WorldWideScience

Sample records for trna glutamate gene

  1. Nucleotide sequence of a human tRNA gene heterocluster

    International Nuclear Information System (INIS)

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-01-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

  2. Mitochondrial tRNA gene translocations in highly eusocial bees

    Directory of Open Access Journals (Sweden)

    Daniela Silvestre

    2006-01-01

    Full Text Available Mitochondrial gene rearrangement events, especially involving tRNA genes, have been described more frequently as more complete mitochondrial genome sequences are becoming available. In the present work, we analyzed mitochondrial tRNA gene rearrangements between two bee species belonging to the tribes Apini and Meliponini within the "corbiculate Apidae". Eleven tRNA genes are in different genome positions or strands. The molecular events responsible for each translocation are explained. Considering the high number of rearrangements observed, the data presented here contradict the general rule of high gene order conservation among closely related organisms, and also represent a powerful molecular tool to help solve questions about phylogeny and evolution in bees.

  3. Diversity of human tRNA genes from the 1000-genomes project.

    Science.gov (United States)

    Parisien, Marc; Wang, Xiaoyun; Pan, Tao

    2013-12-01

    The sequence diversity of individual human genomes has been extensively analyzed for variations and phenotypic implications for mRNA, miRNA, and long non-coding RNA genes. TRNA (tRNA) also exhibits large sequence diversity in the human genome, but tRNA gene sequence variation and potential functional implications in individual human genomes have not been investigated. Here we capitalize on the sequencing data from the 1000-genomes project to examine the diversity of tRNA genes in the human population. Previous analysis of the reference human genome indicated an unexpected large number of diverse tRNA genes beyond the necessity of translation, suggesting that some tRNA transcripts may perform non-canonical functions. We found 24 new tRNA sequences in>1% and 76 new tRNA sequences in>0.2% of all individuals, indicating that tRNA genes are also subject to evolutionary changes in the human population. Unexpectedly, two abundant new tRNA genes contain base-pair mismatches in the anticodon stem. We experimentally determined that these two new tRNAs have altered structures in vitro; however, one new tRNA is not aminoacylated but extremely stable in HeLa cells, suggesting that this new tRNA can be used for non-canonical function. Our results show that at the scale of human population, tRNA genes are more diverse than conventionally understood, and some new tRNAs may perform non-canonical, extra-translational functions that may be linked to human health and disease.

  4. Analysis of the complement and molecular evolution of tRNA genes in cow

    Directory of Open Access Journals (Sweden)

    Barris Wesley C

    2009-04-01

    Full Text Available Abstract Background Detailed information regarding the number and organization of transfer RNA (tRNA genes at the genome level is becoming readily available with the increase of DNA sequencing of whole genomes. However the identification of functional tRNA genes is challenging for species that have large numbers of repetitive elements containing tRNA derived sequences, such as Bos taurus. Reliable identification and annotation of entire sets of tRNA genes allows the evolution of tRNA genes to be understood on a genomic scale. Results In this study, we explored the B. taurus genome using bioinformatics and comparative genomics approaches to catalogue and analyze cow tRNA genes. The initial analysis of the cow genome using tRNAscan-SE identified 31,868 putative tRNA genes and 189,183 pseudogenes, where 28,830 of the 31,868 predicted tRNA genes were classified as repetitive elements by the RepeatMasker program. We then used comparative genomics to further discriminate between functional tRNA genes and tRNA-derived sequences for the remaining set of 3,038 putative tRNA genes. For our analysis, we used the human, chimpanzee, mouse, rat, horse, dog, chicken and fugu genomes to predict that the number of active tRNA genes in cow lies in the vicinity of 439. Of this set, 150 tRNA genes were 100% identical in their sequences across all nine vertebrate genomes studied. Using clustering analyses, we identified a new tRNA-GlyCCC subfamily present in all analyzed mammalian genomes. We suggest that this subfamily originated from an ancestral tRNA-GlyGCC gene via a point mutation prior to the radiation of the mammalian lineages. Lastly, in a separate analysis we created phylogenetic profiles for each putative cow tRNA gene using a representative set of genomes to gain an overview of common evolutionary histories of tRNA genes. Conclusion The use of a combination of bioinformatics and comparative genomics approaches has allowed the confident identification of a

  5. The structure and function of tRNA genes of higher eukaryotes.

    Science.gov (United States)

    Kubli, E

    1981-01-15

    The most recent findings concerning the structure and function of tRNA genes of higher eukaryotes are discussed in an exemplary way. The tRNA genes of higher organisms are either dispersed or clustered at different sites of the genome. Clusters contain tRNA genes oriented in both directions and on both strands of the DNA with spacers of various length inbetween. Some genes contain intervening sequences close to the 3' side of the anticodon. The primary transcription product possesses a 5' leader and a 3' trailer sequence which are removed by several maturation steps in a strict temporal and spacial order. Internal transcription control regions (promotors) are located at the 5' and 3' ends of the mature tRNA coding section of the tRNA gene. External sequences modulating the efficiency of the expression are present at the immediate 5' ends of the genes. Transfer RNA genes are located nonrandomly in the nucleosomes.

  6. Caveolin 3 gene and mitochondrial tRNA methionin gene in ...

    African Journals Online (AJOL)

    ... severe exercise intolerance, lactic acidosis and growth retardation. Since DMD is X-linked maternally inherited disease, mitochondrial mutation in tRNA (Met) gene can be suspected to be the cause for the inefficient splicing of dystrophin gene during its expression and can be implicated as the cause of dystrophin inactive ...

  7. Permuted tRNA genes of Cyanidioschyzon merolae, the origin of the tRNA molecule and the root of the Eukarya domain.

    Science.gov (United States)

    Di Giulio, Massimo

    2008-08-07

    An evolutionary analysis is conducted on the permuted tRNA genes of Cyanidioschyzon merolae, in which the 5' half of the tRNA molecule is codified at the 3' end of the gene and its 3' half is codified at the 5' end. This analysis has shown that permuted genes cannot be considered as derived traits but seem to possess characteristics that suggest they are ancestral traits, i.e. they originated when tRNA molecule genes originated for the first time. In particular, if the hypothesis that permuted genes are a derived trait were true, then we should not have been able to observe that the most frequent class of permuted genes is that of the anticodon loop type, for the simple reason that this class would derive by random permutation from a class of non-permuted tRNA genes, which instead is the rarest. This would not explain the high frequency with which permuted tRNA genes with perfectly separate 5' and 3' halves were observed. Clearly the mechanism that produced this class of permuted genes would envisage the existence, in an advanced stage of evolution, of minigenes codifying for the 5' and 3' halves of tRNAs which were assembled in a permuted way at the origin of the tRNA molecule, thus producing a high frequency of permuted genes of the class here referred. Therefore, this evidence supports the hypothesis that the genes of the tRNA molecule were assembled by minigenes codifying for hairpin-like RNA molecules, as suggested by one model for the origin of tRNA [Di Giulio, M., 1992. On the origin of the transfer RNA molecule. J. Theor. Biol. 159, 199-214; Di Giulio, M., 1999. The non-monophyletic origin of tRNA molecule. J. Theor. Biol. 197, 403-414]. Moreover, the late assembly of the permuted genes of C. merolae, as well as their ancestrality, strengthens the hypothesis of the polyphyletic origins of these genes. Finally, on the basis of the uniqueness and the ancestrality of these permuted genes, I suggest that the root of the Eukarya domain is in the super

  8. Glutamate synthase: An archaeal horizontal gene transfer?

    Indian Academy of Sciences (India)

    (GOGAT) which is a key enzyme in ammonia assimilation in bacteria, algae and plants. It catalyzes the reductive transamidation of amido nitrogen from glutamine to 2-oxoglutarate to form two molecules of glutamate (Temple et al 1998). Glutamate synthases differ according to their molecular weights, subunit compositions, ...

  9. Evidence that the mitochondrial leucyl tRNA synthetase (LARS2) gene represents a novel type 2 diabetes susceptibility gene

    DEFF Research Database (Denmark)

    hart, Leen M; Hansen, Torben; Rietveld, Ingrid

    2005-01-01

    Previously, we have shown that a mutation in the mitochondrial DNA-encoded tRNA(Leu(UUR)) gene is associated with type 2 diabetes. One of the consequences of this mutation is a reduced aminoacylation of tRNA(Leu(UUR)). In this study, we have examined whether variants in the leucyl tRNA synthetase...... gene (LARS2), involved in aminoacylation of tRNA(Leu(UUR)), associate with type 2 diabetes. Direct sequencing of LARS2 cDNA from 25 type 2 diabetic subjects revealed eight single nucleotide polymorphisms. Two of the variants were examined in 7,836 subjects from four independent populations...... no significant differences in clinical variables between carriers and noncarriers. In this study, we provide evidence that the LARS2 gene may represent a novel type 2 diabetes susceptibility gene. The mechanism by which the H324Q variant enhances type 2 diabetes risk needs to be further established...

  10. Tri-split tRNA is a transfer RNA made from 3 transcripts that provides insight into the evolution of fragmented tRNAs in archaea.

    Science.gov (United States)

    Fujishima, Kosuke; Sugahara, Junichi; Kikuta, Kaoru; Hirano, Reiko; Sato, Asako; Tomita, Masaru; Kanai, Akio

    2009-02-24

    Transfer RNA (tRNA) is essential for decoding the genome sequence into proteins. In Archaea, previous studies have revealed unique multiple intron-containing tRNAs and tRNAs that are encoded on 2 separate genes, so-called split tRNAs. Here, we discovered 10 fragmented tRNA genes in the complete genome of the hyperthermoacidophilic Archaeon Caldivirga maquilingensis that are individually transcribed and further trans-spliced to generate all of the missing tRNAs encoding glycine, alanine, and glutamate. Notably, the 3 mature tRNA(Gly)'s with synonymous codons are created from 1 constitutive 3' half transcript and 4 alternatively switching transcripts, representing tRNA made from a total of 3 transcripts named a "tri-split tRNA." Expression and nucleotide sequences of 10 split tRNA genes and their joined tRNA products were experimentally verified. The intervening sequences of split tRNA have high identity to tRNA intron sequences located at the same positions in intron-containing tRNAs in related Thermoproteales species. This suggests that an evolutionary relationship between intron-containing and split tRNAs exists. Our findings demonstrate the first example of split tRNA genes in a free-living organism and a unique tri-split tRNA gene that provides further insight into the evolution of fragmented tRNAs.

  11. Deletion analysis of the expression of rRNA genes and associated tRNA genes carried by a lambda transducing bacteriophage

    International Nuclear Information System (INIS)

    Morgan, E.A.; Nomura, M.

    1979-01-01

    Transducing phage lambda ilv5 carries genes for rRNA's, spacer tRNA's (tRNA 1 /sup Ile/ and tRNA/sub 1B//sup Ala/), and two other tRNA's (tRNA 1 /sup Asp/ and tRNA/sup Trp/). We have isolated a mutant of lambda ilv5, lambda ilv5su7, which carries an amber suppressor mutation in the tRNA/sup Trp/ gene. A series of deletion mutants were isolated from the lambda ilv5su7 phage. Genetic and biochemical analyses of these deletion mutants have confirmed our previous conclusion that the genes for tRNA 1 /sup Asp/ and tRNA/sup Trp/ located at the distal end of the rRNA operon (rrnC) are cotranscribed with other rRNA genes in that operon. In addition, these deletions were used to define roughly the physical location of the promoter(s) of the rRNA operon carried by the lambda ilv5su7 transducing phage

  12. Isolation and characterization of the rat gene encoding glutamate dehydrogenase

    NARCIS (Netherlands)

    Das, A. T.; Arnberg, A. C.; Malingré, H.; Moerer, P.; Charles, R.; Moorman, A. F.; Lamers, W. H.

    1993-01-01

    The concentration of glutamate dehydrogenase (GDH) varies strongly between different organs and between different regions within organs. To permit further studies on the regulation of GDH expression, we isolated and characterized the rat gene encoding the GDH protein. This gene contains 13 exons and

  13. Engineering and Validation of a Vector for Concomitant Expression of Rare Transfer RNA (tRNA) and HIV-1 nef Genes in Escherichia coli.

    Science.gov (United States)

    Mualif, Siti Aisyah; Teow, Sin-Yeang; Omar, Tasyriq Che; Chew, Yik Wei; Yusoff, Narazah Mohd; Ali, Syed A

    2015-01-01

    Relative ease in handling and manipulation of Escherichia coli strains make them primary candidate to express proteins heterologously. Overexpression of heterologous genes that contain codons infrequently used by E. coli is related with difficulties such as mRNA instability, early termination of transcription and/or translation, deletions and/or misincorporation, and cell growth inhibition. These codon bias -associated problems are addressed by co-expressing ColE1-compatible, rare tRNA expressing helper plasmids. However, this approach has inadequacies, which we have addressed by engineering an expression vector that concomitantly expresses the heterologous protein of interest, and rare tRNA genes in E. coli. The expression vector contains three (argU, ileY, leuW) rare tRNA genes and a useful multiple cloning site for easy in-frame cloning. To maintain the overall size of the parental plasmid vector, the rare tRNA genes replaced the non-essential DNA segments in the vector. The cloned gene is expressed under the control of T7 promoter and resulting recombinant protein has a C-terminal 6His tag for IMAC-mediated purification. We have evaluated the usefulness of this expression vector by expressing three HIV-1 genes namely HIV-1 p27 (nef), HIV-1 p24 (ca), and HIV-1 vif in NiCo21(DE3) E.coli and demonstrated the advantages of using expression vector that concomitantly expresses rare tRNA and heterologous genes.

  14. Engineering and Validation of a Vector for Concomitant Expression of Rare Transfer RNA (tRNA and HIV-1 nef Genes in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Siti Aisyah Mualif

    Full Text Available Relative ease in handling and manipulation of Escherichia coli strains make them primary candidate to express proteins heterologously. Overexpression of heterologous genes that contain codons infrequently used by E. coli is related with difficulties such as mRNA instability, early termination of transcription and/or translation, deletions and/or misincorporation, and cell growth inhibition. These codon bias -associated problems are addressed by co-expressing ColE1-compatible, rare tRNA expressing helper plasmids. However, this approach has inadequacies, which we have addressed by engineering an expression vector that concomitantly expresses the heterologous protein of interest, and rare tRNA genes in E. coli. The expression vector contains three (argU, ileY, leuW rare tRNA genes and a useful multiple cloning site for easy in-frame cloning. To maintain the overall size of the parental plasmid vector, the rare tRNA genes replaced the non-essential DNA segments in the vector. The cloned gene is expressed under the control of T7 promoter and resulting recombinant protein has a C-terminal 6His tag for IMAC-mediated purification. We have evaluated the usefulness of this expression vector by expressing three HIV-1 genes namely HIV-1 p27 (nef, HIV-1 p24 (ca, and HIV-1 vif in NiCo21(DE3 E.coli and demonstrated the advantages of using expression vector that concomitantly expresses rare tRNA and heterologous genes.

  15. [Effects of dietary monosodium-glutamate on gene expression].

    Science.gov (United States)

    Jurasek, Júlia Vanda; Raposa, László Bence; Gubicskóné Kisbenedek, Andrea; Varga, Veronika; Szabó, Zoltán; Varjas, Tímea

    2017-03-01

    Nowadays, the food industry more often uses different type of additives during the food production. Our aim was to examine the monosodium-glutamate's effect (in animal experiment) on DNA-methyltransferases in gene expression patterns of mRNA levels. In the investigation we used 24 (n=24) CD1 type female mice. The animals were fed with different equivalent human doses of the tested substance. After autopsy, mRNA was isolated from different tissues (lung, liver, kidney, spleen). DNMT1, DNMT3A and DNMT3B levels were determined by Quantitative Real-Time PCR. DNMT1 significantly suppressed the gene expression in all the three treated groups (pmonosodium glutamate, suppressed the DNMT1 and DNMT3A gene expression - on mRNA levels of several organs - in mice. It can be a similar chemopreventive effect to epigallo-catechin-gallate's, curcumin's, genistein's, likopine's and rezveratrol's effects. In this case it can be possible that the MSG has anticarcinogenic effects. Orv. Hetil., 2017, 158(10), 380-385.

  16. Deletion of genes involved in glutamate metabolism to improve poly-gamma-glutamic acid production in B. amyloliquefaciens LL3.

    Science.gov (United States)

    Zhang, Wei; He, Yulian; Gao, Weixia; Feng, Jun; Cao, Mingfeng; Yang, Chao; Song, Cunjiang; Wang, Shufang

    2015-02-01

    Here, we attempted to elevate poly-gamma-glutamic acid (γ-PGA) production by modifying genes involved in glutamate metabolism in Bacillus amyloliquefaciens LL3. Products of rocR, rocG and gudB facilitate the conversion from glutamate to 2-oxoglutarate in Bacillus subtillis. The gene odhA is responsible for the synthesis of a component of the 2-oxoglutarate dehydrogenase complex that catalyzes the oxidative decarboxylation of 2-oxoglutarate to succinyl coenzyme A. In-frame deletions of these four genes were performed. In shake flask experiments the gudB/rocG double mutant presented enhanced production of γ-PGA, a 38 % increase compared with wild type. When fermented in a 5-L fermenter with pH control, the γ-PGA yield of the rocR mutant was increased to 5.83 g/L from 4.55 g/L for shake flask experiments. The gudB/rocG double mutant produced 5.68 g/L γ-PGA compared with that of 4.03 g/L for the wild type, a 40 % increase. Those results indicated the possibility of improving γ-PGA production by modifying glutamate metabolism, and identified potential genetic targets to improve γ-PGA production.

  17. Molecular cloning and chromosomal localization of one of the human glutamate receptor genes

    OpenAIRE

    Puckett, Carmie; Gomez, Christopher M.; Korenberg, Julie R.; Tung, Howard; Meier, Timothy J.; Chen, Xiao Ning; Hood, Leroy

    1991-01-01

    Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are classified on the basis of their activation by different agonists. The agonists kainate and alpha-amino-3-hydroxy-5-methyl-4-isoxasolepropionic acid define a class of glutamate receptors termed kainate receptors. We have isolated and sequenced a human glutamate receptor (GluHI) cDNA and determined the chromosomal localization of its gene. The DNA sequence of GluHI would encode a 907-am...

  18. Secondary structure and feature of mitochondrial tRNA genes of the Ussurian tube-nosed bat Murina ussuriensis (Chiroptera: Vespertilionidae).

    Science.gov (United States)

    Yoon, Kwang Bae; Park, Yung Chul

    2015-09-01

    The complete mitogenome (NC_021119) of the Ussurian tube-nosed bat Murina ussuriensis (Chiroptera: Vespertilionidae) was annotated and characterized in our recent publication (http://www.ncbi.nlm.nih.gov/nuccore/NC_021119). Here we provide additional information on methods in detail for obtaining the complete sequence of M. ussuriensis mitogenome. In addition, we describe characteristics of 22 tRNA genes and secondary structure and feature of 22 tRNAs of M. ussuriensis mitogenome.

  19. Secondary structure and feature of mitochondrial tRNA genes of the Ussurian tube-nosed bat Murina ussuriensis (Chiroptera: Vespertilionidae

    Directory of Open Access Journals (Sweden)

    Kwang Bae Yoon

    2015-09-01

    Full Text Available The complete mitogenome (NC_021119 of the Ussurian tube-nosed bat Murina ussuriensis (Chiroptera: Vespertilionidae was annotated and characterized in our recent publication (http://www.ncbi.nlm.nih.gov/nuccore/NC_021119. Here we provide additional information on methods in detail for obtaining the complete sequence of M. ussuriensis mitogenome. In addition, we describe characteristics of 22 tRNA genes and secondary structure and feature of 22 tRNAs of M. ussuriensis mitogenome.

  20. Cardiac abnormalities in diabetic patients with mutation in the mitochondrial tRNA Leu(UUR)Gene

    International Nuclear Information System (INIS)

    Ueno, Hiroshi; Shiotani, Hideyuki

    1999-01-01

    An A-to-G transition at position 3243 of the mitochondrial DNA is known to be a pathogenic factor for mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS), diabetes and cardiomyopathy. This mutation causes dysfunction of the central nervous system in MELAS. Because the heart, as well as the brain and nervous system, is highly dependent on the energy produced by mitochondrial oxidation, these tissues are more vulnerable to mitochondrial defects. Cardiac abnormalities were assessed in 10 diabetic patients associated with this mutation using echocardiography and 123 I-metaiodobenzylguanidine (MIBG) scintigraphy, and compared with 19 diabetic patients without the mutation. Duration of diabetes, therapy, control of blood glucose and diabetic complications, such as diabetic retinopathy and nephropathy, were not different between the 2 groups. Diabetic patients with the mutation had a significantly thicker interventricular septum (16.8±3.7 vs 11.0±1.6 mm, p 0.05). In conclusion, left ventricular hypertrophy with or without abnormal wall motion and severely reduced MIBG uptake may be characteristic in diabetic patients with a mutation in the mitochondrial tRNA Leu(UUR) gene. (author)

  1. An artificial intelligence approach fit for tRNA gene studies in the era of big sequence data.

    Science.gov (United States)

    Iwasaki, Yuki; Abe, Takashi; Wada, Kennosuke; Wada, Yoshiko; Ikemura, Toshimichi

    2017-09-12

    Unsupervised data mining capable of extracting a wide range of knowledge from big data without prior knowledge or particular models is a timely application in the era of big sequence data accumulation in genome research. By handling oligonucleotide compositions as high-dimensional data, we have previously modified the conventional self-organizing map (SOM) for genome informatics and established BLSOM, which can analyze more than ten million sequences simultaneously. Here, we develop BLSOM specialized for tRNA genes (tDNAs) that can cluster (self-organize) more than one million microbial tDNAs according to their cognate amino acid solely depending on tetra- and pentanucleotide compositions. This unsupervised clustering can reveal combinatorial oligonucleotide motifs that are responsible for the amino acid-dependent clustering, as well as other functionally and structurally important consensus motifs, which have been evolutionarily conserved. BLSOM is also useful for identifying tDNAs as phylogenetic markers for special phylotypes. When we constructed BLSOM with 'species-unknown' tDNAs from metagenomic sequences plus 'species-known' microbial tDNAs, a large portion of metagenomic tDNAs self-organized with species-known tDNAs, yielding information on microbial communities in environmental samples. BLSOM can also enhance accuracy in the tDNA database obtained from big sequence data. This unsupervised data mining should become important for studying numerous functionally unclear RNAs obtained from a wide range of organisms.

  2. Translational infidelity-induced protein stress results from a deficiency in Trm9-catalyzed tRNA modifications.

    Science.gov (United States)

    Patil, Ashish; Chan, Clement T Y; Dyavaiah, Madhu; Rooney, John P; Dedon, Peter C; Begley, Thomas J

    2012-07-01

    Correct codon-anticodon pairing promotes translational fidelity, with these interactions greatly facilitated by modified nucleosides found in tRNA. We hypothesized that wobble uridine modifications catalyzed by tRNA methyltransferase 9 (Trm9) are essential for translational fidelity. In support, we have used phenotypic, reporter and protein-based assays to demonstrate increased translational infidelity in trm9Δ Saccharomyces cerevisiae cells. Codon reengineering studies suggest that Trm9-catalyzed tRNA modifications promote fidelity during the translation of specific genes, those rich in arginine and glutamic acid codons from mixed boxes. Using quantitative tRNA modification analysis, we determined that trm9Δ cells are only deficient in 2 of 23 tRNA modifications, with those 2, 5-methoxycarbonylmethyluridine (mcm ( 5) U) and 5-methoxycarbonylmethyl-2-thiouridine (mcm ( 5) s ( 2) U), classified as key determinants of translational fidelity. We also show that in the absence of mcm ( 5) U and mcm ( 5) s ( 2) U, the resulting translational infidelity promotes protein errors and activation of unfolded protein and heat shock responses. These data support a model in which Trm9-catalyzed tRNA modifications promote fidelity during the translation of specific transcripts, with decreased wobble base modification leading to translational infidelity, protein errors and activation of protein stress response pathways.

  3. Vector-mediated chromosomal integration of the glutamate decarboxylase gene in streptococcus thermophilus

    Science.gov (United States)

    The integrative vector pINTRS was used to transfer glutamate decarboxylase (GAD) activity to Streptococcus thermophilus ST128, thus allowing for the production of '-aminobutyric acid (GABA). In pINTRS, the gene encoding glutamate decarboxylase, gadB, was flanked by DNA fragments homologous to a S. ...

  4. Cardiac abnormalities in diabetic patients with mutation in the mitochondrial tRNA {sup Leu(UUR)}Gene

    Energy Technology Data Exchange (ETDEWEB)

    Ueno, Hiroshi [Hyogo Medical Center for Adults, Akashi (Japan); Shiotani, Hideyuki

    1999-11-01

    An A-to-G transition at position 3243 of the mitochondrial DNA is known to be a pathogenic factor for mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS), diabetes and cardiomyopathy. This mutation causes dysfunction of the central nervous system in MELAS. Because the heart, as well as the brain and nervous system, is highly dependent on the energy produced by mitochondrial oxidation, these tissues are more vulnerable to mitochondrial defects. Cardiac abnormalities were assessed in 10 diabetic patients associated with this mutation using echocardiography and {sup 123}I-metaiodobenzylguanidine (MIBG) scintigraphy, and compared with 19 diabetic patients without the mutation. Duration of diabetes, therapy, control of blood glucose and diabetic complications, such as diabetic retinopathy and nephropathy, were not different between the 2 groups. Diabetic patients with the mutation had a significantly thicker interventricular septum (16.8{+-}3.7 vs 11.0{+-}1.6 mm, p<0.001) than those without the mutation. Fractional shortening was lower in diabetic patients with the mutation than those without it (30.7{+-}7.0 vs 42.5{+-}6.6, p<0.001). MIBG uptake on the delayed MIBG image was significantly lower in diabetic patients with the mutation than in those without the mutation (mean value of the heart to mediastinum ratio: 1.6{+-}0.2 vs 2.0{+-}0.4, p>0.05). In conclusion, left ventricular hypertrophy with or without abnormal wall motion and severely reduced MIBG uptake may be characteristic in diabetic patients with a mutation in the mitochondrial tRNA {sup Leu(UUR)} gene. (author)

  5. A Comprehensive tRNA Deletion Library Unravels the Genetic Architecture of the tRNA Pool

    Science.gov (United States)

    Bloom-Ackermann, Zohar; Navon, Sivan; Gingold, Hila; Towers, Ruth; Pilpel, Yitzhak; Dahan, Orna

    2014-01-01

    Deciphering the architecture of the tRNA pool is a prime challenge in translation research, as tRNAs govern the efficiency and accuracy of the process. Towards this challenge, we created a systematic tRNA deletion library in Saccharomyces cerevisiae, aimed at dissecting the specific contribution of each tRNA gene to the tRNA pool and to the cell's fitness. By harnessing this resource, we observed that the majority of tRNA deletions show no appreciable phenotype in rich medium, yet under more challenging conditions, additional phenotypes were observed. Robustness to tRNA gene deletion was often facilitated through extensive backup compensation within and between tRNA families. Interestingly, we found that within tRNA families, genes carrying identical anti-codons can contribute differently to the cellular fitness, suggesting the importance of the genomic surrounding to tRNA expression. Characterization of the transcriptome response to deletions of tRNA genes exposed two disparate patterns: in single-copy families, deletions elicited a stress response; in deletions of genes from multi-copy families, expression of the translation machinery increased. Our results uncover the complex architecture of the tRNA pool and pave the way towards complete understanding of their role in cell physiology. PMID:24453985

  6. Evolution of glutamate dehydrogenase genes: evidence for lateral gene transfer within and between prokaryotes and eukaryotes

    Directory of Open Access Journals (Sweden)

    Roger Andrew J

    2003-06-01

    Full Text Available Abstract Background Lateral gene transfer can introduce genes with novel functions into genomes or replace genes with functionally similar orthologs or paralogs. Here we present a study of the occurrence of the latter gene replacement phenomenon in the four gene families encoding different classes of glutamate dehydrogenase (GDH, to evaluate and compare the patterns and rates of lateral gene transfer (LGT in prokaryotes and eukaryotes. Results We extend the taxon sampling of gdh genes with nine new eukaryotic sequences and examine the phylogenetic distribution pattern of the various GDH classes in combination with maximum likelihood phylogenetic analyses. The distribution pattern analyses indicate that LGT has played a significant role in the evolution of the four gdh gene families. Indeed, a number of gene transfer events are identified by phylogenetic analyses, including numerous prokaryotic intra-domain transfers, some prokaryotic inter-domain transfers and several inter-domain transfers between prokaryotes and microbial eukaryotes (protists. Conclusion LGT has apparently affected eukaryotes and prokaryotes to a similar extent within the gdh gene families. In the absence of indications that the evolution of the gdh gene families is radically different from other families, these results suggest that gene transfer might be an important evolutionary mechanism in microbial eukaryote genome evolution.

  7. Circadian modulation of gene expression, but not glutamate uptake, in mouse and rat cortical astrocytes.

    Directory of Open Access Journals (Sweden)

    Christian Beaulé

    2009-10-01

    Full Text Available Circadian clocks control daily rhythms including sleep-wake, hormone secretion, and metabolism. These clocks are based on intracellular transcription-translation feedback loops that sustain daily oscillations of gene expression in many cell types. Mammalian astrocytes display circadian rhythms in the expression of the clock genes Period1 (Per1 and Period2 (Per2. However, a functional role for circadian oscillations in astrocytes is unknown. Because uptake of extrasynaptic glutamate depends on the presence of Per2 in astrocytes, we asked whether glutamate uptake by glia is circadian.We measured glutamate uptake, transcript and protein levels of the astrocyte-specific glutamate transporter, Glast, and the expression of Per1 and Per2 from cultured cortical astrocytes and from explants of somatosensory cortex. We found that glutamate uptake and Glast mRNA and protein expression were significantly reduced in Clock/Clock, Per2- or NPAS2-deficient glia. Uptake was augmented when the medium was supplemented with dibutyryl-cAMP or B27. Critically, glutamate uptake was not circadian in cortical astrocytes cultured from rats or mice or in cortical slices from mice.We conclude that glutamate uptake levels are modulated by CLOCK, PER2, NPAS2, and the composition of the culture medium, and that uptake does not show circadian variations.

  8. ISOLATION AND CHARACTERIZATION OF THE RAT GENE ENCODING GLUTAMATE-DEHYDROGENASE

    NARCIS (Netherlands)

    DAS, AT; ARNBERG, AC; MALINGRE, H; MOERER, P; CHARLES, R; MOORMAN, AFM; LAMERS, WH

    1993-01-01

    The concentration of glutamate dehydrogenase (GDH) varies strongly between different organs and between different regions within organs. To permit further studies on the regulation of GDH expression, we isolated and characterized the rat gene encoding the GDH protein. This gene contains 13 exons and

  9. Mutations of the Corynebacterium glutamicum NCgl1221 Gene, Encoding a Mechanosensitive Channel Homolog, Induce l-Glutamic Acid Production▿

    Science.gov (United States)

    Nakamura, Jun; Hirano, Seiko; Ito, Hisao; Wachi, Masaaki

    2007-01-01

    Corynebacterium glutamicum is a biotin auxotroph that secretes l-glutamic acid in response to biotin limitation; this process is employed in industrial l-glutamic acid production. Fatty acid ester surfactants and penicillin also induce l-glutamic acid secretion, even in the presence of biotin. However, the mechanism of l-glutamic acid secretion remains unclear. It was recently reported that disruption of odhA, encoding a subunit of the 2-oxoglutarate dehydrogenase complex, resulted in l-glutamic acid secretion without induction. In this study, we analyzed odhA disruptants and found that those which exhibited constitutive l-glutamic acid secretion carried additional mutations in the NCgl1221 gene, which encodes a mechanosensitive channel homolog. These NCgl1221 gene mutations lead to constitutive l-glutamic acid secretion even in the absence of odhA disruption and also render cells resistant to an l-glutamic acid analog, 4-fluoroglutamic acid. Disruption of the NCgl1221 gene essentially abolishes l-glutamic acid secretion, causing an increase in the intracellular l-glutamic acid pool under biotin-limiting conditions, while amplification of the wild-type NCgl1221 gene increased l-glutamate secretion, although only in response to induction. These results suggest that the NCgl1221 gene encodes an l-glutamic acid exporter. We propose that treatments that induce l-glutamic acid secretion alter membrane tension and trigger a structural transformation of the NCgl1221 protein, enabling it to export l-glutamic acid. PMID:17513583

  10. tRNA - RMG | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data List Contact us RMG tRNA... Data detail Data name tRNA DOI 10.18908/lsdba.nbdc00193-006 Description of data con...tents Data contents are as follows: Amino acid sequences of 23 tRNA from 17 species identified in the rice m...n Amino acids Amino acid binding to tRNA tRNA tRNA gene indicated by the cognate amino acid in one-letter code rice Rice +: tRNA... present -: tRNA absent y: pseudogene a: mitochondrial tRNA b: plastid-like tRNA Miyata

  11. Experimental Confirmation of a Whole Set of tRNA Molecules in Two Archaeal Species

    Directory of Open Access Journals (Sweden)

    Yoh-ichi Watanabe

    2015-01-01

    Full Text Available Based on the genomic sequences for most archaeal species, only one tRNA gene (isodecoder is predicted for each triplet codon. This observation promotes analysis of a whole set of tRNA molecules and actual splicing patterns of interrupted tRNA in one organism. The entire genomic sequences of two Creanarchaeota, Aeropyrum pernix and Sulfolobus tokodaii, were determined approximately 15 years ago. In these genome datasets, 47 and 46 tRNA genes were detected, respectively. Among them, 14 and 24 genes, respectively, were predicted to be interrupted tRNA genes. To confirm the actual transcription of these predicted tRNA genes and identify the actual splicing patterns of the predicted interrupted tRNA molecules, RNA samples were prepared from each archaeal species and used to synthesize cDNA molecules with tRNA sequence-specific primers. Comparison of the nucleotide sequences of cDNA clones representing unspliced and spliced forms of interrupted tRNA molecules indicated that some introns were located at positions other than one base 3' from anticodon region and that bulge-helix-bulge structures were detected around the actual splicing sites in each interrupted tRNA molecule. Whole-set analyses of tRNA molecules revealed that the archaeal tRNA splicing mechanism may be essential for efficient splicing of all tRNAs produced from interrupted tRNA genes in these archaea.

  12. Risk-Conferring Glutamatergic Genes and Brain Glutamate Plus Glutamine in Schizophrenia

    Directory of Open Access Journals (Sweden)

    Juan R. Bustillo

    2017-06-01

    Full Text Available BackgroundThe proton magnetic resonance spectroscopy (1H-MRS signals from glutamate (or the combined glutamate and glutamine signal—Glx have been found to be greater in various brain regions in people with schizophrenia. Recently, the Psychiatric Genetics Consortium reported that several common single-nucleotide polymorphisms (SNPs in glutamate-related genes confer increased risk of schizophrenia. Here, we examined the relationship between presence of these risk polymorphisms and brain Glx levels in schizophrenia.Methods1H-MRS imaging data from an axial, supraventricular tissue slab were acquired in 56 schizophrenia patients and 67 healthy subjects. Glx was measured in gray matter (GM and white matter (WM regions. The genetic data included six polymorphisms genotyped across an Illumina 5M SNP array. Only three of six glutamate as well as calcium-related SNPs were available for examination. These included three glutamate-related polymorphisms (rs10520163 in CLCN3, rs12704290 in GRM3, and rs12325245 in SLC38A7, and three calcium signaling polymorphisms (rs1339227 in RIMS1, rs7893279 in CACNB2, and rs2007044 in CACNA1C. Summary risk scores for the three glutamate and the three calcium polymorphisms were calculated.ResultsGlx levels in GM positively correlated with glutamate-related genetic risk score but only in younger (≤36 years schizophrenia patients (p = 0.01. Glx levels did not correlate with calcium risk scores. Glx was higher in the schizophrenia group compared to levels in controls in GM and WM regardless of age (p < 0.001.ConclusionElevations in brain Glx are in part, related to common allelic variants of glutamate-related genes known to increase the risk for schizophrenia. Since the glutamate risk scores did not differ between groups, some other genetic or environmental factors likely interact with the variability in glutamate-related risk SNPs to contribute to an increase in brain Glx early in the illness.

  13. Glutamic acid promotes monacolin K production and monacolin K biosynthetic gene cluster expression in Monascus.

    Science.gov (United States)

    Zhang, Chan; Liang, Jian; Yang, Le; Chai, Shiyuan; Zhang, Chenxi; Sun, Baoguo; Wang, Chengtao

    2017-12-01

    This study investigated the effects of glutamic acid on production of monacolin K and expression of the monacolin K biosynthetic gene cluster. When Monascus M1 was grown in glutamic medium instead of in the original medium, monacolin K production increased from 48.4 to 215.4 mg l -1 , monacolin K production increased by 3.5 times. Glutamic acid enhanced monacolin K production by upregulating the expression of mokB-mokI; on day 8, the expression level of mokA tended to decrease by Reverse Transcription-polymerase Chain Reaction. Our findings demonstrated that mokA was not a key gene responsible for the quantity of monacolin K production in the presence of glutamic acid. Observation of Monascus mycelium morphology using Scanning Electron Microscope showed glutamic acid significantly increased the content of Monascus mycelium, altered the permeability of Monascus mycelium, enhanced secretion of monacolin K from the cell, and reduced the monacolin K content in Monascus mycelium, thereby enhancing monacolin K production.

  14. Schizophrenia and oxidative stress: glutamate cysteine ligase modifier as a susceptibility gene

    DEFF Research Database (Denmark)

    Tosic, Mirjana; Ott, Jurg; Barral, Sandra

    2006-01-01

    Oxidative stress could be involved in the pathophysiology of schizophrenia, a major psychiatric disorder. Glutathione (GSH), a redox regulator, is decreased in patients' cerebrospinal fluid and prefrontal cortex. The gene of the key GSH-synthesizing enzyme, glutamate cysteine ligase modifier (GCLM...

