeroen); N.V.A.M. Knoers (Nine); H.G. Brunner; A.P. Jackson (Andrew); E. Bongers (Ernie)

    2015-01-01

    textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia

  19. Small founding number and low genetic diversity in an introduced species exhibiting limited invasion success (speckled dace, Rhinichthys ocsulus)

    Science.gov (United States)

    Andrew Kinziger; Rodney Nakamoto; Eric Anderson; Bret Harvey

    2011-01-01

    Molecular evaluations of successful invaders are common, however studies of introduced species that have had limited invasion success, or have died out completely, are rare. We studied an introduced population of speckled dace (Rhinichthys osculus) from northern California, USA that has rapidly increased in abundance but remained restricted to a 25-km stretch of river...

  20. The Kaplan-Meier Integral in the Presence of Covariates

    DEFF Research Database (Denmark)

    Gerds, Thomas A.; Beyersmann, Jan; Starkopf, Liis

    2017-01-01

    In a series of papers, Winfried Stute introduced and studied the Kaplan-Meier integral as an estimator of parameters of the joint distribution of survival times and covariates based on right censored survival times. We present a review of this work and show that his estimator has an inverse...... probability of censoring weighting (IPCW) representation. We further investigate large sample bias and efficiency. As a central application in a biostatistical context, Kaplan-Meier integrals are used to estimate transition probabilities in a non-Markov illness-death model. We extend already existing...

  1. Meier-Gorlin syndrome Clinical genetics and genomics

    OpenAIRE

    Munnik, Sonja; Hoefsloot, Lies; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine; Brunner, H.G.; Jackson, Andrew; Bongers, Ernie

    2015-01-01

    textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-...

  2. Effect of temperature on the effectiveness of artificial reproduction of dace [Cyprinidae (Leuciscus leuciscus (L.))] under laboratory and field conditions.

    Science.gov (United States)

    Nowosad, Joanna; Targońska, Katarzyna; Chwaluczyk, Rafał; Kaszubowski, Rafał; Kucharczyk, Dariusz

    2014-10-01

    This study sought to determine the effect of water temperature on the effectiveness of artificial reproduction of dace brooders under laboratory and field conditions. Three temperatures were tested in the laboratory: 9.5, 12 and 14.5 °C (± 0.1 °C). The water temperature under field conditions was 11.0 ± 0.3 °C (Czarci Jar Fish Farm) and 13.2 ± 1.4 °C (Janowo Fish Farm). The study showed that artificial reproduction of dace is possible in all the temperature ranges under study and an embryo survival rate of over 87% can be achieved. Dace has also been found to be very sensitive to rapid temperature changes, even within the temperature ranges optimal for the species. Such changes have an adverse effect on the outcome of the reproduction process, such as a decrease in the percentage of reproducing females, a decrease in the pseudo-gonado-somatic index (PGSI) and a decrease in the embryo survival rate. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Prita Meier, Swahili Port Cities: The Architecture of Elsewhere

    OpenAIRE

    Longair, Sarah

    2018-01-01

    Prita Meier’s Swahili Port Cities: the Architecture of Elsewhere is a highly original and important contribution to scholarship on East Africa, and more widely for scholars interested in complicating how we understand the formation of global cities and border zone societies. It is not a conventional architectural history, yet it places buildings, in particular the coral and lime stone constructions found on the Swahili coast, at its heart. Meier uses the “materiality of city life” to offer “a...

  4. Threshold responses of Blackside Dace (Chrosomus cumberlandensis) and Kentucky Arrow Darter (Etheostoma spilotum) to stream conductivity

    Science.gov (United States)

    Hitt, Nathaniel P.; Floyd, Michael; Compton, Michael; McDonald, Kenneth

    2016-01-01

    Chrosomus cumberlandensis (Blackside Dace [BSD]) and Etheostoma spilotum (Kentucky Arrow Darter [KAD]) are fish species of conservation concern due to their fragmented distributions, their low population sizes, and threats from anthropogenic stressors in the southeastern United States. We evaluated the relationship between fish abundance and stream conductivity, an index of environmental quality and potential physiological stressor. We modeled occurrence and abundance of KAD in the upper Kentucky River basin (208 samples) and BSD in the upper Cumberland River basin (294 samples) for sites sampled between 2003 and 2013. Segmented regression indicated a conductivity change-point for BSD abundance at 343 μS/cm (95% CI: 123–563 μS/cm) and for KAD abundance at 261 μS/cm (95% CI: 151–370 μS/cm). In both cases, abundances were negligible above estimated conductivity change-points. Post-hoc randomizations accounted for variance in estimated change points due to unequal sample sizes across the conductivity gradients. Boosted regression-tree analysis indicated stronger effects of conductivity than other natural and anthropogenic factors known to influence stream fishes. Boosted regression trees further indicated threshold responses of BSD and KAD occurrence to conductivity gradients in support of segmented regression results. We suggest that the observed conductivity relationship may indicate energetic limitations for insectivorous fishes due to changes in benthic macroinvertebrate community composition.

  5. Feminization of Longnose Dace (Rhinichthys cataractae in the Oldman River, Alberta, (Canada Provides Evidence of Widespread Endocrine Disruption in an Agricultural Basin

    Directory of Open Access Journals (Sweden)

    Joyce S. Evans

    2012-01-01

    Full Text Available We sampled an abundant, native minnow (Longnose dace—Rhinichthys cataractae throughout the Oldman River, Alberta, to determine physiological responses and possible population level consequences from exposure to compounds with hormone-like activity. Sex ratios varied between sites, were female-biased, and ranged from just over 50% to almost 90%. Histological examination of gonads revealed that at the sites with >60% females in the adult population, there was up to 38% occurrence of intersex gonads in fish identified through visual examination of the gonads as male. In the majority of intersex gonad cases, there was a large proportion (approx., 50% of oocytes within the testicular tissue. In male dace, vitellogenin mRNA expression generally increased with distance downstream. We analyzed river water for 28 endocrine disrupting compounds from eight functional classes, most with confirmed estrogen-like activity, including synthetic estrogens and hormone therapy drugs characteristic of municipal wastewater effluent, plus natural hormones and veterinary pharmaceuticals characteristic of livestock production. The spatial correlation between detected chemical residues and effects to dace physiology indicate that multiple land uses have a cumulative impact on dace in the Oldman River and effects range from altered gene regulation to severely female-biased sex ratios.

  6. Competing risk bias was common in Kaplan-Meier risk estimates published in prominent medical journals.

    Science.gov (United States)

    van Walraven, Carl; McAlister, Finlay A

    2016-01-01

    Risk estimates from Kaplan-Meier curves are well known to medical researchers, reviewers, and editors. In this study, we determined the proportion of Kaplan-Meier analyses published in prominent medical journals that are potentially biased because of competing events ("competing risk bias"). We randomly selected 100 studies that had at least one Kaplan-Meier analysis and were recently published in prominent medical journals. Susceptibility to competing risk bias was determined by examining the outcome and potential competing events. In susceptible studies, bias was quantified using a previously validated prediction model when the number of outcomes and competing events were given. Forty-six studies (46%) contained Kaplan-Meier analyses susceptible to competing risk bias. Sixteen studies (34.8%) susceptible to competing risk cited the number of outcomes and competing events; in six of these studies (6/16, 37.5%), the outcome risk from the Kaplan-Meier estimate (relative to the true risk) was biased upward by 10% or more. Almost half of Kaplan-Meier analyses published in medical journals are susceptible to competing risk bias and may overestimate event risk. This bias was found to be quantitatively important in a third of such studies. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Postglacial recolonization of eastern Blacknose Dace,Rhinichthys atratulus(Teleostei: Cyprinidae), through the gateway of New England.

    Science.gov (United States)

    Tipton, Michelle L; Gignoux-Wolfsohn, Sarah; Stonebraker, Phoebe; Chernoff, Barry

    2011-11-01

    During the last ice age, much of North America far south as 40°N was covered by glaciers (Hewitt 2000). About 20,000 years ago, as the glaciers retreated, the hydrologic landscape changed dramatically creating waterways for fish dispersal. The number of populations responsible for recolonization and the regions from which they recolonized are unknown for many freshwater fishes living in New England and southeastern Canada. The Blacknose Dace,Rhinichthys atratulus, is one of the freshwater fish species that recolonized this region. We hypothesize that the earliest deglaciated region, modern-day Connecticut, was recolonized byR. atratulusvia a single founding event by a single population. In this paper, we test this hypothesis phylogenetically with regard to the major drainage basins within Connecticut. The mitochondrial DNA exhibits low nucleotide diversity, high haplotype diversity, and a dominant haplotype found across the state. A small percentage of individuals in the Housatonic drainage basin, however, share a haplotype with populations in New York drainage basins, a haplotype not found elsewhere in Connecticut's drainage basins. We calculated a range for the rate of divergence for NADH dehydrogenase subunit 2 (nd2) and control region (ctr) of 4.43-6.76% and 3.84-8.48% per million years (my), respectively. While this range is higher than the commonly accepted rate of 2% for mitochondrial DNA, these results join a growing list of publications finding high rates of divergence for various taxa (Peterson and Masel 2009). The data support the conclusion that Connecticut as a whole was recolonized initially by a single founding event that came from a single refugium. Subsequently, the Housatonic basin alone experienced a secondary recolonization event.

  8. Kaplan-Meier Survival Analysis Overestimates the Risk of Revision Arthroplasty: A Meta-analysis.

    Science.gov (United States)

    Lacny, Sarah; Wilson, Todd; Clement, Fiona; Roberts, Derek J; Faris, Peter D; Ghali, William A; Marshall, Deborah A

    2015-11-01

    Although Kaplan-Meier survival analysis is commonly used to estimate the cumulative incidence of revision after joint arthroplasty, it theoretically overestimates the risk of revision in the presence of competing risks (such as death). Because the magnitude of overestimation is not well documented, the potential associated impact on clinical and policy decision-making remains unknown. We performed a meta-analysis to answer the following questions: (1) To what extent does the Kaplan-Meier method overestimate the cumulative incidence of revision after joint replacement compared with alternative competing-risks methods? (2) Is the extent of overestimation influenced by followup time or rate of competing risks? We searched Ovid MEDLINE, EMBASE, BIOSIS Previews, and Web of Science (1946, 1980, 1980, and 1899, respectively, to October 26, 2013) and included article bibliographies for studies comparing estimated cumulative incidence of revision after hip or knee arthroplasty obtained using both Kaplan-Meier and competing-risks methods. We excluded conference abstracts, unpublished studies, or studies using simulated data sets. Two reviewers independently extracted data and evaluated the quality of reporting of the included studies. Among 1160 abstracts identified, six studies were included in our meta-analysis. The principal reason for the steep attrition (1160 to six) was that the initial search was for studies in any clinical area that compared the cumulative incidence estimated using the Kaplan-Meier versus competing-risks methods for any event (not just the cumulative incidence of hip or knee revision); we did this to minimize the likelihood of missing any relevant studies. We calculated risk ratios (RRs) comparing the cumulative incidence estimated using the Kaplan-Meier method with the competing-risks method for each study and used DerSimonian and Laird random effects models to pool these RRs. Heterogeneity was explored using stratified meta-analyses and

  9. Meier-Gorlin syndrome: Growth and secondary sexual development of a microcephalic primordial dwarfism disorder

    NARCIS (Netherlands)

    de Munnik, Sonja A.; Otten, Barto J.; Schoots, Jeroen; Bicknell, Louise S.; Aftimos, Salim; Al-Aama, Jumana Y.; van Bever, Yolande; Bober, Michael B.; Borm, George F.; Clayton-Smith, Jill; Deal, Cheri L.; Edrees, Alaa Y.; Feingold, Murray; Fryer, Alan; van Hagen, Johanna M.; Hennekam, Raoul C.; Jansweijer, Maaike C. E.; Johnson, Diana; Kant, Sarina G.; Opitz, John M.; Ramadevi, A. Radha; Reardon, Willie; Ross, Alison; Sarda, Pierre; Schrander-Stumpel, Constance T. R. M.; Sluiter, A. Erik; Temple, I. Karen; Terhal, Paulien A.; Toutain, Annick; Wise, Carol A.; Wright, Michael; Skidmore, David L.; Samuels, Mark E.; Hoefsloot, Lies H.; Knoers, Nine V. A. M.; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie M. H. F.

    2012-01-01

    MeierGorlin syndrome (MGS) is a rare autosomal recessive disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recently, mutations in the ORC1, ORC4, ORC6, CDT1, and CDC6 genes, encoding components of the pre-replication complex, have been identified. This complex

  10. Meier-Gorlin syndrome: Growth and secondary sexual development of a microcephalic primordial dwarfism disorder

    NARCIS (Netherlands)

    de Munnik, S.A.; Otten, B.J.; Schoots, J.; Bicknell, L.S.; Aftimos, S.; Al-Aama, J.Y.; van Bever, Y.; Bober, M.B.; Borm, G.F.; Clayton-Smith, J.; Deal, C.L.; Edrees, A.Y.; Feingold, M.; Fryer, A.; van Hagen, J.M.; Hennekam, R.C.M.; Jansweijer, M.C.E.; Johnson, D.; Kant, S.G.; Opitz, J.M.; Ramadevi, A.R.; Reardon, W.; Ross, A.; Sarda, P.; Schrander-Stumpel, C.T.R.M.; Sluiter, A.E.; Temple, I.K.; Terhal, P.A.; Toutain, A.; Wise, C.A.; Wright, M.; Skidmore, D.L.; Samuels, M.E.; Hoefsloot, L.H.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, M.H.F.

    2012-01-01

    Meier-Gorlin syndrome (MGS) is a rare autosomal recessive disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recently, mutations in the ORC1, ORC4, ORC6, CDT1, and CDC6 genes, encoding components of the pre-replication complex, have been identified. This

  11. Case Report: Meier-Gorlin syndrome: Report of an additional patient ...

    African Journals Online (AJOL)

    We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS), (microtia, absent patella and short stature). She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level.

  12. Calculating the dielectric anisotropy of nematic liquid crystals: a reinvestigation of the Maier–Meier theory

    International Nuclear Information System (INIS)

    Ran, Zhang; Jun, He; Zeng-Hui, Peng; Li, Xuan

    2009-01-01

    This paper investigates the average dielectric permittivity (ε-bar ) in the Maier–Meier theory for calculating the dielectric anisotropy (Δε) of nematic liquid crystals. For the reason that ε-bar of nematics has the same expression as the dielectric permittivity of the isotropic state, the Onsager equation for isotropic dielectric was used to calculate it. The computed ε-bar shows reasonable agreement with the results of the numerical methods used in the literature. Molecular parameters, such as the polarizability and its anisotropy, the dipole moment and its angle with the molecular long axis, were taken from semi-empirical quantum chemistry (MOCPAC/AM1) modeling. The calculated values of Δε according to the Maier–Meier equation are in good agreement with the experimental results for the investigated compounds having different core structures and polar substituents. (condensed matter: structure, thermal and mechanical properties)

  13. The analysis of competing events like cause-specific mortality--beware of the Kaplan-Meier method

    NARCIS (Netherlands)

    Verduijn, Marion; Grootendorst, Diana C.; Dekker, Friedo W.; Jager, Kitty J.; le Cessie, Saskia

    2011-01-01

    Kaplan-Meier analysis is a popular method used for analysing time-to-event data. In case of competing event analyses such as that of cardiovascular and non-cardiovascular mortality, however, the Kaplan-Meier method profoundly overestimates the cumulative mortality probabilities for each of the

  14. Meier-Gorlin syndrome: Report of an additional patient with congenital heart disease

    Directory of Open Access Journals (Sweden)

    Rabah M. Shawky

    2014-10-01

    Full Text Available We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS, (microtia, absent patella and short stature. She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level. She suffered from recurrent chest infection during the first year of life which improved gradually with age. Although congenital heart is rarely observed in MGS, our patient had in addition fenestrated interatrial septal defect.

  15. TÜ, TPÜ ja EHI uusi magistreid / Eda Tursk, Hille Roots, Heidi Meier

    Index Scriptorium Estoniae

    Tursk, Eda

    2004-01-01

    Tartu ülikooli eesti ja soome-ugri keeleteaduse osakonnas ning kirjanduse ja rahvaluule osakonnas kaitsesid 2003.a. magistritööd Niina Aasmäe, Piret Voll, Larissa Degel, Reet Hendrikson, Tiina Pai, Petar Kehayov, Anna Baidullina, Katrin Ennus, Kristi Jõesaar, Ell Vahtramäe, Lauri Sommer, Andreas Kalkun, Mirjam Hinrikus, Kristel Nõlvak. Tallinna Pedagoogikaülikoolis kaitsesid 2003.a. magistritööd Sirje Nootre, Merike Mägedi, Tiiu Koovit, Heidi Meier, Jaanika Stackhouse, Lilian Ossi, Annika Vamper, Marika Mikkor, Piret Õunapuu, Helin Puksand, Taimi Rosenberg. Eesti Humanitaarinstituudis kaitses 2003.a. magistritööd Merilin Miljan

  16. Application of Kaplan-Meier analysis in reliability evaluation of products cast from aluminium alloys

    OpenAIRE

    J. Szymszal; A. Gierek; J. Kliś

    2010-01-01

    The article evaluates the reliability of AlSi17CuNiMg alloys using Kaplan-Meier-based technique, very popular as a survival estimation tool in medical science. The main object of survival analysis is a group (or groups) of units for which the time of occurrence of an event (failure) taking place after some time of waiting is estimated. For example, in medicine, the failure can be patient’s death. In this study, the failure was the specimen fracture during a periodical fatigue test, while the ...

  17. Biostatistics with emphasis on life table survival rate calculations (including Kaplan Meier) and the logrank test

    International Nuclear Information System (INIS)

    Mould, Richard F.

    1995-01-01

    Purpose/Objective: To explain some of the most useful statistical calculation procedures which are relevant to radiation oncologists and to provide insights on what tests and procedures should be used in various situations such as when survival rates and their associated standard errors have to be determined. To describe some of the problems and pitfalls in clinical trial designs which have to be overcome if a trial is to have the possibility of reaching a successful conclusion. To review methods of computing criteria to quantitatively describe criteria of success (eg. quality of life, long-term survival, cure) of radiation oncology and to suggest possible future statistical improvements in this area. Chi-Squared Test: The chi-squared test is probably the most useful of the tests of statistical significance for the radiation oncologist. Applications will be described, including goodness of fit tests and 2x2 contingency tables which are the simplest of the generalized nxm contingency tables. Degrees of Freedom and P<0.05 for Significance Testing: An Introduction will be given to the meaning of P<0.05 in relation to significance testing and the use of tables of critical values of a test statistic (eg. chi-squared) which are given as a function of degrees of freedom and P-values. Survival Rate Calculations for Grouped and Ungrouped Data: The life-table method (sometimes termed the actuarial method) will be explained for both grouped data (eg. survival times grouped in annual intervals for patients who have died and for those who are still alive or lost to follow-up) and for ungrouped data (when individual survival times are used). The method for ungrouped data is variously termed the Kaplan-Meier or Product Limit method. Logrank Test: This is the most useful test for comparison of the survival experience of two groups of patients and its use will be explained. In part the computation is similar to that for the Kaplan-Meier/Product Limit method

  18. Biostatistics with emphasis on life table survival rate calculations (including Kaplan Meier) and the logrank test

    Energy Technology Data Exchange (ETDEWEB)

    Mould, Richard F

    1995-07-01

    Purpose/Objective: To explain some of the most useful statistical calculation procedures which are relevant to radiation oncologists and to provide insights on what tests and procedures should be used in various situations such as when survival rates and their associated standard errors have to be determined. To describe some of the problems and pitfalls in clinical trial designs which have to be overcome if a trial is to have the possibility of reaching a successful conclusion. To review methods of computing criteria to quantitatively describe criteria of success (eg. quality of life, long-term survival, cure) of radiation oncology and to suggest possible future statistical improvements in this area. Chi-Squared Test: The chi-squared test is probably the most useful of the tests of statistical significance for the radiation oncologist. Applications will be described, including goodness of fit tests and 2x2 contingency tables which are the simplest of the generalized nxm contingency tables. Degrees of Freedom and P<0.05 for Significance Testing: An Introduction will be given to the meaning of P<0.05 in relation to significance testing and the use of tables of critical values of a test statistic (eg. chi-squared) which are given as a function of degrees of freedom and P-values. Survival Rate Calculations for Grouped and Ungrouped Data: The life-table method (sometimes termed the actuarial method) will be explained for both grouped data (eg. survival times grouped in annual intervals for patients who have died and for those who are still alive or lost to follow-up) and for ungrouped data (when individual survival times are used). The method for ungrouped data is variously termed the Kaplan-Meier or Product Limit method. Logrank Test: This is the most useful test for comparison of the survival experience of two groups of patients and its use will be explained. In part the computation is similar to that for the Kaplan-Meier/Product Limit method.

  19. De Novo GMNN Mutations Cause Autosomal-Dominant Primordial Dwarfism Associated with Meier-Gorlin Syndrome.

    Science.gov (United States)

    Burrage, Lindsay C; Charng, Wu-Lin; Eldomery, Mohammad K; Willer, Jason R; Davis, Erica E; Lugtenberg, Dorien; Zhu, Wenmiao; Leduc, Magalie S; Akdemir, Zeynep C; Azamian, Mahshid; Zapata, Gladys; Hernandez, Patricia P; Schoots, Jeroen; de Munnik, Sonja A; Roepman, Ronald; Pearring, Jillian N; Jhangiani, Shalini; Katsanis, Nicholas; Vissers, Lisenka E L M; Brunner, Han G; Beaudet, Arthur L; Rosenfeld, Jill A; Muzny, Donna M; Gibbs, Richard A; Eng, Christine M; Xia, Fan; Lalani, Seema R; Lupski, James R; Bongers, Ernie M H F; Yang, Yaping

    2015-12-03

    Meier-Gorlin syndrome (MGS) is a genetically heterogeneous primordial dwarfism syndrome known to be caused by biallelic loss-of-function mutations in one of five genes encoding pre-replication complex proteins: ORC1, ORC4, ORC6, CDT1, and CDC6. Mutations in these genes cause disruption of the origin of DNA replication initiation. To date, only an autosomal-recessive inheritance pattern has been described in individuals with this disorder, with a molecular etiology established in about three-fourths of cases. Here, we report three subjects with MGS and de novo heterozygous mutations in the 5' end of GMNN, encoding the DNA replication inhibitor geminin. We identified two truncating mutations in exon 2 (the 1(st) coding exon), c.16A>T (p.Lys6(∗)) and c.35_38delTCAA (p.Ile12Lysfs(∗)4), and one missense mutation, c.50A>G (p.Lys17Arg), affecting the second-to-last nucleotide of exon 2 and possibly RNA splicing. Geminin is present during the S, G2, and M phases of the cell cycle and is degraded during the metaphase-anaphase transition by the anaphase-promoting complex (APC), which recognizes the destruction box sequence near the 5' end of the geminin protein. All three GMNN mutations identified alter sites 5' to residue Met28 of the protein, which is located within the destruction box. We present data supporting a gain-of-function mechanism, in which the GMNN mutations result in proteins lacking the destruction box and hence increased protein stability and prolonged inhibition of replication leading to autosomal-dominant MGS. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  20. Enhanced secondary analysis of survival data: reconstructing the data from published Kaplan-Meier survival curves

    Directory of Open Access Journals (Sweden)

    Guyot Patricia

    2012-02-01

    Full Text Available Abstract Background The results of Randomized Controlled Trials (RCTs on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. Methods We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios with statistics based on repeated reconstructions by multiple observers. Results The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. Conclusion The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.

  1. Enhanced secondary analysis of survival data: reconstructing the data from published Kaplan-Meier survival curves.

    Science.gov (United States)

    Guyot, Patricia; Ades, A E; Ouwens, Mario J N M; Welton, Nicky J

    2012-02-01

    The results of Randomized Controlled Trials (RCTs) on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios) with statistics based on repeated reconstructions by multiple observers. The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.

  2. Gastric emptying of solids in humans: improved evaluation by Kaplan-Meier plots, with special reference to obesity and gender

    International Nuclear Information System (INIS)

    Grybaeck, P.; Naeslund, E.; Hellstroem, P.M.; Jacobsson, H.; Backman, L.

    1996-01-01

    It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs

  3. Gastric emptying of solids in humans: improved evaluation by Kaplan-Meier plots, with special reference to obesity and gender

    Energy Technology Data Exchange (ETDEWEB)

    Grybaeck, P. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden); Naeslund, E. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden); Hellstroem, P.M. [Department of Internal Medicine, Karolinska Hospital, Stockholm (Sweden); Jacobsson, H. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden)]|[Department of Nuclear Medicine, Karolinska Hospital, Stockholm (Sweden); Backman, L. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden)

    1996-12-01

    It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs.

  4. KMWin--a convenient tool for graphical presentation of results from Kaplan-Meier survival time analysis.

    Science.gov (United States)

    Gross, Arnd; Ziepert, Marita; Scholz, Markus

    2012-01-01

    Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups.

  5. KMWin – A Convenient Tool for Graphical Presentation of Results from Kaplan-Meier Survival Time Analysis

    Science.gov (United States)

    Gross, Arnd; Ziepert, Marita; Scholz, Markus

    2012-01-01

    Background Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. Results On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. Conclusions We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups. PMID:22723912

  6. KMWin--a convenient tool for graphical presentation of results from Kaplan-Meier survival time analysis.

    Directory of Open Access Journals (Sweden)

    Arnd Gross

    Full Text Available BACKGROUND: Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav, SAS export (xpt or text file (dat, which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. RESULTS: On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. CONCLUSIONS: We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups.

  7. A versatile test for equality of two survival functions based on weighted differences of Kaplan-Meier curves.

    Science.gov (United States)

    Uno, Hajime; Tian, Lu; Claggett, Brian; Wei, L J

    2015-12-10

    With censored event time observations, the logrank test is the most popular tool for testing the equality of two underlying survival distributions. Although this test is asymptotically distribution free, it may not be powerful when the proportional hazards assumption is violated. Various other novel testing procedures have been proposed, which generally are derived by assuming a class of specific alternative hypotheses with respect to the hazard functions. The test considered by Pepe and Fleming (1989) is based on a linear combination of weighted differences of the two Kaplan-Meier curves over time and is a natural tool to assess the difference of two survival functions directly. In this article, we take a similar approach but choose weights that are proportional to the observed standardized difference of the estimated survival curves at each time point. The new proposal automatically makes weighting adjustments empirically. The new test statistic is aimed at a one-sided general alternative hypothesis and is distributed with a short right tail under the null hypothesis but with a heavy tail under the alternative. The results from extensive numerical studies demonstrate that the new procedure performs well under various general alternatives with a caution of a minor inflation of the type I error rate when the sample size is small or the number of observed events is small. The survival data from a recent cancer comparative study are utilized for illustrating the implementation of the process. Copyright © 2015 John Wiley & Sons, Ltd.

  8. Kaplan-Meier survival analysis overestimates cumulative incidence of health-related events in competing risk settings: a meta-analysis.

    Science.gov (United States)

    Lacny, Sarah; Wilson, Todd; Clement, Fiona; Roberts, Derek J; Faris, Peter; Ghali, William A; Marshall, Deborah A

    2018-01-01

    Kaplan-Meier survival analysis overestimates cumulative incidence in competing risks (CRs) settings. The extent of overestimation (or its clinical significance) has been questioned, and CRs methods are infrequently used. This meta-analysis compares the Kaplan-Meier method to the cumulative incidence function (CIF), a CRs method. We searched MEDLINE, EMBASE, BIOSIS Previews, Web of Science (1992-2016), and article bibliographies for studies estimating cumulative incidence using the Kaplan-Meier method and CIF. For studies with sufficient data, we calculated pooled risk ratios (RRs) comparing Kaplan-Meier and CIF estimates using DerSimonian and Laird random effects models. We performed stratified meta-analyses by clinical area, rate of CRs (CRs/events of interest), and follow-up time. Of 2,192 identified abstracts, we included 77 studies in the systematic review and meta-analyzed 55. The pooled RR demonstrated the Kaplan-Meier estimate was 1.41 [95% confidence interval (CI): 1.36, 1.47] times higher than the CIF. Overestimation was highest among studies with high rates of CRs [RR = 2.36 (95% CI: 1.79, 3.12)], studies related to hepatology [RR = 2.60 (95% CI: 2.12, 3.19)], and obstetrics and gynecology [RR = 1.84 (95% CI: 1.52, 2.23)]. The Kaplan-Meier method overestimated the cumulative incidence across 10 clinical areas. Using CRs methods will ensure accurate results inform clinical and policy decisions. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Deficiency in origin licensing proteins impairs cilia formation: implications for the aetiology of Meier-Gorlin syndrome.

    Directory of Open Access Journals (Sweden)

    Tom Stiff

    Full Text Available Mutations in ORC1, ORC4, ORC6, CDT1, and CDC6, which encode proteins required for DNA replication origin licensing, cause Meier-Gorlin syndrome (MGS, a disorder conferring microcephaly, primordial dwarfism, underdeveloped ears, and skeletal abnormalities. Mutations in ATR, which also functions during replication, can cause Seckel syndrome, a clinically related disorder. These findings suggest that impaired DNA replication could underlie the developmental defects characteristic of these disorders. Here, we show that although origin licensing capacity is impaired in all patient cells with mutations in origin licensing component proteins, this does not correlate with the rate of progression through S phase. Thus, the replicative capacity in MGS patient cells does not correlate with clinical manifestation. However, ORC1-deficient cells from MGS patients and siRNA-mediated depletion of origin licensing proteins also have impaired centrosome and centriole copy number. As a novel and unexpected finding, we show that they also display a striking defect in the rate of formation of primary cilia. We demonstrate that this impacts sonic hedgehog signalling in ORC1-deficient primary fibroblasts. Additionally, reduced growth factor-dependent signaling via primary cilia affects the kinetics of cell cycle progression following cell cycle exit and re-entry, highlighting an unexpected mechanism whereby origin licensing components can influence cell cycle progression. Finally, using a cell-based model, we show that defects in cilia function impair chondroinduction. Our findings raise the possibility that a reduced efficiency in forming cilia could contribute to the clinical features of MGS, particularly the bone development abnormalities, and could provide a new dimension for considering developmental impacts of licensing deficiency.

  10. Digital Humanitarians: How Big Data Is Changing the Face of Humanitarian Response : Patrick Meier, 2015, CRC Press (Boca Raton, FL, 978-1-4822-4839-5, 259 pp.).

    Science.gov (United States)

    Dave, Anushree

    2017-12-01

    This is a review of Patrick Meier's 2015 book, Digital Humanitarians: How Big Data Is Changing the Face of Humanitarian Response. The book explores the role of technologies such as high-resolution satellite imagery, online social media, drones, and artificial intelligence in humanitarian responses during disasters such as the 2010 Haiti earthquake. In this analysis, the book is examined using a humanitarian health ethics perspective.

  11. Indigolapsed muudavad maailma / Moon Meier

    Index Scriptorium Estoniae

    Meier, Moon

    2004-01-01

    Kasvatusteadlased avastasid, et alates u 1980. a-st sündinud lapsed on hoopis teistsugused kui eelmised põlvkonnad. Senine haridussüsteem neile ei sobi, hariduses peaks rohkem pöörama tähelepanu emotsioonidele

  12. Mutations in ORC1, encoding the largest subunit of the origin recognition complex, cause microcephalic primordial dwarfism resembling Meier-Gorlin syndrome.

    Science.gov (United States)

    Bicknell, Louise S; Walker, Sarah; Klingseisen, Anna; Stiff, Tom; Leitch, Andrea; Kerzendorfer, Claudia; Martin, Carol-Anne; Yeyati, Patricia; Al Sanna, Nouriya; Bober, Michael; Johnson, Diana; Wise, Carol; Jackson, Andrew P; O'Driscoll, Mark; Jeggo, Penny A

    2011-02-27

    Studies into disorders of extreme growth failure (for example, Seckel syndrome and Majewski osteodysplastic primordial dwarfism type II) have implicated fundamental cellular processes of DNA damage response signaling and centrosome function in the regulation of human growth. Here we report that mutations in ORC1, encoding a subunit of the origin recognition complex, cause microcephalic primordial dwarfism resembling Meier-Gorlin syndrome. We establish that these mutations disrupt known ORC1 functions including pre-replicative complex formation and origin activation. ORC1 deficiency perturbs S-phase entry and S-phase progression. Additionally, we show that Orc1 depletion in zebrafish is sufficient to markedly reduce body size during rapid embryonic growth. Our data suggest a model in which ORC1 mutations impair replication licensing, slowing cell cycle progression and consequently impeding growth during development, particularly at times of rapid proliferation. These findings establish a novel mechanism for the pathogenesis of microcephalic dwarfism and show a surprising but important developmental impact of impaired origin licensing.

  13. La chiesa di Richard Meier a Tor Tre Teste e il suo contributo al consolidamento identitario dei nuovi quartieri romani oltre il GRA / The church designed by Richard Meier in Tor Tre Teste and the identity consolidation in the new roman neighbourhoods beyond the Great Circular Road

    Directory of Open Access Journals (Sweden)

    Giuseppe Bonaccorso

    2014-06-01

    Full Text Available Il contributo proposto ha l’obiettivo di analizzare alcuni significativi brani del tessuto urbano della periferia est di Roma, adottando metodi interpretativi legati alla storia, alla società, alla programmazione urbanistica e alla costruzione. Gli aspetti salienti del quadrante orientale della periferia romana verranno così delineati partendo “dal di dentro”, sottolineandone i percorsi, gli spazi e i nuclei compositivi che sono all’origine della struttura e della forma stessa dei quartieri disposti a cavallo del Grande Raccordo Anulare. In questo ambito, si pone l’attenzione su alcuni episodi chiave che vedono protagoniste le nuove chiese che riescono a creare una centralità all’interno dei quartieri periferici sostituendo le biblioteche, le piazze e i centri commerciali.  Analizzando da vicino questi esempi, si scopre come di recente sono state realizzate chiese firmate da architetti di fama internazionale proprio allo scopo di rafforzare, o meglio di costruire, un fattore identitario per ciascun quartiere ubicato nel settore orientale della città. Partendo quindi dal generale si arriva a indagare una chiesa e un quartiere che possono essere considerati un modello da seguire per tutta la periferia a ridosso del GRA: la chiesa giubilare di Dio Padre Misericordioso progettata da Richard Meier nel quartiere di Tor Tre Teste. La sequenzialità degli eventi che hanno contraddistinto il concorso per la progettazione della chiesa, la scelta della proposta di Richard Meier, la complessità del cantiere, l’analisi tecnica, stilistica e simbolica della realizzazione finale sono quindi analizzate nell’ambito del rapporto con il quartiere e del tentativo di realizzare (attraverso di essa un centro di attrazione per tutta la periferia.   The article analyses some significant parts of the urban tissue at the eastern periphery of Rome, using the interpretative methods inherent to history, society, urban programming and construction

  14. The BAH domain of ORC1 links H4K20me2 to DNA replication licensing and Meier-Gorlin syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Kuo, Alex J; Song, Jikui; Cheung, Peggie; Ishibe-Murakami, Satoko; Yamazoe, Sayumi; Chen, James K; Patel, Dinshaw J; Gozani, Or [Stanford; (MSKCC); (Stanford-MED)

    2012-07-11

    The recognition of distinctly modified histones by specialized 'effector' proteins constitutes a key mechanism for transducing molecular events at chromatin to biological outcomes. Effector proteins influence DNA-templated processes, including transcription, DNA recombination and DNA repair; however, no effector functions have yet been identified within the mammalian machinery that regulate DNA replication. Here we show that ORC1 - a component of ORC (origin of replication complex), which mediates pre-DNA replication licensing - contains a bromo adjacent homology (BAH) domain that specifically recognizes histone H4 dimethylated at lysine 20 (H4K20me2). Recognition of H4K20me2 is a property common to BAH domains present within diverse metazoan ORC1 proteins. Structural studies reveal that the specificity of the BAH domain for H4K20me2 is mediated by a dynamic aromatic dimethyl-lysine-binding cage and multiple intermolecular contacts involving the bound peptide. H4K20me2 is enriched at replication origins, and abrogating ORC1 recognition of H4K20me2 in cells impairs ORC1 occupancy at replication origins, ORC chromatin loading and cell-cycle progression. Mutation of the ORC1 BAH domain has been implicated in the aetiology of Meier-Gorlin syndrome (MGS), a form of primordial dwarfism, and ORC1 depletion in zebrafish results in an MGS-like phenotype. We find that wild-type human ORC1, but not ORC1-H4K20me2-binding mutants, rescues the growth retardation of orc1 morphants. Moreover, zebrafish depleted of H4K20me2 have diminished body size, mirroring the phenotype of orc1 morphants. Together, our results identify the BAH domain as a novel methyl-lysine-binding module, thereby establishing the first direct link between histone methylation and the metazoan DNA replication machinery, and defining a pivotal aetiological role for the canonical H4K20me2 mark, via ORC1, in primordial dwarfism.

  15. Kuidas Sander Saarmets kosmosest maailma vallutama kipub / Moon Meier

    Index Scriptorium Estoniae

    Meier, Moon

    2007-01-01

    Eesti Muusika- ja Teatriakadeemias elektronmuusika erialal õppivast Sander Saarmetsast kui noorest heliloojast, kes on siiani oma nime teinud ulmemuusika ringkondades. Kommenteerivad sõber, muusik, ulmeplaatide boss Aivar Tõnso ja Muschraumi kitarrist Kaur Garšnek

  16. Applying Kaplan-Meier to Item Response Data

    Science.gov (United States)

    McNeish, Daniel

    2018-01-01

    Some IRT models can be equivalently modeled in alternative frameworks such as logistic regression. Logistic regression can also model time-to-event data, which concerns the probability of an event occurring over time. Using the relation between time-to-event models and logistic regression and the relation between logistic regression and IRT, this…

  17. Meier-Gorlin syndrome: Report of an additional patient with ...

    African Journals Online (AJOL)

    Rabah M. Shawky

    2014-05-16

    May 16, 2014 ... which functions during replication can cause Seckel syndrome, a clinically related ... brain, and growth hormone provocation test were normal. Skeletal survey ... atrial defect with left–right shunt [17]. Also our patient suf-.

  18. Lasteaiaõpetajate palk kerkis tibusammul / Jaanika Meier

    Index Scriptorium Estoniae

    Meier, Jaanika

    2007-01-01

    Aastaga on tõusnud pea kõigi Tartumaa lasteaiaõpetajate palk, kõige suurem on palgatõus olnud Kambja vallas, kus keskeriharidusega õpetajad saavad praegu palka minimaalselt 6600 ja kõrgharidusega õpetajad 7000 krooni kuus. Lisa: Lasteaiaõpetajate palk Tartumaal

  19. Lille mäele tuleb suveks Flauerpauer / Jaanika Meier

    Index Scriptorium Estoniae

    Meier, Jaanika

    2008-01-01

    Tartus Lille Maja hoovis avatakse suvekohvik Flauerpauer. Kohviku väliskujunduse autoriteks on Tartu kõrgema kunstikooli tudengid Tiit Joala ja Oliver Kuusmann, sisekujunduse autoriks Tallinna Ülikooli üliõpilane Kudrun Vunk. Selgitusi jagab Lille Maja direktor Hele Riit-Vällik

  20. Noorteühenduste kogu tutvustab Euroopa Liitu / Jaanika Meier

    Index Scriptorium Estoniae

    Meier, Jaanika

    2007-01-01

    Tartu Noorteühenduste Kogu tutvustab projekti "Kodanikuna Euroopa Liidus. Eile. Täna. Homme" noortele Euroopa Liitu, selle toimemehhanisme, arengusuundi ja liidus noortele pakutavaid võimalusi. Lisa: Kas teate

  1. Hakkaks maja värvima / Piret Meier

    Index Scriptorium Estoniae

    Meier, Piret, 1962-

    2004-01-01

    Ehitushoolde spetsialist Lea Täheväli-Stroh majade välimusest ja värvilahenduse valikutest. Lisaks Mirjam Peili kommentaar küsimusele, miks on Eestis saanud moeks värvida maamajad nn. Rootsi punaseks.

  2. Tamula rannaala planeering = Competition of spatial planning of the Tamula lakeside area, Võru / Dace Kalvane

    Index Scriptorium Estoniae

    Kalvane, Dace

    2008-01-01

    Žürii liige Võru Tamula järve rannaala mahulise planeeringu rahvusvahelisest ideekonkursist, auhinnatud töödest. Võidutöö "Lust" autorid on Kaie Enno, Leles Luhse, Maria Zeleznova ja Rein Ailt (Kaie Enno Arhitektuuribüroo)

  3. Development of a sperm cryopreservation protocol for redside dace, Clinostomus elongatus: implications for genome resource banking

    DEFF Research Database (Denmark)

    Butts, Ian A.E.; Mokdad, A.; Trippel, E.A.

    2013-01-01

    of extirpation.We developed cryopreservation protocols by testing the effects of diluent (buffered sperm motility-inhibiting saline solution [BSMIS]; BSMIS + glycine; sucrose; and Hanks’ balanced salt solution [HBSS]), cryoprotectant (dimethyl sulfoxide [DMSO]; propylene glycol [PG]; N,N-dimethylacetamide [DMA...... rate was not significant for BSMIS + glycine or for HBSS, but an effect was detected for sucrose, with sperm frozen at 5◦C/min or 10◦C/min having higher motility than sperm frozen at 1◦C/min. The effect of extender was not significant at 1◦C/min or 5◦C/min, but an effect was detected at 10◦C...

  4. A DACE study on a three stage metal forming process made of Sandvik Nanoflex

    NARCIS (Netherlands)

    Post, J.; Klaseboer, G.; Stinstra, E.; Huetink, Han

    2004-01-01

    Sandvik NanoflexTM combines good corrosion resistance with high strength. The steel has good deformability in austenitic conditions. This material belongs to the group of metastable austenites, so during deformation a straininduced transformation into martensite takes place. After deformation, the

  5. AKaplan-Meier estimators of distance distributions for spatial point processes

    NARCIS (Netherlands)

    Baddeley, A.J.; Gill, R.D.

    1997-01-01

    When a spatial point process is observed through a bounded window, edge effects hamper the estimation of characteristics such as the empty space function $F$, the nearest neighbour distance distribution $G$, and the reduced second order moment function $K$. Here we propose and study product-limit

  6. A Note on Some Characteristics and Correlates of the Meier Art Test of Aesthetic Perception.

    Science.gov (United States)

    Stallings, William M.; Anderson, Frances E.

    The reliability and the predictive and concurrent validity of the MATAP were investigated with the implicit goal of improving the prediction of course grades in the College of Fine and Applied Arts. It was found that reliability and validity coefficients were low, and it was suggested that the scoring system was a source of error variance. (MS)

  7. Ettevaatusprintsiip keskkonnaõiguses : [bakalaureusetöö] / Kristel Meier ; Akadeemia Nord, õigusteaduskond ; juhendaja: Rita Annus

    Index Scriptorium Estoniae

    Meier, Kristel, 1966-

    2002-01-01

    Keskkonnaõiguse üldiseloomustus, eesmärk, põhiprintsiibid, ettevaatusprintsiibi ajalooline taust ja areng, Saksa õiguses, rahvusvaheline kohtupraktika, ettevaatusprintsiip Euroopa Ühenduse keskkonnaõiguses

  8. Meier–Gorlin syndrome: An additional Egyptian patient with ...

    African Journals Online (AJOL)

    Rabah M. Shawky

    2016-01-23

    Jan 23, 2016 ... 1. Introduction. The Meier–Gorlin syndrome (MGS) is a rare autosomal reces- ... was 81.5 cm, weight for stature (<3rd centile) and her skull circumference was ... Polycystic ovaries also were reported in ... moderate conductive hearing loss [4]. ... et al. Meier–Gorlin syndrome genotype-phenotype studies: 35.

  9. Vai mēs kļūsim par Baltijas baskiem jeb Kā būt pārstāvētiem? / Jāns Undusks ; no igauņu valodas tulkojusi Maima Grīnberga-Preisa

    Index Scriptorium Estoniae

    Undusk, Jaan, 1958-

    2005-01-01

    Teksti aluseks on ettekanne 8. Balti vaimse koostöö konverentsil 16. juunil 2001 Tallinnas: Are we Basques of Baltic? The problem of how to be represented. Eesti k.: Looming, 2002, nr. 9. Orig.: Kas meist saavad balti baskid ehk kuidas olla esindatud?

  10. 77 FR 76065 - Endangered and Threatened Wildlife and Plants; Draft Revised Recovery Plan for Kendall Warm...

    Science.gov (United States)

    2012-12-26

    ...] Endangered and Threatened Wildlife and Plants; Draft Revised Recovery Plan for Kendall Warm Springs Dace... revised recovery plan for the Kendall Warm Springs dace (Rhinichthys osculus thermalis). This species is... recovery plan. The Kendall Warm Springs dace (Rhinichthys osculus thermalis), found only in one location in...

  11. A review and comparison of methods for recreating individual patient data from published Kaplan-Meier survival curves for economic evaluations: a simulation study.

    Science.gov (United States)

    Wan, Xiaomin; Peng, Liubao; Li, Yuanjian

    2015-01-01

    In general, the individual patient-level data (IPD) collected in clinical trials are not available to independent researchers to conduct economic evaluations; researchers only have access to published survival curves and summary statistics. Thus, methods that use published survival curves and summary statistics to reproduce statistics for economic evaluations are essential. Four methods have been identified: two traditional methods 1) least squares method, 2) graphical method; and two recently proposed methods by 3) Hoyle and Henley, 4) Guyot et al. The four methods were first individually reviewed and subsequently assessed regarding their abilities to estimate mean survival through a simulation study. A number of different scenarios were developed that comprised combinations of various sample sizes, censoring rates and parametric survival distributions. One thousand simulated survival datasets were generated for each scenario, and all methods were applied to actual IPD. The uncertainty in the estimate of mean survival time was also captured. All methods provided accurate estimates of the mean survival time when the sample size was 500 and a Weibull distribution was used. When the sample size was 100 and the Weibull distribution was used, the Guyot et al. method was almost as accurate as the Hoyle and Henley method; however, more biases were identified in the traditional methods. When a lognormal distribution was used, the Guyot et al. method generated noticeably less bias and a more accurate uncertainty compared with the Hoyle and Henley method. The traditional methods should not be preferred because of their remarkable overestimation. When the Weibull distribution was used for a fitted model, the Guyot et al. method was almost as accurate as the Hoyle and Henley method. However, if the lognormal distribution was used, the Guyot et al. method was less biased compared with the Hoyle and Henley method.

  12. M-X Environmental Technical Report. Environmental Characteristics of Alternative Designated Deployment Areas, Protected Species.

    Science.gov (United States)

    1980-12-22

    purple- spined hedgehog cactus (Echinocereus engelmanii var. purpureus), the Siler pin- cushion cactus (Pediocactus sileri), and the dwarf bear poppy...WHITE RIVER SPINE DACE K WHITE RIVER DESERT SUCKER L WHITE RIVER SPRINGFISH M PAHRANAGAT ROUNDTAIL CHUB* N PAHRUMP KILLIFISH" O MOAPA DACE* P LAHONTAN

  13. Evaluation of protected, threatened, and endangered fish species in Upper Bear Creek watershed

    International Nuclear Information System (INIS)

    Ryon, M.G.

    1998-07-01

    The East Bear Creek Site for the proposed centralized waste facility on the US Department of Energy's Oak Ridge Reservation was evaluated for potential rare, threatened or endangered (T and E) fish species in the six primary tributaries and the main stem of Bear Creek that are within or adjacent to the facility footprint. These tributaries and portion of Bear Creek comprise the upper Bear Creek watershed. One T and E fish species, the Tennessee dace (Phoxinus tennesseensis), was located in these streams. The Tennessee dace is listed by the State of Tennessee as being in need of management, and as such its habitat is afforded some protection. Surveys indicated that Tennessee dace occupy the northern tributaries NT-1, NT-4, and NT-5, as well as Bear Creek. Several specimens of the dace were gravid females, indicating that the streams may function as reproductive habitat for the species. The implications of impacts on the species are discussed and mitigation objectives are included

  14. Valmiera kunstnikud Viljandis / Guna Kalnaca

    Index Scriptorium Estoniae

    Kalnaca, Guna

    1998-01-01

    Valmiera kunsti päevadest Viljandis, kus osalevad 5 professionaalset kunstnikku Valmierast : Dace Bluma-portselan, Vineta Dzervite-graafika, Antra Galzons-maalid, Janis Galzons-maalid, Andris Varpa-skulptuurid. Kunstnike loomingu lühitutvustus.

  15. Dual Axis Controller for Extreme Environments, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — The Dual Axis Controller for Extreme Environments (DACEE) addresses a critical need of NASA's future exploration plans to investigate extreme environments within our...

  16. "ma jätkuvalt vaikin palju ja võimsalt ..." = "es turpinu daudz un spċ̋gi klusṫ ..." = "jeg forsetter å tie mye og heftig ..." : [luuletused] / Dace Sparńe ; tlk. Maima Gr̋nberga, Snorre Karkonens-Svensons

    Index Scriptorium Estoniae

    Sparńe, Dace

    2004-01-01

    Sisu: "ma jätkuvalt vaikin palju ja võimsalt ..." = "es turpinu daudz un spċ̋gi klusṫ ..." = "jeg forsetter å tie mye og heftig ..."; "luba ..." = "apsoli ..." = "lov meg ..."; "punane roos jah-sõna inkarnatsioonina alati ..." = "sarkana roze ḱ j́vŕda inkarnćija b͠s vienmṙ ..." = "en rıd rose forblir inkarnasjonen av jaordet bestandig ..."

  17. Human rights and the challenges of science and technology: Commentary on Meier et al. "Translating the human right to water and sanitation into public policy reform" and Hall et al. "The human right to water: the importance of domestic and productive water rights".

    Science.gov (United States)

    Marks, Stephen P

    2014-12-01

    The expansion of the corpus of international human rights to include the right to water and sanitation has implications both for the process of recognizing human rights and for future developments in the relationships between technology, engineering and human rights. Concerns with threats to human rights resulting from developments in science and technology were expressed in the early days of the United Nations (UN), along with the recognition of the ambitious human right of everyone "to enjoy the benefits of scientific progress and its applications." This comment explores the hypothesis that the emerging concepts most likely to follow recognition of the human right to water primarily involve issues of science and technology, such as access to medicines or clean and healthy environment. Many threats to human rights from advances in science, which were identified in the past as potential, have become real today, such as invasion of privacy from electronic recording, deprivation of health and livelihood as a result of climate change, or control over individual autonomy through advances in genetics and neuroscience. This comment concludes by urging greater engagement of scientists and engineers, in partnership with human rights specialists, in translating normative pronouncements into defining policy and planning interventions.

  18. The question about paleoinformatics

    Science.gov (United States)

    Vartic, Andrei

    2006-12-01

    The author is treating questions about development of informatics in ancient Dacia during Y-th Century B.C. - 2-nd Century A.C. He is introducing a new terminology (paleoinformatics) in view of defining the interests of Daces in numbering, the elementary numbers theory and various aspects of numbers representation. A relation between elementary numbers theory and informatisation has been discussed. A particular interest has been given to calculation of the Circle length/Diameter ratio (number Pi), its calculation by Daces.

  19. 78 FR 69374 - Endangered and Threatened Species; Take of Anadromous Fish

    Science.gov (United States)

    2013-11-19

    ... these species is captured dead or deemed nonviable, it would be retained for genetic analysis. The... Speckled Dace based on genetic and morphological data. The genetic sequence data would be used to better... salmonid populations. In addition, any new data regarding listed species presence would be used to inform...

  20. An emergent multiple predator effect may enhance biotic resistance in a stream fish assemblage

    Science.gov (United States)

    Bret C. Harvey; Jason L. White; Rodney J. Nakamoto

    2004-01-01

    While two cyprinid fishes introduced from nearby drainages have become widespread and abundant in the Eel River of northwestern California, a third nonindigenous cyprinid has remained largely confined to <25 km of one major tributary (the Van Duzen River) for at least 15 years. The downstream limit of this species, speckled dace, does not appear to correspond...

  1. The Environmental Assessment and Management (TEAM) Guide: New Mexico Supplement

    Science.gov (United States)

    2010-03-01

    dace, Phoxinus erythrogaster (j) Colorado pikeminnow, Ptychocheilus lucius (k) loach minnow, Tiaroga cobitis 5-13 Natural Resources Management...writing by the Department, off-site at a readily available location. ST.4.38.NM. Corrective actions must be ta ken u pon a release involving a...cause a public nuisance or threat to human health, safety and welfare, or the environment. Verify th at when c ontaminated s oil is ta ken o ff s ite

  2. Vegetation and Grazing in the St. Katherine Protectorate, South ...

    African Journals Online (AJOL)

    5. Grazing pressure. 1. 2. 3. 4. 5. P lant health. Unk . La bita e. Le gu m ino s a e. Co m p o sita e. A m ara nthac ea e. B ora gin ace ae. C h en opo dia c e ae. E u ph orb iac ea e. S cro ph ula ria cea e. A sc lep id ac e ae. C a ry o phy lla cea e. R ese dace ae. C a pp arace ae. Cuc urb ita cea e. Cruc ife rae. Gram inae. U m be.

  3. Pramana – Journal of Physics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    ... for third-order aberration in the reconstructed wave front of point objects are established by Meier. But Smith, Neil Mohon, Sweatt independently reported that their results differ from that of Meier. We found that coefficients for spherical aberration, astigmatism, tally with Meier's while coefficients for distortion and coma differ.

  4. Mees maalt ja merelt / Eerik Purje

    Index Scriptorium Estoniae

    Purje, Eerik, 1927-

    2004-01-01

    rets. rmt.: Meier, Martin Ottomar. Otto Meier, eestlane : Martin Ottomar Meier, kapten ja laevaomanik. Sündinud 10.11.1881 Heinastes. Surnud 1.08.1955 Pärnus : mälestused. Tallinn : SE&JS, 2004. 328 lk.

  5. Burst Speed of Wild Fishes under High-Velocity Flow Conditions Using Stamina Tunnel with Natural Guidance System in River

    Science.gov (United States)

    Izumi, Mattashi; Yamamoto, Yasuyuki; Yataya, Kenichi; Kamiyama, Kohhei

    Swimming experiments were conducted on wild fishes in a natural guidance system stamina tunnel (cylindrical pipe) installed in a fishway of a local river under high-velocity flow conditions (tunnel flow velocity : 211 to 279 cm·s-1). In this study, the swimming characteristics of fishes were observed. The results show that (1) the swimming speeds of Tribolodon hakonensis (Japanese dace), Phoxinus lagowshi steindachneri (Japanese fat-minnow), Plecoglossus altivelis (Ayu), and Zacco platypus (Pale chub) were in proportion to their body length under identical water flow velocity conditions; (2) the maximum burst speed of Japanese dace and Japanese fat-minnow (measuring 4 to 6 cm in length) was 262 to 319 cm·s-1 under high flow velocity conditions (225 to 230 cm·s-1), while the maximum burst speed of Ayu and Pale chub (measuring 5 cm to 12 cm in length) was 308 to 355 cm·s-1 under high flow velocity conditions (264 to 273 cm·s-1) ; (3) the 50cm-maximum swimming speed of swimming fishes was 1.07 times faster than the pipe-swimming speed; (4) the faster the flow velocity, the shorter the swimming distance became.

  6. Coexistence of fish species in a large lowland river: food niche partitioning between small-sized percids, cyprinids and sticklebacks in submersed macrophytes.

    Science.gov (United States)

    Dukowska, Małgorzata; Grzybkowska, Maria

    2014-01-01

    In the spring and summer of each year, large patches of submersed aquatic macrophytes overgrow the bottom of the alluvial Warta River downstream of a large dam reservoir owing to water management practices. Environmental variables, macroinvertebrates (zoobenthos and epiphytic fauna, zooplankton) and fish abundance and biomass were assessed at this biologically productive habitat to learn intraseasonal dynamics of food types, and their occurrence in the gut contents of small-sized roach, dace, perch, ruffe and three-spined stickleback. Gut fullness coefficient, niche breadth and niche overlap indicated how the fishes coexist in the macrophytes. Chironomidae dominated in the diet of the percids. However, ruffe consumed mostly benthic chironomids, while perch epiphytic chironomids and zooplankton. The diet of dace resembled that in fast flowing water although this rheophilic species occurred at unusual density there. The generalist roach displayed the lowest gut fullness coefficient values and widest niche breadth; consequently, intraspecific rather than interspecific competition decided the fate of roach. Three-spined stickleback differed from the other fishes by consuming epiphytic simuliids and fish eggs. The diet overlap between fishes reaching higher gut fullness coefficient values was rather low when the food associated with the submersed aquatic macrophytes was most abundant; this is congruent with the niche overlap hypothesis that maximal tolerable niche overlap can be higher in less intensely competitive conditions.

  7. Geochemical pathways and biological uptake of radium in small Canadian Shield lakes

    International Nuclear Information System (INIS)

    Hesslein, R.H.; Slavicek, E.

    1984-01-01

    The sediment-water interactions and biological uptake of 226 Ra are described for four small Canadian Shield lakes at the Experimental Lakes Area, Kenora, Ontario. A single addition of 226 Ra was made to each lake between 1970 and 1976. Approximately 90 percent of the added 226 Ra initially sorbed to the sediments. Outflow from the lakes showed losses of only 5-11 percent 226 Ra per year. Models are proposed for adsorption and outflow of 226 Ra from lakes. Biological uptake and long-term 226 Ra concentrations were measured in three species of macrophytes, crayfish, and five species of fish. Bioaccumulation ranged from 1100 to 5000 in macrophytes, 705 in crayfish, from 30 to 80 in large trout (Salvelinus namaycush), white sucker (Catostomus commersoni), and lake whitefish (Coregonus clupeaformis), and from 230 to 1200 in fathead minnows (Pimephales promelas), pearl dace (Semotilus margarita), and northern redbelly dace (Chrosomus eos). The concept of Ra/Ca ratio in organisms versus water and food is used to explain the differences in bioaccumulation. 226 Ra is discriminated against versus calcium by fish but favoured by macrophytes and crayfish

  8. Relative distribution and abundance of fishes and crayfish in 2010 and 2014 prior to saltcedar (Tamarix ssp.) removal in the Amargosa River Canyon, southeastern California

    Science.gov (United States)

    Hereford, Mark E.

    2016-07-22

    The Amargosa River Canyon, located in the Mojave Desert of southeastern California, contains the longest perennial reach of the Amargosa River. Because of its diverse flora and fauna, it has been designated as an Area of Critical Environmental Concern and a Wild and Scenic River by the Bureau of Land Management. A survey of fishes conducted in summer 2010 indicated that endemic Amargosa River pupfish (Cyprinodon nevadensis amargosae) and speckled dace (Rhinichthys osculus spp.) were abundant and occurred throughout the Amargosa River Canyon. The 2010 survey reported non-native red swamp crayfish (Procambarus clarkii) and western mosquitofish (Gambusia affinis) captures were significantly higher, whereas pupfish captures were lower, in areas dominated by non-native saltcedar (Tamarix ssp.). Based on the 2010 survey, it was hypothesized that the invasion of saltcedar could result in a decrease in native species. In an effort to maintain and enhance native fish populations, the Bureau of Land Management removed saltcedar from a 1,550 meter reach of stream on the Amargosa River in autumn 2014 and autumn 2015. Prior to the removal of saltcedar, a survey of fishes and crayfish using baited minnow traps was conducted in the treatment reach to serve as a baseline for future comparisons with post-saltcedar removal surveys. During the 2014 survey, 1,073 pupfish and 960 speckled dace were captured within the treatment reach. Catch per unit effort of pupfish and speckled dace in the treatment reach was less in 2014 than in 2010, although differences could be owing to seasonal variation in capture probability. Non-native mosquitofish catch per unit effort decreased from 2010 to 2014; however, the catch per unit effort of crayfish increased from 2010 to 2014. Future monitoring efforts of this reach should be conducted at the same time period to account for potential seasonal fluctuations of abundance and distribution of fishes and crayfish. A more robust study design that

  9. Studies on water turbine runner which fish can pass through: In case of single stage axial runner

    International Nuclear Information System (INIS)

    Shimizu, Yukimari; Maeda, Takao; Nagoshi, Osamu; Ieda, Kazuma; Shinma, Hisako; Hagimoto, Michiko

    1994-01-01

    The relationship between water turbine runner design and operation and the safe passage of fish through the turbine is studied. The kinds of fish used in the tests are a dace, a sweet fish and a small salmon. A single stage axial runner is used. The velocity and pressure distributions were measured inside the turbine casing and along the casing wall. Many pictures showing fish passing through the rotating runner were taken and analyzed. The swimming speed of the fish was examined from video recordings. Fish pass through the runner more rapidly when they can determine and choose the easier path. Injury and mortality of fish are affected by the runner speed and the location of impact of the runner on the fish body

  10. Fish species of greatest conservation need in wadeable Iowa streams: current status and effectiveness of Aquatic Gap Program distribution models

    Science.gov (United States)

    Sindt, Anthony R.; Pierce, Clay; Quist, Michael C.