  15. Molecular and comparative analysis of the hyperthermostable pyrococcus furiosus glutamate dehydrogenase and its gene

    NARCIS (Netherlands)

    Eggen, Rik I L; Geerling, Ans C M; Voorhorst, Wilfried G B; Kort, Remco; de Vos, Willem M.

    1994-01-01

    The gene for glutamate dehydrogenase (GDH) from Pyrococcus furiosus has been cloned, sequenced and expressed in Escherichia coli. Significant GDH activity could be detected in this host, allowing the further structure-function analysis of this hyperthermostable hexameric enzyme. The deduced primary

  16. Active Center Control of Termination by RNA Polymerase III and tRNA Gene Transcription Levels In Vivo.

    Directory of Open Access Journals (Sweden)

    Keshab Rijal

    2016-08-01

    Full Text Available The ability of RNA polymerase (RNAP III to efficiently recycle from termination to reinitiation is critical for abundant tRNA production during cellular proliferation, development and cancer. Yet understanding of the unique termination mechanisms used by RNAP III is incomplete, as is its link to high transcription output. We used two tRNA-mediated suppression systems to screen for Rpc1 mutants with gain- and loss- of termination phenotypes in S. pombe. 122 point mutation mutants were mapped to a recently solved 3.9 Å structure of yeast RNAP III elongation complex (EC; they cluster in the active center bridge helix and trigger loop, as well as the pore and funnel, the latter of which indicate involvement of the RNA cleavage domain of the C11 subunit in termination. Purified RNAP III from a readthrough (RT mutant exhibits increased elongation rate. The data strongly support a kinetic coupling model in which elongation rate is inversely related to termination efficiency. The mutants exhibit good correlations of terminator RT in vitro and in vivo, and surprisingly, amounts of transcription in vivo. Because assessing in vivo transcription can be confounded by various parameters, we used a tRNA reporter with a processing defect and a strong terminator. By ruling out differences in RNA decay rates, the data indicate that mutants with the RT phenotype synthesize more RNA than wild type cells, and than can be accounted for by their increased elongation rate. Finally, increased activity by the mutants appears unrelated to the RNAP III repressor, Maf1. The results show that the mobile elements of the RNAP III active center, including C11, are key determinants of termination, and that some of the mutations activate RNAP III for overall transcription. Similar mutations in spontaneous cancer suggest this as an unforeseen mechanism of RNAP III activation in disease.

  17. Modulation of gene expression of adenosine and metabotropic glutamate receptors in rat's neuronal cells exposed to L-glutamate and [60]fullerene.

    Science.gov (United States)

    Giust, Davide; Da Ros, Tatiana; Martín, Mairena; Albasanz, José Luis

    2014-08-01

    L-Glutamate (L-Glu) has been often associated not only to fundamental physiological roles, as learning and memory, but also to neuronal cell death and the genesis and development of important neurodegenerative diseases. Herein we studied the variation in the adenosine and metabotropic glutamate receptors expression induced by L-Glu treatment in rat's cortical neurons. The possibility to have structural alteration of the cells induced by L-Glu (100 nM, 1 and 10 microM) has been addressed, studying the modulation of microtubule associated protein-2 (MAP-2) and neurofilament heavy polypeptide (NEFH), natively associated proteins to the dendritic shape maintenance. Results showed that the proposed treatments were not destabilizing the cells, so the L-Glu concentrations were acceptable to investigate fluctuation in receptors expression, which were studied by RT-PCR. Interestingly, C60 fullerene derivative t3ss elicited a protective effect against glutamate toxicity, as demonstrated by MTT assay. In addition, t3ss compound exerted a different effect on the adenosine and metabotropic glutamate receptors analyzed. Interestingly, A(2A) and mGlu1 mRNAs were significantly decreased in conditions were t3ss neuroprotected cortical neurons from L-Glu toxicity. In summary, t3ss protects neurons from glutamate toxicity in a process that appears to be associated with the modulation of the gene expression of adenosine and metabotropic glutamate receptors.

  18. Gene expression of GABA and glutamate pathway markers in the prefrontal cortex of non-suicidal elderly depressed patients

    NARCIS (Netherlands)

    Zhao, J.; Bao, A.-M.; Qi, X.-R.; Kamphuis, W.; Luchetti, S.; Lou, J.-S.; Swaab, D. F.

    2012-01-01

    The prefrontal cortex (PFC) is presumed to be involved in the pathogenesis of depression. We determined the gene expression of 32 markers of the pathways of the two main neurotransmitters of the PFC, gamma-aminobutyric acid (GABA) and l-glutamic acid (glutamate), by real-time quantitative PCR in

  19. Novel glutamate dehydrogenase genes show increased transcript and protein abundances in mature tomato fruits.

    Science.gov (United States)

    Ferraro, Gisela; Bortolotti, Santiago; Mortera, Pablo; Schlereth, Armin; Stitt, Mark; Carrari, Fernando; Kamenetzky, Laura; Valle, Estela M

    2012-06-15

    NAD(P)H-glutamate dehydrogenase (GDH, EC 1.4.1.3) contributes to the control of glutamate homeostasis in all living organisms. In bacteria and animals, GDH is a homohexamer allosterically regulated, whereas in plants NADH-GDH (EC 1.4.1.2) is also found as heterohexamer of α- and β-subunits, but its regulation remains undefined. In tomato (Solanum lycopersicum), GDH activity increases during the fruit ripening along with the content of free glutamate, the most abundant amino acid of ripe fruit involved in conferring the genuine tomato flavour. In this work, novel Slgdh-NAD genes were identified in the recently deciphered tomato genome: three encoding the α-subunit (Slgdh-NAD;A1-3) and one additional gene encoding the β-subunit of GDH (Slgdh-NAD;B1) isolated from a genomic library. These genes are located in different chromosomes. Slgdh-NAD;A1-3 show conserved structures, whereas Slgdh-NAD;B1 includes a novel 5'-untranslated exon. Slgdh-NAD;A1-3 transcripts were detected in all tomato tissues examined, showing the highest levels in mature green fruits, contrasting with Slgdh-NAD;B1 transcripts which were detected mainly in roots or in mature fruits when treated with glutamate, NaCl or salicylic acid. Analyses of GDH activity and protein distribution in different tissues of the Micro-Tom cultivar showed that only the active homohexamer of GDH β-subunits was detected in roots while heterohexamers of GDH α- and β-subunits were found in fruits. These results indicate that GDH β-subunit could modulate the heteromeric isoforms of GDH in response to the environment and physiology of the tomato fruit. This information is relevant to manipulate glutamate contents in tomato fruits genetically. Copyright © 2012 Elsevier GmbH. All rights reserved.

  20. Mutation screening of the glutamate cysteine ligase modifier (GCLM) gene in patients with schizophrenia

    DEFF Research Database (Denmark)

    Butticaz, Christophe; Werge, Thomas; Beckmann, Jacques S

    2009-01-01

    BACKGROUND: Experimental evidences show that glutathione and its rate-limiting synthesizing enzyme, the glutamate-cysteine ligase (GCL), are involved in the pathogenesis of schizophrenia. Furthermore, genetic association has been previously reported between two single nucleotide polymorphisms lying...... in noncoding regions of glutamate cysteine ligase modifier (GCLM) gene, which specifies for the modifier subunit of GCL and schizophrenia. OBJECTIVE: We wanted to investigate the presence of GCLM true functional mutations, likely in linkage disequilibrium with the previously identified single nucleotide...... relationship of any of these DNA variants with schizophrenia. CONCLUSION: It is unlikely that functional mutations in the GCLM gene could play a major role in genetic predisposition to schizophrenia and further studies will be required to assess its etiological function in the disease....

  1. Exercise induced upregulation of glutamate-cysteine ligase catalytic subunit and glutamate-cysteine ligase modifier subunit gene expression in Thoroughbred horses

    Directory of Open Access Journals (Sweden)

    Jeong-Woong Park

    2017-05-01

    Full Text Available Objective This study was performed to reveal the molecular structure and expression patterns of horse glutamate-cysteine ligase catalytic subunit (GCLC and glutamate-cysteine ligase modifier subunit (GCLM genes whose products form glutamate cysteine ligase, which were identified as differentially expressed genes in the previous study. Methods We performed bioinformatics analyses, and gene expression assay with quantitative polymerase chain reaction (qPCR for horse GCLC and GCLM genes in muscle and blood leukocytes of Thoroughbred horses Results Expression of GCLC showed the same pattern in both blood and muscle tissues after exercise. Expression of GCLC increased in the muscle and blood of Thoroughbreds, suggesting a tissue-specific regulatory mechanism for the expression of GCLC. In addition, expression of the GCLM gene increased after exercise in both the blood and muscle of Thoroughbreds. Conclusion We established the expression patterns of GCLC and GCLM in the skeletal muscle and blood of Thoroughbred horses in response to exercise. Further study is now warranted to uncover the functional importance of these genes in exercise and recovery in racehorses.

  2. tRNA Biology in Mitochondria

    Directory of Open Access Journals (Sweden)

    Thalia Salinas-Giegé

    2015-02-01

    Full Text Available Mitochondria are the powerhouses of eukaryotic cells. They are considered as semi-autonomous because they have retained genomes inherited from their prokaryotic ancestor and host fully functional gene expression machineries. These organelles have attracted considerable attention because they combine bacterial-like traits with novel features that evolved in the host cell. Among them, mitochondria use many specific pathways to obtain complete and functional sets of tRNAs as required for translation. In some instances, tRNA genes have been partially or entirely transferred to the nucleus and mitochondria require precise import systems to attain their pool of tRNAs. Still, tRNA genes have also often been maintained in mitochondria. Their genetic arrangement is more diverse than previously envisaged. The expression and maturation of mitochondrial tRNAs often use specific enzymes that evolved during eukaryote history. For instance many mitochondria use a eukaryote-specific RNase P enzyme devoid of RNA. The structure itself of mitochondrial encoded tRNAs is also very diverse, as e.g., in Metazoan, where tRNAs often show non canonical or truncated structures. As a result, the translational machinery in mitochondria evolved adapted strategies to accommodate the peculiarities of these tRNAs, in particular simplified identity rules for their aminoacylation. Here, we review the specific features of tRNA biology in mitochondria from model species representing the major eukaryotic groups, with an emphasis on recent research on tRNA import, maturation and aminoacylation.

  3. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation.

    Science.gov (United States)

    Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi

    2017-12-07

    Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE , a biosynthesis gene cluster of γ-PGA, and pgdS , a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.

  4. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation

    Directory of Open Access Journals (Sweden)

    Yi-Huang Hsueh

    2017-12-01

    Full Text Available Poly-γ-glutamic acid (γ-PGA is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.

  5. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation

    Science.gov (United States)

    Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi

    2017-01-01

    Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production. PMID:29215550

  6. Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

    DEFF Research Database (Denmark)

    Durkin, M E; Jäger, A C; Khurana, T S

    1999-01-01

    The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

  7. Gene transcript accumulation and in situ mRNA hybridization of two putative glutamate dehydrogenase genes in etiolated Glycine max seedlings.

    Science.gov (United States)

    Dimou, M; Tsaniklidis, G; Aivalakis, G; Katinakis, P

    2015-01-01

    Glutamate dehydrogenase (EC 1.4.1.2) is a multimeric enzyme that catalyzes the reversible amination of α-ketoglutarate to form glutamate. We characterized cDNA clones of two Glycine max sequences, GmGDH1 and GmGDH2, that code for putative α- and β-subunits, respectively, of the NADH dependent enzyme. Temporal and spatial gene transcript accumulation studies using semiquantitative RT-PCR and in situ hybridization have shown an overlapping gene transcript accumulation pattern with differences in relative gene transcript accumulation in the organs examined. Detection of NADH-dependent glutamate dehydrogenase activity in situ using a histochemical method showed concordance with the spatial gene transcript accumulation patterns. Our findings suggest that although the two gene transcripts are co-localized in roots of etiolated soybean seedlings, the ratio of the two subunits of the active holoenzyme may vary among tissues.

  8. Glutamate receptors in NG2-glial cells: gene profiling and functional changes after ischemic brain injury

    OpenAIRE

    Waloschková, Eliška

    2017-01-01

    Glutamate is the main excitatory neurotransmitter in the mammalian brain and its transmission is responsible for higher brain functions, such as learning, memory and cognition. Glutamate action is mediated by a variety of glutamate receptors, though their properties were until now studied predominantly in neurons. Glutamate receptors are expressed also in NG2-glia, however their role under physiological conditions as well as in pathological states of the central nervous system is not fully un...

  9. Hyperactivity in mice lacking one allele of the glutamic acid decarboxylase 67 gene.

    Science.gov (United States)

    Smith, Karen Müller

    2018-03-19

    GABAergic interneuron loss, maturational delay or imbalance of glutamatergic to GABAergic signaling has been implicated in several neuropsychiatric disorders including Tourette syndrome and attention-deficit/hyperactivity disorder (ADHD). In schizophrenia, decreases in parvalbumin (PV), somatostatin (Sst) and glutamic acid decarboxylase (GAD) RNA have been observed and seem to indicate a failure in maturation in PV and Sst neurons. In Tourette syndrome, which has a high level of comorbid ADHD, reduced numbers of parvalbumin expressing neurons have been observed in the basal ganglia of affected patients. In addition, polymorphisms in the GAD1 gene that codes for GAD67 protein have been associated with ADHD. We have examined whether mice with a disrupted Gad67 allele, the Gad67 GFP knock-in mice (Gad67-GFP +/- ), display abnormal locomotor behavior or altered anxiety behavior on the elevated plus maze. We found that Gad67-GFP +/- mice displayed a mild hyperactivity compared to control littermates.

  10. Differential levels of glutamate dehydrogenase 1 (GLUD1) in Balb/c and C57BL/6 mice and the effects of overexpression of the Glud1 gene on glutamate release in striatum.

    Science.gov (United States)

    Hascup, Kevin N; Bao, Xiaodong; Hascup, Erin R; Hui, Dongwei; Xu, Wenhao; Pomerleau, Francois; Huettl, Peter; Michaelis, Mary L; Michaelis, Elias K; Gerhardt, Greg A

    2011-04-21

    We have previously shown that overexpression of the Glud1 (glutamate dehydrogenase 1) gene in neurons of C57BL/6 mice results in increased depolarization-induced glutamate release that eventually leads to selective neuronal injury and cell loss by 12 months of age. However, it is known that isogenic lines of Tg (transgenic) mice produced through back-crossing with one strain may differ in their phenotypic characteristics from those produced using another inbred mouse strain. Therefore, we decided to introduce the Glud1 transgene into the Balb/c strain that has endogenously lower levels of GLUD1 (glutamate dehydrogenase 1) enzyme activity in the brain as compared with C57BL/6. Using an enzyme-based MEA (microelectrode array) that is selective for measuring glutamate in vivo, we measured depolarization-induced glutamate release. Within a discrete layer of the striatum, glutamate release was significantly increased in Balb/c Tg mice compared with wt (wild-type) littermates. Furthermore, Balb/c mice released approx. 50-60% of the amount of glutamate compared with C57BL/6 mice. This is similar to the lower levels of endogenous GLUD1 protein in Balb/c compared with C57BL/6 mice. The development of these Glud1-overexpressing mice may allow for the exploration of key molecular events produced by chronic exposure of neurons to moderate, transient increases in glutamate release, a process hypothesized to occur in neurodegenerative disorders.

  11. Regulation of glutamate transporter 1 (GLT-1) gene expression by cocaine self-administration and withdrawal.

    Science.gov (United States)

    Kim, Ronald; Sepulveda-Orengo, Marian T; Healey, Kati L; Williams, Emily A; Reissner, Kathryn J

    2018-01-01

    Downregulation of the astroglial glutamate transporter GLT-1 is observed in the nucleus accumbens (NAc) following administration of multiple drugs of abuse. The decrease in GLT-1 protein expression following cocaine self-administration is dependent on both the amount of cocaine self-administered and the length of withdrawal, with longer access to cocaine and longer withdrawal periods leading to greater decreases in GLT-1 protein. However, the mechanism(s) by which cocaine downregulates GLT-1 protein remains unknown. We used qRT-PCR to examine gene expression of GLT-1 splice isoforms (GLT-1A, GLT-1B) in the NAc, prelimbic cortex (PL) and basolateral amygdala (BLA) of rats, following two widely used models of cocaine self-administration: short-access (ShA) self-administration, and the long-access (LgA) self-administration/incubation model. While downregulation of GLT-1 protein is observed following ShA cocaine self-administration and extinction, this model did not lead to a change in GLT-1A or GLT-1B gene expression in any brain region examined. Forced abstinence following ShA cocaine self-administration also was without effect. In contrast, LgA cocaine self-administration and prolonged abstinence significantly decreased GLT-1A gene expression in the NAc and BLA, and significantly decreased GLT-1B gene expression in the PL. No change was observed in NAc GLT-1A gene expression one day after LgA cocaine self-administration, indicating withdrawal-induced decreases in GLT-1A mRNA. In addition, LgA cocaine self-administration and withdrawal induced hypermethylation of the GLT-1 gene in the NAc. These results indicate that a decrease in NAc GLT-1 mRNA is only observed after extended access to cocaine combined with protracted abstinence, and that epigenetic mechanisms likely contribute to this effect. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Cocaine activates Homer1 immediate early gene transcription in the mesocorticolimbic circuit: differential regulation by dopamine and glutamate signaling.

    Science.gov (United States)

    Ghasemzadeh, M Behnam; Windham, Lindsay K; Lake, Russell W; Acker, Christopher J; Kalivas, Peter W

    2009-01-01

    Homer proteins are intracellular scaffolding proteins that, among glutamate receptors, selectively bind to group1 metabotropic glutamate receptors and regulate their trafficking and intracellular signaling. Homer proteins have been implicated in synaptic and behavioral plasticity, including drug-seeking behavior after cocaine treatment. Homer1 gene activation leads to transcription of a variant mRNA (Homer1a), which functions as an immediate early gene. Homer1a competes with the constitutive Homer proteins (Homer1b/c/d, Homer2a/b, Homer3) for binding to group1 metabotropic glutamate and IP3 receptors. Binding of Homer1a to these proteins disrupts their association with the intracellular signaling scaffold and modulates receptor function. In this study, using RT-PCR, activation of Homer1a mRNA transcription in response to acute and repeated administration of cocaine was characterized in prefrontal cortex, nucleus accumbens, and ventral tegmental area, three mesocorticolimbic nuclei of the rat brain. Moreover, the dopaminergic and glutamatergic regulation of Homer1 gene activation by cocaine was investigated. Acute cocaine rapidly and transiently activated transcription of Homer1a mRNA in all three nuclei. However, repeated administration of cocaine was not effective in inducing the Homer1a mRNA transcription after various withdrawal times ranging from 2 h to 3 weeks. The acute cocaine-mediated activation of Homer1 gene was regulated by D1 but not D2 dopamine receptors. The blockade of AMPA or NMDA glutamate receptors did not prevent cocaine-mediated activation of Homer1 gene in the three mesocorticolimbic nuclei. These data indicate that acute administration of cocaine transiently activates Homer1 gene producing the immediate early gene Homer1a mRNA in the three mesocorticolimbic nuclei of the rat brain. Activation of Homer1 gene may contribute to the cocaine-mediated synaptic and behavioral plasticity.

  13. Amyloid Precursor Protein inDrosophilaGlia Regulates Sleep and Genes Involved in Glutamate Recycling.

    Science.gov (United States)

    Farca Luna, Abud Jose; Perier, Magali; Seugnet, Laurent

    2017-04-19

    Amyloid precursor protein (App) plays a crucial role in Alzheimer's disease via the production and deposition of toxic β-amyloid peptides. App is heavily expressed in neurons, the focus of the vast majority of studies investigating its function. Meanwhile, almost nothing is known about App's function in glia, where it is also expressed, and can potentially participate in the regulation of neuronal physiology. In this report, we investigated whether Appl , the Drosophila homolog of App , could influence sleep-wake regulation when its function is manipulated in glial cells. Appl inhibition in astrocyte-like and cortex glia resulted in higher sleep amounts and longer sleep bout duration during the night, while overexpression had the opposite effect. These sleep phenotypes were not the result of developmental defects, and were correlated with changes in expression in glutamine synthetase (GS) in astrocyte-like glia and in changes in the gap-junction component innexin2 in cortex glia. Downregulating both GS and innexin2, but not either one individually, resulted in higher sleep amounts, similarly to Appl inhibition. Consistent with these results, the expression of GS and innexin2 are increased following sleep deprivation, indicating that GS and innexin2 genes are dynamically linked to vigilance states. Interestingly, the reduction of GS expression and the sleep phenotype observed upon Appl inhibition could be rescued by increasing the expression of the glutamate transporter dEaat1. In contrast, reducing dEaat1 expression severely disrupted sleep. These results associate glutamate recycling, sleep, and a glial function for the App family proteins. SIGNIFICANCE STATEMENT The amyloid precursor protein (App) has been intensively studied for its implication in Alzheimer's disease (AD). The attributed functions of App are linked to the physiology and cellular biology of neurons where the protein is predominantly expressed. Consequences on glia in AD are generally thought to

  14. Synthesis and evaluation of a glutamic acid-modified hPAMAM complex as a promising versatile gene carrier.

    Science.gov (United States)

    Hemmati, Mohammad; Kazemi, Bahram; Najafi, Farhood; Zarebkohan, Amir; Shirkoohi, Reza

    2016-01-01

    Hyperbranched poly(amidoamine) (HPAMAM), structurally analogous to polyamidoamine dendrimer (PAMAM) dendrimers, has been suggested to be an effective carrier for gene delivery. In the present study, glutamic acid-modified hPAMAM was developed as a novel non-viral gene carrier for the first time. The hPAMAM was synthesized by using a modified one-pot method. DNA was found to be bound to hPAMAM at different weight ratios (WhPAMAM/WDNA). The resulting HPAMAM-Glu20 was able to efficiently protect the encapsulated-DNA against degradation for over 2 h. In addition to low cytotoxicity, the transfection efficiency of hPAMAM-Glu20 represented much higher (p glutamic amino acid (Glu)-based gene delivery is an economical, effective and biocompatible method.

  15. Escherichia coli cells expressing a mutant glyV (glycine tRNA) gene have a UVM-constitutive phenotype: implications for mechanisms underlying the mutA or mutC mutator effect.

    Science.gov (United States)

    Murphy, H S; Humayun, M Z

    1997-12-01

    Transfection of M13 single-stranded viral DNA bearing a 3,N4-ethenocytosine lesion into Escherichia coli cells pretreated with UV results in a significant elevation of mutagenesis at the lesion site compared to that observed in untreated cells. This response, termed UVM, for UV modulation of mutagenesis, is induced by a variety of DNA-damaging agents and is distinct from known cellular responses to DNA damage, including the SOS response. This report describes our observation, as a part of our investigation of the UVM phenomenon, that E. coli cells bearing a mutA or mutC allele display a UVM-constitutive phenotype. These mutator alleles were recently mapped (M. M. Slupska, C. Baikalov, R. Lloyd, and J. H. Miller, Proc. Natl. Acad. Sci. USA 93:4380-4385, 1996) to the glyV (mutA) and glyW (mutC) tRNA genes. Each mutant allele was shown to arise by an identical mutation in the anticodon sequence such that the mutant tRNAs could, in principle, mistranslate aspartate codons in mRNA as glycine at a low level. Because a UVM-constitutive phenotype resulting from a mutation in a tRNA gene was unexpected, we undertook a series of experiments designed to test whether the phenotype was indeed mediated by the expression of mutant glycine tRNAs. We placed either a wild-type or a mutant glyV gene under the control of a heterologous inducible promoter on a plasmid vector. E. coli cells expressing the mutant glyV gene displayed all three of the following phenotypes: (i) missense suppression of a test allele, (ii) a mutator phenotype measured by mutation to rifampin resistance, and (iii) a UVM-constitutive phenotype. These phenotypes were not associated with cells expressing the wild-type glyV gene or with cells in which the mutant allele was present but was not transcriptionally induced. These observations provide strong support for the idea that expression of mutant tRNA can confer a mutator phenotype, including the UVM-constitutive phenotype observed in mutA and mutC cells

  16. Detection and transfer of the glutamate decarboxylase gene in Streptococcus thermophilus

    Science.gov (United States)

    GABA (gamma-aminobutyric acid) is generated from glutamate by the action of glutamic acid decarboxylase (GAD) and characterized by hypotensive, diuretic and tranquilizing effects in humans and animals. The production of GABA by lactic acid starter bacteria would enhance the functionality of fermen...

  17. Analysis of strain-specific genes in glutamic acid-producing Corynebacterium glutamicum ssp. lactofermentum AJ 1511.

    Science.gov (United States)

    Nishio, Yousuke; Koseki, Chie; Tonouchi, Naoto; Matsui, Kazuhiko; Sugimoto, Shinichi; Usuda, Yoshihiro

    2017-07-11

    Strains of the bacterium, Corynebacterium glutamicum, are widely used for the industrial production of L-glutamic acid and various other substances. C. glutamicum ssp. lactofermentum AJ 1511, formerly classified as Brevibacterium lactofermentum, and the closely related C. glutamicum ATCC 13032 have been used as industrial strains for more than 50 years. We determined the whole genome sequence of C. glutamicum AJ 1511 and performed genome-wide comparative analysis with C. glutamicum ATCC 13032 to determine strain-specific genetic differences. This analysis revealed that the genomes of the two industrial strains are highly similar despite the phenotypic differences between the two strains. Both strains harbored unique genes but gene transpositions or inversions were not observed. The largest unique region, a 220-kb AT-rich region located between 1.78 and 2.00 Mb position in C. glutamicum ATCC 13032 genome, was missing in the genome of C. glutamicum AJ 1511. The next two largest unique regions were present in C. glutamicum AJ 1511. The first region (413-484 kb position) contains several predicted transport proteins, enzymes involved in sugar metabolism, and transposases. The second region (1.47-1.50 Mb position) encodes restriction modification systems. A gene predicted to encode NADH-dependent glutamate dehydrogenase, which is involved in L-glutamate biosynthesis, is present in C. glutamicum AJ 1511. Strain-specific genes identified in this study are likely to govern phenotypes unique to each strain.

  18. Gene expression patterns in the hippocampus during the development and aging of Glud1 (Glutamate Dehydrogenase 1) transgenic and wild type mice.

    Science.gov (United States)

    Wang, Xinkun; Patel, Nilam D; Hui, Dongwei; Pal, Ranu; Hafez, Mohamed M; Sayed-Ahmed, Mohamed M; Al-Yahya, Abdulaziz A; Michaelis, Elias K

    2014-03-04

    Extraneuronal levels of the neurotransmitter glutamate in brain rise during aging. This is thought to lead to synaptic dysfunction and neuronal injury or death. To study the effects of glutamate hyperactivity in brain, we created transgenic (Tg) mice in which the gene for glutamate dehydrogenase (Glud1) is over-expressed in neurons and in which such overexpression leads to excess synaptic release of glutamate. In this study, we analyzed whole genome expression in the hippocampus, a region important for learning and memory, of 10 day to 20 month old Glud1 and wild type (wt) mice. During development, maturation and aging, both Tg and wt exhibited decreases in the expression of genes related to neurogenesis, neuronal migration, growth, and process elongation, and increases in genes related to neuro-inflammation, voltage-gated channel activity, and regulation of synaptic transmission. Categories of genes that were differentially expressed in Tg vs. wt during development were: synaptic function, cytoskeleton, protein ubiquitination, and mitochondria; and, those differentially expressed during aging were: synaptic function, vesicle transport, calcium signaling, protein kinase activity, cytoskeleton, neuron projection, mitochondria, and protein ubiquitination. Overall, the effects of Glud1 overexpression on the hippocampus transcriptome were greater in the mature and aged than the young. Glutamate hyperactivity caused gene expression changes in the hippocampus at all ages. Some of these changes may result in premature brain aging. The identification of these genomic expression differences is important in understanding the effects of glutamate dysregulation on neuronal function during aging or in neurodegenerative diseases.

  19. Gender differences in associations of glutamate decarboxylase 1 gene (GAD1 variants with panic disorder.

    Directory of Open Access Journals (Sweden)

    Heike Weber

    Full Text Available BACKGROUND: Panic disorder is common (5% prevalence and females are twice as likely to be affected as males. The heritable component of panic disorder is estimated at 48%. Glutamic acid dehydrogenase GAD1, the key enzyme for the synthesis of the inhibitory and anxiolytic neurotransmitter GABA, is supposed to influence various mental disorders, including mood and anxiety disorders. In a recent association study in depression, which is highly comorbid with panic disorder, GAD1 risk allele associations were restricted to females. METHODOLOGY/PRINCIPAL FINDINGS: Nineteen single nucleotide polymorphisms (SNPs tagging the common variation in GAD1 were genotyped in two independent gender and age matched case-control samples (discovery sample n = 478; replication sample n = 584. Thirteen SNPs passed quality control and were examined for gender-specific enrichment of risk alleles associated with panic disorder by using logistic regression including a genotype×gender interaction term. The latter was found to be nominally significant for four SNPs (rs1978340, rs3762555, rs3749034, rs2241165 in the discovery sample; of note, the respective minor/risk alleles were associated with panic disorder only in females. These findings were not confirmed in the replication sample; however, the genotype×gender interaction of rs3749034 remained significant in the combined sample. Furthermore, this polymorphism showed a nominally significant association with the Agoraphobic Cognitions Questionnaire sum score. CONCLUSIONS/SIGNIFICANCE: The present study represents the first systematic evaluation of gender-specific enrichment of risk alleles of the common SNP variation in the panic disorder candidate gene GAD1. Our tentative results provide a possible explanation for the higher susceptibility of females to panic disorder.

  20. Genome-wide copy number variation study associates metabotropic glutamate receptor gene networks with attention deficit hyperactivity disorder

    Science.gov (United States)

    Elia, Josephine; Glessner, Joseph T; Wang, Kai; Takahashi, Nagahide; Shtir, Corina J; Hadley, Dexter; Sleiman, Patrick M A; Zhang, Haitao; Kim, Cecilia E; Robison, Reid; Lyon, Gholson J; Flory, James H; Bradfield, Jonathan P; Imielinski, Marcin; Hou, Cuiping; Frackelton, Edward C; Chiavacci, Rosetta M; Sakurai, Takeshi; Rabin, Cara; Middleton, Frank A; Thomas, Kelly A; Garris, Maria; Mentch, Frank; Freitag, Christine M; Steinhausen, Hans-Christoph; Todorov, Alexandre A; Reif, Andreas; Rothenberger, Aribert; Franke, Barbara; Mick, Eric O; Roeyers, Herbert; Buitelaar, Jan; Lesch, Klaus-Peter; Banaschewski, Tobias; Ebstein, Richard P; Mulas, Fernando; Oades, Robert D; Sergeant, Joseph; Sonuga-Barke, Edmund; Renner, Tobias J; Romanos, Marcel; Romanos, Jasmin; Warnke, Andreas; Walitza, Susanne; Meyer, Jobst; Pálmason, Haukur; Seitz, Christiane; Loo, Sandra K; Smalley, Susan L; Biederman, Joseph; Kent, Lindsey; Asherson, Philip; Anney, Richard J L; Gaynor, J William; Shaw, Philip; Devoto, Marcella; White, Peter S; Grant, Struan F A; Buxbaum, Joseph D; Rapoport, Judith L; Williams, Nigel M; Nelson, Stanley F; Faraone, Stephen V; Hakonarson, Hakon

    2014-01-01

    Attention deficit hyperactivity disorder (ADHD) is a common, heritable neuropsychiatric disorder of unknown etiology. We performed a whole-genome copy number variation (CNV) study on 1,013 cases with ADHD and 4,105 healthy children of European ancestry using 550,000 SNPs. We evaluated statistically significant findings in multiple independent cohorts, with a total of 2,493 cases with ADHD and 9,222 controls of European ancestry, using matched platforms. CNVs affecting metabotropic glutamate receptor genes were enriched across all cohorts (P = 2.1 × 10−9). We saw GRM5 (encoding glutamate receptor, metabotropic 5) deletions in ten cases and one control (P = 1.36 × 10−6). We saw GRM7 deletions in six cases, and we saw GRM8 deletions in eight cases and no controls. GRM1 was duplicated in eight cases. We experimentally validated the observed variants using quantitative RT-PCR. A gene network analysis showed that genes interacting with the genes in the GRM family are enriched for CNVs in ~10% of the cases (P = 4.38 × 10−10) after correction for occurrence in the controls. We identified rare recurrent CNVs affecting glutamatergic neurotransmission genes that were overrepresented in multiple ADHD cohorts. PMID:22138692

  1. tRNA splicing

    OpenAIRE

    Abelson, John; Trotta, Christopher R.; Li, Hong

    1998-01-01

    Introns interrupt the continuity of many eukaryal genes, and therefore their removal by splicing is a crucial step in gene expression. Interestingly, even within Eukarya there are at least four splicing mechanisms. mRNA splicing in the nucleus takes place in two phosphotransfer reactions on a complex and dynamic machine, the spliceosome. This reaction is related in mechanism to the two self-splicing mechanisms for Group 1 and Group 2 introns. In fact the Group 2 introns are spliced by an iden...

  2. The promoter activity of isovaleryl-CoA dehydrogenase-encoding gene (ivdA) from Aspergillus oryzae is strictly repressed by glutamic acid.

    Science.gov (United States)

    Yamashita, Nobuo; Sakamoto, Kazutoshi; Yamada, Osamu; Akita, Osamu; Nishimura, Akira

    2007-06-01

    We cloned the isovaleryl-CoA dehydrogenase (IVD)-encoding gene from Aspergillus oryzae. The promoter of ivdA was subjected to beta-glucuronidase (GUS) reporter assays in which certain amino acids were used as a major carbon source. L-leucine most strongly induced GUS-activity, while in the case of L-glutamate, significantly low activity was found, indicating that ivdA transcription was strongly repressed by glutamic acid.

  3. DNA adenine methyltransferase (Dam) controls the expression of the cytotoxic enterotoxin (act) gene of Aeromonas hydrophila via tRNA modifying enzyme-glucose-inhibited division protein (GidA).

    Science.gov (United States)

    Erova, Tatiana E; Kosykh, Valeri G; Sha, Jian; Chopra, Ashok K

    2012-05-01

    Aeromonas hydrophila is both a human and animal pathogen, and the cytotoxic enterotoxin (Act) is a crucial virulence factor of this bacterium because of its associated hemolytic, cytotoxic, and enterotoxic activities. Previously, to define the role of some regulatory genes in modulating Act production, we showed that deletion of a glucose-inhibited division gene (gidA) encoding tRNA methylase reduced Act levels, while overproduction of DNA adenine methyltransferase (Dam) led to a concomitant increase in Act-associated biological activities of a diarrheal isolate SSU of A. hydrophila. Importantly, there are multiple GATC binding sites for Dam within an upstream sequence of the gidA gene and one such target site in the act gene upstream region. We showed the dam gene to be essential for the viability of A. hydrophila SSU, and, therefore, to better understand the interaction of the encoding genes, Dam and GidA, in act gene regulation, we constructed a gidA in-frame deletion mutant of Escherichia coli GM28 (dam(+)) and GM33 (∆dam) strains. We then tested the expressional activity of the act and gidA genes by using a promoterless pGlow-TOPO vector containing a reporter green fluorescent protein (GFP). Our data indicated that in GidA(+) strains of E. coli, constitutive methylation of the GATC site(s) by Dam negatively regulated act and gidA gene expression as measured by GFP production. However, in the ∆gidA strains, irrespective of the presence or absence of constitutively active Dam, we did not observe any alteration in the expression of the act gene signifying the role of GidA in positively regulating Act production. To determine the exact mechanism of how Dam and GidA influence Act, a real-time quantitative PCR (RT-qPCR) assay was performed. The analysis indicated an increase in gidA and act gene expression in the A. hydrophila Dam-overproducing strain, and these data matched with Act production in the E. coli GM28 strain. Thus, the extent of DNA methylation

  4. tRNA sequence data, annotation data and curation data - tRNADB-CE | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data List Contact us tRNA...DB-CE tRNA sequence data, annotation data and curation data Data detail Data name tRNA s...equence data, annotation data and curation data DOI 10.18908/lsdba.nbdc00720-001 Description of data contents Data of tRNA... search results and curation data. Three prediction programs (tRNAScan-SE, Aragorn and tRNA fi...nder) were used together to search tRNA genes. If the prediction results did not

  5. [Glutamate receptors genes polymorphism and the risk of paranoid schizophrenia in Russians and tatars from the Republic of Bashkortostan].

    Science.gov (United States)

    Gareeva, A E; Khusnutdinova, E K

    2014-01-01

    Schizophrenia is a severe mental disorder that affects about 1% of the world population, leading to disability and social exclusion. Glutamatergic neurotransmission is a violation of one of the main hypotheses put forward to explain the neurobiological mechanisms of schizophrenia. Post mortem studies have found changes in the degree of affinity glutamate receptors, their transcription, and altered expression of their subunits in the prefrontal cortex, hippocampus, and thalamus in patients with schizophrenia. As a result of genetic studies of gene family encoding ionotropic AMPA and kainate glutamate receptors in schizophrenia, ambiguous results were received. The association of polymorphic variants of genes GRIA2 and GRIK2 with paranoid schizophrenia and response to therapy with haloperidol in Russian and Tatar of the Republic of Bashkortostan was conducted in the present study. DNA samples of 257 patients with paranoid schizophrenia and of 349 healthy controls of Russian and Tatar ethnic group living in the Republic of Bashkortostan were involved into the present study. In the result of the present study: (1) high risk genetic markers of paranoid schizophrenia (PSZ) were obtained: in Russians-GR4IA2*CCC (OR = 9.60) and in Tatars-GRIK2*ATG (OR = 3.5), GRIK2*TGG (OR = 3.12) (2) The following low risk genetic markers of PSZ were revealed: in Tatars-GRIA2*T/T (rs43025506) of GRIA2 gene (OR = 0.34); in Russians.- GRIA2*CCT (OR = 0.481). (3) Genetic markers of low haloperido! treatment efficacy in respect of negative and positive symptoms GRIK2*T/T (rs2227281) of GRIK2 gene and GRAL42*C/C in Russians, GRIK2*A/A (rs995640) of GRIK2 gene in Tatars. (4) Genetic markers of low haloperidol treatment efficacy in respect of positive symptoms GRL42*C/C in Russians. The results of the present study support the hypothesis of the involvement of glutamate receptor genes in schizophrenia pathway. Considerable inter-ethnic'diversity of genetic risk factors for this disease was

  6. Analyses of Genomic tRNA Reveal Presence of Novel tRNAs in Oryza sativa

    Science.gov (United States)

    Mohanta, Tapan K.; Bae, Hanhong

    2017-01-01

    Transfer rRNAs are important molecules responsible for the translation event during protein synthesis. tRNAs are widespread found in unicellular to multi-cellular organisms. Analysis of tRNA gene family members in Oryza sativa revealed the presence of 750 tRNA genes distributed unevenly in different chromosomes. The length of O. sativa tRNAs genes were ranged from 66 to 91 nucleotides encoding 52 isoacceptor in total. tRNASer found in chromosome 8 of O. sativa encoded only 66 nucleotides which is the smallest tRNA of O. sativa and to our knowledge, this is the smallest gene of eukaryotic lineage reported so far. Analyses revealed the presence of several novel/pseudo tRNA genes in O. sativa which are reported for the first time. Multiple sequence alignment of tRNAs revealed the presence of family specific conserved consensus sequences. Functional study of these novel tRNA and family specific conserved consensus sequences will be crucial to decipher their importance in biological events. The rate of transition of O. sativa tRNA was found to be higher than the rate of transversion. Evolutionary study revealed, O. sativa tRNAs were evolved from the lineages of multiple common ancestors. Duplication and loss study of tRNAs genes revealed, majority of the O. sativa tRNA were duplicated and 17 of them were found to be undergone loss during the evolution. Orthology and paralogy study showed, the majority of O. sativa tRNA were paralogous and only a few of tRNASer were found to contain orthologous tRNAs. PMID:28713421

  7. Gender Differences in Associations of Glutamate Decarboxylase 1 Gene (GAD1) Variants with Panic Disorder

    OpenAIRE

    Weber, Heike; Scholz, Claus Jürgen; Domschke, Katharina; Baumann, Christian; Klauke, Benedikt; Jacob, Christian P.; Maier, Wolfgang; Fritze, Jürgen; Bandelow, Borwin; Zwanzger, Peter Michael; Lang, Thomas; Fehm, Lydia; Ströhle, Andreas; Hamm, Alfons; Gerlach, Alexander L.

    2012-01-01

    Background: Panic disorder is common (5% prevalence) and females are twice as likely to be affected as males. The heritable component of panic disorder is estimated at 48%. Glutamic acid dehydrogenase GAD1, the key enzyme for the synthesis of the inhibitory and anxiolytic neurotransmitter GABA, is supposed to influence various mental disorders, including mood and anxiety disorders. In a recent association study in depression, which is highly comorbid with panic disorder, GAD1 risk...

  8. Metabolite Fingerprinting in Transgenic Nicotiana tabacum Altered by the Escherichia coli Glutamate Dehydrogenase Gene

    Directory of Open Access Journals (Sweden)

    R. Mungur

    2005-01-01

    Full Text Available With about 200 000 phytochemicals in existence, identifying those of biomedical significance is a mammoth task. In the postgenomic era, relating metabolite fingerprints, abundances, and profiles to genotype is also a large task. Ion analysis using Fourier transformed ion cyclotron resonance mass spectrometry (FT-ICR-MS may provide a high-throughput approach to measure genotype dependency of the inferred metabolome if reproducible techniques can be established. Ion profile inferred metabolite fingerprints are coproducts. We used FT-ICR-MS-derived ion analysis to examine gdhA (glutamate dehydrogenase (GDH; EC 1.4.1.1 transgenic Nicotiana tabacum (tobacco carrying out altered glutamate, amino acid, and carbon metabolisms, that fundamentally alter plant productivity. Cause and effect between gdhA expression, glutamate metabolism, and plant phenotypes was analyzed by 13NH4+ labeling of amino acid fractions, and by FT-ICR-MS analysis of metabolites. The gdhA transgenic plants increased 13N labeling of glutamate and glutamine significantly. FT-ICR-MS detected 2 012 ions reproducible in 2 to 4 ionization protocols. There were 283 ions in roots and 98 ions in leaves that appeared to significantly change abundance due to the measured GDH activity. About 58% percent of ions could not be used to infer a corresponding metabolite. From the 42% of ions that inferred known metabolites we found that certain amino acids, organic acids, and sugars increased and some fatty acids decreased. The transgene caused increased ammonium assimilation and detectable ion variation. Thirty-two compounds with biomedical significance were altered in abundance by GDH including 9 known carcinogens and 14 potential drugs. Therefore, the GDH transgene may lead to new uses for crops like tobacco.

  9. Increased gene dosage of Ube3a results in autism traits and decreased glutamate synaptic transmission in mice.

    Science.gov (United States)

    Smith, Stephen E P; Zhou, Yu-Dong; Zhang, Guangping; Jin, Zhe; Stoppel, David C; Anderson, Matthew P

    2011-10-05

    People with autism spectrum disorder are characterized by impaired social interaction, reduced communication, and increased repetitive behaviors. The disorder has a substantial genetic component, and recent studies have revealed frequent genome copy number variations (CNVs) in some individuals. A common CNV that occurs in 1 to 3% of those with autism--maternal 15q11-13 duplication (dup15) and triplication (isodicentric extranumerary chromosome, idic15)--affects several genes that have been suggested to underlie autism behavioral traits. To test this, we tripled the dosage of one of these genes, the ubiquitin protein ligase Ube3a, which is expressed solely from the maternal allele in mature neurons, and reconstituted the three core autism traits in mice: defective social interaction, impaired communication, and increased repetitive stereotypic behavior. The penetrance of these autism traits depended on Ube3a gene copy number. In animals with increased Ube3a gene dosage, glutamatergic, but not GABAergic, synaptic transmission was suppressed as a result of reduced presynaptic release probability, synaptic glutamate concentration, and postsynaptic action potential coupling. These results suggest that Ube3a gene dosage may contribute to the autism traits of individuals with maternal 15q11-13 duplication and support the idea that increased E3A ubiquitin ligase gene dosage results in reduced excitatory synaptic transmission.

  10. Evidence for synergistic control of glutamate biosynthesis by glutamate dehydrogenases and glutamate in Bacillus subtilis.

    Science.gov (United States)

    Stannek, Lorena; Thiele, Martin J; Ischebeck, Till; Gunka, Katrin; Hammer, Elke; Völker, Uwe; Commichau, Fabian M

    2015-09-01

    In the Gram-positive bacterium, Bacillus subtilis glutamate is synthesized by the glutamine synthetase and the glutamate synthase (GOGAT). During growth with carbon sources that exert carbon catabolite repression, the rocG glutamate dehydrogenase (GDH) gene is repressed and the transcription factor GltC activates the expression of the GOGAT encoding gltAB genes. In the presence of amino acids of the glutamate family, the GDH RocG is synthesized and the enzyme prevents GltC from binding to DNA. The dual control of glutamate biosynthesis allows the efficient utilization of the available nutrients. Here we provide genetic and biochemical evidence that, like RocG, also the paralogous GDH GudB can inhibit the transcription factor GltC, thereby controlling glutamate biosynthesis. Contradictory previous observations show that high level of GDH activity does not result in permanent inhibition of GltC. By controlling the intracellular levels of glutamate through feeding with exogenous arginine, we observed that the GDH-dependent control of GltC and thus expression of the gltAB genes inversely correlates with the glutamate pool. These results suggest that the B. subtilis GDHs RocG and GudB in fact act as glutamate sensors. In conclusion, the GDH-mediated control of glutamate biosynthesis seems to depend on the intracellular glutamate concentration. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  11. Genome-wide gene-environment study identifies glutamate receptor gene GRIN2A as a Parkinson's disease modifier gene via interaction with coffee.

    Science.gov (United States)

    Hamza, Taye H; Chen, Honglei; Hill-Burns, Erin M; Rhodes, Shannon L; Montimurro, Jennifer; Kay, Denise M; Tenesa, Albert; Kusel, Victoria I; Sheehan, Patricia; Eaaswarkhanth, Muthukrishnan; Yearout, Dora; Samii, Ali; Roberts, John W; Agarwal, Pinky; Bordelon, Yvette; Park, Yikyung; Wang, Liyong; Gao, Jianjun; Vance, Jeffery M; Kendler, Kenneth S; Bacanu, Silviu-Alin; Scott, William K; Ritz, Beate; Nutt, John; Factor, Stewart A; Zabetian, Cyrus P; Payami, Haydeh

    2011-08-01

    Our aim was to identify genes that influence the inverse association of coffee with the risk of developing Parkinson's disease (PD). We used genome-wide genotype data and lifetime caffeinated-coffee-consumption data on 1,458 persons with PD and 931 without PD from the NeuroGenetics Research Consortium (NGRC), and we performed a genome-wide association and interaction study (GWAIS), testing each SNP's main-effect plus its interaction with coffee, adjusting for sex, age, and two principal components. We then stratified subjects as heavy or light coffee-drinkers and performed genome-wide association study (GWAS) in each group. We replicated the most significant SNP. Finally, we imputed the NGRC dataset, increasing genomic coverage to examine the region of interest in detail. The primary analyses (GWAIS, GWAS, Replication) were performed using genotyped data. In GWAIS, the most significant signal came from rs4998386 and the neighboring SNPs in GRIN2A. GRIN2A encodes an NMDA-glutamate-receptor subunit and regulates excitatory neurotransmission in the brain. Achieving P(2df) = 10(-6), GRIN2A surpassed all known PD susceptibility genes in significance in the GWAIS. In stratified GWAS, the GRIN2A signal was present in heavy coffee-drinkers (OR = 0.43; P = 6×10(-7)) but not in light coffee-drinkers. The a priori Replication hypothesis that "Among heavy coffee-drinkers, rs4998386_T carriers have lower PD risk than rs4998386_CC carriers" was confirmed: OR(Replication) = 0.59, P(Replication) = 10(-3); OR(Pooled) = 0.51, P(Pooled) = 7×10(-8). Compared to light coffee-drinkers with rs4998386_CC genotype, heavy coffee-drinkers with rs4998386_CC genotype had 18% lower risk (P = 3×10(-3)), whereas heavy coffee-drinkers with rs4998386_TC genotype had 59% lower risk (P = 6×10(-13)). Imputation revealed a block of SNPs that achieved P(2df)coffee-drinkers. This study is proof of concept that inclusion of environmental factors can help identify

  12. Genome-Wide Gene-Environment Study Identifies Glutamate Receptor Gene GRIN2A as a Parkinson's Disease Modifier Gene via Interaction with Coffee

    Science.gov (United States)

    Hamza, Taye H.; Chen, Honglei; Hill-Burns, Erin M.; Rhodes, Shannon L.; Montimurro, Jennifer; Kay, Denise M.; Tenesa, Albert; Kusel, Victoria I.; Sheehan, Patricia; Eaaswarkhanth, Muthukrishnan; Yearout, Dora; Samii, Ali; Roberts, John W.; Agarwal, Pinky; Bordelon, Yvette; Park, Yikyung; Wang, Liyong; Gao, Jianjun; Vance, Jeffery M.; Kendler, Kenneth S.; Bacanu, Silviu-Alin; Scott, William K.; Ritz, Beate; Nutt, John; Factor, Stewart A.; Zabetian, Cyrus P.; Payami, Haydeh

    2011-01-01

    Our aim was to identify genes that influence the inverse association of coffee with the risk of developing Parkinson's disease (PD). We used genome-wide genotype data and lifetime caffeinated-coffee-consumption data on 1,458 persons with PD and 931 without PD from the NeuroGenetics Research Consortium (NGRC), and we performed a genome-wide association and interaction study (GWAIS), testing each SNP's main-effect plus its interaction with coffee, adjusting for sex, age, and two principal components. We then stratified subjects as heavy or light coffee-drinkers and performed genome-wide association study (GWAS) in each group. We replicated the most significant SNP. Finally, we imputed the NGRC dataset, increasing genomic coverage to examine the region of interest in detail. The primary analyses (GWAIS, GWAS, Replication) were performed using genotyped data. In GWAIS, the most significant signal came from rs4998386 and the neighboring SNPs in GRIN2A. GRIN2A encodes an NMDA-glutamate-receptor subunit and regulates excitatory neurotransmission in the brain. Achieving P2df = 10−6, GRIN2A surpassed all known PD susceptibility genes in significance in the GWAIS. In stratified GWAS, the GRIN2A signal was present in heavy coffee-drinkers (OR = 0.43; P = 6×10−7) but not in light coffee-drinkers. The a priori Replication hypothesis that “Among heavy coffee-drinkers, rs4998386_T carriers have lower PD risk than rs4998386_CC carriers” was confirmed: ORReplication = 0.59, PReplication = 10−3; ORPooled = 0.51, PPooled = 7×10−8. Compared to light coffee-drinkers with rs4998386_CC genotype, heavy coffee-drinkers with rs4998386_CC genotype had 18% lower risk (P = 3×10−3), whereas heavy coffee-drinkers with rs4998386_TC genotype had 59% lower risk (P = 6×10−13). Imputation revealed a block of SNPs that achieved P2dfcoffee-drinkers. This study is proof of concept that inclusion of environmental factors can help identify genes that

  13. Genome-wide gene-environment study identifies glutamate receptor gene GRIN2A as a Parkinson's disease modifier gene via interaction with coffee.

    Directory of Open Access Journals (Sweden)

    Taye H Hamza

    2011-08-01

    Full Text Available Our aim was to identify genes that influence the inverse association of coffee with the risk of developing Parkinson's disease (PD. We used genome-wide genotype data and lifetime caffeinated-coffee-consumption data on 1,458 persons with PD and 931 without PD from the NeuroGenetics Research Consortium (NGRC, and we performed a genome-wide association and interaction study (GWAIS, testing each SNP's main-effect plus its interaction with coffee, adjusting for sex, age, and two principal components. We then stratified subjects as heavy or light coffee-drinkers and performed genome-wide association study (GWAS in each group. We replicated the most significant SNP. Finally, we imputed the NGRC dataset, increasing genomic coverage to examine the region of interest in detail. The primary analyses (GWAIS, GWAS, Replication were performed using genotyped data. In GWAIS, the most significant signal came from rs4998386 and the neighboring SNPs in GRIN2A. GRIN2A encodes an NMDA-glutamate-receptor subunit and regulates excitatory neurotransmission in the brain. Achieving P(2df = 10(-6, GRIN2A surpassed all known PD susceptibility genes in significance in the GWAIS. In stratified GWAS, the GRIN2A signal was present in heavy coffee-drinkers (OR = 0.43; P = 6×10(-7 but not in light coffee-drinkers. The a priori Replication hypothesis that "Among heavy coffee-drinkers, rs4998386_T carriers have lower PD risk than rs4998386_CC carriers" was confirmed: OR(Replication = 0.59, P(Replication = 10(-3; OR(Pooled = 0.51, P(Pooled = 7×10(-8. Compared to light coffee-drinkers with rs4998386_CC genotype, heavy coffee-drinkers with rs4998386_CC genotype had 18% lower risk (P = 3×10(-3, whereas heavy coffee-drinkers with rs4998386_TC genotype had 59% lower risk (P = 6×10(-13. Imputation revealed a block of SNPs that achieved P(2df<5×10(-8 in GWAIS, and OR = 0.41, P = 3×10(-8 in heavy coffee-drinkers. This study is proof of

  14. Expression of the gltP gene of Escherichia coli in a glutamate transport-deficient mutant of Rhodobacter sphaeroides restores chemotaxis to glutamate

    NARCIS (Netherlands)

    Jacobs, M.H J; van der Heide, T.; Tolner, B; Driessen, A.J.M.; Konings, W.N

    1995-01-01

    Rhodobacter sphaeroides is chemotactic to glutamate and most other amino acids. In Escherichia coli, chemotaxis involves a membrane-bound sensor that either binds the amino acid directly or interacts with the binding protein loaded with the amino acid. In R. sphaeroides, chemotaxis is thought to

  15. Mutations of the Corynebacterium glutamicum NCgl1221 Gene, Encoding a Mechanosensitive Channel Homolog, Induce l-Glutamic Acid Production▿

    OpenAIRE

    Nakamura, Jun; Hirano, Seiko; Ito, Hisao; Wachi, Masaaki

    2007-01-01

    Corynebacterium glutamicum is a biotin auxotroph that secretes l-glutamic acid in response to biotin limitation; this process is employed in industrial l-glutamic acid production. Fatty acid ester surfactants and penicillin also induce l-glutamic acid secretion, even in the presence of biotin. However, the mechanism of l-glutamic acid secretion remains unclear. It was recently reported that disruption of odhA, encoding a subunit of the 2-oxoglutarate dehydrogenase complex, resulted in l-gluta...

  16. The crystal structure of tRNA

    Indian Academy of Sciences (India)

    Madhu

    of yeast alanine tRNA by Robert Holley's group at Cornell. University (lthaca, NY, USA) in 1965, earned Holley a ... 1964, to a staff position at the MRC LMB's Division of. Molecular Genetics, then co-headed by Francis ... purification methods for tRNAs, especially for the initiator. tRNA. We were becoming less interested in ...

  17. Increased gene expression of selected vesicular and glial glutamate transporters in the frontal cortex in rats exposed to voluntary wheel running.

    Science.gov (United States)

    Graban, J; Hlavacova, N; Jezova, D

    2017-10-01

    Though positive effects of exercise on mood and well being are well recognised, the central regulatory mechanisms are still not fully understood. The present study was aimed to testing the hypothesis that voluntary wheel running activates the gene expression of glutamate transporters in the brain cortex of rats. The animals were assigned to the control and voluntary wheel running groups. Voluntary wheel running rats had free access to a stainless steel activity wheel for 3 weeks. The daily running distance gradually increased to 6.21 ± 1.05 km by day 21. Vesicular glutamate transporter 3 (VGLUT3) mRNA levels in the frontal cortex were significantly elevated in the group of running animals compared to the values in sedentary controls, while the expression of other vesicular transporters were unchanged. The concentrations of mRNA coding for glial glutamate transporter 1 (GLT-1), but not glutamate aspartate transporter (GLAST) were increased by running. Voluntary wheel running resulted in an elevation of plasma corticosterone and increased expression of brain derived neurotrophic factor (BDNF) in the frontal cortex. In conclusion, chronic voluntary wheel running results in increased gene expression of VGLUT3 and GLT-1 in the brain cortex without changes in other glutamate transporter subtypes.

  18. Brief Report: Glutamate Transporter Gene ("SLC1A1") Single Nucleotide Polymorphism (rs301430) and Repetitive Behaviors and Anxiety in Children with Autism Spectrum Disorder

    Science.gov (United States)

    Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli

    2010-01-01

    Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene ("SLC1A1") with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children…

  19. Quadruplex DNA formation in a region of the tRNA gene supE associated with hydrogen peroxide mediated mutations

    Energy Technology Data Exchange (ETDEWEB)

    Akman, S.A.; Lingeman, R.G.; Doroshow, J.H.; Smith, S.S. (City of Hope National Medical Center and Beckman Research Inst., Duarte, CA (United States))

    1991-09-03

    A hot spot for H{sub 2}O{sub 2}/Fe-mediated mutation has been observed between bases 154 and 170 of the supF gene in the mutation reporter plasmid pZ189. To further characterize this hot spot, the authors synthesized the 33mer d(pAAAGTGATGGTGGTGGGGGAAGGATTCGAACCT) (pZ33), which is complementary to bases 159-191 of the supF gene. pZ33 annealed spontaneously in 10 mM Tris-HCl (pH 8.0)-1 mM EDTA-100 mM NaCl at 50C into major forms, one of which migrates more slowly than does d(pT){sub 33} on nondenaturing 12% polyacrylamide gels. They propose that this form is a four-stranded structure stabilized by Hoogsteen-type deoxyguanosine quarters involving all deoxyguanosines of the sequence d-(pGGTGGTGGGGG) because of the following: (1) pZ33 migrates as a single form that comigrates with d(pT){sub 33} on denaturing 20% acrylamide-8 M urea gels; (2) annealing an equimolar mixture of 5{prime}-{sup 32}P-labeled pZ33 and the oligodeoxynucleotide d(pTTTTTTTTpZ33TTTTTTTT) (pZ49), as well as 5{prime}-{sup 32}P-labeled pZ49 and pZ33, caused the formation of four, discreet slowly migrating bands on nondenaturing 12% polyacrylamide gels; (3) an oligodeoxynucleotide identical with pZ33 except that every deoxyguanosine has been replaced with deoxyinosine did not anneal into a slowly migrating for; (4) dimethyl sulfate protection studies demonstrated that all deoxyguanosines of the sequence d(pGGTGGTGGGGG) were protected at N-7 in the slowly migrating form but not in single-stranded pZ33. These data suggest that a hot spot for H{sub 2}O{sub 2}/Fe-mediated base substitutions is located adjacent to a sequence that can spontaneously adopt a quadruplex structure in which deoxyguanosine quartets are Hoogsten bonded.

  20. Biosynthesis and functions of sulfur modifications in tRNA

    Directory of Open Access Journals (Sweden)

    Naoki eShigi

    2014-04-01

    Full Text Available Sulfur is an essential element for a variety of cellular constituents in all living organisms. In tRNA molecules, there are many sulfur-containing nucleosides, such as the derivatives of 2‑thiouridine (s2U, 4-thiouridine (s4U, 2-thiocytidine (s2C, and 2-methylthioadenosine (ms2A. Earlier studies established the functions of these modifications for accurate and efficient translation, including proper recognition of the codons in mRNA or stabilization of tRNA structure. In many cases, the biosynthesis of these sulfur modifications starts with cysteine desulfurases, which catalyze the generation of persulfide (an activated form of sulfur from cysteine. Many sulfur-carrier proteins are responsible for delivering this activated sulfur to each biosynthesis pathway. Finally, specific modification enzymes activate target tRNAs and then incorporate sulfur atoms. Intriguingly, the biosynthesis of 2-thiouridine in all domains of life is functionally and evolutionarily related to the ubiquitin-like post-translational modification system of cellular proteins in eukaryotes. This review summarizes the recent characterization of the biosynthesis of sulfur modifications in tRNA and the novel roles of this modification in cellular functions in various model organisms, with a special emphasis on 2-thiouridine derivatives. Each biosynthesis pathway of sulfur-containing molecules is mutually modulated via sulfur trafficking, and 2-thiouridine and codon usage bias have been proposed to control the translation of specific genes.

  1. Osteo-chondroprogenitor-specific deletion of the selenocysteine tRNA gene, Trsp, leads to chondronecrosis and abnormal skeletal development: a putative model for Kashin-Beck disease.

    Directory of Open Access Journals (Sweden)

    Charlene M Downey

    2009-08-01

    Full Text Available Kashin-Beck disease, a syndrome characterized by short stature, skeletal deformities, and arthropathy of multiple joints, is highly prevalent in specific regions of Asia. The disease has been postulated to result from a combination of different environmental factors, including contamination of barley by mold mycotoxins, iodine deficiency, presence of humic substances in drinking water, and, importantly, deficiency of selenium. This multifunctional trace element, in the form of selenocysteine, is essential for normal selenoprotein function, including attenuation of excessive oxidative stress, and for the control of redox-sensitive molecules involved in cell growth and differentiation. To investigate the effects of skeletal selenoprotein deficiency, a Cre recombinase transgenic mouse line was used to trigger Trsp gene deletions in osteo-chondroprogenitors. Trsp encodes selenocysteine tRNA([Ser]Sec, required for the incorporation of selenocysteine residues into selenoproteins. The mutant mice exhibited growth retardation, epiphyseal growth plate abnormalities, and delayed skeletal ossification, as well as marked chondronecrosis of articular, auricular, and tracheal cartilages. Phenotypically, the mice thus replicated a number of the pathological features of Kashin-Beck disease, supporting the notion that selenium deficiency is important to the development of this syndrome.

  2. A novel dendrimer based on poly (L-glutamic acid) derivatives as an efficient and biocompatible gene delivery vector

    Energy Technology Data Exchange (ETDEWEB)

    Zeng Xin; Pan Shirong; Wang Chi; Wen Yuting; Wu Hongmei; Wang Cuifeng; Wu Chuanbin; Feng Min [School of Pharmaceutical Sciences and the First Affiliated Hospital, Sun Yat-sen University, 80 Zhongshan Road II, Guangzhou 510080 (China); Li Jie, E-mail: gzpshr@163.com, E-mail: fengmin@mail.sysu.edu.cn [Department of Gastrointestinal Surgery, The Third Affiliated Hospital of Sun Yat-sen University, 80 Zhongshan Road II, Guangzhou 510080 (China)

    2011-09-16

    Non-viral gene delivery systems based on cationic polymers have faced limitations related to their relative low gene transfer efficiency, cytotoxicity and system instability in vivo. In this paper, a flexible and pompon-like dendrimer composed of poly (amidoamine) (PAMAM) G4.0 as the inner core and poly (L-glutamic acid) grafted low-molecular-weight polyethylenimine (PLGE) as the surrounding multiple arms was synthesized (MGI dendrimer). The novel MGI dendrimer was designed to combine the merits of size-controlled PAMAM G4.0 and the low toxicity and flexible chains of PLGE. In phosphate-buffered saline dispersions the well-defined DNA/MGI complex above a N/P ratio of 30 showed good stability with particle sizes of approximately 200 nm and a comparatively low polydispersity index. However, the particle size of the DNA/25 kDa polyethylenimine (DNA/PEI 25K) complex was larger than 700 nm under the same salt conditions. The shielding of the compact amino groups at the periphery of flexible PAMAM and biocompatible PLGE chains in MGI resulted in a dramatic decrease of the cytotoxicity compared to native PAMAM G4.0 dendrimer. The in vitro transfection efficiency of DNA/MGI dendrimer complex was higher than that of PAMAM G4.0 dendrimer. Importantly, in serum-containing medium, DNA/MGI complexes at their optimal N/P ratio maintained the same high levels of transfection efficiency as in serum-free medium, while the transfection efficiency of native PAMAM G4.0, PEI 25K and Lipofectamine 2000 were sharply decreased. In vivo gene delivery of pVEGF165/MGI complex into balloon-injured rabbit carotid arteries resulted in significant inhibition of restenosis by increasing VEGF165 expression in local vessels. Therefore, the pompon-like MGI dendrimer may be a promising vector candidate for efficient gene delivery in vivo.

  3. A novel dendrimer based on poly (L-glutamic acid) derivatives as an efficient and biocompatible gene delivery vector

    International Nuclear Information System (INIS)

    Zeng Xin; Pan Shirong; Wang Chi; Wen Yuting; Wu Hongmei; Wang Cuifeng; Wu Chuanbin; Feng Min; Li Jie

    2011-01-01

    Non-viral gene delivery systems based on cationic polymers have faced limitations related to their relative low gene transfer efficiency, cytotoxicity and system instability in vivo. In this paper, a flexible and pompon-like dendrimer composed of poly (amidoamine) (PAMAM) G4.0 as the inner core and poly (L-glutamic acid) grafted low-molecular-weight polyethylenimine (PLGE) as the surrounding multiple arms was synthesized (MGI dendrimer). The novel MGI dendrimer was designed to combine the merits of size-controlled PAMAM G4.0 and the low toxicity and flexible chains of PLGE. In phosphate-buffered saline dispersions the well-defined DNA/MGI complex above a N/P ratio of 30 showed good stability with particle sizes of approximately 200 nm and a comparatively low polydispersity index. However, the particle size of the DNA/25 kDa polyethylenimine (DNA/PEI 25K) complex was larger than 700 nm under the same salt conditions. The shielding of the compact amino groups at the periphery of flexible PAMAM and biocompatible PLGE chains in MGI resulted in a dramatic decrease of the cytotoxicity compared to native PAMAM G4.0 dendrimer. The in vitro transfection efficiency of DNA/MGI dendrimer complex was higher than that of PAMAM G4.0 dendrimer. Importantly, in serum-containing medium, DNA/MGI complexes at their optimal N/P ratio maintained the same high levels of transfection efficiency as in serum-free medium, while the transfection efficiency of native PAMAM G4.0, PEI 25K and Lipofectamine 2000 were sharply decreased. In vivo gene delivery of pVEGF165/MGI complex into balloon-injured rabbit carotid arteries resulted in significant inhibition of restenosis by increasing VEGF165 expression in local vessels. Therefore, the pompon-like MGI dendrimer may be a promising vector candidate for efficient gene delivery in vivo.

  4. Gene Synthesis with H G Khorana

    Indian Academy of Sciences (India)

    IAS Admin

    Why synthesize genes? Because of the naiveté of biologists and molecular biologists in 1965 when Gobind Khorana initiated synthesis of the yeast alanine tRNA gene, this was a valid question. At that time, we could deduce the sequence of only one gene – the yeast alanine tRNA gene as the corresponding tRNA.

  5. Clonal diversity of the glutamate dehydrogenase gene in Giardia duodenalis from Thai Isolates: evidence of genetic exchange or Mixed Infections?

    Directory of Open Access Journals (Sweden)

    Saksirisampant Wilai

    2011-09-01

    Full Text Available Abstract Background The glutamate dehydrogenase gene (gdh is one of the most popular and useful genetic markers for the genotypic analysis of Giardia duodenalis (syn. G. lamblia, G. intestinalis, the protozoan that widely causes enteric disease in humans. To determine the distribution of genotypes of G. duodenalis in Thai populations and to investigate the extent of sequence variation at this locus, 42 fecal samples were collected from 3 regions of Thailand i.e., Central, Northern, and Eastern regions. All specimens were analyzed using PCR-based genotyping and recombinant subcloning methods. Results The results showed that the prevalence of assemblages A and B among these populations was approximately equal, 20 (47.6% and 22 (52.4%, respectively. Sequence analysis revealed that the nucleotide diversity of assemblage B was significantly greater than that in assemblage A. Among all assemblage B positive specimens, the allelic sequence divergence within isolates was detected. Nine isolates showed mixed alleles, ranged from three to nine distinct alleles per isolate. Statistical analysis demonstrated the occurrence of genetic recombination within subassemblages BIII and BIV was likely. Conclusion This study supports increasing evidence that G. duodenalis has the potential for genetic exchange.

  6. Extensive neuroadaptive changes in cortical gene-transcript expressions of the glutamate system in response to repeated intermittent MDMA administration in adolescent rats

    Directory of Open Access Journals (Sweden)

    Malki Rana

    2008-04-01

    Full Text Available Abstract Background Many studies have focused on the implication of the serotonin and dopamine systems in neuroadaptive responses to the recreational drug 3,4-methylenedioxy-metamphetamine (MDMA. Less attention has been given to the major excitatory neurotransmitter glutamate known to be implicated in schizophrenia and drug addiction. The aim of the present study was to investigate the effect of repeated intermittent MDMA administration upon gene-transcript expression of the glutamate transporters (EAAT1, EAAT2-1, EAAT2-2, the glutamate receptor subunits of AMPA (GluR1, GluR2, GluR3, the glutamate receptor subunits of NMDA (NR1, NR2A and NR2B, as well as metabotropic glutamate receptors (mGluR1, mGluR2, mGluR3, mGluR5 in six different brain regions. Adolescent male Sprague Dawley rats received MDMA at the doses of 3 × 1 and 3 × 5 mg/kg/day, or 3× vehicle 3 hours apart, every 7th day for 4 weeks. The gene-transcript levels were assessed using real-time PCR validated with a range of housekeeping genes. Results The findings showed pronounced enhancements in gene-transcript expression of GluR2, mGluR1, mGluR5, NR1, NR2A, NR2B, EAAT1, and EAAT2-2 in the cortex at bregma +1.6. In the caudate putamen, mRNA levels of GluR3, NR2A, and NR2B receptor subunits were significantly increased. In contrast, the gene-transcript expression of GluR1 was reduced in the hippocampus. In the hypothalamus, there was a significant increase of GluR1, GluR3, mGluR1, and mGluR3 gene-transcript expressions. Conclusion Repeated intermittent MDMA administration induces neuroadaptive changes in gene-transcript expressions of glutamatergic NMDA and AMPA receptor subunits, metabotropic receptors and transporters in regions of the brain regulating reward-related associative learning, cognition, and memory and neuro-endocrine functions.

  7. Mutations in genes encoding antibiotic substances increase the synthesis of poly-γ-glutamic acid in Bacillus amyloliquefaciens LL3.

    Science.gov (United States)

    Gao, Weixia; Liu, Fenghong; Zhang, Wei; Quan, Yufen; Dang, Yulei; Feng, Jun; Gu, Yanyan; Wang, Shufang; Song, Cunjiang; Yang, Chao

    2017-02-01

    Poly-γ-glutamic acid (γ-PGA) is an important natural biopolymer that is used widely in fields of foods, medicine, cosmetics, and agriculture. Several B. amyloliquefaciens LL3 mutants were constructed to improve γ-PGA synthesis via single or multiple marker-less in-frame deletions of four gene clusters (itu, bae, srf, and fen) encoding antibiotic substances. γ-PGA synthesis by the Δsrf mutant showed a slight increase (4.1 g/L) compared with that of the wild-type strain (3.3 g/L). The ΔituΔsrf mutant showed increased γ-PGA yield from 3.3 to 4.5 g/L, with an increase of 36.4%. The γ-PGA yield of the ΔituΔsrfΔfen and ΔituΔsrfΔfenΔbae mutants did not show a further increase. The four gene clusters' roles in swarming motility and biofilm formation were also studied. The Δsrf and Δbae mutant strains were both significantly defective in swarming, indicating that bacillaene and surfactin are involved in swarming motility of B. amyloliquefaciens LL3. Furthermore, Δsrf and Δitu mutant strains were obviously defective in biofilm formation; therefore, iturin and surfactin must play important roles in biofilm formation in B. amyloliquefaciens LL3. © 2016 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  8. Ciprofloxacin triggered glutamate production by Corynebacterium glutamicum.

    Science.gov (United States)

    Lubitz, Dorit; Wendisch, Volker F

    2016-10-07

    Corynebacterium glutamicum is a well-studied bacterium which naturally overproduces glutamate when induced by an elicitor. Glutamate production is accompanied by decreased 2-oxoglutatate dehydrogenase activity. Elicitors of glutamate production by C. glutamicum analyzed to molecular detail target the cell envelope. Ciprofloxacin, an inhibitor of bacterial DNA gyrase and topoisomerase IV, was shown to inhibit growth of C. glutamicum wild type with concomitant excretion of glutamate. Enzyme assays showed that 2-oxoglutarate dehydrogenase activity was decreased due to ciprofloxacin addition. Transcriptome analysis revealed that this inhibitor of DNA gyrase increased RNA levels of genes involved in DNA synthesis, repair and modification. Glutamate production triggered by ciprofloxacin led to glutamate titers of up to 37 ± 1 mM and a substrate specific glutamate yield of 0.13 g/g. Even in the absence of the putative glutamate exporter gene yggB, ciprofloxacin effectively triggered glutamate production. When C. glutamicum wild type was cultivated under nitrogen-limiting conditions, 2-oxoglutarate rather than glutamate was produced as consequence of exposure to ciprofloxacin. Recombinant C. glutamicum strains overproducing lysine, arginine, ornithine, and putrescine, respectively, secreted glutamate instead of the desired amino acid when exposed to ciprofloxacin. Ciprofloxacin induced DNA synthesis and repair genes, reduced 2-oxoglutarate dehydrogenase activity and elicited glutamate production by C. glutamicum. Production of 2-oxoglutarate could be triggered by ciprofloxacin under nitrogen-limiting conditions.

  9. Mitochondrial tRNA cleavage by tRNA-targeting ribonuclease causes mitochondrial dysfunction observed in mitochondrial disease

    Energy Technology Data Exchange (ETDEWEB)

    Ogawa, Tetsuhiro, E-mail: atetsu@mail.ecc.u-tokyo.ac.jp; Shimizu, Ayano; Takahashi, Kazutoshi; Hidaka, Makoto; Masaki, Haruhiko, E-mail: amasaki@mail.ecc.u-tokyo.ac.jp

    2014-08-15

    Highlights: • MTS-tagged ribonuclease was translocated successfully to the mitochondrial matrix. • MTS-tagged ribonuclease cleaved mt tRNA and reduced COX activity. • Easy and reproducible method of inducing mt tRNA dysfunction. - Abstract: Mitochondrial DNA (mtDNA) is a genome possessed by mitochondria. Since reactive oxygen species (ROS) are generated during aerobic respiration in mitochondria, mtDNA is commonly exposed to the risk of DNA damage. Mitochondrial disease is caused by mitochondrial dysfunction, and mutations or deletions on mitochondrial tRNA (mt tRNA) genes are often observed in mtDNA of patients with the disease. Hence, the correlation between mt tRNA activity and mitochondrial dysfunction has been assessed. Then, cybrid cells, which are constructed by the fusion of an enucleated cell harboring altered mtDNA with a ρ{sup 0} cell, have long been used for the analysis due to difficulty in mtDNA manipulation. Here, we propose a new method that involves mt tRNA cleavage by a bacterial tRNA-specific ribonuclease. The ribonuclease tagged with a mitochondrial-targeting sequence (MTS) was successfully translocated to the mitochondrial matrix. Additionally, mt tRNA cleavage, which resulted in the decrease of cytochrome c oxidase (COX) activity, was observed.