    2012-01-01

    Effective conservation of fish species of greatest conservation need (SGCN) requires an understanding of species–habitat relationships and distributional trends. Thus, modeling the distribution of fish species across large spatial scales may be a valuable tool for conservation planning. Our goals were to evaluate the status of 10 fish SGCN in wadeable Iowa streams and to test the effectiveness of Iowa Aquatic Gap Analysis Project (IAGAP) species distribution models. We sampled fish assemblages from 86 wadeable stream segments in the Mississippi River drainage of Iowa during 2009 and 2010 to provide contemporary, independent fish species presence–absence data. The frequencies of occurrence in stream segments where species were historically documented varied from 0.0% for redfin shiner Lythrurus umbratilis to 100.0% for American brook lampreyLampetra appendix, with a mean of 53.0%, suggesting that the status of Iowa fish SGCN is highly variable. Cohen's kappa values and other model performance measures were calculated by comparing field-collected presence–absence data with IAGAP model–predicted presences and absences for 12 fish SGCN. Kappa values varied from 0.00 to 0.50, with a mean of 0.15. The models only predicted the occurrences of banded darterEtheostoma zonale, southern redbelly dace Phoxinus erythrogaster, and longnose daceRhinichthys cataractae more accurately than would be expected by chance. Overall, the accuracy of the twelve models was low, with a mean correct classification rate of 58.3%. Poor model performance probably reflects the difficulties associated with modeling the distribution of rare species and the inability of the large-scale habitat variables used in IAGAP models to explain the variation in fish species occurrences. Our results highlight the importance of quantifying the confidence in species distribution model predictions with an independent data set and the need for long-term monitoring to better understand the

  11. Potential population and assemblage influences of non-native trout on native nongame fish in Nebraska headwater streams

    Science.gov (United States)

    Turek, Kelly C.; Pegg, Mark A.; Pope, Kevin L.; Schainost, Steve

    2014-01-01

    Non-native trout are currently stocked to support recreational fisheries in headwater streams throughout Nebraska. The influence of non-native trout introductions on native fish populations and their role in structuring fish assemblages in these systems is unknown. The objectives of this study were to determine (i) if the size structure or relative abundance of native fish differs in the presence and absence of non-native trout, (ii) if native fish-assemblage structure differs in the presence and absence of non-native trout and (iii) if native fish-assemblage structure differs across a gradient in abundances of non-native trout. Longnose dace Rhinichthys cataractae were larger in the presence of brown trout Salmo trutta and smaller in the presence of rainbow trout Oncorhynchus mykiss compared to sites without trout. There was also a greater proportion of larger white suckers Catostomus commersonii in the presence of brown trout. Creek chub Semotilus atromaculatus and fathead minnow Pimephales promelas size structures were similar in the presence and absence of trout. Relative abundances of longnose dace, white sucker, creek chub and fathead minnow were similar in the presence and absence of trout, but there was greater distinction in native fish-assemblage structure between sites with trout compared to sites without trout as trout abundances increased. These results suggest increased risk to native fish assemblages in sites with high abundances of trout. However, more research is needed to determine the role of non-native trout in structuring native fish assemblages in streams, and the mechanisms through which introduced trout may influence native fish populations.

  12. Multiple myeloma in Nigeria: An insight to the clinical, laboratory ...

    African Journals Online (AJOL)

    The average percentage of bone marrow plasmacytosis at diagnosis ... of autologous stem cell transplantation (ASCT) for white, black, and ... Hospital Cancer Registry and Data Collation Institute. .... Figure 1: (a) Kaplan‑Meier survival curve for all myeloma patients, (b) Kaplan‑Meier survival curve for the different sexes b a ...

  13. Targeting Peripheral-Derived Regulatory T Cells as a Means of Enhancing Immune Responses Directed against Prostate Cancer

    Science.gov (United States)

    2017-08-01

    28 weeks) to complete this study. Furthermore, using Kaplan - Meier survival curves, we have discovered that TR AMP; L ck-cre; Klf2fl/fl mice do...3 2 Thymus Spleen Thymus Spleen FoxP3 FoxP3 Figure 2. Kaplan -Meier survival curve. TRAMP (black) versus TRAMP; Lck-cre; Klf2fl/fl (red) survival

  14. RBPJ and EphrinB2 as Molecular Targets to Treat Brain Arteriovenous Malformation in Notch4 Induced Mouse Model

    Science.gov (United States)

    2017-10-01

    of time for mutant mice to moribundity. We recorded numbers of subjects at risk at 0, 25, 50, 75, 100 days old and use the number to generate Kaplan ...Meier curve. We obtained Kaplan -Meier analysis data showed that time to moribundity doubled in Notch4iGOF- EC;RbpjiΔEC mice, as compared to

  15. Disease: H00630 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available AUTHORS ... Meier FM, Frerix M, Hermann W, Muller-Ladner U ... TITLE ... Current immunotherapy in rheumatoid arthritis. ... JOURNAL ... Immunotherapy 5:955-74 (2013) DOI:10.2217/imt.13.94 ...

  16. Nested Cohort - R software package

    Science.gov (United States)

    NestedCohort is an R software package for fitting Kaplan-Meier and Cox Models to estimate standardized survival and attributable risks for studies where covariates of interest are observed on only a sample of the cohort.

  17. [Survival analysis with competing risks: estimating failure probability].

    Science.gov (United States)

    Llorca, Javier; Delgado-Rodríguez, Miguel

    2004-01-01

    To show the impact of competing risks of death on survival analysis. We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection). Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.

  18. ORIGINAL ARTICLES Antiretroviral treatment for children

    African Journals Online (AJOL)

    Kaplan-Meier survival estimate for 407 children at 1 year was. 84% (95% ... highly active antiretroviral therapy (HAART) to 3 million people living with HIV I AIDS in ... 5 Furthermore, improvements in growth and body composition parameters,.

  19. Histoplasmosis Risk and Prevention

    Science.gov (United States)

    ... Huprikar S, Azie N, Quan SP, Meier-Kriesche HU, Horn DL. Clinical characteristics and outcomes in 303 HIV- ... Slama TG, Norton JA, Kohler RB, Eitzen HE, French ML, et al. Risk factors for disseminated or ...

  20. End of Life (Hospice Care)

    Science.gov (United States)

    ... days of life. Meier DE, et al. Hospice: Philosophy of care and appropriate utilization in the United ... Care Organization. http://www.nhpco.org/hospice-statistics-research-press-room/facts-hospice-and-palliative-care. Accessed ...

  1. Cold Vacuum Drying (CVD) Facility Electrical System Captor and Dapper Study

    International Nuclear Information System (INIS)

    SINGH, G.

    2000-01-01

    The objective of this report is to Validate and as-build the Load and Fault hand calculations performed by Meier Associates. Perform a protective device coordination study, not performed by Meier's, and furnish any recommendations, including recommended device settings. Perform Transient Motor Starting (TMS) analysis for the chillers and also the motors on the standby generator system. Indicate any design problems or NEC Code Violations, if found

  2. Análisis de supervivencia en presencia de riesgos competitivos: estimadores de la probabilidad de suceso Survival analysis with competing risks: estimating failure probability

    Directory of Open Access Journals (Sweden)

    Javier Llorca

    2004-10-01

    Full Text Available Objetivo: Mostrar el efecto de los riesgos competitivos de muerte en el análisis de supervivencia. Métodos: Se presenta un ejemplo sobre la supervivencia libre de rechazo tras un trasplante cardíaco, en el que la muerte antes de desarrollar el rechazo actúa como riesgo competitivo. Mediante una simulación se comparan el estimador de Kaplan-Meier y el modelo de decrementos múltiples. Resultados: El método de Kaplan-Meier sobrestima el riesgo de rechazo. A continuación, se expone la aplicación del modelo de decrementos múltiples para el análisis de acontecimientos secundarios (en el ejemplo, la muerte tras el rechazo. Finalmente, se discuten las asunciones propias del método de Kaplan-Meier y las razones por las que no puede ser aplicado en presencia de riesgos competitivos. Conclusiones: El análisis de supervivencia debe ajustarse por los riesgos competitivos de muerte para evitar la sobrestimación del riesgo de fallo que se produce con el método de Kaplan-Meier.Objective: To show the impact of competing risks of death on survival analysis. Method: We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. Results: The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection. Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Conclusions: Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.

  3. Food web analysis reveals effects of pH on mercury bioaccumulation at multiple trophic levels in streams

    Energy Technology Data Exchange (ETDEWEB)

    Jardine, Timothy D., E-mail: tim.jardine@usask.ca [Canadian Rivers Institute and Department of Biology, University of New Brunswick, Saint John, NB E2L 4L5 (Canada); Kidd, Karen A. [Canadian Rivers Institute and Department of Biology, University of New Brunswick, Saint John, NB E2L 4L5 (Canada); O’ Driscoll, Nelson [Department of Earth and Environmental Sciences, Acadia University, Wolfville, NS B4P 2R6 (Canada)

    2013-05-15

    Highlights: ► We examine biomagnification of Hg through stream food webs using δ15 N. ► Slopes of methyl Hg vs. trophic level were higher than total Hg vs. trophic level. ► Biomagnification from predatory insects to fish was related to pH of the water. ► Biomagnification at lower trophic levels was related to dietary concentrations. ► These trends can explain variation in field-measured Hg in food webs. -- Abstract: Biomagnification processes and the factors that govern them, including those for mercury (Hg), are poorly understood in streams. Total and methyl Hg concentrations and relative trophic position (using δ{sup 15}N) were analyzed in biofilm and invertebrates from 21 streams in New Brunswick, Canada to assess food web biomagnification leading to the common minnow blacknose dace (Rhinichthys atratulus), a species known to have Hg concentrations that are higher in low pH waters. Biomagnification slopes within stream food webs measured using Hg vs. δ{sup 15}N or corresponding trophic levels (TL) differed depending on the chemical species analyzed, with total Hg exhibiting increases of 1.3–2.5 per TL (mean slope of total Hg vs. δ{sup 15}N = 0.14 ± 0.06 S.D., range = 0.06–0.20) and methyl Hg showing a more pronounced increase of 2.8 to 6.0 per TL (mean slope of methyl Hg vs. δ{sup 15}N = 0.30 ± 0.08 S.D., range = 0.22–0.39). While Hg biomagnification slopes through the entire food web (Trophic Magnification Factors, TMFs) were not influenced by water chemistry (pH), dietary concentrations of methyl Hg strongly influenced biomagnification factors (BMFs) for consumer-diet pairs within the food web at lower trophic levels, and BMFs between dace and predatory invertebrates were significantly higher in low pH waters. These analyses, coupled with observations of higher Hg in primary producers in streams with low pH, suggest that pH influences both baseline concentrations and biomagnification of Hg in these systems. Because higher Hg

  4. Food web analysis reveals effects of pH on mercury bioaccumulation at multiple trophic levels in streams

    International Nuclear Information System (INIS)

    Jardine, Timothy D.; Kidd, Karen A.; O’ Driscoll, Nelson

    2013-01-01

    Highlights: ► We examine biomagnification of Hg through stream food webs using δ15 N. ► Slopes of methyl Hg vs. trophic level were higher than total Hg vs. trophic level. ► Biomagnification from predatory insects to fish was related to pH of the water. ► Biomagnification at lower trophic levels was related to dietary concentrations. ► These trends can explain variation in field-measured Hg in food webs. -- Abstract: Biomagnification processes and the factors that govern them, including those for mercury (Hg), are poorly understood in streams. Total and methyl Hg concentrations and relative trophic position (using δ 15 N) were analyzed in biofilm and invertebrates from 21 streams in New Brunswick, Canada to assess food web biomagnification leading to the common minnow blacknose dace (Rhinichthys atratulus), a species known to have Hg concentrations that are higher in low pH waters. Biomagnification slopes within stream food webs measured using Hg vs. δ 15 N or corresponding trophic levels (TL) differed depending on the chemical species analyzed, with total Hg exhibiting increases of 1.3–2.5 per TL (mean slope of total Hg vs. δ 15 N = 0.14 ± 0.06 S.D., range = 0.06–0.20) and methyl Hg showing a more pronounced increase of 2.8 to 6.0 per TL (mean slope of methyl Hg vs. δ 15 N = 0.30 ± 0.08 S.D., range = 0.22–0.39). While Hg biomagnification slopes through the entire food web (Trophic Magnification Factors, TMFs) were not influenced by water chemistry (pH), dietary concentrations of methyl Hg strongly influenced biomagnification factors (BMFs) for consumer-diet pairs within the food web at lower trophic levels, and BMFs between dace and predatory invertebrates were significantly higher in low pH waters. These analyses, coupled with observations of higher Hg in primary producers in streams with low pH, suggest that pH influences both baseline concentrations and biomagnification of Hg in these systems. Because higher Hg concentrations in the diets

  5. [Investigation on sanitation of freshwater aquaculture environments and Clonorchis sinensis intermediate host infection in a city of Pearl River Delta region, China].

    Science.gov (United States)

    Man, Wang; Le, Luo; Xue-Qin, Chen; Lei, Li; Yue-Yi, Fang

    2017-10-19

    To understand the current status of the sanitation of freshwater aquaculture environments, and Clonorchis sinensis infection of freshwater fish in the aquaculture and market in a city of Pearl River Delta region, so as to provide the evidence for formulating the prevention and control strategy of clonorchiasis sinensis. In 2016, based on the distribution of freshwater aquaculture, 36 freshwater fish ponds among 14 towns were selected for sampling and investigation, and 10-20 pieces were collected from each pond. Besides, 3 aquatic product wholesale markets were included, among which 3-6 stalls were selected from each market, and 20-30 pieces were collected from each stall. The metacercaria in the fish was examined by the digestion method. In the 36 fish ponds, there were no toilets with the stool being drained into fish ponds directly, and there was only one pond with duck sheds with the stool being drained into fish ponds directly. Totally 437 pieces of freshwater fish from ponds were detected, with a metacercaria positive rate of 4.35% (19/437). The metacercaria positive fish were distributed in 50% (7/14) of towns and 25% (9/36) ponds. The positive rates of crucian carp, grass carp, dace, aristichthysnobilis, and tilapia were 13.95% (6/43), 4.76% (9/189), 4.44 (2/45), 1.55% (2/129), and 0 (0/31) respectively, with statistically significant difference ( χ 2 = 13.46, P = 0.01). Totally 307 pieces of freshwater fish were collected from the wholesale markets, with a total positive rate of 1.95% (6/307). The positive rate of grass carp and aristichthysnobilis were 3.20% (4/125) and 2.78% (2/72) respectively, and no positive samples were found in crucian carp, dace and tilapia, with no statistically significant difference among the different fish in the infection rate (Fisher exact P = 0.75). The sanitation of freshwater aquaculture environments in a city of Pearl River Delta region is relative good. However, there are different degrees of Clonorchis sinensis

  6. Connectivity and conditional models of access and abundance of species in stream networks.

    Science.gov (United States)

    Chelgren, Nathan D; Dunham, Jason B

    2015-07-01

    Barriers to passage of aquatic organisms at stream road crossings are a major cause of habitat fragmentation in stream networks. Accordingly, large investments have been made to restore passage at these crossings, but often without estimation of population-level benefits. Here, we describe a broad-scale approach to quantifying the effectiveness of passage restoration in terms interpretable at population levels, namely numbers of fish and length of stream gained through restoration, by sampling abundance in a study design that accounts for variable biogeographic species pools, variable stream and barrier configurations, and variable probabilities of capture and detectability for multiple species. We modified an existing zero-inflated negative-binomial model to estimate the probability of site access, abundance conditional on access, and capture probability of individual fish. Therein, we modeled probability of access as a function of gradient, stream road-crossing type, and downstream access by fish simultaneously with a predictive model for abundance at sites accessible to fish. Results indicated that replacement of barriers with new crossing designs intended to allow for greater movement was associated with dramatically higher probability of access for all fishes, including migratory Pacific salmon, trout, sculpin, and lamprey. Conversely, existing non-replaced crossings negatively impacted fish distributions. Assuming no downstream constraints on access, we estimated the potential length of stream restored by the program ranged between 7.33 (lamprey) and 15.28 km (small coastal cutthroat and rainbow trout). These contributions represented a fraction of the total length available upstream (187 km) of replaced crossings. When limited ranges of species were considered, the estimated contributions of culvert replacement were reduced (1.65-km range, for longnose dace to 12.31 km for small coastal cutthroat and rainbow trout). Numbers of fish contributed ranged from

  7. Review of fish diversity in the Lake Huron basin

    Science.gov (United States)

    Roseman, E.F.; Schaeffer, J.S.; Steen, P.J.

    2009-01-01

    Lake Huron has a rich aquatic habitat diversity that includes shallow embayments, numerous tributaries, shallow mid-lake reef complexes, archipelagos, and profundal regions. These habitats provide support for warm, cool, and cold water fish communities. Diversity of fishes in Lake Huron reflects post-glaciation colonization events, current climate conditions, accidental and intentional introductions of non-indigenous species, and extinctions. Most extinction events have been largely associated with habitat alterations, exploitation of fisheries, and interactions with non-indigenous species. The most recent historical survey of extirpated and imperiled species conducted in the late 1970s identified 79 fish species in Lake Huron proper and about 50 additional species in tributaries. Of those 129 species, 20 are now considered extirpated or imperiled. Extirpated species include Arctic grayling, paddlefish, weed shiner, deepwater cisco, blackfin cisco, shortnose cisco, and kiyi. Six species have declined appreciably due to loss of clear-water stream habitat: the river redhorse, river darter, black redhorse, pugnose shiner, lake chubsucker, redside dace, eastern sand darter, and channel darter. While numerous agencies, universities, and other organizations routinely monitor nearshore and offshore fish distribution and abundance, there is a need for more rigorous examination of the distribution and abundance of less-common species to better understand their ecology. This information is critical to the development of management plans aimed at ecosystem remediation and restoration.

  8. pH tolerance of Daphnia pulex (leydig, emend. , richard)

    Energy Technology Data Exchange (ETDEWEB)

    Davis, P; Ozburn, G W

    1969-01-01

    The survival time and reproduction of female Daphnia pulex in solutions varying in pH have been observed. Dilute sodium hydroxide or sulfuric acid solutions were added to four different diluent waters: distilled water, aerated tap water, aerated and filtered tap water from an aquarium containing Dace minnows, and Mcintyre River water. D. Pulex (initially up to 72 hours old) survived for the duration of the experiment (32 hours) in river water within a pH range of 6.1 to 10.3; in aquarium water within a pH range of 4.3 to 10.4; only at pH 6.4 and pH 7.6 in distilled water; and in none of the solutions using aerated tap water. The dissolved oxygen content was measured at the beginning and end of every experiment and was found never to fall below 6.2 p.p.M. Those individuals which survived were cultured in the laboratory and parthenogenesis was observed at pH values between 7.0 and 8.7.

  9. Ar neatliekamās medicīniskās palīdzības brigādēm stacionārā nogādāto pacientu apmierinātība ar veselības aprūpi pirms stacionāra un stacionāra etapā

    OpenAIRE

    Dzene, Dace

    2017-01-01

    Autore: Dace Dzene, stud.apl.nr. dd15034 Darba vadītājs: Dr.med. Igors Ivanovs Ar neatliekamās medicīniskās palīdzības brigādēm stacionārā nogādāto pacientu apmierinātība ar veselības aprūpi pirms stacionāra un stacionāra etapā. Maģistra darbs, Latvijas universitāte, Rīga, 2017. Darbs sastāv no teorētiskās un empīriskās daļas, 6 nodaļām, 66 lapām, 29 attēliem, 10 tabulām, 2 pielikumiem. Pētījuma mērķis ir noskaidrot pacientu apmierinātību ar saņemto veselības aprūpes kvalitāti pirms st...

  10. Performance of an Underground Stormwater Detention Chamber and Comparison with Stormwater Management Ponds

    Directory of Open Access Journals (Sweden)

    Jennifer Drake

    2016-05-01

    Full Text Available The transportation of pollutants from impervious surfaces during runoff events to receiving water bodies is a serious environmental problem. Summer runoff is also heated by impervious surfaces, causing thermal enrichment in receiving water body systems and degradation of coldwater aquatic ecosystems. End-of-pipe stormwater management facilities that are open to the environment can result in further elevated temperatures due to exposure to solar radiation. Receiving water systems that provide coldwater habitat require cool water temperatures to sustain healthy conditions for cold water flora and fauna (e.g., trout, dace. Underground Stormwater Detention Chambers (USDC are a technology for the detention and treatment of stormwater runoff that can potentially solve the thermal issues associated with sun-exposed detention facilities while still providing an equivalent level of treatment services for stormwater pollutants. A field study of an USDC located in Southern Ontario was undertaken to characterize its treatment performance and effect on water temperature. The results were: the USDC was found to provide similar levels of stormwater treatment as wet detention ponds. On average, outlet maximum temperatures were 5 °C cooler than inlet maximum temperatures, and outlet water temperatures remained within the thermal regime for coldwater fish habitat throughout the evaluation period. There was little to no stratification of temperature, nor dissolved solids, but stratification of dissolved oxygen was observed mid-winter and into the spring.

  11. Acute toxicity of zinc to several aquatic species native to the Rocky Mountains.

    Science.gov (United States)

    Brinkman, Stephen F; Johnston, Walter D

    2012-02-01

    National water-quality criteria for the protection of aquatic life are based on toxicity tests, often using organisms that are easy to culture in the laboratory. Species native to the Rocky Mountains are poorly represented in data sets used to derive national water-quality criteria. To provide additional data on the toxicity of zinc, several laboratory acute-toxicity tests were conducted with a diverse assortment of fish, benthic invertebrates, and an amphibian native to the Rocky Mountains. Tests with fish were conducted using three subspecies of cutthroat trout (Colorado River cutthroat trout Oncorhynchus clarkii pleuriticus, greenback cutthroat trout O. clarkii stomias, and Rio Grande cutthroat trout O. clarkii virginalis), mountain whitefish (Prosopium williamsoni), mottled sculpin (Cottus bairdi), longnose dace (Rhinichthys cataractae), and flathead chub (Platygobio gracilis). Aquatic invertebrate tests were conducted with mayflies (Baetis tricaudatus, Drunella doddsi, Cinygmula sp. and Ephemerella sp.), a stonefly (Chloroperlidae), and a caddis fly (Lepidostoma sp.). The amphibian test was conducted with tadpoles of the boreal toad (Bufo boreas). Median lethal concentrations (LC(50)s) ranged more than three orders of magnitude from 166 μg/L for Rio Grande cutthroat trout to >67,000 μg/L for several benthic invertebrates. Of the organisms tested, vertebrates were the most sensitive, and benthic invertebrates were the most tolerant.

  12. Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b

    DEFF Research Database (Denmark)

    Kyndi, M.; Sorensen, F.B.; Alsner, J.

    2008-01-01

    -Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue microarray......, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots...

  13. What kind of “Judean” was Jesus?

    Directory of Open Access Journals (Sweden)

    Markus Cromhout

    2007-05-01

    Full Text Available Reconstructions of the historical Jesus are analyzed in terms of a proposed socio-cultural model of Judean ethnicity. At first an overview is given of the work of Meier and Crossan to establish the content they assigned to Jesus’ Judean ethnicity. Drawing on the insights of ethnicity theory, biblical scholarship and the work of Berger and Luckmann, a socio-cultural model of Judean ethnicity is proposed and explained. The reconstructions of Meier and Crossan are then compared with the proposed model. It is argued that none of their reconstructions allow for Jesus to be seen as profoundly Judean.

  14. Deciphering the Adaptive Immune Response to Ovarian Cancer

    Science.gov (United States)

    2013-10-01

    positive for CD8þ TIL. Conversely, of the cases that were positive for CD8þ TIL, approximately half also contained CD20þ TIL. By Kaplan –Meier analysis...and D). Scale bars: 100 mm (A and B) or 50 mm (C and D). Representative of 5 tumor samples. E, Kaplan –Meier curves showing that the presence of both...CH, Subramanian S, van de Rijn M, Turbin D, et al. Intraepithelial T cells and prognosis in ovarian carcinoma: novel associations with stage, tumor

  15. Heteronuclear long-range correlation, what’s new and how far can it take us?

    DEFF Research Database (Denmark)

    Sørensen, Ole W.

    : A novel experiment for small-molecule and biomolecular NMR at natural isotopic abundance. Sebastian Meier, Andrew J. Benie, Jens Ø. Duus and Ole W. Sørensen, Journal of Magnetic Resonance, in press, doi:10.1016/j.jmr.2009.06.017 Recent progress in heteronuclear long-range NMR of complex carbohydrates: 3D...... H2BC and clean HMBC. Sebastian Meier, Bent O. Petersen, Jens Ø. Duus, Ole W. Sørensen. Carbohydrate Research, in press, doi:10.1016/j.carres.2009.08.013...

  16. #IWD2016 Academic Inspiration

    DEFF Research Database (Denmark)

    Meier, Ninna

    2016-01-01

    What academics or books have inspired you in your writing and research, or helped to make sense of the world around you? In this feature essay, Ninna Meier returns to her experience of reading Hannah Arendt as she sought to understand work and how it relates to value production in capitalist...... economies. Meier recounts how Arendt’s book On Revolution (1963) forged connective threads between the ‘smallest parts’ and the ‘largest wholes’ and showed how academic work is never fully relegated to the past, but can return in new iterations across time....

  17. The Feeding Behaviour of Fish from the Upper Lake Baikal Watershed of the Eroo River in Mongolia

    Directory of Open Access Journals (Sweden)

    Sudeep Chandra

    2005-06-01

    Full Text Available The upper Selenge watershed in Mongolia is home to some of the world’s unique fish species. In this study we determined the feeding behaviour of selected fish species collected from the main stream of the Eroo River and two of its upstream tributaries, the Sharlan and Bar Chuluut rivers. Using stable isotope (carbon and nitrogen measurements combined with qualitative and literature information, we determined that taimen ( Hucho taimen and pike ( Esox luceus were the top predators in the Eroo River. They received a substantial amount of their energy from other fish species as well as terrestrial derived sources. Percent presence of biota in lenok ( Brachymystax lenok stomachs demonstrated they eat zoobenthos, invertebrates, fish, and terrestrial rodents. Siberian dace ( Leuciscus baicalensis , a small forage fish collected from the Sharlan and Bar Chuluut rivers demonstrate these fish eat periphyton, zoobenthos and terrestrial invertebrates. In the Bar Chuluut tributary, lenok eat a combination of foods including zoobenthos and other fish species, while arctic grayling ( Thymallus arcticus fed primarily on zoobenthos. Percent frequency analysis showed the two game fish species collected from the Bar Chuluut tributary fed primarily on zoobenthos (85 % for lenok and 80 % for grayling, with 28 families and 10 orders represented in their stomachs. Interviews with families suggested local people fish for a variety of species and that there has been a decline in the catch of taimen and sturgeon ( Acipenser baeri baicalensis over time. Since fishing was poor below highly disturbed areas (e.g. mine sites, local people fished above mine locations or in areas least impacted by these anthropogenic impacts.

  18. Bioaccumulation of radionuclides in fertilized Canadian Shield lake basins

    International Nuclear Information System (INIS)

    Bird, G.A.; Schwartz, W.J.; Hesslein, R.H.; Mills, K.H.; Turner, M.A.

    1998-01-01

    Radionuclide tracers of heavy metals ( 59 Fe, 60 Co, 65 Zn, 75 Se 85 Sr, 134 Cs and 203 Hg) representing potential contamination from nuclear power plants, industry and agriculture were added to separate basins of Lake 226, Experimental Lakes Area, northwestern Ontario. The two basins were part of a eutrophication experiment and differed in their trophic status; the north basin (L226N) was eutrophic whereas the south basin (L226S) was mesotrophic. Our objective was to determine the uptake of the radionuclides by biota and the effect of lake trophic status on their bioaccumulation. The trophic status of the lakes did not appear to have a marked effect on the accumulation of radionuclides by the biota. This may have been because of a mid-summer leakage of nutrients between the basins which enhanced primary production in L226S, because there is a time lag between primary production and the availability of the radionuclides to the fishes or because trophic status does not affect the uptake of at least some of these radionuclides. However, there was a tendency for faster uptake of the radionuclides in L226N by fish than L226S, but the differences were not significant. Concentrations in the biota generally decreased in the order: fathead minnow>pearl dace>tadpoles>slimy sculpin>leeches. Concentrations in biota generally decreased in the order: 65 Zn> 203 Hg> 75 Se> 134 Cs> 60 Co> 85 Sr= 59 Fe. Cobalt-60 concentrations in tadpoles were greater than in the other biota. Radionuclide concentrations in the tissues of lake whitefish indicated that uptake was predominately from food. Radionuclide concentrations were usually higher in the posterior gut, liver and kidney than in other tissues, whereas body burdens were generally high in the muscle for 75 Se, 134 Cs and 203 Hg; kidney and gut for 60 Co; and bone for 65 Zn and 75 Se. Mercury-203 burdens were also high in the bone and gut

  19. Low concentrations of selenium in stream food webs of eastern Canada

    International Nuclear Information System (INIS)

    Jardine, Timothy D.; Kidd, Karen A.

    2011-01-01

    Herbivorous and predatory invertebrates and two species of fish (brook trout and blacknose dace) were collected from 49 streams in New Brunswick, Canada to determine whether concentrations of selenium (Se) in the biota were affected by a point source (a coal-fired power plant), and stream water chemistry (pH, sulphate, conductivity, and total organic carbon), and to determine the trophic transfer of Se through these food webs. Total Se concentrations in the biota were generally low (0.2 to 4.8 μg g -1 dry weight) across sites and there was no relationship between distance from the coal-fired power plant and Se concentrations in invertebrates or fishes. Water chemistry was an equally poor predictor of Se concentrations in invertebrates and fish. Trophic position (determined using δ 15 N) was a significant predictor of Se concentrations in only five of the stream food webs, and two of these had negative slopes, indicating little or no trophic magnification across most systems; many fishes had lower concentrations than their invertebrate prey and trophic transfer was higher at sites with low invertebrate Se concentrations. Variability in Se concentrations in fishes was explained more by site of capture than microhabitat use within the site (as measured with δ 13 C), suggesting among-site differences in geological sources of Se. Because concentrations were below known toxicity thresholds for fish and other consumers, these results suggest that Se is not an environmental issue in New Brunswick streams that do not receive direct inputs from mining activities. - Research Highlights: → Se concentrations in stream invertebrates and fishes in eastern Canada are low. → Concentrations were not related to water chemistry or distance from a point source. → Se did not biomagnify in the food web, yet was almost always in excess of Hg.

  20. Spatial and temporal (1963-2012 variability of ichthyofauna in the large lowland Warta River, Poland

    Directory of Open Access Journals (Sweden)

    Andrzej Kruk

    2015-11-01

    Full Text Available The Warta River is a tributary of the Odra (Oder River. It is 795.2 km long. In 1986 the large Jeziorsko dam reservoir was constructed in the 306th km of its course. In the late 1980s, the river pollution assumed its highest level and stopped increasing as the former political system collapsed and many industrial plants went bankrupt. Unified fish electrocatches have been performed along the Warta River since the 1960s. During the last sampling, in 2011-2012, fish fauna in the middle course of the river was in the poorest condition due to the destabilizing upstream impact of the Jeziorsko dam reservoir, large amounts of wastewater input to the river, and the lack of unpolluted tributaries that could serve as sources of recolonizers. The weakest human pressure was reported for the upper and lower courses, which resulted in higher numbers of species significantly preferring them, and the higher species richness. Species richness significantly increased in comparison with the previous sampling occasions (in 1963-66, 1986-88, and 1996-98. Significant increases in the stability of occurrence, abundance or biomass were recorded for many species including burbot, chub, dace, ide, gudgeon, bleak, bitterling, perch and spined loach. Significant declines in the above mentioned population parameters were rare and related mainly to European eel (a migratory species. The previously recorded strong negative trend (declines in rheophils, increase in the dominance of roach and perch has been reversed. However, regenerated fish assemblages were not recorded in 1996-98 (i.e. several years after the beginning of the improvement in water quality but in 2011-2012 (i.e. about one decade later. We have noticed a similar delay in ichthyofauna recovery also in the Pilica River (Vistula system. This is why we believe that about 15 years are necessary to observe a considerable improvement in fish fauna in larger degraded rivers.

  1. Fish freshness estimation using eye image processing under white and UV lightings

    Science.gov (United States)

    Kanamori, Katsuhiro; Shirataki, Yuri; Liao, Qiuhong; Ogawa, Yuichi; Suzuki, Tetsuhito; Kondo, Naoshi

    2017-05-01

    A non-destructive method of estimating the freshness of fish is required for appropriate price setting and food safety. In particular, for determining the possibility of eating raw fish (sashimi), freshness estimation is critical. We studied such an estimation method by capturing images of fish eyes and performing image processing using the temporal changes of the luminance of pupil and iris. To detect subtle non-visible changes of these features, we used UV (375 nm) light illumination in addition to visible white light illumination. Polarization and two-channel LED techniques were used to remove strong specular reflection from the cornea of the eye and from clear-plastic wrap used to cover the fish to maintain humidity. Pupil and iris regions were automatically detected separately by image processing after the specular reflection removal process, and two types of eye contrast were defined as the ratio of mean and median pixel values of each region. Experiments using 16 Japanese dace (Tribolodon hakonensis) at 23° and 85% humidity for 24 hours were performed. The eye contrast of raw fish increase non-linearly in the initial period and then decreased; however, that of frozen-thawed fish decreased linearly throughout 24 hours, regardless of the lighting. Interestingly, the eye contrast using UV light showed a higher correlation with time than that using white light only in the case of raw fish within the early 6- hour period postmortem. These results show the possibility of estimating fish freshness in the initial stage when fish are eaten raw using white and UV lightings.

  2. Fish biodiversity of the Gabcikovo waterworks

    International Nuclear Information System (INIS)

    Kirka, A.

    1997-01-01

    The historical full list of fish species of the Danube between mouth of the Morava and Ipel rivers had been prepared through decades. It consisted of 66-69 species, which never appear here all at the same time. After 1971, since the Iron Gate on the Yugoslavia-Romania border had been put in function the migration of the big acipenserids was fully stopped. On the other side introduction of new species of fish continuously increased. However, the number of original species consisted of 57 species. In the Danube the occurrence of 45 species from 50 and in the Slovak side arms system 31 species from 56 species were confirmed since 1992 after damming of the Danube. The new full list of species will be achieved only gradually and no species occurring before the damming will be absent. Up to the present time there are no evidence about extinction of any species. In opposite, there is no doubt, that the old - new species like trouts, danube salmon and others are occurring now again in the main channel of the river namely. New micro-habitats as rocky chutes and submerge weirs have created very convenient living conditions together with very reach sources of food (gammarids) and clear substrate on depositing their eggs when spawning. The Cunovo rocky chute is fully inhabited with common rheofils like: trouts, barb, chub, dace, burbot, and with rare and by law protected: bulkhead, streber, zingel, and and long whiskered gudgeon which during last 50 years was found only three times at the Slovak-Hungarian stretch of the Danube river. After finishing the Danube - Main - Rhine canal, the Black Sea and the Atlantic systems have been connected. Despite that the ship locks are considered top be insurmountable barriers for fish, some experts, believe in equalization of the species potentials of fish of these systems within next 50 years. (author)

  3. South African Gastroenterology Review - Vol 8, No 3 (2010)

    African Journals Online (AJOL)

    A clinical audit of inflammatory bowel disease in a South African tertiary institution · EMAIL FULL TEXT EMAIL FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. L Indiveri, R Berman, M Bhagowat, K Govender, W Meier, A Payne, P Poncana, C Pryce, S Seetahal, M Selela, AD Mahomed.

  4. Third-line Targeted Therapy in Metastatic Renal Cell Carcinoma: Results from the International Metastatic Renal Cell Carcinoma Database Consortium

    DEFF Research Database (Denmark)

    Wells, J Connor; Stukalin, Igor; Norton, Craig

    2017-01-01

    and were included in the analysis. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Patients were analyzed for overall survival (OS) and progression-free survival using Kaplan-Meier curves, and were evaluated for overall response. Cox regression analyses were used to determine the statistical association...

  5. ASURV: Astronomical SURVival Statistics

    Science.gov (United States)

    Feigelson, E. D.; Nelson, P. I.; Isobe, T.; LaValley, M.

    2014-06-01

    ASURV (Astronomical SURVival Statistics) provides astronomy survival analysis for right- and left-censored data including the maximum-likelihood Kaplan-Meier estimator and several univariate two-sample tests, bivariate correlation measures, and linear regressions. ASURV is written in FORTRAN 77, and is stand-alone and does not call any specialized libraries.

  6. Surgical Treatment as a Principle for Patients with High-Grade Pancreatic Neuroendocrine Carcinoma

    DEFF Research Database (Denmark)

    Haugvik, Sven-Petter; Janson, Eva Tiensuu; Österlund, Pia

    2016-01-01

    is uncertain. Methods: Data from patients with a diagnosis of hgPNEC determined between 1998 and 2012 were retrospectively registered at 10 Nordic university hospitals. Kaplan–Meier curves were used to compare the overall survival of different treatment groups, and Cox-regression analysis was used to evaluate...

  7. Elevated plasma vitamin B12 levels and cancer prognosis: A population-based cohort study

    DEFF Research Database (Denmark)

    Arendt, Johan Frederik Håkonsen; Farkas, Dora Kormendine; Pedersen, Lars

    2015-01-01

    patients without a plasma Cbl measurement. Patients treated with Cbl were excluded. Survival probability was assessed using Kaplan-Meier curves. Mortality risk ratios (MRR) were computed using Cox proportional hazard regression, adjusted for age, sex, calendar year, cancer stage and comorbidity, scored...

  8. A Hybrid Analysis for Security Protocols with State

    Science.gov (United States)

    2014-07-16

    http://www.mitre.org/publications/ technical-papers/completeness-of-cpsa. [19] Simon Meier, Cas Cremers , and David Basin. Efficient construction of...7] Cas Cremers and Sjouke Mauw. Operational semantics and verification of security protocols. Springer, 2012. [8] Anupam Datta, Ante Derek, John C

  9. Peritoneal drainage for newborn intestinal perforation: primary ...

    African Journals Online (AJOL)

    Keywords: intestinal perforation in newborn, necrotizing enterocolitis, primary peritoneal drainage. Department of Surgery, Paul L. Foster School of Medicine, Texas Tech University. HSC, El Paso, Texas, USA. Correspondence to Donald E. Meier, MD, Department of Surgery, Paul L. Foster. School of Medicine, Texas Tech ...

  10. MNS16A minisatellite genotypes in relation to risk of glioma and meningioma and to glioblastoma outcome

    DEFF Research Database (Denmark)

    Andersson, U.; Osterman, P.; Sjostrom, S.

    2009-01-01

    was analysed using Kaplan-Meier estimates and equality of survival distributions using the log-rank test and Cox proportional hazard ratios. The MNS16A genotype was not associated with risk of occurrence of glioma, glioblastoma (GBM) or meningioma. For GBM there were median survivals of 15.3, 11.0 and 10...

  11. Kirik aastaks 2000 / Triin Ojari

    Index Scriptorium Estoniae

    Ojari, Triin, 1974-

    1998-01-01

    Katoliku kirik tahab aasta 2000 kirikuga tähistada kolmanda kristliku aastatuhande algamist. Rooma äärelinna Tor Tre Testesse planeeritava kiriku konkursi võitis R. Meier. Lihtsa ristkülikulise saaliga kiriku dominandiks on kolm üksteise taga asuvat kaarduvat seina (kolmainsus!), mille klaasitud 'õhuvahed' toimivad valgusallikaina, klaasist on ka katus.

  12. ÜRO peakorterile otsitakse naabrit / Maria-Kristiina Soomre

    Index Scriptorium Estoniae

    Soomre, Maria-Kristiina, 1978-

    2001-01-01

    New Yorki, ÜRO peakorterist lõunasse hakatakse ehitama uut hoonet. Arhitektuurikonkursist on kutsutud osalema: David Childs, Richard Meier ja Peter Eisenmann; Schuman Lichtenstein Claman Efron ja HOK arhitektid; Kohn Pederson Fox, Davis Brody Bond, Toyo Ito ja Rem Koolhaas; Henry Cobb, James Ingo Freed ja Machado & Silvetti Associates; Christian de Portzamparc ja Gary Edward Handel & Associates

  13. Original Article

    African Journals Online (AJOL)

    jen

    This report is a review of our experience with STS over a 23 year period at a busy ... Hospital, Kaduna, with oral and maxillofacial malignancies between the years ..... LM, Mark K, Meier R, Calcaterra TC, Parker ... Cancer 1962;15:1028-1032.

  14. Role of IKK-alpha in the EGFR Signaling Regulation

    Science.gov (United States)

    2014-09-01

    expression. (E) Kaplan -Meier overall survival curves of IKKin breast cancer patient data set. 16 Reference 1. Lo, H. W., Xia, W., Wei, Y...150- 100- 50- 150- 100- Twist1 AKT1-p AKT-T C 250- 150- 100- N-cad P1 P2 P3 TGFβ - - - + + - + + - - + - - + + + - - + - - + + + 50- Vimentin 150- 100

  15. Managerial strategies and behavior in networks

    NARCIS (Netherlands)

    O'Toole, Laurence J.; Meier, Kenneth J.

    2001-01-01

    This manuscript provides the first systematic test of a formal theory of managing government programs in a network context (see O’Toole and Meier 1999). Using data from several hundred school districts in Texas, we create a measure of network management that reflects the time school superintendents

  16. Millele pöörate eluaseme ostmisel ja üürimisel tähelepanu?

    Index Scriptorium Estoniae

    2005-01-01

    Küsimusele vastavad Brüsselis tööd otsiv Kadri Kuusk, Sampo Panga koolitusosakonna juhataja Külli Meier, finantsinspektsiooni osakonnajuhataja Andre Nõmm, Riigikogu liige Meelis Atonen, Palivere lastekodu juhataja Külle Saar, Helsingis töötav arst Jaak Kiviloog, Narva kooliõpetaja Julia Ivanova, maksu- ja tolliameti peaspetsialist Tiiu Kilk

  17. First line chemotherapy plus trastuzumab in metastatic breast cancer ...

    African Journals Online (AJOL)

    First line chemotherapy plus trastuzumab in metastatic breast cancer HER2 positive - Observational institutional study. ... The progression free survival was estimated by the Kaplan-Meier method, from the date of first cycle to the date of progression or at the last consultation, and the median was 12.8 months. Trastuzumab ...

  18. Survival of Root-filled Teeth in the Swedish Adult Population

    DEFF Research Database (Denmark)

    Fransson, Helena; Dawson, Victoria S; Frisk, Fredrik

    2016-01-01

    INTRODUCTION: The aim was to assess survival in the Swedish population of teeth treated by nonsurgical root canal treatment during 2009. METHODS: Data from the Swedish Social Insurance Agency were analyzed by Kaplan-Meier analysis to assess cumulative tooth survival during a period of 5-6 years o...

  19. Age at sexual initiation and factors associated with it among youths ...

    African Journals Online (AJOL)

    Bernt Lindtjorn

    Objective: The objective of the study was to determine the median age at first sexual intercourse and the associated .... Wollo Zone, Amhara National Regional State, North East ..... censored. Urba n. Rura l. Residence rural/urban. Fig 2: Kaplan Meier curve showing log survival for ..... renting and selling pornography films.

  20. A NEW CLASSIFICATION OF OSTEOMYELITIS FOR DEVELOPING ...

    African Journals Online (AJOL)

    Kateee

    2003-07-01

    Jul 1, 2003 ... Background : The term osteomyelitis (OSM) was first coined by Nelaton in 1844. Waldvogel et al, Cierny-Mader, May et al classifications of OSM from developed countries and Meier et al's from Nigeria have been described. Objective:This new classification was developed to highlight significant pathology ...

  1. Vulnerability Analysis of the MAVLink Protocol for Command and Control of Unmanned Aircraft

    Science.gov (United States)

    2013-03-27

    Patton, Nikos Karapanos, Lorenz Meier, Peter Schwabe, Andrew Tridgell, Michael Oborne, Dr. Gareth Owen, and Capt Matthew Vincie, all of whom greatly...Frew and T. Brown . Networking Issues For Small Unmanned Aircraft Systems. In Unmanned Aircraft Systems : International Symposium on Unmanned Aerial

  2. STAT3 inhibitor enhances chemotherapy drug efficacy by ...

    African Journals Online (AJOL)

    Immunohistochemistry and Kaplan-Meier method of survival analysis were used to determine chemoresistance trends in patients. STAT3 inhibitor treatment, RNAi or ectopic overexpression of STAT3 or MUC1 in NSCLC cells were used to determine their inter-molecular relation and for modulating stemness-related genes.

  3. Survival analysis II: Cox regression

    NARCIS (Netherlands)

    Stel, Vianda S.; Dekker, Friedo W.; Tripepi, Giovanni; Zoccali, Carmine; Jager, Kitty J.

    2011-01-01

    In contrast to the Kaplan-Meier method, Cox proportional hazards regression can provide an effect estimate by quantifying the difference in survival between patient groups and can adjust for confounding effects of other variables. The purpose of this article is to explain the basic concepts of the

  4. From perceptual rags to metaphoric riches: Bodily, social, and cultural constraints on socio-cognitive metaphors

    NARCIS (Netherlands)

    IJzerman, H.; Koole, S.L.

    2011-01-01

    What leads people to describe some of their interpersonal relationships as " close" and " warm" and others as " distant" and " cold" ? Landau, Meier, and Keefer (2010) proposed that conceptual metaphors facilitate social cognition by allowing people to use knowledge from a relatively concrete

  5. Absolute, Extreme-Ultraviolet Solar Spectral Irradiance Monitor (AESSIM)

    Science.gov (United States)

    1994-04-01

    molecular constituents [Meier 1991]. This radiation is the principal source of energy for producing and maintaining the complex, time-dependent, thermal...158.4 nm emisions for interstellar wind studies. After -2005, there is unlikely to be sufficient power to provide the requisite heating of the scan

  6. Resources for Topics in Architecture.

    Science.gov (United States)

    Van Noate, Judith, Comp.

    This guide for conducting library research on topics in architecture or on the work of a particular architect presents suggestions for utilizing four categories of resources: books, dictionaries and encyclopedias, indexes, and a periodicals and series list (PASL). Two topics are researched as examples: the contemporary architect Richard Meier, and…

  7. University of Hawaii Institute for Astronomy

    Science.gov (United States)

    2001-01-01

    Thornton, Scott Sheppard, and Wei-Hao Wang. Visiting colleagues included Marcelo Emilio , Miwa Go- to, Olivier Guyon, Masatoshi Imanishi, Roland Meier...Univ. Nevada, Las Vegas ), and C. Deliyannis (Indiana Univ.). Spectroscopic observations at high spectral resolu- tion of unevolved stars in globular

  8. Epilepsy in Rett syndrome--lessons from the Rett networked database

    DEFF Research Database (Denmark)

    Nissenkorn, Andreea; Levy-Drummer, Rachel S; Bondi, Ori

    2015-01-01

    collected. Statistical analysis was done using the IBM SPSS Version 21 software, logistic regression, and Kaplan-Meier survival curves. RESULTS: Epilepsy was present in 68.1% of the patients, with uncontrolled seizures in 32.6% of the patients with epilepsy. Mean age of onset of epilepsy was 4...

  9. Carbonic anhydrase IX and response to postmastectomy radiotherapy in high-risk breast cancer: a subgroup analysis of the DBCG82 b and c trials

    DEFF Research Database (Denmark)

    Kyndi, M.; Sorensen, F.B.; Alsner, J.

    2008-01-01

    -points were loco-regional recurrence, distant metastases, disease-specific survival and overall survival. Statistical analyses included kappa statistics, chi(2) or exact tests, Kaplan-Meier probability plots, Log-rank test and Cox regression analyses. Results CA IX was assessable in 945 cores. The percentage...

  10. Birth interval and its predictors among married women in Dabat ...

    African Journals Online (AJOL)

    2008-12-30

    Birth intervals (time between two successive live births) if short are associated with diverse complications. We assessed birth interval and its predictors among 613 married women who gave birth from January 1 to December 30, 2008. Data were collected in April 2012. Life table and Kaplan-Meier curve were used to ...

  11. Diskurskonflikte im 18. Jahrhundert

    DEFF Research Database (Denmark)

    Finsen, Hans Carl

    2010-01-01

      Georg Friedrich Meier will am Beispiel des Scherzes über den leichten geselligen Auftritt reden. Die Argumente bezieht er dabei aus zwei unterschiedlichen Registern, der Rhetorik und dem rationalistischen Wissenschaftsdenken. Das Wissen über das Ideal der leichten Geselligkeit wird von der Rhet...

  12. Modelling the survivorship of Nigeria children in their first 10 years of ...

    African Journals Online (AJOL)

    Fagbamigbe

    Conflict of Interest: Authors declared no conflict of interest ... Keywords: Survivorship, Nigeria, children mortality, Kaplan Meier, Brass Indirect method, Prediction ... variables or sex of older siblings, post- neonatal mortality is 12% higher and 2nd ... Relationship between maternal education and child survival in developing ...

  13. Fundamental Plane of FSRQs from SDSS DR5 Quasar Catalogue ...

    Indian Academy of Sciences (India)

    Introduction. The formation of relativistic jets in active galactic nuclei (AGNs) is still unclear due to fundamental problems in astrophysics (Meier et al. 2001). Although the jet formation remains unclear, the relationships explored between the jet emission and accretion processes have been explored by many authors ...

  14. In Situ Bioremediation of Perchlorate in Vadose Zone Source Areas

    Science.gov (United States)

    2011-01-01

    tinder the NJDEP lab certification program. (2) Not available as· a certified para meier 11nder tire. NJDEP lab certification program, ( ’ ) 110...paramaters wrder the NJDEP lab cerlijication program. (2) Not available us a certif>ed parameter Tinder thi! NJDEP lab url!fication pragrarn. ( ) no

  15. Influence of antiviral therapy on survival of patients with hepatitis B ...

    African Journals Online (AJOL)

    The mortality rates in two groups were evaluated with Kaplan-Meier estimate. ... 274 (76.9 %) died, with 89 patients belonging to the antiviral group while the ... TACE is different from systemic ... and identification of study participants was not ..... Table 3: Cox regression analysis to deteermine variables associated with overall ...

  16. The influence of obesity on response to tumour necrosis factor-α inhibitors in psoriatic arthritis

    DEFF Research Database (Denmark)

    Højgaard, Pil; Glintborg, Bente; Kristensen, Lars Erik

    2016-01-01

    OBJECTIVES: To investigate the impact of obesity on response to the first TNF-α inhibitor (TNFI) treatment course in patients with PsA followed in routine care. METHODS: We performed an observational cohort study based on the Danish and Icelandic biologics registries. Kaplan-Meier plots, Cox and ...

  17. Application of the standard lymphadenectomy in gastric adenocarcinoma

    International Nuclear Information System (INIS)

    Aguirre Fernandez, Roberto Eduardo; LLera Dominguez, Gerardo de la; Pennon Guerra, Maria; Alvarez Perez, Alvaro

    2011-01-01

    The 5-years postoperative survival of 132 patients operated on due to gastric adenocarcinoma that underwent lymphadenectomy of the two first ganglionic levels. The results of the epidemiological parameters were determined and the survival by Kaplan-Meier method was defined

  18. It's Not Easy to Stand up to Cyberbullies, but We Must

    Science.gov (United States)

    O'Neil, Robert M.

    2008-01-01

    A decade ago, the Supreme Court was almost ready to confer First Amendment protection on the "Internet" believing that it was sufficiently benign. Little did everyone anticipate how different that rosy view might seem today. Several troubling developments have occurred within the past months. Megan Meier, a 13-year-old in Missouri, was apparently…

  19. Clinical outcome among HIV-infected patients starting saquinavir hard gel compared to ritonavir or indinavir

    DEFF Research Database (Denmark)

    Kirk, O; Mocroft, A; Pradier, C

    2001-01-01

    -up within the EuroSIDA study. METHODS: Changes in plasma viral load (pVL) and CD4 cell count from baseline were compared between treatment groups. Time to new AIDS-defining events and death were compared in Kaplan--Meier models, and Cox models were established to further assess differences in clinical...

  20. State-of-art of the vegetation influence on the built environment: from the urban to the building scale; Estado da arte acerca da influencia da vegetacao no ambiente construido: da escala urbana a do edificio

    Energy Technology Data Exchange (ETDEWEB)

    Pietrobon, Claudio E. [Universidade Estadual de Maringa, PR (Brazil). Dept. de Engenharia Civil]. E-mail: carmen@cybertelecom.com.br; Lamberts, Roberto [Santa Catarina Univ., Florianopolis, SC (Brazil). Dept. de Engenharia Civil]. E-mail: lamberts@ecv.ufsc.br; Pereira, Fernando O.R. [Santa Catarina Univ., Florianopolis, SC (Brazil). Dept. de Arquitetura e Urbanismo]. E-mail: feco@arq.ufsc.br

    2000-07-01

    This review paper presents the research made in USA, including studies made by the Lawrence Berkeley Laboratory - University of California and the review papers made by MEIER(1991) and GIVONI(1991). Also, it presents brazilian studies and research about landscaping strategies to climatic mitigation, visual comfort and electric energy conservation on the built environment. (author)

  1. The Materiality of Research

    DEFF Research Database (Denmark)

    Meier, Ninna

    2016-01-01

    In this feature essay, Ninna Meier explores the relationship between time, space and academic writing. She ponders the ‘portable magic’ of research: namely, the capacity for our thoughts to be both grounded in a particular point in time and space and yet simultaneously ‘free from these dimensions...

  2. The Materiality of Research

    DEFF Research Database (Denmark)

    Meier, Ninna

    2016-01-01

    In this feature essay, Ninna Meier reflects on the materiality of the writing – and re-writing – process in academic research. She explores the ways in which our ever-accummulating thoughts come to form layers on the material objects in which we write our notes and discusses the pleasures of co-authorship....

  3. Is there racial/ethnic variance in cervical cancer- specific survival of ...

    African Journals Online (AJOL)

    incident cervical carcinoma, between 1992 and 1999, in the Surveillance Epidemiology and End Results (SEER) Data was linked with Medicare to examine the impact of race/ethnicity on overall and cancer-specific survival, using Kaplan Meier survival estimates and multivariable Cox Regression model. Results: There was ...

  4. Cryptanalysis of the LAKE Hash Family

    DEFF Research Database (Denmark)

    Biryukov, Alex; Gauravaram, Praveen; Guo, Jian

    2009-01-01

    We analyse the security of the cryptographic hash function LAKE-256 proposed at FSE 2008 by Aumasson, Meier and Phan. By exploiting non-injectivity of some of the building primitives of LAKE, we show three different collision and near-collision attacks on the compression function. The first attac...

  5. Can Video Games Be Educational?

    Science.gov (United States)

    Criswell, Chad

    2009-01-01

    One of the biggest debates among music educators today is about whether or not video games are a valid educational tool. As far back as the early 1990s, teachers were using games such as Sid Meier's Civilization to reinforce history and social studies concepts, but until recently games that dealt with areas of music education have been few and far…

  6. Telenovela'de keel / Kaisa Karu

    Index Scriptorium Estoniae

    Karu, Kaisa

    2007-01-01

    Kolumbia telenovela "Luna" peategelasi kehastavad venetsueelalane Gaby Espino ja peruulane Christian Meier. Üheks raskuseks töö juures on erinevate aktsentide ühtlustamise vajadus. Lühidalt ka näitlejate varasemast karjäärist

  7. Therapeutic Inhibition of Pro-Inflammatory Signaling and Toxicity to Staphylococcal Enterotoxin B by a Synthetic Dimeric BB-Loop Mimetic of MyD88

    Science.gov (United States)

    2012-07-27

    56 stock solution and 75 ml of the 16 dilution buffer was mixed with 25 ml of the supernatant, incubated for 30 min at 65 oC to inactivate endogenous ...shock by staphylococcal pyrogenic exotoxin type C. Infect Immun 36: 123–128. Meier survival analysis and log-rank tests were performed to compare

  8. Bias and precision of methods for estimating the difference in restricted mean survival time from an individual patient data meta-analysis

    Directory of Open Access Journals (Sweden)

    Béranger Lueza

    2016-03-01

    Full Text Available Abstract Background The difference in restricted mean survival time ( rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , the area between two survival curves up to time horizon t ∗ $$ {t}^{\\ast } $$ , is often used in cost-effectiveness analyses to estimate the treatment effect in randomized controlled trials. A challenge in individual patient data (IPD meta-analyses is to account for the trial effect. We aimed at comparing different methods to estimate the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ from an IPD meta-analysis. Methods We compared four methods: the area between Kaplan-Meier curves (experimental vs. control arm ignoring the trial effect (Naïve Kaplan-Meier; the area between Peto curves computed at quintiles of event times (Peto-quintile; the weighted average of the areas between either trial-specific Kaplan-Meier curves (Pooled Kaplan-Meier or trial-specific exponential curves (Pooled Exponential. In a simulation study, we varied the between-trial heterogeneity for the baseline hazard and for the treatment effect (possibly correlated, the overall treatment effect, the time horizon t ∗ $$ {t}^{\\ast } $$ , the number of trials and of patients, the use of fixed or DerSimonian-Laird random effects model, and the proportionality of hazards. We compared the methods in terms of bias, empirical and average standard errors. We used IPD from the Meta-Analysis of Chemotherapy in Nasopharynx Carcinoma (MAC-NPC and its updated version MAC-NPC2 for illustration that included respectively 1,975 and 5,028 patients in 11 and 23 comparisons. Results The Naïve Kaplan-Meier method was unbiased, whereas the Pooled Exponential and, to a much lesser extent, the Pooled Kaplan-Meier methods showed a bias with non-proportional hazards. The Peto-quintile method underestimated the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , except with non-proportional hazards at t ∗ $$ {t}^{\\ast } $$ = 5 years. In the presence of treatment effect

  9. Reporting of loss to follow-up information in randomised controlled trials with time-to-event outcomes: a literature survey

    Directory of Open Access Journals (Sweden)

    Bender Ralf

    2011-09-01

    Full Text Available Abstract Background To assess the reporting of loss to follow-up (LTFU information in articles on randomised controlled trials (RCTs with time-to-event outcomes, and to assess whether discrepancies affect the validity of study results. Methods Literature survey of all issues of the BMJ, Lancet, JAMA, and New England Journal of Medicine published between 2003 and 2005. Eligible articles were reports of RCTs including at least one Kaplan-Meier plot. Articles were classified as "assessable" if sufficient information was available to assess LTFU. In these articles, LTFU information was derived from Kaplan-Meier plots, extracted from the text, and compared. Articles were then classified as "consistent" or "not consistent". Sensitivity analyses were performed to assess the validity of study results. Results 319 eligible articles were identified. 187 (59% were classified as "assessable", as they included sufficient information for evaluation; 140 of 319 (44% presented consistent LTFU information between the Kaplan-Meier plot and text. 47 of 319 (15% were classified as "not consistent". These 47 articles were included in sensitivity analyses. When various imputation methods were used, the results of a chi2-test applied to the corresponding 2 × 2 table changed and hence were not robust in about half of the studies. Conclusions Less than half of the articles on RCTs using Kaplan-Meier plots provide assessable and consistent LTFU information, thus questioning the validity of the results and conclusions of many studies presenting survival analyses. Authors should improve the presentation of both Kaplan-Meier plots and LTFU information, and reviewers of study publications and journal editors should critically appraise the validity of the information provided.

  10. ["That flesh, pink and perishable": analysis of disease-free survival analysis in breast cancer in Gipuzkoa (Spain) in the presence of competing risks].

    Science.gov (United States)

    Martínez-Camblor, Pablo; Larrañaga, Nerea; Sarasqueta, Cristina; Mitxelena, María José; Basterretxea, Mikel

    2009-01-01

    To analyze time of disease-free survival and relative survival in women diagnosed with breast cancer in the province of Gipuzkoa within the context of competing risks by assessing differences between the direct use of the Kaplan-Meier estimator and the multiple decrement method on the one hand, and relative survival on the other. All registered breast cancer cases in Gipuzkoa in 1995 and 1996 with stages other than stage IV were included. An 8-year follow-up for recurrence and a 10-year follow-up for survival were performed. Time of disease-free survival was studied by the multiple decrement model. Observed survival and survival corrected by the expected mortality in the population (relative survival) were also studied. Estimation of the probability of recurrence at 8 years with the multiple decrement method was 8.8% lower than that obtained with the Kaplan-Meier method. The difference between the observed and relative survival rates at 10 years was 10.8%. Both results show how, in this case, the Kaplan-Meier estimator overestimates both the probability of recurrence and that of mortality from the disease. Two issues are often overlooked when performing survival analyses: firstly, because of the lack of independence between survival time and censoring time, the results obtained by the Kaplan-Meier estimator are uninterpretable; secondly, it is an incontrovertible fact that one way or another, everyone causes failures. In this approach, survival analyses must take into account the probability of failure in the general population of reference. The results obtained in this study show that superficial use of the Kaplan Meier estimator overestimates both the probability of recurrence and that of mortality caused by the disease.

  11. Serum level of soluble urokinase-type plasminogen activator receptor is a strong and independent predictor of survival in human immunodeficiency virus infection

    DEFF Research Database (Denmark)

    Sidenius, N; Sier, C.F.M.; Ullum, H

    2000-01-01

    levels of soluble uPAR (suPAR) in patients with advanced HIV-1 disease and whether the serum level of suPAR is predictive of clinical outcome. Using an enzyme-linked immunosorbent assay, the level of suPAR was measured retrospectively in serum samples from 314 patients with HIV-1 infection. By Kaplan......-Meier and Cox regression analyses, the serum suPAR levels were correlated to survival with AIDS-related death as the end point. High levels of serum suPAR (greater than median) were associated with poor overall survival, and Kaplan-Meier analysis on patients stratified by suPAR level demonstrated a continuous...

  12. Cardiovascular Risk Factors and 5-year Mortality in the Copenhagen Stroke Study

    DEFF Research Database (Denmark)

    Kammersgaard, Lars Peter; Olsen, Tom Skyhøj

    2005-01-01

    population. METHODS: We studied 905 ischemic stroke patients from the community-based Copenhagen Stroke Study. Patients had a CT scan and stroke severity was measured by the Scandinavian Stroke Scale on admission. A comprehensive evaluation was performed by a standardized medical examination...... and questionnaire for cardiovascular risk factors, age, and sex. Follow-up was performed 5 years after stroke, and data on mortality were obtained for all, except 6, who had left the country. Five-year mortality was calculated by the Kaplan-Meier procedure and the influence of multiple predictors was analyzed...... by Cox proportional hazards analyses adjusted for age, gender, stroke severity, and risk factor profile. RESULTS: In Kaplan-Meier analyses atrial fibrillation (AF), ischemic heart disease, diabetes, and previous stroke were associated with increased mortality, while smoking and alcohol intake were...

  13. Prognostic significance of transient myocardial ischaemia after first acute myocardial infarction: five year follow up study

    DEFF Research Database (Denmark)

    Mickley, H; Nielsen, J R; Berning, J

    1995-01-01

    infarction. MAIN OUTCOME MEASURES: Relation of ambulatory ST segment depression, exercise test variables, and left ventricular ejection fraction to subsequent objective (cardiac death or myocardial infarction) or subjective (need for coronary revascularisation) events. RESULTS: 23 of the 123 patients had...... an association between transient ST segment depression and an adverse long term outcome was found (Kaplan-Meier analysis; P = 0.004). The presence of exercise induced angina identified a similar proportion of patients with a poor prognosis (Kaplan-Meier analysis; P ... ST segment depression had high specificity but poor sensitivity. The presence of exercise induced ST segment depression was of no value in predicting combined cardiac events. Indeed, patients without exertional ST segment depression were at increased risk of future objective end points (Kaplan...