  10. Plant-Specific Preprotein and Amino Acid Transporter Proteins Are Required for tRNA Import into Mitochondria1[OPEN

    Science.gov (United States)

    Kubiszewski-Jakubiak, Szymon; Teixeira, Pedro F.; Narsai, Reena; Ivanova, Aneta; Megel, Cyrille; Schock, Annette; Kraus, Sabrina; Glaser, Elzbieta; Philippar, Katrin; Maréchal-Drouard, Laurence; Soll, Jürgen

    2016-01-01

    A variety of eukaryotes, in particular plants, do not contain the required number of tRNAs to support the translation of mitochondria-encoded genes and thus need to import tRNAs from the cytosol. This study identified two Arabidopsis (Arabidopsis thaliana) proteins, Tric1 and Tric2 (for tRNA import component), which on simultaneous inactivation by T-DNA insertion lines displayed a severely delayed and chlorotic growth phenotype and significantly reduced tRNA import capacity into isolated mitochondria. The predicted tRNA-binding domain of Tric1 and Tric2, a sterile-α-motif at the C-terminal end of the protein, was required to restore tRNA uptake ability in mitochondria of complemented plants. The purified predicted tRNA-binding domain binds the T-arm of the tRNA for alanine with conserved lysine residues required for binding. T-DNA inactivation of both Tric proteins further resulted in an increase in the in vitro rate of in organello protein synthesis, which was mediated by a reorganization of the nuclear transcriptome, in particular of genes encoding a variety of proteins required for mitochondrial gene expression at both the transcriptional and translational levels. The characterization of Tric1/2 provides mechanistic insight into the process of tRNA import into mitochondria and supports the theory that the tRNA import pathway resulted from the repurposing of a preexisting protein import apparatus. PMID:27789739

  11. Over-expression of a glutamate dehydrogenase gene, MgGDH, from Magnaporthe grisea confers tolerance to dehydration stress in transgenic rice.

    Science.gov (United States)

    Zhou, Yanbiao; Zhang, Caisheng; Lin, Jianzhong; Yang, Yuanzhu; Peng, Yuchong; Tang, Dongying; Zhao, Xiaoying; Zhu, Yonghua; Liu, Xuanming

    2015-03-01

    Heterologous expression of a fungal NADP(H)-GDH gene ( MgGDH ) from Magnaporthe grisea can improve dehydration stress tolerance in rice by preventing toxic accumulation of ammonium. Glutamate dehydrogenase (GDH; EC 1.4.1.2 and EC 1.4.1.4) may act as a stress-responsive enzyme in detoxification of high intracellular ammonia and production of glutamate for proline synthesis under stress conditions. In present study, a fungal NADP(H)-GDH gene (MgGDH) from Magnaporthe grisea was over-expressed in rice (Oryza sativa L. cv. 'kitaake'), and the transgenic plants showed the improvement of tolerance to dehydration stress. The kinetic analysis showed that His-TF-MgGDH preferentially utilizes ammonium to produce L-glutamate. Moreover, the affinity of His-TF-MgGDH for ammonium was dramatically higher than that of His-TF-OsGDH for ammonium. Over-expressing MgGDH transgenic rice plants showed lower water-loss rate and higher completely close stomata than the wild-type plants under dehydration stress conditions. In transgenic plants, the NADP(H)-GDH activities were markedly higher than those in wild-type plants and the amination activity was significantly higher than the deamination activity. Compared with wild-type plants, the transgenic plants accumulated much less NH4 (+) but higher amounts of glutamate, proline and soluble sugar under dehydration stress conditions. These results indicate that heterologous expression of MgGDH can prevent toxic accumulation of ammonium and in return improve dehydration stress tolerance in rice.

  12. Structural rearrangements of the RNA polymerase III machinery during tRNA transcription initiation.

    Science.gov (United States)

    Ramsay, Ewan Phillip; Vannini, Alessandro

    2018-04-01

    RNA polymerase III catalyses the synthesis of tRNAs in eukaryotic organisms. Through combined biochemical and structural characterisation, multiple auxiliary factors have been identified alongside RNA Polymerase III as critical in both facilitating and regulating transcription. Together, this machinery forms dynamic multi-protein complexes at tRNA genes which are required for polymerase recruitment, DNA opening and initiation and elongation of the tRNA transcripts. Central to the function of these complexes is their ability to undergo multiple conformational changes and rearrangements that regulate each step. Here, we discuss the available biochemical and structural data on the structural plasticity of multi-protein complexes involved in RNA Polymerase III transcriptional initiation and facilitated re-initiation during tRNA synthesis. Increasingly, structural information is becoming available for RNA polymerase III and its functional complexes, allowing for a deeper understanding of tRNA transcriptional initiation. This article is part of a Special Issue entitled: SI: Regulation of tRNA synthesis and modification in physiological conditions and disease edited by Dr. Boguta Magdalena. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  13. Insulin-induced inhibition of gluconeogenesis genes, including glutamic pyruvic transaminase 2, is associated with reduced histone acetylation in a human liver cell line.

    Science.gov (United States)

    Honma, Kazue; Kamikubo, Michiko; Mochizuki, Kazuki; Goda, Toshinao

    2017-06-01

    Hepatic glutamic pyruvic transaminase (GPT; also known as alanine aminotransferase) is a gluconeogenesis enzyme that catalyzes conversions between alanine and pyruvic acid. It is also used as a blood biomarker for hepatic damage. In this study, we investigated whether insulin regulates GPT expression, as it does for other gluconeogenesis genes, and if this involves the epigenetic modification of histone acetylation. Human liver-derived HepG2 cells were cultured with 0.5-100nM insulin for 8h, and the mRNA expression of GPT, glutamic-oxaloacetic transaminase (GOT), γ-glutamyltransferase (GGT), PCK1, G6PC and FBP1 was measured. We also investigated the extent of histone acetylation around these genes. Insulin suppressed the mRNA expression of gluconeogenesis genes (GPT2, GOT1, GOT2, GGT1, GGT2, G6PC, and PCK1) in HepG2 cells in a dose-dependent manner. mRNA levels of GPT2, but not GPT1, were decreased by insulin. Histone acetylation was also reduced around GPT2, G6PC, and PCK1 in response to insulin. The expression of GPT2 and other gluconeogenesis genes such as G6PC and PCK1 was suppressed by insulin, in association with decreases in histone H3 and H4 acetylation surrounding these genes. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Saturation of recognition elements blocks evolution of new tRNA identities

    Science.gov (United States)

    Saint-Léger, Adélaïde; Bello, Carla; Dans, Pablo D.; Torres, Adrian Gabriel; Novoa, Eva Maria; Camacho, Noelia; Orozco, Modesto; Kondrashov, Fyodor A.; Ribas de Pouplana, Lluís

    2016-01-01

    Understanding the principles that led to the current complexity of the genetic code is a central question in evolution. Expansion of the genetic code required the selection of new transfer RNAs (tRNAs) with specific recognition signals that allowed them to be matured, modified, aminoacylated, and processed by the ribosome without compromising the fidelity or efficiency of protein synthesis. We show that saturation of recognition signals blocks the emergence of new tRNA identities and that the rate of nucleotide substitutions in tRNAs is higher in species with fewer tRNA genes. We propose that the growth of the genetic code stalled because a limit was reached in the number of identity elements that can be effectively used in the tRNA structure. PMID:27386510

  15. The early history of tRNA recognition by aminoacyl-tRNA synthetases

    Indian Academy of Sciences (India)

    Madhu

    2006-10-04

    Oct 4, 2006 ... of molecular biology were thinking on gene expression and genetic code. In a famous letter send in 1955 to the “RNA Tie. Club” Francis Crick predicted the existence of small adaptor. RNA molecules that would carry their own amino acids and. The early history of tRNA recognition by aminoacyl-tRNA.

  16. The crystal structure of tRNA

    Indian Academy of Sciences (India)

    Madhu

    determination of the 3D structure of the tRNA (in 1974) has not been recognized with such distinction. ... structure: these being led by Aaron Klug at the MRC. Laboratory of Molecular Biology (LMB), Cambridge, UK, ..... by-product of the tRNAPhe structure was the first detailed chemical picture of a G–U base pair in a double ...

  17. Glutamate receptors

    DEFF Research Database (Denmark)

    Kristensen, Anders S; Geballe, Matthew T; Snyder, James P

    2006-01-01

    Fast excitatory synaptic transmission in the CNS relies almost entirely on the neurotransmitter glutamate and its family of ion channel receptors. An appreciation of the coupling between agonist binding and channel opening has advanced rapidly during the past five years, largely as a result of ne...

  18. The gdhB gene of Pseudomonas aeruginosa encodes an arginine-inducible NAD(+)-dependent glutamate dehydrogenase which is subject to allosteric regulation.

    Science.gov (United States)

    Lu, C D; Abdelal, A T

    2001-01-01

    The NAD(+)-dependent glutamate dehydrogenase (NAD-GDH) from Pseudomonas aeruginosa PAO1 was purified, and its amino-terminal amino acid sequence was determined. This sequence information was used in identifying and cloning the encoding gdhB gene and its flanking regions. The molecular mass predicted from the derived sequence for the encoded NAD-GDH was 182.6 kDa, in close agreement with that determined from sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the purified enzyme (180 kDa). Cross-linking studies established that the native NAD-GDH is a tetramer of equal subunits. Comparison of the derived amino acid sequence of NAD-GDH from P. aeruginosa with the GenBank database showed the highest homology with hypothetical polypeptides from Pseudomonas putida, Mycobacterium tuberculosis, Rickettsia prowazakii, Legionella pneumophila, Vibrio cholerae, Shewanella putrefaciens, Sinorhizobium meliloti, and Caulobacter crescentus. A moderate degree of homology, primarily in the central domain, was observed with the smaller tetrameric NAD-GDH (protomeric mass of 110 kDa) from Saccharomyces cerevisiae or Neurospora crassa. Comparison with the yet smaller hexameric GDH (protomeric mass of 48 to 55 kDa) of other prokaryotes yielded a low degree of homology that was limited to residues important for binding of substrates and for catalytic function. NAD-GDH was induced 27-fold by exogenous arginine and only 3-fold by exogenous glutamate. Primer extension experiments established that transcription of gdhB is initiated from an arginine-inducible promoter and that this induction is dependent on the arginine regulatory protein, ArgR, a member of the AraC/XyIS family of regulatory proteins. NAD-GDH was purified to homogeneity from a recombinant strain of P. aeruginosa and characterized. The glutamate saturation curve was sigmoid, indicating positive cooperativity in the binding of glutamate. NAD-GDH activity was subject to allosteric control by arginine and citrate, which

  19. Restraint stress differentially regulates inflammation and glutamate receptor gene expression in the hippocampus of C57BL/6 and BALB/c mice.

    Science.gov (United States)

    Sathyanesan, Monica; Haiar, Jacob M; Watt, Michael J; Newton, Samuel S

    2017-03-01

    The inbred mouse strains, C57BL/6 and BALB/c have been used widely in preclinical psychiatric research. The differences in stress susceptibility of available strains has provided a useful platform to test pharmacological agents and behavioral responses. Previous brain gene profiling efforts have indicated that the inflammation and immune response gene pathway is the predominant gene network in the differential stress response of BALB/c and C57BL/6 mice. The implication is that a composite stress paradigm that includes a sequence of extended, varied and unpredictable stressors induces inflammation-related genes in the hippocampus. We hypothesized that the regulation of inflammation genes in the brain could constitute a primary stress response and tested this by employing a simple stress protocol, repeated exposure to the same stressor for 10 days, 2 h of restraint per day. We examined stress-induced regulation of 13 proinflammatory cytokine genes in male BALB/c and C57BL/6 mice using quantitative PCR. Elevated cytokine genes included tumor necrosis factor alpha (TNFα), interleukin 6 (IL6), interleukin 10 (IL10), tumor necrosis factor (TNF) super family members and interleukin 1 receptor 1 (IL1R1). In addition, we examined restraint stress-induced regulation of 12 glutamate receptor genes in both strains. Our results show that restraint stress is sufficient to elevate the expression of inflammation-related genes in the hippocampus of both BABLB/c and C57BL/6 mice, but they differ in the genes that are induced and the magnitude of change. Cell types that are involved in this response include endothelial cells and astrocytes. Lay summary Repeated exposure to a simple restraint stress altered the activities of genes involved in inflammation and the functions of the excitatory neurotransmitter, glutamate. These changes in the hippocampus of the mouse brain showed differences that were dependent on the strain of mice and the length of the stress exposure. The effects

  20. Compilation of tRNA sequences.

    Science.gov (United States)

    Sprinzl, M; Grueter, F; Spelzhaus, A; Gauss, D H

    1980-01-11

    This compilation presents in a small space the tRNA sequences so far published. The numbering of tRNAPhe from yeast is used following the rules proposed by the participants of the Cold Spring Harbor Meeting on tRNA 1978 (1,2;Fig. 1). This numbering allows comparisons with the three dimensional structure of tRNAPhe. The secondary structure of tRNAs is indicated by specific underlining. In the primary structure a nucleoside followed by a nucleoside in brackets or a modification in brackets denotes that both types of nucleosides can occupy this position. Part of a sequence in brackets designates a piece of sequence not unambiguosly analyzed. Rare nucleosides are named according to the IUPACIUB rules (for complicated rare nucleosides and their identification see Table 1); those with lengthy names are given with the prefix x and specified in the footnotes. Footnotes are numbered according to the coordinates of the corresponding nucleoside and are indicated in the sequence by an asterisk. The references are restricted to the citation of the latest publication in those cases where several papers deal with one sequence. For additional information the reader is referred either to the original literature or to other tRNA sequence compilations (3-7). Mutant tRNAs are dealt with in a compilation by J. Celis (8). The compilers would welcome any information by the readers regarding missing material or erroneous presentation. On the basis of this numbering system computer printed compilations of tRNA sequences in a linear form and in cloverleaf form are in preparation.

  1. Recombinant human immunodeficiency virus type 1 nucleocapsid (NCp7) protein unwinds tRNA.

    Science.gov (United States)

    Khan, R; Giedroc, D P

    1992-04-05

    The nucleocapsid protein (NC) of all animal retroviruses, encoded by the gag gene, is the major structural protein of the core ribonucleoprotein complex, bound to genomic RNA in mature virions. NC is also thought to play one or more accessory roles in reverse transcription. Mature NC (p7NC) from human immunodeficiency virus type 1 (HIV-1) is a 71-amino acid, basic protein which contains two Cys3His Zn(II) retroviral-type zinc finger domains. Herein, we describe the subcloning and expression of HIV-1 NC, denoted NC71, from an inducible phage T7 RNA polymerase promoter in Escherichia coli. Purified NC71 can be reversibly reconstituted with 2 g.at Zn(II) determined by atomic absorption. Ultraviolet circulation dichroism spectroscopy has been used to characterize the complexes between highly purified NC71 and the RNA homopolynucleotide poly(A) and E. coli tRNA(mixed). On poly(A), Zn2 NC71 is characterized by an apparent site size n = 15 +/- 3 nucleotides and high affinity (Kapp = 3 x 10(7) M-1) and moderately cooperative (omega approximately 170 +/- 25) binding. A mixture of E. coli tRNA species (tRNA(mixed) was used to probe the conformational changes induced in tRNA upon binding of HIV-1 NC71. Two structural forms of tRNA(mixed), which differ in their degree of tertiary structure, were assayed for their susceptibility to denaturation by NC71. Five molar monomer equivalents of NC71 are required to denature the "inactive" tRNA in the absence of Mg2+. A Zn(II)-free, oxidized form of NC71 was also shown to unwind inactive tRNA with the same efficiency and stoichiometry. The detailed spectral changes which occur on NC-induced denaturation closely mimic temperature-induced denaturation of inactive tRNA(mixed). The prototype helix-destabilizing protein, T4 gene 32 protein, is unable to unwind this form of tRNA under the same conditions. The stoichiometry of unwinding of inactive tRNA by NC71 is consistent with the site size determined with poly(A). An "active" form of t

  2. Regulation of tRNA biogenesis in plants and its link to plant growth and response to pathogens.

    Science.gov (United States)

    Soprano, Adriana Santos; Smetana, Juliana Helena Costa; Benedetti, Celso Eduardo

    2017-12-06

    The field of tRNA biology, encompassing the functional and structural complexity of tRNAs, has fascinated scientists over the years and is continuously growing. Besides their fundamental role in protein translation, new evidence indicates that tRNA-derived molecules also regulate gene expression and protein synthesis in all domains of life. This review highlights some of the recent findings linking tRNA transcription and modification with plant cell growth and response to pathogens. In fact, mutations in proteins directly involved in tRNA synthesis and modification most often lead to pleiotropic effects on plant growth and immunity. As plants need to optimize and balance their energy and nutrient resources towards growth and defense, regulatory pathways that play a central role in integrating tRNA transcription and protein translation with cell growth control and organ development, such as the auxin-TOR signaling pathway, also influence the plant immune response against pathogens. As a consequence, distinct pathogens employ an array of effector molecules including tRNA fragments to target such regulatory pathways to exploit the plant's translational capacity, gain access to nutrients and evade defenses. An example includes the RNA polymerase III repressor MAF1, a conserved component of the TOR signaling pathway that controls ribosome biogenesis and tRNA synthesis required for plant growth and which is targeted by a pathogen effector molecule to promote disease. This article is part of a Special Issue entitled: SI: Regulation of tRNA synthesis and modification in physiological conditions and disease edited by Dr. Boguta Magdalena. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. [Protective action of glutamate antibodies on increased expression of genes of programmed death of rat brain cells induced by injection of a β-amyloid fragment (25-35)].

    Science.gov (United States)

    Kolobov, V V; Davydova, T V; Fomina, V G

    2014-01-01

    Glutamate antibodies intranasally administered to Wistar rats at a dose of 300 μg/kg reduced the elevated levels of expression of Aifml, Casp3, and Parp 1 genes in the prefrontal cortex and Aifml and Casp3 genes in the hippocampus on the third day after administration of the β-amyloid fragment Aβ25-35 into the Meynert nuclei of the brain. Changes in Aifm1, Bax, Casp3, and Parp 1 gene expression were not found in the hypothalamus, and changes in Bax gene expression were not found in the brain structures studied. The discovered features of gene expression in the prefrontal cortex and hippocampus are considered in terms of development of various cell-death programs, which are modulated by glutamate antibodies.

  4. A case-control study of the relationship between the metabotropic glutamate receptor 3 gene and schizophrenia in the Chinese population.

    Science.gov (United States)

    Chen, Qi; He, Guang; Chen, Qingying; Wu, Shengnan; Xu, Yifeng; Feng, Guoyin; Li, Yucheng; Wang, Lijun; He, Lin

    2005-02-01

    Recent studies of the association between the metabotropic glutamate receptor 3 gene (GRM3) and schizophrenia have produced conflicting results, although GRM3 is a promising candidate gene. Fujii et al. found a single nuclear polymorphism (SNP) for within this gene, rs1468412 to have a positive association to schizophrenia in Japanese patients. To investigate this further, we genotyped 7 SNPs around GRM3 including rs1468412, in 752 Chinese patients with schizophrenia and 752 controls using Taqman technology. We did not detect any association between rs1468412 and schizophrenia, however we found differences in the allele frequency distribution of SNP rs2299225 (p=0.0297, odds ration [OR]=1.44, 95% confidence interval 1.05-1.99) between cases and controls. Moreover, the overall frequency of haplotypes constructed from three SNPs including rs2299225 showed significant differences between cases and controls (p=0.0017). Our results partially support the previous studies in other ethnic groups and indicate that the GRM3 gene may play an important role in the etiology of schizophrenia in the Han Chinese.

  5. Genome-wide identification, characterization and classification of ionotropic glutamate receptor genes (iGluRs) in the malaria vector Anopheles sinensis (Diptera: Culicidae).

    Science.gov (United States)

    Wang, Ting-Ting; Si, Feng-Ling; He, Zheng-Bo; Chen, Bin

    2018-01-15

    Ionotropic glutamate receptors (iGluRs) are conserved ligand-gated ion channel receptors, and ionotropic receptors (IRs) were revealed as a new family of iGluRs. Their subdivision was unsettled, and their characteristics are little known. Anopheles sinensis is a major malaria vector in eastern Asia, and its genome was recently well sequenced and annotated. We identified iGluR genes in the An. sinensis genome, analyzed their characteristics including gene structure, genome distribution, domains and specific sites by bioinformatic methods, and deduced phylogenetic relationships of all iGluRs in An. sinensis, Anopheles gambiae and Drosophila melanogaster. Based on the characteristics and phylogenetics, we generated the classification of iGluRs, and comparatively analyzed the intron number and selective pressure of three iGluRs subdivisions, iGluR group, Antenna IR and Divergent IR subfamily. A total of 56 iGluR genes were identified and named in the whole-genome of An. sinensis. These genes were located on 18 scaffolds, and 31 of them (29 being IRs) are distributed into 10 clusters that are suggested to form mainly from recent gene duplication. These iGluRs can be divided into four groups: NMDA, non-NMDA, Antenna IR and Divergent IR based on feature comparison and phylogenetic analysis. IR8a and IR25a were suggested to be monophyletic, named as Putative in the study, and moved from the Antenna subfamily in the IR family to the non-NMDA group as a sister of traditional non-NMDA. The generated iGluRs of genes (including NMDA and regenerated non-NMDA) are relatively conserved, and have a more complicated gene structure, smaller ω values and some specific functional sites. The iGluR genes in An. sinensis, An. gambiae and D. melanogaster have amino-terminal domain (ATD), ligand binding domain (LBD) and Lig_Chan domains, except for IR8a that only has the LBD and Lig_Chan domains. However, the new concept IR family of genes (including regenerated Antenna IR, and Divergent

  6. Expression pattern conferred by a glutamic acid-rich protein gene promoter in field-grown transgenic cassava (Manihot esculenta Crantz).

    Science.gov (United States)

    Beltrán, J; Prías, M; Al-Babili, S; Ladino, Y; López, D; Beyer, P; Chavarriaga, P; Tohme, J

    2010-05-01

    A major constraint for incorporating new traits into cassava using biotechnology is the limited list of known/tested promoters that encourage the expression of transgenes in the cassava's starchy roots. Based on a previous report on the glutamic-acid-rich protein Pt2L4, indicating a preferential expression in roots, we cloned the corresponding gene including promoter sequence. A promoter fragment (CP2; 731 bp) was evaluated for its potential to regulate the expression of the reporter gene GUSPlus in transgenic cassava plants grown in the field. Intense GUS staining was observed in storage roots and vascular stem tissues; less intense staining in leaves; and none in the pith. Consistent with determined mRNA levels of the GUSPlus gene, fluorometric analyses revealed equal activities in root pulp and stems, but 3.5 times less in leaves. In a second approach, the activity of a longer promoter fragment (CP1) including an intrinsic intron was evaluated in carrot plants. CP1 exhibited a pronounced tissue preference, conferring high expression in the secondary phloem and vascular cambium of roots, but six times lower expression levels in leaf vascular tissues. Thus, CP1 and CP2 may be useful tools to improve nutritional and agronomical traits of cassava by genetic engineering. To date, this is the first study presenting field data on the specificity and potential of promoters for transgenic cassava.

  7. Improvement in antioxidant activity, angiotensin-converting enzyme inhibitory activity and in vitro cellular properties of fermented pepino milk by Lactobacillus strains containing the glutamate decarboxylase gene.

    Science.gov (United States)

    Chiu, Tsai-Hsin; Tsai, Shwu-Jene; Wu, Tsung-Yen; Fu, Szu-Chieh; Hwang, Yi-Ting

    2013-03-15

    The purpose of this study was to evaluate the functional potential of fermented pepino extract (PE) milk by Lactobacillus strains containing the glutamate decarboxylase (GAD) gene. Three Lactobacillus strains were selected, including L. brevis BCRC 12310, L. casei BCRC 14082 and L. salivarius subsp. salivarius BCRC 14759. The contents of free amino acids, total phenolics content, total carotenoids and the associated functional and antioxidant abilities were analyzed, including angiotensin-converting enzyme (ACE) inhibition activity, 1,1-diphenyl-2-picylhydrazyl (DPPH) radical-scavenging ability and oxygen radical absorbance capacity (ORAC). Cell proliferation of fermented PE milk was also evaluated by MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay. Compared to the unfermented PE, fermented PE milk from Lactobacillus strains with the GAD gene showed higher levels of total phenolics, γ-aminobutyric acid, ACE inhibitory activity, DPPH, and ORAC. The viability of human promyelocytic leukemia cells (HL-60) determined by the MTT method decreased significantly when the cells were incubated with the PE and the fermented PE milk extracts. The consumption of fermented PE milk from Lactobacillus strains with the GAD gene is expected to benefit health. Further application as a health food is worthy of investigation. © 2012 Society of Chemical Industry. © 2012 Society of Chemical Industry.

  8. Performance of Glutamate Dehydrogenase and Triose Phosphate Isomerase Genes in the Analysis of Genotypic Variability of Isolates of Giardia duodenalis from Livestocks

    Science.gov (United States)

    Fava, Natália M. N.; Soares, Rodrigo M.; Scalia, Luana A. M.; Kalapothakis, Evanguedes; Pena, Isabella F.; Vieira, Carlos U.; Faria, Elaine S. M.; Cunha, Maria J.; Couto, Talles R.; Cury, Márcia Cristina

    2013-01-01

    Giardia duodenalis is a small intestinal protozoan parasite of several terrestrial vertebrates. This work aims to assess the genotypic variability of Giardia duodenalis isolates from cattle, sheep and pigs in the Southeast of Brazil, by comparing the standard characterization between glutamate dehydrogenase (gdh) and triose phosphate isomerase (tpi) primers. Fecal samples from the three groups of animals were analyzed using the zinc sulphate centrifugal flotation technique. Out of 59 positive samples, 30 were from cattle, 26 from sheep and 3 from pigs. Cyst pellets were stored and submitted to PCR and nested-PCR reactions with gdh and tpi primers. Fragment amplification of gdh and tpi genes was observed in 25 (42.4%) and 36 (61.0%) samples, respectively. Regarding the sequencing, 24 sequences were obtained with gdh and 20 with tpi. For both genes, there was a prevalence of E specific species assemblage, although some isolates have been identified as A and B, by the tpi sequencing. This has also shown a larger number of heterogeneous sequences, which have been attribute to mixed infections between assemblages B and E. The largest variability of inter-assemblage associated to the frequency of heterogeneity provided by tpi sequencing reinforces the polymorphic nature of this gene and makes it an excellent target for studies on molecular epidemiology. PMID:24308010

  9. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli

    OpenAIRE

    Takada, Hiraku; Shimada, Tomohiro; Dey, Debashish; Quyyum, M. Zuhaib; Nakano, Masahiro; Ishiguro, Akira; Yoshida, Hideji; Yamamoto, Kaneyoshi; Sen, Ranjan; Ishihama, Akira

    2016-01-01

    Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order) and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters rec...

  10. Genome-wide gene-environment study identifies glutamate receptor gene GRIN2A as a Parkinson's disease modifier gene via interaction with coffee.

    OpenAIRE

    Taye H Hamza; Honglei Chen; Erin M Hill-Burns; Shannon L Rhodes; Jennifer Montimurro; Denise M Kay; Albert Tenesa; Victoria I Kusel; Patricia Sheehan; Muthukrishnan Eaaswarkhanth; Dora Yearout; Ali Samii; John W Roberts; Pinky Agarwal; Yvette Bordelon

    2011-01-01

    Our aim was to identify genes that influence the inverse association of coffee with the risk of developing Parkinson's disease (PD). We used genome-wide genotype data and lifetime caffeinated-coffee-consumption data on 1,458 persons with PD and 931 without PD from the NeuroGenetics Research Consortium (NGRC), and we performed a genome-wide association and interaction study (GWAIS), testing each SNP's main-effect plus its interaction with coffee, adjusting for sex, age, and two principal compo...

  11. Effects of Heterologous tRNA Modifications on the Production of Proteins Containing Noncanonical Amino Acids.

    Science.gov (United States)

    Crnković, Ana; Vargas-Rodriguez, Oscar; Merkuryev, Anna; Söll, Dieter

    2018-02-02

    Synthesis of proteins with noncanonical amino acids (ncAAs) enables the creation of protein-based biomaterials with diverse new chemical properties that may be attractive for material science. Current methods for large-scale production of ncAA-containing proteins, frequently carried out in Escherichia coli , involve the use of orthogonal aminoacyl-tRNA synthetases (o-aaRSs) and tRNAs (o-tRNAs). Although o-tRNAs are designed to be orthogonal to endogenous aaRSs, their orthogonality to the components of the E. coli metabolism remains largely unexplored. We systematically investigated how the E. coli tRNA modification machinery affects the efficiency and orthogonality of o-tRNA Sep used for production of proteins with the ncAA O- phosphoserine (Sep). The incorporation of Sep into a green fluorescent protein (GFP) in 42 E. coli strains carrying deletions of single tRNA modification genes identified several genes that affect the o-tRNA activity. Deletion of cysteine desulfurase ( iscS ) increased the yield of Sep-containing GFP more than eightfold, while overexpression of dimethylallyltransferase MiaA and pseudouridine synthase TruB improved the specificity of Sep incorporation. These results highlight the importance of tRNA modifications for the biosynthesis of proteins containing ncAAs, and provide a novel framework for optimization of o-tRNAs.

  12. Effects of Heterologous tRNA Modifications on the Production of Proteins Containing Noncanonical Amino Acids

    Directory of Open Access Journals (Sweden)

    Ana Crnković

    2018-02-01

    Full Text Available Synthesis of proteins with noncanonical amino acids (ncAAs enables the creation of protein-based biomaterials with diverse new chemical properties that may be attractive for material science. Current methods for large-scale production of ncAA-containing proteins, frequently carried out in Escherichia coli, involve the use of orthogonal aminoacyl-tRNA synthetases (o-aaRSs and tRNAs (o-tRNAs. Although o-tRNAs are designed to be orthogonal to endogenous aaRSs, their orthogonality to the components of the E. coli metabolism remains largely unexplored. We systematically investigated how the E. coli tRNA modification machinery affects the efficiency and orthogonality of o-tRNASep used for production of proteins with the ncAA O-phosphoserine (Sep. The incorporation of Sep into a green fluorescent protein (GFP in 42 E. coli strains carrying deletions of single tRNA modification genes identified several genes that affect the o-tRNA activity. Deletion of cysteine desulfurase (iscS increased the yield of Sep-containing GFP more than eightfold, while overexpression of dimethylallyltransferase MiaA and pseudouridine synthase TruB improved the specificity of Sep incorporation. These results highlight the importance of tRNA modifications for the biosynthesis of proteins containing ncAAs, and provide a novel framework for optimization of o-tRNAs.

  13. RNA Polymerase III Output Is Functionally Linked to tRNA Dimethyl-G26 Modification.

    Directory of Open Access Journals (Sweden)

    Aneeshkumar G Arimbasseri

    2015-12-01

    Full Text Available Control of the differential abundance or activity of tRNAs can be important determinants of gene regulation. RNA polymerase (RNAP III synthesizes all tRNAs in eukaryotes and it derepression is associated with cancer. Maf1 is a conserved general repressor of RNAP III under the control of the target of rapamycin (TOR that acts to integrate transcriptional output and protein synthetic demand toward metabolic economy. Studies in budding yeast have indicated that the global tRNA gene activation that occurs with derepression of RNAP III via maf1-deletion is accompanied by a paradoxical loss of tRNA-mediated nonsense suppressor activity, manifested as an antisuppression phenotype, by an unknown mechanism. We show that maf1-antisuppression also occurs in the fission yeast S. pombe amidst general activation of RNAP III. We used tRNA-HydroSeq to document that little changes occurred in the relative levels of different tRNAs in maf1Δ cells. By contrast, the efficiency of N2,N2-dimethyl G26 (m(22G26 modification on certain tRNAs was decreased in response to maf1-deletion and associated with antisuppression, and was validated by other methods. Over-expression of Trm1, which produces m(22G26, reversed maf1-antisuppression. A model that emerges is that competition by increased tRNA levels in maf1Δ cells leads to m(22G26 hypomodification due to limiting Trm1, reducing the activity of suppressor-tRNASerUCA and accounting for antisuppression. Consistent with this, we show that RNAP III mutations associated with hypomyelinating leukodystrophy decrease tRNA transcription, increase m(22G26 efficiency and reverse antisuppression. Extending this more broadly, we show that a decrease in tRNA synthesis by treatment with rapamycin leads to increased m(22G26 modification and that this response is conserved among highly divergent yeasts and human cells.

  14. Ketamine and ketamine metabolites as novel estrogen receptor ligands: Induction of cytochrome P450 and AMPA glutamate receptor gene expression.

    Science.gov (United States)

    Ho, Ming-Fen; Correia, Cristina; Ingle, James N; Kaddurah-Daouk, Rima; Wang, Liewei; Kaufmann, Scott H; Weinshilboum, Richard M

    2018-04-03

    Major depressive disorder (MDD) is the most common psychiatric illness worldwide, and it displays a striking sex-dependent difference in incidence, with two thirds of MDD patients being women. Ketamine treatment can produce rapid antidepressant effects in MDD patients, effects that are mediated-at least partially-through glutamatergic neurotransmission. Two active metabolites of ketamine, (2R,6R)-hydroxynorketamine (HNK) and (2S,6S)-HNK, also appear to play a key role in ketamine's rapid antidepressant effects through the activation of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) glutamate receptors. In the present study, we demonstrated that estrogen plus ketamine or estrogen plus active ketamine metabolites displayed additive effects on the induction of the expression of AMPA receptor subunits. In parallel, the expression of estrogen receptor alpha (ERα) was also significantly upregulated. Even more striking, radioligand binding assays demonstrated that [ 3 H]-ketamine can directly bind to ERα (K D : 344.5 ± 13 nM). Furthermore, ketamine and its (2R,6R)-HNK and (2S,6S)-HNK metabolites displayed similar affinity for ERα (IC 50 : 2.31 ± 0.1, 3.40 ± 0.2, and 3.53 ± 0.2 µM, respectively) as determined by [ 3 H]-ketamine displacement assays. Finally, induction of AMPA receptors by either estrogens or ketamine and its metabolites was lost when ERα was knocked down or silenced pharmacologically. These results suggest a positive feedback loop by which estrogens can augment the effects of ketamine and its (2R,6R)-HNK and (2S,6S)-HNK metabolites on the ERα-induced transcription of CYP2A6 and CYP2B6, estrogen inducible enzymes that catalyze ketamine's biotransformation to form the two active metabolites. These observations provide novel insight into ketamine's molecular mechanism(s) of action and have potential implications for the treatment of MDD. Copyright © 2018 Elsevier Inc. All rights reserved.

  15. Gain-Of-Function Mutational Activation of Human TRNA Synthetase Procytokine

    Energy Technology Data Exchange (ETDEWEB)

    Yang, X.L.; Kapoor, M.; Otero, F.J.; Slike, B.M.; Tsuruta, H.; Frausto, R.; Bates, A.; Ewalt, K.L.; Cheresh, D.A.; Schimmel, P.; /Scripps Res. Inst. /SLAC, SSRL

    2009-04-30

    Disease-causing mutations occur in genes for aminoacyl tRNA synthetases. That some mutations are dominant suggests a gain of function. Native tRNA synthetases, such as tyrosyl-tRNA synthetase (TyrRS) and tryptophanyl-tRNA synthetase, catalyze aminoacylation and are also procytokines that are activated by natural fragmentation. In principle, however, gain-of-function phenotypes could arise from mutational activation of synthetase procytokines. From crystal structure analysis, we hypothesized that a steric block of a critical Glu-Leu-Arg (ELR) motif in full-length TyrRS suppresses the cytokine activity of a natural fragment. To test this hypothesis, we attempted to uncover ELR in the procytokine by mutating a conserved tyrosine (Y341) that tethers ELR. Site-specific proteolytic cleavage and small-angle X-ray scattering established subtle opening of the structure by the mutation. Strikingly, four different assays demonstrated mutational activation of cytokine functions. The results prove the possibilities for constitutive gain-of-function mutations in tRNA synthetases.

  16. RNase MRP cleaves pre-tRNASer-Met in the tRNA maturation pathway.

    Science.gov (United States)

    Saito, Yuichiro; Takeda, Jun; Adachi, Kousuke; Nobe, Yuko; Kobayashi, Junya; Hirota, Kouji; Oliveira, Douglas V; Taoka, Masato; Isobe, Toshiaki

    2014-01-01

    Ribonuclease mitochondrial RNA processing (RNase MRP) is a multifunctional ribonucleoprotein (RNP) complex that is involved in the maturation of various types of RNA including ribosomal RNA. RNase MRP consists of a potential catalytic RNA and several protein components, all of which are required for cell viability. We show here that the temperature-sensitive mutant of rmp1, the gene for a unique protein component of RNase MRP, accumulates the dimeric tRNA precursor, pre-tRNA(Ser-Met). To examine whether RNase MRP mediates tRNA maturation, we purified the RNase MRP holoenzyme from the fission yeast Schizosaccharomyces pombe and found that the enzyme directly and selectively cleaves pre-tRNA(Ser-Met), suggesting that RNase MRP participates in the maturation of specific tRNA in vivo. In addition, mass spectrometry-based ribonucleoproteomic analysis demonstrated that this RNase MRP consists of one RNA molecule and 11 protein components, including a previously unknown component Rpl701. Notably, limited nucleolysis of RNase MRP generated an active catalytic core consisting of partial mrp1 RNA fragments, which constitute "Domain 1" in the secondary structure of RNase MRP, and 8 proteins. Thus, the present study provides new insight into the structure and function of RNase MRP.

  17. Gene Synthesis with HG Khorana

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 17; Issue 12. Gene Synthesis with H G Khorana. Marvin H Caruthers. General Article Volume 17 Issue 12 December 2012 pp ... Keywords. Chemical synthesis of genes for yeast alanine tRNA and E. coli supressor tRNA; Khorana's philosophy on science.

  18. Origins and Early Evolution of the tRNA Molecule

    Directory of Open Access Journals (Sweden)

    Koji Tamura

    2015-12-01

    Full Text Available Modern transfer RNAs (tRNAs are composed of ~76 nucleotides and play an important role as “adaptor” molecules that mediate the translation of information from messenger RNAs (mRNAs. Many studies suggest that the contemporary full-length tRNA was formed by the ligation of half-sized hairpin-like RNAs. A minihelix (a coaxial stack of the acceptor stem on the T-stem of tRNA can function both in aminoacylation by aminoacyl tRNA synthetases and in peptide bond formation on the ribosome, indicating that it may be a vestige of the ancestral tRNA. The universal CCA-3′ terminus of tRNA is also a typical characteristic of the molecule. “Why CCA?” is the fundamental unanswered question, but several findings give a comprehensive picture of its origin. Here, the origins and early evolution of tRNA are discussed in terms of various perspectives, including nucleotide ligation, chiral selectivity of amino acids, genetic code evolution, and the organization of the ribosomal peptidyl transferase center (PTC. The proto-tRNA molecules may have evolved not only as adaptors but also as contributors to the composition of the ribosome.

  19. Origins and Early Evolution of the tRNA Molecule.

    Science.gov (United States)

    Tamura, Koji

    2015-12-03

    Modern transfer RNAs (tRNAs) are composed of ~76 nucleotides and play an important role as "adaptor" molecules that mediate the translation of information from messenger RNAs (mRNAs). Many studies suggest that the contemporary full-length tRNA was formed by the ligation of half-sized hairpin-like RNAs. A minihelix (a coaxial stack of the acceptor stem on the T-stem of tRNA) can function both in aminoacylation by aminoacyl tRNA synthetases and in peptide bond formation on the ribosome, indicating that it may be a vestige of the ancestral tRNA. The universal CCA-3' terminus of tRNA is also a typical characteristic of the molecule. "Why CCA?" is the fundamental unanswered question, but several findings give a comprehensive picture of its origin. Here, the origins and early evolution of tRNA are discussed in terms of various perspectives, including nucleotide ligation, chiral selectivity of amino acids, genetic code evolution, and the organization of the ribosomal peptidyl transferase center (PTC). The proto-tRNA molecules may have evolved not only as adaptors but also as contributors to the composition of the ribosome.

  20. Cloning and characterization of the gene encoding glutamate 1-semialdehyde 2,1-aminomutase, which is involved in delta-aminolevulinic acid synthesis in Propionibacterium freudenreichii.

    Science.gov (United States)

    Murakami, K; Hashimoto, Y; Murooka, Y

    1993-01-01

    The gene from Propionibacterium freudenreichii that encodes glutamate 1-semialdehyde 2,1-aminomutase (EC 5.4.3.8), which is involved in the C5 pathway for synthesis of delta-aminolevulinic acid (ALA), a precursor in heme and cobalamin biosynthesis, was cloned onto a multicopy plasmid, pUC18, via complementation of an ALA-deficient mutant (hemL) of Escherichia coli. Subcloning of fragments from the initial 3.3-kb chromosomal fragment allowed the isolation of a 1.9-kb fragment which could complement the hemL mutation. Nucleotide sequence analysis of the 1.9-kb DNA fragment revealed an open reading frame (ORF) that was located downstream from a potential ribosome-binding site. The ORF encoded a polypeptide of 441 amino acid residues, and the deduced molecular mass of this polypeptide is 45,932 Da. A high G+C content (70 mol%) of the codons of the ORF was found and was consistent with the taxonomic features of Propionibacterium species. The amino acid sequence showed a high degree of homology with those of the HemL proteins from other organisms, and a putative binding site for pyridoxal 5'-phosphate was conserved, with the exception of a single substitution of phenylalanine for leucine. These results suggest that ALA is synthesized via the C5 pathway in a producer of vitamin B12, P. freudenreichii.

  1. Lycopene modulates cholinergic dysfunction, Bcl-2/Bax balance, and antioxidant enzymes gene transcripts in monosodium glutamate (E621) induced neurotoxicity in a rat model.

    Science.gov (United States)

    Sadek, Kadry; Abouzed, Tarek; Nasr, Sherif

    2016-04-01

    The effect of monosodium glutamate (MSG) on brain tissue and the relative ability of lycopene to avert these neurotoxic effects were investigated. Thirty-two male Wistar rats were distributed into 4 groups: group I, untreated (placebo); group II, injected with MSG (5 mg·kg(-1)) s.c.; group III, gastrogavaged with lycopene (10 mg·kg(-1)) p.o.; and group IV received MSG with lycopene with the same mentioned doses for 30 days. The results showed that MSG induced elevation in lipid peroxidation marker and perturbation in the antioxidant homeostasis and increased the levels of brain and serum cholinesterase (ChE), total creatine phosphokinase (CPK), creatine phosphokinase isoenzymes BB (CPK-BB), and lactate dehydrogenase (LDH). Glutathione S-transferase (GST), superoxide dismutase (SOD), and catalase (CAT) activities and gene expression were increased and glutathione content was reduced in the MSG-challenged rats, and these effects were ameliorated by lycopene. Furthermore, MSG induced apoptosis in brain tissues reflected in upregulation of pro-apoptotic Bax while lycopene upregulated the anti-apoptotic Bcl-2. Our results indicate that lycopene appears to be highly effective in relieving the toxic effects of MSG by inhibiting lipid peroxidation and inducing modifications in the activity of cholinesterase and antioxidant pathways. Interestingly, lycopene protects brain tissue by inhibiting apoptosis signaling induced by MSG.

  2. Identification of single nucleotide polymorphisms of the human metabotropic glutamate receptor 1 gene and pharmacological characterization of a P993S variant.

    Science.gov (United States)

    Downey, Patrick M; Petrò, Roberta; Simon, Jason S; Devlin, David; Lozza, Gianluca; Veltri, Alessio; Beltramo, Massimiliano; Bertorelli, Rosalia; Reggiani, Angelo

    2009-04-01

    mGluR1 receptors are believed to play major roles in the pathophysiology of diseases such as anxiety and chronic pain and are being actively investigated as targets for drug development. Sequence polymorphisms can potentially influence the efficacy of drugs in patient populations and are therefore an important consideration in the drug development process. To identify DNA sequence variants of the mGluR1 receptor, comparative DNA sequencing was performed on DNA samples (n=186) from apparently healthy subjects representing two ethnic groups. In total, eight non-synonymous single nucleotide polymorphisms (SNPs) were identified and one SNP (c2977>T) was found to be particularly common, this SNP results in a proline to serine substitution at residue 993 (P993S). The WT (P993) and S993 variants were expressed in an inducible system which allowed us to titrate gene expression to equivalent levels and were pharmacologically characterized. We determined the potency and affinity of standard antagonist compounds as well as the potency and efficacy of the endogenous ligand glutamate and other agonist compounds at both receptor variants. Agonist evoked increases in intracellular Ca(2+) were measured by fluorometric imaging plate reader (FLIPR). The potency of mGluR1 antagonists was evaluated by their ability to inhibit quisqualate induced increases in intracellular Ca(2+), while their affinities were determined by radio-ligand binding studies. This study demonstrates that the Pro993Ser amino acid exchange is highly frequent in the human mGluR1 gene. This polymorphism however, does not appear to affect the potency of agonist compounds or the potencies or affinities of small molecule antagonist compounds.

  3. Allelic association, DNA resequencing and copy number variation at the metabotropic glutamate receptor GRM7 gene locus in bipolar disorder.

    Science.gov (United States)

    Kandaswamy, Radhika; McQuillin, Andrew; Curtis, David; Gurling, Hugh

    2014-06-01

    Genetic markers at the GRM7 gene have shown allelic association with bipolar disorder (BP) in several case-control samples including our own sample. In this report, we present results of resequencing the GRM7 gene in 32 bipolar samples and 32 random controls selected from 553 bipolar cases and 547 control samples (UCL1). Novel and potential etiological base pair changes discovered by resequencing were genotyped in the entire UCL case-control sample. We also report on the association between GRM7 and BP in a second sample of 593 patients and 642 controls (UCL2). The three most significantly associated SNPs in the original UCL1 BP GWAS sample were genotyped in the UCL2 sample, of which none were associated. After combining the genotype data for the two samples only two (rs1508724 and rs6769814) of the original three SNP markers remained significantly associated with BP. DNA sequencing revealed mutations in three cases which were absent in control subjects. A 3'-UTR SNP rs56173829 was found to be significantly associated with BP in the whole UCL sample (P = 0.035; OR = 0.482), the rare allele being less common in cases compared to controls. Bioinformatic analyses predicted a change in the centroid secondary structure of RNA and alterations in the miRNA binding sites for the mutated base of rs56173829. We also validated two deletions and a duplication within GRM7 using quantitative-PCR which provides further support for the pre-existing evidence that copy number variants at GRM7 may have a role in the etiology of BP. © 2014 The Authors. American Journal of Medical Genetics Part B: Neuropsychiatric Published by Wiley Periodicals, Inc.

  4. [Glutamate signaling and neural plasticity].

    Science.gov (United States)

    Watanabe, Masahiko

    2013-07-01

    Proper functioning of the nervous system relies on the precise formation of neural circuits during development. At birth, neurons have redundant synaptic connections not only to their proper targets but also to other neighboring cells. Then, functional neural circuits are formed during early postnatal development by the selective strengthening of necessary synapses and weakening of surplus connections. Synaptic connections are also modified so that projection fields of active afferents expand at the expense of lesser ones. We have studied the molecular mechanisms underlying these activity-dependent prunings and the plasticity of synaptic circuitry using gene-engineered mice defective in the glutamatergic signaling system. NMDA-type glutamate receptors are critically involved in the establishment of the somatosensory pathway ascending from the brainstem trigeminal nucleus to the somatosensory cortex. Without NMDA receptors, whisker-related patterning fails to develop, whereas lesion-induced plasticity occurs normally during the critical period. In contrast, mice lacking the glutamate transporters GLAST or GLT1 are selectively impaired in the lesion-induced critical plasticity of cortical barrels, although whisker-related patterning itself develops normally. In the developing cerebellum, multiple climbing fibers initially innervating given Purkinje cells are eliminated one by one until mono-innervation is achieved. In this pruning process, P/Q-type Ca2+ channels expressed on Purkinje cells are critically involved by the selective strengthening of single main climbing fibers against other lesser afferents. Therefore, the activation of glutamate receptors that leads to an activity-dependent increase in the intracellular Ca2+ concentration plays a key role in the pruning of immature synaptic circuits into functional circuits. On the other hand, glutamate transporters appear to control activity-dependent plasticity among afferent fields, presumably through adjusting

  5. Reverse translocation of tRNA in the ribosome.

    Science.gov (United States)

    Shoji, Shinichiro; Walker, Sarah E; Fredrick, Kurt

    2006-12-28

    A widely held view is that directional movement of tRNA in the ribosome is determined by an intrinsic mechanism and driven thermodynamically by transpeptidation. Here, we show that, in certain ribosomal complexes, the pretranslocation (PRE) state is thermodynamically favored over the posttranslocation (POST) state. Spontaneous and efficient conversion from the POST to PRE state is observed when EF-G is depleted from ribosomes in the POST state or when tRNA is added to the E site of ribosomes containing P-site tRNA. In the latter assay, the rate of tRNA movement is increased by streptomycin and neomycin, decreased by tetracycline, and not affected by the acylation state of the tRNA. In one case, we provide evidence that complex conversion occurs by reverse translocation (i.e., direct movement of the tRNAs from the E and P sites to the P and A sites, respectively). These findings have important implications for the energetics of translocation.

  6. Tomato Glutamate Decarboxylase Genes SlGAD2 and SlGAD3 Play Key Roles in Regulating γ-Aminobutyric Acid Levels in Tomato (Solanum lycopersicum).

    Science.gov (United States)

    Takayama, Mariko; Koike, Satoshi; Kusano, Miyako; Matsukura, Chiaki; Saito, Kazuki; Ariizumi, Tohru; Ezura, Hiroshi

    2015-08-01

    Tomato (Solanum lycopersicum) can accumulate relatively high levels of γ-aminobutyric acid (GABA) during fruit development. However, the molecular mechanism underlying GABA accumulation and its physiological function in tomato fruits remain elusive. We previously identified three tomato genes (SlGAD1, SlGAD2 and SlGAD3) encoding glutamate decarboxylase (GAD), likely the key enzyme for GABA biosynthesis in tomato fruits. In this study, we generated transgenic tomato plants in which each SlGAD was suppressed and those in which all three SlGADs were simultaneously suppressed. A significant decrease in GABA levels, i.e. 50-81% compared with wild-type (WT) levels, was observed in mature green (MG) fruits of the SlGAD2-suppressed lines, while a more drastic reduction (up to <10% of WT levels) was observed in the SlGAD3- and triple SlGAD-suppressed lines. These findings suggest that both SlGAD2 and SlGAD3 expression are crucial for GABA biosynthesis in tomato fruits. The importance of SlGAD3 expression was also confirmed by generating transgenic tomato plants that over-expressed SlGAD3. The MG and red fruits of the over-expressing transgenic lines contained higher levels of GABA (2.7- to 5.2-fold) than those of the WT. We also determined that strong down-regulation of the SlGADs had little effect on overall plant growth, fruit development or primary fruit metabolism under normal growth conditions. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  7. Redox engineering by ectopic expression of glutamate dehydrogenase genes links NADPH availability and NADH oxidation with cold growth in Saccharomyces cerevisiae.

    Science.gov (United States)

    Ballester-Tomás, Lidia; Randez-Gil, Francisca; Pérez-Torrado, Roberto; Prieto, Jose Antonio

    2015-07-09

    Cold stress reduces microbial growth and metabolism being relevant in industrial processes like wine making and brewing. Knowledge on the cold transcriptional response of Saccharomyces cerevisiae suggests the need of a proper redox balance. Nevertheless, there are no direct evidence of the links between NAD(P) levels and cold growth and how engineering of enzymatic reactions requiring NAD(P) may be used to modify the performance of industrial strains at low temperature. Recombinant strains of S. cerevisiae modified for increased NADPH- and NADH-dependent Gdh1 and Gdh2 activity were tested for growth at low temperature. A high-copy number of the GDH2-encoded glutamate dehydrogenase gene stimulated growth at 15°C, while overexpression of GDH1 had detrimental effects, a difference likely caused by cofactor preferences. Indeed, neither the Trp(-) character of the tested strains, which could affect the synthesis of NAD(P), nor changes in oxidative stress susceptibility by overexpression of GDH1 and GDH2 account for the observed phenotypes. However, increased or reduced NADPH availability by knock-out or overexpression of GRE3, the NADPH-dependent aldose reductase gene, eliminated or exacerbated the cold-growth defect observed in YEpGDH1 cells. We also demonstrated that decreased capacity of glycerol production impairs growth at 15 but not at 30°C and that 15°C-grown baker's yeast cells display higher fermentative capacity than those cultivated at 30°C. Thus, increasing NADH oxidation by overexpression of GDH2 would help to avoid perturbations in the redox metabolism induced by a higher fermentative/oxidative balance at low temperature. Finally, it is shown that overexpression of GDH2 increases notably the cold growth in the wine yeast strain QA23 in both standard growth medium and synthetic grape must. Redox constraints limit the growth of S. cerevisiae at temperatures below the optimal. An adequate supply of NAD(P) precursors as well as a proper level of reducing

  8. The initiator methionine tRNA drives cell migration and invasion leading to increased metastatic potential in melanoma

    Directory of Open Access Journals (Sweden)

    Joanna Birch

    2016-10-01

    Full Text Available The cell's repertoire of transfer RNAs (tRNAs has been linked to cancer. Recently, the level of the initiator methionine tRNA (tRNAiMet in stromal fibroblasts has been shown to influence extracellular matrix (ECM secretion to drive tumour growth and angiogenesis. Here we show that increased tRNAiMet within cancer cells does not influence tumour growth, but drives cell migration and invasion via a mechanism that is independent from ECM synthesis and dependent on α5β1 integrin and levels of the translation initiation ternary complex. In vivo and ex vivo migration (but not proliferation of melanoblasts is significantly enhanced in transgenic mice which express additional copies of the tRNAiMet gene. We show that increased tRNAiMet in melanoma drives migratory, invasive behaviour and metastatic potential without affecting cell proliferation and primary tumour growth, and that expression of RNA polymerase III-associated genes (which drive tRNA expression are elevated in metastases by comparison with primary tumours. Thus, specific alterations to the cancer cell tRNA repertoire drive a migration/invasion programme that may lead to metastasis.

  9. Glutamate release from platelets: exocytosis versus glutamate transporter reversal.

    Science.gov (United States)

    Kasatkina, Ludmila A; Borisova, Tatiana A

    2013-11-01

    Platelets express neuronal and glial glutamate transporters EAAT 1-3 in the plasma membrane and vesicular glutamate transporters VGLUT 1,2 in the membrane of secretory granules. This study is focused on the assessment of non-exocytotic glutamate release, that is, the unstimulated release, heteroexchange and glutamate transporter reversal in platelets. Using the glutamate dehydrogenase assay, the absence of unstimulated release of endogenous glutamate from platelets was demonstrated, even after inhibition of glutamate transporters and cytoplasmic enzyme glutamine synthetase by dl-threo-β-benzyloxyaspartate and methionine sulfoximine, respectively. Depolarization of the plasma membrane by exposure to elevated [K(+)] did not induce the release of glutamate from platelets that was shown using the glutamate dehydrogenase assay and radiolabeled l-[(14)C]glutamate. Glutamate efflux by means of heteroexchange with transportable inhibitor of glutamate transporters dl-threo-β-hydroxyaspartate (dl-THA) was not observed. Furthermore, the protonophore cyanide-p-trifluoromethoxyphenyl-hydrazon (FCCP) and inhibitor of V-type H(+)-ATPase bafilomycin A1 also failed to stimulate the release of glutamate from platelets. However, exocytotic release of glutamate from secretory granules in response to thrombin stimulation was not prevented by elevated [K(+)], dl-THA, FCCP and bafilomycin A1. In contrast to nerve terminals, platelets cannot release glutamate in a non-exocytotic manner. Heteroexchange, transporter-mediated and unstimulated release of glutamate are not inherent to platelets. Therefore, platelets may be used as a peripheral marker/model for the analysis of glutamate uptake by brain nerve terminals only (direct function of transporters), whereas the mechanisms of glutamate release are different in platelets and nerve terminals. Glutamate is released by platelets exclusively by means of exocytosis. Also, reverse function of vesicular glutamate transporters of platelets is

  10. Glutamate receptor agonists

    DEFF Research Database (Denmark)

    Vogensen, Stine Byskov; Greenwood, Jeremy R; Bunch, Lennart

    2011-01-01

    The neurotransmitter (S)-glutamate [(S)-Glu] is responsible for most of the excitatory neurotransmission in the central nervous system. The effect of (S)-Glu is mediated by both ionotropic and metabotropic receptors. Glutamate receptor agonists are generally a-amino acids with one or more...... stereogenic centers due to strict requirements in the agonist binding pocket of the activated state of the receptor. By contrast, there are many examples of achiral competitive antagonists. The present review addresses how stereochemistry affects the activity of glutamate receptor ligands. The review focuses...... mainly on agonists and discusses stereochemical and conformational considerations as well as biostructural knowledge of the agonist binding pockets, which is useful in the design of glutamate receptor agonists. Examples are chosen to demonstrate how stereochemistry not only determines how the agonist...

  11. Biogenesis and function of tRNA fragments during sperm maturation and fertilization in mammals.

    Science.gov (United States)

    Sharma, Upasna; Conine, Colin C; Shea, Jeremy M; Boskovic, Ana; Derr, Alan G; Bing, Xin Y; Belleannee, Clemence; Kucukural, Alper; Serra, Ryan W; Sun, Fengyun; Song, Lina; Carone, Benjamin R; Ricci, Emiliano P; Li, Xin Z; Fauquier, Lucas; Moore, Melissa J; Sullivan, Robert; Mello, Craig C; Garber, Manuel; Rando, Oliver J

    2016-01-22

    Several recent studies link parental environments to phenotypes in subsequent generations. In this work, we investigate the mechanism by which paternal diet affects offspring metabolism. Protein restriction in mice affects small RNA (sRNA) levels in mature sperm, with decreased let-7 levels and increased amounts of 5' fragments of glycine transfer RNAs (tRNAs). In testicular sperm, tRNA fragments are scarce but increase in abundance as sperm mature in the epididymis. Epididymosomes (vesicles that fuse with sperm during epididymal transit) carry RNA payloads matching those of mature sperm and can deliver RNAs to immature sperm in vitro. Functionally, tRNA-glycine-GCC fragments repress genes associated with the endogenous retroelement MERVL, in both embryonic stem cells and embryos. Our results shed light on sRNA biogenesis and its dietary regulation during posttesticular sperm maturation, and they also link tRNA fragments to regulation of endogenous retroelements active in the preimplantation embryo. Copyright © 2016, American Association for the Advancement of Science.

  12. Engineering CRISPR/Cpf1 with tRNA promotes genome editing capability in mammalian systems.

    Science.gov (United States)

    Wu, Han; Liu, Qishuai; Shi, Hui; Xie, Jingke; Zhang, Quanjun; Ouyang, Zhen; Li, Nan; Yang, Yi; Liu, Zhaoming; Zhao, Yu; Lai, Chengdan; Ruan, Degong; Peng, Jiangyun; Ge, Weikai; Chen, Fangbing; Fan, Nana; Jin, Qin; Liang, Yanhui; Lan, Ting; Yang, Xiaoyu; Wang, Xiaoshan; Lei, Zhiyong; Doevendans, Pieter A; Sluijter, Joost P G; Wang, Kepin; Li, Xiaoping; Lai, Liangxue

    2018-04-10

    CRISPR/Cpf1 features a number of properties that are distinct from CRISPR/Cas9 and provides an excellent alternative to Cas9 for genome editing. To date, genome engineering by CRISPR/Cpf1 has been reported only in human cells and mouse embryos of mammalian systems and its efficiency is ultimately lower than that of Cas9 proteins from Streptococcus pyogenes. The application of CRISPR/Cpf1 for targeted mutagenesis in other animal models has not been successfully verified. In this study, we designed and optimized a guide RNA (gRNA) transcription system by inserting a transfer RNA precursor (pre-tRNA) sequence downstream of the gRNA for Cpf1, protecting gRNA from immediate digestion by 3'-to-5' exonucleases. Using this new gRNA tRNA system, genome editing, including indels, large fragment deletion and precise point mutation, was induced in mammalian systems, showing significantly higher efficiency than the original Cpf1-gRNA system. With this system, gene-modified rabbits and pigs were generated by embryo injection or somatic cell nuclear transfer (SCNT) with an efficiency comparable to that of the Cas9 gRNA system. These results demonstrated that this refined gRNA tRNA system can boost the targeting capability of CRISPR/Cpf1 toolkits.

  13. Genomic analysis of Bacillus subtilis lytic bacteriophage ϕNIT1 capable of obstructing natto fermentation carrying genes for the capsule-lytic soluble enzymes poly-γ-glutamate hydrolase and levanase.

    Science.gov (United States)

    Ozaki, Tatsuro; Abe, Naoki; Kimura, Keitarou; Suzuki, Atsuto; Kaneko, Jun

    2017-01-01

    Bacillus subtilis strains including the fermented soybean (natto) starter produce capsular polymers consisting of poly-γ-glutamate and levan. Capsular polymers may protect the cells from phage infection. However, bacteriophage ϕNIT1 carries a γ-PGA hydrolase gene (pghP) that help it to counteract the host cell's protection strategy. ϕNIT had a linear double stranded DNA genome of 155,631-bp with a terminal redundancy of 5,103-bp, containing a gene encoding an active levan hydrolase. These capsule-lytic enzyme genes were located in the possible foreign gene cluster regions between central core and terminal redundant regions, and were expressed at the late phase of the phage lytic cycle. All tested natto origin Spounavirinae phages carried both genes for capsule degrading enzymes similar to ϕNIT1. A comparative genomic analysis revealed the diversity among ϕNIT1 and Bacillus phages carrying pghP-like and levan-hydrolase genes, and provides novel understanding on the acquisition mechanism of these enzymatic genes.

  14. Glutamate dehydrogenase (RocG) in Bacillus licheniformis WX-02: Enzymatic properties and specific functions in glutamic acid synthesis for poly-γ-glutamic acid production.

    Science.gov (United States)

    Tian, Guangming; Wang, Qin; Wei, Xuetuan; Ma, Xin; Chen, Shouwen

    2017-04-01

    Poly-γ-glutamic acid (γ-PGA), a natural biopolymer, is widely used in cosmetics, medicine, food, water treatment, and agriculture owing to its features of moisture sequestration, cation chelation, non-toxicity and biodegradability. Intracellular glutamic acid, the substrate of γ-PGA, is a limiting factor for high yield in γ-PGA production. Bacillus subtilis and Bacillus licheniformis are both important γ-PGA producing strains, and B. subtilis synthesizes glutamic acid in vivo using the unique GOGAT/GS pathway. However, little is known about the glutamate synthesis pathway in B. licheniformis. The aim of this work was to characterize the glutamate dehydrogenase (RocG) in glutamic acid synthesis from B. licheniformis with both in vivo and in vitro experiments. By re-directing the carbon flux distribution, the rocG gene deletion mutant WX-02ΔrocG produced intracellular glutamic acid with a concentration of 90ng/log(CFU), which was only 23.7% that of the wild-type WX-02 (380ng/log(CFU)). Furthermore, the γ-PGA yield of mutant WX-02ΔrocG was 5.37g/L, a decrease of 45.3% compared to the wild type (9.82g/L). In vitro enzymatic assays of RocG showed that RocG has higher affinity for 2-oxoglutarate than glutamate, and the glutamate synthesis rate was far above degradation. This is probably the first study to reveal the glutamic acid synthesis pathway and the specific functions of RocG in B. licheniformis. The results indicate that γ-PGA production can be enhanced through improving intracellular glutamic acid synthesis. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Riluzole and gabapentinoids activate glutamate transporters to facilitate glutamate-induced glutamate release from cultured astrocytes

    OpenAIRE

    Yoshizumi, Masaru; Eisenach, James. C.; Hayashida, Ken-ichiro

    2011-01-01

    We have recently demonstrated that the glutamate transporter activator riluzole paradoxically enhanced glutamate-induced glutamate release from cultured astrocytes. We further showed that both riluzole and the α2δ subunit ligand gabapentin activated descending inhibition in rats by increasing glutamate receptor signaling in the locus coeruleus and hypothesized that these drugs share common mechanisms to enhance glutamate release from astrocytes. In the present study, we examined the effects o...

  16. [Preparation of leucine-methyl glutamate-glutamic acid copolymers].

    Science.gov (United States)

    Pan, S; Shi, F; Huang, L; Zhou, Q; Lin, Z; Yi, W

    1997-06-01

    The method for preparing leucine-methyl glutamate-glutamic acid copolymer was studied. In the first place benzyl glutamate and methyl glutamate were synthesized respectively. Then N-carboxy anhydrides (NCA) of leucine, benzyl glutamate or methyl glutamate were prepared in a closed container by phosgene-toluene solution method. After copolymerization the copolymers were debenzylated and demethylated by anhydrous hydrogen bromide. The free carboxyl group mole content in side chains of the copolymer was controlled by various standing periods following bubbling HBr. Analysis of infrared spectrogram and ultraviolet asorbance of copolymers indicated that this procedure resulted in the loss of almost all benzyl groups and some methyl groups.

  17. Use of a Yeast tRNase Killer Toxin to Diagnose Kti12 Motifs Required for tRNA Modification by Elongator.

    Science.gov (United States)

    Mehlgarten, Constance; Prochaska, Heike; Hammermeister, Alexander; Abdel-Fattah, Wael; Wagner, Melanie; Krutyhołowa, Rościsław; Jun, Sang Eun; Kim, Gyung-Tae; Glatt, Sebastian; Breunig, Karin D; Stark, Michael J R; Schaffrath, Raffael

    2017-09-05

    Saccharomyces cerevisiae cells are killed by zymocin, a tRNase ribotoxin complex from Kluyveromyces lactis , which cleaves anticodons and inhibits protein synthesis. Zymocin's action requires specific chemical modification of uridine bases in the anticodon wobble position (U34) by the Elongator complex (Elp1-Elp6). Hence, loss of anticodon modification in mutants lacking Elongator or related KTI ( K. lactis Toxin Insensitive) genes protects against tRNA cleavage and confers resistance to the toxin. Here, we show that zymocin can be used as a tool to genetically analyse KTI12 , a gene previously shown to code for an Elongator partner protein. From a kti12 mutant pool of zymocin survivors, we identify motifs in Kti12 that are functionally directly coupled to Elongator activity. In addition, shared requirement of U34 modifications for nonsense and missense tRNA suppression ( SUP4 ; SOE1 ) strongly suggests that Kti12 and Elongator cooperate to assure proper tRNA functioning. We show that the Kti12 motifs are conserved in plant ortholog DRL1/ELO4 from Arabidopsis thaliana and seem to be involved in binding of cofactors (e.g., nucleotides, calmodulin). Elongator interaction defects triggered by mutations in these motifs correlate with phenotypes typical for loss of U34 modification. Thus, tRNA modification by Elongator appears to require physical contact with Kti12, and our preliminary data suggest that metabolic signals may affect proper communication between them.

  18. Loss of wobble uridine modification in tRNA anticodons interferes with TOR pathway signaling.

    Science.gov (United States)

    Scheidt, Viktor; Jüdes, André; Bär, Christian; Klassen, Roland; Schaffrath, Raffael

    2014-11-29

    Previous work in yeast has suggested that modification of tRNAs, in particular uridine bases in the anticodon wobble position (U34), is linked to TOR (target of rapamycin) signaling. Hence, U34 modification mutants were found to be hypersensitive to TOR inhibition by rapamycin. To study whether this involves inappropriate TOR signaling, we examined interaction between mutations in TOR pathway genes ( tip41 ∆, sap190 ∆, ppm1 ∆, rrd1 ∆) and U34 modification defects ( elp3 ∆, kti 12∆, urm1 ∆, ncs2 ∆) and found the rapamycin hypersensitivity in the latter is epistatic to drug resistance of the former. Epistasis, however, is abolished in tandem with a gln3 ∆ deletion, which inactivates transcription factor Gln3 required for TOR-sensitive activation of NCR (nitrogen catabolite repression) genes. In line with nuclear import of Gln3 being under control of TOR and dephosphorylation by the Sit4 phosphatase, we identify novel TOR-sensitive sit4 mutations that confer rapamycin resistance and importantly, mislocalise Gln3 when TOR is inhibited. This is similar to gln3 ∆ cells, which abolish the rapamycin hypersensitivity of U34 modification mutants, and suggests TOR deregulation due to tRNA undermodification operates through Gln3. In line with this, loss of U34 modifications ( elp3 ∆, urm1 ∆) enhances nuclear import of and NCR gene activation ( MEP2 , GAP1 ) by Gln3 when TOR activity is low. Strikingly, this stimulatory effect onto Gln3 is suppressed by overexpression of tRNAs that usually carry the U34 modifications. Collectively, our data suggest that proper TOR signaling requires intact tRNA modifications and that loss of U34 modifications impinges on the TOR-sensitive NCR branch via Gln3 misregulation.

  19. Thiolation Controls Cytoplasmic tRNA Stability and Acts as a Negative Determinant for tRNA Editing in Mitochondria

    Czech Academy of Sciences Publication Activity Database

    Wohlgamuth-Benedum, J. M.; RUBIO, M. A. T.; Paris, Zdeněk; Long, Shaojun; Poliak, Pavel; Lukeš, Julius; Alfonzo, J. D.

    2009-01-01

    Roč. 284, č. 36 (2009), s. 23947-23953 ISSN 0021-9258 R&D Projects: GA ČR GA204/06/1558; GA MŠk LC07032; GA MŠk 2B06129 Institutional research plan: CEZ:AV0Z60220518 Keywords : T. brucei * tRNA * 2-thiolation * Fe-S cluster * editing Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.328, year: 2009

  20. Identity Elements of tRNA as Derived from Information Analysis

    Science.gov (United States)

    Zamudio, Gabriel S.; José, Marco V.

    2018-03-01

    The decipherment of the tRNA's operational code, known as the identity problem, requires the location of the sites in the tRNA structure that are involved in their correct recognition by the corresponding aminoacyl-tRNA synthetase. In this work, we determine the identity elements of each tRNA isoacceptor by means of the variation of information measure from information theory. We show that all isoacceptors exhibit sites associated with some bases of the anticodon. These sites form clusters that are scattered along the tRNA structure. The clusters determine the identity elements of each tRNA. We derive a catalogue of clustered sites for each tRNA that expands previously reported elements.

  1. Glutamate receptor agonists

    DEFF Research Database (Denmark)

    Vogensen, Stine Byskov; Greenwood, Jeremy R; Bunch, Lennart

    2011-01-01

    stereogenic centers due to strict requirements in the agonist binding pocket of the activated state of the receptor. By contrast, there are many examples of achiral competitive antagonists. The present review addresses how stereochemistry affects the activity of glutamate receptor ligands. The review focuses...... mainly on agonists and discusses stereochemical and conformational considerations as well as biostructural knowledge of the agonist binding pockets, which is useful in the design of glutamate receptor agonists. Examples are chosen to demonstrate how stereochemistry not only determines how the agonist...

  2. Capture, unfolding, and detection of individual tRNA molecules using a nanopore device

    Directory of Open Access Journals (Sweden)

    Andrew M Smith

    2015-06-01

    Full Text Available Transfer RNAs (tRNA are the most common RNA molecules in cells and have critical roles as both translators of the genetic code and regulators of protein synthesis. As such, numerous methods have focused on studying tRNA abundance and regulation, with the most widely used methods being RNA-seq and microarrays. Though revolutionary to transcriptomics, these assays are limited by an inability to encode tRNA modifications in the requisite cDNA. These modifications are abundant in tRNA and critical to their function. Here we describe proof-of-concept experiments where individual tRNA molecules are examined as linear strands using a biological nanopore. This method utilizes an enzymatically ligated synthetic DNA adapter to concentrate tRNA at the lipid bilayer of the nanopore device and efficiently denature individual tRNA molecules as they are pulled through the α-hemolysin (α-HL nanopore. Additionally, the DNA adapter provides a loading site for ϕ29 DNA polymerase (ϕ29 DNAP, which acts as a brake on the translocating tRNA. This increases the dwell time of adapted tRNA in the nanopore, allowing us to identify the region of the nanopore signal that is produced by the translocating tRNA itself. Using adapter-modified E. coli tRNAfMet and tRNALys, we show that the nanopore signal during controlled translocation is dependent on the identity of the tRNA. This confirms that adapter-modified tRNA can translocate end-to-end through nanopores and provides the foundation for future work in direct sequencing of individual transfer RNA with a nanopore-based device.

  3. Capture, Unfolding, and Detection of Individual tRNA Molecules Using a Nanopore Device

    Science.gov (United States)

    Smith, Andrew M.; Abu-Shumays, Robin; Akeson, Mark; Bernick, David L.

    2015-01-01

    Transfer RNAs (tRNA) are the most common RNA molecules in cells and have critical roles as both translators of the genetic code and regulators of protein synthesis. As such, numerous methods have focused on studying tRNA abundance and regulation, with the most widely used methods being RNA-seq and microarrays. Though revolutionary to transcriptomics, these assays are limited by an inability to encode tRNA modifications in the requisite cDNA. These modifications are abundant in tRNA and critical to their function. Here, we describe proof-of-concept experiments where individual tRNA molecules are examined as linear strands using a biological nanopore. This method utilizes an enzymatically ligated synthetic DNA adapter to concentrate tRNA at the lipid bilayer of the nanopore device and efficiently denature individual tRNA molecules, as they are pulled through the α-hemolysin (α-HL) nanopore. Additionally, the DNA adapter provides a loading site for ϕ29 DNA polymerase (ϕ29 DNAP), which acts as a brake on the translocating tRNA. This increases the dwell time of adapted tRNA in the nanopore, allowing us to identify the region of the nanopore signal that is produced by the translocating tRNA itself. Using adapter-modified Escherichia coli tRNAfMet and tRNALys, we show that the nanopore signal during controlled translocation is dependent on the identity of the tRNA. This confirms that adapter-modified tRNA can translocate end-to-end through nanopores and provide the foundation for future work in direct sequencing of individual transfer RNA with a nanopore-based device. PMID:26157798

  4. Glutamate oxidation in astrocytes: Roles of glutamate dehydrogenase and aminotransferases.

    Science.gov (United States)

    McKenna, Mary C; Stridh, Malin H; McNair, Laura F; Sonnewald, Ursula; Waagepetersen, Helle S; Schousboe, Arne

    2016-12-01

    The cellular distribution of transporters and enzymes related to glutamate metabolism led to the concept of the glutamate-glutamine cycle. Glutamate is released as a neurotransmitter and taken up primarily by astrocytes ensheathing the synapses. The glutamate carbon skeleton is transferred back to the presynaptic neurons as the nonexcitatory amino acid glutamine. The cycle was initially thought to function with a 1:1 ratio between glutamate released and glutamine taken up by neurons. However, studies of glutamate metabolism in astrocytes have shown that a considerable proportion of glutamate undergoes oxidative degradation; thus, quantitative formation of glutamine from the glutamate taken up is not possible. Oxidation of glutamate is initiated by transamination catalyzed by an aminotransferase, or oxidative deamination catalyzed by glutamate dehydrogenase (GDH). We discuss methods available to elucidate the enzymes that mediate this conversion. Methods include pharmacological tools such as the transaminase inhibitor aminooxyacetic acid, studies using GDH knockout mice, and siRNA-mediated knockdown of GDH in astrocytes. Studies in brain slices incubated with [ 15 N]glutamate demonstrated activity of GDH in astrocytes in situ. These results, in conjunction with reports in the literature, support the conclusion that GDH is active in astrocytes both in culture and in vivo and that this enzyme plays a significant role in glutamate oxidation. Oxidative metabolism of glutamate, primarily mediated by GDH, but also by transamination by aspartate aminotransferase, provides considerably more energy than is required to maintain the activity of the high-affinity glutamate transporters needed for efficient removal of glutamate from the synaptic cleft. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  5. Effect of Correlated tRNA Abundances on Translation Errors and Evolution of Codon Usage Bias

    OpenAIRE

    Shah, Premal; Gilchrist, Michael A.