  14. Cardiovascular risk factors and 5-year mortality in the Copenhagen Stroke Study

    DEFF Research Database (Denmark)

    Kammersgaard, Lars Peter; Olsen, Tom Skyhøj

    2005-01-01

    population. METHODS: We studied 905 ischemic stroke patients from the community-based Copenhagen Stroke Study. Patients had a CT scan and stroke severity was measured by the Scandinavian Stroke Scale on admission. A comprehensive evaluation was performed by a standardized medical examination...... and questionnaire for cardiovascular risk factors, age, and sex. Follow-up was performed 5 years after stroke, and data on mortality were obtained for all, except 6, who had left the country. Five-year mortality was calculated by the Kaplan-Meier procedure and the influence of multiple predictors was analyzed...... by Cox proportional hazards analyses adjusted for age, gender, stroke severity, and risk factor profile. RESULTS: In Kaplan-Meier analyses atrial fibrillation (AF), ischemic heart disease, diabetes, and previous stroke were associated with increased mortality, while smoking and alcohol intake were...

  15. Safety, tolerability, and initial efficacy of AZD6140, the first reversible oral adenosine diphosphate receptor antagonist, compared with clopidogrel, in patients with non-ST-segment elevation acute coronary syndrome: primary results of the DISPERSE-2 trial

    DEFF Research Database (Denmark)

    Cannon, Christopher P; Husted, Steen; Harrington, Robert A

    2007-01-01

    , or clopidogrel 300-mg loading dose plus 75 mg once daily for up to 12 weeks. RESULTS: The primary end point, the Kaplan-Meier rate of major or minor bleeding through 4 weeks, was 8.1% in the clopidogrel group, 9.8% in the AZD6140 90-mg group, and 8.0% in the AZD6140 180-mg group (p = 0.43 and p = 0.......96, respectively, vs. clopidogrel); the major bleeding rates were 6.9%, 7.1%, and 5.1%, respectively (p = 0.91 and p = 0.35, respectively, vs. clopidogrel). Although not statistically significant, favorable trends were seen in the Kaplan-Meier rates of myocardial infarction (MI) over the entire study period (MI: 5...

  16. A population-based study of survival and discharge status for survivors after head injury

    DEFF Research Database (Denmark)

    Engberg, Aase Worså; Teasdale, T W

    2004-01-01

    and cerebral lesion was described quantitatively through Kaplan-Meier survival distributions. Besides, patterns of severity, neurophysical and mental sequelae among survivors 5, 10 and 15 years post-injury were described. It was shown by examples how the study has been useful already for the planning......-Meier survival functions were calculated for these two categories. Hospital records for a random sample of 389 survivors in 1997 after cranial fracture, acute brain lesion or chronical subdural haematoma, which occurred in 1982, 1987 and 1992 in patients aged 15 years or more at injury, were reviewed. Survivors...... the decreasing incidence with time, the point prevalence of survivors in 1997 after brain lesions occurring in 1982, 1987 or 1992 was nearly the same, averaging 8.4 per 100 000 of the population above age 14. Half of them were severe, as defined by initial Glasgow Coma Score

  17. Treatment of primary tracheal carcinoma. The role of external and endoluminal radiotherapy

    International Nuclear Information System (INIS)

    Harms, W.; Wannenmacher, M.; Becker, H.; Herth, F.; Gagel, B.

    2000-01-01

    Background and Purpose: In a retrospective study the role of radiation therapy for the treatment of primary tracheal carcinoma was investigated. Patients and Methods: Between 1984 and 1997, 25 patients with primary tracheal carcinoma were treated with external beam radiotherapy (17 squamous-cell carcinoma [SCC], 8 adenoid cystic carcinoma [ACC], median dose SCC 60 Gy, ACC 55 Gy). An additional brachytherapy boost was carried out in 10/25 patients (median dose SCC 18 Gy, ACC 15 Gy). Ten patients underwent operative treatment. Results: The median survival (Kaplan-Meier) for patients with SCC was 33 months (ACC 94.2). The 1-, 2- and 5-year survival rates (Kaplan-Meier) for patients with SCC were 64.7% (ACC 85.7%), 64.7% (ACC 85.7%), and 26% (ACC 85.7%). Patients with ACC and patients with a complete remission after treatment had a significantly better survival probability (log rank test, p [de

  18. Survival Analysis of Patients with End Stage Renal Disease

    Science.gov (United States)

    Urrutia, J. D.; Gayo, W. S.; Bautista, L. A.; Baccay, E. B.

    2015-06-01

    This paper provides a survival analysis of End Stage Renal Disease (ESRD) under Kaplan-Meier Estimates and Weibull Distribution. The data were obtained from the records of V. L. MakabaliMemorial Hospital with respect to time t (patient's age), covariates such as developed secondary disease (Pulmonary Congestion and Cardiovascular Disease), gender, and the event of interest: the death of ESRD patients. Survival and hazard rates were estimated using NCSS for Weibull Distribution and SPSS for Kaplan-Meier Estimates. These lead to the same conclusion that hazard rate increases and survival rate decreases of ESRD patient diagnosed with Pulmonary Congestion, Cardiovascular Disease and both diseases with respect to time. It also shows that female patients have a greater risk of death compared to males. The probability risk was given the equation R = 1 — e-H(t) where e-H(t) is the survival function, H(t) the cumulative hazard function which was created using Cox-Regression.

  19. Parental consanguineous marriages and clinical response to chemotherapy in locally advanced breast cancer patients.

    Science.gov (United States)

    Saadat, Mostafa; Khalili, Maryam; Omidvari, Shahpour; Ansari-Lari, Maryam

    2011-03-28

    The main aim of the present study was investigating the association between parental consanguinity and clinical response to chemotherapy in females affected with locally advanced breast cancer. A consecutive series of 92 patients were prospectively included in this study. Clinical assessment of treatment was accomplished by comparing initial tumor size with preoperative tumor size using revised RECIST guideline (version 1.1). Clinical response defined as complete response, partial response and no response. The Kaplan-Meier survival analysis were used to evaluate the association of parental marriages (first cousin vs unrelated marriages) and clinical response to chemotherapy (complete and partial response vs no response). Number of courses of chemotherapy was considered as time, in the analysis. Kaplan-Meier analysis revealed that offspring of unrelated marriages had poorer response to chemotherapy (log rank statistic=5.10, df=1, P=0.023). Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  20. Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b&c

    DEFF Research Database (Denmark)

    Kyndi, Marianne; Sørensen, Flemming Brandt; Knudsen, Helle

    2008-01-01

    -Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......PURPOSE: To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). PATIENTS AND METHODS: The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue...... tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. RESULTS: p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan...

  1. Comparative pathogenicity of Vibrio spp., Photobacterium damselae ssp. damselae and five isolates of Aeromonas salmonicida ssp. achromogenes in juvenile Atlantic halibut (Hippoglossus hippoglossus).

    Science.gov (United States)

    Bowden, T J; Bricknell, I R; Preziosi, B M

    2018-01-01

    Juvenile Atlantic halibut (~100 mg, Hippoglossus hippoglossus) were exposed to Vibrio proteolyticus, a Vibrio spp. isolate, Photobacterium damselae ssp. damselae and five different isolates of Aeromonas salmonicida ssp. achromogenes via an hour-long bath immersion to ascertain their variation in pathogenicity to this fish species. Results were analysed using Kaplan-Meier survival analysis. Analysis of the data from challenges using A. salmonicida ssp. achromogenes revealed three survival values of zero and a spread of values from 0 to 28.43. Challenges using a Vibrio spp isolate, V. proteolyticus and P. damselae resulted in Kaplan-Meier survival estimates of 31.21, 50.41 and 57.21, respectively. As all bacterial species tested could induce juvenile halibut mortalities, they must all be considered as potential pathogens. However, the degree of pathogenicity of A. salmonicida is isolate dependent. © 2017 John Wiley & Sons Ltd.

  2. Impact of Comorbidities on Tumor Necrosis Factor Inhibitor Therapy in Psoriatic Arthritis

    DEFF Research Database (Denmark)

    Ballegaard, Christine; Højgaard, Pil; Dreyer, Lene

    2017-01-01

    characteristics, disease activity and treatment response and persistence was obtained from the DANBIO registry. Information on comorbidities according to the Charlson Comorbidity Index (CCI) was obtained through linkage with the Danish National Patient Register. Kaplan-Meier plots and Cox proportional hazard...... compared with patients without comorbidities (hazard ratio 1.72, [1.26 to 2.37], p = 0.001). A smaller proportion of patients with a CCI score ≥ 2 achieved European League Against Rheumatism (EULAR) good response (p

  3. Tetranectin positive expression in tumour tissue leads to longer survival in Danish women with ovarian cancer. Results from the 'Malova' ovarian cancer study

    DEFF Research Database (Denmark)

    Heeran, Mel C; Rask, Lene; Høgdall, Claus K

    2015-01-01

    of the disease. Using tissue arrays we analysed the expression levels in tissues from 166 women with borderline ovarian tumours (BOTs) and 592 women with ovarian cancer (OC). A panel of three antibodies was used for immunohistochemistry: a polyclonal and two monoclonal antibodies. Serum TN was measured using...... found to imply longer OS (p Kaplan-Meier survival analysis performed on all OC cases showed a significantly longer OS (p = 0...

  4. Short-term mortality in patients with myocardial injury and myocardial infarction type 1 and type 2

    DEFF Research Database (Denmark)

    Sarkisian, Laura; Saaby, L.; Poulsen, T. S.

    2015-01-01

    -year period we prospectively studied hospitalized patients having cardiac troponin I (cTnI) measured on clinical indication. The diagnosis of type 1 and type 2 MI was according to the universal definition involving a rising and/or falling pattern of cTnI values above the decision limit of 30 ng/L. c....... The results are depicted in the figure (Kaplan-Meier curves, log-rank-test; p-value...

  5. Measuring survival time: a probability-based approach useful in healthcare decision-making.

    Science.gov (United States)

    2011-01-01

    In some clinical situations, the choice between treatment options takes into account their impact on patient survival time. Due to practical constraints (such as loss to follow-up), survival time is usually estimated using a probability calculation based on data obtained in clinical studies or trials. The two techniques most commonly used to estimate survival times are the Kaplan-Meier method and the actuarial method. Despite their limitations, they provide useful information when choosing between treatment options.

  6. Survival analysis

    International Nuclear Information System (INIS)

    Badwe, R.A.

    1999-01-01

    The primary endpoint in the majority of the studies has been either disease recurrence or death. This kind of analysis requires a special method since all patients in the study experience the endpoint. The standard method for estimating such survival distribution is Kaplan Meier method. The survival function is defined as the proportion of individuals who survive beyond certain time. Multi-variate comparison for survival has been carried out with Cox's proportional hazard model

  7. Montessori-skole: die ander kant

    Directory of Open Access Journals (Sweden)

    Monica Viljoen

    1995-03-01

    Full Text Available Na aanleiding van die artikel “Die invloed van die New Age-beweging op die onderwysagenda van die toekoms” deur Lien van Niekerk en Corinne Meier van die Departement Historiese Opvoedkunde van Unisa (vgl. Koers, 59 (1 1994:69-84 wil ek graag ’n ander sy van Montessori-skole onder die aandag van Koers lesers bring.

  8. A Review of Cyanobacterial Odorous and Bioactive Metabolites: Impacts and Management Alternatives in Aquaculture

    Science.gov (United States)

    2008-05-06

    Ben-Amotz, A., 1985. Lipid and lipopoly- saccharide constituents of cyanobacterium Spirulina platensis (Cyanophyceae, Nostocales). Mar. Ecol. Prog...only been confirmed in liver and brain cells (Fischer et al., 2005; Meier- Abt et al., 2007). Once inside cells, microcystins and nodularins inhibit... assay ) or PPIA (protein phosphatase inhibition assay ) but the actual toxin responsible was not confirmed (i.e., confirmation by LC-MS, MALDI, or HPLC is

  9. 28 June 2010 - Inauguration of the exhibition "Universe of Particles" in the Globe of Science and Innovation.

    CERN Multimedia

    Maximilien Brice

    2010-01-01

    tirage 01-07: From left to right: Organiser M. Prola-Tessaur;Atelier Brückner Managing Director S. Brückner; Ambassador of Switzerland to the UN D. Martinelli; Rolex SA Director-General B. Meier; CERN Director-General R. Heuer; State Councillor of the Republic and Canton of Geneva in charge of the Department of PUblic Instruction, culture en sport C. Beer.

  10. Melanoma Patients with Unknown Primary Site or Nodal Recurrence after Initial Diagnosis Have a Favourable Survival Compared to Those with Synchronous Lymph Node Metastasis and Primary Tumour

    OpenAIRE

    Weide, Benjamin; Faller, Christine; Els?sser, Margrit; B?ttner, Petra; Pflugfelder, Annette; Leiter, Ulrike; Eigentler, Thomas Kurt; Bauer, J?rgen; Meier, Friedegund; Garbe, Claus

    2013-01-01

    BACKGROUND: A direct comparison of prognosis between patients with regional lymph node metastases (LNM) detected synchronously with the primary melanoma (primary LNM), patients who developed their first LNM subsequently (secondary LNM) and those with initial LNM in melanoma with unknown primary site (MUP) is missing thus far. PATIENTS AND METHODS: Survival of 498 patients was calculated from the time point of the first macroscopic LNM using Kaplan Meier and multivariate Cox hazard regression ...

  11. Assessment of the Air Force Materiel Command Reorganization: Report for Congress

    Science.gov (United States)

    2013-01-01

    8 Mintzberg, 1979. 9 Richard L. Daft , Organization Theory and Design, 9th ed., Mason, Ohio: Thomson South-Western, 2007. 27 areas.10 An...MIT Press, 1962. 11 Daft , 2007; Duncan, 1979. 12 Williamson, 1983; Chandler, 1962. 13 Daft , 2007; Duncan, 1979. 14 D. S. Pugh, D. J. Hickson, C...1965. 19 Bohte and Meier, 2001. 20 See, for example, Bell, 1967. 21 Daft , 2007. 22 Galbraith, 1977. 23 Daft , 2007. 24 Galbraith, 1977. 25

  12. Fluid Resuscitation for Hemorrhagic Shock in Tactical Combat Casualty Care: TCCC Guidelines Change 14-01 - 2 June 2014

    Science.gov (United States)

    2014-06-02

    associated coagulopathy.32 The presence of a coagulopathy was found to nearly double the mortality in patients with traumatic subdural hematoma .125 The...375. 125. Lemcke J, Al-Zain F, Brelie CvD, Meier U. The influence of coagulopathy on outcome after traumatic subdural hematoma : a retrospective...of a subdural mass. Anesthesiology. 1991;75:319–327. 165. Stanford G, Patterson C, Payne L, Fabian T. Hypertonic saline resuscitation in a porcine

  13. Syncytin immunoreactivity in colorectal cancer

    DEFF Research Database (Denmark)

    Larsen, Julie Mou; Christensen, Ib Jarle; Nielsen, Hans Jørgen

    2009-01-01

    monoclonal syncytin antibody we have assessed syncytin expression in a retrospective series of 140 colorectal cancer patients. Variable degrees of syncytin expression were detected in both colonic and rectal tumors and the prognostic impact of such expression was analysed with the Kaplan-Meier method...... and the Cox proportional hazard model. Interestingly, increased syncytin expression was associated with decreased overall survival in rectal but not in colonic cancer patients. Thus, the prognostic impact of syncytin expression appears to vary with the tumor type....

  14. Role of IKK-alpha in EGFR Signaling Regulation

    Science.gov (United States)

    2013-09-01

    heatmap. (B) Low expression of ΙΚΚα in TNBC cell lines. (C) Low expression of ΙΚΚα in TNBC cell lines. (D) Kaplan -Meier overall survival curves of...0.2 150- 100- 50- 150- 100- 0.5 50- 50- - - + + - + - + Vimentin E-cad N-cad 150- 100- 50- 150- 100- Twist1 AKT-p AKT-T C 250- 150- 100- N-cad P1 P2 P3

  15. Survival of Patients With Cervical Cancer in Rural India

    OpenAIRE

    Vinoda Thulaseedharan, Jissa; Malila, Nea; Swaminathan, Rajaraman; Esmy Pulikottil, Okuru; Hakama, Matti; Muwonge, Richard; Sankaranarayanan, Rengaswamy

    2015-01-01

    Background: Patients’ survival after diagnosis of cervical cancer is indirectly influenced by socio-economic factors. We evaluated this survival and its socio-economic determinants in a rural population in south India. Methods: We assessed 165 women diagnosed with cervical cancer from the routine care control arm of a randomized screening trial conducted in rural south India. Kaplan-Meier curves were plotted to illustrate the observed survival of cancer patients. The effect of socio-econom...

  16. MEKK1 is a Novel Regulator of the Dmp1-Arf-p53 Pathway and Prognostic Indicator in Breast Cancer

    Science.gov (United States)

    2012-12-01

    hDMP1, INK4a/ARF, p53 or Hdm2 amplification. Kaplan -Meier analyses have been conducted to study the impact for the impact of loss or gain of each locus on...Palma P, Pellegrini S, Fina P et al. Mdm2 gene alterations and mdm2 protein expression in breast carcinomas. J Pathol 1995; 175: 31–38. 21 Turbin DA

  17. Wash-oil problem

    Energy Technology Data Exchange (ETDEWEB)

    Chlosta, J

    1941-01-01

    Meier-Grolman and others have deduced from experimental studies of the vapor pressure of solutions of benzene in paraffin oil and Solway oil-paraffin oil mixtures that the higher the proportion of aliphatic compounds in a wash oil, the less suitable it is for benzene scrubbing. This generalization is not supported. Paraffin oils from brown-coal tar and low viscous oils from the Fischer-Tropsch hydrocarbon synthesis process are both being successfully used for benzene scrubbing.

  18. Naised, kes toovad naeratuse näole / Katrin Oja

    Index Scriptorium Estoniae

    Oja, Katrin

    2006-01-01

    Heast teenindusest räägivad Eesti Gaasi juhatuse esimehe assistent, Aasta Sekretär 2005 Tiivi Lind, lounge 8 baaridaam Kadri Kask ja Sampo Panga koolitusspetsialist, Aasta Teenindaja 2006 Aires Rühka. Kommenteerivad nende ülemused - Sampo Panga koolitusosakonna juhataja Külli Meier, Eesti Gaasi juhatuse esimees Aarne Saar ja lounge 8 mänedžer Heinar Õispuu

  19. Censoring: a new approach for detection limits in total-reflection X-ray fluorescence

    International Nuclear Information System (INIS)

    Pajek, M.; Kubala-Kukus, A.; Braziewicz, J.

    2004-01-01

    It is shown that the detection limits in the total-reflection X-ray fluorescence (TXRF), which restrict quantification of very low concentrations of trace elements in the samples, can be accounted for using the statistical concept of censoring. We demonstrate that the incomplete TXRF measurements containing the so-called 'nondetects', i.e. the non-measured concentrations falling below the detection limits and represented by the estimated detection limit values, can be viewed as the left random-censored data, which can be further analyzed using the Kaplan-Meier (KM) method correcting for nondetects. Within this approach, which uses the Kaplan-Meier product-limit estimator to obtain the cumulative distribution function corrected for the nondetects, the mean value and median of the detection limit censored concentrations can be estimated in a non-parametric way. The Monte Carlo simulations performed show that the Kaplan-Meier approach yields highly accurate estimates for the mean and median concentrations, being within a few percent with respect to the simulated, uncensored data. This means that the uncertainties of KM estimated mean value and median are limited in fact only by the number of studied samples and not by the applied correction procedure for nondetects itself. On the other hand, it is observed that, in case when the concentration of a given element is not measured in all the samples, simple approaches to estimate a mean concentration value from the data yield erroneous, systematically biased results. The discussed random-left censoring approach was applied to analyze the TXRF detection-limit-censored concentration measurements of trace elements in biomedical samples. We emphasize that the Kaplan-Meier approach allows one to estimate the mean concentrations being substantially below the mean level of detection limits. Consequently, this approach gives a new access to lower the effective detection limits for TXRF method, which is of prime interest for

  20. Cetuximab Concomitant with Second-Line Radiation Therapy in Patients with Locally Advanced Recurrent Squamous Cell Head and Neck Cancer

    Directory of Open Access Journals (Sweden)

    Muge Akmansu

    2010-12-01

    Full Text Available We presented 9 recurrent head and neck carcinoma patients. Priorly all of them had received radiochemotherapy. We used cetuximab and irradiation concomitantly. Overall survival analysis of the patients was performed using the Kaplan-Meier method on SPSS version 15.0. Based on this calculation, mean follow-up duration is 12.8 months. Mean survival time is 19.8 months and annual mean survival rate is 59.3%.

  1. Creating an isotopically similar Earth–Moon system with correct ...

    Indian Academy of Sciences (India)

    Bryant M. Wyatt

    2018-03-13

    Mar 13, 2018 ... SCOTT A. COOK1, JOHN H. GRESHAM1, MICHAEL F. HIBBS3 and. SHAUKAT N. ... ical impact (Benz et al. 1986 ... the impactor (Meier 2012; Zhang et al. 2012). .... (B–G) Snap shots 0.49, 1.95, 3.82, 5.13, 9.28, and 15.32 hours into the collision. (H) Two ... funding; Robert W. Muth for insightful remarks and.

  2. Application of Enlisted Force Retention Levels and Career Field Stability

    Science.gov (United States)

    2017-03-23

    APPLICATION OF ENLISTED FORCE RETENTION LEVELS AND CAREER FIELD STABILITY THESIS Presented to the Faculty Department of Operational Sciences ...Fulfillment of the Requirements for the Degree of Master of Science in Operations Research Jamie T. Zimmermann, MS, BS Captain, USAF March 2017...Appendix B. The function proc lifetest is a nonparametric estimate of the survivor function using either the Kaplan-Meier method or the actuarial

  3. A Model of Medical Countermeasures for Vesicant Exposure

    Science.gov (United States)

    2015-10-01

    lipophilic, can diffuse readily through the intracellular spaces of the stratum corneum, which are filled with lipids such as sebum, oils , waxes, as...does not decontaminate his skin or his eyes. The resulting injury to the eyes, lungs, and skin are shown in Figure 8-1. Figure 8-1. Eye, Lung, and...R.Vijayaraghavan, & S.C.Pant. (2011). Designing of mouse model: A new approach for studying sulphur mustard-induced skin lesions. Burns . Meier, H. M. (1998

  4. High income, employment, postgraduate education, and marriage. A suicidal cocktail among psychiatric patients

    DEFF Research Database (Denmark)

    Agerbo, Esben

    2007-01-01

    longitudinal data on income, labor market affiliation, educational attainment, and marital and cohabitational status (96,369 patients, 256,619 admissions, and 2727 suicides). MAIN OUTCOME MEASURES: Suicide risks after hospital discharge were depicted using Kaplan-Meier product-limit methods. Hazard ratios (HRs...... is generally associated with low income, unemployment, educational underachievement, and singleness, but this study suggests that the opposite is true among psychiatric patients. However, loss of income, labor market status, and marriage increase the suicide risk....

  5. Challenges in risk estimation using routinely collected clinical data: The example of estimating cervical cancer risks from electronic health-records.

    Science.gov (United States)

    Landy, Rebecca; Cheung, Li C; Schiffman, Mark; Gage, Julia C; Hyun, Noorie; Wentzensen, Nicolas; Kinney, Walter K; Castle, Philip E; Fetterman, Barbara; Poitras, Nancy E; Lorey, Thomas; Sasieni, Peter D; Katki, Hormuzd A

    2018-06-01

    Electronic health-records (EHR) are increasingly used by epidemiologists studying disease following surveillance testing to provide evidence for screening intervals and referral guidelines. Although cost-effective, undiagnosed prevalent disease and interval censoring (in which asymptomatic disease is only observed at the time of testing) raise substantial analytic issues when estimating risk that cannot be addressed using Kaplan-Meier methods. Based on our experience analysing EHR from cervical cancer screening, we previously proposed the logistic-Weibull model to address these issues. Here we demonstrate how the choice of statistical method can impact risk estimates. We use observed data on 41,067 women in the cervical cancer screening program at Kaiser Permanente Northern California, 2003-2013, as well as simulations to evaluate the ability of different methods (Kaplan-Meier, Turnbull, Weibull and logistic-Weibull) to accurately estimate risk within a screening program. Cumulative risk estimates from the statistical methods varied considerably, with the largest differences occurring for prevalent disease risk when baseline disease ascertainment was random but incomplete. Kaplan-Meier underestimated risk at earlier times and overestimated risk at later times in the presence of interval censoring or undiagnosed prevalent disease. Turnbull performed well, though was inefficient and not smooth. The logistic-Weibull model performed well, except when event times didn't follow a Weibull distribution. We have demonstrated that methods for right-censored data, such as Kaplan-Meier, result in biased estimates of disease risks when applied to interval-censored data, such as screening programs using EHR data. The logistic-Weibull model is attractive, but the model fit must be checked against Turnbull non-parametric risk estimates. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Modelos estimados de análisis de supervivencia para el tiempo de permanencia de los estudiantes de la Universidad Francisco de Paula Santander

    OpenAIRE

    Mawency Vergel Ortega; José Joaquín Martínez Lozano; Eduardo Ibargüen Mondragón

    2016-01-01

    The article shows factors associated with college desertion. The survival analysis technique allowed to perform a study with students from different programs at the Francisco de Paula Santander University, considering the events: semester, abandonment, punishment, punishment - abandonment. Using the Kaplan-Meier estimator [1], the survival function for each event of interest was estimated and desertion models whose variables were significant at 10% using the semi-parametric met...

  7. On the Materiality of Writing in Academia or Remembering Where I Put My Thoughts

    DEFF Research Database (Denmark)

    Meier, Ninna

    2016-01-01

    In this feature essay, Ninna Meier reflects on the materiality of the writing – and re-writing – process in academic research. She explores the ways in which our ever-accumulating thoughts come to form layers on the material objects in which we write our notes and discusses the pleasures of co......-authorship. This essay originally appeared on LSE Review of Books and is the first in a new series examining the material cultures of academic research, reading and writing....

  8. Improve T Cell Therapy in Neuroblastoma

    Science.gov (United States)

    2015-09-01

    bioluminescence was then measured overtime. The graph is representative of one of 4 experiments using CMV-CTLs from 4 donors. Panel E. Kaplan-Meier...whole-cell vaccine expressing the iC9 gene and labeled with an enhanced firefly luciferase. Tumor growth was measured by in vivo imaging. Panel E...down regulation in LTE -T cells is not caused by specific culture conditions. T lymphocytes were activated with immobilized OKT3 (1 μg ml) and

  9. Protective Role of Comfrey Leave Extracts on UV-induced Zebrafish Fin Damage

    OpenAIRE

    Cheng, Chien-Chung; Chou, Chi-Yuan; Chang, Yao-Chin; Wang, Hsuan-Wen; Wen, Chi-Chung; Chen, Yau-Hung

    2014-01-01

    In zebrafish, UV exposure leads to fin malformation phenotypes including fin reduction or absence. The present study evaluated UV-protective activities of comfrey leaves extracts in a zebrafish model by recording fin morphological changes. Chemopreventive effects of comfrey leave extracts were evaluated using Kaplan-Meier analysis and Cox proportional hazards regression. The results showed that (1) the mean times of return to normal fin in the UV+comfrey (50 and 100 ppm) groups were 3.43 and ...

  10. 8TH International Laser Physics Workshop Lphys󈨧 Budapest, July 2-6, 1999, Program

    Science.gov (United States)

    1999-07-05

    Gerhard J. MUller (Germany) Rudolf Steiner (Germany) Symposium Status and Future Directions of High-Power Laser Installations Co-Chairs: See Leang...Sciences, Kazan. Russia I.A. Shcherbakov General Physics Institute. Russian Academy of Sciences. Moscow, Russia R. Steiner Institute of Laser Technologies...14.50-15.15 R. Steiner , A. Pohl, A. Bentele, T. Meier (Ulm, Germany) Laser Doppler sensor for laser assisted injection 30 SEMINAR 5 --- LASER METHODS IN

  11. RARE COMPONENT OF THE FISH FAUNA OF THE 'SULINSKY' NATIONAL LANDSCAPE RESERVE

    Directory of Open Access Journals (Sweden)

    N. Ja. Rudik-Leuska

    2014-06-01

    authorities should focus attention on their protection and restoration of abundance. Keywords: Sulinsky Reserve, Sula Bay, conservation lists, sterlet (Acipenser ruthenus L., Crucian carp (Carassius carassius L., Common dace (Leuciscus leuciscus L., Wels catfish (Silurus glanis L., Asp (Aspius aspius L., Bitterling (Rhodeus sericeus Pall., Spined loach (Cobitis taenia L..

  12. Variation in fish mercury concentrations in streams of the Adirondack region, New York: A simplified screening approach using chemical metrics

    Science.gov (United States)

    Burns, Douglas A.; Riva-Murray, Karen

    2018-01-01

    Simple screening approaches for the neurotoxicant methylmercury (MeHg) in aquatic ecosystems may be helpful in risk assessments of natural resources. We explored the development of such an approach in the Adirondack Mountains of New York, USA, a region with high levels of MeHg bioaccumulation. Thirty-six perennial streams broadly representative of 1st and 2nd order streams in the region were sampled during summer low flow and analyzed for several solutes and for Hg concentrations in fish. Several landscape and chemical metrics that are typically strongly related to MeHg concentrations in aquatic biota were explored for strength of association with fish Hg concentrations. Data analyses were based on site mean length-normalized and standardized Hg concentrations (assumed to be dominantly MeHg) in whole juvenile and adult Brook Trout Salvelinus fontinalis, Creek Chub Semotilus atromaculatus, Blacknose Dace Rhinichthys atratulus, and Central Mudminnow Umbra limi, as well as on multi-species z-scores. Surprisingly, none of the landscape metrics was related significantly to regional variation in fish Hg concentrations or to z-scores across the study streams. In contrast, several chemical metrics including dissolved organic carbon (DOC) concentrations, sulfate concentrations (SO42−), pH, ultra-violet absorbance (UV254), and specific ultra-violet absorbance were significantly related to regional variation in fish Hg concentrations. A cluster analysis based on DOC, SO42−, and pH identified three distinct groups of streams: (1) high DOC, acidic streams, (2) moderate DOC, slightly acidic streams, and (3) low DOC circum-neutral streams with relatively high SO42−. Preliminary analysis indicated no significant difference in fish Hg z-scores between the moderate and high DOC groups, so these were combined for further analysis. The resulting two groups showed strong differences (p 6.9 mg/L, SO42− 0.31 cm−1 were tested as thresholds to identify Adirondack

  13. Abandoned mine drainage in the Swatara Creek Basin, southern anthracite coalfield, Pennsylvania, USA: 1. stream quality trends coinciding with the return of fish

    Science.gov (United States)

    Cravotta, Charles A.; Brightbill, Robin A.; Langland, Michael J.

    2010-01-01

    Acidic mine drainage (AMD) from legacy anthracite mines has contaminated Swatara Creek in eastern Pennsylvania. Intermittently collected base-flow data for 1959–1986 indicate that fish were absent immediately downstream from the mined area where pH ranged from 3.5 to 7.2 and concentrations of sulfate, dissolved iron, and dissolved aluminum were as high as 250, 2.0, and 4.7 mg/L, respectively. However, in the 1990s, fish returned to upper Swatara Creek, coinciding with the implementation of AMD treatment (limestone drains, limestone diversion wells, limestone sand, constructed wetlands) in the watershed. During 1996–2006, as many as 25 species of fish were identified in the reach downstream from the mined area, with base-flow pH from 5.8 to 7.6 and concentrations of sulfate, dissolved iron, and dissolved aluminum as high as 120, 1.2, and 0.43 mg/L, respectively. Several of the fish taxa are intolerant of pollution and low pH, such as river chub (Nocomis icropogon) and longnose dace (Rhinichthys cataractae). Cold-water species such as brook trout (Salvelinus fontinalis) and warm-water species such as rock bass (Ambloplites rupestris) varied in predominance depending on stream flow and stream temperature. Storm flow data for 1996–2007 indicated pH, alkalinity, and sulfate concentrations decreased as the stream flow and associated storm-runoff component increased, whereas iron and other metal concentrations were poorly correlated with stream flow because of hysteresis effects (greater metal concentrations during rising stage than falling stage). Prior to 1999, pH\\5.0 was recorded during several storm events; however, since the implementation of AMD treatments, pH has been maintained near neutral. Flow-adjusted trends for1997–2006 indicated significant increases in calcium; decreases in hydrogen ion, dissolved aluminum, dissolved and total manganese, and total iron; and no change in sulfate or dissolved iron in Swatara Creek immediately downstream from the

  14. Competing approaches to analysis of failure times with competing risks.

    Science.gov (United States)

    Farley, T M; Ali, M M; Slaymaker, E

    2001-12-15

    For the analysis of time to event data in contraceptive studies when individuals are subject to competing causes for discontinuation, some authors have recently advocated the use of the cumulative incidence rate as a more appropriate measure to summarize data than the complement of the Kaplan-Meier estimate of discontinuation. The former method estimates the rate of discontinuation in the presence of competing causes, while the latter is a hypothetical rate that would be observed if discontinuations for the other reasons could not occur. The difference between the two methods of analysis is the continuous time equivalent of a debate that took place in the contraceptive literature in the 1960s, when several authors advocated the use of net (adjusted or single decrement life table rates) rates in preference to crude rates (multiple decrement life table rates). A small simulation study illustrates the interpretation of the two types of estimate - the complement of the Kaplan-Meier estimate corresponds to a hypothetical rate where discontinuations for other reasons did not occur, while the cumulative incidence gives systematically lower estimates. The Kaplan-Meier estimates are more appropriate when estimating the effectiveness of a contraceptive method, but the cumulative incidence estimates are more appropriate when making programmatic decisions regarding contraceptive methods. Other areas of application, such as cancer studies, may prefer to use the cumulative incidence estimates, but their use should be determined according to the application. Copyright 2001 John Wiley & Sons, Ltd.

  15. Clinical Significance of Preoperative Albumin and Globulin Ratio in Patients with Gastric Cancer Undergoing Treatment

    Directory of Open Access Journals (Sweden)

    Min-jie Mao

    2017-01-01

    Full Text Available Background. The pretreatment albumin and globulin ratio (AGR was an inflammation-associated factor which was related to the overall survival in various malignancies. The aim of this study was to evaluate the prognostic value of AGR in patients with gastric cancer. Method. This retrospective study included 862 cases pathologically diagnosed with gastric cancer. All patients were randomly divided into the testing group (431 cases and validation group (431 cases. The relationships of AGR with clinicopathologic characteristics and prognosis were analyzed by Kaplan-Meier and Cox regression methods. Results. In the testing group, the median overall survival was 26.90 months and the cutoff value of AGR was 1.50 based on R language. Kaplan-Meier analysis showed that lower AGR was correlated with poorer overall survival. Multivariate analysis demonstrated that AGR was an independent prognostic factor for overall survival (HR: 0.584, 95% CI = 0.351–0.973, and p = 0.039. In the validation group, the median overall survival was 24.10 months. Lower AGR (≤1.50 also had a significantly poorer overall survival by Kaplan-Meier analysis. According to multivariate analysis, the AGR was also confirmed to be an independent prognostic factor for overall survival (HR: 0.578, 95% CI = 0.373–0.897, and p = 0.015. Conclusions. Our study suggested that the pretreatment AGR could be a prognostic biomarker for overall survival in patients with gastric cancer.

  16. The development of a new algorithm to calculate a survival function in non-parametric ways

    International Nuclear Information System (INIS)

    Ahn, Kwang Won; Kim, Yoon Ik; Chung, Chang Hyun; Kim, Kil Yoo

    2001-01-01

    In this study, a generalized formula of the Kaplan-Meier method is developed. The idea of this algorithm is that the result of the Kaplan-Meier estimator is the same as that of the redistribute-to-the right algorithm. Hence, the result of the Kaplan-Meier estimator is used when we redistribute to the right. This can be explained as the following steps, at first, the same mass is distributed to all the points. At second, when you reach the censored points, you must redistribute the mass of that point to the right according to the following rule; to normalize the masses, which are located to the right of the censored point, and redistribute the mass of the censored point to the right according to the ratio of the normalized mass. Until now, we illustrate the main idea of this algorithm.The meaning of that idea is more efficient than PL-estimator in the sense that it decreases the mass of after that area. Just like a redistribute to the right algorithm, this method is enough for the probability theory

  17. «Esa corporeidad mortal y rosa»: análisis del tiempo libre de enfermedad del cáncer de mama en Gipuzkoa en presencia de riesgos competitivos "That deadly and pink corporeity": Analysis of disease-free survival analysis in breast cancer in Gipuzkoa (Spain in the presence of competing risks

    Directory of Open Access Journals (Sweden)

    Pablo Martínez-Camblor

    2009-12-01

    Full Text Available Objetivo: Analizar el tiempo de supervivencia libre de enfermedad y la supervivencia relativa en mujeres diagnosticadas de cáncer de mama en la provincia de Gipuzkoa en un contexto de riesgos competitivos, valorando las diferencias encontradas entre el uso directo del estimador de Kaplan-Meier y el método de decrementos múltiples por un lado y la supervivencia relativa por otro. Métodos: Se consideraron todos los casos de cáncer de mama registrados en la provincia de Gipuzkoa durante los años 1995 y 1996 en estadio distinto del IV, y se hizo un seguimiento de 8 años para la recidiva y de 10 años para la supervivencia. Se analizó el tiempo de supervivencia libre de enfermedad mediante el método de decrementos múltiples. Asimismo, también se analizó el tiempo de supervivencia observado y corregido por la mortalidad esperada de la población, conocido como supervivencia relativa. Resultados: La estimación de la probabilidad de recidiva a los 8 años por el método de decrementos múltiples es un 8,8% inferior a la obtenida por el método de Kaplan-Meier. La diferencia entre la supervivencia observada y la relativa a los 10 años es del 10,8%. Ambos resultados indican que, en este caso, el método de Kaplan-Meier sobrestima tanto la probabilidad de recaída como la de muerte por la enfermedad. Conclusiones: Dos cuestiones que muchas veces se obvian al realizar un análisis de supervivencia son, por un lado, que la no independencia entre el tiempo de supervivencia y el tiempo de censura hacen no interpretables los resultados obtenidos por el estimador de Kaplan-Meier, y por otro el hecho, hasta hora incuestionable, de que de una manera u otra todos causamos fallo y, desde este planteamiento, en el estudio del tiempo de supervivencia hay que tener presente la probabilidad de fallo en la población general de referencia. En los resultados obtenidos se observa que utilizar de manera superficial el estimador de Kaplan-Meier comporta una

  18. Simplified tools for measuring retention in care in antiretroviral treatment program in Ethiopia: cohort and current retention in care.

    Science.gov (United States)

    Assefa, Yibeltal; Worku, Alemayehu; Wouters, Edwin; Koole, Olivier; Haile Mariam, Damen; Van Damme, Wim

    2012-01-01

    Patient retention in care is a critical challenge for antiretroviral treatment programs. This is mainly because retention in care is related to adherence to treatment and patient survival. It is therefore imperative that health facilities and programs measure patient retention in care. However, the currently available tools, such as Kaplan Meier, for measuring retention in care have a lot of practical limitations. The objective of this study was to develop simplified tools for measuring retention in care. Retrospective cohort data were collected from patient registers in nine health facilities in Ethiopia. Retention in care was the primary outcome for the study. Tools were developed to measure "current retention" in care during a specific period of time for a specific "ART-age group" and "cohort retention" in care among patients who were followed for the last "Y" number of years on ART. "Probability of retention" based on the tool for "cohort retention" in care was compared with "probability of retention" based on Kaplan Meier. We found that the new tools enable to measure "current retention" and "cohort retention" in care. We also found that the tools were easy to use and did not require advanced statistical skills. Both "current retention" and "cohort retention" are lower among patients in the first two "ART-age groups" and "ART-age cohorts" than in subsequent "ART-age groups" and "ART-age cohorts". The "probability of retention" based on the new tools were found to be similar to the "probability of retention" based on Kaplan Meier. The simplified tools for "current retention" and "cohort retention" will enable practitioners and program managers to measure and monitor rates of retention in care easily and appropriately. We therefore recommend that health facilities and programs start to use these tools in their efforts to improve retention in care and patient outcomes.

  19. Simplified tools for measuring retention in care in antiretroviral treatment program in Ethiopia: cohort and current retention in care.

    Directory of Open Access Journals (Sweden)

    Yibeltal Assefa

    Full Text Available INTRODUCTION: Patient retention in care is a critical challenge for antiretroviral treatment programs. This is mainly because retention in care is related to adherence to treatment and patient survival. It is therefore imperative that health facilities and programs measure patient retention in care. However, the currently available tools, such as Kaplan Meier, for measuring retention in care have a lot of practical limitations. The objective of this study was to develop simplified tools for measuring retention in care. METHODS: Retrospective cohort data were collected from patient registers in nine health facilities in Ethiopia. Retention in care was the primary outcome for the study. Tools were developed to measure "current retention" in care during a specific period of time for a specific "ART-age group" and "cohort retention" in care among patients who were followed for the last "Y" number of years on ART. "Probability of retention" based on the tool for "cohort retention" in care was compared with "probability of retention" based on Kaplan Meier. RESULTS: We found that the new tools enable to measure "current retention" and "cohort retention" in care. We also found that the tools were easy to use and did not require advanced statistical skills. Both "current retention" and "cohort retention" are lower among patients in the first two "ART-age groups" and "ART-age cohorts" than in subsequent "ART-age groups" and "ART-age cohorts". The "probability of retention" based on the new tools were found to be similar to the "probability of retention" based on Kaplan Meier. CONCLUSION: The simplified tools for "current retention" and "cohort retention" will enable practitioners and program managers to measure and monitor rates of retention in care easily and appropriately. We therefore recommend that health facilities and programs start to use these tools in their efforts to improve retention in care and patient outcomes.

  20. Long-Term Survivors Using Intraoperative Radiotherapy for Recurrent Gynecologic Malignancies

    International Nuclear Information System (INIS)

    Tran, Phuoc T.; Su Zheng; Hara, Wendy; Husain, Amreen; Teng, Nelson; Kapp, Daniel S.

    2007-01-01

    Purpose: To analyze the outcomes of therapy and identify prognostic factors for patients treated with surgery followed by intraoperative radiotherapy (IORT) for gynecologic malignancies at a single institution. Methods and Materials: We performed a retrospective review of 36 consecutive patients treated with IORT to 44 sites with mean follow-up of 50 months. The primary site was the cervix in 47%, endometrium in 31%, vulva in 14%, vagina in 6%, and fallopian tubes in 3%. Previous RT had failed in 72% of patients, and 89% had recurrent disease. Of 38 IORT sessions, 84% included maximal cytoreductive surgery, including 18% exenterations. The mean age was 52 years (range, 30-74), mean tumor size was 5 cm (range, 0.5-12), previous disease-free interval was 32 months (range, 0-177), and mean IORT dose was 1,152 cGy (range, 600-1,750). RT and systemic therapy after IORT were given to 53% and 24% of the cohort, respectively. The outcomes measured were locoregional control (LRC), distant metastasis-free survival (DMFS), disease-specific survival (DSS), and treatment-related complications. Results: The Kaplan-Meier 5-year LRC, DMFS, and DSS probability for the whole group was 44%, 51%, and 47%, respectively. For cervical cancer patients, the Kaplan-Meier 5-year LRC, DMFS, and DSS estimate was 45%, 60%, and 46%, respectively. The prognostic factors found on multivariate analysis (p ≤ 0.05) were the disease-free interval for LRC, tumor size for DMFS, and cervical primary, previous surgery, and locoregional relapse for DSS. Our cohort had 10 Grade 3-4 complications associated with treatment (surgery and IORT) and a Kaplan-Meier 5-year Grade 3-4 complication-free survival rate of 72%. Conclusions: Survival for pelvic recurrence of gynecologic cancer is poor (range, 0-25%). IORT after surgery seems to confer long-term local control in carefully selected patients

  1. Initial high anti-emetic efficacy of granisetron with dexamethasone is not maintained over repeated cycles.

    Science.gov (United States)

    de Wit, R.; van den Berg, H.; Burghouts, J.; Nortier, J.; Slee, P.; Rodenburg, C.; Keizer, J.; Fonteyn, M.; Verweij, J.; Wils, J.

    1998-01-01

    We have reported previously that the anti-emetic efficacy of single agent 5HT3 antagonists is not maintained when analysed with the measurement of cumulative probabilities. Presently, the most effective anti-emetic regimen is a combination of a 5HT3 antagonist plus dexamethasone. We, therefore, assessed the sustainment of efficacy of such a combination in 125 patients, scheduled to receive cisplatin > or = 70 mg m(-2) either alone or in combination with other cytotoxic drugs. Anti-emetic therapy was initiated with 10 mg of dexamethasone and 3 mg of granisetron intravenously, before cisplatin. On days 1-6, patients received 8 mg of dexamethasone and 1 mg of granisetron twice daily by oral administration. Protection was assessed during all cycles and calculated based on cumulative probability analyses using the method of Kaplan-Meier and a model for transitional probabilities. Irrespective of the type of analysis used, the anti-emetic efficacy of granisetron/dexamethasone decreased over cycles. The initial complete acute emesis protection rate of 66% decreased to 30% according to the method of Kaplan-Meier and to 39% using the model for transitional probabilities. For delayed emesis, the initial complete protection rate of 52% decreased to 21% (Kaplan-Meier) and to 43% (transitional probabilities). In addition, we observed that protection failure in the delayed emesis period adversely influenced the acute emesis protection in the next cycle. We conclude that the anti-emetic efficacy of a 5HT3 antagonist plus dexamethasone is not maintained over multiple cycles of highly emetogenic chemotherapy, and that the acute emesis protection is adversely influenced by protection failure in the delayed emesis phase. PMID:9652766

  2. Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b and c

    International Nuclear Information System (INIS)

    Kyndi, M.; Alsner, J.; Nielsen, H.M.; Overgaard, J.; Soerensen, F.B.; Knudsen, H.; Overgaard, M.

    2008-01-01

    Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b and c studies. Tissue microarray sections were stained with immunohistochemistry for p53 and BCL2. Median potential follow-up was 17 years. Clinical endpoints were locoregional recurrence (LRR), distant metastases (DM), overall mortality, and overall survival (OS). Statistical analyses included Kappa statistics, χ2 or exact tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots showed reduced OS and improved DM and LRR probabilities after PMRT within subgroups of both p53 negative and p53 positive patients. Negative BCL2 expression was significantly associated with increased overall mortality, DM and LRR probability in multivariate Cox regression analyses. Kaplan-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2 and randomization status. Significant reductions in LRR probability after PMRT were recorded within both the BCL2 positive and BCL2 negative subgroups. Conclusion. p53 was not associated with survival after radiotherapy in high-risk breast cancer, but BCL2 might be

  3. Mixture models for undiagnosed prevalent disease and interval-censored incident disease: applications to a cohort assembled from electronic health records.

    Science.gov (United States)

    Cheung, Li C; Pan, Qing; Hyun, Noorie; Schiffman, Mark; Fetterman, Barbara; Castle, Philip E; Lorey, Thomas; Katki, Hormuzd A

    2017-09-30

    For cost-effectiveness and efficiency, many large-scale general-purpose cohort studies are being assembled within large health-care providers who use electronic health records. Two key features of such data are that incident disease is interval-censored between irregular visits and there can be pre-existing (prevalent) disease. Because prevalent disease is not always immediately diagnosed, some disease diagnosed at later visits are actually undiagnosed prevalent disease. We consider prevalent disease as a point mass at time zero for clinical applications where there is no interest in time of prevalent disease onset. We demonstrate that the naive Kaplan-Meier cumulative risk estimator underestimates risks at early time points and overestimates later risks. We propose a general family of mixture models for undiagnosed prevalent disease and interval-censored incident disease that we call prevalence-incidence models. Parameters for parametric prevalence-incidence models, such as the logistic regression and Weibull survival (logistic-Weibull) model, are estimated by direct likelihood maximization or by EM algorithm. Non-parametric methods are proposed to calculate cumulative risks for cases without covariates. We compare naive Kaplan-Meier, logistic-Weibull, and non-parametric estimates of cumulative risk in the cervical cancer screening program at Kaiser Permanente Northern California. Kaplan-Meier provided poor estimates while the logistic-Weibull model was a close fit to the non-parametric. Our findings support our use of logistic-Weibull models to develop the risk estimates that underlie current US risk-based cervical cancer screening guidelines. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.

  4. Review of epidemiological and clinical characteristics and overall survival in patients with colorectal cancer

    Directory of Open Access Journals (Sweden)

    Michelle Eisenhardt

    2013-10-01

    Full Text Available Backgound and Objectives: Colorectal cancer (CRC has high incidence, is often treatable and curable if diagnosed early. This study aimed to identify the epidemiological characteristic and assess overall survival in patients with CRC treated at a center specializing in oncology. Methods: Medical records of 127 patients with CRC were retrospectively evaluated. Clinical and epidemiological characteristics, in addition to treatment protocols and adverse reactions presented by patients were reviewed. The association of significance was assessed by chi-square and Fisher exact tests. The survival analyses were performed using the Kaplan-Meier method. The confidence interval was of 95% (p

  5. A reconstructed melanoma data set for evaluating differential treatment benefit according to biomarker subgroups

    Directory of Open Access Journals (Sweden)

    Jaya M. Satagopan

    2017-06-01

    Full Text Available The data presented in this article are related to the research article entitled “Measuring differential treatment benefit across marker specific subgroups: the choice of outcome scale” (Satagopan and Iasonos, 2015 [1]. These data were digitally reconstructed from figures published in Larkin et al. (2015 [2]. This article describes the steps to digitally reconstruct patient-level data on time-to-event outcome and treatment and biomarker groups using published Kaplan-Meier survival curves. The reconstructed data set and the corresponding computer programs are made publicly available to enable further statistical methodology research.

  6. Proton pump inhibitor use and risk of adverse cardiovascular events in aspirin treated patients with first time myocardial infarction: nationwide propensity score matched study

    DEFF Research Database (Denmark)

    Charlot, Mette; Grove, Erik; Hansen, Peter Riis

    2011-01-01

    : All aspirin treated patients surviving 30 days after a first myocardial infarction from 1997 to 2006, with follow-up for one year. Patients treated with clopidogrel were excluded. MAIN OUTCOME MEASURES: The risk of the combined end point of cardiovascular death, myocardial infarction, or stroke...... associated with use of proton pump inhibitors was analysed using Kaplan-Meier analysis, Cox proportional hazard models, and propensity score matched Cox proportional hazard models. Results 3366 of 19 925 (16.9%) aspirin treated patients experienced recurrent myocardial infarction, stroke, or cardiovascular...

  7. Association of versican turnover with all-cause mortality in patients on haemodialysis

    DEFF Research Database (Denmark)

    Genovese, Federica; Karsdal, Morten A; Leeming, Diana J

    2014-01-01

    with cardiovascular diseases. The objective of the study was to investigate the association of versican turnover assessed in plasma with survival in haemodialysis patients. METHODS: A specific matrix metalloproteinase-generated neo-epitope fragment of versican (VCANM) was measured in plasma of 364 haemodialysis...... patients with a 5-years follow-up, using a robust competitive enzyme-linked immunosorbent assays. Association between VCANM plasma concentration and survival was assessed by Kaplan-Meier analysis and adjusted Cox model. RESULTS: Haemodialysis patients with plasma VCANM concentrations in the lowest quartile...

  8. Effect of darapladib on major coronary events after an acute coronary syndrome

    DEFF Research Database (Denmark)

    O'Donoghue, Michelle L; Braunwald, Eugene; White, Harvey D

    2014-01-01

    ]) at 868 sites in 36 countries. INTERVENTIONS: Patients were randomized to either once-daily darapladib (160 mg) or placebo on a background of guideline-recommended therapy. Patients were followed up for a median of 2.5 years between December 7, 2009, and December 6, 2013. MAIN OUTCOMES AND MEASURES......: The primary end point (major coronary events) was the composite of coronary heart disease (CHD) death, MI, or urgent coronary revascularization for myocardial ischemia. Kaplan-Meier event rates are reported at 3 years. RESULTS: During a median duration of 2.5 years, the primary end point occurred in 903...

  9. Epidemiology of Massive Transfusion

    DEFF Research Database (Denmark)

    Halmin, Märit; Chiesa, Flaminia; Vasan, Senthil K

    2016-01-01

    in Sweden from 1987 and in Denmark from 1996. A total of 92,057 patients were included. Patients were followed until the end of 2012. MEASUREMENTS AND MAIN RESULTS: Descriptive statistics were used to characterize the patients and indications. Post transfusion mortality was expressed as crude 30-day...... mortality and as long-term mortality using the Kaplan-Meier method and using standardized mortality ratios. The incidence of massive transfusion was higher in Denmark (4.5 per 10,000) than in Sweden (2.5 per 10,000). The most common indication for massive transfusion was major surgery (61.2%) followed...

  10. The prognostic value of the suPARnosticTM ELISA assay in HIV-1 infected individuals is not affected by uPAR promoter polymorphisms

    DEFF Research Database (Denmark)

    Schneider, Uffe; Nielsen, Rikke; Pedersen, Court

    2007-01-01

    . METHODS: DNA samples were collected retrospectively from 145 Danes infected with HIV-1 with known seroconversion times. In addition, plasma was collected retrospectively from 81 of these participants for use in the suPAR analysis. Survival was analysed using Kaplan Meier analysis. RESULTS: Survival...... to A transition at -118 and an A to G transition at -465 comparative to the transcription start site. These promoter transitions did not influence neither the suPAR levels nor patient survival. CONCLUSION: Plasma suPAR levels, as measured by the suPARnosticTM assay, were strongly predictive of survival in ART...

  11. Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, Jesper

    1999-01-01

    for folate biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP. METHODS: We studied bronchoalveolar samples collected in 1989-99 from a prospective cohort of HIV-1-infected patients who had PCP. In 144...... patients with 152 episodes of PCP, we analysed portions of DHPS using PCR and direct sequencing. The relation between survival, P. carinii DHPS mutations, and other predictors of treatment failure was assessed by Kaplan-Meier and multivariate Cox regression analysis. FINDINGS: P. carinii DHPS mutations...

  12. Breast conserving treatment in Denmark, 1989-1998. A nationwide population-based study of the Danish Breast Cancer Co-operative Group

    DEFF Research Database (Denmark)

    Ewertz, M.; Kempel, M.M.; During, M.

    2008-01-01

    patients in Denmark. PATIENTS AND METHODS: To evaluate the results of this treatment, we performed a nationwide population-based follow-up study of patients aged less than 75 years treated in Denmark from 1989 to 1998 based on the database of Danish Breast Cancer Cooperative Group. RESULTS: At 15 years...... of follow-up, the Kaplan-Meier estimate of overall survival was 69% among 3 758 patients who received the recommended treatment. Within the first 10 years of follow-up, the cumulative incidences of loco-regional recurrences, distant metastases or other malignant disease, or death as a first event were 9...

  13. Contemporaneous VLBA 5 GHz Observations of Large Area Telescope Detected Blazars

    Science.gov (United States)

    2012-01-10

    on board the Fermi Gamma-ray Space Telescope is a wide-field telescope covering the energy range from about 20 MeV to more than 300 GeV. It has been... energies via inverse Compton processes (e.g., Björnsson 2010; Tavecchio et al. 2011; Abdo et al. 2011). Meier (2005) expected several reconnection...Astrophys. Space Sci. Libr ., 285, 109 Healey, S. E., Romani, R. W., Cotter, G., et al. 2008, ApJS, 175, 97 Healey, S. E., Romani, R. W., Taylor, G. B

  14. Interdisciplinary interventional therapy for tracheobronchial stenosis with modern metal net stents; Interdisziplinaere interventionelle Therapie tracheobronchialer Stenosen mit modernen Metallmaschenstents

    Energy Technology Data Exchange (ETDEWEB)

    Rieger, J.; Linsenmaier, U.; Fedorowski, A.; Pfeifer, K.J. [Ludwig-Maximilians-Universitaet Muenchen (Germany). Inst. fuer Klinische Radiologie; Hautmann, H.; Huber, R.M. [Klinikum Innenstadt der Ludwig-Maximilians-Universitaet Muenchen (Germany). Abteilung Pulmonologie, Medizinische Klinik

    2002-08-01

    Study objectives: Assessment of the therapeutic potential of tracheobronchial stenting for obstructive tracheobronchial disease, in-vivo comparison of different stent types and development of helpful criteria for choosing the suitable stent type. Material and Methods: Prospective case analysis. Between 1993 and 1999 53 stents were implanted into the tracheobronchial system of 39 consecutive patients with benign or malignant airway obstruction. Every single stent (26 Strecker Stents, 18 Wallstents, 6 Accuflex Nitinolstents, 1 Dumon-, 1 Ruesch- and 1 Palmazstent) was recorded in an unified database. Analysis comprised clinical effectiveness, lung function if possible, relevant complications and radiologic follow-up parameters. The probability of their remaining within the tracheobronchial system, of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for three stent types. Results: Stent placement proved itself to be an effective treatment in 86% of the patients. Resistance could be normalized in 9/9 patients. Kaplan-Meier analysis clearly revealed a higher probability for the Wall- and Nitinolstent to remain within the tracheobronchial system and to remain uncompressed. Dislocation also occurred more rarely. Explanation of the Wallstent, however, if desired, was much more difficult compared to the Strecker stent. The Wallstent also occasionally led to the formation of granulation tissue especially at the proximal stent end and, as such, required reintervention. (orig.) [German] Ziel: Erfassung des therapeutischen Potenzials der Stentbehandlung bei tracheobronchialen Stenosen, in-vivo Vergleich verschiedener Stenttypen und Erarbeitung von geeigneten Kriterien zur Stentwahl. Material und Methodik: Prospektive Fallanalyse. Zwischen 1993 und 1999 wurden insgesamt 53 Stents in das Tracheobronichalsystem von 39 konsekutiven Patienten implantiert. Jeder einzelne Stent (26 Streckerstents, 18 Wallstents, 6 Nitinolstents, ein Dumonstent

  15. International Union of Theoretical and Applied Mechanics: Symposium on Adiabatic Waves in liquid-Vapor Systems Held at Goettingen (Germany, F.R.) on 28 August-1 September 1989. Abstracts of the Contributed Papers

    Science.gov (United States)

    1989-09-01

    THE LIQUID- VAPOR CRITICAL POINT" P.A. Thompson, J.E. Shepherd, H.J. Cho, S.Can Gulen (Troy). Non-euilibrium in dinamic systems , critical phenomena...IN LIQUID-VAPOR SYSTEMS G~ttingen: 28. August - 1. September 1989 Chairmen: Gerd E.A. Meier & Philip A. Thompson Secretary: Tomasz A. Kowalewski...is a great pleasure to welcome you on behalf of the Organizing Committee to the IUTAM Symposium on Adiabatic Waves in Liquid Vapor Systems . We are

  16. Reexamining trends in premarital sex in the United States

    OpenAIRE

    Lawrence L. Wu; Steven Martin; Paula England

    2018-01-01

    Background: In a heavily cited paper, Finer (2007) asserted that by age 30, 82Š of US women born 1939-1948 engaged in premarital sex, increasing to 94Š for those born 1969-1978. Using the same data, our age 30 estimates are 55Š and 87Š for women born 1939-1948 and 1969-1978. Our analyses thus document strikingly different levels and trends. Methods: We replicate Finer's single-decrement Kaplan-Meier estimates of premarital sex using Cycles 3-6 of the National Survey of Family Growth, the s...

  17. Association between implantable cardioverter-defibrillator therapy and different lead positions in patients with cardiac resynchronization therapy

    DEFF Research Database (Denmark)

    Kronborg, Mads Brix; Johansen, Jens Brock; Haarbo, Jens

    2017-01-01

    /mid-ventricular/apical for the LV-LP, and as apical/non-apical for the RV-LP. Appropriate and inappropriate therapies were registered during follow-up via remote monitoring or at device interrogations. Time to event was summarized with Kaplan-Meier plots, and competed risk regression analysis was used to calculate adjusted hazard...... with an apical. We observed no significant association between appropriate therapy and LV-LP in left anterior oblique or right anterior oblique views or inappropriate therapy between any lead positions. Conclusion: An apical RV-LP is associated with an increased risk of appropriate therapy for ventricular...

  18. The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer

    Science.gov (United States)

    2014-03-01

    8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression

  19. Prognostic role of syncytin expression in breast cancer

    DEFF Research Database (Denmark)

    Larsson, Lars-Inge; Holck, Susanne; Christensen, Ib Jarle

    2007-01-01

    Breast cancer cells were recently found to produce syncytin, an endogenous retroviral protein implicated in cell fusion, immune regulation, and nitric oxide synthase expression. To determine whether syncytin has a prognostic role in breast cancer, we investigated a series of 165 premenopausal lymph...... node-negative women for syncytin expression using an immunocytochemical scoring system. Results were analyzed with the Kaplan-Meier method and with the Cox proportional hazard model. Syncytin expression was observed in 38% of the patients, and the degree of syncytin expression constituted a positive...

  20. Detection of angiogenesis-dependent parameters by functional MRI: Correlation between histomorphology and evaluation of clinical relevance as prognostic factor for the example of cervical carcinoma

    International Nuclear Information System (INIS)

    Hawighorst, H.; Knopp, M.V.; Schoenberg, S.O.; Essig, M.; Kaick, G. van; Schaeffer, U.; Knapstein, P.G.; Weikel, W.

    1998-01-01

    Purpose: Purpose of this study is to compare functional MRI parameters with histomorphological markers of tumor microvessel density (MVD) and permeability (vascular endothelial growth factor) and to determine the ultimate value of both approaches by correlation with disease outcome in patients with primary cancer of the uterine cervix. Method: Pharmacokinetic parameters were calculated from contrast-enhanced dynamic MR imaging series in 37 patients with biopsy-proven primary cervical cancer. On the operative whole mount specimens, histomorphological markers of tumor angiogenesis (MVD, VEGF) were compared with the MRI-derived parameters. For MRI and histomorphological data, Kaplan-Meier survival curves were calculated and compared using logrank statistics. Results: Significant (p [de

  1. The new Wuerzburg data base for radiation therapy

    International Nuclear Information System (INIS)

    Richter, J.; Richter, E.; Tausch, J.