    2010-01-01

    Despite the fact that tRNA abundances are thought to play a major role in determining translation error rates, their distribution across the genetic code and the resulting implications have received little attention. In general, studies of codon usage bias (CUB) assume that codons with higher tRNA abundance have lower missense error rates. Using a model of protein translation based on tRNA competition and intra-ribosomal kinetics, we show that this assumption can be violated when tRNA abundan...

  6. Glutamate oxidation in astrocytes: Roles of glutamate dehydrogenase and aminotransferases

    DEFF Research Database (Denmark)

    McKenna, Mary C; Stridh, Malin H; McNair, Laura Frendrup

    2016-01-01

    to the presynaptic neurons as the nonexcitatory amino acid glutamine. The cycle was initially thought to function with a 1:1 ratio between glutamate released and glutamine taken up by neurons. However, studies of glutamate metabolism in astrocytes have shown that a considerable proportion of glutamate undergoes...... the enzymes that mediate this conversion. Methods include pharmacological tools such as the transaminase inhibitor aminooxyacetic acid, studies using GDH knockout mice, and siRNA-mediated knockdown of GDH in astrocytes. Studies in brain slices incubated with [15N]glutamate demonstrated activity of GDH......The cellular distribution of transporters and enzymes related to glutamate metabolism led to the concept of the glutamate–glutamine cycle. Glutamate is released as a neurotransmitter and taken up primarily by astrocytes ensheathing the synapses. The glutamate carbon skeleton is transferred back...

  7. Sequence organization and control of transcription in the bacteriophage T4 tRNA region.

    Science.gov (United States)

    Broida, J; Abelson, J

    1985-10-05

    Bacteriophage T4 contains genes for eight transfer RNAs and two stable RNAs of unknown function. These are found in two clusters at 70 X 10(3) base-pairs on the T4 genetic map. To understand the control of transcription in this region we have completed the sequencing of 5000 base-pairs in this region. The sequence contains a part of gene 3, gene 1, gene 57, internal protein I, the tRNA genes and five open reading frames which most likely code for heretofore unidentified proteins. We have used subclones of the region to investigate the kinetics of transcription in vivo. The results show that transcription in this region consists of overlapping early, middle and late transcripts. Transcription is directed from two early promoters, one or two middle promoters and perhaps two late promoters. This region contains all of the features that are seen in T4 transcription and as such is a good place to study the phenomenon in more detail.

  8. Non-Conserved Residues in Clostridium acetobutylicum tRNA(Ala) Contribute to tRNA Tuning for Efficient Antitermination of the alaS T Box Riboswitch.

    Science.gov (United States)

    Liu, Liang-Chun; Grundy, Frank J; Henkin, Tina M

    2015-09-28

    The T box riboswitch regulates expression of amino acid-related genes in Gram-positive bacteria by monitoring the aminoacylation status of a specific tRNA, the binding of which affects the folding of the riboswitch into mutually exclusive terminator or antiterminator structures. Two main pairing interactions between the tRNA and the leader RNA have been demonstrated to be necessary, but not sufficient, for efficient antitermination. In this study, we used the Clostridium acetobutylicum alaS gene, which encodes alanyl-tRNA synthetase, to investigate the specificity of the tRNA response. We show that the homologous C. acetobutylicum tRNA(Ala) directs antitermination of the C. acetobutylicum alaS gene in vitro, but the heterologous Bacillus subtilis tRNA(Ala) (with the same anticodon and acceptor end) does not. Base substitutions at positions that vary between these two tRNAs revealed synergistic and antagonistic effects. Variation occurs primarily at positions that are not conserved in tRNA(Ala) species, which indicates that these non-conserved residues contribute to optimal antitermination of the homologous alaS gene. This study suggests that elements in tRNA(Ala) may have coevolved with the homologous alaS T box leader RNA for efficient antitermination.

  9. Non-Conserved Residues in Clostridium acetobutylicum tRNAAla Contribute to tRNA Tuning for Efficient Antitermination of the alaS T Box Riboswitch

    Science.gov (United States)

    Liu, Liang-Chun; Grundy, Frank J.; Henkin, Tina M.

    2015-01-01

    The T box riboswitch regulates expression of amino acid-related genes in Gram-positive bacteria by monitoring the aminoacylation status of a specific tRNA, the binding of which affects the folding of the riboswitch into mutually exclusive terminator or antiterminator structures. Two main pairing interactions between the tRNA and the leader RNA have been demonstrated to be necessary, but not sufficient, for efficient antitermination. In this study, we used the Clostridium acetobutylicum alaS gene, which encodes alanyl-tRNA synthetase, to investigate the specificity of the tRNA response. We show that the homologous C. acetobutylicum tRNAAla directs antitermination of the C. acetobutylicum alaS gene in vitro, but the heterologous Bacillus subtilis tRNAAla (with the same anticodon and acceptor end) does not. Base substitutions at positions that vary between these two tRNAs revealed synergistic and antagonistic effects. Variation occurs primarily at positions that are not conserved in tRNAAla species, which indicates that these non-conserved residues contribute to optimal antitermination of the homologous alaS gene. This study suggests that elements in tRNAAla may have coevolved with the homologous alaS T box leader RNA for efficient antitermination. PMID:26426057

  10. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Hiraku Takada

    Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons

  11. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli

    Science.gov (United States)

    Takada, Hiraku; Shimada, Tomohiro; Dey, Debashish; Quyyum, M. Zuhaib; Nakano, Masahiro; Ishiguro, Akira; Yoshida, Hideji; Yamamoto, Kaneyoshi; Sen, Ranjan

    2016-01-01

    Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order) and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3’ proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP) holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon), within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons are expressed

  12. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

    Science.gov (United States)

    Takada, Hiraku; Shimada, Tomohiro; Dey, Debashish; Quyyum, M Zuhaib; Nakano, Masahiro; Ishiguro, Akira; Yoshida, Hideji; Yamamoto, Kaneyoshi; Sen, Ranjan; Ishihama, Akira

    2016-01-01

    Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order) and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP) holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon), within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons are expressed

  13. Viral tRNA Mimicry from a Biocommunicative Perspective

    Directory of Open Access Journals (Sweden)

    Ascensión Ariza-Mateos

    2017-12-01

    Full Text Available RNA viruses have very small genomes which limits the functions they can encode. One of the strategies employed by these viruses is to mimic key factors of the host cell so they can take advantage of the interactions and activities these factors typically participate in. The viral RNA genome itself was first observed to mimic cellular tRNA over 40 years ago. Since then researchers have confirmed that distinct families of RNA viruses are accessible to a battery of cellular factors involved in tRNA-related activities. Recently, potential tRNA-like structures have been detected within the sequences of a 100 mRNAs taken from human cells, one of these being the host defense interferon-alpha mRNA; these are then additional to the examples found in bacterial and yeast mRNAs. The mimetic relationship between tRNA, cellular mRNA, and viral RNA is the central focus of two considerations described below. These are subsequently used as a preface for a final hypothesis drawing on concepts relating to mimicry from the social sciences and humanities, such as power relations and creativity. Firstly, the presence of tRNA-like structures in mRNAs indicates that the viral tRNA-like signal could be mimicking tRNA-like elements that are contextualized by the specific carrier mRNAs, rather than, or in addition to, the tRNA itself, which would significantly increase the number of potential semiotic relations mediated by the viral signals. Secondly, and in particular, mimicking a host defense mRNA could be considered a potential new viral strategy for survival. Finally, we propose that mRNA’s mimicry of tRNA could be indicative of an ancestral intracellular conflict in which species of mRNAs invaded the cell, but from within. As the meaning of the mimetic signal depends on the context, in this case, the conflict that arises when the viral signal enters the cell can change the meaning of the mRNAs’ internal tRNA-like signals, from their current significance to that

  14. Metatranscriptomic analysis of microbes in an Oceanfront deep-subsurface hot spring reveals novel small RNAs and type-specific tRNA degradation.

    Science.gov (United States)

    Murakami, Shinnosuke; Fujishima, Kosuke; Tomita, Masaru; Kanai, Akio

    2012-02-01

    Studies of small noncoding RNAs (sRNAs) have been conducted predominantly using culturable organisms, and the acquisition of further information about sRNAs from global environments containing uncultured organisms now is very important. In this study, hot spring water (57°C, pH 8.1) was collected directly from the underground environment at depths of 250 to 1,000 m in Yunohama, Japan, and small RNA sequences obtained from the environment were analyzed. A phylogenetic analysis of both archaeal and bacterial 16S rRNA gene sequences was conducted, and the results suggested the presence of unique species in the environment, corresponding to the Archaeal Richmond Mine Acidophilic Nanoorganisms (ARMAN) group and three new Betaproteobacteria. A metatranscriptomic analysis identified 64,194 (20,057 nonredundant) cDNA sequences. Of these cDNAs, 90% were either tRNAs, tRNA fragments, rRNAs, or rRNA fragments, whereas 2,181 reads (10%) were classified as previously uncharacterized putative candidate sRNAs. Among these, 15 were particularly abundant, 14 of which showed no sequence similarity to any known noncoding RNA, and at least six of which form very stable RNA secondary structures. The analysis of a large number of tRNA fragments suggested that unique relationships exist between the anticodons of the tRNAs and the sites of tRNA degradation. Previous bacterial tRNA degradation studies have been limited to specific organisms, such as Escherichia coli and Streptomyces coelicolor, and the current results suggest that specific tRNA decay occurs more frequently than previously expected.

  15. Glucose replaces glutamate as energy substrate to fuel glutamate uptake in glutamate dehydrogenase-deficient astrocytes.

    Science.gov (United States)

    Pajęcka, Kamilla; Nissen, Jakob D; Stridh, Malin H; Skytt, Dorte M; Schousboe, Arne; Waagepetersen, Helle S

    2015-07-01

    Cultured astrocytes treated with siRNA to knock down glutamate dehydrogenase (GDH) were used to investigate whether this enzyme is important for the utilization of glutamate as an energy substrate. By incubation of these cells in media containing different concentrations of glutamate (range 100-500 µM) in the presence or in the absence of glucose, the metabolism of these substrates was studied by using tritiated glutamate or 2-deoxyglucose as tracers. In addition, the cellular contents of glutamate and ATP were determined. The astrocytes were able to maintain physiological levels of ATP regardless of the expression level of GDH and the incubation condition, indicating a high degree of flexibility with regard to regulatory mechanisms involved in maintaining an adequate energy level in the cells. Glutamate uptake was found to be increased in these cells when exposed to increasing levels of extracellular glutamate independently of the GDH expression level. Moreover, increased intracellular glutamate content was observed in the GDH-deficient cells after a 2-hr incubation in the presence of 100 µM glutamate. It is significant that GDH-deficient cells exhibited an increased utilization of glucose in the presence of 250 and 500 µM glutamate, monitored as an increase in the accumulation of tritiated 2-deoxyglucose-6-phosphate. These findings underscore the importance of the expression level of GDH for the ability to utilize glutamate as an energy source fueling its own energy-requiring uptake. © 2015 Wiley Periodicals, Inc.

  16. Production of poly-γ-glutamic acid by a thermotolerant glutamate-independent strain and comparative analysis of the glutamate dependent difference.

    Science.gov (United States)

    Zeng, Wei; Chen, Guiguang; Guo, Ye; Zhang, Bin; Dong, Mengna; Wu, Yange; Wang, Jun; Che, Zhiqun; Liang, Zhiqun

    2017-11-25

    Poly-γ-glutamic acid (γ-PGA) is a promising microbial polymer with wide applications in industry, agriculture and medicine. In this study, a novel glutamate-independent γ-PGA producing strain with thermotolerant characteristics was isolated and identified as Bacillus subtilis GXG-5, then its product was also characterized. The fermentation process was optimized by single-factor tests, and results showed that high temperature (50 °C) was especially suitable for the γ-PGA production by GXG-5. The γ-PGA yield reached 19.50 ± 0.75 g/L with substrate conversion efficiency of 78% at 50 °C in 10 L fermentor. Comparison of GXG-5 and GXA-28 (glutamate-dependent strain) under respective optimal fermentation conditions, the γ-PGA yield of GXG-5 was 19.0% higher than that of GXA-28, and GXG-5 was also superior to GXA-28 in the availability of carbon sources and substrates. Furthermore, the glutamate dependent difference between GXA-28 and GXG-5 was analyzed by genomic sequencing, results indicated that genes related to the glutamate dependent difference mainly involved in carbohydrate transport and metabolism and amino acid metabolism, and 13 genes related to γ-PGA synthesis were mutated in GXG-5. This study provided a potential glutamate-independent strain to replace glutamate-dependent strain for γ-PGA production, and shared novel information for understanding the glutamate dependent difference at the genomic level.

  17. Infidelity of translation of encephalomyocarditis viral RNA with tRNA from human malignant trophoblastic cells

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, O.K.; Kuchino, Y.

    1977-09-23

    We have investigated tRNA from the human malignant trophoblastic cells (BeWo cell) and human chorionic tissue for the translation of specific mRNAs, in a tRNA-dependent protein synthesizing system from Ehrlich ascites cells. BeWo cell tRNA and chorionic tRNA supported oviduct mRNA or encephalomyocarditis (EMC) viral RNA directed amino acid incorporation into polypeptides equally effectively. Polypeptides synthesized with oviduct mRNA and tRNA from both sources were identical upon sodium dodecylsulfate polyacrylamide gel electrophoresis. But the EMC RNA directed polypeptides synthesized with BeWo cell tRNA were different from those synthesized with chorionic tRNA. A polypeptide (molecular weight 58,000) was apparently not synthesized and the synthesis of a faster moving component (molecular weight, 14,000) was enhanced when BeWo cell tRNA was used. These results imply a functional difference in tRNA from human malignant cells compared to their normal counterpart.

  18. Evidence for glutamate as a neuroglial transmitter within sensory ganglia.

    Science.gov (United States)

    Kung, Ling-Hsuan; Gong, Kerui; Adedoyin, Mary; Ng, Johnson; Bhargava, Aditi; Ohara, Peter T; Jasmin, Luc

    2013-01-01

    This study examines key elements of glutamatergic transmission within sensory ganglia of the rat. We show that the soma of primary sensory neurons release glutamate when depolarized. Using acute dissociated mixed neuronal/glia cultures of dorsal root ganglia (DRG) or trigeminal ganglia and a colorimetric assay, we show that when glutamate uptake by satellite glial cells (SGCs) is inhibited, KCl stimulation leads to simultaneous increase of glutamate in the culture medium. With calcium imaging we see that the soma of primary sensory neurons and SGCs respond to AMPA, NMDA, kainate and mGluR agonists, and selective antagonists block this response. Using whole cell patch-clamp technique, inward currents were recorded from small diameter (ganglion preparation) in response to local application of the above glutamate receptor agonists. Following a chronic constriction injury (CCI) of either the inferior orbital nerve or the sciatic nerve, glutamate expression increases in the trigeminal ganglia and DRG respectively. This increase occurs in neurons of all diameters and is present in the somata of neurons with injured axons as well as in somata of neighboring uninjured neurons. These data provides additional evidence that glutamate can be released within the sensory ganglion, and that the somata of primary sensory neurons as well as SGCs express functional glutamate receptors at their surface. These findings, together with our previous gene knockdown data, suggest that glutamatergic transmission within the ganglion could impact nociceptive threshold.

  19. Chronic SSRI stimulation of astrocytic 5-HT2B receptors change multiple gene expressions/editings and metabolism of glutamate, glucose and glycogen: a potential paradigm shift

    Directory of Open Access Journals (Sweden)

    Leif eHertz

    2015-02-01

    Full Text Available It is firmly believed that the mechanism of action of SSRIs in major depression is to inhibit the serotonin transporter, SERT, and increase extracellular concentration of serotonin. However, this undisputed observation does not prove that SERT inhibition is the mechanism, let alone the only mechanism, by which SSRI’s exert their therapeutic effects. It has recently been demonstrated that 5-HT2B receptor stimulation is needed for the antidepressant effect of fluoxetine in vivo. The ability of all 5 currently used SSRIs to stimulate the 5-HT2B receptor equipotentially incultured astrocyteshas been known for several years,and increasing evidence has shown the importance of astrocytes and astrocyte-neuronal interactions for neuroplasticity and complex brain activity. This paper reviews acute and chronic effects of 5-HT2B receptor stimulation in cultured astrocytes and in astrocytes freshly isolated from brains of mice treated with fluoxetine for 14 daystogether with effects ofanti-depressant therapy on turnover of glutamate and GABA and metabolism of glucose and glycogen. It is suggested that these events are causally related to the mechanism of action of SSRIs and of interest for development of newer antidepressant drugs.

  20. Side effects of extra tRNA supplied in a typical bacterial protein production scenario

    DEFF Research Database (Denmark)

    Søgaard, Karina Marie; Nørholm, Morten H. H.

    2016-01-01

    Recombinant protein production is at the core of biotechnology and numerous molecular tools and bacterial strains have been developed to make the process more efficient. One commonly used generic solution is to supply extra copies of low-abundance tRNAs to compensate for the presence of complemen......Recombinant protein production is at the core of biotechnology and numerous molecular tools and bacterial strains have been developed to make the process more efficient. One commonly used generic solution is to supply extra copies of low-abundance tRNAs to compensate for the presence...... of complementary rare codons in genes-of-interest. Here we show that such extra tRNA, supplied by the commonly used pLysSRARE2 plasmid, can cause two side effects: (1) growth and gene expression can be impaired, and (2) apparent positive effects can be caused by differential expression of the lysozyme gene encoded...... on the same plasmid and not the tRNAs per se. These phenomena seem to have been largely overlooked despite the huge popularity of the T7/pET-based systems for bacterial protein production....

  1. Reduced excitatory amino acid transporter 1 and metabotropic glutamate receptor 5 expression in the cerebellum of fragile X mental retardation gene 1 premutation carriers with fragile X-associated tremor/ataxia syndrome.

    Science.gov (United States)

    Pretto, Dalyir I; Kumar, Madhur; Cao, Zhengyu; Cunningham, Christopher L; Durbin-Johnson, Blythe; Qi, Lihong; Berman, Robert; Noctor, Stephen C; Hagerman, Randi J; Pessah, Isaac N; Tassone, Flora

    2014-05-01

    A premutation (PM) expansion (55-200 CGG) in the fragile X mental retardation gene 1 causes elevated messenger RNA and reduced fragile X mental retardation gene 1 protein. Young PM carriers can develop characteristic physical features and mild cognitive disabilities. In addition, individuals with PM, particularly male carriers, are at high risk to develop fragile X-associated tremor/ataxia syndrome (FXTAS) with aging. Human postmortem FXTAS brains show extensive white matter disease in the cerebellum and the presence of intranuclear inclusions throughout the brain, although their etiologic significance is unknown. In the current work, expression levels of the metabotropic glutamate (Glu) receptor 5 and the Glu transporter excitatory amino acid transporter 1, examined by reverse transcription polymerase chain reaction and western blot analyses, were found to be reduced in the postmortem cerebellum of PM carriers with FXTAS compared with age matched controls, with higher CGG repeat number having greater reductions in both proteins. These data suggests a dysregulation of Glu signaling in PM carriers, which would likely contribute to the development and severity of FXTAS. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Analysis of variations in the glutamate receptor, N-methyl D-aspartate 2A (GRIN2A gene reveals their relative importance as genetic susceptibility factors for heroin addiction.

    Directory of Open Access Journals (Sweden)

    Bin Zhao

    Full Text Available The glutamate receptor, N-methyl D-aspartate 2A (GRIN2A gene that encodes the 2A subunit of the N-methyl D-aspartate (NMDA receptor was recently shown to be involved in the development of opiate addiction. Genetic polymorphisms in GRIN2A have a plausible role in modulating the risk of heroin addiction. An association of GRIN2A single-nucleotide polymorphisms (SNPs with heroin addiction was found earlier in African Americans. To identify markers that contribute to the genetic susceptibility to heroin addiction, we examined the potential association between heroin addiction and forty polymorphisms of the GRIN2A gene using the MassARRAY system and GeneScan in this study. The frequency of the (GT26 repeats (rs3219790 in the heroin addiction group was significantly higher than that in the control group (χ(2 = 5.360, P = 0.021. The allele frequencies of three polymorphisms (rs1102972, rs1650420, and rs3104703 in intron 3 were strongly associated with heroin addiction (P<0.001, 0.0002, and <0.001, after Bonferroni correction. Three additional SNPs from the same intron (rs1071502, rs6497730, and rs1070487 had nominally significant P values for association (P<0.05, but did not pass the threshold value. Haplotype analysis revealed that the G-C-T-C-C-T-A (block 6 and T-T (block 10 haplotypes of the GRIN2A gene displayed a protective effect (P = <0.001 and 0.003. These findings point to a role for GRIN2A polymorphisms in heroin addiction among the Han Chinese from Shaanxi province, and may be informative for future genetic or neurobiological studies on heroin addiction.

  3. Boosting Anaplerotic Reactions by Pyruvate Kinase Gene Deletion and Phosphoenolpyruvate Carboxylase Desensitization for Glutamic Acid and Lysine Production in Corynebacterium glutamicum.

    Science.gov (United States)

    Yokota, Atsushi; Sawada, Kazunori; Wada, Masaru

    In the 1980s, Shiio and coworkers demonstrated using random mutagenesis that the following three phenotypes were effective for boosting lysine production by Corynebacterium glutamicum: (1) low-activity-level citrate synthase (CS L ), (2) phosphoenolpyruvate carboxylase (PEPC) resistant to feedback inhibition by aspartic acid (PEPC R ), and (3) pyruvate kinase (PYK) deficiency. Here, we reevaluated these phenotypes and their interrelationship in lysine production using recombinant DNA techniques.The pyk deletion and PEPC R (D299N in ppc) independently showed marginal effects on lysine production, but both phenotypes synergistically increased lysine yield, demonstrating the importance of PEPC as an anaplerotic enzyme in lysine production. Similar effects were also found for glutamic acid production. CS L (S252C in gltA) further increased lysine yield. Thus, using molecular techniques, the combination of these three phenotypes was reconfirmed to be effective for lysine production. However, a simple CS L mutant showed instabilities in growth and lysine yield.Surprisingly, the pyk deletion was found to increase biomass production in wild-type C. glutamicum ATCC13032 under biotin-sufficient conditions. The mutant showed a 37% increase in growth (based on OD 660 ) compared with the ATCC13032 strain in a complex medium containing 100 g/L glucose. Metabolome analysis revealed the intracellular accumulation of excess precursor metabolites. Thus, their conversion into biomass was considered to relieve the metabolic distortion in the pyk-deleted mutant. Detailed physiological studies of various pyk-deleted mutants also suggested that malate:quinone oxidoreductase (MQO) is important to control both the intracellular oxaloacetic acid (OAA) level and respiration rate. These findings may facilitate the rational use of C. glutamicum in fermentation industries.

  4. Increased L-arginine Production by Site-directed Mutagenesis of N-acetyl-L-glutamate Kinase and proB Gene Deletion in Corynebacterium crenatum.

    Science.gov (United States)

    Zhang, Bin; Wan, Fang; Qiu, Yu Lou; Chen, Xue Lan; Tang, Li; Chen, Jin Cong; Xiong, Yong Hua

    2015-12-01

    In Corynebacterium crenatum, the adjacent D311 and D312 of N-acetyl-L-glutamate kinase (NAGK), as a key rate-limiting enzyme of L-arginine biosynthesis under substrate regulatory control by arginine, were initially replaced with two arginine residues to investigate the L-arginine feedback inhibition for NAGK. NAGK enzyme expression was evaluated using a plasmid-based method. Homologous recombination was employed to eliminate the proB. The IC50 and enzyme activity of NAGK M4, in which the D311R and D312R amino acid substitutions were combined with the previously reported E19R and H26E substitutions, were 3.7-fold and 14.6% higher, respectively, than those of the wild-type NAGK. NAGK M4 was successfully introduced into the C. crenatum MT genome without any genetic markers; the L-arginine yield of C. crenatum MT-M4 was 26.2% higher than that of C. crenatum MT. To further improve upon the L-arginine yield, we constructed the mutant C. crenatum MT-M4 proB. The optimum concentration of L-proline was also investigated in order to determine its contribution to L-arginine yield. After L-proline was added to the medium at 10 mmol/L, the L-arginine yield reached 16.5 g/L after 108 h of shake-flask fermentation, approximately 70.1% higher than the yield attained using C. crenatum MT. Feedback inhibition of L-arginine on NAGK in C. crenatum is clearly alleviated by the M4 mutation of NAGK, and deletion of the proB in C. crenatum from MT to M4 results in a significant increase in arginine production. Copyright © 2015 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  5. Glucose replaces glutamate as energy substrate to fuel glutamate uptake in glutamate dehydrogenase-deficient astrocytes

    DEFF Research Database (Denmark)

    Pajęcka, Kamilla; Nissen, Jakob D; Stridh, Malin H

    2015-01-01

    Cultured astrocytes treated with siRNA to knock down glutamate dehydrogenase (GDH) were used to investigate whether this enzyme is important for the utilization of glutamate as an energy substrate. By incubation of these cells in media containing different concentrations of glutamate (range 100......-500 µM) in the presence or in the absence of glucose, the metabolism of these substrates was studied by using tritiated glutamate or 2-deoxyglucose as tracers. In addition, the cellular contents of glutamate and ATP were determined. The astrocytes were able to maintain physiological levels of ATP...... regardless of the expression level of GDH and the incubation condition, indicating a high degree of flexibility with regard to regulatory mechanisms involved in maintaining an adequate energy level in the cells. Glutamate uptake was found to be increased in these cells when exposed to increasing levels...

  6. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  7. Effect of correlated tRNA abundances on translation errors and evolution of codon usage bias.

    Directory of Open Access Journals (Sweden)

    Premal Shah

    2010-09-01

    Full Text Available Despite the fact that tRNA abundances are thought to play a major role in determining translation error rates, their distribution across the genetic code and the resulting implications have received little attention. In general, studies of codon usage bias (CUB assume that codons with higher tRNA abundance have lower missense error rates. Using a model of protein translation based on tRNA competition and intra-ribosomal kinetics, we show that this assumption can be violated when tRNA abundances are positively correlated across the genetic code. Examining the distribution of tRNA abundances across 73 bacterial genomes from 20 different genera, we find a consistent positive correlation between tRNA abundances across the genetic code. This work challenges one of the fundamental assumptions made in over 30 years of research on CUB that codons with higher tRNA abundances have lower missense error rates and that missense errors are the primary selective force responsible for CUB.

  8. tRNA conjugation with chitosan nanoparticles: An AFM imaging study.

    Science.gov (United States)

    Agudelo, D; Kreplak, L; Tajmir-Riahi, H A

    2016-04-01

    The conjugation of tRNA with chitosan nanoparticles of different sizes 15,100 and 200 kDa was investigated in aqueous solution using multiple spectroscopic methods and atomic force microscopy (AFM). Structural analysis showed that chitosan binds tRNA via G-C and A-U base pairs as well as backbone PO2 group, through electrostatic, hydrophilic and H-bonding contacts with overall binding constants of KCh-15-tRNA=4.1 (±0.60)×10(3)M(-1), KCh-100-tRNA=5.7 (±0.8)×10(3)M(-1) and KCh-200-tRNA=1.2 (±0.3)×10(4)M(-1). As chitosan size increases more stable polymer-tRNA conjugate is formed. AFM images showed major tRNA aggregation and particle formation occurred as chitosan concentration increased. Even though chitosan induced major biopolymer structural changes, tRNA remains in A-family structure. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Intrinsic Properties of tRNA Molecules as Deciphered via Bayesian Network and Distribution Divergence Analysis

    Directory of Open Access Journals (Sweden)

    Sergio Branciamore

    2018-02-01

    Full Text Available The identity/recognition of tRNAs, in the context of aminoacyl tRNA synthetases (and other molecules, is a complex phenomenon that has major implications ranging from the origins and evolution of translation machinery and genetic code to the evolution and speciation of tRNAs themselves to human mitochondrial diseases to artificial genetic code engineering. Deciphering it via laboratory experiments, however, is difficult and necessarily time- and resource-consuming. In this study, we propose a mathematically rigorous two-pronged in silico approach to identifying and classifying tRNA positions important for tRNA identity/recognition, rooted in machine learning and information-theoretic methodology. We apply Bayesian Network modeling to elucidate the structure of intra-tRNA-molecule relationships, and distribution divergence analysis to identify meaningful inter-molecule differences between various tRNA subclasses. We illustrate the complementary application of these two approaches using tRNA examples across the three domains of life, and identify and discuss important (informative positions therein. In summary, we deliver to the tRNA research community a novel, comprehensive methodology for identifying the specific elements of interest in various tRNA molecules, which can be followed up by the corresponding experimental work and/or high-resolution position-specific statistical analyses.

  10. Defective i6A37 modification of mitochondrial and cytosolic tRNAs results from pathogenic mutations in TRIT1 and its substrate tRNA.

    Directory of Open Access Journals (Sweden)

    John W Yarham

    2014-06-01

    Full Text Available Identifying the genetic basis for mitochondrial diseases is technically challenging given the size of the mitochondrial proteome and the heterogeneity of disease presentations. Using next-generation exome sequencing, we identified in a patient with severe combined mitochondrial respiratory chain defects and corresponding perturbation in mitochondrial protein synthesis, a homozygous p.Arg323Gln mutation in TRIT1. This gene encodes human tRNA isopentenyltransferase, which is responsible for i6A37 modification of the anticodon loops of a small subset of cytosolic and mitochondrial tRNAs. Deficiency of i6A37 was previously shown in yeast to decrease translational efficiency and fidelity in a codon-specific manner. Modelling of the p.Arg323Gln mutation on the co-crystal structure of the homologous yeast isopentenyltransferase bound to a substrate tRNA, indicates that it is one of a series of adjacent basic side chains that interact with the tRNA backbone of the anticodon stem, somewhat removed from the catalytic center. We show that patient cells bearing the p.Arg323Gln TRIT1 mutation are severely deficient in i6A37 in both cytosolic and mitochondrial tRNAs. Complete complementation of the i6A37 deficiency of both cytosolic and mitochondrial tRNAs was achieved by transduction of patient fibroblasts with wild-type TRIT1. Moreover, we show that a previously-reported pathogenic m.7480A>G mt-tRNASer(UCN mutation in the anticodon loop sequence A36A37A38 recognised by TRIT1 causes a loss of i6A37 modification. These data demonstrate that deficiencies of i6A37 tRNA modification should be considered a potential mechanism of human disease caused by both nuclear gene and mitochondrial DNA mutations while providing insight into the structure and function of TRIT1 in the modification of cytosolic and mitochondrial tRNAs.

  11. Glutamic acid as anticancer agent: An overview

    OpenAIRE

    Dutta, Satyajit; Ray, Supratim; Nagarajan, K.

    2013-01-01

    The objective of the article is to highlight various roles of glutamic acid like endogenic anticancer agent, conjugates to anticancer agents, and derivatives of glutamic acid as possible anticancer agents. Besides these emphases are given especially for two endogenous derivatives of glutamic acid such as glutamine and glutamate. Glutamine is a derivative of glutamic acid and is formed in the body from glutamic acid and ammonia in an energy requiring reaction catalyzed by glutamine synthase. I...

  12. Loss of a conserved tRNA anticodon modification perturbs cellular signaling.

    Directory of Open Access Journals (Sweden)

    Boris Zinshteyn

    Full Text Available Transfer RNA (tRNA modifications enhance the efficiency, specificity and fidelity of translation in all organisms. The anticodon modification mcm(5s(2U(34 is required for normal growth and stress resistance in yeast; mutants lacking this modification have numerous phenotypes. Mutations in the homologous human genes are linked to neurological disease. The yeast phenotypes can be ameliorated by overexpression of specific tRNAs, suggesting that the modifications are necessary for efficient translation of specific codons. We determined the in vivo ribosome distributions at single codon resolution in yeast strains lacking mcm(5s(2U. We found accumulations at AAA, CAA, and GAA codons, suggesting that translation is slow when these codons are in the ribosomal A site, but these changes appeared too small to affect protein output. Instead, we observed activation of the GCN4-mediated stress response by a non-canonical pathway. Thus, loss of mcm(5s(2U causes global effects on gene expression due to perturbation of cellular signaling.

  13. Glutamate mechanisms underlying opiate memories

    NARCIS (Netherlands)

    Peters, J.; de Vries, T.J.

    2012-01-01

    As the major excitatory neurotransmitter in the brain, glutamate plays an undisputable integral role in opiate addiction. This relates, in part, to the fact that addiction is a disorder of learning and memory, and glutamate is required for most types of memory formation. As opiate addiction

  14. Mutations in Cytosine-5 tRNA Methyltransferases Impact Mobile Element Expression and Genome Stability at Specific DNA Repeats

    Directory of Open Access Journals (Sweden)

    Bianca Genenncher

    2018-02-01

    Full Text Available The maintenance of eukaryotic genome stability is ensured by the interplay of transcriptional as well as post-transcriptional mechanisms that control recombination of repeat regions and the expression and mobility of transposable elements. We report here that mutations in two (cytosine-5 RNA methyltransferases, Dnmt2 and NSun2, impact the accumulation of mobile element-derived sequences and DNA repeat integrity in Drosophila. Loss of Dnmt2 function caused moderate effects under standard conditions, while heat shock exacerbated these effects. In contrast, NSun2 function affected mobile element expression and genome integrity in a heat shock-independent fashion. Reduced tRNA stability in both RCMT mutants indicated that tRNA-dependent processes affected mobile element expression and DNA repeat stability. Importantly, further experiments indicated that complex formation with RNA could also contribute to the impact of RCMT function on gene expression control. These results thus uncover a link between tRNA modification enzymes, the expression of repeat DNA, and genomic integrity.

  15. Defects in tRNA modification associated with neurological and developmental dysfunctions in Caenorhabditis elegans elongator mutants.

    Directory of Open Access Journals (Sweden)

    Changchun Chen

    2009-07-01

    Full Text Available Elongator is a six subunit protein complex, conserved from yeast to humans. Mutations in the human Elongator homologue, hELP1, are associated with the neurological disease familial dysautonomia. However, how Elongator functions in metazoans, and how the human mutations affect neural functions is incompletely understood. Here we show that in Caenorhabditis elegans, ELPC-1 and ELPC-3, components of the Elongator complex, are required for the formation of the 5-carbamoylmethyl and 5-methylcarboxymethyl side chains of wobble uridines in tRNA. The lack of these modifications leads to defects in translation in C. elegans. ELPC-1::GFP and ELPC-3::GFP reporters are strongly expressed in a subset of chemosensory neurons required for salt chemotaxis learning. elpc-1 or elpc-3 gene inactivation causes a defect in this process, associated with a posttranscriptional reduction of neuropeptide and a decreased accumulation of acetylcholine in the synaptic cleft. elpc-1 and elpc-3 mutations are synthetic lethal together with those in tuc-1, which is required for thiolation of tRNAs having the 5'methylcarboxymethyl side chain. elpc-1; tuc-1 and elpc-3; tuc-1 double mutants display developmental defects. Our results suggest that, by its effect on tRNA modification, Elongator promotes both neural function and development.

  16. Substrate and Cation Binding Mechanism of Glutamate Transporter Homologs

    NARCIS (Netherlands)

    Jensen, Sonja

    2017-01-01

    Glutamate transporters and their homologs are membrane proteins that transport glutamate and aspartate together with sodium ions and/or protons. Human glutamate transporters remove the neurotransmitter glutamate after signal transmission. Therefore, glutamate transporters play a great role in

  17. A Glutamic Acid-Producing Lactic Acid Bacteria Isolated from Malaysian Fermented Foods

    Directory of Open Access Journals (Sweden)

    Bita Forghani

    2012-05-01

    Full Text Available L-glutamaic acid is the principal excitatory neurotransmitter in the brain and an important intermediate in metabolism. In the present study, lactic acid bacteria (218 were isolated from six different fermented foods as potent sources of glutamic acid producers. The presumptive bacteria were tested for their ability to synthesize glutamic acid. Out of the 35 strains showing this capability, strain MNZ was determined as the highest glutamic-acid producer. Identification tests including 16S rRNA gene sequencing and sugar assimilation ability identified the strain MNZ as Lactobacillus plantarum. The characteristics of this microorganism related to its glutamic acid-producing ability, growth rate, glucose consumption and pH profile were studied. Results revealed that glutamic acid was formed inside the cell and excreted into the extracellular medium. Glutamic acid production was found to be growth-associated and glucose significantly enhanced glutamic acid production (1.032 mmol/L compared to other carbon sources. A concentration of 0.7% ammonium nitrate as a nitrogen source effectively enhanced glutamic acid production. To the best of our knowledge this is the first report of glutamic acid production by lactic acid bacteria. The results of this study can be further applied for developing functional foods enriched in glutamic acid and subsequently γ-amino butyric acid (GABA as a bioactive compound.