    1991-01-01

    Conception, structure and realisation of a new data base for radiation therapy are present. The data base utilizes the commercial data base system ORACLE and the data base language SQL. A program package for statistical analyses including Kaplan-Meier-calculations, logrank test and Gehan/Breslow test was elaborated. The input of the data recorded on form sheets is carried out on a data base of the Tumor Centre in the first instance. From there the data are transfered to the ORACLE data base. Up to now the courses of disease of about 13 000 patients are stored. Therefore, extensive and detailed statistical analyses are practicable. (orig.) [de

  2. Aldo-keto Reductase Family 1 B10 as a Novel Target for Breast Cancer Treatment

    Science.gov (United States)

    2010-08-01

    overexpressed in tested human breast cancer tissues and mediates acetyl-CoA carboxylase-α ( ACCA ) stability, affecting fatty acid de novo synthesis and...9703; Fax. 217-545-3227; E-mail: dcao@siumed.edu Running title: AKR1B10 as a new risk factor for breast cancer Abbreviations used: ACCA , acetyl...The effect of AKR1B10 expression in cancer tissue on patient survival was evaluated with Kaplan - Meier plots, and results showed that AKR1B10

  3. Molecular genetics analysis of hereditary breast and ovarian cancer patients in India

    OpenAIRE

    Soumittra, Nagasamy; Meenakumari, Balaiah; Parija, Tithi; Sridevi, Veluswami; Nancy, Karunakaran N; Swaminathan, Rajaraman; Rajalekshmy, Kamalalayam R; Majhi, Urmila; Rajkumar, Thangarajan

    2009-01-01

    Abstract Background Hereditary cancers account for 5–10% of cancers. In this study BRCA1, BRCA2 and CHEK2*(1100delC) were analyzed for mutations in 91 HBOC/HBC/HOC families and early onset breast and early onset ovarian cancer cases. Methods PCR-DHPLC was used for mutation screening followed by DNA sequencing for identification and confirmation of mutations. Kaplan-Meier survival probabilities were computed for five-year survival data on Breast and Ovarian cancer cases separately, and differe...

  4. Reverse hybrid total hip arthroplasty

    DEFF Research Database (Denmark)

    Wangen, Helge; Havelin, Leif I.; Fenstad, Anne M

    2017-01-01

    Background and purpose - The use of a cemented cup together with an uncemented stem in total hip arthroplasty (THA) has become popular in Norway and Sweden during the last decade. The results of this prosthetic concept, reverse hybrid THA, have been sparsely described. The Nordic Arthroplasty....... Patients and methods - From the NARA, we extracted data on reverse hybrid THAs from January 1, 2000 until December 31, 2013. 38,415 such hips were studied and compared with cemented THAs. The Kaplan-Meier method and Cox regression analyses were used to estimate the prosthesis survival and the relative risk...

  5. Growth pattern of colorectal liver metastasis as a marker of recurrence risk

    DEFF Research Database (Denmark)

    Eefsen, R L; Vermeulen, P B; Christensen, I J

    2015-01-01

    from patient and pathology records. Histological GP were evaluated and related to recurrence free and OS. Kaplan-Meier curves, log-rank test and Cox regression analysis were used. The 5-year OS was 41.8% (95% CI 33.8-49.8%). Growth pattern evaluation of the largest liver metastasis was possible in 224...... free survival (RFS) than patients resected for non-desmoplastic liver metastases (p=0.05). When patients were stratified according to neo-adjuvant treatment in the multivariate Cox regression model, hazard ratios for RFS compared to desmoplastic were: pushing (HR=1.37, 95% CI 0.93-2.02, p=0...

  6. Renal replacement therapy for autosomal dominant polycystic kidney disease (ADPKD) in Europe

    DEFF Research Database (Denmark)

    Spithoven, Edwin M; Kramer, Anneke; Meijer, Esther

    2014-01-01

    on RRT prevalence and survival on RRT in 12 European countries with 208 million inhabitants. We studied four 5-year periods (1991-2010). Survival analysis was performed by the Kaplan-Meier method and by Cox proportional hazards regression. RESULTS: From the first to the last study period, the prevalence...... for non-ADPKD subjects. Improved survival was noted for all RRT modalities: haemodialysis [adjusted hazard ratio for mortality during the last versus first time period 0.75 (95% confidence interval 0.61-0.91), peritoneal dialysis 0.55 (0.38-0.80) and transplantation 0.52 (0.32-0.74)]. Cardiovascular...

  7. Volume-Based F-18 FDG PET/CT Imaging Markers Provide Supplemental Prognostic Information to Histologic Grading in Patients With High-Grade Bone or Soft Tissue Sarcoma

    DEFF Research Database (Denmark)

    Andersen, Kim Francis; Fuglo, Hanna Maria; Rasmussen, Sine Hvid

    2015-01-01

    analysis. Kaplan-Meier survival estimates and log-rank test were used to compare the degree of equality of survival distributions. Prognostic variables with related hazard ratios (HR) were assessed using Cox proportional hazards regression analysis.Forty-one of 92 patients died during follow-up (45%; 12 BS.......05, HR 3.37 [95% CI 1.02-11.11]). No significant results were demonstrated for MTV40%.Volume-based F-18 FDG PET/CT imaging markers in terms of pretreatment estimation of TLG provide supplemental prognostic information to histologic grading, with significant independent properties for prediction...

  8. Hospital volume and the risk of revision in Oxford unicompartmental knee arthroplasty in the Nordic countries -an observational study of 14,496 cases

    DEFF Research Database (Denmark)

    Badawy, Mona; Fenstad, Anne M.; Bartz-Johannessen, Christoffer A.

    2017-01-01

    Background: High procedure volume and dedication to unicompartmental knee arthroplasty (UKA) has been suggested to improve revision rates. This study aimed to quantify the annual hospital volume effect on revision risk in Oxfordu? nicompartmental knee arthroplasty in the Nordic countries. Methods......). The outcome was revision risk after 2 and 10 years calculated using Kaplan Meier method. Multivariate Cox regression analysis was used to assess the Hazard Ratio (HR) of any revision due to specific reasons with 95% confidence intervals (CI). Results: The implant survival was 80% at 10 years in the volume...

  9. The 434(G>C) polymorphism in the eosinophil cationic protein gene and its association with tissue eosinophilia in oral squamous cell carcinomas

    DEFF Research Database (Denmark)

    Pereira, Michele C; Oliveira, Denise T; Olivieri, Eloísa H R

    2010-01-01

    OBJECTIVE: The aim of this study was to investigate the prevalence of the Eosinophil cationic protein (ECP)-gene polymorphism 434(G>C) in oral squamous cell carcinoma (OSCC) patients and its association with tumor-associated tissue eosinophilia (TATE), demographic, clinical, and microscopic...... of ECP-gene polymorphism 434(G>C) with TATE, demographic, clinical, and microscopic variables in OSCC patients. Disease-free survival and overall survival were calculated by the Kaplan-Meier product-limit actuarial method and the comparison of the survival curves were performed using log rank test...

  10. Magnitude of bacteraemia predicts one-year mortality

    DEFF Research Database (Denmark)

    Gradel, Kim Oren; Schønheyder, Henrik Carl; Søgaard, Mette

    Objectives: All hospitals in our region use the BacT/Alert® blood culture (BC) system with a 3-bottle BC set for adults. We hypothesized that the magnitude of bacteremia (i.e., number of positive bottles in the initial BC set) predicted one-year mortality. Methods In a population-based study we...... with a BC index of 1 (i.e., one positive bottle) were chosen as the reference group. We computed Kaplan-Meier curves and performed Cox regression analyses to estimate mortality rate ratios (MRRs) with 95 % confidence intervals [CIs] 30 and 365 days after the initial BC sampling date, first in crude analyses...... mortality....

  11. Incidence and Outcome of BRCA Mutations in Unselected Patients with Triple Receptor-Negative Breast Cancer.

    LENUS (Irish Health Repository)

    Gonzalez-Angulo, Ana M

    2011-03-01

    To investigate the incidence of germline and somatic BRCA1\\/2 mutations in unselected patients with triple-negative breast cancer (TNBC) and determine the prognostic significance of carrying a mutation. Methods: DNA was obtained from 77 TNBC and normal tissues. BRCA1\\/2 exons\\/flanking regions were sequenced from tumor and patients classified as mutant or wild type (WT). Sequencing was repeated from normal tissue to identify germline and somatic mutations. Patient characteristics were compared with chi-square. Survival was estimated by Kaplan-Meier method and compared with log-rank. Cox proportional hazards models were fit to determine the independent association of mutation status with outcome.

  12. Factores de Deserción Estudiantil en Ingeniería: Una Aplicación de Modelos de Duración Student Dropout Factors in Engineering: An Application of Duration Models

    OpenAIRE

    Christian J Díaz

    2009-01-01

    Se analizó la deserción estudiantil universitaria, en estudiantes de carreras de ingeniería de la cohorte del año 2004 hasta enero del año 2007. Se evaluó la retención utilizando un modelo de Kaplan-Meier, y se determinaron factores de la deserción con un modelo de riesgos proporcionales de Cox. Los resultados muestran que la mayor probabilidad de desertar se presenta en los tres primeros semestres, y en estudiantes que provienen de colegios financiados por el estado. Son factores determinant...

  13. Restaging and Survival Analysis of 4036 Ovarian Cancer Patients According to the 2013 FIGO Classification for Ovarian, Fallopian Tube, and Primary Peritoneal Cancer

    DEFF Research Database (Denmark)

    Rosendahl, Mikkel; Høgdall, Claus Kim; Mosgaard, Berit Jul

    2016-01-01

    OBJECTIVE: With the 2013 International Federation of Gynecology and Obstetrics (FIGO) staging for ovarian, fallopian tube, and primary peritoneal cancer, the number of substages changed from 10 to 14. Any classification of a malignancy should easily assign patients to prognostic groups, refer....... MATERIALS AND METHODS: Demographic, surgical, histological, and survival data from 4036 ovarian cancer patients were used in the analysis. Five-year survival rates (5YSR) and hazard ratios for the old and revised FIGO staging were calculated using Kaplan-Meier curves and Cox regression. RESULTS: A total...

  14. Clinical outcomes in patients with node-negative breast cancer treated based on the recurrence score results: evidence from a large prospectively designed registry.

    Science.gov (United States)

    Stemmer, Salomon M; Steiner, Mariana; Rizel, Shulamith; Soussan-Gutman, Lior; Ben-Baruch, Noa; Bareket-Samish, Avital; Geffen, David B; Nisenbaum, Bella; Isaacs, Kevin; Fried, Georgeta; Rosengarten, Ora; Uziely, Beatrice; Svedman, Christer; McCullough, Debbie; Maddala, Tara; Klang, Shmuel H; Zidan, Jamal; Ryvo, Larisa; Kaufman, Bella; Evron, Ella; Karminsky, Natalya; Goldberg, Hadassah; Shak, Steven; Liebermann, Nicky

    2017-01-01

    The 21-gene Recurrence Score® (RS) assay is a validated prognostic/predictive tool in ER + early-stage breast cancer. However, clinical outcome data from prospective studies in RS ≥ 11 patients are lacking, as are relevant real-life clinical practice data. In this retrospective analysis of a prospectively designed registry, we evaluated treatments/clinical outcomes in patients undergoing RS-testing through Clalit Health Services. The analysis included N0 ER + HER2-negative breast cancer patients who were RS-tested from 1/2006 through 12/2010. Medical records were reviewed to verify treatments/recurrences/survival. The cohort included 1801 patients (median follow-up, 6.2 years). Median age was 60 years, 50.4% were grade 2 and 81.1% had invasive ductal carcinoma; 48.9% had RS < 18, 40.7% RS 18-30, and 10.4% RS ≥ 31, with chemotherapy use of 1.4, 23.7, and 87.2%, respectively. The 5-year Kaplan-Meier estimates for distant recurrence were 0.8, 3.0, and 8.6%, for patients with RS < 18, RS 18-30 and RS ≥ 31, respectively; the corresponding 5-year Kaplan-Meier estimates for breast cancer death were 0.0, 0.9, and 6.2%. Chemotherapy-untreated patients with RS < 11 ( n  = 304) and 11-25 ( n  = 1037) (TAILORx categorizatio n ) had 5-year Kaplan-Meier estimates for distant recurrence risk/breast cancer death of 1.0%/0.0% and 1.3%/0.4%, respectively. Our results extend those of the prospective TAILORx trial: the 5-year Kaplan-Meier estimates for distant recurrence and breast cancer death rate for the RS < 18 patients were very low supporting the use of endocrine therapy alone. Furthermore, in chemotherapy-untreated patients with RS 11-25 (where TAILORx patients were randomized to chemoendocrine or endocrine therapy alone), 5-year distant recurrence rates were also very low, suggesting that chemotherapy would not have conferred clinically meaningful benefit.

  15. United States Air Force Research Initiation Program. 1984 Research Reports. Volume 2.

    Science.gov (United States)

    1986-05-01

    differential determination of adrenaline and noradrenaline in plasma." Clinica Chemica Acta. Vol. 30, pp. 373-376, 1970. 37. Stegemann, J., U. Meier, W...34%" . 1. Agh-anian, G. K. and R. Y. Wang. Physiology and Pharma - coloay cf central serotonergic neurons. In: Psych ph cl . j aGe tion A of P M...34, AIAA Journal, Vol. 18, No. 1, January 1980,"[ ’ "<. .’ip p . 1 1 - 1 5 . 39. Rotta, J.C., "Temperaturverteilungen in der Turbulenten Grenzschicht an

  16. Markov chains and semi-Markov models in time-to-event analysis.

    Science.gov (United States)

    Abner, Erin L; Charnigo, Richard J; Kryscio, Richard J

    2013-10-25

    A variety of statistical methods are available to investigators for analysis of time-to-event data, often referred to as survival analysis. Kaplan-Meier estimation and Cox proportional hazards regression are commonly employed tools but are not appropriate for all studies, particularly in the presence of competing risks and when multiple or recurrent outcomes are of interest. Markov chain models can accommodate censored data, competing risks (informative censoring), multiple outcomes, recurrent outcomes, frailty, and non-constant survival probabilities. Markov chain models, though often overlooked by investigators in time-to-event analysis, have long been used in clinical studies and have widespread application in other fields.

  17. Sequential alternating deferiprone and deferoxamine treatment compared to deferiprone monotherapy: main findings and clinical follow-up of a large multicenter randomized clinical trial in -thalassemia major patients

    DEFF Research Database (Denmark)

    Pantalone, Gaetano Restivo; Maggio, Aurelio; Vitrano, Angela

    2011-01-01

    In β-thalassemia major (β-TM) patients, iron chelation therapy is mandatory to reduce iron overload secondary to transfusions. Recommended first line treatment is deferoxamine (DFO) from the age of 2 and second line treatment after the age of 6 is deferiprone (L1). A multicenter randomized open...... thalassemia patients were randomized and underwent intention-to-treat analysis. Statistically, a decrease of serum ferritin level was significantly higher in alternating sequential L1-DFO patients compared with L1 alone patients (p = 0.005). Kaplan-Meier survival analysis for the two chelation treatments did...

  18. Writing for Impact

    DEFF Research Database (Denmark)

    Meier, Ninna

    2016-01-01

    Academic work may have impact in a variety of ways, depending on purpose, audience and field, but this is most likely to happen when your work resonates in meaningful ways with people. Ninna Meier encourages a more systematic investigation of the role of writing in achieving impact. Impact through...... writing means getting your readers to understand and remember your message and leave the reading experience changed. The challenge is to make what you write resonate with an audience’s reservoir of experiential knowledge. If the words do not connect to anything tangible, interest can be quickly lost....

  19. Demographic Clinical and Prognostic Factors of Primary Ovarian Adenocarcinomas of Serous and Clear Cell Histology—A Comparative Study

    DEFF Research Database (Denmark)

    Schnack, Tine H; Høgdall, Estrid; Nedergaard, Lotte

    2016-01-01

    -based prospectively collected data on oCCC (n = 179) and oSAC (n = 2363) cases were obtained from the Danish Gynecological Cancer Database. χ, Fischer or Wilcoxon-Mann-Whitney, multivariate logistic regression, univariate Kaplan-Meier, and multivariate Cox regression tests were used. Statistical tests were 2-sided. P......, 0.62; 95% confidence interval, 0.37-0.92).Although more oSAC than oCCC cases diagnosed in stage III or IV were referred to neoadjuvant chemotherapy, a higher proportion of oCCC achieved complete cytoreduction at primary debulking surgery and/or had lymphadenectomy performed; overall survival were...

  20. Demographic clinical and prognostic characteristics of primary ovarian, peritoneal and tubal adenocarcinomas of serous histology-

    DEFF Research Database (Denmark)

    Schnack, Tine H; Sørensen, Rie D; Nedergaard, Lotte

    2014-01-01

    OBJECTIVES: Invasive serous adenocarcinomas may present as primary ovarian (POC), primary fallopian tube (PFC) or primary peritoneal (PPC) carcinomas. Whether they are variants of the same malignancy or develop through different pathways is debated. METHODS: Population-based prospectively collected...... data on POC (n=1443), PPC (n=268) and PFC (n=171) cases was obtained from the Danish Gynecological Cancer Database (2005-2013). Chi-square, Fisher's or Wilcoxon-Mann-Whitney test, multivariate logistic regression, Kaplan-Meier and multivariate Cox-regression were used as appropriate. Statistical tests...

  1. Prognostic value of efficiently correcting nocturnal desaturations after one month of non-invasive ventilation in amyotrophic lateral sclerosis: a retrospective monocentre observational cohort study.

    Science.gov (United States)

    Gonzalez-Bermejo, Jésus; Morelot-Panzini, Capucine; Arnol, Nathalie; Meininger, Vincent; Kraoua, Salah; Salachas, François; Similowski, Thomas

    2013-09-01

    Abstract NIV adherence ('quantity' of ventilation) has a prognostic impact in amyotrophic lateral sclerosis (ALS). We hypothesized that NIV effectiveness ('quality') could also have a similar impact. NIV effectiveness was evaluated in 82 patients within the first month (M1) and every three months (symptoms, arterial blood bases, and nocturnal pulsed oxygen saturation - SpO2). Kaplan-Meier survival and risk factors for mortality one year after NIV initiation were evaluated. Forty patients were considered 'correctly ventilated' at M1 (Group 1, less than 5% of nocturnal oximetry time with an SpO2NIV effectiveness to correct nocturnal desaturations is an independent prognostic factor.

  2. Surface-wave tomography of Ireland and surroundings using ambient noise and teleseismic data

    Science.gov (United States)

    Bonadio, Raffaele; Arroucau, Pierre; Lebedev, Sergei; Meier, Thomas; Schaeffer, Andrew; Licciardi, Andrea; Piana Agostinetti, Nicola

    2016-04-01

    Ireland's geology is dominated by northeast-southwest structural trends and suture zones, mostly inferred from geological mapping and a few active source seismic experiments. However, their geometry and extent at depth and their continuity across the Irish Sea are still poorly known. Important questions also remain unanswered regarding the thickness and bulk properties of the sedimentary cover at the regional scale, the deformation and flow of the deep crust during the formation of Ireland, the thickness of Ireland's lithosphere today, and the thermal structure and dynamics of the asthenosphere beneath Ireland. In this work, we take advantage of abundant, newly available broadband data from temporary array deployments and permanent seismic networks in Ireland and Great Britain to produce high-resolution models of seismic velocity structure and anisotropy of the lithosphere. We combine Rayleigh and Love phase velocity measurements from waveform cross-correlation using both ambient noise and teleseismic data in order to produce high-quality dispersion curves for periods ranging from 1 to 300 s. The phase velocity measurement procedures are adapted from Meier et al.[2], Lebedev et al.[1] and Soomro et al.[3] and are automated in order to deal with the large amount of data and ensure consistency and reproducibility. For the nearly 200 stations used in this study, we obtain a very large number of dispersion curves from both ambient noise and teleseimic data. Dispersion measurements are then inverted in a tomographic procedure for surface-wave phase velocity maps in a very broad period range. The maps constrain the 3D seismic-velocity structure of the crust and upper mantle underlying Ireland and the Irish Sea. {9} Lebedev, S., T. Meier, R. D. van der Hilst. Asthenospheric flow and origin of volcanism in the Baikal Rift area, Earth Planet. Sci. Lett., 249, 415-424, 2006. Meier, T., K. Dietrich, B. Stockhert, H.P. Harjes, One-dimensional models of shear wave velocity for

  3. Mesalazine in treating diverticular disease of the colon.

    Science.gov (United States)

    Tursi, Antonio

    2013-07-01

    Evaluation of: Kruis W, Meier E, Schumacher M, Mickisch O, Greinwald R, Mueller R; German SAG-20 Study Group. Randomised clinical trial: mesalazine (Salofalk granules) for uncomplicated diverticular disease of the colon - a placebo-controlled study. Aliment. Pharmacol. Ther. 37(7), 680-690 (2013). Although diverticular disease (DD) is one of the commonest diseases in the western world, robust evidences about its treatment are lack so far. A recent, placebo-controlled study found mesalazine effective in obtaining pain relief in patients suffering from DD. A brief comment is provided herein in order to assess the rationale of this drug in treating DD.

  4. Assessment of cerebral blood flow by means of non-diffusible tracers

    Energy Technology Data Exchange (ETDEWEB)

    Bagni, B; Carraro, P L; Candini, G; Feggi, L M

    1985-01-01

    A program for the evaluation of cerebral blood flow based on the analysis of the time activity curves is presented. The method is based on the Meier and Zierler formula, applying the partition coefficients suggested by Lassen et al. for the corrections deriving from the use of non-diffusible indicators (Technetium-99m-DTPA). Particular attention is given to the smoothing of the time-activity curve (using Legendre's polynomials) and to the correction function for reflux. The computation procedures and their validity are discussed.

  5. Duración del desempleo y canales de búsqueda de empleo en Colombia

    OpenAIRE

    Carlos Augusto Viáfara L; José Ignacio Uribe G

    2009-01-01

    Este artículo estudia la duración del desempleo en Colombia como indicador de la efectividad de los canales de búsqueda de empleo, con información de la Encuesta Continua de Hogares (ECH) del segundo trimestre de 2006. Se estiman modelos de duración paramétricos (Weibull de riesgos proporcionales) y no paramétricos (Kaplan-Meier). Los resultados indican que en la duración del desempleo influye considerablemente el canal de búsqueda que usan los empleados para conseguir empleo y los desocupado...

  6. Notion of Prejudice in the Works of Immanuel Kant

    Directory of Open Access Journals (Sweden)

    Pedro Jesús Teruel

    2014-02-01

    Full Text Available The notion of prejudice occupies a not very visible place in the Kantian works. In fact it has been seldom treated in Kantian studies in German, English, French, Italian or Spanish. But it connects with relevant key notes of the Critique of Pure Reason (1781, 1787 as well as from the Critique of Practical Reason (1788 and the Critique of Judgement (1790. The aim of this paper consists in the analysis of the Kantian notion of prejudice, its systematic place and its sources (among these particularly the works of Georg Friedrich Meier and the thought of Christian Thomasius.

  7. Cementless One-Stage Revision in Chronic Periprosthetic Hip Joint Infection. Ninety-One Percent Infection Free Survival in 56 Patients at Minimum 2-Year Follow-Up

    DEFF Research Database (Denmark)

    Lange, Jeppe; Troelsen, Anders; Solgaard, Søren

    2018-01-01

    was re-revision performed due to infection and was evaluated by competing risk analysis, with death and aseptic revision as competing events. All-cause mortality was evaluated by Kaplan-Meier survival analysis. Oxford Hip Score (OHS) was used as disease-specific patient-reported outcome measure. RESULTS......BACKGROUND: Cementless 1-stage revision in chronic periprosthetic hip joint infections is limited evaluated. The purpose of this study was to evaluate a specific treatment protocol in this patient group. METHODS: The study was performed as a multicenter, proof-of-concept, observational study...

  8. Mortality impact of positive blood cultures in patients with suspected community-acquired bacteraemia. A Danish population-based cohort study

    DEFF Research Database (Denmark)

    Søgaard, Mette; Nørgaard, Mette; Sørensen, Henrik Toft

    2009-01-01

    for age, gender, coexisting chronic diseases, marital status, use of immunosuppressives, and calendar period. Further, we conducted analyses restricted to patients a discharge diagnose of infectious diseases (ICD-10 codes A00-B99). Results: In total, 1,665 (8.2%) patients had positive blood culture...... System. We computed Kaplan-Meier curves and product limit estimates for the main study variables. Next, time-dependent Cox regression analyses was used to compare the risk of death in patients with positive blood cultures and patients with negative cultures at days 0-7, 8-30, and 31-180, controlling...

  9. Human milk: medicine for premature babies.

    Science.gov (United States)

    Hilton, Sioned

    2011-12-01

    Following years of research there have been some significant developments in the understanding and subsequent support being offered to Neonatal Intensive Care Unit (NICU) families. In addition, ground breaking advances in the treatment of premature infants, with specific interest in the role of human milk, are now available. New information was presented by leading international researcher, Professor Meier, at an international symposium earlier this year. This article seeks to share this insightful information and provide support to those working in or around the NICU.

  10. Excellent survival after liver transplantation for isolated polycystic liver disease: an European Liver Transplant Registry study

    DEFF Research Database (Denmark)

    van Keimpema, Loes; Nevens, Frederik; Adam, René

    2011-01-01

    Patients with end-stage isolated polycystic liver disease (PCLD) suffer from incapacitating symptoms because of very large liver volumes. Liver transplantation (LT) is the only curative option. This study assesses the feasibility of LT in PCLD. We used the European Liver Transplant Registry (ELTR......) database to extract demographics and outcomes of 58 PCLD patients. We used Kaplan-Meier survival analysis for survival rates. Severe abdominal pain (75%) was the most prominent symptom, while portal hypertension (35%) was the most common complication in PCLD. The explantation of the polycystic liver...

  11. High frequency of tumor cells with nuclear Egr-1 protein expression in human bladder cancer is associated with disease progression

    DEFF Research Database (Denmark)

    Egerod, Frederikke N S Lihme; Bartels, Annette; Fristrup, Niels

    2009-01-01

    bladder cancer. RESULTS: The frequency of tumor cells with nuclear Egr-1 immunolabelling correlated to bladder cancer stage, grade and to later progression to muscle-invasive bladder cancer (T2-4). Stage T1 tumors exhibited significantly higher frequencies of tumor cells with nuclear Egr-1 immunolabelling...... than Ta tumors (P = 0.001). Furthermore, Kaplan-Meier survival analysis showed that a high frequency of tumor cells with nuclear Egr-1 immunolabelling was significantly associated with a higher risk of progression to stage T2-4 (log-rank test, P = 0.035). Tumor cells with nuclear Egr-1 immunolabelling...

  12. Increased 30-day mortality in patients with diabetes undergoing surgery for colorectal cancer

    DEFF Research Database (Denmark)

    Fransgaard, T; Thygesen, L C; Gögenur, I

    2016-01-01

    with the use of antidiabetic drugs identified through the Danish National Prescription Registry and DCCG. The 30-day mortality was examined by the Kaplan-Meier method with the log-rank test and the Cox regression model used to test statistical significance. RESULTS: The study included 29 353 patients, of whom...... 3250 had preexisting diabetes. The 30-day mortality was significantly increased in patients with CRC and preexisting diabetes (adjusted hazard ratio 1.17, 95% CI 1.01-1.35, P = 0.03). The type of antidiabetic medication used was not associated with 30-day mortality. CONCLUSION: Preexisting diabetes...

  13. Polymorphous low-grade adenocarcinoma: A Danish national study

    DEFF Research Database (Denmark)

    Elhakim, Mohammad Talal; Breinholt, Helle; Godballe, Christian

    2016-01-01

    . Histological slides were reviewed and data concerning demographics, tumour site, clinical stage, treatment profiles and follow-up were retrieved. Survival estimates and prognostic factors were evaluated by comparing Kaplan–Meier plots using the Mantel–Haenszel log-rank test. Results Of the 73 patients, 47 (64......%) were female. Median age was 58 years. The most common location was the palate (73%). Median latency was five months. Recurrence was seen in 13% of patients. Overall survival (OS), disease-specific survival (DSS) and recurrence-free survival (RFS) rates after 10 years were 73%, 99% and 83%, respectively...

  14. Influence of Body Mass Index on Tumor Pathology and Survival in Uterine Cancer

    DEFF Research Database (Denmark)

    Bjerrum Kristensen, Anne; Hare-Bruun, Helle; Høgdall, Claus Kim

    2017-01-01

    OBJECTIVE: To evaluate the influence of body mass index (BMI) on endometrial tumor pathology, stage and complication rate and to identify individual prognostic factors, such as BMI, in types I and II endometrial cancer. DESIGN: Register study included all Danish women who underwent surgery...... I and II endometrial cancer were retrieved. Kaplan-Meier plot was used to illustrate differences in survival in relation to BMI. Log-rank test was used to demonstrate difference between the curves. Cox regression hazard model was used to estimate hazard ratios (HR) of the effect of BMI on overall...

  15. Experience of the Casablanca radiotherapy-oncology centre on radiotherapy in the treatment of the adult Hodgkin lymphoma; Experience du centre de radiotherapie-oncologie de Casablanca sur la radiotherapie dans le traitement du lymphome de Hodgkin de l'adulte

    Energy Technology Data Exchange (ETDEWEB)

    Bouchbika, Z.; Benchakroun, N.; Sellai, N.; Jouhadi, H.; Tawfiq, N.; Sahraoui, S.; Benider, A. [Service radiotherapie-oncologie, CHU Ibn-Rochd, Casablanca (Morocco)

    2011-10-15

    The authors report the assessment of the local control, global survival and survival without recurrence, and also late complications, based on retrospective study over 8 years of 169 cases Hodgkin lymphoma in patients older than 18 (average age of 34) and who had been submitted to radiotherapy. Survival has been computed according to the Kaplan-Meier method. The authors notice that the recurrence rate is slightly higher than in the literature. During the considered period, radiotherapy was two-dimensional with higher doses than those corresponding to current standards. The improvement of radiotherapy techniques and the decrease of doses within the standards should improve the therapeutic results. Short communication

  16. Clinical Features in a Danish Population-Based Cohort of Probable Multiple System Atrophy Patients

    DEFF Research Database (Denmark)

    Starhof, Charlotte; Korbo, Lise; Lassen, Christina Funch

    2016-01-01

    Background: Multiple system atrophy (MSA) is a rare, sporadic and progressive neurodegenerative disorder. We aimed to describe the clinical features of Danish probable MSA patients, evaluate their initial response to dopaminergic therapy and examine mortality. Methods: From the Danish National...... the criteria for probable MSA. We recorded clinical features, examined differences by MSA subtype and used Kaplan-Meier survival analysis to examine mortality. Results: The mean age at onset of patients with probable MSA was 60.2 years (range 36-75 years) and mean time to wheelchair dependency was 4.7 years...

  17. Estimating a population cumulative incidence under calendar time trends

    DEFF Research Database (Denmark)

    Hansen, Stefan N; Overgaard, Morten; Andersen, Per K

    2017-01-01

    BACKGROUND: The risk of a disease or psychiatric disorder is frequently measured by the age-specific cumulative incidence. Cumulative incidence estimates are often derived in cohort studies with individuals recruited over calendar time and with the end of follow-up governed by a specific date....... It is common practice to apply the Kaplan-Meier or Aalen-Johansen estimator to the total sample and report either the estimated cumulative incidence curve or just a single point on the curve as a description of the disease risk. METHODS: We argue that, whenever the disease or disorder of interest is influenced...

  18. Impact of Marital Status on Tumor Stage at Diagnosis and on Survival in Male Breast Cancer

    OpenAIRE

    Adekolujo, Orimisan Samuel; Tadisina, Shourya; Koduru, Ujwala; Gernand, Jill; Smith, Susan Jane; Kakarala, Radhika Ramani

    2016-01-01

    The effect of marital status (MS) on survival varies according to cancer type and gender. There has been no report on the impact of MS on survival in male breast cancer (MBC). This study aims to determine the influence of MS on tumor stage at diagnosis and survival in MBC. Men with MBC ≥18 years of age in the SEER database from 1990 to 2011 were included in the study. MS was classified as married and unmarried (including single, divorced, separated, widowed). Kaplan–Meier method was used to e...

  19. Report of Case Studies on Gender Equality as a Focus Point of National and Nativist Discourses

    DEFF Research Database (Denmark)

    Siim, Birte; Krizsán, Andrea; Gruziel, Dominika

    Cosmopolitanism, Oxford: Oxford University Press.Fraser, N. (2013). Fortunes of Feminism: From State-Managed Capitalism to Neoliberal Crisis, London: VersoKymlicka, Will (1995). Multicultural Citizenship. A Liberal Theory of Minority Rights, Oxford, Oxford University Press.Lombardo, E., P. Meier & M. Verloo (eds....... Scholars have proposed a notion of rooted cosmopolitan citizenship (Benhabib 2006) beyond the national state. The recent political and economic crisis has inspired debates about gender equality and gender justice within and beyond the nation state. Feminist scholarship has started to explore intersections...

  20. Simple Unawareness in Dynamic Psychological Games

    DEFF Research Database (Denmark)

    Nielsen, Carsten Søren; Sebald, Alexander Christopher

    2017-01-01

    Building on Battigalli and Dufwenberg (2009)’s framework of dynamic psychological games and the progress in the modeling of dynamic unawareness by Heifetz, Meier, and Schipper (2013a) we model and analyze the impact of asymmetric awareness in the strategic interaction of players motivated...... by reciprocity and guilt. Specifically we characterize extensive-form games with psychological payoffs and simple unawareness, define extensive-form rationalizability and, using this, show that unawareness has a pervasive impact on the strategic interaction of psychologically motivated players. Intuitively...

  1. Mercury in fishes from 21 national parks in the Western United States: inter- and intra-park variation in concentrations and ecological risk

    Science.gov (United States)

    Eagles-Smith, Collin A.; Willacker, James J.; Flanagan Pritz, Colleen M.

    2014-01-01

    of fish sampled were above a benchmark for risk to highly sensitive avian consumers (90 ng/g ww), and THg concentrations in 68 percent of fish sampled were above exposure levels recommended by the Great Lakes Advisory Group (50 ng/g ww) for unlimited consumption by humans. Of the fish assessed for risk to human consumers (that is, species that are large enough to be consumed by recreational or subsistence anglers), only one individual fish from Yosemite National Park had a muscle Hg concentration exceeding the benchmark (950 ng/g ww) at which no human consumption is advised. Zion, Capital Reef, Wrangell-St. Elias, and Lake Clark National Parks all contained sites in which most fish exceeded benchmarks for the protection of human and wildlife health. This finding is particularly concerning in Zion and Capitol Reef National Parks because the fish from these parks were speckled dace, a small, invertebrate-feeding species, yet their Hg concentrations were as high or higher than those in the largest, long-lived predatory species, such as lake trout. Future targeted research and monitoring across park habitats would help identify patterns of Hg distribution across the landscape and facilitate management decisions aimed at reducing the ecological risk posed by Hg contamination in sensitive ecosystems protected by the National Park Service.

  2. Preliminary assessment of factors influencing riverine fish communities in Massachusetts.

    Science.gov (United States)

    Armstrong, David S.; Richards, Todd A.; Brandt, Sara L.

    2010-01-01

    The U.S. Geological Survey, in cooperation with the Massachusetts Department of Conservation and Recreation (MDCR), Massachusetts Department of Environmental Protection (MDEP), and the Massachusetts Department of Fish and Game (MDFG), conducted a preliminary investigation of fish communities in small- to medium-sized Massachusetts streams. The objective of this investigation was to determine relations between fish-community characteristics and anthropogenic alteration, including flow alteration and impervious cover, relative to the effect of physical basin and land-cover (environmental) characteristics. Fish data were obtained for 756 fish-sampling sites from the Massachusetts Division of Fisheries and Wildlife fish-community database. A review of the literature was used to select a set of fish metrics responsive to flow alteration. Fish metrics tested include two fish-community metrics (fluvial-fish relative abundance and fluvial-fish species richness), and five indicator species metrics (relative abundance of brook trout, blacknose dace, fallfish, white sucker, and redfin pickerel). Streamflows were simulated for each fish-sampling site using the Sustainable Yield Estimator application (SYE). Daily streamflows and the SYE water-use database were used to determine a set of indicators of flow alteration, including percent alteration of August median flow, water-use intensity, and withdrawal and return-flow fraction. The contributing areas to the fish-sampling sites were delineated and used with a Geographic Information System (GIS) to determine a set of environmental characteristics, including elevation, basin slope, percent sand and gravel, percent wetland, and percent open water, and a set of anthropogenic-alteration variables, including impervious cover and dam density. Two analytical techniques, quantile regression and generalized linear modeling, were applied to determine the association between fish-response variables and the selected environmental and

  3. Instream flow assessment of streams draining the Arbuckle-Simpson Aquifer

    Science.gov (United States)

    Seilheimer, Titus S.; Fisher, William L.

    2008-01-01

    The availability of high quality water is critical to both humans and ecosystems. A recent proposal was made by rapidly expanding municipalities in central Oklahoma to begin transferring groundwater from the Arbuckle-Simpson aquifer, a sensitive sole-source aquifer in south-central Oklahoma. Concerned citizens and municipalities living on and getting their drinking water from the Arbuckle-Simpson lobbied the legislature to pass a temporary moratorium on groundwater transfer to allow for a comprehensive study of the aquifer and its ecosystems. We conducted an instream flow assessment using Physical Habitat Simulation (PHABSIM) on springs and streams with four spring-dependent species: two minnows, southern redbelly dace (Phoxinus erthyrogaster) and redspot chub (Nocomis asper); and two darters, least darter (Etheostoma microperca) and orangethroat darter (Etheostoma spectabile). Spring habitats are unique compared to other river habitats because they have constant flow and temperature, small and isolated habitat patches, and a general lack of predators. Our study sites included two spring-fed streams, one larger stream with high groundwater inputs, and a river with both groundwater and surface water inputs that is adjacent to the small spring-fed streams. These habitats meet the criteria for groundwater dependent ecosystems because they would not exist without the surface expression of groundwater. A total of 99 transects in all four sites were surveyed for channel elevation, and three sets of water surface elevation and water velocity were measured. Habitat suitability criteria were derived for the species at each site using nonparametric confidence limits based on underwater observations made by snorkelers. Simulations of flow were focused on declines in discharge, which is the expected effect of the proposed groundwater diversion. Our results show that only a small proportion of the total available area in each habitat is considered to be preferred habitat

  4. Radioecological zoning of territories of carrying out of underground nuclear explosions in conditions of Yakutia

    International Nuclear Information System (INIS)

    Yakovleva, V.D.; Stepanov, V.E.

    2005-01-01

    raised divisible by two (from 16 μR/h); in a soil - vegetative are registered artificial radionuclides 3 listed above groups; are area activity for cesium - 137 makes from 16.3 kBq/m 2 (0.4 Ci/km 2 ) (16-fold excess of a level of global cesium - 137) and more, for americium - 241 - from 0.08 kBq/m 2 (2.1 mCi/km 2 ) (8-fold excess of a level of global americium-241) and more. 3. The buffer zone is defined to attributes: a) the vegetative cover is not damaged; the scale - background corresponds natural; the soil - vegetative cover contains cesium -137 and americium - 241, area which activity makes from 3.2 kBq/m 2 and 31.3 Bq/m 2 accordingly (3-fold increase in background levels), but in some daces is not observed precise excess above background in that case the raised (increased) maintenance(contents) of cesium - 137 in lichens (Cadalene stellaris, Cladina rangiferina from 170 Bq/kg, Aulacomnium from 120 Bq/kg) and bushes (Betula exilis from 4.5 Bk/kg) is found out. 4. Area the maintenance (contents) of cesium - 137 and americium - 241 in a soil - vegetative cover of a zone of global radioactive losses makes from 0.8 up to 1.9 kBq/m 2 and from 9.2 up to 11.2 Bk/m 2 accordingly. Concentration of cesium - 137 in lichens (Cladina stellaris, Cladina rangiferina, Aulacomnium varies within the limits of 90 Bq/kg), in bushes (Betula exilis within the limits of 2 Bq/kg)

  5. Persistent fatigue in young athletes: measuring the clinical course and identifying variables affecting clinical recovery.

    Science.gov (United States)

    Locke, S; Osborne, M; O'Rourke, P

    2011-02-01

    The objective of this paper is to measure the clinical course (months) in young athletes with persistent fatigue and to identify any covariates affecting the duration of recovery. This was a prospective longitudinal study of 68 athletes; 87% were elite (42 males, 26 females), aged 20.5±3.74 years (SD), who presented with the symptom of persistent fatigue. The collective duration to full clinical recovery was estimated using Kaplan-Meier product-limit curves, and covariates associated with prolonging recovery were identified from Cox proportional hazard models. The median recovery was 5 months (range 1-60 months). The range of presenting symptom duration was 0.5-36 months. The covariates identified were an increased duration of presenting symptoms [hazard ratio (HR), 1.06; 95% confidence interval (CI), 1.02-1.12; P=0.005] and the response of serum cortisol concentration to a standard exercise challenge (HR, 1.92; 95% CI, 1.09-3.38; P=0.03). Delay in recovery was not associated with categories of fatigue that included medical, training-related diagnoses, or other causes. In conclusion, the fatigued athlete represents a significant clinical problem with a median recovery of 5 months, whose collective clinical course to recovery can be estimated by Kaplan-Meier curves and appears to be a continuum. © 2009 John Wiley & Sons A/S.

  6. Glioblastoma: does the pre-treatment geometry matter? A postcontrast T1 MRI-based study

    International Nuclear Information System (INIS)

    Perez-Beteta, Julian; Martinez-Gonzalez, Alicia; Molina, David; Amo-Salas, Mariano; Luque, Belen; Perez-Garcia, Victor M.; Arregui, Elena; Calvo, Manuel; Borras, Jose M.; Lopez, Carlos; Claramonte, Marta; Barcia, Juan A.; Iglesias, Lidia; Avecillas, Josue; Albillo, David; Navarro, Miguel; Villanueva, Jose M.; Paniagua, Juan C.; Perez-Romasanta, Luis; Martino, Juan; Velasquez, Carlos; Asenjo, Beatriz; Benavides, Manuel; Herruzo, Ismael; Delgado, Maria del Carmen; Valle, Ana del; Falkov, Anthony; Schucht, Philippe; Arana, Estanislao

    2017-01-01

    The potential of a tumour's volumetric measures obtained from pretreatment MRI sequences of glioblastoma (GBM) patients as predictors of clinical outcome has been controversial. Mathematical models of GBM growth have suggested a relation between a tumour's geometry and its aggressiveness. A multicenter retrospective clinical study was designed to study volumetric and geometrical measures on pretreatment postcontrast T1 MRIs of 117 GBM patients. Clinical variables were collected, tumours segmented, and measures computed including: contrast enhancing (CE), necrotic, and total volumes; maximal tumour diameter; equivalent spherical CE width and several geometric measures of the CE ''rim''. The significance of the measures was studied using proportional hazards analysis and Kaplan-Meier curves. Kaplan-Meier and univariate Cox survival analysis showed that total volume [p = 0.034, Hazard ratio (HR) = 1.574], CE volume (p = 0.017, HR = 1.659), spherical rim width (p = 0.007, HR = 1.749), and geometric heterogeneity (p = 0.015, HR = 1.646) were significant parameters in terms of overall survival (OS). Multivariable Cox analysis for OS provided the later two parameters as age-adjusted predictors of OS (p = 0.043, HR = 1.536 and p = 0.032, HR = 1.570, respectively). Patients with tumours having small geometric heterogeneity and/or spherical rim widths had significantly better prognosis. These novel imaging biomarkers have a strong individual and combined prognostic value for GBM patients. (orig.)

  7. Censoring approach to the detection limits in X-ray fluorescence analysis

    International Nuclear Information System (INIS)

    Pajek, M.; Kubala-Kukus, A.

    2004-01-01

    We demonstrate that the effect of detection limits in the X-ray fluorescence analysis (XRF), which limits the determination of very low concentrations of trace elements and results in appearance of the so-called 'nondetects', can be accounted for using the statistical concept of censoring. More precisely, the results of such measurements can be viewed as the left random censored data, which can further be analyzed using the Kaplan-Meier method correcting the data for the presence of nondetects. Using this approach, the results of measured, detection limit censored concentrations can be interpreted in a nonparametric manner including the correction for the nondetects, i.e. the measurements in which the concentrations were found to be below the actual detection limits. Moreover, using the Monte Carlo simulation technique we show that by using the Kaplan-Meier approach the corrected mean concentrations for a population of the samples can be estimated within a few percent uncertainties with respect of the simulated, uncensored data. This practically means that the final uncertainties of estimated mean values are limited in fact by the number of studied samples and not by the correction procedure itself. The discussed random-left censoring approach was applied to analyze the XRF detection-limit-censored concentration measurements of trace elements in biomedical samples

  8. Glioblastoma: does the pre-treatment geometry matter? A postcontrast T1 MRI-based study

    Energy Technology Data Exchange (ETDEWEB)

    Perez-Beteta, Julian; Martinez-Gonzalez, Alicia; Molina, David; Amo-Salas, Mariano; Luque, Belen; Perez-Garcia, Victor M. [Universidad de Castilla-La Mancha, Laboratory of Mathematical Oncology, Edificio Politecnico, Instituto de Matematica Aplicada a la Ciencia y la Ingenieria, Ciudad Real (Spain); Arregui, Elena; Calvo, Manuel; Borras, Jose M.; Lopez, Carlos; Claramonte, Marta [Hospital General de Ciudad Real, Ciudad Real (Spain); Barcia, Juan A.; Iglesias, Lidia; Avecillas, Josue [Hospital Clinico San Carlos, Madrid (Spain); Albillo, David; Navarro, Miguel; Villanueva, Jose M.; Paniagua, Juan C.; Perez-Romasanta, Luis [Hospital Universitario de Salamanca, Salamanca (Spain); Martino, Juan; Velasquez, Carlos [Hospital Marques de Valdecilla, Santander (Spain); Asenjo, Beatriz; Benavides, Manuel; Herruzo, Ismael [Hospital Carlos Haya, Malaga (Spain); Delgado, Maria del Carmen; Valle, Ana del [Universidad de Sevilla, Facultad de Matematicas, Sevilla (Spain); Falkov, Anthony [Auckland Radiation Oncology, Auckland (New Zealand); Schucht, Philippe [Bern Inselspital, Neurosurgery Department, Bern (Switzerland); Arana, Estanislao [Instituto Valenciano de Oncologia, Valencia (Spain)

    2017-03-15

    The potential of a tumour's volumetric measures obtained from pretreatment MRI sequences of glioblastoma (GBM) patients as predictors of clinical outcome has been controversial. Mathematical models of GBM growth have suggested a relation between a tumour's geometry and its aggressiveness. A multicenter retrospective clinical study was designed to study volumetric and geometrical measures on pretreatment postcontrast T1 MRIs of 117 GBM patients. Clinical variables were collected, tumours segmented, and measures computed including: contrast enhancing (CE), necrotic, and total volumes; maximal tumour diameter; equivalent spherical CE width and several geometric measures of the CE ''rim''. The significance of the measures was studied using proportional hazards analysis and Kaplan-Meier curves. Kaplan-Meier and univariate Cox survival analysis showed that total volume [p = 0.034, Hazard ratio (HR) = 1.574], CE volume (p = 0.017, HR = 1.659), spherical rim width (p = 0.007, HR = 1.749), and geometric heterogeneity (p = 0.015, HR = 1.646) were significant parameters in terms of overall survival (OS). Multivariable Cox analysis for OS provided the later two parameters as age-adjusted predictors of OS (p = 0.043, HR = 1.536 and p = 0.032, HR = 1.570, respectively). Patients with tumours having small geometric heterogeneity and/or spherical rim widths had significantly better prognosis. These novel imaging biomarkers have a strong individual and combined prognostic value for GBM patients. (orig.)

  9. Treatment of Benign and Malignant Tracheobronchial Obstruction with Metal Wire Stents: Experience with a Balloon-Expandable and a Self-Expandable Stent Type

    International Nuclear Information System (INIS)

    Rieger, Johannes; Hautmann, Hubert; Linsenmaier, Ulrich; Weber, Cristoph; Treitl, Markus; Huber, R.M.; Pfeifer, Klaus-Juergen

    2004-01-01

    Over the last few years various types of metal wire stents have been increasingly employed in the treatment of both malignant and benign tracheobronchial obstruction. To date, however, few studies have investigated the in vivo properties of different stent types. We implanted 26 balloon-expandable tantalum Strecker stents (18 patients) and 18 self-expandable Wallstents (16 patients) into the tracheobronchial system of 30 patients with combined stenting in 4 patients. Mean age was 51 years (range: 0.5-79 years). Malignant disease was present in 23 patients, benign disease in seven patients. Both patients and individual stents were monitored clinically and radiographically. The probability of stents remaining within the tracheobronchial system, and of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for both stent types. Average stent follow-up time was 112 days until explantation and 115 days until patients' death or discharge. Kaplan-Meier analysis revealed a higher probability for the Wallstent to remain within the tracheobronchial system. Dislocation and compression occurred more rarely. Explantation, however, if desired, was more difficult compared to the Strecker stent. The Wallstent also led to the formation of granulation tissue, especially at the proximal stent end, frequently requiring reintervention. Both stent types proved to be effective therapeutic options in the management of obstructive tracheobronchial disease. The mechanical properties of the Strecker stent seem to be less favorable compared to the Wallstent but removal is easy. For benign disease, however, the Wallstent reveals limitations due to significant side effects

  10. An improved method for calculation of interface pressure force in PLIC-VOF methods

    International Nuclear Information System (INIS)

    Sefollahi, M.; Shirani, E.

    2004-08-01

    Conventional methods for the modeling of surface tension force in Piecewise Linear Interface Calculation-Volume of Fluid (PLIC-VOF) methods, such as Continuum Surface Force (CSF), Continuum Surface Stress (CSS) and also Meier's method, convert the surface tension force into a body force. Not only do they include the force in the interfacial cells but also in the neighboring cells. Thus they produce spurious currents. Also the pressure jump, due to the surface tension, is not calculated accurately in these methods. In this paper a more accurate method for the application of interface force in the computational modeling of free surfaces and interfaces which use PLIC-VOF methods is developed. This method is based on the evaluation of the surface tension force only in the interfacial cells and not the neighboring cells. Also the normal and the interface surface area needed for the calculation of the surface tension force is calculated more accurately. The present method is applied to a two-dimensional motionless drop of liquid and a bubble of gas as well as a non-circular two-dimensional drop, which oscillates due to the surface tension force, in an initially stagnant fluid with no gravity force. The results are compared with the results of the cases when CSF, CSS and Meier's methods are used. It is shown that the present method calculates pressure jump at the interface more accurately and produces less spurious currents comparing to CSS an CSF models. (author)

  11. The Prognostic Impact of NK/NKT Cell Density in Periampullary Adenocarcinoma Differs by Morphological Type and Adjuvant Treatment.

    Science.gov (United States)

    Lundgren, Sebastian; Warfvinge, Carl Fredrik; Elebro, Jacob; Heby, Margareta; Nodin, Björn; Krzyzanowska, Agnieszka; Bjartell, Anders; Leandersson, Karin; Eberhard, Jakob; Jirström, Karin

    2016-01-01

    Natural killer (NK) cells and NK T cells (NKT) are vital parts of tumour immunosurveillance. However, their impact on prognosis and chemotherapy response in periampullary adenocarcinoma, including pancreatic cancer, has not yet been described. Immune cell-specific expression of CD56, CD3, CD68 and CD1a was analysed by immunohistochemistry on tissue microarrays with tumours from 175 consecutive cases of periampullary adenocarcinoma, 110 of pancreatobiliary type (PB-type) and 65 of intestinal type (I-type) morphology. Kaplan-Meier and Cox regression analysis were applied to determine the impact of CD56+ NK/NKT cells on 5-year overall survival (OS). High density of CD56+ NK/NKT cells correlated with low N-stage and lack of perineural, lymphatic vessel and peripancreatic fat invasion. High density of CD56+ NK/NKT cells was associated with prolonged OS in Kaplan-Meier analysis (p = 0.003), and in adjusted Cox regression analysis (HR = 0.49; 95% CI 0.29-0.86). The prognostic effect of high CD56+ NK/NKT cell infiltration was only evident in cases not receiving adjuvant chemotherapy in PB-type tumours (p for interaction = 0.014). This study demonstrates that abundant infiltration of CD56+ NK/NKT cells is associated with a prolonged survival in periampullary adenocarcinoma. However, the negative interaction with adjuvant treatment is noteworthy. NK cell enhancing strategies may prove to be successful in the management of these cancers.

  12. Factors Affecting the Recurrence of Giant Cell Tumor of Bone After Surgery: A Clinicopathological Study of 80 Cases from a Single Center

    Directory of Open Access Journals (Sweden)

    Dong-dong Cheng

    2015-07-01

    Full Text Available Background/Aims: This aim of the present study was to identify specific markers determining the recurrence of the giant cell tumor of bone (GCTB. Methods: This study involved the clinicopathological analysis of 80 cases. All of the clinical features, pathological fracture, Campanacci grade, histological features and surgical methods were reviewed. Immunohistochemistry was used to detect the expression of Ki-67, CD147, mutant p53 and p63 in GCTB. Comparisons between different groups were performed using the Chi-square test. The risk factors affecting recurrence were analyzed using a binary logistic model. Kaplan-Meier analysis was employed for the survival analysis between the groups. Cell proliferation assays, migration and invasion assays were used to detect the function of CD147 on GCTB in vitro. Results: The univariate analysis showed that Ki-67 and CD147 expression, pathological fracture, Campanacci grade and surgical method were associated with recurrence. The multivariate analysis revealed that CD147 expression, Campanacci grade and surgical method were the factors affecting GCTB recurrence. In addition, the Kaplan-Meier analysis revealed that these factors affected tumor-free survival time. In vitro study revealed that the CD147 knockdown by small interfering RNA (siRNA technique dramatically reduced the proliferation, migration and invasion of GCTB. Conclusion: Our results suggest that CD147 may serve as an adequate marker for GCTB recurrence. Campanacci grade is a risk factor for GCTB recurrence, which is also affected by the surgical method used.

  13. Prognostic value of MLH1 promoter methylation in male patients with esophageal squamous cell carcinoma.

    Science.gov (United States)

    Wu, Dongping; Chen, Xiaoying; Xu, Yan; Wang, Haiyong; Yu, Guangmao; Jiang, Luping; Hong, Qingxiao; Duan, Shiwei

    2017-04-01

    The DNA mismatch repair (MMR) gene MutL homolog 1 ( MLH1 ) is critical for the maintenance of genomic integrity. Methylation of the MLH1 gene promoter was identified as a prognostic marker for numerous types of cancer including glioblastoma, colorectal, ovarian and gastric cancer. The present study aimed to determine whether MLH1 promoter methylation was associated with survival in male patients with esophageal squamous cell carcinoma (ESCC). Formalin-fixed, paraffin-embedded ESCC tissues were collected from 87 male patients. MLH1 promoter methylation was assessed using the methylation-specific polymerase chain reaction approach. Kaplan-Meier survival curves and log-rank tests were used to evaluate the association between MLH1 promoter methylation and overall survival (OS) in patients with ESCC. Cox regression analysis was used to obtain crude and multivariate hazard ratios (HR), and 95% confidence intervals (CI). The present study revealed that MLH1 promoter methylation was observed in 53/87 (60.9%) of male patients with ESCC. Kaplan-Meier survival analysis demonstrated that MLH1 promoter hypermethylation was significantly associated with poorer prognosis in patients with ESCC (P=0.048). Multivariate survival analysis revealed that MLH1 promoter hypermethylation was an independent predictor of poor OS in male patients with ESCC (HR=1.716; 95% CI=1.008-2.921). Therefore, MLH1 promoter hypermethylation may be a predictor of prognosis in male patients with ESCC.

  14. Prognostic significance of hemoglobin level in patients with congestive heart failure and normal ejection fraction.

    Science.gov (United States)

    Varadarajan, Padmini; Gandhi, Siddharth; Sharma, Sanjay; Umakanthan, Branavan; Pai, Ramdas G

    2006-10-01

    Previous studies have shown low hemoglobin (Hb) to have an adverse effect on survival in patients with congestive heart failure (CHF) and reduced left ventricular (LV) ejection fraction (EF); but its effect on survival in patients with CHF and normal EF is not known. This study sought to determine whether low Hb has an effect on survival in patients with both CHF and normal EF. Detailed chart reviews were performed by medical residents on 2,246 patients (48% with normal EF) with a discharge diagnosis of CHF in a large tertiary care hospital from 1990 to 1999. The CHF diagnosis was validated using the Framingham criteria. Mortality data were obtained from the National Death Index. Survival analysis was performed using Kaplan-Meier and Cox regression models. By Kaplan-Meier analysis, low Hb (< 12 gm/dl) compared with normal hemoglobin was associated with a lower 5-year survival in patients with CHF and both normal (38 vs. 50%, p = 0.0008) and reduced (35 vs. 48%, p = 0.0009) EF. Using the Cox regression model, low Hb was an independent predictor of mortality after adjusting for age, gender, renal dysfunction, diabetes mellitus, hypertension, and EF in both groups of patients. Low Hb has an independent adverse effect on survival in patients with CHF and both normal and reduced EF in both groups of patients.

  15. High-dose-rate brachytherapy with two or three fractions as monotherapy in the treatment of locally advanced prostate cancer

    International Nuclear Information System (INIS)

    Hoskin, Peter; Rojas, Ana; Ostler, Peter; Hughes, Robert; Alonzi, Roberto; Lowe, Gerry; Bryant, Linda

    2014-01-01

    Background: To evaluate late urinary (GU) and gastrointestinal (GI) adverse events (AEs) and biochemical control of disease after high-dose rate brachytherapy (HDR-BT) in locally advanced prostate cancer. Patients and methods: 227 consecutive patients were treated with 3 × 10.5 Gy (n = 109) or 2 × 13 Gy (n = 118) HDR-BT alone. Biochemical failure was assessed using the Phoenix definition of PSA nadir + 2 μg/l and late AEs using the RTOG scoring system and the International Prostate Symptom Score (IPSS). Results: Kaplan–Meier estimates and prevalence of late events indicate that urinary, bowel and IPSS symptoms are higher after 31.5 Gy than after 26 Gy, however differences are significant only for Grade 1 and 2 urinary toxicity. Kaplan–Meier estimates of morbidity are consistently and considerably higher than time-point estimates of prevalence; which reflects the transient nature of most symptoms. At 3 years 93% and 97% of patients treated with 26 and 31.5 Gy, respectively, were free from biochemical relapse (p = 0.5) and 91% for the latter regimen at 5 years. In univariate and multivariate analysis risk-category was the only significant predictor of relapse (p < 0.03). Conclusion: These HDR-BT schedules achieved high levels of biochemical control of disease in patients with advanced prostate cancer with few severe complications seen throughout the first 3 years

  16. Radiologic Placement of Tunneled Central Venous Catheters in Pediatric Patients

    International Nuclear Information System (INIS)

    Kim, Eun Ji; Song, Soon Young; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Jeong, Woo Kyoung; Lee, Yong Ho

    2010-01-01

    We evaluated the technical success and complication rates associated with the radiological placement of tunneled central venous catheters in pediatric patients. Between May 1, 2005 and March 31, 2008, a total of 46 tunneled central venous catheters were placed in 34 children (M:F = 22:12; mean age, 9.9 years [9 months to 16.8 years]). All procedures were performed under ultrasonographic and fluoroscopic guidance. Follow-up data were obtained through the retrospective review of the medical records. We used the Kaplan-Meier survival method for the evaluation of survival rate of the catheters. All procedures were technically successful. The observed periprocedural complications included hematoma formation in three patients. The mean catheter life was 189.3 days (total, 8710 days; range, 7-810). Catheters were removed due to death (n=9), the end of treatment (n=8), catheter sepsis (n=4), malfunction (n=8), and accidental removal (n=4). The rate of catheter sepsis and malfunction was 0.459 and 0.919 for every 1000 catheter days, respectively. The expected mean catheter life was 479.6 days as per the Kaplan- Meier analysis. The results suggest that the radiologic placement of a tunneled central venous catheter is an effective technique with a high technical success rate and low complication rate

  17. Comparison of colorectal and gastric cancer: Survival and prognostic factors

    International Nuclear Information System (INIS)

    Moghimi-Dehkordi, Bijan; Safaee, Azadeh; Zali, Mohammad R

    2009-01-01

    Gastric and colorectal cancers are the most common gastrointestinal malignancies in Iran. We aim to compare the survival rates and prognostic factors between these two cancers. We studied 1873 patients with either gastric or colorectal cancer who were registered in one referral cancer registry center in Tehran, Iran. All patients were followed from their time of diagnosis until December 2006 (as failure time). Survival curves were calculated according to the Kaplan-Meier Method and compared by the Log-rank test. Multivariate analysis of prognostic factors was carried out using the Cox proportional hazard model. Of 1873 patients, there were 746 with gastric cancer and 1138 with colorectal cancer. According to the Kaplan-Meier method 1, 3, 5, and 7-year survival rates were 71.2, 37.8, 25.3, and 19.5%, respectively, in gastric cancer patients and 91.1, 73.1, 61, and 54.9%, respectively, in patients with colorectal cancer. Also, univariate analysis showed that age at diagnosis, sex, grade of tumor, and distant metastasis were of prognostic significance in both cancers ( P < 0.0001). However, in multivariate analysis, only distant metastasis in colorectal cancer and age at diagnosis, grade of tumor, and distant metastasis in colorectal cancer were identified as independent prognostic factors influencing survival. According to our findings, survival is significantly related to histological differentiation of tumor and distant metastasis in colorectal cancer patients and only to distant metastasis in gastric cancer patients. (author)

  18. Evaluating the reliability of multi-body mechanisms: A method considering the uncertainties of dynamic performance

    International Nuclear Information System (INIS)

    Wu, Jianing; Yan, Shaoze; Zuo, Ming J.

    2016-01-01

    Mechanism reliability is defined as the ability of a certain mechanism to maintain output accuracy under specified conditions. Mechanism reliability is generally assessed by the classical direct probability method (DPM) derived from the first order second moment (FOSM) method. The DPM relies strongly on the analytical form of the dynamic solution so it is not applicable to multi-body mechanisms that have only numerical solutions. In this paper, an indirect probability model (IPM) is proposed for mechanism reliability evaluation of multi-body mechanisms. IPM combines the dynamic equation, degradation function and Kaplan–Meier estimator to evaluate mechanism reliability comprehensively. Furthermore, to reduce the amount of computation in practical applications, the IPM is simplified into the indirect probability step model (IPSM). A case study of a crank–slider mechanism with clearance is investigated. Results show that relative errors between the theoretical and experimental results of mechanism reliability are less than 5%, demonstrating the effectiveness of the proposed method. - Highlights: • An indirect probability model (IPM) is proposed for mechanism reliability evaluation. • The dynamic equation, degradation function and Kaplan–Meier estimator are used. • Then the simplified form of indirect probability model is proposed. • The experimental results agree well with the predicted results.

  19. High serum uric acid concentration predicts poor survival in patients with breast cancer.

    Science.gov (United States)

    Yue, Cai-Feng; Feng, Pin-Ning; Yao, Zhen-Rong; Yu, Xue-Gao; Lin, Wen-Bin; Qian, Yuan-Min; Guo, Yun-Miao; Li, Lai-Sheng; Liu, Min

    2017-10-01

    Uric acid is a product of purine metabolism. Recently, uric acid has gained much attraction in cancer. In this study, we aim to investigate the clinicopathological and prognostic significance of serum uric acid concentration in breast cancer patients. A total of 443 female patients with histopathologically diagnosed breast cancer were included. After a mean follow-up time of 56months, survival was analysed using the Kaplan-Meier method. To further evaluate the prognostic significance of uric acid concentrations, univariate and multivariate Cox regression analyses were applied. Of the clinicopathological parameters, uric acid concentration was associated with age, body mass index, ER status and PR status. Univariate analysis identified that patients with increased uric acid concentration had a significantly inferior overall survival (HR 2.13, 95% CI 1.15-3.94, p=0.016). In multivariate analysis, we found that high uric acid concentration is an independent prognostic factor predicting death, but insufficient to predict local relapse or distant metastasis. Kaplan-Meier analysis indicated that high uric acid concentration is related to the poor overall survival (p=0.013). High uric acid concentration predicts poor survival in patients with breast cancer, and might serve as a potential marker for appropriate management of breast cancer patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Phosphorus-32 therapy for cystic craniopharyngiomas

    International Nuclear Information System (INIS)

    Barriger, Robert Bryan; Chang, Andrew; Lo, Simon S.; Timmerman, Robert D.; DesRosiers, Colleen; Boaz, Joel C.; Fakiris, Achilles J.

    2011-01-01

    Background and purpose: To examine control rates for predominantly cystic craniopharyngiomas treated with intracavitary phosphorus-32 (P-32). Material and methods: 22 patients with predominantly cystic craniopharyngiomas were treated at Indiana University between October 1997 and December 2006. Nineteen patients with follow-up of at least 6 months were evaluated. The median patient age was 11 years, median cyst volume was 9 ml, a median dose of 300 Gy was prescribed to the cyst wall, and median follow-up was 62 months. Results: Overall cyst control rate after the initial P-32 treatment was 67%. Complete tumor control after P-32 was 42%. Kaplan-Meier 1-, 3-, and 5-year initial freedom-from-progression rates were 68%, 49%, and 31%, respectively. Following salvage therapy, the Kaplan-Meier 1-, 3-, and 5-year ultimate freedom-from-progression rates were 95%, 95%, and 86%, respectively. All patients were alive at the last follow-up. Visual function was stable or improved in 81% when compared prior to P-32 therapy. Pituitary function remained stable in 74% of patients following P-32 therapy. Conclusions: Intracystic P-32 can be an effective and tolerable treatment for controlling cystic components of craniopharyngiomas as a primary treatment or after prior therapies, but frequently allows for progression of solid tumor components. Disease progression in the form of solid tumor progression, re-accumulation of cystic fluid, or development of new cysts may require further radiotherapy or surgical intervention for optimal long-term disease control.

  1. Correlations of Hemoglobin Level and Perioperative Blood Transfusion with the Prognosis of Gastric Cancer: A Retrospective Study.

    Science.gov (United States)

    Wu, Gang; Zhang, Dai-Yang; Duan, Yu-Han; Zhang, Ying-Qiong; Cui, Xian-Nian; Luo, Zheng

    2017-05-23

    BACKGROUND This study was designed to explore the correlations of hemoglobin level (Hb) and perioperative blood transfusion with the prognosis of gastric cancer (GC). MATERIAL AND METHODS Our study consisted of 210 patients with GC who all received a D2 radical operation. These patients were assigned into three groups: 68 cases in group A (blood transfusion >5 U); 59 cases in group B (blood transfusion blood transfusion). A 5-year follow-up was conducted to evaluate the disease-free survival of the patients. Univariate analysis was performed to reveal the relationship between the indicators and the patients with GC. Kaplan-Meier method was employed to analyze the survival rate of patients, and Cox regression analysis was applied to determine the independent prognostic factors of GC. RESULTS The univariate analysis indicated that age, perioperative blood transfusion amount, TNM staging, maximal tumor diameter, differentiation degree and invasion degree were associated with the prognosis of GC. The Kaplan-Meier curve showed that the disease-free survival rate was declined in the patients who were older, those received more amount of blood transfusion, those in advanced TNM staging, those had larger tumor diameter, and those with decreased degree of differentiation and invasion. Cox regression analysis indicated that perioperative blood transfusion, maximal tumor diameter and invasion degree were the independent factors affecting disease-free survival of the GC. CONCLUSIONS Our study revealed that large amount of perioperative blood transfusion leads to poor prognosis of GC.

  2. Interdisciplinary interventional therapy for tracheobronchial stenosis with modern metal net stents

    International Nuclear Information System (INIS)

    Rieger, J.; Linsenmaier, U.; Fedorowski, A.; Pfeifer, K.J.; Hautmann, H.; Huber, R.M.

    2002-01-01

    Study objectives: Assessment of the therapeutic potential of tracheobronchial stenting for obstructive tracheobronchial disease, in-vivo comparison of different stent types and development of helpful criteria for choosing the suitable stent type. Material and Methods: Prospective case analysis. Between 1993 and 1999 53 stents were implanted into the tracheobronchial system of 39 consecutive patients with benign or malignant airway obstruction. Every single stent (26 Strecker Stents, 18 Wallstents, 6 Accuflex Nitinolstents, 1 Dumon-, 1 Ruesch- and 1 Palmazstent) was recorded in an unified database. Analysis comprised clinical effectiveness, lung function if possible, relevant complications and radiologic follow-up parameters. The probability of their remaining within the tracheobronchial system, of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for three stent types. Results: Stent placement proved itself to be an effective treatment in 86% of the patients. Resistance could be normalized in 9/9 patients. Kaplan-Meier analysis clearly revealed a higher probability for the Wall- and Nitinolstent to remain within the tracheobronchial system and to remain uncompressed. Dislocation also occurred more rarely. Explanation of the Wallstent, however, if desired, was much more difficult compared to the Strecker stent. The Wallstent also occasionally led to the formation of granulation tissue especially at the proximal stent end and, as such, required reintervention. (orig.) [de

  3. The preoperative plasma fibrinogen level is an independent prognostic factor for overall survival of breast cancer patients who underwent surgical treatment.

    Science.gov (United States)

    Wen, Jiahuai; Yang, Yanning; Ye, Feng; Huang, Xiaojia; Li, Shuaijie; Wang, Qiong; Xie, Xiaoming

    2015-12-01

    Previous studies have suggested that plasma fibrinogen contributes to tumor cell proliferation, progression and metastasis. The current study was performed to evaluate the prognostic relevance of preoperative plasma fibrinogen in breast cancer patients. Data of 2073 consecutive breast cancer patients, who underwent surgery between January 2002 and December 2008 at the Sun Yat-sen University Cancer Center, were retrospectively evaluated. Plasma fibrinogen levels were routinely measured before surgeries. Participants were grouped by the cutoff value estimated by the receiver operating characteristic (ROC) curve analysis. Overall survival (OS) was assessed using Kaplan-Meier analysis, and multivariate Cox proportional hazards regression model was performed to evaluate the independent prognostic value of plasma fibrinogen level. The optimal cutoff value of preoperative plasma fibrinogen was determined to be 2.83 g/L. The Kaplan-Meier analysis showed that patients with high fibrinogen levels had shorter OS than patients with low fibrinogen levels (p factor for OS in breast cancer patients (HR = 1.475, 95% confidence interval (CI): 1.177-1.848, p = 0.001). Subgroup analyses revealed that plasma fibrinogen level was an unfavorable prognostic parameter in stage II-III, Luminal subtypes and triple-negative breast cancer patients. Elevated preoperative plasma fibrinogen was independently associated with poor prognosis in breast cancer patients and may serve as a valuable parameter for risk assessment in breast cancer patients. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  4. Safety and efficacy of a xenogeneic DNA vaccine encoding for human tyrosinase as adjunctive treatment for oral malignant melanoma in dogs following surgical excision of the primary tumor.

    Science.gov (United States)

    Grosenbaugh, Deborah A; Leard, A Timothy; Bergman, Philip J; Klein, Mary K; Meleo, Karri; Susaneck, Steven; Hess, Paul R; Jankowski, Monika K; Jones, Pamela D; Leibman, Nicole F; Johnson, Maribeth H; Kurzman, Ilene D; Wolchok, Jedd D

    2011-12-01

    To evaluate the safety and efficacy of a vaccine containing plasmid DNA with an insert encoding human tyrosinase (ie, huTyr vaccine) as adjunctive treatment for oral malignant melanoma (MM) in dogs. 111 dogs (58 prospectively enrolled in a multicenter clinical trial and 53 historical controls) with stage II or III oral MM (modified World Health Organization staging scale, I to IV) in which locoregional disease control was achieved. 58 dogs received an initial series of 4 injections of huTyr vaccine (102 μg of DNA/injection) administered transdermally by use of a needle-free IM vaccination device. Dogs were monitored for adverse reactions. Surviving dogs received booster injections at 6-month intervals thereafter. Survival time for vaccinates was compared with that of historical control dogs via Kaplan-Meier survival analysis for the outcome of death. Kaplan-Meier analysis of survival time until death attributable to MM was determined to be significantly improved for dogs that received the huTyr vaccine, compared with that of historical controls. However, median survival time could not be determined for vaccinates because dogs as adjunctive treatment for oral MM. Response to DNA vaccination in dogs with oral MM may be useful in development of plasmid DNA vaccination protocols for human patients with similar disease.

  5. Increased Transfusion of Fresh Frozen Plasma is Associated with Mortality or Worse Functional Outcomes After Severe Traumatic Brain Injury: A Retrospective Study.

    Science.gov (United States)

    Zhang, Li-Min; Li, Rui; Zhao, Xiao-Chun; Zhang, Qian; Luo, Xing-Liao

    2017-08-01

    The fresh frozen plasma (FFP) transfusion threshold and timing for traumatic brain injury (TBI)-associated coagulopathy are controversial. Thus, a multicenter retrospective study was conducted to determine whether or not FFP transfusion is associated with poor outcomes after severe TBI. Data from decompressive craniotomy after blunt force trauma that took place between December 2013 and June 2016 were collected in a multicenter chart. The primary outcomes were mortality and survival, as well as worse outcomes (defined as a Glasgow Outcome Scale [GOS] score ≤3) and better outcomes (GOS score ≥4). Secondary outcomes included 90-day survival rates in all patients with or without FFP transfusion, as well as length of hospital stay in patients with a better prognosis (GOS score ≥4). Univariate analysis, bivariate logistic regression, Spearman rank correlation, and Kaplan-Meier analysis were performed to account for the association between perioperative FFP transfusion and different outcomes. Bivariate logistic analysis showed that mortality and worse outcomes were correlated with FFP transfusion and Glasgow Coma Scale score (P < 0.05). Kaplan-Meier analysis suggested that mortality was statistically higher in the FFP transfusion groups compared with the no FFP transfusion groups, regardless of the severity of TBI (P < 0.05). The overall complications, acute respiratory distress syndrome, and pneumonia rate were significantly higher for patients receiving FFP transfusion (P < 0.05). Increased perioperative FFP infusion was independently associated with mortality or worse outcomes across a spectrum of surgical risk profiles. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Adjacent segment pathology following anterior decompression and fusion using cage and plate for the treatment of degenerative cervical spinal diseases.

    Science.gov (United States)

    Song, Kyung-Jin; Choi, Byung-Wan; Kim, Jong-Kil

    2014-12-01

    Retrospective study. To analyze the incidence and prevalence of clinical adjacent segment pathology (CASP) following anterior decompression and fusion with cage and plate augmentation for degenerative cervical diseases. No long-term data on the use of cage and plate augmentation have been reported. The study population consisted of 231 patients who underwent anterior cervical discectomy and fusion (ACDF) with cage and plate for degenerative cervical spinal disease. The incidence and prevalence of CASP was determined by using the Kaplan-Meier survival analysis. To analyze the factors that influence CASP, data on preoperative and postoperative sagittal alignment, spinal canal diameter, the distance between the plate and adjacent disc, extent of fusion level, and the presence or absence of adjacent segment degenerative changes by imaging studies were evaluated. CASP occurred in 15 of the cases, of which 9 required additional surgery. At 8-year follow-up, the average yearly incidence was 1.1%. The rate of disease-free survival based on Kaplan-Meier survival analysis was 93.6% at 5 years and 90.2% at 8 years. No statistically significant differences in CASP incidence based on radiological analysis were observed. Significantly high incidence of CASP was observed in the presence of increased adjacent segment degenerative changes (pdegenerative cervical disease is associated with a lower incidence in CSAP by 1.1% per year, and the extent of preoperative adjacent segment degenerative changes has been shown as a risk factor for CASP.

  7. An electronic health record-enabled obesity database

    Directory of Open Access Journals (Sweden)

    Wood G

    2012-05-01

    Full Text Available Abstract Background The effectiveness of weight loss therapies is commonly measured using body mass index and other obesity-related variables. Although these data are often stored in electronic health records (EHRs and potentially very accessible, few studies on obesity and weight loss have used data derived from EHRs. We developed processes for obtaining data from the EHR in order to construct a database on patients undergoing Roux-en-Y gastric bypass (RYGB surgery. Methods Clinical data obtained as part of standard of care in a bariatric surgery program at an integrated health delivery system were extracted from the EHR and deposited into a data warehouse. Data files were extracted, cleaned, and stored in research datasets. To illustrate the utility of the data, Kaplan-Meier analysis was used to estimate length of post-operative follow-up. Results Demographic, laboratory, medication, co-morbidity, and survey data were obtained from 2028 patients who had undergone RYGB at the same institution since 2004. Pre-and post-operative diagnostic and prescribing information were available on all patients, while survey laboratory data were available on a majority of patients. The number of patients with post-operative laboratory test results varied by test. Based on Kaplan-Meier estimates, over 74% of patients had post-operative weight data available at 4 years. Conclusion A variety of EHR-derived data related to obesity can be efficiently obtained and used to study important outcomes following RYGB.

  8. Maternal smoking during pregnancy and the risk of pediatric cardiovascular diseases of the offspring: A population-based cohort study with up to 18-years of follow up.

    Science.gov (United States)

    Leybovitz-Haleluya, Noa; Wainstock, Tamar; Landau, Daniella; Sheiner, Eyal

    2018-06-01

    Cigarette smoke is a well-known reproductive toxicant. We aimed to study the long-term effect of cigarette smoking during pregnancy on the risk for childhood cardiovascular morbidity of the offspring. A population-based cohort analysis was performed comparing total and subtypes of cardiovascular related pediatric hospitalizations among offspring of smoking mothers versus offspring of non-smoking mothers. The analysis included all singletons born between the years 1999-2014.A Kaplan-Meier survival curve was used to compare the cumulative cardiovascular morbidity, and a Cox proportional hazards model was constructed to adjust for confounders. The study population included 242,342 newborns which met inclusion criteria; among them 2861 were born to smoking mothers. Offspring of smoking mothers had higher rates of cardiovascular-related hospitalizations (1.3% vs. 0.6%, OR 2.1, 95% CI 1.5-2.9; p < 0.001; Kaplan-Meier log-rank test p < 0.001). Smoking exposure during pregnancy is associated with an increased risk for long-term pediatric cardiovascular morbidity of the offspring. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. Stent placement with the monorail technique for treatment of mesenteric artery stenosis.

    Science.gov (United States)

    Schaefer, Philipp J; Schaefer, Fritz K W; Hinrichsen, Holger; Jahnke, Thomas; Charalambous, Nikolas; Heller, Martin; Mueller-Huelsbeck, Stefan

    2006-04-01

    To analyze the immediate and midterm success of stenting of mesenteric arteries by a monorail technique in patients with chronic mesenteric ischemia. In this prospective case series, 19 patients (11 male, 8 female; mean age, 62.9 +/- 10.4 y; range, 36-82 y) with 23 symptomatic stenoses of mesenteric arteries were treated with stent placement by a monorail technique in a radiologic intervention center over a period of 4.5 years. Clinical examinations and duplex sonography were used to evaluate the stents' patency and clinical success. Kaplan-Meier graphs were calculated to analyze the patency and freedom-from-symptom rate. Initial technical success rate was 22/23 (96%). Mean follow-up was 17 months (range, 1-58 mo). Primary patency and primary clinical success rates were 82% and 78%, respectively. According to Kaplan-Meier tables, the patency rates were 96%, 87%, 76%, and 61% at 0, 1, 15, and 24 months, respectively, and the freedom-from-symptom rates were 95%, 90%, 72%, and 54% at 0, 1, 24, and 30 months, respectively. No peri-interventional complications occurred. Two patients died of cardiac failure in the hospital within 30 days after intervention; deaths were not related to the intervention. Stent placement by a monorail technique in mesenteric arteries is an effective and safe treatment for symptomatic stenoses in patients with chronic mesenteric ischemia after a mean follow-up of 17 months.

  10. Decreased graft survival in liver transplant recipients of donors with positive blood cultures: a review of the United Network for Organ Sharing dataset.

    Science.gov (United States)

    Huaman, Moises A; Vilchez, Valery; Mei, Xiaonan; Shah, Malay B; Daily, Michael F; Berger, Jonathan; Gedaly, Roberto

    2017-06-01

    Liver transplantation using blood culture positive donors (BCPD) has allowed a significant expansion of the donor pool. We aimed to characterize BCPD and assess the outcomes of BCPD liver transplant recipients. We retrieved data from the United Network for Organ Sharing (UNOS) registry on all adults who underwent primary, single-organ deceased-donor liver transplantation in the USA between 2008 and 2013. Patients were classified into two cohorts: the BCPD cohort and the non-BCPD cohort. One-year graft and patient survival were compared between cohorts using Kaplan-Meier estimates and Cox models. A total of 28 961 patients were included. There were 2316 (8.0%) recipients of BCPD. BCPD were more likely to be older, female, black, diabetic, hypertensive, and obese compared to non-BCPD. Graft survival was significantly lower in BCPD recipients compared to non-BCPD recipients (Kaplan-Meier, 0.85 vs. 0.87; P = 0.009). Results remained significant in propensity-matched analysis (P = 0.038). BCPD was independently associated with decreased graft survival (adjusted HR; 1.10, 95% CI 1.01-1.20; P = 0.04). There were no significant differences in patient survival between study groups. BCPD was associated with decreased graft survival in liver transplant recipients. Studies are needed to identify subgroups of BCPD with the highest risk of graft failure and characterize the underlying pathogenic mechanisms. © 2016 Steunstichting ESOT.

  11. Duration of Psoriatic Skin Disease as Risk Factor for Subsequent Onset of Psoriatic Arthritis

    DEFF Research Database (Denmark)

    Egeberg, Alexander; Skov, Lone; Zachariae, Claus

    2018-01-01

    It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA). Survival analysis and Kaplan-Meier life table techniques were used. The study comprised 10,011 psoria......It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA). Survival analysis and Kaplan-Meier life table techniques were used. The study comprised 10......,011 psoriasis patients (severe n = 4,618), and 1,269 patients also had PsA. Incidence of PsA increased with duration of cutaneous symptoms (p = 0.0001). Psoriasis diagnosed before age 20 or 30 years, respectively, suggested a lower risk of PsA than psoriasis diagnosed after age 50 years, yet age at first...... cutaneous symptoms did not predict development of PsA. No clear association with disease severity was found. PsA incidence appeared stable with longer duration of psoriasis, but further data are needed to firmly establish the relationship with age of psoriasis onset....

  12. Metastatic volume: an old oncologic concept and a new prognostic factor for stage IV melanoma patients.

    Science.gov (United States)

    Panasiti, V; Curzio, M; Roberti, V; Lieto, P; Devirgiliis, V; Gobbi, S; Naspi, A; Coppola, R; Lopez, T; di Meo, N; Gatti, A; Trevisan, G; Londei, P; Calvieri, S

    2013-01-01

    The last melanoma staging system of the 2009 American Joint Committee on Cancer takes into account, for stage IV disease, the serum levels of lactate dehydrogenase (LDH) and the site of distant metastases. Our aim was to compare the significance of metastatic volume, as evaluated at the time of stage IV melanoma diagnosis, with other clinical predictors of prognosis. We conducted a retrospective multicentric study. To establish which variables were statistically correlated both with death and survival time, contingency tables were evaluated. The overall survival curves were compared using the Kaplan-Meier method. Metastatic volume and number of affected organs were statistically related to death. In detail, patients with a metastatic volume >15 cm(3) had a worse prognosis than those with a volume lower than this value (survival probability at 60 months: 6.8 vs. 40.9%, respectively). The Kaplan-Meier method confirmed that survival time was significantly related to the site(s) of metastases, to elevated LDH serum levels and to melanoma stage according to the latest system. Our results suggest that metastatic volume may be considered as a useful prognostic factor for survival among melanoma patients.

  13. [Application of Competing Risks Model in Predicting Smoking Relapse Following Ischemic Stroke].

    Science.gov (United States)

    Hou, Li-Sha; Li, Ji-Jie; Du, Xu-Dong; Yan, Pei-Jing; Zhu, Cai-Rong

    2017-07-01

    To determine factors associated with smoking relapse in men who survived from their first stroke. Data were collected through face to face interviews with stroke patients in the hospital, and then repeated every three months via telephone over the period from 2010 to 2014. Kaplan-Meier method and competing risk model were adopted to estimate and predict smoking relapse rates. The Kaplan-Meier method estimated a higher relapse rate than the competing risk model. The four-year relapse rate was 43.1% after adjustment of competing risk. Exposure to environmental tobacco smoking outside of home and workplace (such as bars and restaurants) ( P =0.01), single ( P <0.01), and prior history of smoking at least 20 cigarettes per day ( P =0.02) were significant predictors of smoking relapse. When competing risks exist, competing risks model should be used in data analyses. Smoking interventions should give priorities to those without a spouse and those with a heavy smoking history. Smoking ban in public settings can reduce smoking relapse in stroke patients.

  14. Factors affecting commencement and cessation of smoking behaviour in Malaysian adults

    Directory of Open Access Journals (Sweden)

    Ghani Wan

    2012-03-01

    Full Text Available Abstract Background Tobacco consumption peak in developed countries has passed, however, it is on the increase in many developing countries. Apart from cigarettes, consumption of local hand-rolled cigarettes such as bidi and rokok daun are prevalent in specific communities. Although factors associated with smoking initiation and cessation has been investigated elsewhere, the only available data for Malaysia is on prevalence. This study aims to investigate factors associated with smoking initiation and cessation which is imperative in designing intervention programs. Methods Data were collected from 11,697 adults by trained recording clerks on sociodemographic characteristics, practice of other risk habit and details of smoking such as type, duration and frequency. Smoking commencement and cessation were analyzed using the Kaplan-Meier estimates and log-rank tests. Univariate and multivariate Cox proportional hazard regression models were used to calculate the hazard rate ratios. Results Males had a much higher prevalence of the habit (61.7% as compared to females (5.8%. Cessation was found to be most common among the Chinese and those regularly consuming alcoholic beverages. Kaplan-Meier plot shows that although males are more likely to start smoking, females are found to be less likely to stop. History of betel quid chewing and alcohol consumption significantly increase the likelihood of commencement (p Conclusions Gender, ethnicity, history of quid chewing and alcohol consumption have been found to be important factors in smoking commencement; while ethnicity, betel quid chewing and type of tobacco smoked influences cessation.

  15. Evaluation of the TRPM2 channel as a biomarker in breast cancer using public databases analysis.

    Science.gov (United States)

    Sumoza-Toledo, Adriana; Espinoza-Gabriel, Mario Iván; Montiel-Condado, Dvorak

    Breast cancer is one of the most common malignancies affecting women. Recent investigations have revealed a major role of ion channels in cancer. The transient receptor potential melastatin-2 (TRPM2) is a plasma membrane and lysosomal channel with important roles in cell migration and cell death in immune cells and tumor cells. In this study, we investigated the prognostic value of TRPM2 channel in breast cancer, analyzing public databases compiled in Oncomine™ (Thermo Fisher, Ann Arbor, MI) and online Kaplan-Meier Plotter platforms. The results revealed that TRPM2 mRNA overexpression is significant in situ and invasive breast carcinoma compared to normal breast tissue. Furthermore, multi-gene validation using Oncomine™ showed that this channel is coexpressed with proteins related to cellular migration, transformation, and apoptosis. On the other hand, Kaplan-Meier analysis exhibited that low expression of TRPM2 could be used to predict poor outcome in ER- and HER2+ breast carcinoma patients. TRPM2 is a promising biomarker for aggressiveness of breast cancer, and a potential target for the development of new therapies. Copyright © 2016 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

  16. Prior history of non-melanoma skin cancer is associated with increased mortality in patients with chronic lymphocytic leukemia

    Science.gov (United States)

    Toro, Jorge R.; Blake, Patrick W.; Björkholm, Magnus; Kristinsson, Sigurdur Y.; Wang, Zhuoqiao; Landgren, Ola

    2009-01-01

    We investigated whether a previous diagnosis of non-melanoma skin cancer among chronic lymphocytic leukemia patients is a predictor of poor outcome. Using the Swedish Cancer Registry, we conducted a population-based study to evaluate the survival patterns among chronic lymphocytic leukemia patients with and without non-melanoma skin cancer. Cox proportional hazards regression models were used and Kaplan-Meier curves were constructed. Of a total of 12,041 chronic lymphocytic leukemia cases identified, 236 cases, including 111 squamous cell cancer, had a prior history of non-melanoma skin cancer. Chronic lymphocytic leukemia patients with a prior history of non-melanoma skin cancer had a 1.29-fold (95% CI 1.10–1.52; p=0.0024) increased risk of dying; and those with a history of squamous cell cancer had a further elevated 1.86-fold (95% CI 1.46–2.36; p<0.0001) risk of dying. Kaplan-Meier plots showed that patients with a history of non-melanoma skin cancer, particularly those with squamous cell cancer, had significantly poorer survival than chronic lymphocytic leukemia patients without non-melanoma skin cancer (p<0.0001; log-rank test). Non-melanoma skin cancer may be a novel clinical predictor of worse chronic lymphocytic leukemia outcome. PMID:19794092

  17. Elevated Serum IL-17 Expression at Cessation Associated with Graves’ Disease Relapse

    Directory of Open Access Journals (Sweden)

    Jianhui Li

    2018-01-01

    Full Text Available Background. Antithyroid drug (ATD treatment occupies the cornerstone therapeutic modality of Graves’ disease (GD with a high relapse rate after discontinuation. This study aimed to assess potential risk factors for GD relapse especially serum interleukin-17 (IL-17 expression. Methods. Consecutive newly diagnosed GD patients who were scheduled to undergo ATD therapy from May 2011 to May 2014 were prospectively enrolled. Risk factors for GD relapse were analyzed by univariate and multivariate Cox proportional hazard analyses. The association between serum IL-17 expression at cessation and GD relapse was analyzed with relapse-free survival (RFS by the Kaplan–Meier survival analysis and log-rank test. Results. Of the 117 patients, 72 (61.5% maintained a remission for 12 months after ATD withdrawal and 45 (38.5% demonstrated GD relapse. The final multivariate Cox analysis indicated elevated IL-17 expression at cessation to be an independent risk factor for GD relapse within 12 months after ATD withdrawal (HR: 3.04, 95% CI: 1.14–7.67, p=0.021. Patients with higher expressions of IL-17 (≥median value at cessation demonstrated a significantly higher RFS than those with lower levels by the Kaplan–Meier analysis and log-rank test (p=0.028. Conclusions. This present study indicated elevated serum IL-17 expression at cessation to be a predictor for GD relapse within 12 months.

  18. Talent in Female Gymnastics: a Survival Analysis Based upon Performance Characteristics.

    Science.gov (United States)

    Pion, J; Lenoir, M; Vandorpe, B; Segers, V

    2015-11-01

    This study investigated the link between the anthropometric, physical and motor characteristics assessed during talent identification and dropout in young female gymnasts. 3 cohorts of female gymnasts (n=243; 6-9 years) completed a test battery for talent identification. Performance-levels were monitored over 5 years of competition. Kaplan-Meier and Cox Proportional Hazards analyses were conducted to determine the survival rate and the characteristics that influence dropout respectively. Kaplan-Meier analysis indicated that only 18% of the female gymnasts that passed the baseline talent identification test survived at the highest competition level 5 years later. The Cox Proportional Hazards Model indicated that gymnasts with a score in the best quartile for a specific characteristic significantly increased chances of survival by 45-129%. These characteristics being: basic motor skills (129%), shoulder strength (96%), leg strength (53%) and 3 gross motor coordination items (45-73%). These results suggest that tests batteries commonly used for talent identification in young female gymnasts may also provide valuable insights into future dropout. Therefore, multidimensional test batteries deserve a prominent place in the selection process. The individual test results should encourage trainers to invest in an early development of basic physical and motor characteristics to prevent attrition. © Georg Thieme Verlag KG Stuttgart · New York.

  19. Differential Expression and Clinical Significance of Transforming Growth Factor-Beta Isoforms in GBM Tumors.

    Science.gov (United States)

    Roy, Laurent-Olivier; Poirier, Marie-Belle; Fortin, David

    2018-04-08

    Glioblastoma (GBM) represents the most common and aggressive malignant primary brain tumors in adults. Response to standard treatment is transitory and the survival of clinical trial cohorts are little more than 14 months. GBM are characterized by excessive proliferation, invasiveness, and radio-/chemoresistance features; which are strongly upregulated by transforming growth factor-beta (TGF-β). We hypothesized that TGF-β gene expression could correlate with overall survival (OS) and serve as a prognostic biomarker. TGF-β₁ and -β₂ expression were analyzed by qPCR in 159 GBM tumor specimens. Kaplan-Meier and multivariate analyses were used to correlate expression with OS and progression-free survival (PFS). In GBM, TGF-β₁ and -β₂ levels were 33- and 11-fold higher respectively than in non-tumoral samples. Kaplan-Meier and multivariate analyses revealed that high to moderate expressions of TGF-β₁ significantly conferred a strikingly poorer OS and PFS in newly diagnosed patients. Interestingly, at relapse, neither isoforms had meaningful impact on clinical evolution. We demonstrate that TGF-β₁ is the dominant isoform in newly diagnosed GBM rather than the previously acknowledged TGF-β₂. We believe our study is the first to unveil a significant relationship between TGF-β₁ expression and OS or PFS in newly diagnosed GBM. TGF-β₁ could serve as a prognostic biomarker or target affecting treatment planning and patient follow-up.

  20. Differential Expression and Clinical Significance of Transforming Growth Factor-Beta Isoforms in GBM Tumors

    Directory of Open Access Journals (Sweden)

    Laurent-Olivier Roy

    2018-04-01

    Full Text Available Glioblastoma (GBM represents the most common and aggressive malignant primary brain tumors in adults. Response to standard treatment is transitory and the survival of clinical trial cohorts are little more than 14 months. GBM are characterized by excessive proliferation, invasiveness, and radio-/chemoresistance features; which are strongly upregulated by transforming growth factor-beta (TGF-β. We hypothesized that TGF-β gene expression could correlate with overall survival (OS and serve as a prognostic biomarker. TGF-β1 and -β2 expression were analyzed by qPCR in 159 GBM tumor specimens. Kaplan–Meier and multivariate analyses were used to correlate expression with OS and progression-free survival (PFS. In GBM, TGF-β1 and -β2 levels were 33- and 11-fold higher respectively than in non-tumoral samples. Kaplan–Meier and multivariate analyses revealed that high to moderate expressions of TGF-β1 significantly conferred a strikingly poorer OS and PFS in newly diagnosed patients. Interestingly, at relapse, neither isoforms had meaningful impact on clinical evolution. We demonstrate that TGF-β1 is the dominant isoform in newly diagnosed GBM rather than the previously acknowledged TGF-β2. We believe our study is the first to unveil a significant relationship between TGF-β1 expression and OS or PFS in newly diagnosed GBM. TGF-β1 could serve as a prognostic biomarker or target affecting treatment planning and patient follow-up.

  1. Radiologic Placement of Tunneled Central Venous Catheters in Pediatric Patients

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Eun Ji; Song, Soon Young; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Jeong, Woo Kyoung; Lee, Yong Ho [Hanyang University College of Medicine, Seoul (Korea, Republic of)

    2010-08-15

    We evaluated the technical success and complication rates associated with the radiological placement of tunneled central venous catheters in pediatric patients. Between May 1, 2005 and March 31, 2008, a total of 46 tunneled central venous catheters were placed in 34 children (M:F = 22:12; mean age, 9.9 years [9 months to 16.8 years]). All procedures were performed under ultrasonographic and fluoroscopic guidance. Follow-up data were obtained through the retrospective review of the medical records. We used the Kaplan-Meier survival method for the evaluation of survival rate of the catheters. All procedures were technically successful. The observed periprocedural complications included hematoma formation in three patients. The mean catheter life was 189.3 days (total, 8710 days; range, 7-810). Catheters were removed due to death (n=9), the end of treatment (n=8), catheter sepsis (n=4), malfunction (n=8), and accidental removal (n=4). The rate of catheter sepsis and malfunction was 0.459 and 0.919 for every 1000 catheter days, respectively. The expected mean catheter life was 479.6 days as per the Kaplan- Meier analysis. The results suggest that the radiologic placement of a tunneled central venous catheter is an effective technique with a high technical success rate and low complication rate.

  2. Duration of clopidogrel treatment and risk of mortality and recurrent myocardial infarction among 11 680 patients with myocardial infarction treated with percutaneous coronary intervention: a cohort study

    Directory of Open Access Journals (Sweden)

    Køber Lars

    2010-01-01

    Full Text Available Abstract Background The optimal duration of clopidogrel treatment after percutaneous coronary intervention (PCI is unclear. We studied the risk of death or recurrent myocardial infarction (MI in relation to 6- and 12-months clopidogrel treatment among MI patients treated with PCI. Methods Using nationwide registers of hospitalizations and drug dispensing from pharmacies we identified 11 680 patients admitted with MI, treated with PCI and clopidogrel. Clopidogrel treatment was categorized in a 6-months and a 12-months regimen. Rates of death, recurrent MI or a combination of both were analyzed by the Kaplan Meier method and Cox proportional hazards models. Bleedings were compared between treatment regimens. Results The Kaplan Meier analysis indicated no benefit of the 12-months regimen compared with the 6-months in all endpoints. The Cox proportional hazards analysis confirmed these findings with hazard ratios for the 12-months regimen (the 6-months regimen used as reference for the composite endpoint of 1.01 (confidence intervals 0.81-1.26 and 1.24 (confidence intervals 0.95-1.62 for Day 0-179 and Day 180-540 after discharge. Bleedings occurred in 3.5% and 4.1% of the patients in the 6-months and 12-months regimen (p = 0.06. Conclusions We found comparable rates of death and recurrent MI in patients treated with 6- and 12-months' clopidogrel. The potential benefit of prolonged clopidogrel treatment in a real-life setting remains uncertain.

  3. [Expression and clinical significance of 5hmC in bladder urothelial carcinoma].

    Science.gov (United States)

    Li, Jie; Xu, Yuqiao; Zhang, Zhiwen; Zhang, Ming; Zhang, Zhekai; Zhang, Feng; Li, Qing

    2016-02-01

    To investigate the expression of 5-hydroxymethylcytosine (5hmC) in bladder urothelial carcinoma (UC) and its clinical significance. The expression of 5hmC in 21 cases of UC tissues and pericarcinous urinary tract epithelium was detected by immunohistochemical staining. Then the expression of 5hmC in the surgical resection of UC tissues in 92 cases was also surveyed. Non parametric U Mann-Whitney test was used to analyze the correlation between 5hmC expression and clinical data. Single factor survival analysis was performed by Kaplan-Meier test. The expression of 5hmC in normal urinary tract epithelium and UC tissues was significantly different, but there was no significant difference in the expression of 5hmC between low and high grades of UC tissues as well as between different TNM grades. Kaplan-Meier single factor survival analysis showed that there was no significant correlation between the 5hmC expression level and the survival rate or the recurrence-free survival of UC patients. The expression level of 5hmC in UC tissues is significantly lower than that in pericarcinous urinary tract epithelium. There is no correlation between the 5hmC expression and the progression, prognosis and recurrence of UC.

  4. High Neutrophil-to-Lymphocyte Ratio is a Significant Predictor of Cardiovascular and All-Cause Mortality in Patients Undergoing Peritoneal Dialysis

    Directory of Open Access Journals (Sweden)

    Xiangxue Lu

    2018-03-01

    Full Text Available Background/Aims: Chronic inflammation is associated with increased risk of cardiovascular death in patients with end-stage renal disease (ESRD. Although elevated neutrophil-to-lymphocyte ratio (NLR, a novel inflammatory marker, has been shown to predict cardiovascular disease and all-cause mortality in the general population, limited evidence is available for its role in ESRD. Methods: We enrolled 86 patients undergoing peritoneal dialysis (PD for a 36-month follow-up to investigate the association between the NLR and arterial stiffness markers, namely, carotid-femoral pulse wave velocity (cfPWV and carotid augmentation index (AIx, and mortality in PD patients. The primary endpoints were cardiovascular mortality and all-cause mortality. Kaplan–Meier curves were used to show the cumulative incidence of cardiovascular mortality and all-cause mortality. Results: High NLR was found to be a predictor of increased cfPWV (β = 1.150; P < 0.001 and AIx (β = 3.945; P < 0.001 in patients on PD. Patients with higher NLR had lower survival during follow-up. Kaplan–Meier curves showed that the cumulative incidences of both cardiovascular mortality and all-cause mortality were significantly higher in patients with NLR ≥ 4.5 (both P < 0.01. Conclusion: Our results suggest that high NLR is independently associated with arterial stiffness and predicts cardiovascular and all-cause mortality in PD patients.

  5. Assessing the effect of quantitative and qualitative predictors on gastric cancer individuals survival using hierarchical artificial neural network models.

    Science.gov (United States)

    Amiri, Zohreh; Mohammad, Kazem; Mahmoudi, Mahmood; Parsaeian, Mahbubeh; Zeraati, Hojjat

    2013-01-01

    There are numerous unanswered questions in the application of artificial neural network models for analysis of survival data. In most studies, independent variables have been studied as qualitative dichotomous variables, and results of using discrete and continuous quantitative, ordinal, or multinomial categorical predictive variables in these models are not well understood in comparison to conventional models. This study was designed and conducted to examine the application of these models in order to determine the survival of gastric cancer patients, in comparison to the Cox proportional hazards model. We studied the postoperative survival of 330 gastric cancer patients who suffered surgery at a surgical unit of the Iran Cancer Institute over a five-year period. Covariates of age, gender, history of substance abuse, cancer site, type of pathology, presence of metastasis, stage, and number of complementary treatments were entered in the models, and survival probabilities were calculated at 6, 12, 18, 24, 36, 48, and 60 months using the Cox proportional hazards and neural network models. We estimated coefficients of the Cox model and the weights in the neural network (with 3, 5, and 7 nodes in the hidden layer) in the training group, and used them to derive predictions in the study group. Predictions with these two methods were compared with those of the Kaplan-Meier product limit estimator as the gold standard. Comparisons were performed with the Friedman and Kruskal-Wallis tests. Survival probabilities at different times were determined using the Cox proportional hazards and a neural network with three nodes in the hidden layer; the ratios of standard errors with these two methods to the Kaplan-Meier method were 1.1593 and 1.0071, respectively, revealed a significant difference between Cox and Kaplan-Meier (P neural network, and the neural network and the standard (Kaplan-Meier), as well as better accuracy for the neural network (with 3 nodes in the hidden layer

  6. Improved long-term survival after intra-operative single high-dose ATG-Fresenius induction in renal transplantation: a single centre experience.

    Science.gov (United States)

    Kaden, Jürgen; May, Gottfried; Völp, Andreas; Wesslau, Claus

    2009-01-01

    In organ grafts donor-specific sensitization is initiated immediately after revascularization. Therefore, in 1990 we introduced the intra-operative single high-dose ATG-Fresenius (ATG-F) induction in addition to standard triple drug therapy (TDT) consisting of steroids, azathioprine and cyclosporin. A total of 778 first renal transplantations from deceased donors, performed between 1987 and 1998, were included in this evaluation. This retrospective analysis of clinic records and electronic databases presents data of all recipients of first kidney grafts who received two different ATG-F inductions (1(st) group: 9 mg/kg body weight as single high-dose intra-operatively, n=484; 2(nd) group: 3 mg/kg body weight on 7 or 8 consecutive days as multiple-dose starting also intra-operatively, n=78) and standard TDT alone (3(rd) group: TDT alone, n=216). The 10-year patient survival rates were 72.6+/-2.6% (TDT + ATG-F single high-dose), 79.5+/-5.1% (TDT + ATG-F multiple-dose) and 67.2+/-3.7%% (TDT alone; Kaplan-Meier estimates with standard errors; ATG-F vs TDT alone, p=0.001). The 10-year graft survival rates with censoring of patients that died with a functioning graft were 73.8+/-2.4%, 57.7+/-5.8% and 58.4+/-3.6% (Kaplan-Meier estimates with standard errors; 1(st) vs 2(nd )and 3(rd) group, respectively, p<0.001) and the 10-year graft survival rates with patient death counted as graft failure were 58.3+/-2.7%, 55.7+/-5.8% and 48.2+/-3.5% (Kaplan-Meier estimates with standard errors; ATG-F single high-dose vs TDT, p=0.023). In pre-sensitized recipients there were also significant differences in favour of ATG-F, more notably in the single high-dose ATG-F induction. A total of 69% of the patients in the two cohorts receiving ATG-F did not experience any transplant rejections compared to 56% in patients undergoing TDT alone (p=0.018). The incidence of infectious complications was comparable across all groups. According to evidence obtained from the routine documentation of 778

  7. Análisis de la recurrencia de cáncer de lengua considerando la presencia de eventos competitivos.

    Directory of Open Access Journals (Sweden)

    Raúl Vicente Mantilla Quispe

    2008-10-01

    Full Text Available Objetivo: Estimar la probabilidad de recurrencia en pacientes con cáncer de lengua según la edad, el estado ganglionar patológico y el tipo de tratamiento de los pacientes considerando la muerte antes de la recurrencia como evento competitivo. Material y métodos: Serie de casos retrospectiva de 290 pacientes con cáncer de lengua, con tratamiento en el INEN, entre los años 1977 y 2000. Se excluyeron del estudio 29 pacientes tratados solo con radioterapia. De los 261 pacientes, 31 solo tuvieron tratamiento del tumor primario. Resultados: La recurrencia fue 36,8%, la recurrencia local fue la más frecuente. La incidencia acumulada de la recurrencia a los 5 años, con el método de Kaplan Meier, se estimó en 44,7%, y según el análisis de riesgos competitivos en 42,4%. En el análisis univariado considerando riesgos competitivos, las incidencias acumuladas fueron: 56,8 y 38,9% en pacientes menores o iguales que 45 y mayores que 45 años respectivamente (p = 0,1556, 29,4% y 50,5% en pacientes con ganglios patológicos negativos y positivos, respectivamente (p = 0,0002, y 37,5% en pacientes con cirugía, y 47,4% con radioterapia (p = 0,03. En el análisis multivariado, con regresión de riesgos competitivos, no se encontró diferencia entre los tipos de tratamiento sobre la recurrencia (RR = 1,146, p = 0,620. Conclusiones: La pequeña diferencia entre los resultados del método Kaplan Meier y el que toma en cuenta eventos competitivos se debe a la baja tasa del evento competitivo, más aún por que se trata de muerte no relacionada con la enfermedad. La tasa de recurrencia fue similar al reportado en la literatura. Sólo se encontró diferencia significativa en la tasa de recurrencia en el grupo con compromiso ganglionar positivo. Aunque la comparación con los métodos estándar, Kaplan Meier y Regresión de Cox, muestra resultados similares se deben tener en cuenta los eventos competitivos. (Rev Med Hered 2008;19: 145-151.

  8. The Short-Term and Intermediate-Term Risk of Second Neoplasms After Diagnosis and Treatment of Unilateral Vestibular Schwannoma: Analysis of 9460 Cases

    International Nuclear Information System (INIS)

    Carlson, Matthew L.; Glasgow, Amy E.; Jacob, Jeffrey T.; Habermann, Elizabeth B.; Link, Michael J.

    2016-01-01

    Purpose: To determine the incidence of second intracranial neoplasms after the diagnosis and treatment of sporadic vestibular schwannoma (VS). Methods and Materials: Analysis of the Surveillance, Epidemiology, and End Results (SEER) database including all patients identified with a diagnosis of VS and a second intracranial tumor. The Kaplan-Meier method was used to determine the incidence of second tumors while allowing for censoring at loss to follow-up or death. Multivariable associations between treatment modality and second tumor formation were explored using Cox proportional hazards regression analysis. Two illustrative cases are also presented. Results: In all, 9460 patients with unilateral VS were identified between 2004 and 2012. Overall, 66 (0.7%) patients experienced a separate intracranial tumor, benign or malignant, after treatment of VS. Kaplan-Meier estimates for time to second neoplasm at 1, 3, and 5 years were 0.3%, 0.7%, and 0.8%, respectively. Multivariable comparison between VS treatment modalities revealed that the risk of second tumor formation was similar between radiation and surgery (hazard ratio [HR] 0.74; 95% confidence interval [CI] 0.36-1.51; P=.93) but greater for tumors managed with observation alone compared with radiation (HR 2.48; 95% CI 1.31-4.71; P<.01). A total of 6 (0.06%) intracranial malignancies were diagnosed after VS treatment. Kaplan-Meier estimates for time to malignancy at 1, 3, and 5 years were 0%, 0.1%, and 0.1%, respectively. After adjustment for age at diagnosis, sex, and treatment modality, the probability of malignancy after radiation was not greater than after observation alone or microsurgery (HR 4.88; 95% CI 0.85-28.14; P=.08) during the study period. Conclusions: The risk for the development of a second intracranial neoplasm, benign or malignant, at 5 years after treatment of unilateral VS is approximately 0.8%, whereas the risk of acquiring a separate malignancy is 0.1%, or approximately 1 per 1000 cases

  9. Long-term use of amiodarone before heart transplantation significantly reduces early post-transplant atrial fibrillation and is not associated with increased mortality after heart transplantation

    Directory of Open Access Journals (Sweden)

    Rivinius R

    2016-02-01

    Full Text Available Rasmus Rivinius,1 Matthias Helmschrott,1 Arjang Ruhparwar,2 Bastian Schmack,2 Christian Erbel,1 Christian A Gleissner,1 Mohammadreza Akhavanpoor,1 Lutz Frankenstein,1 Fabrice F Darche,1 Patrick A Schweizer,1 Dierk Thomas,1 Philipp Ehlermann,1 Tom Bruckner,3 Hugo A Katus,1 Andreas O Doesch1 1Department of Cardiology, Angiology and Pneumology, 2Department of Cardiac Surgery, Heidelberg University Hospital, 3Institute for Medical Biometry and Informatics, University of Heidelberg, Heidelberg, Germany Background: Amiodarone is a frequently used antiarrhythmic drug in patients with end-stage heart failure. Given its long half-life, pre-transplant use of amiodarone has been controversially discussed, with divergent results regarding morbidity and mortality after heart transplantation (HTX.Aim: The aim of this study was to investigate the effects of long-term use of amiodarone before HTX on early post-transplant atrial fibrillation (AF and mortality after HTX.Methods: Five hundred and thirty patients (age ≥18 years receiving HTX between June 1989 and December 2012 were included in this retrospective single-center study. Patients with long-term use of amiodarone before HTX (≥1 year were compared to those without long-term use (none or <1 year of amiodarone. Primary outcomes were early post-transplant AF and mortality after HTX. The Kaplan–Meier estimator using log-rank tests was applied for freedom from early post-transplant AF and survival.Results: Of the 530 patients, 74 (14.0% received long-term amiodarone therapy, with a mean duration of 32.3±26.3 months. Mean daily dose was 223.0±75.0 mg. Indications included AF, Wolff–Parkinson–White syndrome, ventricular tachycardia, and ventricular fibrillation. Patients with long-term use of amiodarone before HTX had significantly lower rates of early post-transplant AF (P=0.0105. Further, Kaplan–Meier analysis of freedom from early post-transplant AF showed significantly lower rates of AF in this

  10. Resultado do tratamento cirúrgico das neoplasias do seio piriforme

    Directory of Open Access Journals (Sweden)

    Costa Claudiney C.

    2003-01-01

    Full Text Available Os tumores da laringe e hipofaringe apresentam alta incidência no Brasil, sendo o sexto sítio mais comum entre os tumores malignos no sexo masculino. O diagnóstico inicial geralmente é realizado com lesões em estadio clínicos avançados diminuindo o sucesso do tratamento instituído. OBJETIVOS: Avaliar a evolução de 60 pacientes com carcinoma epidermóide de seio piriforme, considerando tratamento instituído, complicações e sobrevida estimada em 5 anos. FORMA DE ESTUDO: Estudo retrospectivo. MÉTODO: Os testes estatístico utilizados foram o método de Kaplan-Meier e o teste exato de Fisher. RESULTADOS: Dos 60 pacientes, 43 foram submetidos a tratamento cirúrgico seguido de radioterapia. Atualmente 27,9% estão vivos sem doença, 11,6% vivos com doença, 9,4% mortos sem doença, 34,8% mortos com doença e perda de seguimento de 16,3%. A complicação pós-operatória mais freqüente foi a fístula cutânea. A recidiva local ocorreu em 5 pacientes, regional em 6, loco-regional em 3 e metástase à distância em 6. Não houve correlação entre margem cirúrgica comprometida e sobrevida em 20 pacientes com recidiva tumoral (Teste de Fisher. Aplicando a curva de sobrevida atuarial pelo método Kaplan-Meier, obtivemos média de sobrevida em 5 anos de 23,2 meses. CONCLUSÃO: A principal complicação pós-operatória foi a fístula cutânea, sendo tratada clinicamente. A margem cirúrgica comprometida não alterou o prognóstico, apesar de ser sempre um dos princípios da cirurgia oncológica. A principal falha no tratamento foi a recidiva locorregional. A curva de sobrevida atuarial (Kaplan-Meier em cinco anos apresentou média de 23,2 meses.

  11. The Short-Term and Intermediate-Term Risk of Second Neoplasms After Diagnosis and Treatment of Unilateral Vestibular Schwannoma: Analysis of 9460 Cases

    Energy Technology Data Exchange (ETDEWEB)

    Carlson, Matthew L., E-mail: carlson.matthew@mayo.edu [Department of Otorhinolaryngology, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Glasgow, Amy E. [Division of Health Care Policy and Research and the Robert D. and Patricia E. Kern Center for the Science of Health Care Delivery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Jacob, Jeffrey T. [Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Habermann, Elizabeth B. [Division of Health Care Policy and Research and the Robert D. and Patricia E. Kern Center for the Science of Health Care Delivery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Link, Michael J. [Department of Otorhinolaryngology, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States)

    2016-07-15

    Purpose: To determine the incidence of second intracranial neoplasms after the diagnosis and treatment of sporadic vestibular schwannoma (VS). Methods and Materials: Analysis of the Surveillance, Epidemiology, and End Results (SEER) database including all patients identified with a diagnosis of VS and a second intracranial tumor. The Kaplan-Meier method was used to determine the incidence of second tumors while allowing for censoring at loss to follow-up or death. Multivariable associations between treatment modality and second tumor formation were explored using Cox proportional hazards regression analysis. Two illustrative cases are also presented. Results: In all, 9460 patients with unilateral VS were identified between 2004 and 2012. Overall, 66 (0.7%) patients experienced a separate intracranial tumor, benign or malignant, after treatment of VS. Kaplan-Meier estimates for time to second neoplasm at 1, 3, and 5 years were 0.3%, 0.7%, and 0.8%, respectively. Multivariable comparison between VS treatment modalities revealed that the risk of second tumor formation was similar between radiation and surgery (hazard ratio [HR] 0.74; 95% confidence interval [CI] 0.36-1.51; P=.93) but greater for tumors managed with observation alone compared with radiation (HR 2.48; 95% CI 1.31-4.71; P<.01). A total of 6 (0.06%) intracranial malignancies were diagnosed after VS treatment. Kaplan-Meier estimates for time to malignancy at 1, 3, and 5 years were 0%, 0.1%, and 0.1%, respectively. After adjustment for age at diagnosis, sex, and treatment modality, the probability of malignancy after radiation was not greater than after observation alone or microsurgery (HR 4.88; 95% CI 0.85-28.14; P=.08) during the study period. Conclusions: The risk for the development of a second intracranial neoplasm, benign or malignant, at 5 years after treatment of unilateral VS is approximately 0.8%, whereas the risk of acquiring a separate malignancy is 0.1%, or approximately 1 per 1000 cases

  12. Pesticide mixtures in the Swedish streams: Environmental risks, contributions of individual compounds and consequences of single-substance oriented risk mitigation.

    Science.gov (United States)

    Gustavsson, Mikael; Kreuger, Jenny; Bundschuh, Mirco; Backhaus, Thomas

    2017-11-15

    This paper presents the ecotoxicological assessment and environmental risk evaluation of complex pesticide mixtures occurring in freshwater ecosystems in southern Sweden. The evaluation is based on exposure data collected between 2002 and 2013 by the Swedish pesticide monitoring program and includes 1308 individual samples, detecting mixtures of up to 53 pesticides (modal=8). Pesticide mixture risks were evaluated using three different scenarios for non-detects (best-case, worst-case and using the Kaplan-Meier method). The risk of each scenario was analyzed using Swedish Water Quality Objectives (WQO) and trophic-level specific environmental thresholds. Using the Kaplan-Meier method the environmental risk of 73% of the samples exceeded acceptable levels, based on an assessment using Concentration-Addition and WQOs for the individual pesticides. Algae were the most sensitive organism group. However, analytical detection limits, especially for insecticides, were insufficient to analyze concentrations at or near their WQO's. Thus, the risk of the analyzed pesticide mixtures to crustaceans and fish is systematically underestimated. Treating non-detects as being present at their individual limit of detection increased the estimated risk by a factor 100 or more, compared to the best-case or the Kaplan-Meier scenario. Pesticide mixture risks are often driven by only 1-3 compounds. However, the risk-drivers (i.e., individual pesticides explaining the largest share of potential effects) differ substantially between sites and samples, and 83 of the 141 monitored pesticides need to be included in the assessment to account for 95% of the risk at all sites and years. Single-substance oriented risk mitigation measures that would ensure that each individual pesticide is present at a maximum of 95% of its individual WQO, would also reduce the mixture risk, but only from a median risk quotient of 2.1 to a median risk quotient of 1.8. Also, acceptable total risk levels would still

  13. Sobrevivência após acidentes de trânsito: impacto das variáveis clínicas e pré-hospitalares Sobrevida después de accidentes de tránsito: impacto de las variables clínicas y pre hospitalarias Survival after motor vehicle crash: impact of clinical and prehospital variables

    Directory of Open Access Journals (Sweden)

    Marisa Aparecida Amaro Malvestio

    2008-08-01

    Full Text Available OBJETIVO: Analisar as variáveis clínicas e pré-hospitalares associadas à sobrevivência de vítimas de acidente de trânsito. MÉTODOS: Estudo realizado no município de São Paulo, SP, de 1999 a 2003. Foram analisados dados de 175 pacientes, entre 12 e 65 anos, vitimados por acidente de trânsito. A Análise de Sobrevivência de Kaplan-Meier foi utilizada na abordagem dos resultados na cena do acidente com as vítimas de escore OBJETIVO: Analizar las variables clínicas y pre hospitalarias asociadas a la sobrevida de víctimas de accidentes del tránsito. MÉTODOS: Estudio realizado en el municipio de São Paulo (Sudeste de Brasil, de 1999 a 2003. Fueron analizados datos de 175 pacientes, entre 12 y 65 años, victimas de accidentes de tránsito. El análisis de Sobrevida de Kaplan-Meier fue utilizado en el abordaje de los resultados en la escena del accidente con las víctimas de score OBJECTIVE: To assess clinical and prehospital variables associated with survival of motor vehicle crash victims. METHODS: Study carried out in the city of São Paulo (Southeastern Brazil, from 1999 to 2003. Data from 175 patients, who were aged between 12 and 65 years and had been motor vehicle crash victims, were analyzed. Kaplan-Meier Survival Analysis was used to approach the results at the accident scene with victims scoring <11, according to the Revised Trauma Score. Variables analyzed were: sex, age, injury mechanisms, basic and advanced support procedures, Revised Trauma Score parameters and fluctuations, time elapsed in the prehospital phase and trauma severity according to the Injury Severity Score and Maximum Abbreviated Injury Scale. RESULTS: Analysis revealed that victims who were less likely to survive during the hospitalization period showed serious lesions in the abdomen, thorax, or lower limbs, with negative fluctuation of respiratory frequency and Revised Trauma Score in the prehospital phase. In addition, they needed specialized

  14. Age at hysterectomy as a predictor for subsequent pelvic organ prolapse repair

    DEFF Research Database (Denmark)

    Lykke, Rune; Blaakær, Jan; Ottesen, Bent

    2016-01-01

    from 1977 to 2009 from the Danish National Patient Registry. The cohort consisted of 154,882 hysterectomized women, who were followed up for up to 32 years. Survival analysis for each age group at hysterectomy was performed using Kaplan-Meier product limit methods. RESULTS: For all hysterectomized......INTRODUCTION AND HYPOTHESIS: The aim of this study was to investigate the association between patient age at the time of hysterectomy and subsequent pelvic organ prolapse (POP) surgery. METHODS: We gathered data on all benign hysterectomies and POP surgeries performed in Denmark on Danish women...... women, we found that low age at hysterectomy yielded a lower risk of subsequent POP surgery than did hysterectomy at an older age. This difference diminished after stratification by indication; all non-POP hysterectomies had a low cumulative incidence at 8-11 % at the end of the follow-up period...

  15. Increased mortality associated with low use of clopidogrel in patients with heart failure and acute myocardial infarction not undergoing percutaneous coronary intervention

    DEFF Research Database (Denmark)

    Bonde, Lisbeth; Sorensen, Rikke; Fosbøl, Emil Loldrup

    2010-01-01

    with patients not treated with clopidogrel. Similarly, 2 groups without HF were identified. Risks of all-cause death were obtained by the Kaplan-Meier method and Cox regression analyses. RESULTS: We identified 56,944 patients with first-time AMI. In the matched cohort with HF (n = 5,050) and a mean follow......OBJECTIVES: We studied the association of clopidogrel with mortality in acute myocardial infarction (AMI) patients with heart failure (HF) not receiving percutaneous coronary intervention (PCI). BACKGROUND: Use of clopidogrel after AMI is low in patients with HF, despite the fact that clopidogrel...... is associated with absolute mortality reduction in AMI patients. METHODS: All patients hospitalized with first-time AMI (2000 through 2005) and not undergoing PCI within 30 days from discharge were identified in national registers. Patients with HF treated with clopidogrel were matched by propensity score...

  16. Changes in white matter as determinant of global functional decline in older independent outpatients: three year follow-up of LADIS (leukoaraiosis and disability) study cohort

    DEFF Research Database (Denmark)

    Inzitari, Domenico; Pracucci, Giovanni; Poggesi, Anna

    2009-01-01

    cerebral infarcts and atrophy. MAIN OUTCOME MEASURE: Transition from no disability (defined as a score of 0 or 1 on the instrumental activities of daily living scale) to disability (score >/=2) or death over three year follow-up. Secondary outcomes were incident dementia and stroke. RESULTS: Over a mean...... follow-up period of 2.42 years (SD 0.97, median 2.94 years), information on the main outcome was available for 633 patients. The annual rate of transition or death was 10.5%, 15.1%, and 29.5%, respectively, for patients with mild, moderate, or severe age related changes in white matter (Kaplan-Meier log...

  17. Measuring the success of combined intravesical dimethyl sulfoxide and triamcinolone for treatment of bladder pain syndrome/interstitial cystitis.

    Science.gov (United States)

    Gafni-Kane, Adam; Botros, Sylvia M; Du, Hongyan; Sand, Robert I; Sand, Peter K

    2013-02-01

    The purpose of this study was to investigate change in bladder capacity as a measure of response to combined intravesical dimethyl sulfoxide (DMSO) and triamcinolone instillations for the treatment of newly diagnosed bladder pain syndrome/interstitial cystitis (BPS/IC). 141 newly diagnosed women were identified retrospectively. 79 were treated with weekly DMSO/triamcinolone instillations. Change in bladder capacity with bladder retrofill, daytime urinary frequency, nocturia episodes per night, and Likert scale symptom scores were reviewed. Wilcoxon signed-rank tests, Wilcoxon rank-sum tests, Spearman's rank correlations, COX regression analysis, and a Kaplan-Meier survival curve were performed. Significant changes (median (25(th)-percentile to 75(th)-percentile) were noted for bladder capacity (75 mL (25 to 130 mL), p measure of response to intravesical DMSO/triamcinolone for newly diagnosed BPS/IC. Clinical outcomes do not differ based upon presence of DO.

  18. Enhanced Predictive Capability of a 1-Hour Oral Glucose Tolerance Test

    DEFF Research Database (Denmark)

    Pareek, Manan; Bhatt, Deepak L; Nielsen, Mette L

    2018-01-01

    OBJECTIVE: To examine whether the 1-h blood glucose measurement would be a more suitable screening tool for assessing the risk of diabetes and its complications than the 2-h measurement. RESEARCH DESIGN AND METHODS: We conducted a prospective population-based cohort study of 4,867 men, randomly...... selected from prespecified birth cohorts between 1921 and 1949, who underwent an oral glucose tolerance test with blood glucose measurements at 0, 1, and 2 h. Subjects were followed for up to 39 years, with registry-based recording of events. Discriminative abilities of elevated 1-h (≥8.6 mmol/L) versus 2......-h (≥7.8 mmol/L) glucose for predicting incident type 2 diabetes, vascular complications, and mortality were compared using Kaplan-Meier analysis, Cox proportional hazards regression, and net reclassification improvement. RESULTS: Median age was 48 years (interquartile range [IQR] 48-49). During...