  18. A Glutamic Acid-Producing Lactic Acid Bacteria Isolated from Malaysian Fermented Foods

    Science.gov (United States)

    Zareian, Mohsen; Ebrahimpour, Afshin; Bakar, Fatimah Abu; Mohamed, Abdul Karim Sabo; Forghani, Bita; Ab-Kadir, Mohd Safuan B.; Saari, Nazamid

    2012-01-01

    l-glutamaic acid is the principal excitatory neurotransmitter in the brain and an important intermediate in metabolism. In the present study, lactic acid bacteria (218) were isolated from six different fermented foods as potent sources of glutamic acid producers. The presumptive bacteria were tested for their ability to synthesize glutamic acid. Out of the 35 strains showing this capability, strain MNZ was determined as the highest glutamic-acid producer. Identification tests including 16S rRNA gene sequencing and sugar assimilation ability identified the strain MNZ as Lactobacillus plantarum. The characteristics of this microorganism related to its glutamic acid-producing ability, growth rate, glucose consumption and pH profile were studied. Results revealed that glutamic acid was formed inside the cell and excreted into the extracellular medium. Glutamic acid production was found to be growth-associated and glucose significantly enhanced glutamic acid production (1.032 mmol/L) compared to other carbon sources. A concentration of 0.7% ammonium nitrate as a nitrogen source effectively enhanced glutamic acid production. To the best of our knowledge this is the first report of glutamic acid production by lactic acid bacteria. The results of this study can be further applied for developing functional foods enriched in glutamic acid and subsequently γ-amino butyric acid (GABA) as a bioactive compound. PMID:22754309

  19. Enhanced production of poly glutamic acid by Bacillus sp. SW1-2 ...

    African Journals Online (AJOL)

    Bacillus sp. SW1-2 producing poly glutamic acid (PGA), locally isolated from Eastern province in Saudi Arabia, was characterized and identified based on 16S rRNA gene sequencing. Phylogenetic analysis revealed its closeness to Bacillus megaterium. The homopolymer consists mainly of glutamic as indicated in the ...

  20. Base-pairing versatility determines wobble sites in tRNA anticodons of vertebrate mitogenomes.

    Directory of Open Access Journals (Sweden)

    Miguel M Fonseca

    Full Text Available BACKGROUND: Vertebrate mitochondrial genomes typically have one transfer RNA (tRNA for each synonymous codon family. This limited anticodon repertoire implies that each tRNA anticodon needs to wobble (establish a non-Watson-Crick base pairing between two nucleotides in RNA molecules to recognize one or more synonymous codons. Different hypotheses have been proposed to explain the factors that determine the nucleotide composition of wobble sites in vertebrate mitochondrial tRNA anticodons. Until now, the two major postulates--the "codon-anticodon adaptation hypothesis" and the "wobble versatility hypothesis"--have not been formally tested in vertebrate mitochondria because both make the same predictions regarding the composition of anticodon wobble sites. The same is true for the more recent "wobble cost hypothesis". PRINCIPAL FINDINGS: In this study we have analyzed the occurrence of synonymous codons and tRNA anticodon wobble sites in 1553 complete vertebrate mitochondrial genomes, focusing on three fish species with mtDNA codon usage bias reversal (L-strand is GT-rich. These mitogenomes constitute an excellent opportunity to study the evolution of the wobble nucleotide composition of tRNA anticodons because due to the reversal the predictions for the anticodon wobble sites differ between the existing hypotheses. We observed that none of the wobble sites of tRNA anticodons in these unusual mitochondrial genomes coevolved to match the new overall codon usage bias, suggesting that nucleotides at the wobble sites of tRNA anticodons in vertebrate mitochondrial genomes are determined by wobble versatility. CONCLUSIONS/SIGNIFICANCE: Our results suggest that, at wobble sites of tRNA anticodons in vertebrate mitogenomes, selection favors the most versatile nucleotide in terms of wobble base-pairing stability and that wobble site composition is not influenced by codon usage. These results are in agreement with the "wobble versatility hypothesis".

  1. A Drosophila model for mito-nuclear diseases generated by an incompatible interaction between tRNA and tRNA synthetase

    Directory of Open Access Journals (Sweden)

    Marissa A. Holmbeck

    2015-08-01

    Full Text Available Communication between the mitochondrial and nuclear genomes is vital for cellular function. The assembly of mitochondrial enzyme complexes, which produce the majority of cellular energy, requires the coordinated expression and translation of both mitochondrially and nuclear-encoded proteins. The joint genetic architecture of this system complicates the basis of mitochondrial diseases, and mutations both in mitochondrial DNA (mtDNA- and nuclear-encoded genes have been implicated in mitochondrial dysfunction. Previously, in a set of mitochondrial-nuclear introgression strains, we characterized a dual genome epistasis in which a naturally occurring mutation in the Drosophila simulans simw501 mtDNA-encoded transfer RNA (tRNA for tyrosine (tRNATyr interacts with a mutation in the nuclear-encoded mitochondrially localized tyrosyl-tRNA synthetase from Drosophila melanogaster. Here, we show that the incompatible mitochondrial-nuclear combination results in locomotor defects, reduced mitochondrial respiratory capacity, decreased oxidative phosphorylation (OXPHOS enzyme activity and severe alterations in mitochondrial morphology. Transgenic rescue strains containing nuclear variants of the tyrosyl-tRNA synthetase are sufficient to rescue many of the deleterious phenotypes identified when paired with the simw501 mtDNA. However, the severity of this defective mito-nuclear interaction varies across traits and genetic backgrounds, suggesting that the impact of mitochondrial dysfunction might be tissue specific. Because mutations in mitochondrial tRNATyr are associated with exercise intolerance in humans, this mitochondrial-nuclear introgression model in Drosophila provides a means to dissect the molecular basis of these, and other, mitochondrial diseases that are a consequence of the joint genetic architecture of mitochondrial function.

  2. Metabotropic glutamate receptors in glial cells

    NARCIS (Netherlands)

    D'Antoni, Simona; Berretta, Antonio; Bonaccorso, Carmela Maria; Bruno, Valeria; Aronica, Eleonora; Nicoletti, Ferdinando; Catania, Maria Vincenza

    2008-01-01

    Glutamate is the major excitatory neurotransmitter in the mammalian central nervous system (CNS) and exerts its actions via a number of ionotropic glutamate receptors/channels and metabotropic glutamate (mGlu) receptors. In addition to being expressed in neurons, glutamate receptors are expressed in

  3. Essential nontranslational functions of tRNA synthetases.

    Science.gov (United States)

    Guo, Min; Schimmel, Paul

    2013-03-01

    Nontranslational functions of vertebrate aminoacyl tRNA synthetases (aaRSs), which catalyze the production of aminoacyl-tRNAs for protein synthesis, have recently been discovered. Although these new functions were thought to be 'moonlighting activities', many are as critical for cellular homeostasis as their activity in translation. New roles have been associated with their cytoplasmic forms as well as with nuclear and secreted extracellular forms that affect pathways for cardiovascular development and the immune response and mTOR, IFN-γ and p53 signaling. The associations of aaRSs with autoimmune disorders, cancers and neurological disorders further highlight nontranslational functions of these proteins. New architecture elaborations of the aaRSs accompany their functional expansion in higher organisms and have been associated with the nontranslational functions for several aaRSs. Although a general understanding of how these functions developed is limited, the expropriation of aaRSs for essential nontranslational functions may have been initiated by co-opting the amino acid-binding site for another purpose.

  4. Essential Non-Translational Functions of tRNA Synthetases

    Science.gov (United States)

    Guo, Min; Schimmel, Paul

    2013-01-01

    Nontranslational functions of vertebrate aminoacyl tRNA synthetases (aaRSs), which catalyze the production of aminoacyl-tRNAs for protein synthesis, have recently been discovered. While these new functions were thought to be ‘moonlighting activities’, many are as critical for cellular homeostasis as the activity in translation. New roles have been associated with cytoplasmic forms as well as with nuclear and secreted extracellular forms that impact pathways for cardiovascular development, the immune response, and mTOR, IFN-γ and p53 signaling. The associations of aaRSs with autoimmune disorders, cancers and neurological disorders further highlight nontranslational functions of these proteins. Novel architecture elaborations of the aaRSs accompany their functional expansion in higher organisms and have been associated with the nontranslational functions for several aaRSs. While a general understanding of how these functions developed is limited, the expropriation of aaRSs for essential nontranslational functions may have been initiated by co-opting the amino acid binding site for another purpose. PMID:23416400

  5. Glutamic acid as anticancer agent: An overview.

    Science.gov (United States)

    Dutta, Satyajit; Ray, Supratim; Nagarajan, K

    2013-10-01

    The objective of the article is to highlight various roles of glutamic acid like endogenic anticancer agent, conjugates to anticancer agents, and derivatives of glutamic acid as possible anticancer agents. Besides these emphases are given especially for two endogenous derivatives of glutamic acid such as glutamine and glutamate. Glutamine is a derivative of glutamic acid and is formed in the body from glutamic acid and ammonia in an energy requiring reaction catalyzed by glutamine synthase. It also possesses anticancer activity. So the transportation and metabolism of glutamine are also discussed for better understanding the role of glutamic acid. Glutamates are the carboxylate anions and salts of glutamic acid. Here the roles of various enzymes required for the metabolism of glutamates are also discussed.

  6. Blood glutamate scavenging: Insight into neuro protection

    OpenAIRE

    Leibowitz, A; Boyko, M; Shapira, Y; Zlotnik, A

    2012-01-01

    Brain insults are characterized by a multitude of complex processes, of which glutamate release plays a major role. Deleterious excess of glutamate in the brain's extracellular fluids stimulates glutamate receptors, which in turn lead to cell swelling, apoptosis, and neuronal death. These exacerbate neurological outcome. Approaches aimed at antagonizing the astrocytic and glial glutamate receptors have failed to demonstrate clinical benefit. Alternatively, eliminating excess glutamate from br...

  7. Blood Glutamate Scavenging: Insight into Neuroprotection

    OpenAIRE

    Leibowitz, Akiva; Boyko, Matthew; Shapira, Yoram; Zlotnik, Alexander

    2012-01-01

    Brain insults are characterized by a multitude of complex processes, of which glutamate release plays a major role. Deleterious excess of glutamate in the brain’s extracellular fluids stimulates glutamate receptors, which in turn lead to cell swelling, apoptosis, and neuronal death. These exacerbate neurological outcome. Approaches aimed at antagonizing the astrocytic and glial glutamate receptors have failed to demonstrate clinical benefit. Alternatively, eliminating excess glutamate from br...

  8. Regulation of glutamate dehydrogenase in Bacillus subtilis.

    OpenAIRE

    Kane, J F; Wakim, J; Fischer, R S

    1981-01-01

    The activity of the nicotinamide adenine dinucleotide-dependent glutamate dehydrogenase in Bacillus subtilis was influenced by the carbon source, but not the nitrogen source, in the growth medium. The highest specific activity for this enzyme was found when B. subtilis was grown in a minimal or rich medium that contained glutamate as the carbon source. It is proposed that glutamate dehydrogenase serves a catabolic function in the metabolism of glutamate, is induced by glutamate, and is subjec...

  9. Regulation of glutamate dehydrogenase in Bacillus subtilis.

    Science.gov (United States)

    Kane, J F; Wakim, J; Fischer, R S

    1981-01-01

    The activity of the nicotinamide adenine dinucleotide-dependent glutamate dehydrogenase in Bacillus subtilis was influenced by the carbon source, but not the nitrogen source, in the growth medium. The highest specific activity for this enzyme was found when B. subtilis was grown in a minimal or rich medium that contained glutamate as the carbon source. It is proposed that glutamate dehydrogenase serves a catabolic function in the metabolism of glutamate, is induced by glutamate, and is subject to catabolite repression. PMID:6118356

  10. Evolution and expression analysis of the soybean glutamate ...

    Indian Academy of Sciences (India)

    Evolution and expression analysis of the soybean glutamate decarboxylase gene family. TAE KYUNG HYUN, SEUNG HEE EOM, XIAO HAN and JU-SUNG KIM http://www.ias.ac.in/jbiosci. J. Biosci. 39(5), December 2014, 899–907, © Indian Academy of Sciences. Supplementary material. Supplementary figure 1.

  11. Antibodies to a recombinant glutamate-rich Plasmodium falciparum protein

    DEFF Research Database (Denmark)

    Hogh, B; Petersen, E; Dziegiel, Morten Hanefeld

    1992-01-01

    A Plasmodium falciparum antigen gene coding for a 220-kD glutamate-rich protein (GLURP) has been cloned, and the 783 C-terminal amino acids of this protein (GLURP489-1271) have been expressed as a beta-galactosidase fusion protein in Escherichia coli. The encoded 783 amino acid residues contain two...

  12. Antibodies to a recombinant glutamate-rich Plasmodium falciparum protein

    DEFF Research Database (Denmark)

    Hogh, B; Petersen, E; Dziegiel, Morten Hanefeld

    1992-01-01

    A Plasmodium falciparum antigen gene coding for a 220-kD glutamate-rich protein (GLURP) has been cloned, and the 783 C-terminal amino acids of this protein (GLURP489-1271) have been expressed as a beta-galactosidase fusion protein in Escherichia coli. The encoded 783 amino acid residues contain t...

  13. Methods for antagonizing glutamate neurotoxicity.

    Science.gov (United States)

    Choi, D W

    1990-01-01

    Recent evidence suggests that glutamate-induced neuronal damage may contribute importantly to neuronal death in several neurological diseases, including cerebral hypoxia-ischemia. This review outlines a range of measures that might be used to protect neurons from such excitotoxic damage. The organizing thesis is a speculative consideration of glutamate neurotoxicity as a sequential three-stage process--induction, amplification, and expression--each perhaps specifically amenable to therapeutic interference. Overstimulation of glutamate receptors likely induces the intracellular accumulation of several substances, including Ca2+, Na+, inositol-1,4,5-trisphosphate, and diacylglycerol. Blockade of this induction might be accomplished most easily by antagonizing postsynaptic glutamate receptors, but also might be accomplished by reducing glutamate release from presynaptic terminals, or improving glutamate clearance from synaptic clefts. Following induction, several steps may importantly amplify the resultant rise in intracellular free Ca2+, and promote the spread of excessive excitation to other circuit neurons. Protective strategies operative at this level might include blockade of additional Ca2+ influx, blockade of Ca2+ release from intracellular stores, and interference with the mechanisms coupling glutamate receptor stimulation to lasting enhancements of excitatory synaptic efficacy. Following amplification, toxic levels of intracellular free Ca2+ might trigger destructive cascades bearing direct responsibility for resultant neuronal degeneration--the expression of excitotoxicity. The most important cascades to block may be those related to the activation of catabolic enzymes, and the generation of free radicals. Broad consideration of possible methods for antagonizing glutamate neurotoxicity may be needed to develop therapies with the greatest efficacy, and least adverse consequences for brain function.

  14. Alternative tRNA priming of human immunodeficiency virus type 1 reverse transcription explains sequence variation in the primer-binding site that has been attributed to APOBEC3G activity

    NARCIS (Netherlands)

    Das, Atze T.; Vink, Monique; Berkhout, Ben

    2005-01-01

    It is generally assumed that human immunodeficiency virus type 1 (HIV-1) uses exclusively the cellular tRNA(3)(Lys) molecule as a primer for reverse transcription. We demonstrate that HIV-1 uses not only tRNA(3)(Lys) but also an alternative tRNA primer. This tRNA was termed tRNA(5)(Lys), and the

  15. Glutamate receptor ligands

    DEFF Research Database (Denmark)

    Guldbrandt, Mette; Johansen, Tommy N; Frydenvang, Karla Andrea

    2002-01-01

    Homologation and substitution on the carbon backbone of (S)-glutamic acid [(S)-Glu, 1], as well as absolute stereochemistry, are structural parameters of key importance for the pharmacological profile of (S)-Glu receptor ligands. We describe a series of methyl-substituted 2-aminoadipic acid (AA...... or slightly lower potencies than (S)-AA [e.g., EC(50) = 76 microM for (2S,4S)-4-methyl-AA (5a) as compared to EC(50) = 35 microM for (S)-AA]. The position of the methyl substituent had a profound effect on the observed pharmacology, whereas the absolute stereochemistry at the methylated carbon atom had a very......) analogs, and the synthesis, stereochemistry, and enantiopharmacology of 3-methyl-AA (4a-d), 4-methyl-AA (5a-d), 5-methyl-AA (6a-d), and (E)-Delta(4)-5-methyl-AA (7a and 7b) are reported. The compounds were resolved using chiral HPLC and the configurational assignments of the enantiomers were based on X...

  16. Genotoxicity of monosodium glutamate.

    Science.gov (United States)

    Ataseven, Nazmiye; Yüzbaşıoğlu, Deniz; Keskin, Ayten Çelebi; Ünal, Fatma

    2016-05-01

    Monosodium glutamate (MSG) is one of the most widely used flavor enhancers throughout the world. The aim of this study is to investigate the genotoxic potential of MSG by using chromosome aberrations (CAs), sister-chromatid exchanges (SCEs), cytokinesis-blocked micronucleus (CBMN), and random amplified polymorphic DNA-polimerase chain reaction (RAPD-PCR) in cultured human lymphocytes and alkaline comet assays in isolated human lymphocytes, which were incubated with six concentrations (250, 500, 1000, 2000, 4000 and 8000 μg/mL) of MSG. The result of this study indicated that MSG significantly and dose dependently increased the frequencies of CAs, SCE and MN in all treatments and times, compared with control. However, the replication (RI) and nuclear division indices (NDI) were not affected. In this paper, in vitro genotoxic effects of the MSG was also investigated on human peripheral lymphocytes by analysing the RAPD-PCR with arbitrary 10-mer primers. The changes occurring in RAPD profiles after MSG treatment include increase or decrease in band intensity and gain or loss of bands. In the comet assay, this additive caused DNA damage at all concentrations in isolated human lymphocytes after 1-h in vitro exposure. Our results demonstrate that MSG is genotoxic to the human peripheral blood lymphocytes in vitro. Copyright © 2016. Published by Elsevier Ltd.

  17. Antibodies to a recombinant glutamate-rich Plasmodium falciparum protein

    DEFF Research Database (Denmark)

    Hogh, B; Petersen, E; Dziegiel, Morten Hanefeld

    1992-01-01

    A Plasmodium falciparum antigen gene coding for a 220-kD glutamate-rich protein (GLURP) has been cloned, and the 783 C-terminal amino acids of this protein (GLURP489-1271) have been expressed as a beta-galactosidase fusion protein in Escherichia coli. The encoded 783 amino acid residues contain two...... areas of repeated amino acid sequences. Antibodies against recombinant GLURP489-1271, as well as against a synthetic peptide corresponding to GLURP899-916, and against a synthetic peptide representing the major glutamate rich repeat sequence from the P. falciparum ring erythrocyte surface antigen (Pf155...

  18. The MiaA tRNA modification enzyme is necessary for robust RpoS expression in Escherichia coli.

    Science.gov (United States)

    Thompson, Karl M; Gottesman, Susan

    2014-02-01

    The stationary phase/general stress response sigma factor RpoS (σ(S)) is necessary for adaptation and restoration of homeostasis in stationary phase. As a physiological consequence, its levels are tightly regulated at least at two levels. Multiple small regulatory RNA molecules modulate its translation, in a manner that is dependent on the RNA chaperone Hfq and the rpoS 5' untranslated region. ClpXP and the RssB adaptor protein degrade RpoS, unless it is protected by an anti-adaptor. We here find that, in addition to these posttranscriptional levels of regulation, tRNA modification also affects the steady-state levels of RpoS. We screened mutants of several RNA modification enzymes for an effect on RpoS expression and identified the miaA gene, encoding a tRNA isopentenyltransferase, as necessary for full expression of both an rpoS750-lacZ translational fusion and the RpoS protein. This effect is independent of rpoS, the regulatory RNAs, and RpoS degradation. RpoD steady-state levels were not significantly different in the absence of MiaA, suggesting that this is an RpoS-specific effect. The rpoS coding sequence is significantly enriched for leu codons that use MiaA-modified tRNAs, compared to rpoD and many other genes. Dependence on MiaA may therefore provide yet another way for RpoS levels to respond to growth conditions.

  19. Prevalence of the A1555G (12S rRNA and tRNA Ser(UCN mitochondrial mutations in hearing-impaired Brazilian patients

    Directory of Open Access Journals (Sweden)

    Abreu-Silva R.S.

    2006-01-01

    Full Text Available Mitochondrial mutations are responsible for at least 1% of the cases of hereditary deafness, but the contribution of each mutation has not yet been defined in African-derived or native American genetic backgrounds. A total of 203 unselected hearing-impaired patients were screened for the presence of the mitochondrial mutation A1555G in the 12S rRNA gene and mutations in the tRNA Ser(UCN gene in order to assess their frequency in the ethnically admixed Brazilian population. We found four individuals with A1555G mutation (2%, which is a frequency similar to those reported for European-derived populations in unselected samples. On the other hand, complete sequencing of the tRNA Ser(UCN did not reveal reported pathogenic substitutions, namely A7445G, 7472insC, T7510C, or T7511C. Instead, other rare substitutions were found such as T1291C, A7569G, and G7444A. To evaluate the significance of these findings, 110 "European-Brazilians" and 190 "African-Brazilians" unrelated hearing controls were screened. The T1291C, A7569G and G7444A substitutions were each found in about 1% (2/190 of individuals of African ancestry, suggesting that they are probably polymorphic. Our results indicate that screening for the A1555G mutation is recommended among all Brazilian deaf patients, while testing for mutations in the tRNA Ser(UCN gene should be considered only when other frequent deafness-causing mutations have been excluded or in the presence of a maternal transmission pattern.

  20. The effect of pH and ADP on ammonia affinity for human glutamate dehydrogenases

    DEFF Research Database (Denmark)

    Zaganas, Ioannis; Pajecka, Kamilla; Nielsen, Camilla Wendel

    2013-01-01

    Glutamate dehydrogenase (GDH) uses ammonia to reversibly convert α-ketoglutarate to glutamate using NADP(H) and NAD(H) as cofactors. While GDH in most mammals is encoded by a single GLUD1 gene, humans and other primates have acquired a GLUD2 gene with distinct tissue expression profile. The two h...... of the kidney during systemic acidosis. The reverse could apply for conditions of local or systemic hyperammonemia or alkalosis....

  1. Interactions between RNAP III transcription machinery and tRNA processing factors.

    Science.gov (United States)

    Arimbasseri, G Aneeshkumar

    2018-04-01

    Eukaryotes have at least three nuclear RNA polymerases to carry out transcription. While RNA polymerases I and II are responsible for ribosomal RNA transcription and messenger RNA transcription, respectively, RNA Polymerase III transcribes approximately up to 300 nt long noncoding RNAs, including tRNA. For all three RNAPs, the nascent transcripts generated undergo extensive post-transcriptional processing. Transcription of mRNAs by RNAP II and their processing are coupled with the aid of the C-terminal domain of the RNAP II. RNAP I transcription and the processing of its transcripts are co-localized to the nucleolus and to some extent, rRNA processing occurs co-transcriptionally. Here, I review the current evidence for the interaction between tRNA processing factors and RNA polymerase III. These interactions include the moonlighting functions of tRNA processing factors in RNAP III transcription and the indirect effect of tRNA transcription levels on tRNA modification machinery. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. tRNA modification profiles of the fast-proliferating cancer cells

    International Nuclear Information System (INIS)

    Dong, Chao; Niu, Leilei; Song, Wei; Xiong, Xin; Zhang, Xianhua; Zhang, Zhenxi; Yang, Yi; Yi, Fan; Zhan, Jun; Zhang, Hongquan; Yang, Zhenjun; Zhang, Li-He; Zhai, Suodi; Li, Hua; Ye, Min; Du, Quan

    2016-01-01

    Despite the recent progress in RNA modification study, a comprehensive modification profile is still lacking for mammalian cells. Using a quantitative HPLC/MS/MS assay, we present here a study where RNA modifications are examined in term of the major RNA species. With paired slow- and fast-proliferating cell lines, distinct RNA modification profiles are first revealed for diverse RNA species. Compared to mRNAs, increased ribose and nucleobase modifications are shown for the highly-structured tRNAs and rRNAs, lending support to their contribution to the formation of high-order structures. This study also reveals a dynamic tRNA modification profile in the fast-proliferating cells. In addition to cultured cells, this unique tRNA profile has been further confirmed with endometrial cancers and their adjacent normal tissues. Taken together, the results indicate that tRNA is a actively regulated RNA species in the fast-proliferating cancer cells, and suggest that they may play a more active role in biological process than expected. -- Highlights: •RNA modifications were first examined in term of the major RNA species. •A dynamic tRNA modifications was characterized for the fast-proliferating cells. •The unique tRNA profile was confirmed with endometrial cancers and their adjacent normal tissues. •tRNA was predicted as an actively regulated RNA species in the fast-proliferating cancer cells.

  3. tRNA modification profiles of the fast-proliferating cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Dong, Chao; Niu, Leilei; Song, Wei [State Key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences, Department of Obstetrics and Gynecology, Peking University Third Hospital, Peking University, Beijing 100191 (China); Xiong, Xin; Zhang, Xianhua [Departmentof Pharmacy, Peking University Third Hospital, Peking University, Beijing 100191 (China); Zhang, Zhenxi; Yang, Yi; Yi, Fan [State Key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences, Department of Obstetrics and Gynecology, Peking University Third Hospital, Peking University, Beijing 100191 (China); Zhan, Jun; Zhang, Hongquan [Department of Anatomy, Histology and Embryology, Laboratory of Molecular Cell Biology and Tumor Biology, Peking University, Beijing 100191 (China); Yang, Zhenjun; Zhang, Li-He [State Key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences, Department of Obstetrics and Gynecology, Peking University Third Hospital, Peking University, Beijing 100191 (China); Zhai, Suodi [Departmentof Pharmacy, Peking University Third Hospital, Peking University, Beijing 100191 (China); Li, Hua, E-mail: huali88@sina.com [State Key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences, Department of Obstetrics and Gynecology, Peking University Third Hospital, Peking University, Beijing 100191 (China); Ye, Min, E-mail: yemin@bjmu.edu.cn [State Key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences, Department of Obstetrics and Gynecology, Peking University Third Hospital, Peking University, Beijing 100191 (China); Du, Quan, E-mail: quan.du@pku.edu.cn [State Key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences, Department of Obstetrics and Gynecology, Peking University Third Hospital, Peking University, Beijing 100191 (China)

    2016-08-05

    Despite the recent progress in RNA modification study, a comprehensive modification profile is still lacking for mammalian cells. Using a quantitative HPLC/MS/MS assay, we present here a study where RNA modifications are examined in term of the major RNA species. With paired slow- and fast-proliferating cell lines, distinct RNA modification profiles are first revealed for diverse RNA species. Compared to mRNAs, increased ribose and nucleobase modifications are shown for the highly-structured tRNAs and rRNAs, lending support to their contribution to the formation of high-order structures. This study also reveals a dynamic tRNA modification profile in the fast-proliferating cells. In addition to cultured cells, this unique tRNA profile has been further confirmed with endometrial cancers and their adjacent normal tissues. Taken together, the results indicate that tRNA is a actively regulated RNA species in the fast-proliferating cancer cells, and suggest that they may play a more active role in biological process than expected. -- Highlights: •RNA modifications were first examined in term of the major RNA species. •A dynamic tRNA modifications was characterized for the fast-proliferating cells. •The unique tRNA profile was confirmed with endometrial cancers and their adjacent normal tissues. •tRNA was predicted as an actively regulated RNA species in the fast-proliferating cancer cells.

  4. Group I Metabotropic Glutamate Receptors

    DEFF Research Database (Denmark)

    Erichsen, Julie Ladeby; Blaabjerg, Morten; Bogetofte Thomasen, Helle

    2015-01-01

    is, however, needed to realise their therapeutic potential. Glutamate and group I metabotropic glutamate receptors (mGluRs) affect proliferation and survival of rodent NSCs both during embryonic and postnatal development. To investigate the role of group I mGluRs (mGluR1 and mGluR5) on human NSCs, we...... differentiated an immortalized, forebrain-derived stem cell line in the presence or absence of glutamate and with addition of either the group I mGluR agonist DHPG or the selective antagonists; MPEP (mGluR5) and LY367385 (mGluR1). Characterization of differentiated cells revealed that both mGluR1 and mGluR5 were...... present on the cells. Addition of glutamate to the growth medium significantly increased cell proliferation and reduced cell death, resulting in increased cell numbers. In the presence of glutamate, selective activation of group I mGluRs reduced gliogenesis, whereas selective inhibition of group I m...

  5. Enzymatic production of α-ketoglutaric acid from l-glutamic acid via l-glutamate oxidase.

    Science.gov (United States)

    Niu, Panqing; Dong, Xiaoxiang; Wang, Yuancai; Liu, Liming

    2014-06-10

    In this study, a novel strategy for α-ketoglutaric acid (α-KG) production from l-glutamic acid using recombinant l-glutamate oxidase (LGOX) was developed. First, by analyzing the molecular structure characteristics of l-glutamic acid and α-KG, LGOX was found to be the best catalyst for oxidizing the amino group of l-glutamic acid to a ketonic group without the need for exogenous cofactor. Then the LGOX gene was expressed in Escherichia coli BL21 (DE3) in a soluble and active form, and the recombinant LGOX activity reached to a maximum value of 0.59U/mL at pH 6.5, 30°C. Finally, the maximum α-KG concentration reached 104.7g/L from 110g/L l-glutamic acid in 24h, under the following optimum conditions: 1.5U/mL LGOX, 250U/mL catalase, 3mM MnCl2, 30°C, and pH 6.5. Copyright © 2014. Published by Elsevier B.V.

  6. Reduced expression of glutamate transporter EAAT2 and impaired glutamate transport in human primary astrocytes exposed to HIV-1 or gp120

    International Nuclear Information System (INIS)

    Wang Zhuying; Pekarskaya, Olga; Bencheikh, Meryem; Chao Wei; Gelbard, Harris A.; Ghorpade, Anuja; Rothstein, Jeffrey D.; Volsky, David J.

    2003-01-01

    L-Glutamate is the major excitatory neurotransmitter in the brain. Astrocytes maintain low levels of synaptic glutamate by high-affinity uptake and defects in this function may lead to neuronal cell death by excitotoxicity. We tested the effects of HIV-1 and its envelope glycoprotein gp120 upon glutamate uptake and expression of glutamate transporters EAAT1 and EAAT2 in fetal human astrocytes in vitro. Astrocytes isolated from fetal tissues between 16 and 19 weeks of gestation expressed EAAT1 and EAAT2 RNA and proteins as detected by Northern blot analysis and immunoblotting, respectively, and the cells were capable of specific glutamate uptake. Exposure of astrocytes to HIV-1 or gp120 significantly impaired glutamate uptake by the cells, with maximum inhibition within 6 h, followed by gradual decline during 3 days of observation. HIV-1-infected cells showed a 59% reduction in V max for glutamate transport, indicating a reduction in the number of active transporter sites on the cell surface. Impaired glutamate transport after HIV-1 infection or gp120 exposure correlated with a 40-70% decline in steady-state levels of EAAT2 RNA and protein. EAAT1 RNA and protein levels were less affected. Treatment of astrocytes with tumor necrosis factor-α (TNF-α) decreased the expression of both EAAT1 and EAAT2, but neither HIV-1 nor gp120 were found to induce TNF-α production by astrocytes. These findings demonstrate that HIV-1 and gp120 induce transcriptional downmodulation of the EAAT2 transporter gene in human astrocytes and coordinately attenuate glutamate transport by the cells. Reduction of the ability of HIV-1-infected astrocytes to take up glutamate may contribute to the development of neurological disease

  7. The role of glutamine oxoglutarate aminotransferase and glutamate dehydrogenase in nitrogen metabolism in Mycobacterium bovis BCG.

    Science.gov (United States)

    Viljoen, Albertus J; Kirsten, Catriona J; Baker, Bienyameen; van Helden, Paul D; Wiid, Ian J F

    2013-01-01

    Recent evidence suggests that the regulation of intracellular glutamate levels could play an important role in the ability of pathogenic slow-growing mycobacteria to grow in vivo. However, little is known about the in vitro requirement for the enzymes which catalyse glutamate production and degradation in the slow-growing mycobacteria, namely; glutamine oxoglutarate aminotransferase (GOGAT) and glutamate dehydrogenase (GDH), respectively. We report that allelic replacement of the Mycobacterium bovis BCG gltBD-operon encoding for the large (gltB) and small (gltD) subunits of GOGAT with a hygromycin resistance cassette resulted in glutamate auxotrophy and that deletion of the GDH encoding-gene (gdh) led to a marked growth deficiency in the presence of L-glutamate as a sole nitrogen source as well as reduction in growth when cultured in an excess of L-asparagine.

  8. Global translational impacts of the loss of the tRNA modification t6A in yeast

    Directory of Open Access Journals (Sweden)

    Patrick C. Thiaville

    2015-12-01

    Full Text Available The universal tRNA modification t6A is found at position 37 of nearly all tRNAs decoding ANN codons. The absence of t6A37 leads to severe growth defects in baker’s yeast, phenotypes similar to those caused by defects in mcm5s2U34 synthesis. Mutants in mcm5s2U34 can be suppressed by overexpression of tRNALysUUU, but we show t6A phenotypes could not be suppressed by expressing any individual ANN decoding tRNA, and t6A and mcm5s2U are not determinants for each other’s formation. Our results suggest that t6A deficiency, like mcm5s2U deficiency, leads to protein folding defects, and show that the absence of t6A led to stress sensitivities (heat, ethanol, salt and sensitivity to TOR pathway inhibitors. Additionally, L-homoserine suppressed the slow growth phenotype seen in t6A-deficient strains, and proteins aggregates and Advanced Glycation End-products (AGEs were increased in the mutants. The global consequences on translation caused by t6A absence were examined by ribosome profiling. Interestingly, the absence of t6A did not lead to global translation defects, but did increase translation initiation at upstream non-AUG codons and increased frame-shifting in specific genes. Analysis of codon occupancy rates suggests that one of the major roles of t6A is to homogenize the process of elongation by slowing the elongation rate at codons decoded by high abundance tRNAs and I34:C3 pairs while increasing the elongation rate of rare tRNAs and G34:U3 pairs. This work reveals that the consequences of t6A absence are complex and multilayered and has set the stage to elucidate the molecular basis of the observed phenotypes.

  9. tRNA's wobble decoding of the genome: 40 years of modification.

    Science.gov (United States)

    Agris, Paul F; Vendeix, Franck A P; Graham, William D

    2007-02-09

    The genetic code is degenerate, in that 20 amino acids are encoded by 61 triplet codes. In 1966, Francis Crick hypothesized that the cell's limited number of tRNAs decoded the genome by recognizing more than one codon. The ambiguity of that recognition resided in the third base-pair, giving rise to the Wobble Hypothesis. Post-transcriptional modifications at tRNA's wobble position 34, especially modifications of uridine 34, enable wobble to occur. The Modified Wobble Hypothesis proposed in 1991 that specific modifications of a tRNA wobble nucleoside shape the anticodon architecture in such a manner that interactions were restricted to the complementary base plus a single wobble pairing for amino acids with twofold degenerate codons. However, chemically different modifications at position 34 would expand the ability of a tRNA to read three or even four of the fourfold degenerate codons. One foundation of Crick's Wobble Hypothesis was that a near-constant geometry of canonical base-pairing be maintained in forming all three base-pairs between the tRNA anticodon and mRNA codon on the ribosome. In accepting an aminoacyl-tRNA, the ribosome requires maintenance of a specific geometry for the anticodon-codon base-pairing. However, it is the post-transcriptional modifications at tRNA wobble position 34 and purine 37, 3'-adjacent to the anticodon, that pre-structure the anticodon domain to ensure the correct codon binding. The modifications create both the architecture and the stability needed for decoding through restraints on anticodon stereochemistry and conformational space, and through selective hydrogen bonding. A physicochemical understanding of modified nucleoside contributions to the tRNA anticodon domain architecture and its decoding of the genome has advanced RNA world evolutionary theory, the principles of RNA chemistry, and the application of this knowledge to the introduction of new amino acids to proteins.

  10. Catalytic mechanism and inhibition of tRNA (Uracil-5-)methyltransferase: evidence for covalent catalysis

    International Nuclear Information System (INIS)

    Santi, D.V.; Hardy, L.W.

    1987-01-01

    tRNA (Ura-5-) methyltransferase catalyzes the transfer of a methyl group from S-adenosylmethionine (AdoMet) to the 5-carbon of a specific Urd residue in tRNA. This results in stoichiometric release of tritium from [5- 3 H] Urd-labeled substrate tRNA isolated from methyltransferase-deficient Escherichia coli. The enzyme also catalyzes an AdoMet-independent exchange reaction between [5- 3 H]-Urd-labeled substrate tRNA and protons of water at a rate that is about 1% that of the normal methylation reaction, but with identical stoichiometry. S-Adenosylhomocysteine inhibits the rate of the exchange reaction by 2-3-fold, whereas an analog having the sulfur of AdoMet replaced by nitrogen accelerates the exchange reaction 9-fold. In the presence (but not absence) of AdoMet, 5-fluorouracil-substituted tRNA (FUra-tRNA) leads to the first-order inactivation of the enzyme. This is accompanied by the formation of a stable covalent complex containing the enzyme, FUra-tRNA, and the methyl group AdoMet. A mechanism for catalysis is proposed that explains both the 5-H exchange reaction and the inhibition by FUra-tRNA: the enzyme forms a covalent Michael adduct with substrate or inhibitor tRNA by attack of a nucleophilic group of the enzyme at carbon 6 of the pyrimidine residue to be modified. As a result, an anion equivalent is generated at carbon 5 that is sufficiently reactive to be methylated by AdoMet. Preliminary experiments and precedents suggest that the nucleophilic catalyst of the enzyme is a thiol group of cysteine. The potent irreversible inhibition by FUra-tRNA suggest that a mechanism for the RNA effects of FUra may also involve irreversible inhibition of RNA-modifying enzymes

  11. DNA nanopore translocation in glutamate solutions

    NARCIS (Netherlands)

    Plesa, C.; Van Loo, N.; Dekker, C.