  19. Combined measurement of copeptin, high-sensitivity troponin T, and N-terminal proBNP improves the identification of patients at risk of cardiovascular death

    DEFF Research Database (Denmark)

    Alehagen, Urban; Dahlström, Ulf; Carstensen, John

    2012-01-01

    and all mortality was registered. Cardiovascular mortality was evaluated using Kaplan–Meier plots and multivariate Cox proportional hazard regression analyses. Results: Copeptin, HS-TnT, and NT-proBNP measurements provided independent prognostic information in a multivariate setting over 5 years (hazard......Objectives: A multimarker strategy for the handling of patients with heart failure has been suggested in the literature. Therefore, the potential prognostic relevance of combined copeptin, high-sensitivity troponin T (HS-TnT), and N-terminal proBNP (NT-proBNP) measurement in plasma from elderly...... patients with symptoms of heart failure was evaluated. Methods: This study included 470 elderly patients (mean age 73 years) from a rural municipality with symptoms of heart failure. Clinical examination, echocardiography, and biomarker measurements were performed. All patients were followed for 13 years...

  20. Measuring quality indicators in the operating room: cleaning and turnover time.

    Science.gov (United States)

    Jericó, Marli de Carvalho; Perroca, Márcia Galan; da Penha, Vivian Colombo

    2011-01-01

    This exploratory-descriptive study was carried out in the Surgical Center Unit of a university hospital aiming to measure time spent with concurrent cleaning performed by the cleaning service and turnover time and also investigated potential associations between cleaning time and the surgery's magnitude and specialty, period of the day and the room's size. The sample consisted of 101 surgeries, computing cleaning time and 60 surgeries, computing turnover time. The Kaplan-Meier method was used to analyze time and Pearson's correlation to study potential correlations. The time spent in concurrent cleaning was 7.1 minutes and turnover time was 35.6 minutes. No association between cleaning time and the other variables was found. These findings can support nurses in the efficient use of resources thereby speeding up the work process in the operating room.

  1. Analyzing repeated data collected by mobile phones and frequent text messages. An example of Low back pain measured weekly for 18 weeks

    DEFF Research Database (Denmark)

    Axén, Iben; Bodin, Lennart; Kongsted, Alice

    2012-01-01

    to recovery? This question was answered using survival analysis, illustrated in Kaplan-Meier curves, Proportional Hazard regression analyses and spline regression analyses. 4: How is the repeatedly measured data associated with baseline (predictor) variables? This question was answered using generalized...... involves some challenges. Vital issues to consider are the within-subject correlation, the between measurement occasion correlation and the presence of missing values. The overall aim of this commentary is to describe different methods of analyzing repeated data. It is meant to give an overview...... for the clinical researcher in order for complex outcome measures to be interpreted in a clinically meaningful way. METHODS: A model data set was formed using data from two clinical studies, where patients with low back pain were followed with weekly text messages for 18 weeks. Different research questions...

  2. Descriptive epidemiology and natural history of idiopathic venous thromboembolism in U.S. active duty enlisted personnel, 1998-2007.

    Science.gov (United States)

    Freeman, Randall J; Li, Yuanzhang; Niebuhr, David W

    2011-05-01

    The estimated incidence of idiopathic venous thromboembolism (IVTE) cases in the United States ranges from 24,000 to 282,000/year. This analysis explores the incidence and prevalence of IVTE in the military and if cases experience increased attrition. The Defense Medical Surveillance System was searched for incident IVTE cases from 1998 through 2007. Enlisted cases were each matched to 3 controls. Kaplan-Meier survival analysis and Cox proportional hazard modeling were performed. We matched 463 cases to 1,389 controls. Outpatient IVTE rates have increased markedly from 1998 through 2007. Cases of all-cause attrition risk (0.56 [95% CI = 0.44, 0.72]) and rates were significantly less than controls (p readiness, and medical costs.

  3. Failure rate of cemented and uncemented total hip replacements

    DEFF Research Database (Denmark)

    Makela, K. T.; Matilainen, M.; Pulkkinen, P.

    2014-01-01

    ). Participants 347 899 total hip replacements performed during 1995-2011. Main outcome measures Probability of implant survival (Kaplan-Meier analysis) along with implant survival with revision for any reason as endpoint (Cox multiple regression) adjusted for age, sex, and diagnosis in age groups 55-64, 65......Objective To assess the failure rate of cemented, uncemented, hybrid, and reverse hybrid total hip replacements in patients aged 55 years or older. Design Register study. Setting Nordic Arthroplasty Register Association database (combined data from Sweden, Norway, Denmark, and Finland......-74, and 75 years or older. Results The proportion of total hip replacements using uncemented implants increased rapidly towards the end of the study period. The 10 year survival of cemented implants in patients aged 65 to 74 and 75 or older (93.8%, 95% confidence interval 93.6% to 94.0% and 95.9%, 95...

  4. Primary mediastinal large B-cell lymphoma: Clinical features, prognostic factors and survival with RCHOP in Arab patients in the PET scan era.

    Science.gov (United States)

    Al Shemmari, Salem; Sankaranarayanan, Sreedharan P; Krishnan, Yamini

    2014-07-01

    PMBCL is a distinct type of nonhodgkins lymphoma with specific clinicopathological features. To clarify clinical features, treatment alternatives and outcomes, we evaluated 28 Arab patients treated with chemotherapy or radiotherapy between 2006 and 2011. PMBCL lymphoma patients identified according to WHO classification and treated at KCCC between 2006 and 2011 were included in this study. Demographic and clinical data are presented as means or medians. Overall survival was estimated using the Kaplan-Meier method. Survival rates were compared using the log-rank test. A P lymphoma entity seen in the young with good survival. The role of PET scan for response evaluation and the type of consolidation therapy needs to be further clarified.

  5. Extra-large pore zeolite (ITQ-40) with the lowest framework density containing double four- and double three-rings

    Science.gov (United States)

    Díaz-Cabañas, M. J.; Jiang, J.; Afeworki, M.; Dorset, D. L.; Soled, S. L.; Strohmaier, K. G.

    2010-01-01

    The first zeolite structure (ITQ-40) that contains double four (D4) and double three (D3) member ring secondary building units has been synthesized by introducing Ge and NH4F and working in concentrated synthesis gels. It is the first time that D3-Rs have been observed in a zeolite structure. As was previously analyzed [Brunner GO, Meier, WM (1989) Nature 337:146–147], such a structure has a very low framework density (10.1 T/1,000 Å3). Indeed, ITQ-40 has the lowest framework density ever achieved in oxygen-containing zeolites. Furthermore, it contains large pore openings, i.e., 15-member rings parallel to the [001] hexagonal axis and 16-member ring channels perpendicular to this axis. The results presented here push ahead the possibilities of zeolites for uses in electronics, control delivery of drugs and chemicals, as well as for catalysis. PMID:20660773

  6. Impact of Gender, Co-Morbidity and Social Factors on Labour Market Affiliation after First Admission for Acute Coronary Syndrome

    DEFF Research Database (Denmark)

    Osler, Merete; Mårtensson, Solvej; Prescott, Eva

    2014-01-01

    -morbidity and socio-economic position on subsequent labour market affiliation and transition between various social services in patients admitted for the first time with ACS. METHODS: From 2001 to 2009 all first-time hospitalisations for ACS were identified in the Danish National Patient Registry (n = 79......BACKGROUND: Over the last decades survival after acute coronary syndrome (ACS) has improved, leading to an increasing number of patients returning to work, but little is known about factors that may influence their labour market affiliation. This study examines the impact of gender, co...... between the above labour market states was examined using Kaplan-Meier estimates and Cox proportional hazards models. FINDINGS: A total of 37% of patients were in work 30 days after first ACS diagnosis, while 55% were on sick leave and 8% were unemployed. Seventy-nine per cent returned to work once during...

  7. Trends in adult leukemia incidence and survival in Denmark, 1943-2003

    DEFF Research Database (Denmark)

    Thygesen, Lau Caspar; Nielsen, Ove Juul; Johansen, Christoffer

    2009-01-01

    The etiology of leukemia is largely unknown. Ecological data indicating trends in incidence and survival can provide information about changes in risk factors, can reflect underlying changes in diagnostic classification, and can measure therapeutic advances. From the records of the Danish Cancer...... Registry with registration starting from 1943, we calculated age-specific, period-specific, and age-standardized (world standard) incidence rates of chronic lymphoid leukemia (CLL), acute lymphoid leukemia (ALL), chronic myeloid leukemia (CML), and acute myeloid leukemia (AML) for persons above the age...... of 18. Kaplan-Meier survival curves and median survival times were calculated. Between 1943 and 2003, there were 26,036 cases of leukemia reported. The age-specific incidence rates of CLL, CML, and AML were higher for older men and women, while the incidence rates of ALL by age were more homogeneous...

  8. Disciplinary action against physicians: who is likely to get disciplined?

    Science.gov (United States)

    Khaliq, Amir A; Dimassi, Hani; Huang, Chiung-Yu; Narine, Lutchmie; Smego, Raymond A

    2005-07-01

    We sought to determine the characteristics of disciplined physicians at-large and the risk of disciplinary action over time and to report the type and frequency of complaints and the nature of disciplinary actions against allopathic physicians in Oklahoma. Descriptive statistics, Kaplan-Meier analysis, and Cox proportional hazards modeling of publicly available data on physicians licensed by the Oklahoma Board of Medical Licensure and Supervision. Among 14,314 currently or previously licensed physicians, 396 (2.8%) had been disciplined. Using univariate proportional hazards analysis, men (P disciplinary action compared to US medical graduates (P disciplinary action, medical schools and residency training programs must continue to emphasize both patient care and medical professionalism as critical core competencies.

  9. The effect of quitting smoking on the risk of unfavorable events after surgical treatment of oral potentially malignant lesions

    DEFF Research Database (Denmark)

    Vladimirov, B S; Schiødt, Morten

    2009-01-01

    smokers at the time of diagnosis and were treated surgically. Patients were advised to quit smoking at each visit. The change of smoking habits and occurrence of unfavorable events were noted during follow-up. Descriptive statistics, Fischer's exact test, Kaplan-Meier curves with log-rank test, and Cox......The aim of this study was to examine if cessation of smoking after surgical excision of oral potentially malignant lesions in smokers reduced the risk of recurrences, development of new lesions or malignancies. 51 patients with oral leukoplakia or erythroplakia were included. They were daily...... proportional hazards model were used for analysis. 16 patients (31%) quit smoking during the observation period. Only one quitter (6%) developed recurrence compared with 11 continuing smokers (33%) (p

  10. Differential risk assessments from five hypoxia specific assays: The basis for biologically adapted individualized radiotherapy in advanced head and neck cancer patients

    DEFF Research Database (Denmark)

    Nordsmark, Marianne; Eriksen, Jesper Grau; Gebski, Val

    2007-01-01

    osteopontin measured by ELISA, tumour oxygenation status using pO(2) needle electrodes and tumour osteopontin, hypoxia inducible factor 1alpha (HIF-1alpha) and carboxyanhydrase 9 (CA9) by immunohistochemistry. The primary treatment was radiotherapy and the hypoxic radiosensitizer nimorazole. Loco......-regional tumour control was evaluated at 5 years. RESULTS: All five markers showed inter-tumour variability. Inter-marker correlations were inconsistent. Only plasma osteopontin inversely correlated with median tumour pO(2), (p=0.02, r=0.28) and CA9 correlated with HIF-1alpha (p...-Meier analysis high plasma osteopontin, high HIF-1alpha and high proportion of tumour pO(2)2.5mmHg (HP(2.5)) related significantly with poorer loco-regional control, whereas CA9 and tumour osteopontin failed to predict loco-regional control in this set dataset. When analyzing Hb, stage, and the five markers...

  11. Characterization of annual disease progression of multiple sclerosis patients: A population-based study

    DEFF Research Database (Denmark)

    Freilich, Jonatan; Manouchehrinia, Ali; Trusheim, Mark

    2017-01-01

    Previous research characterizing factors influencing multiple sclerosis (MS) disease progression has typically been based on time to disease milestones (Kaplan-Meier, Cox hazard regression, etc.). A limitation of these methods is the handling of the often large groups of patients not reaching...... the milestone. To characterize clinical factors influencing MS disease progression as annual transitions from each Expanded Disability Status Scale (EDSS). The annual progression of 11,964 patients from the Swedish MS Registry was analysed with 10 multinomial logistic regressions, that is, one for transition...... from each full EDSS with explanatory variables age, sex, age at onset, time in current EDSS, highest prior EDSS, MS course and treatment. All factors (except sex) investigated had statistically significant impacts on transitions from at least one EDSS. However, significance and size of the effect...

  12. A nationwide study of serous “borderline” ovarian tumors in Denmark 1978–2002

    DEFF Research Database (Denmark)

    Hannibal, Charlotte Gerd; Vang, Russell; Junge, Jette

    2014-01-01

    OBJECTIVE: To describe the study population and estimate overall survival of women with a serous "borderline" ovarian tumor (SBT) in Denmark over 25 years relative to the general population. METHODS: The Danish Pathology Data Bank and the Danish Cancer Registry were used to identify 1487 women...... as noninvasive or invasive. Medical records were collected from hospital departments and reviewed. Data were analyzed using Kaplan-Meier and relative survival was estimated with follow-up through September 2, 2013. RESULTS: A cohort of 1042 women with a confirmed SBT diagnosis was identified. Women with stage I...... had an overall survival similar to the overall survival expected from the general population (p=0.3), whereas women with advanced stage disease had a poorer one (pwomen with noninvasive (pwomen with advanced stage...

  13. Modified polarimetric bidirectional reflectance distribution function with diffuse scattering: surface parameter estimation

    Science.gov (United States)

    Zhan, Hanyu; Voelz, David G.

    2016-12-01

    The polarimetric bidirectional reflectance distribution function (pBRDF) describes the relationships between incident and scattered Stokes parameters, but the familiar surface-only microfacet pBRDF cannot capture diffuse scattering contributions and depolarization phenomena. We propose a modified pBRDF model with a diffuse scattering component developed from the Kubelka-Munk and Le Hors et al. theories, and apply it in the development of a method to jointly estimate refractive index, slope variance, and diffuse scattering parameters from a series of Stokes parameter measurements of a surface. An application of the model and estimation approach to experimental data published by Priest and Meier shows improved correspondence with measurements of normalized Mueller matrix elements. By converting the Stokes/Mueller calculus formulation of the model to a degree of polarization (DOP) description, the estimation results of the parameters from measured DOP values are found to be consistent with a previous DOP model and results.

  14. Nomogram based overall survival prediction in stereotactic body radiotherapy for oligo-metastatic lung disease

    DEFF Research Database (Denmark)

    Tanadini-Lang, S; Rieber, J; Filippi, A R

    2017-01-01

    BACKGROUND: Radical local treatment of pulmonary metastases is practiced with increasing frequency due to acknowledgment and better understanding of oligo-metastatic disease. This study aimed to develop a nomogram predicting overall survival (OS) after stereotactic body radiotherapy (SBRT......) for pulmonary metastases. PATIENTS AND METHODS: A multi-institutional database of 670 patients treated with SBRT for pulmonary metastases was used as training cohort. Cox regression analysis with bidirectional variable elimination was performed to identify factors to be included into the nomogram model...... to predict 2-year OS. The calibration rate of the nomogram was assessed by plotting the actual Kaplan-Meier 2-year OS against the nomogram predicted survival. The nomogram was externally validated using two separate monocentric databases of 145 and 92 patients treated with SBRT for pulmonary metastases...

  15. S100A14 is a novel independent prognostic biomarker in the triple-negative breast cancer subtype

    DEFF Research Database (Denmark)

    Ehmsen, Sidse; Hansen, Lea Tykgaard; Bak, Martin

    2015-01-01

    Triple-negative breast cancer (TNBC) represents a heterogeneous subgroup with generally poor outcome and lack of an effective targeted therapy. Prognostic or predictive biomarkers to guide treatment decisions for this group of patients are needed. To evaluate the potential of S100A14 protein...... as a novel biomarker in TNBC, the protein expression of S100A14 was correlated with clinical outcomes in a Pilot Sample set and a Danish cohort of predominantly TNBC patients. Kaplan-Meier analysis identified a prognostic impact of S100A14 on disease-free survival and overall survival, showing that tumors......-), had equally poor outcomes as those with tumor-positive axillary lymph nodes (N+), while TNBC/N- patients with low S100A14 expression had a significantly better disease free survival (p = 0.013). Multivariate analysis revealed that S100A14 is an independent prognostic factor for TNBC patients (p = 0...

  16. Expression and clinical significance of PIWIL2 in hilar cholangiocarcinoma tissues and cell lines.

    Science.gov (United States)

    Chen, Y J; Xiong, X F; Wen, S Q; Tian, L; Cheng, W L; Qi, Y Q

    2015-06-26

    The objective of this study was to explore the relationship between PIWI-like protein 2 (PIWIL2) and clinicopathological charac-teristics and prognosis after radical resection. To accomplish this, we analyzed PIWIL2 expression in hilar cholangiocarcinoma tissues and cell lines. PIWIL2 expression was detected by immunohistochemistry in 41 hilar cholangiocarcinoma samples and 10 control tissues. Western blotting and immunocytofluorescence were used to investigate PIWIL2 expression in the cholangiocarcinoma cell line QBC939 and the bile duct epithelial cell line HIBEpic. Univariate and multivariate surviv-al analyses were performed using the Kaplan-Meier method for hilar cholangiocarcinoma patients who underwent radical resection. PIWIL2 expression was significantly higher in the hilar cholangiocarcinoma tissues and QBC939 cells than in control tissues and HIBEpic cells, respectively (P hilar cholangiocarcinoma (P hilar cholangiocarcinoma.

  17. Survival analysis in hematologic malignancies: recommendations for clinicians

    Science.gov (United States)

    Delgado, Julio; Pereira, Arturo; Villamor, Neus; López-Guillermo, Armando; Rozman, Ciril

    2014-01-01

    The widespread availability of statistical packages has undoubtedly helped hematologists worldwide in the analysis of their data, but has also led to the inappropriate use of statistical methods. In this article, we review some basic concepts of survival analysis and also make recommendations about how and when to perform each particular test using SPSS, Stata and R. In particular, we describe a simple way of defining cut-off points for continuous variables and the appropriate and inappropriate uses of the Kaplan-Meier method and Cox proportional hazard regression models. We also provide practical advice on how to check the proportional hazards assumption and briefly review the role of relative survival and multiple imputation. PMID:25176982

  18. [Treatment of non-Hodgkin's lymphoma associated with acquired immnodeficiency syndrome (AIDS) at the Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán].

    Science.gov (United States)

    Uriarte-Duque, Juan; Hernández-Riverab, Gabriela

    2006-01-01

    Survival in patients with acquired immunodeficiency syndrome (AIDS) related non-Hodgkin's Lymphoma has improved with the use of High Active Antiretroviral Therapy (HAART) and less toxic chemotherapy. Clinical characteristics and outcome among patients treated for AIDS related non-Hodgkin's Lymphoma are described. Nine patients were studied retrospectively. Overall survival (OS) and Free Disease Survival (FDS) using a Kaplan-Meier model were analyzed. Patients received (DA-EPOCH) etoposide, prednisone, vincristine, doxorubicin and cyclophosphamide. The overall Survival was 18 months and 13 month Free Disease Survival with a median follow-up of 16 months showing full response in 8/9 patients was observed. A very satisfactory treatment response in this group of patients expressed as an increased Overall Survival was noted.

  19. Risk of invasive breast cancer and ductal carcinoma in situ in women with atypical papillary lesions of the breast.

    Science.gov (United States)

    Cuneo, Kyle C; Dash, Rajesh C; Wilke, Lee G; Horton, Janet K; Koontz, Bridget F

    2012-09-01

    Benign papillary lesions of the breast include papilloma and papillomatosis. A retrospective analysis of patients with a papillary breast lesion diagnosed between October 1992 and December 2009 was performed. Patients were excluded if they had a previous or concurrent diagnosis of invasive or in situ cancer or less than 6 months of follow-up. The Kaplan-Meier method was used to determine the risk of developing subsequent malignancy. The log rank test was used to compare groups of patients. Median follow-up for the 167 patients included in the study was 4.6 years. Fifty-one patients had a papillary lesion with atypia and 116 patients had a papillary lesion without atypia. Patients with a papillary lesion with atypia were more likely to develop invasive or in situ breast cancer with a 5 year risk of 13.0% versus 4.6% in patients with no atypia (p = 0.03). © 2012 Wiley Periodicals, Inc.

  20. DETERMINANTES DE LOS FLUJOS DE EXPORTACIONES PARA LAS EMPRESAS EN COSTA RICA: UN ANÁLISIS DE SUPERVIVENCIA

    Directory of Open Access Journals (Sweden)

    Carlos E. Umaña

    2013-03-01

    Full Text Available Con base en cifras sobre exportaciones de Costa Rica para el período 2000-2008, desglosados a nivel de empresa, productos exportados y mercados de destino, el presente estudio busca identificar los factores relacionados con las decisiones de una empresa, que aumentan o disminuyen la probabilidad de abandonar el mercado externo. Este trabajo cuantifica el impacto de una serie de factores, utilizando una tasa de supervivencia que pondera los años de actividad exportadora por la antigüedad de las transacciones y el número de veces que cada empresa salió del mercado externo. Se presenta un análisis de supervivencia de las empresas exportadoras que operan en Costa Rica, con base en un modelo de riesgos proporcionales de Cox, y el estimador de Kaplan-Meier. El estudio confirma la importancia de la diversificación de las exportaciones para la supervivencia de la empresa exportadora.

  1. Investigations of Near-Field Thermal-Hydrologic-Mechanical-Chemical Models for Radioactive Waste Disposal in Clay/Shale Rock

    International Nuclear Information System (INIS)

    Liu, H.H.; Li, L.; Zheng, L.; Houseworth, J.E.; Rutqvist, J.

    2011-01-01

    Clay/shale has been considered as potential host rock for geological disposal of high-level radioactive waste throughout the world, because of its low permeability, low diffusion coefficient, high retention capacity for radionuclides, and capability to self-seal fractures. For example, Callovo-Oxfordian argillites at the Bure site, France (Fouche et al., 2004), Toarcian argillites at the Tournemire site, France (Patriarche et al., 2004), Opalinus Clay at the Mont Terri site, Switzerland (Meier et al., 2000), and Boom clay at the Mol site, Belgium (Barnichon and Volckaert, 2003) have all been under intensive scientific investigation (at both field and laboratory scales) for understanding a variety of rock properties and their relationships to flow and transport processes associated with geological disposal of radioactive waste. Figure 1-1 presents the distribution of clay/shale formations within the USA.

  2. The BCR-ABLT315I mutation compromises survival in chronic phase chronic myelogenous leukemia patients resistant to tyrosine kinase inhibitors, in a matched pair analysis

    DEFF Research Database (Denmark)

    Nicolini, Franck E; Ibrahim, Amr R; Soverini, Simona

    2013-01-01

    The BCR-ABL T315I mutation confers resistance to currently licensed tyrosine kinase inhibitors in chronic myelogenous leukemia. However, the impact of this mutation on survival in early stages of disease, in chronic phase, has never been detailed. Using matched pair analysis, a cohort of 64...... patients with chronic phase chronic myelogenous leukemia harboring a T315I mutation and resistant to imatinib mesylate was compared to a similar cohort of 53 chronic phase patients resistant to imatinib, but with no detectable T315I mutation, in the pre-ponatinib era. These patients were matched according...... to age at diagnosis, interval between disease diagnosis and start of imatinib treatment, and duration of imatinib therapy. Kaplan-Meier survival analyses demonstrated the significant negative impact of the presence of the T315I mutation on overall survival (since imatinib-resistance: 48.4 months for T315...

  3. Estimation of Unemployment Duration in Botoşani County Using Survival Analysis

    Directory of Open Access Journals (Sweden)

    Darabă Gabriel

    2017-01-01

    Full Text Available In this paper we aim at estimating the unemployment duration in Botosani County in order tostudy the impact of individual characteristics (gender, age, place of residence, unemploymentbenefit, etc. on the length of unemployment spells. We use Cox regression model to measure theeffects of gender, age, residential environment, etc. on the hazard rate of leaving unemploymentandKaplan-Meier estimator to compare survival probabilities among different categories ofunemployed persons. The study is carried out on a sample of 200 unemployment spellsregisteredwith the Employment Agency of Botoşani County from January 2012 to December 2015. Theresults reveal that place of residence, unemployment benefit and unemployed category have asignificant impact on unemployment spells.

  4. A population-based, incidence cohort study of mid-back pain after traffic collisions

    DEFF Research Database (Denmark)

    Johansson, M S; Boyle, E; Hartvigsen, Jan

    2015-01-01

    BACKGROUND: Traffic collisions often result in a wide range of symptoms included in the umbrella term whiplash-associated disorders. Mid-back pain (MBP) is one of these symptoms. The incidence and prognosis of different traffic injuries and their related conditions (e.g. neck pain, low back pain...... data from a population-based inception cohort of all traffic injuries occurring in Saskatchewan, Canada, during a 2-year period were used. Annual overall and age-sex-specific incidence rates were calculated, the course of recovery was described using the Kaplan-Meier technique, and associations between...... recovery was 101 days (95% CI: 99-104) and about 23% were still not recovered after 1 year. Participant's expectation for recovery, general health, extent of severely affecting comorbidities and having experienced a previous traffic injury were some of the prognostic factors identified. CONCLUSIONS...

  5. RECONCILING AGN-STAR FORMATION, THE SOLTAN ARGUMENT, AND MEIER’S PARADOX

    Energy Technology Data Exchange (ETDEWEB)

    Garofalo, David [Department of Physics, Kennesaw State University, Marietta GA, 30060 (United States); Kim, Matthew I.; Christian, Damian J. [Department of Physics and Astronomy, California State University, Northridge CA, 91330 (United States); Hollingworth, Emily [Department of Aerospace Engineering, Georgia Institute of Technology, Atlanta GA, 30332 (United States); Lowery, Aaron [Department of Geosciences, Mississippi State University, MS, 39762 (United States); Harmon, Matthew [Department of Physics, Southern Polytechnic State University, Marietta GA, 30060 (United States)

    2016-02-01

    We provide a theoretical context for understanding the recent work of Kalfountzou et al. showing that star formation is enhanced at lower optical luminosity in radio-loud quasars. Our proposal for coupling the assumption of collimated FRII quasar-jet-induced star formation with lower accretion optical luminosity also explains the observed jet power peak in active galaxies at higher redshift compared to the peak in accretion power, doing so in a way that predicts the existence of a family of radio-quiet active galactic nuclei associated with rapidly spinning supermassive black holes at low redshift, as mounting observations suggest. The relevance of this work lies in its promise to explain the observed cosmological evolution of accretion power, jet power, and star formation in a way that is both compatible with the Soltan argument and resolves the so-called “Meier Paradox.”.

  6. CASAS: Cancer Survival Analysis Suite, a web based application.

    Science.gov (United States)

    Rupji, Manali; Zhang, Xinyan; Kowalski, Jeanne

    2017-01-01

    We present CASAS, a shiny R based tool for interactive survival analysis and visualization of results. The tool provides a web-based one stop shop to perform the following types of survival analysis:  quantile, landmark and competing risks, in addition to standard survival analysis.  The interface makes it easy to perform such survival analyses and obtain results using the interactive Kaplan-Meier and cumulative incidence plots.  Univariate analysis can be performed on one or several user specified variable(s) simultaneously, the results of which are displayed in a single table that includes log rank p-values and hazard ratios along with their significance. For several quantile survival analyses from multiple cancer types, a single summary grid is constructed. The CASAS package has been implemented in R and is available via http://shinygispa.winship.emory.edu/CASAS/. The developmental repository is available at https://github.com/manalirupji/CASAS/.

  7. Energy payback and CO2 gas emissions from fusion and solar photovoltaic electric power plants. Final report to Department of Energy, Office of Fusion Energy Sciences

    International Nuclear Information System (INIS)

    Kulcinski, G.L.

    2002-01-01

    A cradle-to-grave net energy and greenhouse gas emissions analysis of a modern photovoltaic facility that produces electricity has been performed and compared to a similar analysis on fusion. A summary of the work has been included in a Ph.D. thesis titled ''Life-cycle assessment of electricity generation systems and applications for climate change policy analysis'' by Paul J. Meier, and a synopsis of the work was presented at the 15th Topical meeting on Fusion Energy held in Washington, DC in November 2002. In addition, a technical note on the effect of the introduction of fusion energy on the greenhouse gas emissions in the United States was submitted to the Office of Fusion Energy Sciences (OFES)

  8. Constraints and autonomy for creativity in extracurricular gamejams and curricular assessment

    Directory of Open Access Journals (Sweden)

    Simon Grey

    2018-05-01

    Full Text Available The engagement observed by the players of the games that they play is a desirable quality that has not gone unnoticed in the field of education, leading to concepts such as gamification of education, game-based learning and serious games for training. Game designer Sid Meier is often cited as defining games as being ‘a series of interesting decisions’. The concept of choice implies an autonomous selection from a constrained set of options. This article reflects on the impact of autonomy and constraints, and extrinsic and intrinsic motivators on students’ software development work during both curricular and extracurricular activities. Finally, a model for the design of games for game-based learning is proposed in terms of autonomy and constraints with respect to learning outcomes.

  9. Registry of Hospital das Clínicas of the University of São Paulo Medical School: first official solid organ and tissue transplantation report - 2008

    Directory of Open Access Journals (Sweden)

    Estela Azeka

    2009-02-01

    Full Text Available OBJECTIVE: The aim of this study was to report a single center experience of organ and tissue transplantation INTRODUCTION: This is the first report of organ and tissue transplantation at the Hospital das Clínicas of the University of Sao Paulo Medical School. METHODS: We collected data from each type of organ transplantation from 2002 to 2007. The data collected were patient characteristics and actuarial survival Kaplan-Meier curves at 30 days, one year, and five years RESULTS: There were a total of 3,321 transplants at our institution and the 5-year survival curve ranged from 53% to 88%. CONCLUSION: This report shows that solid organ and tissue transplants are feasible within the institution and allow us to expect that the quality of transplantation will improve in the future.

  10. Approaches and perioperative management in periacetabular osteotomy surgery

    DEFF Research Database (Denmark)

    Søballe, Kjeld; Troelsen, Anders

    2012-01-01

    .9 to 8.1 years) of 209 PAOs performed using this approach have shown Kaplan-Meier survivorship rates of 94.7% at 5 years and 88.6% at 8.1 years, with conversion to total hip arthroplasty as the end point. Perioperative management includes a patient education program, optimized pain treatment strategies...... (local infiltration analgesia), and a progressive mobilization and exercise program. The transsartorial approach coupled with a specific perioperative management program has proved successful for PAO surgery.......In the early days of periacetabular osteotomy (PAO), surgical approaches were characterized by extensive soft-tissue dissection. The Smith-Petersen approach (and iliofemoral modifications) and the ilioinguinal approach have traditionally been used for PAO. The optimal surgical approach for PAO...

  11. Digital outlines and topography of the glaciers of the American West

    Science.gov (United States)

    Fountain, Andrew G.; Hoffman, Matthew; Jackson, Keith; Basagic, Hassan; Nylen, Thomas; Percy, David

    2007-01-01

    Alpine glaciers have generally receded during the past century (post-“Little Ice Age”) because of climate warming (Oerlemans and others, 1998; Mann and others, 1999; Dyurgerov and Meier, 2000; Grove, 2001). This general retreat has accelerated since the mid 1970s, when a shift in atmospheric circulation occurred (McCabe and Fountain, 1995; Dyurgerov and Meier, 2000). The loss in glacier cover has had several profound effects. First, the shrinkage of glaciers results in a net increase in stream flow, typically in late summer when water supplies are at the lowest levels (Fountain and Tangborn, 1985). This additional water is important to ecosystems (Hall and Fagre, 2003) and to human water needs (Tangborn, 1980). However, if shrinkage continues, the net contribution to stream flow will diminish, and the effect upon these benefactors will be adverse. Glacier shrinkage is also a significant factor in current sea level rise (Meier, 1984; Dyurgerov and Meier, 2000). Second, many of the glaciers in the West Coast States are located on stratovolcanoes, and continued recession will leave oversteepened river valleys. These valleys, once buttressed by ice are now subject to failure, creating conditions for lahars (Walder and Driedger, 1994; O’Connor and others, 2001). Finally, reduction or loss of glaciers reduce or eliminate glacial activity as an important geomorphic process on landscape evolution and alters erosion rates in high alpine areas (Hallet and others, 1996). Because of the importance of glaciers to studies of climate change, hazards, and landscape modification, glacier inventories have been published for Alaska (Manley, in press), China (http://wdcdgg.westgis.ac.cn/DATABASE/Glacier/Glacier.asp), Nepal (Mool and others, 2001), Switzerland (Paul and others, 2002), and the Tyrolian Alps of Austria (Paul, 2002), among other locales. To provide the necessary data for assessing the magnitude and rate of glacier change in the American West, exclusive of Alaska

  12. Exome mutation burden predicts clinical outcome in ovarian cancer carrying mutated BRCA1 and BRCA2 genes

    DEFF Research Database (Denmark)

    Birkbak, Nicolai Juul; Kochupurakkal, Bose; Gonzalez-Izarzugaza, Jose Maria

    2013-01-01

    drugs and relative to non-mutation carriers present a favorable clinical outcome following therapy. Genome sequencing studies have shown a high number of mutations in the tumor genome in patients carrying BRCA1 or BRCA2 mutations (mBRCA). The present study used exome-sequencing and SNP 6 array data...... between low Nmut and shorter PFS and OS in mBRCA HGSOC by Cox regression and Kaplan-Meier analyses. The association was also significant when the analysis was limited to germline BRCA1 or BRCA2 mutated patients with SNP array-determined loss of heterozygosity of the BRCA1 or BRCA2 locus in the tumors....... In the mBRCA HGSOC tumors, Nmut was correlated with the genome fraction with loss of heterozygosity and with number of telomeric allelic imbalance, genomic measures evaluating chromosomal instability. However, no significant association between Nmut and PFS or OS was found in HGSOC carrying wild-type BRCA1...

  13. Geographical variations in the use of cancer treatments are associated with survival of lung cancer patients

    DEFF Research Database (Denmark)

    Møller, Henrik; Coupland, Victoria H; Tataru, Daniela

    2018-01-01

    INTRODUCTION: Lung cancer outcomes in England are inferior to comparable countries. Patient or disease characteristics, healthcare-seeking behaviour, diagnostic pathways, and oncology service provision may contribute. We aimed to quantify associations between geographic variations in treatment...... and survival of patients in England. METHODS: We retrieved detailed cancer registration data to analyse the variation in survival of 176,225 lung cancer patients, diagnosed 2010-2014. We used Kaplan-Meier analysis and Cox proportional hazards regression to investigate survival in the two-year period following...... diagnosis. RESULTS: Survival improved over the period studied. The use of active treatment varied between geographical areas, with inter-quintile ranges of 9%-17% for surgical resection, 4%-13% for radical radiotherapy, and 22%-35% for chemotherapy. At 2 years, there were 188 potentially avoidable deaths...

  14. Mechanisms and pathways of growth failure in primordial dwarfism.

    Science.gov (United States)

    Klingseisen, Anna; Jackson, Andrew P

    2011-10-01

    The greatest difference between species is size; however, the developmental mechanisms determining organism growth remain poorly understood. Primordial dwarfism is a group of human single-gene disorders with extreme global growth failure (which includes Seckel syndrome, microcephalic osteodysplastic primordial dwarfism I [MOPD] types I and II, and Meier-Gorlin syndrome). Ten genes have now been identified for microcephalic primordial dwarfism, encoding proteins involved in fundamental cellular processes including genome replication (ORC1 [origin recognition complex 1], ORC4, ORC6, CDT1, and CDC6), DNA damage response (ATR [ataxia-telangiectasia and Rad3-related]), mRNA splicing (U4atac), and centrosome function (CEP152, PCNT, and CPAP). Here, we review the cellular and developmental mechanisms underlying the pathogenesis of these conditions and address whether further study of these genes could provide novel insight into the physiological regulation of organism growth.

  15. Simpson's atherectomy in peripheral arteries

    International Nuclear Information System (INIS)

    Kueffer, G.; Spengel, F.A.; Hansen, R.; Pfluger, T.; Nathrath, W.; Muenchen Univ.; Muenchen Univ.

    1990-01-01

    Over a seventeen-month period, a percutaneous transluminal removal of stenosing plaque material from leg and pelvic arteries was performed successfully and without complication in 43 patients. A complete atherectomy in the femoropopliteal vessels succeeded in 99% of cases. In the pelvic region, the primary results were much lower (58%). After six months, the angiographically checked restenosis rate was 17% for femoropopliteal vessels and 11% for iliac arteries, and the corresponding Kaplan-Meier cumulative patency rates were 73.8 and 78.7% respectively. Simpson's atherectomy is the only method of its kind that is therapeutically effective and diagnostically significant, since the removed plaque can be used for further tests. (orig.) [de

  16. Do clinical data and human papilloma virus genotype influence spontaneous regression in grade I cervical intraepithelial neoplasia?

    Science.gov (United States)

    Cortés-Alaguero, Caterina; González-Mirasol, Esteban; Morales-Roselló, José; Poblet-Martinez, Enrique

    2017-03-15

    To determine whether medical history, clinical examination and human papilloma virus (HPV) genotype influence spontaneous regression in cervical intraepithelial neoplasia grade I (CIN-I). We retrospectively evaluated 232 women who were histologically diagnosed as have CIN-I by means of Kaplan-Meier curves, the pattern of spontaneous regression according to the medical history, clinical examination, and HPV genotype. Spontaneous regression occurred in most patients and was influenced by the presence of multiple HPV genotypes but not by the HPV genotype itself. In addition, regression frequency was diminished when more than 50% of the cervix surface was affected or when an abnormal cytology was present at the beginning of follow-up. The frequency of regression in CIN-I is high, making long-term follow-up and conservative management advisable. Data from clinical examination and HPV genotyping might help to anticipate which lesions will regress.

  17. Direct visual internal urethrotomy: Is it a durable treatment option?

    Science.gov (United States)

    Pal, Dilip Kumar; Kumar, Sanjay; Ghosh, Bastab

    2017-01-01

    To evaluate the long-term success rate of direct vision internal urethrotomy as a treatment for anterior urethral strictures. We retrospectively analyzed the results for patients who underwent internal urethrotomy from January 2009 to January 2014 for anterior urethral strictures. Patients were followed till January 2016. Patients with complicated urethral strictures with a history of previous urethroplasty, hypospadias repair, or previous radiation were excluded from the study, as anticipated low success rate of direct visual internal urethrotomy (DVIU) in these patients. The Kaplan-Meier method was used to analyze stricture-free probability after the first, second, and third urethrotomy. A total of 186 patients were included in this study. Stricture-free rates after first, second, and third urethrotomy were 29.66%, 22.64%, and 13.33%, respectively. Although DVIU may be a management option for anterior urethral stricture disease, it seems that long-term results are disappointing.

  18. Implementing an online tool for genome-wide validation of survival-associated biomarkers in ovarian-cancer using microarray data from 1287 patients

    DEFF Research Database (Denmark)

    Győrffy, Balázs; Lánczky, András; Szállási, Zoltán

    2012-01-01

    was set up using gene expression data and survival information of 1287 ovarian cancer patients downloaded from Gene Expression Omnibus and The Cancer Genome Atlas (Affymetrix HG-U133A, HG-U133A 2.0, and HG-U133 Plus 2.0 microarrays). After quality control and normalization, only probes present on all......). A Kaplan–Meier survival plot was generated and significance was computed. The tool can be accessed online at www.kmplot.com/ovar. We used this integrative data analysis tool to validate the prognostic power of 37 biomarkers identified in the literature. Of these, CA125 (MUC16; P=3.7x10–5, hazard ratio (HR...... biomarker validation platform that mines all available microarray data to assess the prognostic power of 22 277 genes in 1287 ovarian cancer patients. We specifically used this tool to evaluate the effect of 37 previously published biomarkers on ovarian cancer prognosis....

  19. Moderate precision of prognostic scoring systems in a consecutive, prospective cohort of 544 patients with metastatic spinal cord compression

    DEFF Research Database (Denmark)

    Morgen, Søren Schmidt; Nielsen, Dennis Hallager; Larsen, Claus Falck

    2014-01-01

    and compared to the observed survival. We assessed how precise the scoring systems predicted survival with McNemar's test. The prognostic value was illustrated with Kaplan-Meier curves, and the individual prognostic components were analyzed with Cox regression analysis. RESULTS: The mean age was 65 years...... (range 20-95), and 57 % of the patients were men. The majority of tumors were lung (23 %), prostate (21 %), and breast tumors (18 %). The overall precision of predicted survival was 58.7 % for the Tokuhashi Revised score and 52.9 % for the Tomita score. The observed survival in each of the scoring groups...... was most precise in predicting survival. However, due to the relatively low precision, we suggest that a modification of both scoring systems is necessary....

  20. Tuberculosis-related mortality in people living with HIV in Europe and Latin America

    DEFF Research Database (Denmark)

    Podlekareva, Daria; Efsen, Anne Marie Werlinrud; Schultze, Anna

    2016-01-01

    baseline, whichever occurred first. Risk factors for all-cause and tuberculosis-related deaths were assessed using Kaplan-Meier estimates and Cox models. FINDINGS: Of 1406 patients (834 in eastern Europe, 317 in western Europe, and 255 in Latin America), 264 (19%) died within 12 months. 188 (71...... a multiregional (eastern Europe, western Europe, and Latin America) prospective cohort study: the TB:HIV study. METHODS: Consecutive HIV-positive patients aged 16 years or older with a diagnosis of tuberculosis between Jan 1, 2011, and Dec 31, 2013, were enrolled from 62 HIV and tuberculosis clinics in 19...... countries in eastern Europe, western Europe, and Latin America. The primary endpoint was death within 12 months after starting tuberculosis treatment; all deaths were classified according to whether or not they were tuberculosis related. Follow-up was either until death, the final visit, or 12 months after...

  1. Hypofractionated radiation therapy for invasive thyroid carcinoma in dogs: a retrospective analysis of survival

    International Nuclear Information System (INIS)

    Brearley, M.J.; Hayes, A.M.; Murphy, S.

    1999-01-01

    Thirteen dogs with invasive thyroid carcinoma (WHO classification T2b or T3b) seen between January 1991 and October 1997 were treated by external beam Irradiation. Four once-weekly fractions of 9 gray of 4 MeV X-rays were administered. Four of the dogs died of progression of the primary disease and four from metastatic spread. Of the remaining dogs, three died of unrelated problems, although two were still alive at the time of the censor. Kaplan-Meier analysis of the survival time from first dose to death from either primary or metastatic disease gave a median survival time of 96 weeks (mean 85 weeks, range six to 247 weeks). Radiographic evidence of pulmonary metastatic disease at presentation had no prognostic value whereas crude growth rate was a highly significant factor. The present series Indicates that radiation therapy should be considered an important modality for the control of invasive thyroid carcinoma in the dog

  2. Fractionated afterloading therapy in inoperable malignant tumours of the brain

    International Nuclear Information System (INIS)

    Sparenberg, A.

    1987-01-01

    With the advent of the method of afterloading the range of uses for fractionated interstitial brady-therapy could be broadened to include malignant cerebral tumours. The mean survival time of 33 female patients was calculated to be 8.3 months for the entire group and 11.3 months for cases not otherwise pretreated. Even though the age, tumour volume, target dose and Karnofsky index obviously tended to influence the survival time, such relationships could not be confirmed statistically. Using the method by Kaplan-Meier it was determined that 65% of the total study group were likely to survive beyond six months and 32% to survive for one year. A separate analysis of patients receiving no previous treatment showed these chances to be 75% and 44%, respectively. The advantages of this therapy are discussed on a comparative basis. (VHE) [de

  3. Whole abdominal irradiation in ovarian carcinoma

    International Nuclear Information System (INIS)

    Romestaing, P.; Gallo, C.; Gerard, J.F.; Ardiet, J.M.; Carrie, C.

    1989-01-01

    The prognosis of ovarian cancers, which are frequently diagnosed at a late stage, can probably be improved by whole abdominal radiotherapy. 45 patients in Lyon and 8 patients in Montelimar (7 stage I or C, 10 stage II and 36 stage III) were treated by whole abdominal radiotherapy, generally after 6 courses of chemotherapy (46 cases). The overall 5-year survival of this group of patients was 48% (Kaplan-Meier method). When the patients treated by complete resection at 1st look surgery (19 cases) are compared with those in whom 1st look surgery was incomplete (34 cases), the actuarial survival was 83% versus 27%. This study demonstrates that whole abdominal radiotherapy is feasible without any serious long-term complications after two operations and 6 courses of chemotherapy. These encouraging results need to be confirmed by randomized prospective studies [fr

  4. Carotid flow velocity/diameter ratio is a predictor of cardiovascular events in hypertensive patients

    DEFF Research Database (Denmark)

    Bellinazzi, Vera R; Cipolli, José A; Pimenta, Marcio V

    2015-01-01

    AD) greater than the median value presented the worst clinical outcome compared to those with isolated sFV less than the median value or sAD greater than the median value, suggesting an additive effect of these two variables. Further, Kaplan-Meier analysis demonstrated worse outcome for individuals with s...... intima-media thickness and clinically defined high cardiovascular risk did not. Furthermore, area under the receiver-operating characteristic curve for sFV/sAD was higher than that for Framingham risk score (0.77 versus 0.64; P = 0.045), whereas adding sFV/sAD to the Framingham risk factors resulted...

  5. Strategy for personalized treatment of human papillomavirus-positive oropharyngeal squamous cell carcinoma

    International Nuclear Information System (INIS)

    Mizumachi, Takatsugu; Hatakeyama, Hiromitsu; Kano, Satoshi; Sakashita, Tomohiro; Suzuki, Seigo; Homma, Akihiro; Oridate, Nobuhiko; Fukuda, Satoshi

    2011-01-01

    We performed a retrospective analysis of the association between tumor HPV status and the demographic and clinicopathological parameters of 83 patients with oropharyngeal squamous cell carcinoma at Hokkaido University Hospital, Japan, between 1998 and 2010. The parameters included age, gender, tumor subsite, Tumor-Node-Metastasis (TNM) stage, and overall survival. HPV status was established by multiplex polymerase chain reaction analysis. Of the 83 oropharyngeal cancers, 22 were positive for HPV-16, two for HPV-18, and one for HPV-35 and HPV-58. Kaplan-Meier survival analysis showed improved overall survival rates in patients with HPV-positive tumors (p=0.0024) compared with HPV-negative tumors. Of the 51 patients who received chemoradiotherapy, HPV-positive patients experienced better overall survival than HPV-negative patients (p=0.0024). HPV status is a significantly favorable prognostic factor in oropharyngeal cancer in Japan. (author)

  6. Mortality and secular trend in the incidence of bipolar disorder

    DEFF Research Database (Denmark)

    Medici, Clara Reece; Videbech, Poul; Gustafsson, Lea Nørgreen

    2015-01-01

    BACKGROUND: The world-wide interest in bipolar disorder is illustrated by an exponential increase in publications on the disorder registered in Pubmed since 1990. This inspired an investigation of the epidemiology of bipolar disorder. METHODS: This was a register-based cohort study. All first......-ever diagnoses of bipolar disorder (International Classification of Diseases-10: F31) were identified in the nationwide Danish Psychiatric Central Research Register between 1995 and 2012. Causes of death were obtained from The Danish Register of Causes of Death. Age- and gender standardized incidence rates......, standardized mortality ratio (SMR) and Kaplan-Meier survival estimates were calculated. RESULTS: We identified 15,334 incident cases of bipolar disorder. The incidence rate increased from 18.5/100,000 person-years (PY) in 1995 to 28.4/100,000 PY in 2012. The mean age at time of diagnosis decreased...

  7. IMP3 expression in human ovarian cancer is associated with improved survival

    DEFF Research Database (Denmark)

    Noske, Aurelia; Faggad, Areeg; Wirtz, Ralph

    2009-01-01

    The insulin-like growth factor-II mRNA-binding protein IMP3 plays an important role in embryogenesis and recent reports suggest an involvement in tumorigenesis. Although IMP3 expression has been well studied in mouse and human fetal and adult gonads, its role in ovarian cancer is unknown. We...... investigated the expression of IMP3 at protein and mRNA levels in a cohort of primary ovarian carcinomas and in 11 ovarian cancer cell lines. Western blot analysis revealed an expression of IMP3 in all ovarian cancer cell lines and immunohistochemistry demonstrated a positive cytoplasmic staining in 32 of 68...... carcinomas (47%). In contrast, epithelium of borderline tumors, as well as, benign ovarian lesions and normal ovaries exhibited only weak or no IMP3 expression. In univariate Kaplan-Meier analysis, IMP3 protein expression was significantly associated with better overall survival (P=0.048). To confirm...

  8. Survival pathological prognosis factors in breast cancer

    International Nuclear Information System (INIS)

    Gonzalez-Longoria Boada, Lourdes B.

    2012-01-01

    A descriptive and longitudinal study of 273 women with breast cancer belonging to Granma province was carried out from 2003 to 2004, in order to analyze the survival of this female population, reason why the method of Kaplan Meier was used for the calculation of the mentioned variable and the Log Rank test was used for the comparison of curves. Patients with higher survival at 5 years were those who had tumors of 2 cm or less (87.5%), histological grade I (90.3%), nuclear grade I (88.3%), as well as the absence of vascular, lymphatic or lymph node invasion (with 80.6; 74.9 and 6.1% respectively). Also, tumor size, histological and nuclear grade, nodal status, as well as lymphatic and vascular invasion constituted prognosis factors, which favored the individualization of therapeutic behaviors

  9. Immunological effects of Sizofiran (SPG) combined with irradiation in patients with oral cancer

    International Nuclear Information System (INIS)

    Tominaga, Kazuhiro; Tominaga, Naohiro; Tokuhisa, Michio

    1995-01-01

    Effects of Sizofiran (SPG) combined with irradiation for primary oral squamous cell carcinoma were evaluated with regard to cell-mediated immunity. Twenty-four patients, who were managed with irradiation from 1989 to 1993, were divided into two groups, a SPG group and a control group. Thirteen patients received concomitant administration of SPG intramuscularly with irradiation as SPG group, and 11 patients were not administered any biological response modifiers as the control group. In the SPG group, depression of blastoid transformation of lymphocytes, IL-2 production and LAK activity due to irradiation were prevented, and recovery of blastoid transformation was promoted, while peripheral monocytes tended to increase. Upon comparison for survival (Kaplan-Meier method) between the SPG group and control group, the survival rate of the SPG group tended to be superior to that of the control group. However, no significant difference was observed between them. (author)

  10. Association between age at antiretroviral therapy initiation and 24-month immune response in West-African HIV-infected children

    DEFF Research Database (Denmark)

    Desmonde, Sophie; Dicko, Fatoumata; Koueta, Fla

    2014-01-01

    measurements, including one at ART initiation (baseline) were included. CD4 cell gain on ART was estimated using a multivariable linear mixed model adjusted for baseline variables: age, CD4 cell count, sex, first-line ART regimen. Kaplan-Meier survival curves and a Cox proportional hazards regression model...... compared immune recovery for age within 24 months post-ART. RESULTS: Of the 4808 children initiated on ART, 3014 were enrolled at a median age of 5.6 years; 61.2% were immunodeficient. After 12 months, children at least 4 years at baseline had significantly lower CD4 cell gains compared with children less...... these children, 75% reached immune recovery: 12-month rates were significantly highest in all those aged 2-5 years at ART initiation compared with those less than 2 years. Beyond 12 months on ART, immune recovery was significantly lower in children initiated more than 5 years (adjusted hazard ratio: 0.69, 95...

  11. Measurements and Monte Carlo calculations of neutron production cross-sections at 180{sup o} for the 140 MeV proton incident reactions on carbon, iron, and gold

    Energy Technology Data Exchange (ETDEWEB)

    Iwamoto, Yosuke, E-mail: iwamoto.yosuke@jaea.go.j [Japan Atomic Energy Agency, 2-4, Shirakatashirane, Tokai-mura, Naka-gun, Ibaraki 319-1195 (Japan); Satoh, Daiki [Japan Atomic Energy Agency, 2-4, Shirakatashirane, Tokai-mura, Naka-gun, Ibaraki 319-1195 (Japan); Hagiwara, Masayuki [KEK (Japan); Yashima, Hiroshi [Kyoto University (Japan); Nakane, Yoshihiro [Japan Atomic Energy Agency, 2-4, Shirakatashirane, Tokai-mura, Naka-gun, Ibaraki 319-1195 (Japan); Tamii, Atsushi [Research Center for Nuclear Physics, Osaka University (Japan); Iwase, Hiroshi [KEK (Japan); Endo, Akira; Nakashima, Hiroshi; Sakamoto, Yukio [Japan Atomic Energy Agency, 2-4, Shirakatashirane, Tokai-mura, Naka-gun, Ibaraki 319-1195 (Japan); Hatanaka, Kichiji [Research Center for Nuclear Physics, Osaka University (Japan); Niita, Koji [Research Organization for Information Science and Technology (Japan)

    2010-08-21

    The neutron production cross-sections of carbon, iron, and gold targets with 140 MeV protons at 180{sup o} were measured at the RCNP cyclotron facility. The time-of-flight technique was used to obtain the neutron energy spectra in the energy range above 1 MeV. The carbon and iron target results were compared with the experimental data from 113 MeV (p,xn) reactions at 150{sup o} reported by Meier et al. Our data agreed well with them in spite of different incident energies and angles. Calculations were then performed using different intra-nuclear cascade models (Bertini, ISOBAR, and JQMD) implemented with PHITS code. The results calculated using the ISOBAR and JQMD models roughly agreed with the experimental iron and gold target data, but the Bertini could not reproduce the high-energy neutrons above 10 MeV.

  12. Measurements and Monte Carlo calculations of neutron production cross-sections at 180o for the 140 MeV proton incident reactions on carbon, iron, and gold

    International Nuclear Information System (INIS)

    Iwamoto, Yosuke; Satoh, Daiki; Hagiwara, Masayuki; Yashima, Hiroshi; Nakane, Yoshihiro; Tamii, Atsushi; Iwase, Hiroshi; Endo, Akira; Nakashima, Hiroshi; Sakamoto, Yukio; Hatanaka, Kichiji; Niita, Koji

    2010-01-01

    The neutron production cross-sections of carbon, iron, and gold targets with 140 MeV protons at 180 o were measured at the RCNP cyclotron facility. The time-of-flight technique was used to obtain the neutron energy spectra in the energy range above 1 MeV. The carbon and iron target results were compared with the experimental data from 113 MeV (p,xn) reactions at 150 o reported by Meier et al. Our data agreed well with them in spite of different incident energies and angles. Calculations were then performed using different intra-nuclear cascade models (Bertini, ISOBAR, and JQMD) implemented with PHITS code. The results calculated using the ISOBAR and JQMD models roughly agreed with the experimental iron and gold target data, but the Bertini could not reproduce the high-energy neutrons above 10 MeV.

  13. Hypoalbuminemia is a strong predictor of 30-day all-cause mortality in acutely admitted medical patients

    DEFF Research Database (Denmark)

    Jellinge, Marlene Ersgaard; Henriksen, Daniel Pilsgaard; Hallas, Peter

    2014-01-01

    (precision of predictions) for hypoalbuminemia was determined. RESULTS: We included 5,894 patients and albumin was available in 5,451 (92.5%). A total of 332 (5.6%) patients died within 30 days of admission. Median plasma albumin was 40 g/L (IQR 37-43). Crude 30-day mortality in patients with low albumin......OBJECTIVE: Emergency patients with hypoalbuminemia are known to have increased mortality. No previous studies have, however, assessed the predictive value of low albumin on mortality in unselected acutely admitted medical patients. We aimed at assessing the predictive power of hypoalbuminemia on 30...... follow-up. Patients were divided into three groups according to their plasma albumin levels (0-34, 35-44 and ≥45 g/L) and mortality was identified for each group using Kaplan-Meier survival plot. Discriminatory power (ability to discriminate patients at increased risk of mortality) and calibration...

  14. Combined effect of angioinfarction with immunotherapy in patients with stage IV renal cell carcinoma

    International Nuclear Information System (INIS)

    Oh, Joo Hyeong; Yoon, Yup; Jeong, Yu Mee; Ko, Young Tae; Chang, Sung Goo

    1994-01-01

    To assess the combined effectiveness of angioinfarction and immunotherapy for improving survival in patients with stage IV renal cell carcinoma. During the past 3 years, 13 patients of stage IV renal cell carcinoma were treated with angioinfarction and immunotherapy. Angioinfarction was performed on these 13 patients using absolute ethanol and occlusive balloon catheter. After angioinfarction, Interferon alpha was used for immunotherapy. For our analysis, 12 control patients of stage IV renal cell carcinoma without treatment were included in the study. Survival has been calculated according to the Kaplan and Meier method. The 1 year survival rate and median survival time in patients treated with angioinfarction and immunotherapy, were 46% and 13 months and in patients without treatment, 16% and 4 months, respectively. The combined treatment of angioinfarction and immunotherapy is of considerable value for improving survival in patients with stage IV renal cell carcinoma

  15. Prognostic value of body mass index before treatment for laryngeal squamous cell carcinoma

    International Nuclear Information System (INIS)

    Li, Zhao-Qu; Zou, Lan; Liu, Tian-Run; Yang, An-Kui

    2015-01-01

    Patients with head and neck cancer often suffer from malnutrition. This study aims to investigate the influence of body mass index (BMI) on the prognosis of laryngeal squamous cell carcinoma (LSCC). A total of 473 patients with LSCC initially treated at Sun Yat-sen University Cancer Center between January 2005 and July 2009 were retrospectively reviewed. Survival analysis was performed by the Kaplan-Meier method and Cox regression model. Low BMI before treatment was significantly associated with poor overall survival in patients with LSCC (P<0.001). BMI was an independent prognostic factor for patients with LSCC. Leanness before treatment was associated with poor prognosis in patients with LSCC. Good nutritional status is favorable to improve survival in patients with LSCC

  16. Breast conserving treatment of breast carcinoma T2 ({<=} 4 cm) and T3 by neoadjuvant chemotherapy, quadrantectomy, high dose rate brachytherapy as a boost, external beam radiotherapy and adjuvant chemotherapy: local control and overall survival analysis; Tratamento conservador do cancer de mama T2 ({<=} 4 cm) e T3 por quimioterapia neoadjuvante, quadrantectomia, braquiterapia com alta taxa de dose como reforco de dose, teleterapia complementar e quimioterapia adjuvante: analise de controle local e sobrevida global

    Energy Technology Data Exchange (ETDEWEB)

    Soares, Celia Regina; Miziara Filho, Miguel Abrao; Fogaroli, Ricardo Cesar; Baraldi, Helena Espindola; Pellizzon, Antonio Cassio Assis; Pelosi, Edilson Lopes [Instituto do Cancer Dr. Arnaldo Vieira de Carvalho (ICAVC), Sao Paulo, SP (Brazil). Servico de Radioterapia], e-mail: celiarsoares@terra.com.br; Fristachi, Carlos Elias [Instituto do Cancer Dr. Arnaldo Vieira de Carvalho (ICAVC), Sao Paulo, SP (Brazil). Servico de Onco-Ginecologia e Mastologia; Paes, Roberto Pinto [Instituto do Cancer Dr. Arnaldo Vieira de Carvalho (ICAVC), Sao Paulo, SP (Brazil)

    2008-12-15

    Objective: to assess the treatment of breast cancer T2 ({<=} 4 cm) and T3 through neoadjuvant chemotherapy, quadrantectomy and high dose rate brachytherapy as a boost, complementary radiotherapy and adjuvant chemotherapy, considering local control and overall survival. Material and method: this clinical prospective descriptive study was based on the evaluation of 88 patients ranging from 30 to 70 years old, with infiltrating ductal carcinoma, clinical stage IIb and IIIa, responsive to the neoadjuvant chemotherapy, treated from June/1995 to December/2006. Median follow-up was 58 months. Using clinical methods the tumor was evaluated before and after three or four cycles of chemotherapy based on anthracyclines. Overall survival and local control were assessed according to Kaplan-Meier methodology. Results: Local control and overall survival in five years were 90% and 73.5%, respectively. Conclusion: local control and overall survival were comparable to other forms of treatment. (author)

  17. The fractal dimension of architecture

    CERN Document Server

    Ostwald, Michael J

    2016-01-01

    Fractal analysis is a method for measuring, analysing and comparing the formal or geometric properties of complex objects. In this book it is used to investigate eighty-five buildings that have been designed by some of the twentieth-century’s most respected and celebrated architects. Including designs by Le Corbusier, Eileen Gray, Frank Lloyd Wright, Robert Venturi, Frank Gehry, Peter Eisenman, Richard Meier and Kazuyo Sejima amongst others, this book uses mathematics to analyse arguments and theories about some of the world’s most famous designs. Starting with 625 reconstructed architectural plans and elevations, and including more than 200 specially prepared views of famous buildings, this book presents the results of the largest mathematical study ever undertaken into architectural design and the largest single application of fractal analysis presented in any field. The data derived from this study is used to test three overarching hypotheses about social, stylistic and personal trends in design, along...

  18. Clinical outcome of 19 patients with nasopharyngeal cancer. A review of neo-adjuvant chemotherapy

    International Nuclear Information System (INIS)

    Sakamoto, Masayuki; Kitahara, Nobuo; Asanuma, Satoshi; Ichimura, Keiichi; Abe, Kazuya

    2001-01-01

    We clinically examined 19 cases of nasopharyngeal cancer in which primary care was administered in the Department of Otolaryngology, Tokyo Metropolitan Fuchu Hospital between September 1990 and August 1999. The subjects consisted of 11 males and 8 females. Histophathological study revealed 17 cases of WHO type III tumors (14 cases were poorly differentiated squamous cell carcinoma and 3 cases were lymph-epithelioma). The accumulated 5-year survival rate by the Kaplan-Meier method was 50% in T1, 75% in T2, 0% in T4, and 36% overall. Neo-adjuvant chemotherapy was administered in 15 cases and distant metastasis appeared in 3 cases (21%) after definitive radiotherapy. The biological characteristic of WHO type III tumors is a tendency towards early metastasis, and we speculated that this might be the cause of the lower level of effectiveness of the neo-adjuvant chemotherapy in these cases. At present, this therapy is not effective and further improvement is required. (author)

  19. Colorectal cancers detected through screening are associated with lower stages and improved survival

    DEFF Research Database (Denmark)

    Lindebjerg, Jan; Osler, Merete; Bisgaard, Claus Hedebo

    2014-01-01

    in the feasibility study cohort were reviewed with respect to the effect of screening participation on stages and survival. MATERIAL AND METHODS: All cases of CRC in a feasibility study cohort diagnosed from the beginning of the study until two years after the study ended were identified. Differences...... in the distribution of colon cancer stages and rectal cancer groups between the various screening categories were analysed through χ(2)-tests. Survival analysis with respect to screening groups was done by Kaplan-Meier and Cox-Mantel hazard ratios, and survival was corrected for lead time. RESULTS: Colon cancers...... detected through screening were diagnosed at significantly lower stages than among screening non-responders. There were relatively fewer locally advanced rectal cancers among patients diagnosed through positive FOBT than among non-responders. Survival among screening cancer patients was superior...

  20. Dental trauma. Combination injuries 1. The risk of pulp necrosis in permanent teeth with concussion injuries and concomitant crown fractures

    DEFF Research Database (Denmark)

    Lauridsen, Eva Fejerskov; Hermann, Nuno Vibe; Gerds, Thomas Alexander

    2012-01-01

    included 469 permanent incisors with concussion from 358 patients (226 male, 132 female). Among these, 292 had a concomitant crown fracture (70 with and 222 without pulp exposure). All teeth were examined and treated according to standardized protocol. Statistical analysis:  The risk of PN was analyzed...... by the Kaplan–Meier method and Cox regression. Risk factors included in the analysis: gender, age, stage of root development, type of crown fracture, and response to electric pulp test (EPT) at the initial examination. The level of significance was set at 5%. Results:  The risk of PN was low in teeth......The reported risk of pulp necrosis (PN) is low in teeth with concussion injuries. A concomitant crown fracture may affect the risk of PN. Aim:  To analyze the influence of a crown fracture (with and without pulp exposure) on the risk of PN in teeth with concussion injury. Material:  The study...

  1. Dental trauma. Combination injuries 3. The risk of pulp necrosis in permanent teeth with extrusion or lateral luxation and concomitant crown fractures without pulp exposure

    DEFF Research Database (Denmark)

    Lauridsen, Eva Fejerskov; Hermann, Nuno Vibe; Gerds, Thomas Alexander

    2012-01-01

    Aim: To analyze the influence of a crown fracture without pulp exposure on the risk of pulp necrosis (PN) in teeth with extrusion or lateral luxation. Material and methods: The study included 82 permanent incisors with extrusion from 78 patients (57 male, 21 female) and 179 permanent incisors...... with lateral luxation from 149 patients (87 male, 62 female). A total of 25 teeth with extrusion and 33 teeth with lateral luxation had suffered a concomitant crown fracture (infraction, enamel fracture or enamel-dentin-fracture). All the teeth were examined and treated according to a standardized protocol....... Statistics: The risk of PN was analyzed separately for teeth with immature and mature root development by the Kaplan–Meier method, the log-rank test and Cox regression (lateral luxation only). The level of significance was set at 5%. Risk factors included in the analysis were gender, age, crown fracture...

  2. The risk of healing complications in primary teeth with intrusive luxation

    DEFF Research Database (Denmark)

    Lauridsen, Eva; Blanche, Paul; Yousaf, Nadia

    2017-01-01

    BACKGROUND/AIMS: Intrusive luxation is a frequent injury in the primary dentition. Complications such as ankylosis or pulp necrosis and infection with periapical inflammation may affect the developing permanent tooth if not diagnosed and treated in time. The aim of this study was to report the risk...... of pulp necrosis (PN), pulp canal obliteration (PCO), infection-related resorption (IRR), ankylosis-related resorption (ARR) and premature tooth loss (PTL) in primary teeth following intrusive luxation, and to identify possible risk factors for PN and PTL. MATERIALS AND METHOD: A retrospective analysis...... of a cohort comprising 149 patients 194 intruded primary incisors. No treatment was performed. The follow-up programme included examination after 4 weeks, 8 weeks, 6 months, 1 year, and at 6 years of age. The minimum follow-up period was 1 year or until time of tooth loss. STATISTICS: The Kaplan Meier...

  3. Dental trauma. Combination injuries 2. The risk of pulp necrosis in permanent teeth with subluxation injuries and concomitant crown fractures

    DEFF Research Database (Denmark)

    Lauridsen, Eva Fejerskov; Hermann, Nuno Vibe; Gerds, Thomas Alexander

    2012-01-01

    on the risk of PN in permanent teeth with subluxation injury. Material and Methods:  The study included 404 permanent incisors with subluxation injury from 289 patients (188 male, 101 female). Of these teeth, 137 had also suffered a concomitant crown fracture. All the teeth were examined and treated according...... to a standardized protocol. Statistical Analysis:  The risk of PN was analysed separately for teeth with immature and mature root development by the Kaplan–Meier method, the log-rank test and Cox regression analysis. The level of significance was set at 5%. Risk factors included in the analysis were gender, patient......The reported risk of pulp necrosis (PN) is generally low in teeth with subluxation injuries. A concomitant crown fracture may increase the risk of PN in such teeth. Aim:  To analyse the influence of a concomitant trauma-related infraction, enamel-, enamel–dentin- or enamel–dentin–pulp fracture...

  4. Shock Wave Science and Technology Reference Library

    CERN Document Server

    2007-01-01

    Shock waves in multiphase flows refers to a rich variety of phenomena of interest to physicists, chemists, and fluid dynamicists, as well as mechanical, biomedical and aeronautical engineers. This volume treats shock and expansion waves in (bullet) complex, bubbly liquids (L van Wijngaarden, Y Tomita, V Kedrinskii) and (bullet) cryogenic liquids (M Murakami) and examines the relationship of shock waves with (bullet) phase transitions (A Guha, CF Delale, G Schnerr, MEH van Dongen) (bullet) induced phase transitions (GEA Meier) as well as their interaction with (bullet) solid foams, textiles, porous and granular media (B Skews, DMJ Smeulders, MEH van Dongen, V Golub, O Mirova) All chapters are self-contained, so they can be read independently, although they are of course thematically interrelated. Taken together, they offer a timely reference on shock waves in multiphase flows, including new viewpoints and burgeoning developments. The book will appeal to beginners as well as professional scientists and engineer...

  5. Investigations of Near-Field Thermal-Hydrologic-Mechanical-Chemical Models for Radioactive Waste Disposal in Clay/Shale Rock

    Energy Technology Data Exchange (ETDEWEB)

    Liu, H.H.; Li, L.; Zheng, L.; Houseworth, J.E.; Rutqvist, J.

    2011-06-20

    Clay/shale has been considered as potential host rock for geological disposal of high-level radioactive waste throughout the world, because of its low permeability, low diffusion coefficient, high retention capacity for radionuclides, and capability to self-seal fractures. For example, Callovo-Oxfordian argillites at the Bure site, France (Fouche et al., 2004), Toarcian argillites at the Tournemire site, France (Patriarche et al., 2004), Opalinus Clay at the Mont Terri site, Switzerland (Meier et al., 2000), and Boom clay at the Mol site, Belgium (Barnichon and Volckaert, 2003) have all been under intensive scientific investigation (at both field and laboratory scales) for understanding a variety of rock properties and their relationships to flow and transport processes associated with geological disposal of radioactive waste. Figure 1-1 presents the distribution of clay/shale formations within the USA.

  6. 5th CIRP international conference on industrial product-service systems

    CERN Document Server

    2013-01-01

    “An Industrial Product-Service System is characterized by the integrated and mutually  determined planning, development, provision and use of product and service shares including its immanent software components in Business-to-Business applications and represents a knowledge-intensive socio-technical system.” – Meier, Roy, Seliger (2010) Since the first conference in 2009, the CIRP International Conference on Industrial Product-Service Systems has become a well-established international forum for the review and discussion of advances, research results and industrial improvements. Researchers from all over the world have met at previous IPS² conferences in Cranfield (2009), Linköping (2010), Braunschweig (2011) and Tokyo (2012). In 2013, the 5th CIRP International Conference on Industrial Product-Service Systems is held in Bochum. Important topics of IPS² research presented at the conference are: planning and development, sustainability, business models, operation, service engineering, knowledge mana...

  7. Criminal recidivism in sexual homicide perpetrators.

    Science.gov (United States)

    Hill, Andreas; Habermann, Niels; Klusmann, Dietrich; Berner, Wolfgang; Briken, Peer

    2008-02-01

    Forensic psychiatric reports on 166 sexual homicide perpetrators in Germany were retrospectively analyzed for criminal risk factors. Follow-up information about release and reconvictions from federal criminal records was available for 139 offenders; 90 (64.7%) had been released. The estimated recidivism rate (Kaplan-Meier analyses) for 20 years at risk was 23.1% for sexual and 18.3% for nonsexual violent reoffences. Three men (3.3%) were reconvicted for attempted or completed homicide. Only young age at the time of sexual homicide resulted in higher sexual recidivism, whereas increased nonsexual violent recidivism was related to previous sexual and nonsexual delinquency, psychopathic symptoms, and higher scores in risk assessment instruments. Increased recidivism with any violent reoffence was associated with age-related factors: young age at first sexual offence, at homicide, and at release and duration of detention. The impacts of the results for risk assessment, relapse prevention, and supervision are discussed.

  8. Survival and clinical outcome of dogs with ischaemic stroke

    DEFF Research Database (Denmark)

    Gredal, Hanne Birgit; Toft, Nils; Westrup, Ulrik

    2013-01-01

    The objectives of the present study were to investigate survival time, possible predictors of survival and clinical outcome in dogs with ischaemic stroke. A retrospective study of dogs with a previous diagnosis of ischaemic stroke diagnosed by magnetic resonance imaging (MRI) was performed....... The association between survival and the hypothesised risk factors was examined using univariable exact logistic regression. Survival was examined using Kaplan-Meier and Cox regression. Twenty-two dogs were identified. Five dogs (23%) died within the first 30days of the stroke event. Median survival in 30-day...... survivors was 505days. Four dogs (18%) were still alive by the end of the study. Right-sided lesions posed a significantly increased risk of mortality with a median survival time in dogs with right-sided lesions of 24days vs. 602days in dogs with left sided lesions (P=0.006). Clinical outcome was considered...

  9. Cabazitaxel as second-line or third-line therapy in patients with metastatic castration-resistant prostate cancer

    DEFF Research Database (Denmark)

    Kongsted, Per; Svane, Inge M; Lindberg, Henriette

    2016-01-01

    To compare treatment outcomes in patients with metastatic castration-resistant prostate cancer treated with cabazitaxel (CA) as second-line or third-line therapy in the everyday clinical setting. Charts from 94 patients treated with CA as second-line (n=28) or third-line therapy (n=66) were...... evaluated. Common Terminology Criteria for Adverse Events were used to register grade 3-4 nonhematological toxicity during treatment with CA. Baseline metastatic castration-resistant prostate cancer-related prognostic factors, duration of therapy, and maximum prostate-specific antigen (PSA) percentage...... change were registered during treatment with CA and previous/subsequent novel androgen receptor targeting therapies. Progression-free survival (PFS) and overall survival (OS) were calculated using the Kaplan-Meier method. A median of 6 versus 5 treatment cycles was administered in patients treated...

  10. Survival benefit of early androgen receptor inhibitor therapy in locally advanced prostate cancer

    DEFF Research Database (Denmark)

    Thomsen, Frederik B; Brasso, Klaus; Christensen, Ib J

    2015-01-01

    BACKGROUND: The optimal timing of endocrine therapy in non-metastatic prostate cancer (PCa) is still an issue of debate. METHODS: A randomised, double-blind, parallel-group trial comparing bicalutamide 150mg once daily with placebo in addition to standard care in patients with hormone-naïve, non......-metastatic PCa. Kaplan-Meier analysis was used to estimate overall survival (OS) and multivariate Cox proportional hazard model was performed to analyse time-to-event (death). FINDINGS: A total of 1218 patients were included into the Scandinavian Prostate Cancer Group (SPCG)-6 study of which 607 were randomised...... disease (hazard ratios (HR)=0.77 (95% confidence interval (CI): 0.63-0.94, p=0.01), regardless of baseline prostate-specific antigen (PSA), with a survival benefit which was apparent throughout the study period. In contrast, survival favoured randomisation to the placebo arm in patients with localised...

  11. Increased risk of revision for infection in rheumatoid arthritis patients with total hip replacements

    DEFF Research Database (Denmark)

    Schrama, Johannes Cornelis; Fenstad, Anne M; Dale, Håvard

    2015-01-01

    Background and purpose-Medical treatment of rheumatoid arthritis (RA) has changed dramatically over the last 15 years, including immune modulation. We investigated the risk of revision for infection after primary total hip replacement (THR) in patients with rheumatoid arthritis over a 16-year...... period, and compared it with that in THR patients with osteoarthritis (OA).Patients and methods-We identified 13,384 THRs in RA patients and 377,287 THRs in OA patients from 1995 through 2010 in a dataset from the Nordic Arthroplasty Register Association (NARA). Kaplan-Meier survival curves......, with revision for infection as the endpoint, were constructed. Cox regression analyses were performed to calculate the relative risk (RR) of revision for infection adjusted for age, sex, fixation technique, and year of primary surgery.Results-RA patients had a 1.3 times (95% CI 1.0-1.6) higher risk of revision...

  12. Protective effect of Asparagus racemosus root extract against lethal total - body electron beam radiation induced damage in Swiss albino mice

    International Nuclear Information System (INIS)

    Sharmila, K.P.; Bhandary, B. Satheesh Kumar; Suchetha Kumari, N.; Bhat, Vadish S.; Shetty, Jayaram; Peter, Alex John; Jose, Jerish M.; Fernandes, Ronald

    2016-01-01

    To investigate the protective effect of Asparagus Racemosus Root ethanolic extract (ARE) in Swiss albino mice against acute lethal total - body Electron beam irradiation. Swiss Albino mice were used for the assessment of radiation induced sickness and 30 day survival analysis. Survival studies were determined using the Kaplan-Meier survival curves. The maximum survival was observed in the experimental mice pretreated with 200 mg/kg.b.wt. of ARE which also reduced the radiation sickness characteristics. This dose was considered as an optimal dose for radioprotection. Treatment of mice with ARE before irradiation delayed the onset of mortality as compared with the untreated irradiated controls. Present findings demonstrate the potential of ARE in mitigating radiation-induced mortality, which may be attributed to its free radical scavenging and increased antioxidant potential

  13. Estimating the Robustness of Composite CBA and MCDA Assessments by Variation of Criteria Importance Order

    DEFF Research Database (Denmark)

    Jensen, Anders Vestergaard; Barfod, Michael Bruhn; Leleur, Steen

    2011-01-01

    described is based on the fact that when using MCA as a decision-support tool, questions often arise about the weighting (or prioritising) of the included criteria. This part of the MCA is seen as the most subjective part and could give reasons for discussion among the decision makers or stakeholders......Abstract This paper discusses the concept of using rank variation concerning the stakeholder prioritising of importance criteria for exploring the sensitivity of criteria weights in multi-criteria analysis (MCA). Thereby the robustness of the MCA-based decision support can be tested. The analysis....... Furthermore, the relative weights can make a large difference in the resulting assessment of alternatives (Hobbs and Meier 2000). Therefore it is highly relevant to introduce a procedure for estimating the importance of criteria weights. This paper proposes a methodology for estimating the robustness...

  14. Equity and improvement in outcome of breast cancer in Denmark

    DEFF Research Database (Denmark)

    Andreasen, A H; Mouridsen, H T; Andersen, K W

    1994-01-01

    The trend in the prognosis for female breast cancer patients was investigated by comparing Kaplan-Meier survival curves of different patient cohorts diagnosed during the period 1948-87. The study is based on 71,448 patients from the Danish Cancer Registry. The cohorts were defined by age...... in other parts of Denmark. For patients diagnosed in 1978-87 the prognosis, however, reached an equal level in all parts of the country. Thus, it is reasonable to assume that the national programme introduced in 1977 by the Danish Breast Cancer Cooperative Group (DBCG) has played an important role...... and not only brought about therapeutic improvements in breast cancer treatment in Denmark, but also ensured equity in the outcome on a national scale....

  15. PAM50 breast cancer intrinsic subtypes and effect of gemcitabine in advanced breast cancer patients

    DEFF Research Database (Denmark)

    Jørgensen, Charlotte Levin Tykjær; Nielsen, Torsten O; Bjerre, Karsten D

    2014-01-01

    BACKGROUND: In vitro studies suggest basal breast cancers are more sensitive to gemcitabine relative to other intrinsic subtypes. The main objective of this study was to use specimens from a randomized clinical trial to evaluate whether the basal-like subtype identifies patients with advanced...... breast cancer who benefit from gemcitabine plus docetaxel (GD) compared to single agent docetaxel (D). MATERIAL AND METHODS: From patients randomly assigned to GD or D, RNA was isolated from archival formalin-fixed, paraffin-embedded primary breast tumor tissue and used for PAM50 intrinsic subtyping...... chemotherapy were analyzed by the Kaplan-Meier method, and Cox proportional hazards regression models. Data analysis was performed independently by the Danish Breast Cancer Cooperative Group (DBCG) statistical core and all statistical tests were two-sided. RESULTS: RNA from 270 patients was evaluable; 84...

  16. Reflections on evaluative practice in higher education: an experience collaborative

    Directory of Open Access Journals (Sweden)

    Suênya Marley Mourão Batista

    2016-12-01

    Full Text Available This article aims to reflect on the evaluation practice of higher education teachers generated from research conducted as part of a private higher education institution. The objective of this study is to characterize the assessment practices of teachers who work in higher education and collaborate in order to facilitate the expansion of dynamic assessment practices were used as theoretical and methodological support the studies of Vygotsky (2007, Liberali (2008, Ibiapina (2007, 2008, Meier (2007, Campione (2002 and Hoffmann (2011. Field research was conducted in a qualitative approach to collaborative type with 3 (three in higher education using the reflective interview as data collection tool to promote critical thinking about assessment practices to develop. The results showed the prevalence of use of traditional assessment practices by teachers and the possibility of performing dynamic assessment practices from the understanding of these nurtured by the research and training process.

  17. Similarities Between Deaf or Hard of Hearing and Hearing Students' Awareness of Affective Words' Valence in Written Language.

    Science.gov (United States)

    Li, Degao; Zhang, Fan; Zeng, Xihong

    2016-01-01

    An affective priming task was used with two cohorts of college students, one deaf or hard of hearing (D/HH), the other hearing, in two experiments. The same set of affective-word targets, preceded by "※※" in Experiment 1 but by affective-word primes of the same valence as the targets in Experiment 2, were presented vertically above or below the screen center. Stimuli that preceded the targets were shown at the screen center. D/HH participants generally performed more poorly than hearing participants, but both groups performed similarly in that both did better on the positive targets than on the negative in both experiments, and on supporting metaphorical associations between valence and vertical positions (Meier & Robinson, 2004), as indicated by reaction times, in Experiment 2. The researchers concluded that D/HH and hearing college students perform similarly in developing cognition-grounded representations of affective words in written language.

  18. Clinical and echocardiographic assessment of the Medtronic Advantage aortic valve prosthesis: the Scandinavian multicentre, prospective study

    DEFF Research Database (Denmark)

    Haaverstad, Rune; Vitale, Nicola; Karevold, Asbjørn

    2006-01-01

    OBJECTIVE: The aim of this report is the prospective, multicentre evaluation of clinical results and haemodynamic performance of the Medtronic Advantage aortic valve prosthesis. METHODS: From April 2001 to June 2003, 166 patients (male:female 125:41; mean (SD) age 61.8 (11.8) years) received...... an aortic advantage valve prosthesis. Complete cumulative follow-up was 242.7 patient-years (maximum 3.2; mean 1.6 years). Postoperatively, patients underwent early (within 30 days) and 1 year transthoracic echocardiography. RESULTS: 30 day mortality was 2.4% (n = 4). Kaplan-Meier estimates of freedom from...... echocardiography. CONCLUSIONS: Haemodynamic performance and early clinical results of Medtronic advantage in the aortic position were satisfactory and comparable with those of other bileaflet valves in current clinical use....

  19. The association of donor and recipient age with graft survival in paediatric renal transplant recipients in a European Society for Paediatric Nephrology/European Renal Association-European Dialysis and Transplantation Association Registry study

    DEFF Research Database (Denmark)

    Chesnaye, Nicholas C.; Van Stralen, Karlijn J.; Bonthuis, Marjolein

    2017-01-01

    from the ESPN/ERA-EDTA Registry. The effect of donor and recipient age combinations on 5-year graft-failure risk, stratified by donor source, was estimated using Kaplan-Meier survival curves and Cox regression, while adjusting for sex, primary renal diseases with a high risk of recurrence, pre......Background The impact of donor age in paediatric kidney transplantation is unclear. We therefore examined the association of donor-recipient age combinations with graft survival in children. Methods Data for 4686 first kidney transplantations performed in 13 countries in 1990-2013 were extracted......-emptive transplantation, year of transplantation and country. Results The risk of graft failure in older living donors (50-75 years old) was similar to that of younger living donors {adjusted hazard ratio [aHR] 0.74 [95% confidence interval (CI) 0.38-1.47]}. Deceased donor (DD) age was non-linearly associated with graft...

  20. Lipoprotein(a) and the risk of cardiovascular disease in the European population

    DEFF Research Database (Denmark)

    Waldeyer, Christoph; Makarova, Nataliya; Zeller, Tanja

    2017-01-01

    Aims: As promising compounds to lower Lipoprotein(a) (Lp(a)) are emerging, the need for a precise characterization and comparability of the Lp(a)-associated cardiovascular risk is increasing. Therefore, we aimed to evaluate the distribution of Lp(a) concentrations across the European population......, to characterize the association with cardiovascular outcomes and to provide high comparability of the Lp(a)-associated cardiovascular risk by use of centrally determined Lp(a) concentrations. Methods and results: Based on the Biomarkers for Cardiovascular Risk Assessment in Europe (BiomarCaRE)-project, we......-Meier curves showed the highest event rate of MCE and CVD events for Lp(a) levels≥90th percentile (log-rank test: Prisk factors revealed a significant association of Lp(a) levels with MCE and CVD with a hazard ratio (HR...

  1. Treatment-dependent and treatment-independent risk factors associated with the risk of diabetes-related events

    DEFF Research Database (Denmark)

    Wilke, Thomas; Mueller, Sabrina; Groth, Antje

    2015-01-01

    BACKGROUND: The aim of this study was to analyse which factors predict the real-world macro-/microvascular event, hospitalisation and death risk in patients with type 2 diabetes mellitus. Furthermore, we aimed to investigate whether there exists both an under- and over-treatment risk...... of these patients. METHODS: We used a German claims/clinical data set covering the years 2010-12. Diabetes-related events were defined as (1) macro-, (2) microvascular events leading to inpatient hospitalisation, (3) other hospitalisations with type 2 diabetes mellitus as main diagnosis, (4) all-cause death and (5......) a composite outcome including all event categories 1-4. Factors associated with event risk were analysed by a Kaplan-Meier curve analysis and by multivariable Cox regression models. RESULTS: 229,042 patients with type 2 diabetes mellitus (mean age 70.2 years; mean CCI 6.03) were included. Among factors...

  2. Duration of Psoriatic Skin Disease as Risk Factor for Subsequent Onset of Psoriatic Arthritis

    Directory of Open Access Journals (Sweden)

    Alexander Egeberg

    2018-03-01

    Full Text Available It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA. Survival analysis and Kaplan–Meier life table techniques were used. The study comprised 10,011 psoriasis patients (severe n = 4,618, and 1,269 patients also had PsA. Incidence of PsA increased with duration of cutaneous symptoms (p = 0.0001. Psoriasis diagnosed before age 20 or 30 years, respectively, suggested a lower risk of PsA than psoriasis diagnosed after age 50 years, yet age at first cutaneous symptoms did not predict development of PsA. No clear association with disease severity was found. PsA incidence appeared stable with longer duration of psoriasis, but further data are needed to firmly establish the relationship with age of psoriasis onset.

  3. Enzalutamide Antitumour Activity Against Metastatic Castration-resistant Prostate Cancer Previously Treated with Docetaxel and Abiraterone

    DEFF Research Database (Denmark)

    Brasso, Klaus; Thomsen, Frederik B; Schrader, Andres J

    2015-01-01

    prostate-specific antigen (PSA) kinetics, patient characteristics, and progression-free survival, respectively. Kaplan-Meier survival analysis and Cox proportional hazard analysis were performed. RESULTS AND LIMITATIONS: We identified 137 patients who prior to enzalutamide had progressed following a median...... of eight cycles of docetaxel and seven courses of abiraterone. The median time on enzalutamide was 3.2 mo; median OS from the time patients started enzalutamide was 8.3 mo (95% confidence interval, 6.8-9.8). Only 45 (38%) and 22 (18%) patients had PSA declines (unconfirmed) >30% and 50%, respectively....... Patients who had more than 30% or 50% falls in PSA had improved survival compared with patients who had no such PSA fall (11.4 mo vs 7.1 mo; p=0.001 and 12.6 vs 7.4 mo; p=0.007, respectively). Poor performance status and low haemoglobin was negatively associated with OS. CONCLUSIONS: Median OS...

  4. Radical prostatectomy in clinically localized high-risk prostate cancer

    DEFF Research Database (Denmark)

    Røder, Martin Andreas; Berg, Kasper Drimer; Christensen, Ib Jarle

    2013-01-01

    ) is regarded as primary therapy by others. This study examined the outcome for high-risk localized PCa patients treated with RP. Material and methods. Of 1300 patients who underwent RP, 231 were identified as high-risk. Patients were followed for biochemical recurrence (BCR) (defined as prostate-specific......Abstract Objective. The optimal therapeutic strategy for high-risk localized prostate cancer (PCa) is controversial. Supported by randomized trials, the combination of external beam radiation therapy (EBRT) and endocrine therapy (ET) is advocated by many, while radical prostatectomy (RP...... antigen ≥ 0.2 ng/ml), metastatic disease and survival. Excluding node-positive patients, none of the patients received adjuvant therapy before BCR was confirmed. Univariate and multivariate analysis was performed with Kaplan-Meier and Cox proportional hazard models. Results. Median follow-up was 4.4 years...

  5. [Clinical Study of 2014 ISUP New Grade Group Classification for Prostate Cancer Patients Treated by Androgen Deprivation Therapy].

    Science.gov (United States)

    Uno, Masahiro; Kawase, Makoto; Kato, Daiki; Ishida, Takashi; Kato, Seiichi; Fujimoto, Yoshinori

    2018-01-01

    The 2014 International Society of Urological Pathology (ISUP) has proposed a new grade group (GG) classification for Gleason scores (GS). The usefulness of the new GG classification was investigated with 518 prostate cancer patients who underwent androgen deprivation therapy. According to the new GG classification, Stages B‒D and the new GG classification relapse-free rate for each stage were calculated using the Kaplan‒Meier method. The new GG classification revealed a significant difference for the relapse-free rate only between some groups. Analysis using the Cox proportional hazards model indicated that the risk of relapse was higher in GGs 4 and 5 than in GG 1. The usefulness about the relapse-free rate in androgen deprivation therapy of the 2014 ISUP new grade group classification a waits future examination.

  6. Changes in acute response to radiation after implementation of new national guidelines for head and neck cancer

    DEFF Research Database (Denmark)

    Hansen, C. R.; Bertelsen, Anders; Zukauskaite, R.

    2015-01-01

    of volume of CTV1 for most institutions which previously used different margins. Change in CTV1 volume definition could influence the risk and time evolution of adverse effects e.g. mucositis. This study investigates change in acute response during RT in a centre where GTV to CTV1 margin was increased from......Purpose/Objective: New national guidelines (GL) for radiotherapy (RT) of head and neck cancer (HNC) were implemented at the beginning of 2013. One purpose of the new GL was to nationally standardise the expansion from GTV to high risk CTV (CTV1). This standardisation has resulted in change...... endpoints were dichotomized, grade 0- 1 vs 2+ or 0-2 vs 3+. Potential change in actuarial cumulative incidence (One minus the Kaplan Meier estimator) of mucositis was tested using the log-rank test. To stratify for the potential effect between non-accelerated (5 fx/w) and accelerated (6/10 fx/w) treatments...

  7. Cholecystokinin in plasma predicts cardiovascular mortality in elderly females

    DEFF Research Database (Denmark)

    Gøtze, Jens P.; Rehfeld, Jens F; Alehagen, Urban

    2016-01-01

    BACKGROUND: Cholecystokinin (CCK) and gastrin are related gastrointestinal hormones with documented cardiovascular effects of exogenous administration. It is unknown whether measurement of endogenous CCK or gastrin in plasma contains information regarding cardiovascular mortality. METHODS......: Mortality risk was evaluated using Cox proportional hazard regression and Kaplan-Meier analyses. Elderly patients in a primary care setting with symptoms of cardiac disease, i.e. shortness of breath, peripheral edema, and/or fatigue, were evaluated (n=470). Primary care patients were followed for 13years...... information was obtained from 4th quartile gastrin concentrations on 5-year cardiovascular mortality risk. CONCLUSIONS: CCK in plasma is an independent marker of cardiovascular mortality in elderly female patients. The study thus introduces measurement of plasma CCK in gender-specific cardiovascular risk...

  8. Long-Term Safety of In Utero Exposure to Anti-TNFα Drugs for the Treatment of Inflammatory Bowel Disease

    DEFF Research Database (Denmark)

    Chaparro, M; Verreth, A; Lobaton, T

    2018-01-01

    OBJECTIVES: The long-term safety of exposure to anti-tumor necrosis factor (anti-TNFα) drugs during pregnancy has received little attention. We aimed to compare the relative risk of severe infections in children of mothers with inflammatory bowel disease (IBD) who were exposed to anti-TNFα drugs...... in utero with that of children who were not exposed to the drugs. METHODS: Retrospective multicenter cohort study. Exposed cohort: children from mothers with IBD receiving anti-TNFα medication (with or without thiopurines) at any time during pregnancy or during the 3 months before conception. Non......-exposed cohort: children from mothers with IBD not treated with anti-TNFα agents or thiopurines at any time during pregnancy or the 3 months before conception. The cumulative incidence of severe infections after birth was estimated using Kaplan-Meier curves, which were compared using the log-rank test. Cox...

  9. Severe periodontitis and higher cirrhosis mortality

    DEFF Research Database (Denmark)

    Ladegaard Grønkjær, Lea; Holmstrup, Palle; Schou, Søren

    2018-01-01

    Background Periodontitis and edentulism are prevalent in patients with cirrhosis, but their clinical significance is largely unknown. Objective The objective of this article is to determine the association of severe periodontitis and edentulism with mortality in patients with cirrhosis. Methods...... A total of 184 cirrhosis patients underwent an oral examination. All-cause and cirrhosis-related mortality was recorded. The associations of periodontitis and edentulism with mortality were explored by Kaplan–Meier survival plots and Cox proportional hazards regression adjusted for age, gender, cirrhosis...... etiology, Child–Pugh score, Model for End-Stage Liver Disease score, smoker status, present alcohol use, comorbidity, and nutritional risk score. Results The total follow-up time was 74,197 days (203.14 years). At entry, 44% of the patients had severe periodontitis and 18% were edentulous. Forty...

  10. Prognostic impact of tumor MET expression among patients with stage IV gastric cancer

    DEFF Research Database (Denmark)

    Erichsen, Rune; Kelsh, Michael A; Oliner, Kelly S

    2016-01-01

    PURPOSE: We aimed to investigate the prevalence and prognostic impact of tumor mesenchymal epithelial transition factor (MET) expression in stage IV gastric cancers in a real-world clinical setting because existing evidence is sparse. METHODS: The study included archived cancer specimens from 103...... stage IV gastric cancer patients (2003-2010). We analyzed MET-protein expression by immunohistochemistry (MET-positive if ≥25% of tumor cells showed MET expression). We calculated overall survival using the Kaplan-Meier method and hazard ratios comparing mortality among MET-positive and MET.......6 months), corresponding to an adjusted hazard ratio of 2.2 (95% confidence interval, 1.3-3.7). CONCLUSIONS: Tumor MET expression is prevalent and has substantial prognostic impact in stage IV gastric cancer patients....

  11. Clinical application and prognostic assessment of serum Tumor Associated Material (TAM) from esophageal cancer patients.

    Science.gov (United States)

    Zhou, K; Yan, Y; Zhao, S; Li, B

    2014-01-01

    To explore the correlation between serum levels of Tumor Associated Materials (TAM) and clinicopathological parameters and prognosis in patients with esophageal cancer (EC). The levels of TAM were determined by chemical colorimetry in 100 EC patients and 100 healthy controls. Serum TAM levels were significantly higher in patients with esophageal carcinoma than in the control group (p TAM were associated with tumor size (p = 0.004), tumor depth (p TAM (p = 0.001). Kaplan-Meier analysis showed patients with increased levels of TAM after operation had an lower overall survival (p TAM may be an independent factor affecting the overall survival and disease-free survival (p TAM could be used to screen for tumor and assess unfavorable prognosis in patients with EC.

  12. The influence of unilateral oophorectomy on the age of menopause

    DEFF Research Database (Denmark)

    Rosendahl, M; Simonsen, M K; Kjer, J J

    2017-01-01

    OBJECTIVE: To determine the age of menopause after premenopausal unilateral oophorectomy (UO) and to establish whether UO at a young age leads to menopause at a younger age than if UO occurs at an older age. METHODS: A cohort of 28 731 women, of whom 17 781 (62%) were menopausal, was investigated....... Information on menopause was obtained from self-reported questionnaires. Surgical data were obtained from the National Patient Register to avoid recollection bias. Age of menopause after UO/not UO was determined using Kaplan-Meier curves. Cox regression was used to identify factors of importance for early...... menopause. RESULTS: UO was performed in 1148 women. Women with UO after the age of 45 years, premenopausal hysterectomy, bilateral oophorectomy and cancer were excluded, leaving 236 in the analysis. Menopause occurred 1.8 years earlier after UO compared to women with two intact ovaries (mean 49.5 vs. 51...

  13. Long-term mortality in patients with atrial septal defect

    DEFF Research Database (Denmark)

    Nyboe, Camilla; Karunanithi, Zarmiga; Nielsen-Kudsk, Jens Erik

    2018-01-01

    Aims: In this nationwide cohort of atrial septal defect (ASD) patients, the largest to date, we report the longest follow-up time with and without closure in childhood and adulthood compared with a general population cohort. Methods and results: Using population-based registries, we included Danish...... individuals born before 1994 who received an ASD diagnosis between 1959 and 2013. All diagnoses were subsequently validated (n = 2277). Using the Kaplan-Meier estimates and Cox proportional hazards regression adjusted for sex, birth year, and a modified Charlson Comorbidity Index, we compared the mortality...... of ASD patients with that of a birth year and sex matched general population cohort. The median follow-up from ASD diagnosis was 18.1 years (range 1-53 years). Patients with ASD had a higher mortality [adjusted hazard ratio (HR): 1.7; 95% confidence interval (CI): 1.5-1.9] compared with the general...

  14. Outcome of lithium prophylaxis: a prospective follow-up of affective disorder patients assigned to high and low serum lithium levels

    DEFF Research Database (Denmark)

    Vestergaard, Per; Licht, Rasmus Wentzer; Brodersen, Anders Torp

    1998-01-01

    The purpose of the study was to examine the outcome of long-term lithium treatment in consecutively admitted affective disorder patients assigned to high and low serum lithium levels. A total of 91 patients were diagnosed according to DSM-III criteria and randomly allocated to two open treatment...... groups in which prophylactic lithium was administered in high (serum lithium 0.8-1.0 mmol L-1) and low (serum lithium 0.5-0.8 mmol L-1) doses, respectively. The patients were followed for 2 years or until discontinuation of lithium treatment or readmission to hospital for recurrence of affective illness....... The main outcome of the treatment groups was compared with Kaplan-Meier survival curves and by Cox regression analysis. A total of 31 patients (34%) completed 24 months of prophylactic lithium treatment without recurrence and readmission to hospital. In total, 18 patients (20%) suffered a recurrence...

  15. LINEAR REGRESSION MODEL ESTİMATİON FOR RIGHT CENSORED DATA

    Directory of Open Access Journals (Sweden)

    Ersin Yılmaz

    2016-05-01

    Full Text Available In this study, firstly we will define a right censored data. If we say shortly right-censored data is censoring values that above the exact line. This may be related with scaling device. And then  we will use response variable acquainted from right-censored explanatory variables. Then the linear regression model will be estimated. For censored data’s existence, Kaplan-Meier weights will be used for  the estimation of the model. With the weights regression model  will be consistent and unbiased with that.   And also there is a method for the censored data that is a semi parametric regression and this method also give  useful results  for censored data too. This study also might be useful for the health studies because of the censored data used in medical issues generally.

  16. Butyrylcholinesterase Levels on Admission Predict Severity and 12-Month Mortality in Hospitalized AIDS Patients

    Science.gov (United States)

    Xu, Lijun; Huang, Ying; Yang, Zongxing; Sun, Jia; Xu, Yan; Zheng, Jinlei; Kinloch, Sabine; Yin, Michael T.; Weng, Honglei

    2018-01-01

    Background Butyrylcholinesterase (BChE) is synthesized mainly in the liver and an important marker in many infectious/inflammatory diseases, but its role in acquired immunodeficiency syndrome (AIDS) patients is not clear. We wished to ascertain if BChE level is associated with the progression/prognosis of AIDS patients. Methods BChE levels (in U/L) were measured in 505 patients; assessed. Kaplan–Meier curves and Cox proportional hazards model were used to assess associations between low BChE levels and mortality, after adjustment for age, CD4 count, WHO stage, and laboratory parameters. Results A total of 129 patients (25.5%) had a lower BChE level. BChE was closely associated with CD4 count, WHO stage, CRP level, and BMI (all P AIDS severity and is an independent risk factor for increased mortality in AIDS patients. PMID:29736152

  17. The effectiveness of arthroscopic stabilisation for failed open shoulder instability surgery.

    Science.gov (United States)

    Millar, N L; Murrell, G A C

    2008-06-01

    We identified ten patients who underwent arthroscopic revision of anterior shoulder stabilisation between 1999 and 2005. Their results were compared with 15 patients, matched for age and gender, who had a primary arthroscopic stabilisation during the same period. At a mean follow-up of 37 and 36 months, respectively, the scores for pain and shoulder function improved significantly between the pre-operative and follow-up visits in both groups (p = 0.002), with no significant difference between them (p = 0.4). The UCLA and Rowe shoulder scores improved significantly (p = 0.004 and p = 0.002, respectively), with no statistically significant differences between groups (p = 0.6). Kaplan-Meier analysis for time to recurrent instability showed no differences between the groups (p = 0.2). These results suggest that arthroscopic revision anterior shoulder stabilisation is as reliable as primary arthroscopic stabilisation for patients who have had previous open surgery for recurrent anterior instability.

  18. Stent graft placement for dysfunctional arteriovenous grafts

    Energy Technology Data Exchange (ETDEWEB)

    Jeon, Gyeong Sik [Dept. of Radiology, CHA Bundang Medical Center, College of Medicine, CHA University, Seongnam (Korea, Republic of); Shin, Byung Seok; Ohm, Joon Young; Ahn, Moon Sang [Chungnam National University Hospital, Daejeon (Korea, Republic of)

    2015-07-15

    This study aimed to evaluate the usefulness and outcomes of stent graft use in dysfunctional arteriovenous grafts. Eleven patients who underwent stent graft placement for a dysfunctional hemodialysis graft were included in this retrospective study. Expanded polytetrafluoroethylene covered stent grafts were placed at the venous anastomosis site in case of pseudoaneurysm, venous laceration, elastic recoil or residual restenosis despite the repeated angioplasty. The patency of the arteriovenous graft was evaluated using Kaplan-Meier analysis. Primary and secondary mean patency was 363 days and 741 days. Primary patency at 3, 6, and 12 months was 82%, 73%, and 32%, respectively. Secondary patency at the 3, 6, 12, 24, and 36 months was improved to 91%, 82%, 82%, 50%, and 25%, respectively. Fractures of the stent graft were observed in 2 patients, but had no effect on the patency. Stent graft placement in dysfunctional arteriovenous graft is useful and effective in prolonging graft patency.

  19. The prognostic value of lymph node metastases and tumour regression grade in rectal cancer patients treated with long-course preoperative chemoradiotherapy

    DEFF Research Database (Denmark)

    Lindebjerg, J; Spindler, Karen-Lise Garm; Ploen, J

    2009-01-01

    to the tumour regression grade system and lymph node status in the surgical specimen was assessed. The prognostic value of clinico-pathological parameters was analysed using univariate analysis and Kaplan-Meier methods for comparison of groups. RESULTS: All patients responded to treatment and 47% had a major......OBJECTIVE: The purpose of the present study was to investigate the impact of tumour regression and the post-treatment lymph node status on the prognosis of rectal cancer treated by preoperative neoadjuvant chemoradiotherapy. METHOD: One hundred and thirty-five patients with locally advanced T3.......01). CONCLUSION: The combined assessment of lymph-node status and tumour response has strong prognostic value in locally advanced rectal cancer patient treated with preoperative long-course chemoradiation....

  20. Metformin Increases Overall Survival in Patients with Diabetes Undergoing Surgery for Colorectal Cancer

    DEFF Research Database (Denmark)

    Fransgaard, Tina; Thygesen, Lau Caspar; Gögenur, Ismail

    2015-01-01

    -Meier estimator and the Cox regression model adjusted for important clinical risk factors were used. RESULTS: A total of 30,493 patients were included in the study, of which 3391 were diagnosed with diabetes and 1962 were treated with metformin. The adjusted HR of all-cause mortality for the diabetes group was 1......BACKGROUND: Emerging evidence suggests that metformin decreases the risk of developing colorectal cancer in patients with diabetes, but only few studies have examined potential survival benefits after surgery for colorectal cancer (CRC). The purpose of the study was to examine the association......'s National Clinical Database (DCCG). The Danish National Patient Register (NPR) records all hospital contacts in Denmark, and the diagnosis of diabetes was identified by combining NPR data with use of antidiabetic drugs identified through the Danish National Prescription Registry and DCCG. The Kaplan...

  1. Using preventive home monitoring to reduce hospital admission rates and reduce costs

    DEFF Research Database (Denmark)

    Dinesen, Birthe Irene; Haesum, Lisa K E; Soerensen, Natascha

    2012-01-01

    We studied whether preventive home monitoring of patients with chronic obstructive pulmonary disease (COPD) could reduce the frequency of hospital admissions and lower the cost of hospitalization. Patients were recruited from a health centre, general practitioner (GP) or the pulmonary hospital ward....... They were randomized to usual care or tele-rehabilitation with a telehealth monitoring device installed in their home for four months. A total of 111 patients were suitable for inclusion and consented to be randomized: 60 patients were allocated to intervention and three were lost to follow...... of admissions was €3461 per patient in the intervention group and €4576 in the control group; this difference was not significant. The Kaplan-Meier estimates for time to hospital admission were longer for the intervention group than the controls, but the difference was not significant. Future work requires...

  2. Transcatheter aortic valve implantation in failed bioprosthetic surgical valves

    DEFF Research Database (Denmark)

    Dvir, Danny; Webb, John G; Bleiziffer, Sabine

    2014-01-01

    for patients with structural valve deterioration; however, a comprehensive evaluation of survival after the procedure has not yet been performed. OBJECTIVE: To determine the survival of patients after transcatheter valve-in-valve implantation inside failed surgical bioprosthetic valves. DESIGN, SETTING......, stroke, and New York Heart Association functional class. RESULTS: Modes of bioprosthesis failure were stenosis (n = 181 [39.4%]), regurgitation (n = 139 [30.3%]), and combined (n = 139 [30.3%]). The stenosis group had a higher percentage of small valves (37% vs 20.9% and 26.6% in the regurgitation...... and combined groups, respectively; P = .005). Within 1 month following valve-in-valve implantation, 35 (7.6%) patients died, 8 (1.7%) had major stroke, and 313 (92.6%) of surviving patients had good functional status (New York Heart Association class I/II). The overall 1-year Kaplan-Meier survival rate was 83...

  3. Análisis multivariado de recidiva y progresión en el carcinoma de células transicionales de vejiga en estadio T1: Valor pronóstico de p53 y ki67

    OpenAIRE

    Rodríguez Alonso, A.; Pita Fernández, S.; González Carreró, J.; Nogueira March, J.L.

    2003-01-01

    OBJETIVO: Establecer los factores pronósticos de recidiva y progresión en el carcinoma de células transicionales de vejiga en estadio T1, prestando especial atención al valor pronóstico de p53 y ki67. MATERIAL Y MÉTODOS: 175 pacientes con tumor vesical incidente de la categoría T1. El estudio inmunohistoquímico fue realizado con los anticuerpos monoclonales DO7, para p53 y MIB-1, para ki67. Se utilizó la metodología de Kaplan-Meier y se realizó un análisis multivariado de regresión de Cox, pa...

  4. Association between poor clinical prognosis and sleep duration among breast cancer patients

    Directory of Open Access Journals (Sweden)

    Thalyta Cristina Mansano-Schlosser

    Full Text Available ABSTRACT Objective: to investigate the association between clinical progression and the quality and duration of sleep in women with breast cancer. Method: longitudinal study, with 114 participants, conducted in a hospital in Brazil. The instruments used were: questionnaire for sociodemographic and clinical characterization, Pittsburgh Sleep Quality Index; Beck Depression Inventory and Herth Hope Scale. Data were analyzed through descriptive statistics and survival analyses (outcome: poor clinical progression, using the Kaplan-Meier curve, Log-rank test and Cox proportional model. Results: a higher probability of poor clinical progression was verified in women with sleep durations of less than six hours or nine hours and over (p=.0173. Conclusion: the results suggest the importance of further studies that seek to verify whether the quantitative management of sleep disorders would have an impact on the progression of breast cancer. Women should be encouraged to report sleep problems to nurses.

  5. Analyzing survival curves at a fixed point in time for paired and clustered right-censored data

    Science.gov (United States)

    Su, Pei-Fang; Chi, Yunchan; Lee, Chun-Yi; Shyr, Yu; Liao, Yi-De

    2018-01-01

    In clinical trials, information about certain time points may be of interest in making decisions about treatment effectiveness. Rather than comparing entire survival curves, researchers can focus on the comparison at fixed time points that may have a clinical utility for patients. For two independent samples of right-censored data, Klein et al. (2007) compared survival probabilities at a fixed time point by studying a number of tests based on some transformations of the Kaplan-Meier estimators of the survival function. However, to compare the survival probabilities at a fixed time point for paired right-censored data or clustered right-censored data, their approach would need to be modified. In this paper, we extend the statistics to accommodate the possible within-paired correlation and within-clustered correlation, respectively. We use simulation studies to present comparative results. Finally, we illustrate the implementation of these methods using two real data sets. PMID:29456280

  6. A 10-year cohort analysis of routine paediatric ART data in a rural South African setting.

    Science.gov (United States)

    Lilian, R R; Mutasa, B; Railton, J; Mongwe, W; McINTYRE, J A; Struthers, H E; Peters, R P H

    2017-01-01

    South Africa's paediatric antiretroviral therapy (ART) programme is managed using a monitoring and evaluation tool known as TIER.Net. This electronic system has several advantages over paper-based systems, allowing profiling of the paediatric ART programme over time. We analysed anonymized TIER.Net data for HIV-infected children aged ART in a rural district of South Africa between 2005 and 2014. We performed Kaplan-Meier survival analysis to assess outcomes over time. Records of 5461 children were available for analysis; 3593 (66%) children were retained in care. Losses from the programme were higher in children initiated on treatment in more recent years (P ART programme and highlights interventions to improve programme performance.

  7. Estimating a population cumulative incidence under calendar time trends

    DEFF Research Database (Denmark)

    Hansen, Stefan N; Overgaard, Morten; Andersen, Per K

    2017-01-01

    BACKGROUND: The risk of a disease or psychiatric disorder is frequently measured by the age-specific cumulative incidence. Cumulative incidence estimates are often derived in cohort studies with individuals recruited over calendar time and with the end of follow-up governed by a specific date...... by calendar time trends, the total sample Kaplan-Meier and Aalen-Johansen estimators do not provide useful estimates of the general risk in the target population. We present some alternatives to this type of analysis. RESULTS: We show how a proportional hazards model may be used to extrapolate disease risk...... estimates if proportionality is a reasonable assumption. If not reasonable, we instead advocate that a more useful description of the disease risk lies in the age-specific cumulative incidence curves across strata given by time of entry or perhaps just the end of follow-up estimates across all strata...

  8. Breast-conserving treatment of early breast cancer

    International Nuclear Information System (INIS)

    Pirtoli, L.; Bellezza, A.; Pepi, F.; Tucci, E.; Crociani, M.; Crastolla, A.M.; Farzad, M.; Bindi, M.

    1993-01-01

    Results of large prospective trials, often based on selected series and optimal treatment techniques, indicate that breast conserving therapy is appropriate for most patients with early breast cancer. Questions remain regarding the therapeutic outcome in common practice. We report on a series of 206 consecutive, unselected patients treated with current radiotherapy procedures. The Kaplan-Meier evaluation showed 5- and 8-year survival rates (93%, 91%), distant disease-free survival rates (87%, 85%) and local relapse-free survival rates (90%, 88%) that were comparable to those of the conservative arms in reported randomised trials and to the data from retrospective studies reported by authoritative institutions. However, subanalysis according to prognostic factors such as menopausal status, age and axillary nodal status was of limited value, due to the small number of cases. (orig.)

  9. Periodontal healing complications following concussion and subluxation injuries in the permanent dentition: a longitudinal cohort study

    DEFF Research Database (Denmark)

    Hermann, Nuno Vibe; Lauridsen, Eva; Ahrensburg, Søren Steno

    2012-01-01

    Purpose The purpose of the study was to analyze the risk of periodontal ligament (PDL) healing complications following concussion and subluxation injuries in the permanent dentition. Material and method A total 469 permanent teeth (358 patients) with concussion and 404 permanent teeth......-related resorption (ankylosis), marginal bone loss, and tooth loss were analyzed with the Kaplan–Meier method. Results Concussion: In teeth with immature root development, no healing complications were observed. For teeth with mature root development, the risk of repair related resorption after 3 years was 3.2% (95...... among teeth with concussion. Subluxation: In teeth with immature root development, the risk of infection-related resorption after 3 years was 1.7% [95% confidence interval (CI): 0–3.8%]. Infection-related resorption occurred significantly more often in teeth with concomitant crown fracture (P = 0...

  10. Radiotherapy for carcinoma of the esophagus in aged patients

    International Nuclear Information System (INIS)

    Nomoto, Satoshi; Imada, Hajime; Yamashita, Shigeru; Terashima, Hiromi; Nakata, Hajime; Itoh, Hideaki; Ohsato, Keiichi; Okamura, Takeshi

    1995-01-01

    One hundred and fifty-four patients with esophageal carcinoma were treated with either irradiation alone or irradiation combined with surgery at the University of Occupational and Environmental Health Hospital between January 1980 and February 1992. The number of patients 75 years old and older was 25. In patients 74 years old and younger, the overall five-year survival rate by Kaplan-Meier method was 24.5%. The survival rate was best in the patients who were treated by a combination of irradiation and surgery. In patients 75 years old and older, the one-year survival rate was 59%, and the three-year rate was 20%. Aged patients had a tendency to be worse in performance status, and there was no correlation between treatment modality and survival time. We conclude that radiotherapy is useful for treating esophageal cancer in aged patients particularly when maintenance of the quality of life is considered. (author)

  11. A short-term clinical evaluation of IPS Empress 2 crowns.

    Science.gov (United States)

    Toksavul, Suna; Toman, Muhittin

    2007-01-01

    The aim of this study was to evaluate the clinical performance of all-ceramic crowns made with the IPS Empress 2 system after an observation period of 12 to 60 months. Seventy-nine IPS Empress 2 crowns were placed in 21 patients. The all-ceramic crowns were evaluated clinically, radiographically, and using clinical photographs. The evaluations took place at baseline (2 days after cementation) and at 6-month intervals for 12 to 60 months. Survival rate of the crowns was determined using Kaplan-Meier statistical analysis. Based on the US Public Health Service criteria, 95.24% of the crowns were rated satisfactory after a mean follow-up period of 58 months. Fracture was registered in only 1 crown. One endodontically treated tooth failed as a result of fracture at the cervical margin area. In this in vivo study, IPS Empress 2 crowns exhibited a satisfactory clinical performance during an observation period ranging from 12 to 60 months.

  12. Genital lesions after consensual sexual intercourse: They are frequent and they last for several days

    DEFF Research Database (Denmark)

    Astrup, Birgitte Schmidt; Lauritsen, Jens; Ravn, Pernille

    , respectively. The median survival time for lacerations was 24 hours (n=19) seen with the naked eye, 40 hours seen with the colposcope (n=28) and 80 hours seen with toluidine blue dye (n=26). Several important pitfalls in the diagnosis of lesions using the three techniques were identified. We propose a model...... insight into the duration of lesions, frequency of lesions seen with different investigative techniques and to identify pitfalls in the diagnosis of lesions. Materials and Methods: 98 women were examined within 48 hours of consensual sexual intercourse using the naked eye, the colposcope and toluidine...... blue dye application. 50 of the women were re-examined after 3 or 4 days and again after 6 or 7 days, and Kaplan-Meier plots of the duration of lacerations were produced. Results: Lacerations were the most frequent lesion seen with all three techniques, seen in 31%, 41% and 49% of participants...

  13. Outcome after arthroscopic labral surgery in patients previously treated with periacetabular osteotomy

    DEFF Research Database (Denmark)

    Hartig-Andreasen, Charlotte; Nielsen, Torsten G; Lund, Bent

    2017-01-01

    To identify factors predicting failure after hip arthroscopy in patients with previous periacetabular osteotomy (PAO) defined as a conversion to total hip replacement (THR) and to evaluate the patient reported outcome scores. Of 55 hips treated with hip arthroscopy after PAO from Aug 2008 to 2012....... Nine hips were converted to a THR. Kaplan-Meier survival rate was 52.8% (95% CI, 10%-83.8%) at 6.5 years follow-up. Statistically significant predictors of failure: joint space width after PAO ...% of the hips. In 42% of the hips cartilage lesions of Becks grade >3 were found. Mean mHHS and HOS were 65.7 and 68.8 respectively at follow-up. A NRS pain score of >3 in rest and during activity were present in respectively, 43% and 62% of the patients. Hip arthroscopy after PAO demonstrated limited clinical...

  14. Effect of intra-hepatic arterial infusion chemotherapy for patients with liver metastasis from breast cancer

    International Nuclear Information System (INIS)

    Liu Dezhong; Li Huai; Zeng Huiying; Yang Ling

    2001-01-01

    Objective: To evaluate the efficacy of intra-hepatic arterial infusion chemotherapy for patients with liver metastasis from breast cancer. Methods: 1993-1998 years, Thirty four patients with liver metastasis from breast cancer had received epi-adriamycin, cisplatin, mitomycin and 5-fluorouracil by intrahepatic arterial infusion chemotherapy. Twelve patients had received embolization. Results: Six patients (17.65%) had a complete response, 12 patients (35.29%) had a partial response. The overall response rate was 52.94%. Cumulative survival rates at 1, 2, 3 and 4 years were 56.90%, 25.00%, 5.00% and 5.00% respectively (Kaplan-Meier method). The median overall survival time was 11.5 months. Conclusion: Intra-hepatic arterial infusion chemotherapy is safe and effective for liver metastasis from breast cancer and should be the first choice of treatment for these patients

  15. Lenalidomide-induced myelosuppression is associated with renal dysfunction: adverse events evaluation of treatment-naïve patients undergoing front-line lenalidomide and dexamethasone therapy.

    Science.gov (United States)

    Niesvizky, Ruben; Naib, Tara; Christos, Paul J; Jayabalan, David; Furst, Jessica R; Jalbrzikowski, Jessica; Zafar, Faiza; Mark, Tomer; Lent, Richard; Pearse, Roger N; Ely, Scott; Leonard, John P; Mazumdar, Madhu; Chen-Kiang, Selina; Coleman, Morton

    2007-09-01

    Data on 72 patients receiving lenalidomide/dexamethasone for multiple myeloma (MM) was used to determine the factors that are associated with lenalidomide-induced myelosuppression. Eight of 14 patients with grade > or =3 myelosuppression had baseline creatinine clearance (CrCl) < or =0.67 ml/s. Kaplan-Meier analysis by log-rank test demonstrated a significant association (P < 0.0001) between renal insufficiency and time to myelosuppression (hazard ratio = 8.4; 95% confidence interval 2.9-24.7, P = 0.0001). Therefore, CrCl is inversely associated with significant myelosuppression. Caution should be exercised when lenalidomide therapy is commenced and CrCl should be incorporated as a determinant of the initial dosing of lenalidomide in MM patients.

  16. Marital status is an independent prognostic factor for pancreatic neuroendocrine tumors patients: An analysis of the Surveillance, Epidemiology, and End Results (SEER) database.

    Science.gov (United States)

    Zhou, Huaqiang; Zhang, Yuanzhe; Song, Yiyan; Tan, Wulin; Qiu, Zeting; Li, Si; Chen, Qinchang; Gao, Shaowei

    2017-09-01

    Marital status's prognostic impact on pancreatic neuroendocrine tumors (PNET) has not been rigorously studied. We aimed to explore the relationship between marital status and outcomes of PNET. We retrospectively investigated 2060 PNET cases between 2004 and 2010 from Surveillance, Epidemiology, and End Results (SEER) database. Variables were compared by Chi 2 test, t-test as appropriate. Kaplan-Meier methods and COX proportional hazard models were used to ascertain independent prognostic factors. Married patients had better 5-year overall survival (OS) (53.37% vs. 42.27%, Pvs. 59.82%, P=0.001) comparing with unmarried patients. Multivariate analysis revealed marital status is an independent prognostic factor, with married patients showing better OS (HR=0.74; 95% CI: 0.65-0.84; Punmarried patients may be associated with a delayed diagnosis with advanced tumor stage, psychosocial and socioeconomic factors. Further studies are needed. Copyright © 2017. Published by Elsevier Masson SAS.

  17. Fatigue, General Health, and Ischemic Heart Disease in Older Adults

    DEFF Research Database (Denmark)

    Ekmann, Anette; Petersen, Inge; Mänty, Minna Regina

    2013-01-01

    Backgrounds.Fatigue has been shown to predict ischemic heart disease (IHD) and mortality in nonsmoking middle-aged men free of cardiovascular disease. The aim of this study was to investigate the predictive value of fatigue for IHD and general health in nondisabled individuals free...... of cardiovascular disease and older than 70 years. METHODS: The study population was drawn from The Longitudinal Study of Aging Danish Twins. In total, 1,696 participants were followed up for 2-10 years by questionnaires and 10-16 years through registries. Kaplan Meier, Cox Proportional Hazard and logistic.......08-2.00) compared with participants without fatigue. CONCLUSION: We concluded that fatigue in nondisabled older adults free of cardiovascular disease is an early predictor for development of subsequent poor general health and IHD....

  18. Smooth conditional distribution function and quantiles under random censorship.

    Science.gov (United States)

    Leconte, Eve; Poiraud-Casanova, Sandrine; Thomas-Agnan, Christine

    2002-09-01

    We consider a nonparametric random design regression model in which the response variable is possibly right censored. The aim of this paper is to estimate the conditional distribution function and the conditional alpha-quantile of the response variable. We restrict attention to the case where the response variable as well as the explanatory variable are unidimensional and continuous. We propose and discuss two classes of estimators which are smooth with respect to the response variable as well as to the covariate. Some simulations demonstrate that the new methods have better mean square error performances than the generalized Kaplan-Meier estimator introduced by Beran (1981) and considered in the literature by Dabrowska (1989, 1992) and Gonzalez-Manteiga and Cadarso-Suarez (1994).

  19. A population-based study of survival and discharge status for survivors after head injury

    DEFF Research Database (Denmark)

    Engberg, Aase Worså; Teasdale, T W

    2004-01-01

    -Meier survival functions were calculated for these two categories. Hospital records for a random sample of 389 survivors in 1997 after cranial fracture, acute brain lesion or chronical subdural haematoma, which occurred in 1982, 1987 and 1992 in patients aged 15 years or more at injury, were reviewed. Survivors...... the decreasing incidence with time, the point prevalence of survivors in 1997 after brain lesions occurring in 1982, 1987 or 1992 was nearly the same, averaging 8.4 per 100 000 of the population above age 14. Half of them were severe, as defined by initial Glasgow Coma Score .... There was no tendency with time of injury with regard to percentage occurrence of neurophysical, speech or mental deficits at discharge. The calculated number of candidates for rehabilitation of personal activities of daily life briefly after injury was 9.8 per 100 000 with cerebral lesion and 1.2 per 100 000...

  20. Physical activity increases survival after heart valve surgery

    DEFF Research Database (Denmark)

    Lund, K.; Sibilitz, Kirstine Lærum; Kikkenborg Berg, Selina

    2016-01-01

    physical activity levels 6-12 months after heart valve surgery and (1) survival, (2) hospital readmission 18-24 months after surgery and (3) participation in exercise-based cardiac rehabilitation. METHODS: Prospective cohort study with registry data from The CopenHeart survey, The Danish National Patient......OBJECTIVES: Increased physical activity predicts survival and reduces risk of readmission in patients with coronary heart disease. However, few data show how physical activity is associated with survival and readmission after heart valve surgery. Objective were to assess the association between...... Register and The Danish Civil Registration System of 742 eligible patients. Physical activity was quantified with the International Physical Activity Questionnaire and analysed using Kaplan-Meier analysis and Cox regression and logistic regression methods. RESULTS: Patients with a moderate to high physical...

  1. Long-term mortality in patients diagnosed with Listeria monocytogenes meningitis: A Danish nationwide cohort study

    DEFF Research Database (Denmark)

    Roed, Casper; Engsig, Frederik Neess; Omland, Lars Haukali

    2012-01-01

    OBJECTIVES: To determine the long-term mortality, the causes of death and the incidence of cancer in listeria meningitis patients. METHODS: Nationwide, population-based cohort study including all adult patients diagnosed with listeria meningitis from 1977 to 2006 and alive 1 year after diagnosis......, and an age-and gender-matched, population control cohort. Kaplan-Meier tables, Cox regression analysis and cumulative incidence function were used as outcome analyses. RESULTS: We identified 114 listeria meningitis patients and 1026 population controls. The adjusted mortality rate ratio (MRR) for listeria...... meningitis patients the first 5 years of follow-up was 2.35(95% confidence interval (CI) 1.60-3.45) thereafter the MRR was 0.93(95% CI: 0.56-1.55). Listeria meningitis patients had an increased risk of death due to cancer the first 5 years of follow-up, and in the same period patients above 50 years of age...

  2. PRAME gene expression profile in medulloblastoma

    Directory of Open Access Journals (Sweden)

    Tânia Maria Vulcani-Freitas

    2011-02-01

    Full Text Available Medulloblastoma is the most common malignant tumors of central nervous system in the childhood. The treatment is severe, harmful and, thus, has a dismal prognosis. As PRAME is present in various cancers, including meduloblastoma, and has limited expression in normal tissues, this antigen can be an ideal vaccine target for tumor immunotherapy. In order to find a potential molecular target, we investigated PRAME expression in medulloblastoma fragments and we compare the results with the clinical features of each patient. Analysis of gene expression was performed by real-time quantitative PCR from 37 tumor samples. The Mann-Whitney test was used to analysis the relationship between gene expression and clinical characteristics. Kaplan-Meier curves were used to evaluate survival. PRAME was overexpressed in 84% samples. But no statistical association was found between clinical features and PRAME overexpression. Despite that PRAME gene could be a strong candidate for immunotherapy since it is highly expressed in medulloblastomas.

  3. Radiation therapy for the cervical and upper thoracic esophageal cancer

    International Nuclear Information System (INIS)

    Chatani, Masashi; Teshima, Teruki; Inoue, Toshihiko

    1990-01-01

    This is a retrospective analysis of 19 patients with carcinoma of the cervical esophagus (Ce) and 36 of the upper thoracic esophagus (Iu) treated with radiotherapy between September 1977 and December 1987. Three-year survival rates by Kaplan-Meier method were 18% in Ce cancer and 7% in Iu cancer. Two-year local tumor control was obtained in 3 Ce and 4 Iu cancer. Concerning the treatment methods for the above 7 patients, 3 patients with carcinoma of the Ce were treated with double wedged technique and 4 of Iu were treated with box-technique (2 patients), rotation technique (1) and double wedge technique (1). There were no 2-year local tumor control in patients who received less than 60 Gy of the tumor dose or whose tumor exceeded more than 10 cm in length. Double wedge technique is suitable for radiotherapy of Ce cancer, while further investigation of dose and compensation is necessary for Iu cancer. (author)

  4. Demographic, Clinical, and Prognostic Factors of Ovarian Clear Cell Adenocarcinomas According to Endometriosis Status

    DEFF Research Database (Denmark)

    Schnack, Tine H; Høgdall, Estrid; Thomsen, Lotte Nedergaard

    2017-01-01

    OBJECTIVES: Women with endometriosis carry an increased risk for ovarian clear cell adenocarcinomas (CCCs). Clear cell adenocarcinoma may develop from endometriosis lesions. Few studies have compared clinical and prognostic factors and overall survival in patients diagnosed as having CCC according...... to endometriosis status. METHODS: Population-based prospectively collected data on CCC with coexisting pelvic (including ovarian; n = 80) and ovarian (n = 46) endometriosis or without endometriosis (n = 95) were obtained through the Danish Gynecological Cancer Database. χ Test, independent-samples t test, logistic...... regression, Kaplan-Meier test, and Cox regression were used. Statistical tests were 2 sided. P values less than 0.05 were considered statistically significant. RESULTS: Patients with CCC and pelvic or ovarian endometriosis were significantly younger than CCC patients without endometriosis, and a higher...

  5. Patients undergoing radical prostatectomy have a better survival than the background population

    DEFF Research Database (Denmark)

    Andreas Røder, Martin; Brasso, Klaus; Drimer Berg, Kasper

    2013-01-01

    underwent radical prostatectomy. Patients were followed prospectively per protocol. No patients were lost to follow-up. Overall and cause-specific survival were described using Kaplan-Meier plots. Standardized relative survival and mortality ratio were calculated based on expected survival in the age......INTRODUCTION: The objective of this study was to investigate standardised relative survival and mortality ratio for patients undergoing radical prostatectomy for localized prostate cancer at our institution. MATERIAL AND METHODS: Between 1995 and 2010, a total of 1,350 consecutive patients......-matched Danish population using the methods and macros described by Dickmann. The country-specific population mortality rates used for calculation of the expected survival were based on data from The Human Mortality Database. RESULTS: The median follow-up was 3.4 years (range: 0-14.3 years). A total of 59 (4...

  6. Geographical variations in the use of cancer treatments are associated with survival of lung cancer patients

    DEFF Research Database (Denmark)

    Møller, Henrik; Coupland, Victoria H; Tataru, Daniela

    2018-01-01

    INTRODUCTION: Lung cancer outcomes in England are inferior to comparable countries. Patient or disease characteristics, healthcare-seeking behaviour, diagnostic pathways, and oncology service provision may contribute. We aimed to quantify associations between geographic variations in treatment...... and survival of patients in England. METHODS: We retrieved detailed cancer registration data to analyse the variation in survival of 176,225 lung cancer patients, diagnosed 2010-2014. We used Kaplan-Meier analysis and Cox proportional hazards regression to investigate survival in the two-year period following...... to statistical adjustments for age, sex, socio-economic status, performance status and co-morbidity. CONCLUSION: The extent of use of different treatment modalities varies between geographical areas in England. These variations are not attributable to measurable patient and tumour characteristics, and more...

  7. Oncologic safety of cervical nerve preservation in neck dissection for head and neck cancer.

    Science.gov (United States)

    Honda, Keigo; Asato, Ryo; Tsuji, Jun; Miyazaki, Masakazu; Kada, Shinpei; Tsujimura, Takashi; Kataoka, Michiko

    2017-09-01

    Although the functional merits of preserving cervical nerves in neck dissection for head and neck cancer have been reported, the oncologic safety has not yet been determined. Therefore, the purpose of this study was to evaluate the safety of cervical nerve preservation. A retrospective chart review was performed on patients with head and neck cancer who had been treated by neck dissection between 2009 and 2014 at Kyoto Medical Center. Management of cervical nerves and clinical results were analyzed. A total of 335 sides of neck dissection had been performed in 222 patients. Cervical nerves were preserved in 175 neck sides and resected in 160 sides. The 5-year overall survival (OS) rate calculated by the Kaplan-Meier method was 71%. The 5-year neck control rate was 95% in cervical nerve preserved sides and 89% in cervical nerve resected sides. Preserving cervical nerves in neck dissection is oncologically safe in selected cases. © 2017 Wiley Periodicals, Inc.

  8. Effect of ω-3 Polyunsaturated Fatty Acids in Young People at Ultrahigh Risk for Psychotic Disorders

    DEFF Research Database (Denmark)

    McGorry, Patrick D; Nelson, Barnaby; Markulev, Connie

    2017-01-01

    Rating Scale (MADRS) (range, 0-60), Young Mania Rating Scale (YMRS) (range, 0-44), Social and Occupational Functioning Assessment Scale (SOFAS) (range, 0-100), and the Global Functioning: Social and Role scale (range, 0-10). For SOFAS and Global Functioning: Social and Role scale, higher scores were...... better; for other measures, lower scores were better. Results: In this study of 304 adults at ultrahigh risk for psychotic disorders, 153 (50.3%) received ω-3 PUFAs and 151 (49.7%) received placebo. In all, 139 (45.7%) were male; mean (SD) age was 19.1 (4.6) years. The Kaplan-Meier-estimated 6-month...... outcome was transition to psychosis status at 6 months. The secondary outcomes were general levels of psychopathology and functioning, as assessed by the Brief Psychiatric Rating Scale (BPRS) (range, 24-168), Scale for the Assessment of Negative Symptoms (SANS) (range, 0-125), Montgomery-Åsberg Depression...

  9. Does surgery or radiation provide the best overall survival in Ewing's sarcoma? A review of the National Cancer Data Base.

    Science.gov (United States)

    Miller, Benjamin J; Gao, Yubo; Duchman, Kyle R

    2017-09-01

    There is continuing debate regarding the ideal modality for local control of the primary tumor for patients with Ewing's sarcoma. The primary aim of this study is to investigate the impact of the method of local control on overall survival in patients with Ewing's sarcoma. The National Cancer Data Base was used to identify patients Ewing's sarcoma of bone. A Kaplan-Meier survival analysis was performed at 2, 5, and 10 years. Factors with a level of significance of P 8 cm, and male sex while controlling for tumor site. Surgery alone was consistently the method of local control that resulted in the highest overall survival. Surgery alone resulted in the best overall survival for patients with Ewing's sarcoma of bone. The results of this investigation provide support to the approach of surgical resection with negative margins when possible. © 2017 Wiley Periodicals, Inc.

  10. Real-world effectiveness of everolimus-based therapy versus fulvestrant monotherapy in HR(+)/HER2(-) metastatic breast cancer.

    Science.gov (United States)

    Hao, Yanni; Lin, Peggy L; Xie, Jipan; Li, Nanxin; Koo, Valerie; Ohashi, Erika; Wu, Eric Q; Rogerio, Jaqueline

    2015-08-01

    Assessing real-world effectiveness of everolimus-based therapy (EVE) versus fulvestrant monotherapy (FUL) among postmenopausal women with hormone receptor-positive (HR(+))/HER2(-) metastatic breast cancer (mBC) after progression on nonsteroidal aromatase inhibitor (NSAI). Medical charts of community-based patients who received EVE or FUL for mBC after NSAI were examined. Progression-free survival (PFS), time on treatment and time to chemotherapy were compared using Kaplan-Meier curves and Cox proportional hazards models adjusting for line of therapy and patient characteristics. 192 patients received EVE and 156 FUL. After adjusting for patient characteristics, EVE was associated with significantly longer PFS than FUL (hazard ratio: 0.71; p = 0.045). EVE was associated with better PFS than FUL among NSAI-refractory postmenopausal HR(+)/HER2(-) mBC patients.

  11. Chest computed tomography scores are predictive of survival in patients with cystic fibrosis awaiting lung transplantation

    DEFF Research Database (Denmark)

    Loeve, Martine; Hop, Wim C. J.; de Bruijne, Marleen

    2012-01-01

    Rationale: Up to a third of cystic fibrosis (CF) patients awaiting lung transplantation (LTX) die while waiting. Inclusion of computed tomography (CT) scores may improve survival prediction models such as the lung allocation score (LAS). Objectives: This study investigated the association between...... CT and survival in CF patients screened for LTX. Methods: Clinical data and chest CTs of 411 CF patients screened for LTX between 1990 and 2005 were collected from 17 centers. CTs were scored with the Severe Advanced Lung Disease (SALD) 4-category scoring system, including the components "infection....../inflammation" (INF), air trapping/hypoperfusion (AT), normal/hyperperfusion (NOR) and bulla/cysts (BUL). The volume of each component was computed using semi-automated software. Survival analysis included Kaplan-Meier curves, and Cox-regression models. Measurements and main results: 366 (186 males) out of 411...

  12. Conditional survival of patients with diffuse large B-cell lymphoma

    DEFF Research Database (Denmark)

    Møller, Michael Boe; Pedersen, Niels Tinggaard; Christensen, Bjarne E

    2006-01-01

    BACKGROUND: Prognosis of lymphoma patients is usually estimated at the time of diagnosis and the estimates are guided by the International Prognostic Index (IPI). However, conditional survival estimates are more informative clinically, as they consider those patients only who have already survive...... survival probability provides more accurate prognostic information than the conventional survival rate estimated from the time of diagnosis.......BACKGROUND: Prognosis of lymphoma patients is usually estimated at the time of diagnosis and the estimates are guided by the International Prognostic Index (IPI). However, conditional survival estimates are more informative clinically, as they consider those patients only who have already survived...... a period of time after treatment. Conditional survival data have not been reported for lymphoma patients. METHODS: Conditional survival was estimated for 1209 patients with diffuse large B-cell lymphoma (DLBCL) from the population-based LYFO registry of the Danish Lymphoma Group. The Kaplan-Meier method...

  13. Infants with prenatally diagnosed kidney anomalies have an increased risk of urinary tract infections

    DEFF Research Database (Denmark)

    Rasmussen, Maria; Sunde, Lone; Andersen, René F

    2017-01-01

    AIM: This study estimated the urinary tract infection (UTI) risk in a nationwide cohort of infants prenatally diagnosed with parenchymal kidney anomalies compared with a comparison cohort. METHODS: A Danish population-based nationwide cohort of foetuses diagnosed with parenchymal kidney anomalies...... between 2007 and 2012 had previously been identified. These were compared with foetuses without kidney anomalies who were prenatally scanned the same year. Live born infants were followed from birth until the diagnosis of UTI, emigration, death or two years of age. Cumulative incidences of UTIs were...... computed. Mortality was estimated using the Kaplan-Meier method. RESULTS: We identified 412 foetuses with parenchymal kidney anomalies out of 362 069 who underwent ultrasound scans and 277 were born alive. The overall risk of a UTI before the age of two years was 19%, and it was 14% among infants without...

  14. Predictors of antiviral treatment initiation in hepatitis C virus-infected patients: a Danish cohort study

    DEFF Research Database (Denmark)

    Hansen, N; Obel, N; Christensen, P B

    2009-01-01

    Predictive factors for initiation of antiviral therapy in chronically infected hepatitis C virus (HCV) patients are not fully elucidated. The aim of this study was to determine predictive factors for initiation of treatment with standard or pegylated interferon either alone or combined...... with ribavirin. A Danish cohort of individuals chronically infected with HCV was used and observation time was calculated from the date of inclusion in the cohort to date of death, last clinical observation, 1 January 2007, or start of HCV antiviral treatment in treatment-naïve patients. Kaplan-Meier survival...... analysis was used to construct time to event curves. Cox regression was used to determine the incidence rate ratios as estimates of relative risk (RR) and 95% confidence intervals (CI). A total of 1780 patients were enrolled in the study. The cumulative chance of treatment initiation over 5 years was 33...

  15. pFAK-Y397 overexpression as both a prognostic and a predictive biomarker for patients with metastatic osteosarcoma.

    Science.gov (United States)

    Thanapprapasr, Kamolrat; Nartthanarung, Adisak; Thanapprapasr, Duangmani; Jinawath, Artit

    2017-01-01

    Focal adhesion kinase (FAK) is important for tumor cell survival and metastasis in various cancers. However, its expression and prognostic value in patients with metastatic osteosarcoma remain unknown. We investigated the expression of FAK and its phosphorylated form (pFAK-Y397) in osteosarcoma tissues from 53 patients by immunohistochemistry and evaluated their correlations with clinicopathologic characteristics and outcomes. The prognostic values were assessed using Kaplan-Meier survival and Cox regression analyses. Total FAK and pFAK-Y397 were overexpressed in 48 (90.6%) and 33 (62.3%) cases, respectively. pFAK-Y397 overexpression was correlated with poor histologic response after neoadjuvant chemotherapy in patients with osteosarcoma regardless of the presence of metastasis or not. Kaplan-Meier curve showed that patients with metastatic osteosarcoma with pFAK-Y397 overexpression had significantly worse overall survival (OS) than those with non-overexpression (P = 0.044). Multivariate Cox regression analysis confirmed pFAK-Y397 overexpression as an independent prognostic predictor for OS and post metastases OS (PMOS) (P = 0.017, P = 0.006, respectively). Age at diagnosis was also an independent indicator for PMOS (P = 0.003). However, total FAK expression was not correlated with any clinicopathologic characteristics or OS in patients with metastatic osteosarcoma. In conclusion, our findings identified FAK as a common aberrant protein overexpression in various subtypes of osteosarcoma. pFAK-Y397 overexpression can be used as a prognostic biomarker predicting poor OS for patients with metastatic osteosarcoma, and the expression of pFAK-Y397 differentiated good and poor responders to neoadjuvant chemotherapy.

  16. Perioperative Blood Transfusion as a Significant Predictor of Biochemical Recurrence and Survival after Radical Prostatectomy in Patients with Prostate Cancer.

    Directory of Open Access Journals (Sweden)

    Jung Kwon Kim

    Full Text Available There have been conflicting reports regarding the association of perioperative blood transfusion (PBT with oncologic outcomes including recurrence rates and survival outcomes in prostate cancer. We aimed to evaluate whether perioperative blood transfusion (PBT affects biochemical recurrence-free survival (BRFS, cancer-specific survival (CSS, and overall survival (OS following radical prostatectomy (RP for patients with prostate cancer.A total of 2,713 patients who underwent RP for clinically localized prostate cancer between 1993 and 2014 were retrospectively analyzed. We performed a comparative analysis based on receipt of transfusion (PBT group vs. no-PBT group and transfusion type (autologous PBT vs. allogeneic PBT. Univariate and multivariate Cox-proportional hazard regression analysis were performed to evaluate variables associated with BRFS, CSS, and OS. The Kaplan-Meier method was used to calculate survival estimates for BRFS, CSS, and OS, and log-rank test was used to conduct comparisons between the groups.The number of patients who received PBT was 440 (16.5%. Among these patients, 350 (79.5% received allogeneic transfusion and the other 90 (20.5% received autologous transfusion. In a multivariate analysis, allogeneic PBT was found to be statistically significant predictors of BRFS, CSS, and OS; conversely, autologous PBT was not. The Kaplan-Meier survival analysis showed significantly decreased 5-year BRFS (79.2% vs. 70.1%, log-rank, p = 0.001, CSS (98.5% vs. 96.7%, log-rank, p = 0.012, and OS (95.5% vs. 90.6%, log-rank, p < 0.001 in the allogeneic PBT group compared to the no-allogeneic PBT group. In the autologous PBT group, however, none of these were statistically significant compared to the no-autologous PBT group.We found that allogeneic PBT was significantly associated with decreased BRFS, CSS, and OS. This provides further support for the immunomodulation hypothesis for allogeneic PBT.

  17. Intraoperative Radiation Therapy for Locally Advanced and Recurrent Soft-Tissue Sarcomas in Adults

    International Nuclear Information System (INIS)

    Tran, Phuoc T.; Hara, Wendy; Su Zheng; Lin, H. Jill; Bendapudi, Pavan K.; Norton, Jeffrey; Teng, Nelson; King, Christopher R.; Kapp, Daniel S.

    2008-01-01

    Purpose: To analyze the outcomes of and identify prognostic factors for patients treated with surgery and intraoperative radiotherapy (IORT) for locally advanced and recurrent soft-tissue sarcoma in adults from a single institution. Methods and Materials: We retrospectively reviewed 50 consecutive patients treated with IORT to 62 sites of disease. Primary sites included retroperitoneum-pelvis (78%), extremity (8%), and other (14%). Seventy percent of patients had recurrent disease failing prior surgery (70%) and/or radiation (32%). Mean disease-free interval (DFI) before IORT was 1.9 years (range, 2 weeks-5.4 years). The IORT was delivered with orthovoltage X-rays using individually sized beveled cone applicators. Clinical characteristics were as follows: mean tumor size, 10 cm (range, 1-25 cm); high-grade histologic subtype (72%); and mean dose, 1,159 cGy (range, 600-1,600 cGy). Postoperative radiation or chemotherapy was administered to 37% of IORT Sites and 32% of patients, respectively. Outcomes measured were infield control (IFC), locoregional control (LRC), distant metastasis-free survival (DMFS), disease-specific survival (DSS), and treatment-related complications. Mean and median follow-up of alive patients were 59 and 35 months, respectively. Results: Kaplan-Meier 5-year IFC, LRC, DMFS, and DSS probabilities for the entire group were 55%, 26%, 51%, and 25%, respectively. Prognostic factors found to be significant (p < 0.05) on multivariate analysis were prior DFI and tumor size for LRC, extremity location and leiomyosarcoma histologic subtype for DMFS, and prior DFI for DSS. Our cohort had five Grade 3/4 complications associated with treatment or a 5-year Kaplan-Meier Grade 3/4 complication-free survival rate of 85%. Conclusions: IORT after tumor reductive surgery is well tolerated and seems to confer IFC in carefully selected patients

  18. Phase II study of paclitaxel given once per week along with trastuzumab and pertuzumab in patients with human epidermal growth factor receptor 2-positive metastatic breast cancer.

    Science.gov (United States)

    Dang, Chau; Iyengar, Neil; Datko, Farrah; D'Andrea, Gabriella; Theodoulou, Maria; Dickler, Maura; Goldfarb, Shari; Lake, Diana; Fasano, Julie; Fornier, Monica; Gilewski, Theresa; Modi, Shanu; Gajria, Devika; Moynahan, Mary Ellen; Hamilton, Nicola; Patil, Sujata; Jochelson, Maxine; Norton, Larry; Baselga, Jose; Hudis, Clifford

    2015-02-10

    The CLEOPATRA (Clinical Evaluation of Trastuzumab and Pertuzumab) study demonstrated superior progression-free survival (PFS) and overall survival when pertuzumab was added to trastuzumab and docetaxel. Paclitaxel given once per week is effective and less toxic than docetaxel. We performed a phase II study to evaluate the efficacy and safety of pertuzumab and trastuzumab with paclitaxel given once per week. Patients with metastatic human epidermal growth factor receptor 2-positive breast cancer with zero to one prior therapy were enrolled. Treatment consisted of paclitaxel 80 mg/m(2) once per week plus trastuzumab (8 mg/kg loading dose → 6 mg/kg) once every 3 weeks plus pertuzumab (840 mg loading dose → 420 mg) once every 3 weeks, all given intravenously. The primary end point was 6-month PFS assessed by Kaplan-Meier methods. From January 2011 to December 2013, we enrolled 69 patients: 51 (74%) and 18 (26%) treated in first- and second-line metastatic settings, respectively. At a median follow-up of 21 months (range, 3 to 38 months), 6-month PFS was 86% (95% CI, 75% to 92%). The median PFS was 19.5 months (95% CI, 14 to 26 months) overall. PFS was 24.2 months (95% CI, 14 months to not reached [NR]) and 16.4 months (95% CI, 8.5 months to NR) for those without and with prior treatment, respectively. At 1 year, Kaplan-Meier PFS was 70% (95% CI, 56% to 79%) overall, 71% (95% CI, 55% to 82%) for those without prior therapy, and 66% (95% CI, 40% to 83%) for those with prior therapy. Treatment was well-tolerated; there was no febrile neutropenia or symptomatic left ventricular systolic dysfunction. Paclitaxel given once per week with trastuzumab and pertuzumab is highly active and well tolerated and seems to be an effective alternative to docetaxel-based combination therapy. © 2014 by American Society of Clinical Oncology.

  19. Phase II Study of Paclitaxel Given Once per Week Along With Trastuzumab and Pertuzumab in Patients With Human Epidermal Growth Factor Receptor 2–Positive Metastatic Breast Cancer

    Science.gov (United States)

    Dang, Chau; Iyengar, Neil; Datko, Farrah; D'Andrea, Gabriella; Theodoulou, Maria; Dickler, Maura; Goldfarb, Shari; Lake, Diana; Fasano, Julie; Fornier, Monica; Gilewski, Theresa; Modi, Shanu; Gajria, Devika; Moynahan, Mary Ellen; Hamilton, Nicola; Patil, Sujata; Jochelson, Maxine; Norton, Larry; Baselga, Jose; Hudis, Clifford

    2015-01-01

    Purpose The CLEOPATRA (Clinical Evaluation of Trastuzumab and Pertuzumab) study demonstrated superior progression-free survival (PFS) and overall survival when pertuzumab was added to trastuzumab and docetaxel. Paclitaxel given once per week is effective and less toxic than docetaxel. We performed a phase II study to evaluate the efficacy and safety of pertuzumab and trastuzumab with paclitaxel given once per week. Patients and Methods Patients with metastatic human epidermal growth factor receptor 2–positive breast cancer with zero to one prior therapy were enrolled. Treatment consisted of paclitaxel 80 mg/m2 once per week plus trastuzumab (8 mg/kg loading dose → 6 mg/kg) once every 3 weeks plus pertuzumab (840 mg loading dose → 420 mg) once every 3 weeks, all given intravenously. The primary end point was 6-month PFS assessed by Kaplan-Meier methods. Results From January 2011 to December 2013, we enrolled 69 patients: 51 (74%) and 18 (26%) treated in first- and second-line metastatic settings, respectively. At a median follow-up of 21 months (range, 3 to 38 months), 6-month PFS was 86% (95% CI, 75% to 92%). The median PFS was 19.5 months (95% CI, 14 to 26 months) overall. PFS was 24.2 months (95% CI, 14 months to not reached [NR]) and 16.4 months (95% CI, 8.5 months to NR) for those without and with prior treatment, respectively. At 1 year, Kaplan-Meier PFS was 70% (95% CI, 56% to 79%) overall, 71% (95% CI, 55% to 82%) for those without prior therapy, and 66% (95% CI, 40% to 83%) for those with prior therapy. Treatment was well-tolerated; there was no febrile neutropenia or symptomatic left ventricular systolic dysfunction. Conclusion Paclitaxel given once per week with trastuzumab and pertuzumab is highly active and well tolerated and seems to be an effective alternative to docetaxel-based combination therapy. PMID:25547504

  20. The prognostic value of metabolic tumor volume in FDG PET/CT evaluation of post-operative survival in patients with esophageal squamous cell cancer

    International Nuclear Information System (INIS)

    Zhu Wanqi; Yu Jinming; Sun Xiaorong; Xing Ligang; Xie Peng; Sun Xindong; Guo Hongbo; Yang Guoren; Kong Li

    2011-01-01

    Objective: To evaluate the prognostic value of MTV on 18 F-FDG PET/CT in patients with esophageal cancer. Methods: Forty-nine patients with esophageal cancer underwent 18 F-FDG PET/CT scan before surgery. The median follow-up time for the patients was 29 months (range, 8-57 months). The prognostic significance of MTV, age, sex, histologic grade, SUV max of the primary tumor, tumor size measured on PET/CT, T stage, N stage, M stage, American Joint Committee on Cancer (AJCC) stage, number and location of lymph nodes metastases were assessed by Kaplan-Meier analysis and multivariate Cox model. Results: In the univariate analysis, AJCC stage (χ 2 =16.206, hazard ratio (HR)=1.177, P<0.001), N stage (χ 2 =9.536, HR=10.833, P=0.002), T stage (χ 2 =5.810, HR=2.397, P=0.016), number of lymph nodes metastases (χ 2 =11.423, HR=1.567, P=0.001), and MTV (χ 2 =3.872, HR=2.433, P=0.049) were significant predictors of survival.Multivariate analysis showed that MTV and AJCC stage were independent predictors of survival (χ 2 =4.525, HR 1.170, P=0.033; χ 2 =4.875, HR=3.071, P=0.027). Kaplan-Meier survival curves revealed longer survival time of low-MTV group as compared to high-MTV group (Log-rank, χ 2 =4.186, P=0.041). Conclusion: MTV on 18 F-FDG PET/CT may be an independent prognostic factor in patients with esophageal cancer. (authors)

  1. A prospective observational study comparing a physiological scoring system with time-based discharge criteria in pediatric ambulatory surgical patients.

    Science.gov (United States)

    Armstrong, James; Forrest, Helen; Crawford, Mark W

    2015-10-01

    Discharge criteria based on physiological scoring systems can be used in the postanesthesia care unit (PACU) to fast-track patients after ambulatory surgery; however, studies comparing physiological scoring systems with traditional time-based discharge criteria are lacking. The purpose of this study was to compare PACU discharge readiness times using physiological vs time-based discharge criteria in pediatric ambulatory surgical patients. We recorded physiological observations from consecutive American Society of Anesthesiologists physical status I-III patients aged 1-18 yr who were admitted to the PACU after undergoing ambulatory surgery in a tertiary academic pediatric hospital. The physiological score was a combination of the Aldrete and Chung systems. Scores were recorded every 15 min starting upon arrival in the PACU. Patients were considered fit for discharge once they attained a score ≥12 (maximum score, 14), provided no score was zero, with the time to achieve a score ≥12 defining the criteria-based discharge (CBD) time. Patients were discharged from the PACU when both the CBD and the existing time-based discharge (TBD) criteria were met. The CBD and TBD data were compared using Kaplan-Meier and log-rank analysis. Observations from 506 children are presented. Median (interquartile range [IQR]) age was 5.5 [2.8-9.9] yr. Median [IQR] CBD and TBD PACU discharge readiness times were 30 [15-45] min and 60 [45-60] min, respectively. Analysis of Kaplan-Meier curves indicated a significant difference in discharge times using the different criteria (hazard ratio, 5.43; 95% confidence interval, 4.51 to 6.53; P < 0.001). All patients were discharged home without incident. This prospective study suggests that discharge decisions based on physiological criteria have the potential for significantly speeding the transit of children through the PACU, thereby enhancing PACU efficiency and resource utilization.

  2. Determining the sample size required to establish whether a medical device is non-inferior to an external benchmark.

    Science.gov (United States)

    Sayers, Adrian; Crowther, Michael J; Judge, Andrew; Whitehouse, Michael R; Blom, Ashley W

    2017-08-28

    The use of benchmarks to assess the performance of implants such as those used in arthroplasty surgery is a widespread practice. It provides surgeons, patients and regulatory authorities with the reassurance that implants used are safe and effective. However, it is not currently clear how or how many implants should be statistically compared with a benchmark to assess whether or not that implant is superior, equivalent, non-inferior or inferior to the performance benchmark of interest.We aim to describe the methods and sample size required to conduct a one-sample non-inferiority study of a medical device for the purposes of benchmarking. Simulation study. Simulation study of a national register of medical devices. We simulated data, with and without a non-informative competing risk, to represent an arthroplasty population and describe three methods of analysis (z-test, 1-Kaplan-Meier and competing risks) commonly used in surgical research. We evaluate the performance of each method using power, bias, root-mean-square error, coverage and CI width. 1-Kaplan-Meier provides an unbiased estimate of implant net failure, which can be used to assess if a surgical device is non-inferior to an external benchmark. Small non-inferiority margins require significantly more individuals to be at risk compared with current benchmarking standards. A non-inferiority testing paradigm provides a useful framework for determining if an implant meets the required performance defined by an external benchmark. Current contemporary benchmarking standards have limited power to detect non-inferiority, and substantially larger samples sizes, in excess of 3200 procedures, are required to achieve a power greater than 60%. It is clear when benchmarking implant performance, net failure estimated using 1-KM is preferential to crude failure estimated by competing risk models. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No

  3. Bias Correction Methods Explain Much of the Variation Seen in Breast Cancer Risks of BRCA1/2 Mutation Carriers.

    Science.gov (United States)

    Vos, Janet R; Hsu, Li; Brohet, Richard M; Mourits, Marian J E; de Vries, Jakob; Malone, Kathleen E; Oosterwijk, Jan C; de Bock, Geertruida H

    2015-08-10

    Recommendations for treating patients who carry a BRCA1/2 gene are mainly based on cumulative lifetime risks (CLTRs) of breast cancer determined from retrospective cohorts. These risks vary widely (27% to 88%), and it is important to understand why. We analyzed the effects of methods of risk estimation and bias correction and of population factors on CLTRs in this retrospective clinical cohort of BRCA1/2 carriers. The following methods to estimate the breast cancer risk of BRCA1/2 carriers were identified from the literature: Kaplan-Meier, frailty, and modified segregation analyses with bias correction consisting of including or excluding index patients combined with including or excluding first-degree relatives (FDRs) or different conditional likelihoods. These were applied to clinical data of BRCA1/2 families derived from our family cancer clinic for whom a simulation was also performed to evaluate the methods. CLTRs and 95% CIs were estimated and compared with the reference CLTRs. CLTRs ranged from 35% to 83% for BRCA1 and 41% to 86% for BRCA2 carriers at age 70 years width of 95% CIs: 10% to 35% and 13% to 46%, respectively). Relative bias varied from -38% to +16%. Bias correction with inclusion of index patients and untested FDRs gave the smallest bias: +2% (SD, 2%) in BRCA1 and +0.9% (SD, 3.6%) in BRCA2. Much of the variation in breast cancer CLTRs in retrospective clinical BRCA1/2 cohorts is due to the bias-correction method, whereas a smaller part is due to population differences. Kaplan-Meier analyses with bias correction that includes index patients and a proportion of untested FDRs provide suitable CLTRs for carriers counseled in the clinic. © 2015 by American Society of Clinical Oncology.

  4. Proton Beam Radiotherapy for Uveal Melanomas at Nice Teaching Hospital: 16 Years' Experience

    International Nuclear Information System (INIS)

    Caujolle, Jean-Pierre; Mammar, Hamid; Chamorey, Emmanuel Phar; Pinon, Fabien; Herault, Joel; Gastaud, Pierre

    2010-01-01

    Purpose: To present the results of uveal melanomas treated at Nice Teaching Hospital. Methods and Materials: This retrospective study included 886 consecutive patients referred to our clinic for the treatment of uveal melanomas by proton beam radiotherapy from June 1991 to December 2007. Survival rates were determined by using Kaplan-Meier estimates, and prognostic factors were evaluated using the log-rank test or Cox model. Results: The number (percent total) of subjects staged according to the TNM classification system (6th edition) of malignant tumors included 39 stage T1 (4.4%), 420 stage T2 (47.40%), 409 stage T3 (46.16%), and 18 stage T4 (2.03%) patients. The median follow-up was 63.7 months. The Kaplan-Meier overall survival rate at 5 years according to the sixth edition TNM classification was 92% for T1, 89% for T2, 67% for T3, and 62% for T4; and at 10 years, 86% for T1, 78% for T2, 43% for T3, and 41% for T4. Five factors were found to be associated with an increased death rate: advanced age, tumor thickness, largest tumor basal diameter, tumor volume, and tumor volume-to-eyeball volume ratio. The metastasis-free survival rates were 88.3 % at 5 years and 76.4 % at 10 years. The local control rates were 93.9% at 5 years and 92.1% at 10 years. The ocular conservation rates were 91.1% at 5 years and 87.3% at 10 years. Conclusions: We report the results of a large series of patients treated for uveal melanomas with a very long follow-up. Despite the large tumor volume treated, our results were similar to previously published findings relating to proton beam therapy.

  5. SAMSN1 is highly expressed and associated with a poor survival in glioblastoma multiforme.

    Directory of Open Access Journals (Sweden)

    Yong Yan

    Full Text Available OBJECTIVES: To study the expression pattern and prognostic significance of SAMSN1 in glioma. METHODS: Affymetrix and Arrystar gene microarray data in the setting of glioma was analyzed to preliminarily study the expression pattern of SAMSN1 in glioma tissues, and Hieratical clustering of gene microarray data was performed to filter out genes that have prognostic value in malignant glioma. Survival analysis by Kaplan-Meier estimates stratified by SAMSN1 expression was then made based on the data of more than 500 GBM cases provided by The Cancer Genome Atlas (TCGA project. At last, we detected the expression of SAMSN1 in large numbers of glioma and normal brain tissue samples using Tissue Microarray (TMA. Survival analysis by Kaplan-Meier estimates in each grade of glioma was stratified by SAMSN1 expression. Multivariate survival analysis was made by Cox proportional hazards regression models in corresponding groups of glioma. RESULTS: With the expression data of SAMSN1 and 68 other genes, high-grade glioma could be classified into two groups with clearly different prognoses. Gene and large sample tissue microarrays showed high expression of SAMSN1 in glioma particularly in GBM. Survival analysis based on the TCGA GBM data matrix and TMA multi-grade glioma dataset found that SAMSN1 expression was closely related to the prognosis of GBM, either PFS or OS (P<0.05. Multivariate survival analysis with Cox proportional hazards regression models confirmed that high expression of SAMSN1 was a strong risk factor for PFS and OS of GBM patients. CONCLUSION: SAMSN1 is over-expressed in glioma as compared with that found in normal brains, especially in GBM. High expression of SAMSN1 is a significant risk factor for the progression free and overall survival of GBM.

  6. Controlled, prospective, randomized, clinical split-mouth evaluation of partial ceramic crowns luted with a new, universal adhesive system/resin cement: results after 18 months.

    Science.gov (United States)

    Vogl, Vanessa; Hiller, Karl-Anton; Buchalla, Wolfgang; Federlin, Marianne; Schmalz, Gottfried

    2016-12-01

    A new universal adhesive with corresponding luting composite was recently marketed which can be used both, in a self-etch or in an etch-and-rinse mode. In this study, the clinical performance of partial ceramic crowns (PCCs) inserted with this adhesive and the corresponding luting material used in a self-etch or selective etch approach was compared with a self-adhesive universal luting material. Three PCCs were placed in a split-mouth design in 50 patients. Two PCCs were luted with a combination of a universal adhesive/resin cement (Scotchbond Universal/RelyX Ultimate, 3M ESPE) with (SB+E)/without (SB-E) selective enamel etching. Another PCC was luted with a self-adhesive resin cement (RelyX Unicem 2, 3M ESPE). Forty-eight patients were evaluated clinically according to FDI criteria at baseline and 6, 12 and 18 months. For statistical analyses, the chi-square test (α = 0.05) and Kaplan-Meier analysis were applied. Clinically, no statistically significant differences between groups were detected over time. Within groups, clinically significant increase for criterion "marginal staining" was detected for SB-E over 18 months. Kaplan-Meier analysis revealed significantly higher retention rates for SB+E (97.8 %) and SB-E (95.6 %) in comparison to RXU2 (75.6 %). The 18-month clinical performance of a new universal adhesive/composite combination showed no differences with respect to bonding strategy and may be recommended for luting PCCs. Longer-term evaluation is needed to confirm superiority of SB+E over SB-E. At 18 months, the new multi-mode adhesive, Scotchbond Universal, showed clinically reliable results when used for luting PCCs.

  7. A novel systemic immune-inflammation index predicts survival and quality of life of patients after curative resection for esophageal squamous cell carcinoma.

    Science.gov (United States)

    Wang, Lu; Wang, Cong; Wang, Jiangfeng; Huang, Xiaochen; Cheng, Yufeng

    2017-10-01

    A novel systemic immune-inflammation index (SII) based on platelet (P), neutrophil (N), and lymphocyte (L) counts has been reported to be associated with clinical outcomes in several solid tumors. We aimed to investigate its prognostic value in esophageal squamous cell carcinoma (ESCC) and the potential relationship with quality of life (QOL). A total of 280 ESCC patients who underwent esophagectomy were enrolled. SII (SII = P × N/L) was calculated on the basis of data obtained within 1 week before surgery. An optimal cut-off value stratified patients into high (≥560) and low (<560) preoperative SII groups. The widely used EORTC QLQ-C30 and QLQ-OES18 were utilized to assess QOL at cancer diagnosis and 36 months after surgery. Generalized estimating equations (GEEs) were used to evaluate the association of SII with QOL. Kaplan-Meier method and Cox proportional regression were used to analyze the prognostic value of SII. Kaplan-Meier analyses revealed that higher SII correlated significantly with poorer overall survival (OS) (p < 0.001) and disease-free survival (DFS) (p < 0.001) in patients with ESCC. Multivariate analysis identified SII as an independent prognostic factor for OS (p < 0.001; HR 2.578; 95% CI 1.625-4.088) and DFS (p < 0.001; HR 2.699; 95% CI 1.726-4.223). In addition, patients with high SII exhibited notably deteriorating QOL (p < 0.05). The preoperative SII is a promising biomarker for predicting survival and QOL of patients with ESCC. It may help to identify the high-risk patients for treatment strategy decisions.

  8. The association between high on-treatment platelet reactivity and early recurrence of ischemic events after minor stroke or TIA.

    Science.gov (United States)

    Rao, Zilong; Zheng, Huaguang; Wang, Fei; Wang, Anxin; Liu, Liping; Dong, Kehui; Zhao, Xingquan; Wang, Yilong; Cao, Yibin

    2017-08-01

    To evaluate the role of HTPR in predicting early recurrence of ischemic events in patients with minor ischemic stroke or high-risk TIA. From January 2014 to September 2014, a single center continuously enrolled patients with minor ischemic stroke or high-risk TIA and gave them antiplatelet therapy consisting of aspirin with clopidogrel. HTPR was assessed by TEG after 7 days of antiplatelet therapy and detected CYP2C19 genotype. The incidence of recurrent ischemic events was assessed 3 months after onset. The incidence of recurrent ischemic events was compared between the HTPR and NTPR groups with the Kaplan-Meier method, and multivariate Cox proportional hazards models were used to determine the risk factors associated with recurrent ischemic events. We enrolled 278 eligible patients with minor ischemic stroke or high-risk TIA. Through TEG testing, patients with HTPR were 22.7%, and carriers were not associated with HTPR to ADP by TEG-ADP(%) (p = 0.193). A total of 265 patients completed 3 months of follow-up, and Kaplan-Meier analysis showed that patients with HTPR had a higher percentage of recurrent ischemic events compared with patients with NTPR (p = 0.002). In multivariate Cox proportional hazards models, history of ischemic stroke or TIA (HR 4.45, 95% CI 1.77-11.16, p = 0.001) and HTPR (HR 3.34, 95% CI 1.41-7.91, p = 0.006) was independently associated with recurrent ischemic events. In patients with minor stroke or TIA, the prevalence of HTPR was 22.7%, and HTPR was independently associated with recurrent ischemic events.

  9. Präoperative Vorhersge der Rezidivrate des klinisch lokalisierten Prostatakarzinoms nach einer radikalen Prostatektomie

    Directory of Open Access Journals (Sweden)

    Graefen M

    1999-01-01

    Full Text Available Die radikale Prostatektomie scheint die zur Zeit effektivste Therapie des klinisch lokalisierten Prostatakarzinoms zu sein. Dennoch liegt die Rezidivrate bei bis zu 40 % der operierten Patienten. Mit dieser Arbeit wurde anhand präoperativer Befunde ein Algorithmus entwickelt, mit welchem die Prognose des klinisch lokalisierten Prostatakarzinoms bereits vor einer operativen Therapie abgeschätzt werden kann. Hierzu wurden multiple präoperative Befunde, welche bei der Diagnose des Prostatakarzinoms erhoben werden, bezüglich ihres Einflusses auf einen PSA-Progress nach radikaler Prostatektomie geprüft. Dies erfolgte mittels einer univariaten Kaplan-Meier Analyse sowie einer multivariaten Statistik (Cox-Regression und CART-Analyse. Schwerpunkt bildete hierbei die Einbeziehung der Ergebnisse der systematischen Sextanten-Biopsie der Prostata. Alle präoperativen Befunde haben in der univariaten Kaplan-Meier Analyse einen signifikanten Einfluß auf ein PSA-Rezidiv. In der Cox-Regression hatte der Anteil an niedrigdifferenziertem Prostatakarzinom den größten Einfluß auf das Auftreten eines Tumorprogresses, gefolgt von der Anzahl der positiven Stanzen in der Biopsie und dem präoperativen PSA-Wert; alle anderen Parameter hatten keinen unabhängig signifikanten Einfluß auf den Tumorprogress. Mittels der zusätzlich durchgeführten CART Analyse konnten verschiedene Risikogruppen definiert werden, deren Rezidivrisiko bei 3 % für Patienten mit geringem Rezidivrisiko sowie 80 % für solche mit einem hohen Rezidivrisiko 2 Jahre nach der Operation betrug. Der niedrigdifferenzierte Tumoranteil hat somit den größten Einfluß auf die Prognose eines klinisch lokalisierten Prostatakarzinoms. Anhand der präsentierten CART-Analysen wurden einfach anwendbare Entscheidungsbäume entwickelt, mit denen eine Abschätzung des Therapieerfolges des klinisch lokalisierten Prostatakarzinoms bereits vor einer Operation möglich ist.

  10. Predicting long-term graft survival in adult kidney transplant recipients

    Directory of Open Access Journals (Sweden)

    Brett W Pinsky

    2012-01-01

    Full Text Available The ability to accurately predict a population′s long-term survival has important implications for quantifying the benefits of transplantation. To identify a model that can accurately predict a kidney transplant population′s long-term graft survival, we retrospectively studied the United Network of Organ Sharing data from 13,111 kidney-only transplants completed in 1988- 1989. Nineteen-year death-censored graft survival (DCGS projections were calculated and com-pared with the population′s actual graft survival. The projection curves were created using a two-part estimation model that (1 fits a Kaplan-Meier survival curve immediately after transplant (Part A and (2 uses truncated observational data to model a survival function for long-term projection (Part B. Projection curves were examined using varying amounts of time to fit both parts of the model. The accuracy of the projection curve was determined by examining whether predicted sur-vival fell within the 95% confidence interval for the 19-year Kaplan-Meier survival, and the sample size needed to detect the difference in projected versus observed survival in a clinical trial. The 19-year DCGS was 40.7% (39.8-41.6%. Excellent predictability (41.3% can be achieved when Part A is fit for three years and Part B is projected using two additional years of data. Using less than five total years of data tended to overestimate the population′s long-term survival, accurate prediction of long-term DCGS is possible, but requires attention to the quantity data used in the projection method.

  11. Prognostic value of preoperative absolute lymphocyte count in recurrent hepatocellular carcinoma following thermal ablation: a retrospective analysis

    Directory of Open Access Journals (Sweden)

    Li X

    2014-10-01

    Full Text Available Xin Li, Zhiyu Han, Zhigang Cheng, Jie Yu, Xiaoling Yu, Ping Liang Department of Interventional Ultrasound, Chinese PLA General Hospital, Beijing, People's Republic of China Purpose: To investigate the prognostic value of preoperative absolute lymphocyte count (ALC in recurrent hepatocellular carcinoma (RHCC following thermal ablation. Materials and methods: We retrospectively analyzed the relationship between preoperative ALC and the clinicopathologic factors and long-term prognosis in 423 RHCC patients who underwent curative thermal ablation. Correlation analysis, receiver operating characteristic (ROC calculation, Kaplan–Meier curves, and multivariate regression were used for statistical analysis. Results: The median time to recurrence was 12 months for RHCC patients after thermal ablation. On multivariate Cox regression analysis, preoperative ALC was an independent risk factor for cancer recurrence, along with tumor differentiation and α-fetoprotein level. ALC ≥1.64×109/L defined by ROC calculation was associated with prolonged survival (area under the curve 0.741, P<0.001. Patients with ALC ≥1.64×109/L showed a mean survival of 20.2 months versus 11.6 months for patients with ALC <1.64×109/L (P<0.001. Patients were stratified into high and low groups according to ALC status. After excluding the basic parameters between groups, the 1- and 3-year recurrence rates in the high group were 20.9% and 29.5%, respectively, which were significantly lower than those of the low group (58.4% and 71.9%, respectively; P<0.001. The recurrence-free survival rates in the two groups analyzed by Kaplan–Meier curves were significantly different (P<0.001. Conclusion: Preoperative ALC is a powerful prognostic factor for RHCC recurrence after thermal ablation, which suggests that maintaining a high ALC in RHCC patients might improve cancer outcomes. Keywords: absolute lymphocyte count, recurrent hepatocellular carcinoma, thermal ablation, recurrence  

  12. Heart transplant outcomes in recipients of Centers for Disease Control (CDC) high risk donors.

    Science.gov (United States)

    Tsiouris, Athanasios; Wilson, Lynn; Sekar, Rajesh B; Mangi, Abeel A; Yun, James J

    2016-12-01

    A lack of donor hearts remains a major limitation of heart transplantation. Hearts from Centers for Disease Control (CDC) high-risk donors can be utilized with specific recipient consent. However, outcomes of heart transplantation with CDC high-risk donors are not well known. We sought to define outcomes, including posttransplant hepatitis and human immunodeficiency virus (HIV) status, in recipients of CDC high-risk donor hearts at our institution. All heart transplant recipients from August 2010 to December 2014 (n = 74) were reviewed. Comparison of 1) CDC high-risk donor (HRD) versus 2) standard-risk donor (SRD) groups were performed using chi-squared tests for nominal data and Wilcoxon two-sample tests for continuous variables. Survival was estimated with Kaplan-Meier curves. Of 74 heart transplant recipients reviewed, 66 (89%) received a SRD heart and eight (11%) received a CDC HRD heart. We found no significant differences in recipient age, sex, waiting list 1A status, pretransplant left ventricular assist device (LVAD) support, cytomegalovirus (CMV) status, and graft ischemia times (p = NS) between the HRD and SRD groups. All of the eight HRD were seronegative at the time of transplant. Postoperatively, there was no significant difference in rejection rates at six and 12 months posttransplant. Importantly, no HRD recipients acquired hepatitis or HIV. Survival in HRD versus SRD recipients was not significantly different by Kaplan-Meier analysis (log rank p = 0.644) at five years posttransplant. Heart transplants that were seronegative at the time of transplant had similar posttransplant graft function, rejection rates, and five-year posttransplant survival versus recipients of SRD hearts. At our institution, no cases of hepatitis or HIV occurred in HRD recipients in early follow-up. © 2016 Wiley Periodicals, Inc.

  13. Long-Term Outcomes With Intraoperative Radiotherapy as a Component of Treatment for Locally Advanced or Recurrent Uterine Sarcoma

    International Nuclear Information System (INIS)

    Barney, Brandon M.; Petersen, Ivy A.; Dowdy, Sean C.; Bakkum-Gamez, Jamie N.; Haddock, Michael G.

    2012-01-01

    Purpose: To report our institutional experience with intraoperative radiotherapy (IORT) as a component of treatment for women with locally advanced or recurrent uterine sarcoma. Methods and Materials: From 1990 to 2010, 16 women with primary (n = 3) or locoregionally recurrent (n = 13) uterine sarcoma received IORT as a component of combined modality treatment. Tumor histology studies found leiomyosarcoma (n = 9), endometrial stromal sarcoma (n = 4), and carcinosarcoma (n = 3). Surgery consisted of gross total resection in 2 patients, subtotal resection in 6 patients, and resection with close surgical margins in 8 patients. The median IORT dose was 12.5 Gy (range, 10–20 Gy). All patients received perioperative external beam radiotherapy (EBRT; median dose, 50.4 Gy; range, 20–62.5 Gy), and 6 patients also received perioperative systemic therapy. Results: Seven of the 16 patients are alive at a median follow-up of 44 months (range, 11–203 months). The 3-year Kaplan-Meier estimate of local relapse (within the EBRT field) was 7%, and central control (within the IORT field) was 100%. No local failures occurred in any of the 6 patients who underwent subtotal resection. The 3-year freedom from distant relapse was 48%, with failures occurring most frequently in the lungs or mediastinum. Median survival was 18 months, and 3-year Kaplan-Meier estimates of cause-specific and overall survival were 58% and 53%, respectively. Three patients (19%) experienced late Grade 3 toxicity. Conclusions: A combined modality approach with perioperative EBRT, surgery, and IORT for locally advanced or recurrent uterine sarcoma resulted in excellent local disease control with acceptable toxicity, even in patients with positive resection margins. With this approach, some patients were able to experience long-term freedom from recurrence.

  14. Comparison of Pathologic Response Evaluation Systems after Anthracycline with/without Taxane-Based Neoadjuvant Chemotherapy among Different Subtypes of Breast Cancers.

    Directory of Open Access Journals (Sweden)

    Hee Jin Lee

    Full Text Available Several methods are used to assess the pathologic response of breast cancer after neoadjuvant chemotherapy (NAC to predict clinical outcome. However, the clinical utility of these systems for each molecular subtype of breast cancer is unclear. Therefore, we applied six pathologic response assessment systems to specific subtypes of breast cancer and compared the results.Five hundred and eighty eight breast cancer patients treated with anthracycline with/without taxane-based NAC were retrospectively analyzed, and the ypTNM stage, residual cancer burden (RCB, residual disease in breast and nodes (RDBN, tumor response ratio, Sataloff's classification, and Miller-Payne grading system were evaluated. The results obtained for each assessment system were analyzed in terms of patient survival.In triple-negative tumors, all systems were significantly associated with disease-free survival and Kaplan-Meier survival curves for disease-free survival were clearly separated by all assessment methods. For HR+/HER2- tumors, systems assessing the residual tumor (ypTNM stage, RCB, and RDBN had prognostic significance. However, for HER2+ tumors, the association between patient survival and the pathologic response assessment results varied according to the system used, and none resulted in distinct Kaplan-Meier curves.Most of the currently available pathologic assessment systems used after anthracycline with/without taxane-based NAC effectively classified triple-negative breast cancers into groups showing different prognoses. The pathologic assessment systems evaluating residual tumors only also had prognostic significance in HR+/HER2- tumors. However, new assessment methods are required to effectively evaluate the pathologic response of HR+/HER2+ and HR-/HER2+ tumors to anthracycline with/without taxane-based NAC.

  15. The Role of Vaginal Brachytherapy in the Treatment of Surgical Stage I Papillary Serous or Clear Cell Endometrial Cancer

    International Nuclear Information System (INIS)

    Barney, Brandon M.; Petersen, Ivy A.; Mariani, Andrea; Dowdy, Sean C.; Bakkum-Gamez, Jamie N.; Haddock, Michael G.

    2013-01-01

    Objectives: The optimal adjuvant therapy for International Federation of Gynecology and Obstetrics (FIGO) stage I papillary serous (UPSC) or clear cell (CC) endometrial cancer is unknown. We report on the largest single-institution experience using adjuvant high-dose-rate vaginal brachytherapy (VBT) for surgically staged women with FIGO stage I UPSC or CC endometrial cancer. Methods and Materials: From 1998-2011, 103 women with FIGO 2009 stage I UPSC (n=74), CC (n=21), or mixed UPSC/CC (n=8) endometrial cancer underwent total abdominal hysterectomy with bilateral salpingo-oophorectomy followed by adjuvant high-dose-rate VBT. Nearly all patients (n=98, 95%) also underwent extended lymph node dissection of pelvic and paraortic lymph nodes. All VBT was performed with a vaginal cylinder, treating to a dose of 2100 cGy in 3 fractions. Thirty-five patients (34%) also received adjuvant chemotherapy. Results: At a median follow-up time of 36 months (range, 1-146 months), 2 patients had experienced vaginal recurrence, and the 5-year Kaplan Meier estimate of vaginal recurrence was 3%. The rates of isolated pelvic recurrence, locoregional recurrence (vaginal + pelvic), and extrapelvic recurrence (including intraabdominal) were similarly low, with 5-year Kaplan-Meier estimates of 4%, 7%, and 10%, respectively. The estimated 5-year overall survival was 84%. On univariate analysis, delivery of chemotherapy did not affect recurrence or survival. Conclusions: VBT is effective at preventing vaginal relapse in women with surgical stage I UPSC or CC endometrial cancer. In this cohort of patients who underwent comprehensive surgical staging, the risk of isolated pelvic or extrapelvic relapse was low, implying that more extensive adjuvant radiation therapy is likely unnecessary.

  16. Communicating projected survival with treatments for chronic kidney disease: patient comprehension and perspectives on visual aids.

    Science.gov (United States)

    Dowen, Frances; Sidhu, Karishma; Broadbent, Elizabeth; Pilmore, Helen

    2017-09-21

    Mortality in end stage renal disease (ESRD) is higher than many malignancies. There is no data about the optimal way to present information about projected survival to patients with ESRD. In other areas, graphs have been shown to be more easily understood than narrative. We examined patient comprehension and perspectives on graphs in communicating projected survival in chronic kidney disease (CKD). One hundred seventy-seven patients with CKD were shown 4 different graphs presenting post transplantation survival data. Patients were asked to interpret a Kaplan Meier curve, pie chart, histogram and pictograph and answer a multi-choice question to determine understanding. We measured interpretation, usefulness and preference for the graphs. Most patients correctly interpreted the graphs. There was asignificant difference in the percentage of correct answers when comparing different graph types (p = 0.0439). The pictograph was correctly interpreted by 81% of participants, the histogram by 79%, pie chart by 77% and Kaplan Meier by 69%. Correct interpretation of the histogram was associated with educational level (p = 0.008) and inversely associated with age > 65 (p = 0.008). Of those who interpreted all four graphs correctly, there was an association with employment (p = 0.001) and New Zealand European ethnicity (p = 0.002). 87% of patients found the graphs useful. The pie chart was the most preferred graph (p 0.002). The readability of the graphs may have been improved with an alternative colour choice, especially in the setting of visual impairment. Visual aids, can be beneficial adjuncts to discussing survival in CKD.

  17. Setting the stage for medieval plague: Pre-black death trends in survival and mortality.

    Science.gov (United States)

    DeWitte, Sharon N

    2015-11-01

    The 14(th) -century Black Death was one of the most devastating epidemics in human history, killing tens of millions of people in a short period of time. It is not clear why mortality rates during the epidemic were so high. One possibility is that the affected human populations were particularly stressed in the 14(th) century, perhaps as a result of repeated famines in areas such as England. This project examines survival and mortality in two pre-Black Death time periods, 11-12(th) centuries vs 13(th) century CE, to determine if demographic conditions were deteriorating before the epidemic occurred. This study is done using a sample of individuals from several London cemeteries that have been dated, in whole or in part, either to the 11-12(th) centuries (n = 339) or 13(th) century (n = 258). Temporal trends in survivorship and mortality are assessed via Kaplan-Meier survival analysis and by modeling time period as a covariate affecting the Gompertz hazard of adult mortality. The age-at-death distributions from the two pre-Black Death time periods are significantly different, with fewer older adults in 13(th) century. The results of Kaplan-Meier survival analysis indicate reductions in survival before the Black Death, with significantly lower survival in the 13(th) century (Mantel Cox p < 0.001). Last, hazard analysis reveals increases in mortality rates before the Black Death. Together, these results suggest that health in general was declining in the 13(th) century, and this might have led to high mortality during the Black Death. This highlights the importance of considering human context to understand disease in past and living human populations. © 2015 Wiley Periodicals, Inc.

  18. Exclusive breastfeeding duration and determinants among Brazilian children under two years of age

    Directory of Open Access Journals (Sweden)

    Sarah Warkentin

    2013-06-01

    Full Text Available OBJECTIVE: The present study described the duration and identified the determinants of exclusive breastfeeding. METHODS: The study used data from the Pesquisa Nacional de Demografia e Saúde da Criança e da Mulher 2006 (National Demographic and Health Survey on Women and Children 2006. Data were collected using questionnaires administered by trained professionals and refer to a subsample of 1,704 children aged less than 24 months. The estimated durations of exclusive breastfeeding are presented according to socioeconomic, demographic and epidemiological variables. Kaplan Meier estimator curves were used to produce valid estimates of breastfeeding duration and the Cox's proportional hazards model was fitted to identify risks. RESULTS: The median estimated duration of exclusive breastfeeding was 60 days. The final Cox model consisted of mother's age <20 years (hazard ratio=1.53, 95% confidence interval=1.11-1.48, use of pacifier (hazard ratio=1.53, 95% confidence interval=1.37-1.71, not residing in the country's southeast region (hazard ratio=1.22, 95% confidence interval=1.07-1.40 and socioeconomic status (hazard ratio=1.28, 95% confidence interval=1.06-1.55. CONCLUSION: The Kaplan Meier estimator corrected the underestimated duration of breastfeeding in the country when calculated by the current status methodology. Despite the national efforts done in the last decades to promote breastfeeding, the results indicate that the duration of exclusive breastfeeding is still half of that recommended for this dietary practice to promote health. Ways to revert this situation would be ongoing educational activities involving the educational and health systems, associated with advertising campaigns on television and radio mainly targeting young mothers with low education level and low income, identified as those at high risk of weaning their children early.

  19. Setting standards and monitoring quality in the NHS 1999–2013: a classic case of goal conflict

    Science.gov (United States)

    Knight, Alec; Littlejohns, Anna; Poole, Tara‐Lynn; Kieslich, Katharina

    2016-01-01

    Abstract 2013 saw the National Health Service (NHS) in England severely criticized for providing poor quality despite successive governments in the previous 15 years, establishing a range of new institutions to improve NHS quality. This study seeks to understand the contributions of political and organizational influences in enabling the NHS to deliver high‐quality care through exploring the experiences of two of the major new organizations established to set standards and monitor NHS quality. We used a mixed method approach: first a cross‐sectional, in‐depth qualitative interview study and then the application of principal agent modeling (Waterman and Meier broader framework). Ten themes were identified as influencing the functioning of the NHS regulatory institutions: socio‐political environment; governance and accountability; external relationships; clarity of purpose; organizational reputation; leadership and management; organizational stability; resources; organizational methods; and organizational performance. The organizations could be easily mapped onto the framework, and their transience between the different states could be monitored. We concluded that differing policy objectives for NHS quality monitoring resulted in central involvement and organizational change. This had a disruptive effect on the ability of the NHS to monitor quality. Constant professional leadership, both clinical and managerial, and basing decisions on best evidence, both technical and organizational, helped one institution to deliver on its remit, even within a changing political/policy environment. Application of the Waterman–Meier framework enabled an understanding and description of the dynamic relationship between central government and organizations in the NHS and may predict when tensions will arise in the future. © 2016 The Authors. The International Journal of Health Planning and Management Published by John Wiley & Sons Ltd. PMID:27435020

  20. Perioperative and mid-term oncologic outcomes of robotic assisted radical cystectomy with totally intracorporeal neobladder: Results of a propensity score matched comparison with open cohort from a single-centre series.

    Science.gov (United States)

    Simone, Giuseppe; Tuderti, Gabriele; Misuraca, Leonardo; Anceschi, Umberto; Ferriero, Mariaconsiglia; Minisola, Francesco; Guaglianone, Salvatore; Gallucci, Michele

    2018-04-17

    In this study, we compared perioperative and oncologic outcomes of patients treated with either open or robot-assisted radical cystectomy and intracorporeal neobladder at a tertiary care center. The institutional prospective bladder cancer database was queried for "cystectomy with curative intent" and "neobladder". All patients underwent robot-assisted radical cystectomy and intracorporeal neobladder or open radical cystectomy and orthotopic neobladder for high-grade non-muscle invasive bladder cancer or muscle invasive bladder cancer with a follow-up length ≥2 years were included. A 1:1 propensity score matching analysis was used. Kaplan-Meier method was performed to compare oncologic outcomes of selected cohorts. Survival rates were computed at 1,2,3 and 4 years after surgery and the log rank test was applied to assess statistical significance between the matched groups. Overall, 363 patients (299 open and 64 robotic) were included. Open radical cystectomy patients were more frequently male (p = 0.08), with higher pT stages (p = 0.003), lower incidence of urothelial histologies (p = 0.05) and lesser adoption of neoadjuvant chemotherapy (open radical cystectomy cases (all p ≥ 0.22). Open cohort showed a higher rate of perioperative overall complications (91.3% vs 42.2%, p 0.001). At Kaplan-Meier analysis robotic and open cohorts displayed comparable disease-free survival (log-rank p = 0.746), cancer-specific survival (p = 0.753) and overall-survival rates (p = 0.909). Robot-assisted radical cystectomy and intracorporeal neobladder provides comparable oncologic outcomes of open radical cystectomy and orthotopic neobladder at intermediate term survival analysis. Copyright © 2018 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical Oncology. All rights reserved.