    2015-01-01

    Nanopore experiments have traditionally been carried out with chloride-based solutions. Here we introduce silver/silver-glutamate-based electrochemistry as an alternative, and study the viscosity, conductivity, and nanopore translocation characteristics of potassium-, sodium-, and lithium-glutamate

  12. Crosslinking of tRNA containing a long extra arm to elongation factor Tu by trans-diamminedichloroplatinum(II)

    DEFF Research Database (Denmark)

    Rasmussen, Nils-Jørgen; Wikman, Friedrik; Clark, Brian F. C.

    1990-01-01

    A tRNA containing a long extra arm, namely E. coli tRNA1Leu has been crosslinked to elongation factor Tu, with the crosslinking reagent trans-diamminedichloroplatinum(II). The nucleotide involved in the crosslinking was identified to be a guanosine in the variable region at position 47F or 47G....

  13. Movement of the 3'-end of tRNA through the peptidyl transferase centre and its inhibition by antibiotics

    DEFF Research Database (Denmark)

    Kirillov, Stanislav; Porse, Bo Torben; Vester, Birthe

    1997-01-01

    experimental data and, especially, those relevant to substrate movements through the peptidyl transferase centre. With the exception of deacylated tRNA, which binds at the E-site, ribosomal interactions of the 3'-ends of the tRNA substrates generate only a small part of the total free energy of t...

  14. 21 CFR 582.1516 - Monopotassium glutamate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Monopotassium glutamate. 582.1516 Section 582.1516 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Additives § 582.1516 Monopotassium glutamate. (a) Product. Monopotassium glutamate. (b) Conditions of use...

  15. 21 CFR 182.1516 - Monopotassium glutamate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Monopotassium glutamate. 182.1516 Section 182.1516 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD... Substances § 182.1516 Monopotassium glutamate. (a) Product. Monopotassium glutamate. (b) Conditions of use...

  16. 21 CFR 182.1500 - Monoammonium glutamate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Monoammonium glutamate. 182.1500 Section 182.1500 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD... Substances § 182.1500 Monoammonium glutamate. (a) Product. Monoammonium glutamate. (b) Conditions of use...

  17. 21 CFR 582.1500 - Monoammonium glutamate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Monoammonium glutamate. 582.1500 Section 582.1500 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Additives § 582.1500 Monoammonium glutamate. (a) Product. Monoammonium glutamate. (b) Conditions of use...

  18. Glutamate esters as agents for cholescintigraphy

    International Nuclear Information System (INIS)

    Colombetti, L.

    1976-01-01

    Several sup(99m)Tc-labelled aldehyde glutamate complexes having similar pharmacological properties as sup(99m)Tc-pyridoxylidene glutamate have been prepared. The dynamic behaviour of these compounds in dogs and rabbits was studied using a digital computer and scintillation camera. The aldehyde-glutamate complex promises to be a useful agent for the dynamic study of hepatic and biliary function

  19. 21 CFR 182.1045 - Glutamic acid.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Glutamic acid. 182.1045 Section 182.1045 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN....1045 Glutamic acid. (a) Product. Glutamic acid. (b) [Reserved] (c) Limitations, restrictions, or...

  20. Essential roles of aspartate aminotransferase 1 and vesicular glutamate transporters in β-cell glutamate signaling for incretin-induced insulin secretion.

    Directory of Open Access Journals (Sweden)

    Naoya Murao

    Full Text Available Incretins (GLP-1 and GIP potentiate insulin secretion through cAMP signaling in pancreatic β-cells in a glucose-dependent manner. We recently proposed a mechanistic model of incretin-induced insulin secretion (IIIS that requires two critical processes: 1 generation of cytosolic glutamate through the malate-aspartate (MA shuttle in glucose metabolism and 2 glutamate transport into insulin granules by cAMP signaling to promote insulin granule exocytosis. To directly prove the model, we have established and characterized CRISPR/Cas9-engineered clonal mouse β-cell lines deficient for the genes critical in these two processes: aspartate aminotransferase 1 (AST1, gene symbol Got1, a key enzyme in the MA shuttle, which generates cytosolic glutamate, and the vesicular glutamate transporters (VGLUT1, VGLUT2, and VGLUT3, gene symbol Slc17a7, Slc17a6, and Slc17a8, respectively, which participate in glutamate transport into secretory vesicles. Got1 knockout (KO β-cell lines were defective in cytosolic glutamate production from glucose and showed impaired IIIS. Unexpectedly, different from the previous finding that global Slc17a7 KO mice exhibited impaired IIIS from pancreatic islets, β-cell specific Slc17a7 KO mice showed no significant impairment in IIIS, as assessed by pancreas perfusion experiment. Single Slc17a7 KO β-cell lines also retained IIIS, probably due to compensatory upregulation of Slc17a6. Interestingly, triple KO of Slc17a7, Slc17a6, and Slc17a8 diminished IIIS, which was rescued by exogenously introduced wild-type Slc17a7 or Slc17a6 genes. The present study provides direct evidence for the essential roles of AST1 and VGLUTs in β-cell glutamate signaling for IIIS and also shows the usefulness of the CRISPR/Cas9 system for studying β-cells by simultaneous disruption of multiple genes.

  1. Structural requirements for the binding of tRNA Lys3 to reverse transcriptase of the human immunodeficiency virus type 1

    NARCIS (Netherlands)

    Oude Essink, B. B.; Das, A. T.; Berkhout, B.

    1995-01-01

    Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA Lys3 molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA

  2. The glutamate/GABA-glutamine cycle

    DEFF Research Database (Denmark)

    Bak, Lasse K; Schousboe, Arne; Waagepetersen, Helle S

    2006-01-01

    or GABA from neurons and subsequent uptake into astrocytes. In return, astrocytes release glutamine to be taken up into neurons for use as neurotransmitter precursor. In this review, the basic properties of the glutamate/GABA-glutamine cycle will be discussed, including aspects of transport and metabolism...... of intercellular transfer of ammonia produced in neurons (when glutamine is deamidated to glutamate) and utilized in astrocytes (for amidation of glutamate) when the glutamate/GABA-glutamine cycle is operating. A main objective of this review is to endorse the view that the glutamate/GABA-glutamine cycle must...

  3. Formation of tRNA granules in the nucleus of heat-induced human cells

    International Nuclear Information System (INIS)

    Miyagawa, Ryu; Mizuno, Rie; Watanabe, Kazunori; Ijiri, Kenichi

    2012-01-01

    Highlights: ► tRNAs are tranlocated into the nucleus in heat-induced HeLa cells. ► tRNAs form the unique granules in the nucleus. ► tRNA ganules overlap with nuclear stress granules. -- Abstract: The stress response, which can trigger various physiological phenomena, is important for living organisms. For instance, a number of stress-induced granules such as P-body and stress granule have been identified. These granules are formed in the cytoplasm under stress conditions and are associated with translational inhibition and mRNA decay. In the nucleus, there is a focus named nuclear stress body (nSB) that distinguishes these structures from cytoplasmic stress granules. Many splicing factors and long non-coding RNA species localize in nSBs as a result of stress. Indeed, tRNAs respond to several kinds of stress such as heat, oxidation or starvation. Although nuclear accumulation of tRNAs occurs in starved Saccharomyces cerevisiae, this phenomenon is not found in mammalian cells. We observed that initiator tRNA Met (Meti) is actively translocated into the nucleus of human cells under heat stress. During this study, we identified unique granules of Meti that overlapped with nSBs. Similarly, elongator tRNA Met was translocated into the nucleus and formed granules during heat stress. Formation of tRNA granules is closely related to the translocation ratio. Then, all tRNAs may form the specific granules.

  4. Protozoan ALKBH8 Oxygenases Display both DNA Repair and tRNA Modification Activities

    DEFF Research Database (Denmark)

    Zdżalik, Daria; Vågbø, Cathrine B; Kirpekar, Finn

    2014-01-01

    , interestingly, two protozoan ALKBH8s also catalyzed wobble uridine modification of tRNA, thus displaying a dual in vitro activity. Also, we found the modification status of tRNAGly(UCC) to be unaltered in an ALKBH8 deficient mutant of Agrobacterium tumefaciens, indicating that bacterial ALKBH8s have a function...

  5. The early history of tRNA recognition by aminoacyl-tRNA synthetases

    Indian Academy of Sciences (India)

    Madhu

    2006-10-04

    Oct 4, 2006 ... of these enzymes for correct genetic code expression as well as early structural data and related enzymology will be reviewed. Despite structural diversity, all synthetases follow a two-step mechanism for tRNA aminoacylation. Specificity, however, is not absolute since synthetases were shown to catalyze ...

  6. Real-time tRNA transit on single translating ribosomes at codon resolution

    Science.gov (United States)

    Uemura, Sotaro; Aitken, Colin Echeverría; Korlach, Jonas; Flusberg, Benjamin A.; Turner, Stephen W.; Puglisi, Joseph D.

    2015-01-01

    Translation by the ribosome occurs by a complex mechanism involving the coordinated interaction of multiple nucleic acid and protein ligands. Here we have used zero-mode waveguides (ZMWs) and sophisticated detection instrumentation to allow real-time observation of translation at physiologically-relevant (μM) ligand concentrations. Translation at each codon is monitored by stable binding of tRNAs – labeled with distinct fluorophores – to translating ribosomes, allowing direct detection of the identity of tRNA molecules bound to the ribosome, and therefore, the underlying mRNA sequence. We observe the transit of tRNAs on single translating ribosomes and have determined the number of tRNA molecules simultaneously bound to the ribosome, at each codon of an mRNA. Our results show that ribosomes are only briefly occupied by two tRNAs and that release of deacylated tRNA from the E site is uncoupled from binding of A-site tRNA and occurs rapidly after translocation. The methods outlined here have broad application to the study of mRNA sequences, and the mechanism and regulation of translation. PMID:20393556

  7. Selection of tRNA charging quality control mechanisms that increase mistranslation of the genetic code

    DEFF Research Database (Denmark)

    Yadavalli, Srujana S; Ibba, Michael

    2013-01-01

    Mistranslation can follow two events during protein synthesis: production of non-cognate amino acid:transfer RNA (tRNA) pairs by aminoacyl-tRNA synthetases (aaRSs) and inaccurate selection of aminoacyl-tRNAs by the ribosome. Many aaRSs actively edit non-cognate amino acids, but editing mechanisms...

  8. Machine News and Volatility: The Dow Jones Industrial Average and the TRNA Sentiment Series

    NARCIS (Netherlands)

    D.E. Allen (David); A.K. Singh (Abhay)

    2014-01-01

    markdownabstract__Abstract__ This paper features an analysis of the relationship between the volatility of the Dow Jones Industrial Average (DJIA) Index and a sentiment news series using daily data obtained from the Thomson Reuters News Analytics (TRNA) provided by SIRCA (The Securities Industry

  9. tRNA acceptor-stem and anticodon bases embed separate features of amino acid chemistry

    Science.gov (United States)

    Carter, Charles W.; Wolfenden, Richard

    2016-01-01

    abstract The universal genetic code is a translation table by which nucleic acid sequences can be interpreted as polypeptides with a wide range of biological functions. That information is used by aminoacyl-tRNA synthetases to translate the code. Moreover, amino acid properties dictate protein folding. We recently reported that digital correlation techniques could identify patterns in tRNA identity elements that govern recognition by synthetases. Our analysis, and the functionality of truncated synthetases that cannot recognize the tRNA anticodon, support the conclusion that the tRNA acceptor stem houses an independent code for the same 20 amino acids that likely functioned earlier in the emergence of genetics. The acceptor-stem code, related to amino acid size, is distinct from a code in the anticodon that is related to amino acid polarity. Details of the acceptor-stem code suggest that it was useful in preserving key properties of stereochemically-encoded peptides that had developed the capacity to interact catalytically with RNA. The quantitative embedding of the chemical properties of amino acids into tRNA bases has implications for the origins of molecular biology. PMID:26595350

  10. Unusual evolutionary history of the tRNA splicing endonuclease EndA: relationship to the LAGLIDADG and PD-(D/E)XK deoxyribonucleases.

    Science.gov (United States)

    Bujnicki, J M; Rychlewski, L

    2001-03-01

    The tRNA splicing endoribonuclease EndA from Methanococcus jannaschii is a homotetramer formed via heterologous interaction between the two pairs of homodimers. Each monomer consists of two alpha/beta domains, the N-terminal domain (NTD) and the C-terminal domain (CTD) containing the RNase A-like active site. Comparison of the EndA coordinates with the publicly available protein structure database revealed the similarity of both domains to site-specific deoxyribonucleases: the NTD to the LAGLIDADG family and the CTD to the PD-(D/E)XK family. Superposition of the NTD on the catalytic domain of LAGLIDADG homing endonucleases allowed a suggestion to be made about which amino acid residues of the tRNA splicing nuclease might participate in formation of a presumptive cryptic deoxyribonuclease active site. On the other hand, the CTD and PD-(D/E)XK endonucleases, represented by restriction enzymes and a phage lambda exonuclease, were shown to share extensive similarities of the structural framework, to which entirely different active sites might be attached in two alternative locations. These findings suggest that EndA evolved from a fusion protein with at least two distinct endonuclease activities: the ribonuclease, which made it an essential "antitoxin" for the cells whose RNA genes were interrupted by introns, and the deoxyribonuclease, which provided the means for homing-like mobility. The residues of the noncatalytic CTDs from the positions corresponding to the catalytic side chains in PD-(D/E)XK deoxyribonucleases map to the surface at the opposite side to the tRNA binding site, for which no function has been implicated. Many restriction enzymes from the PD-(D/E)XK superfamily might have the potential to maintain an additional active or binding site at the face opposite the deoxyribonuclease active site, a property that can be utilized in protein engineering.

  11. Identification and sequence analysis of metazoan tRNA 3'-end processing enzymes tRNase Zs.

    Directory of Open Access Journals (Sweden)

    Zhikang Wang

    Full Text Available tRNase Z is the endonuclease responsible for removing the 3'-trailer sequences from precursor tRNAs, a prerequisite for the addition of the CCA sequence. It occurs in the short (tRNase Z(S and long (tRNase Z(L forms. Here we report the identification and sequence analysis of candidate tRNase Zs from 81 metazoan species. We found that the vast majority of deuterostomes, lophotrochozoans and lower metazoans have one tRNase Z(S and one tRNase Z(L genes, whereas ecdysozoans possess only a single tRNase Z(L gene. Sequence analysis revealed that in metazoans, a single nuclear tRNase Z(L gene is likely to encode both the nuclear and mitochondrial forms of tRNA 3'-end processing enzyme through mechanisms that include alternative translation initiation from two in-frame start codons and alternative splicing. Sequence conservation analysis revealed a variant PxKxRN motif, PxPxRG, which is located in the N-terminal region of tRNase Z(Ss. We also identified a previously unappreciated motif, AxDx, present in the C-terminal region of both tRNase Z(Ss and tRNase Z(Ls. The AxDx motif consisting mainly of a very short loop is potentially close enough to form hydrogen bonds with the loop containing the PxKxRN or PxPxRG motif. Through complementation analysis, we demonstrated the likely functional importance of the AxDx motif. In conclusion, our analysis supports the notion that in metazoans a single tRNase Z(L has evolved to participate in both nuclear and mitochondrial tRNA 3'-end processing, whereas tRNase Z(S may have evolved new functions. Our analysis also unveils new evolutionarily conserved motifs in tRNase Zs, including the C-terminal AxDx motif, which may have functional significance.

  12. The Pai-associated leuX specific tRNA5(Leu) affects type 1fimbriation in pathogenic Escherichia coli by control of FimB recombinase expression

    DEFF Research Database (Denmark)

    Ritter, A.; Gally, D.; Olsen, Peter Bjarke

    1997-01-01

    ) and other virulence factors. Transcription of fimA, encoding the major type 1 fimbrialsubunit is controlled by an invertable DNA switch. The inversion is catalysed by two recombinases,FimB and FimE. FimB is able to turn the switch on, FimE only off. The fimB gene of strain 536contains five TTG codons...... recognized by tRNA5Leu, fimE contains only two. It was proposed thatturning on the fim switch requires efficient translation of FimB, in turn requiring tRNA5Leu. Strainsin which the TTG codons in fimB were replaced with CTG codons at the wild-type locus were ableto produce type 1 fimbriae in the absence...

  13. Steric complementarity in the decoding center is important for tRNA selection by the ribosome.

    Science.gov (United States)

    Khade, Prashant K; Shi, Xinying; Joseph, Simpson

    2013-10-23

    Accurate tRNA selection by the ribosome is essential for the synthesis of functional proteins. Previous structural studies indicated that the ribosome distinguishes between cognate and near-cognate tRNAs by monitoring the geometry of the codon-anticodon helix in the decoding center using the universally conserved 16S ribosomal RNA bases G530, A1492 and A1493. These bases form hydrogen bonds with the 2'-hydroxyl groups of the codon-anticodon helix, which are expected to be disrupted with a near-cognate codon-anticodon helix. However, a recent structural study showed that G530, A1492 and A1493 form hydrogen bonds in a manner identical with that of both cognate and near-cognate codon-anticodon helices. To understand how the ribosome discriminates between cognate and near-cognate tRNAs, we made 2'-deoxynucleotide and 2'-fluoro substituted mRNAs, which disrupt the hydrogen bonds between the A site codon and G530, A1492 and A1493. Our results show that multiple 2'-deoxynucleotide substitutions in the mRNA substantially inhibit tRNA selection, whereas multiple 2'-fluoro substitutions in the mRNA have only modest effects on tRNA selection. Furthermore, the miscoding antibiotics paromomycin and streptomycin rescue the defects in tRNA selection with the multiple 2'-deoxynucleotide substituted mRNA. These results suggest that steric complementarity in the decoding center is more important than the hydrogen bonds between the A site codon and G530, A1492 and A1493 for tRNA selection. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  14. Structural similarities and functional differences clarify evolutionary relationships between tRNA healing enzymes and the myelin enzyme CNPase.

    Science.gov (United States)

    Muruganandam, Gopinath; Raasakka, Arne; Myllykoski, Matti; Kursula, Inari; Kursula, Petri

    2017-05-16

    Eukaryotic tRNA splicing is an essential process in the transformation of a primary tRNA transcript into a mature functional tRNA molecule. 5'-phosphate ligation involves two steps: a healing reaction catalyzed by polynucleotide kinase (PNK) in association with cyclic phosphodiesterase (CPDase), and a sealing reaction catalyzed by an RNA ligase. The enzymes that catalyze tRNA healing in yeast and higher eukaryotes are homologous to the members of the 2H phosphoesterase superfamily, in particular to the vertebrate myelin enzyme 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNPase). We employed different biophysical and biochemical methods to elucidate the overall structural and functional features of the tRNA healing enzymes yeast Trl1 PNK/CPDase and lancelet PNK/CPDase and compared them with vertebrate CNPase. The yeast and the lancelet enzymes have cyclic phosphodiesterase and polynucleotide kinase activity, while vertebrate CNPase lacks PNK activity. In addition, we also show that the healing enzymes are structurally similar to the vertebrate CNPase by applying synchrotron radiation circular dichroism spectroscopy and small-angle X-ray scattering. We provide a structural analysis of the tRNA healing enzyme PNK and CPDase domains together. Our results support evolution of vertebrate CNPase from tRNA healing enzymes with a loss of function at its N-terminal PNK-like domain.

  15. The archaeal COG1901/DUF358 SPOUT-methyltransferase members, together with pseudouridine synthase Pus10, catalyze the formation of 1-methylpseudouridine at position 54 of tRNA

    Science.gov (United States)

    Chatterjee, Kunal; Blaby, Ian K.; Thiaville, Patrick C.; Majumder, Mrinmoyee; Grosjean, Henri; Yuan, Y. Adam; Gupta, Ramesh; de Crécy-Lagard, Valérie

    2012-01-01

    The methylation of pseudouridine (Ψ) at position 54 of tRNA, producing m1Ψ, is a hallmark of many archaeal species, but the specific methylase involved in the formation of this modification had yet to be characterized. A comparative genomics analysis had previously identified COG1901 (DUF358), part of the SPOUT superfamily, as a candidate for this missing methylase family. To test this prediction, the COG1901 encoding gene, HVO_1989, was deleted from the Haloferax volcanii genome. Analyses of modified base contents indicated that while m1Ψ was present in tRNA extracted from the wild-type strain, it was absent from tRNA extracted from the mutant strain. Expression of the gene encoding COG1901 from Halobacterium sp. NRC-1, VNG1980C, complemented the m1Ψ minus phenotype of the ΔHVO_1989 strain. This in vivo validation was extended with in vitro tests. Using the COG1901 recombinant enzyme from Methanocaldococcus jannaschii (Mj1640), purified enzyme Pus10 from M. jannaschii and full-size tRNA transcripts or TΨ-arm (17-mer) fragments as substrates, the sequential pathway of m1Ψ54 formation in Archaea was reconstituted. The methylation reaction is AdoMet dependent. The efficiency of the methylase reaction depended on the identity of the residue at position 55 of the TΨ-loop. The presence of Ψ55 allowed the efficient conversion of Ψ54 to m1Ψ54, whereas in the presence of C55, the reaction was rather inefficient and no methylation reaction occurred if a purine was present at this position. These results led to renaming the Archaeal COG1901 members as TrmY proteins. PMID:22274953

  16. L-Glutamate production by lysozyme-sensitive Corynebacterium glutamicum ltsA mutant strains

    Directory of Open Access Journals (Sweden)

    Nagai Kazuo

    2001-10-01

    Full Text Available Abstract Background A non-pathogenic species of coryneform bacteria, Corynebacterium glutamicum, was originally isolated as an L-glutamate producing bacterium and is now used for fermentative production of various amino acids. A mutation in the C. glutamicum ltsA gene caused susceptibility to lysozyme, temperature-sensitive growth, and L-glutamate production. Results The characteristics of eight lysozyme-sensitive mutants which had been isolated after N-methyl-N'-nitro-N-nitrosoguanidine mutagenesis were examined. Complementation analysis with the cloned wild-type ltsA gene and DNA sequencing of the ItsA region revealed that four mutants had a mutation in the ltsA gene. Among them, two mutants showed temperature-sensitive growth and overproduced L-glutamate at higher temperatures, as well as the previously reported ltsA mutant. Other two showed temperature-resistant growth: one missense mutant produced L-glutamate to some extent but the other nonsense mutant did not. These two mutants remained temperature-resistant in spite of introduction of ltsA::kan mutation that causes temperature-sensitive growth in the wild-type background. Conclusions These results indicate that a defect caused by the ltsA mutations is responsible for temperature-sensitive growth and L-glutamate overproduction by C. glutamicum. The two temperature-resistant mutants seem to carry suppressor mutations that rendered cells temperature-resistance and abolished L-glutamate overproduction.

  17. Polycistronic tRNA and CRISPR guide-RNA enables highly efficient multiplexed genome engineering in human cells.

    Science.gov (United States)

    Dong, Fengping; Xie, Kabin; Chen, Yueying; Yang, Yinong; Mao, Yingwei

    2017-01-22

    CRISPR/Cas9 has been widely used for genomic editing in many organisms. Many human diseases are caused by multiple mutations. The CRISPR/Cas9 system provides a potential tool to introduce multiple mutations in a genome. To mimic complicated genomic variants in human diseases, such as multiple gene deletions or mutations, two or more small guide RNAs (sgRNAs) need to be introduced all together. This can be achieved by separate Pol III promoters in a construct. However, limited enzyme sites and increased insertion size lower the efficiency to make a construct. Here, we report a strategy to quickly assembly multiple sgRNAs in one construct using a polycistronic-tRNA-gRNA (PTG) strategy. Taking advantage of the endogenous tRNA processing system in mammalian cells, we efficiently express multiple sgRNAs driven using only one Pol III promoter. Using an all-in-one construct carrying PTG, we disrupt the deacetylase domain in multiple histone deacetylases (HDACs) in human cells simultaneously. We demonstrate that multiple HDAC deletions significantly affect the activation of the Wnt-signaling pathway. Thus, this method enables to efficiently target multiple genes and provide a useful tool to establish mutated cells mimicking human diseases. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Fate of glutamate carbon and nitrogen in isolated guinea-pig kidney-cortex tubules. Evidence for involvement of glutamate dehydrogenase in glutamine sythesis from glutamate.

    OpenAIRE

    Baverel, G; Genoux, C; Forissier, M; Pellet, M

    1980-01-01

    1. The pathways and the fate of glutamate carbon and nitrogen were investigated in isolated guinea-pig kidney-cortex tubules. 2. At low glutamate concentration (1 mM), the glutamate carbon skeleton was either completely oxidized or converted into glutamine. At high glutamate concentration (5 mM), glucose, lactate and alanine were additional products of glutamate metabolism. 3. At neither concentration of glutamate was there accumulation of ammonia. 4. Nitrogen-balance calculations and the rel...

  19. Identification and analysis of candidate fungal tRNA 3'-end processing endonucleases tRNase Zs, homologs of the putative prostate cancer susceptibility protein ELAC2

    Directory of Open Access Journals (Sweden)

    Zhao Wei

    2010-09-01

    Full Text Available Abstract Background tRNase Z is the endonuclease that is responsible for the 3'-end processing of tRNA precursors, a process essential for tRNA 3'-CCA addition and subsequent tRNA aminoacylation. Based on their sizes, tRNase Zs can be divided into the long (tRNase ZL and short (tRNase ZS forms. tRNase ZL is thought to have arisen from a tandem gene duplication of tRNase ZS with further sequence divergence. The species distribution of tRNase Z is complex. Fungi represent an evolutionarily diverse group of eukaryotes. The recent proliferation of fungal genome sequences provides an opportunity to explore the structural and functional diversity of eukaryotic tRNase Zs. Results We report a survey and analysis of candidate tRNase Zs in 84 completed fungal genomes, spanning a broad diversity of fungi. We find that tRNase ZL is present in all fungi we have examined, whereas tRNase ZS exists only in the fungal phyla Basidiomycota, Chytridiomycota and Zygomycota. Furthermore, we find that unlike the Pezizomycotina and Saccharomycotina, which contain a single tRNase ZL, Schizosaccharomyces fission yeasts (Taphrinomycotina contain two tRNase ZLs encoded by two different tRNase ZL genes. These two tRNase ZLs are most likely localized to the nucleus and mitochondria, respectively, suggesting partitioning of tRNase Z function between two different tRNase ZLs in fission yeasts. The fungal tRNase Z phylogeny suggests that tRNase ZSs are ancestral to tRNase ZLs. Additionally, the evolutionary relationship of fungal tRNase ZLs is generally consistent with known phylogenetic relationships among the fungal species and supports tRNase ZL gene duplication in certain fungal taxa, including Schizosaccharomyces fission yeasts. Analysis of tRNase Z protein sequences reveals putative atypical substrate binding domains in most fungal tRNase ZSs and in a subset of fungal tRNase ZLs. Finally, we demonstrate the presence of pseudo-substrate recognition and catalytic motifs at

  20. Introduction to the Glutamate-Glutamine Cycle

    DEFF Research Database (Denmark)

    Sonnewald, Ursula; Schousboe, Arne

    2016-01-01

    The term 'glutamate-glutamine cycle' was coined several decades ago based on the observation that using certain (14)C-labeled precursors for studies of brain metabolism the specific radioactivity of glutamine generated from glutamate was higher than that of glutamate, its immediate precursor....... This is metabolically impossible unless it is assumed that at least two distinct pools of these amino acids exist. This combined with the finding that the enzyme synthesizing glutamine from glutamate was expressed in astrocytes but not in neurons formed the basis of the notion that a cycle must exist in which glutamate...... released from neurons is transported into astrocytes, converted to glutamine which is subsequently returned to neurons and converted to glutamate by an enzyme the activity of which is much higher in neurons than in astrocytes. Originally this cycle was supposed to function in a stoichiometric fashion...

  1. Introduction to the Glutamate-Glutamine Cycle

    DEFF Research Database (Denmark)

    Sonnewald, Ursula; Schousboe, Arne

    2016-01-01

    . This is metabolically impossible unless it is assumed that at least two distinct pools of these amino acids exist. This combined with the finding that the enzyme synthesizing glutamine from glutamate was expressed in astrocytes but not in neurons formed the basis of the notion that a cycle must exist in which glutamate......The term 'glutamate-glutamine cycle' was coined several decades ago based on the observation that using certain (14)C-labeled precursors for studies of brain metabolism the specific radioactivity of glutamine generated from glutamate was higher than that of glutamate, its immediate precursor...... released from neurons is transported into astrocytes, converted to glutamine which is subsequently returned to neurons and converted to glutamate by an enzyme the activity of which is much higher in neurons than in astrocytes. Originally this cycle was supposed to function in a stoichiometric fashion...

  2. Enhanced Dynamics of Hydrated tRNA on Nanodiamond Surfaces: A Combined Neutron Scattering and MD Simulation Study.

    Science.gov (United States)

    Dhindsa, Gurpreet K; Bhowmik, Debsindhu; Goswami, Monojoy; O'Neill, Hugh; Mamontov, Eugene; Sumpter, Bobby G; Hong, Liang; Ganesh, Panchapakesan; Chu, Xiang-Qiang

    2016-09-14

    Nontoxic, biocompatible nanodiamonds (ND) have recently been implemented in rational, systematic design of optimal therapeutic use in nanomedicines. However, hydrophilicity of the ND surface strongly influences structure and dynamics of biomolecules that restrict in situ applications of ND. Therefore, fundamental understanding of the impact of hydrophilic ND surface on biomolecules at the molecular level is essential. For tRNA, we observe an enhancement of dynamical behavior in the presence of ND contrary to generally observed slow motion at strongly interacting interfaces. We took advantage of neutron scattering experiments and computer simulations to demonstrate this atypical faster dynamics of tRNA on ND surface. The strong attractive interactions between ND, tRNA, and water give rise to unlike dynamical behavior and structural changes of tRNA in front of ND compared to without ND. Our new findings may provide new design principles for safer, improved drug delivery platforms.

  3. Contribution of glutamate decarboxylase in Lactobacillus reuteri to acid resistance and persistence in sourdough fermentation.

    Science.gov (United States)

    Su, Marcia S; Schlicht, Sabine; Gänzle, Michael G

    2011-08-30

    Acid stress impacts the persistence of lactobacilli in industrial sourdough fermentations, and in intestinal ecosystems. However, the contribution of glutamate to acid resistance in lactobacilli has not been demonstrated experimentally, and evidence for the contribution of acid resistance to the competitiveness of lactobacilli in sourdough is lacking. It was therefore the aim of this study to investigate the ecological role of glutamate decarboxylase in L. reuteri. A gene coding for a putative glutamate decarboxylase, gadB, was identified in the genome of L. reuteri 100-23. Different from the organization of genetic loci coding for glutamate decarboxylase in other lactic acid bacteria, gadB was located adjacent to a putative glutaminase gene, gls3. An isogenic deletion mutant, L. reuteri ∆gadB, was generated by a double crossover method. L. reuteri 100-23 but not L. reuteri ∆gadB converted glutamate to γ-aminobutyrate (GABA) in phosphate butter (pH 2.5). In sourdough, both strains converted glutamine to glutamate but only L. reuteri 100-23 accumulated GABA. Glutamate addition to phosphate buffer, pH 2.5, improved survival of L. reuteri 100-23 100-fold. However, survival of L. reuteri ∆gadB remained essentially unchanged. The disruption of gadB did not affect growth of L. reuteri in mMRS or in sourdough. However, the wild type strain L. reuteri 100-23 displaced L. reuteri ∆gadB after 5 cycles of fermentation in back-slopped sourdough fermentations. The conversion of glutamate to GABA by L. reuteri 100-23 contributes to acid resistance and to competitiveness in industrial sourdough fermentations. The organization of the gene cluster for glutamate conversion, and the availability of amino acids in cereals imply that glutamine rather than glutamate functions as the substrate for GABA formation. The exceptional coupling of glutamine deamidation to glutamate decarboxylation in L. reuteri likely reflects adaptation to cereal substrates.

  4. Contribution of glutamate decarboxylase in Lactobacillus reuteri to acid resistance and persistence in sourdough fermentation

    Directory of Open Access Journals (Sweden)

    Gänzle Michael G

    2011-08-01

    Full Text Available Abstract Background Acid stress impacts the persistence of lactobacilli in industrial sourdough fermentations, and in intestinal ecosystems. However, the contribution of glutamate to acid resistance in lactobacilli has not been demonstrated experimentally, and evidence for the contribution of acid resistance to the competitiveness of lactobacilli in sourdough is lacking. It was therefore the aim of this study to investigate the ecological role of glutamate decarboxylase in L. reuteri. Results A gene coding for a putative glutamate decarboxylase, gadB, was identified in the genome of L. reuteri 100-23. Different from the organization of genetic loci coding for glutamate decarboxylase in other lactic acid bacteria, gadB was located adjacent to a putative glutaminase gene, gls3. An isogenic deletion mutant, L. reuteri ∆gadB, was generated by a double crossover method. L. reuteri 100-23 but not L. reuteri ∆gadB converted glutamate to γ-aminobutyrate (GABA in phosphate butter (pH 2.5. In sourdough, both strains converted glutamine to glutamate but only L. reuteri 100-23 accumulated GABA. Glutamate addition to phosphate buffer, pH 2.5, improved survival of L. reuteri 100-23 100-fold. However, survival of L. reuteri ∆gadB remained essentially unchanged. The disruption of gadB did not affect growth of L. reuteri in mMRS or in sourdough. However, the wild type strain L. reuteri 100-23 displaced L. reuteri ∆gadB after 5 cycles of fermentation in back-slopped sourdough fermentations. Conclusions The conversion of glutamate to GABA by L. reuteri 100-23 contributes to acid resistance and to competitiveness in industrial sourdough fermentations. The organization of the gene cluster for glutamate conversion, and the availability of amino acids in cereals imply that glutamine rather than glutamate functions as the substrate for GABA formation. The exceptional coupling of glutamine deamidation to glutamate decarboxylation in L. reuteri likely

  5. Contribution of glutamate decarboxylase in Lactobacillus reuteri to acid resistance and persistence in sourdough fermentation

    Science.gov (United States)

    2011-01-01

    Background Acid stress impacts the persistence of lactobacilli in industrial sourdough fermentations, and in intestinal ecosystems. However, the contribution of glutamate to acid resistance in lactobacilli has not been demonstrated experimentally, and evidence for the contribution of acid resistance to the competitiveness of lactobacilli in sourdough is lacking. It was therefore the aim of this study to investigate the ecological role of glutamate decarboxylase in L. reuteri. Results A gene coding for a putative glutamate decarboxylase, gadB, was identified in the genome of L. reuteri 100-23. Different from the organization of genetic loci coding for glutamate decarboxylase in other lactic acid bacteria, gadB was located adjacent to a putative glutaminase gene, gls3. An isogenic deletion mutant, L. reuteri ∆gadB, was generated by a double crossover method. L. reuteri 100-23 but not L. reuteri ∆gadB converted glutamate to γ-aminobutyrate (GABA) in phosphate butter (pH 2.5). In sourdough, both strains converted glutamine to glutamate but only L. reuteri 100-23 accumulated GABA. Glutamate addition to phosphate buffer, pH 2.5, improved survival of L. reuteri 100-23 100-fold. However, survival of L. reuteri ∆gadB remained essentially unchanged. The disruption of gadB did not affect growth of L. reuteri in mMRS or in sourdough. However, the wild type strain L. reuteri 100-23 displaced L. reuteri ∆gadB after 5 cycles of fermentation in back-slopped sourdough fermentations. Conclusions The conversion of glutamate to GABA by L. reuteri 100-23 contributes to acid resistance and to competitiveness in industrial sourdough fermentations. The organization of the gene cluster for glutamate conversion, and the availability of amino acids in cereals imply that glutamine rather than glutamate functions as the substrate for GABA formation. The exceptional coupling of glutamine deamidation to glutamate decarboxylation in L. reuteri likely reflects adaptation to cereal

  6. Scyl1 Facilitates Nuclear tRNA Export in Mammalian Cells by Acting at the Nuclear Pore Complex

    Science.gov (United States)

    Chafe, Shawn C.

    2010-01-01

    Scyl1 is an evolutionarily conserved N-terminal protein kinase-like domain protein that plays a role in COP1-mediated retrograde protein trafficking in mammalian cells. Furthermore, loss of Scyl1 function has been shown to result in neurodegenerative disorders in mice. Here, we report that Scyl1 is also a cytoplasmic component of the mammalian nuclear tRNA export machinery. Like exportin-t, overexpression of Scyl1 restored export of a nuclear export-defective serine amber suppressor tRNA mutant in COS-7 cells. Scyl1 binds tRNA saturably, and associates with the nuclear pore complex by interacting, in part, with Nup98. Scyl1 copurifies with the nuclear tRNA export receptors exportin-t and exportin-5, the RanGTPase, and the eukaryotic elongation factor eEF-1A, which transports aminoacyl-tRNAs to the ribosomes. Scyl1 interacts directly with exportin-t and RanGTP but not with eEF-1A or RanGDP in vitro. Moreover, exportin-t containing tRNA, Scyl1, and RanGTP form a quaternary complex in vitro. Biochemical characterization also suggests that the nuclear aminoacylation-dependent pathway is primarily responsible for tRNA export in mammalian cells. These findings together suggest that Scyl1 participates in the nuclear aminoacylation-dependent tRNA export pathway and may unload aminoacyl-tRNAs from the nuclear tRNA export receptor at the cytoplasmic side of the nuclear pore complex and channels them to eEF-1A. PMID:20505071

  7. Sharing the load: Mex67-Mtr2 cofunctions with Los1 in primary tRNA nuclear export.

    Science.gov (United States)

    Chatterjee, Kunal; Majumder, Shubhra; Wan, Yao; Shah, Vijay; Wu, Jingyan; Huang, Hsiao-Yun; Hopper, Anita K

    2017-11-01

    Eukaryotic transfer RNAs (tRNAs) are exported from the nucleus, their site of synthesis, to the cytoplasm, their site of function for protein synthesis. The evolutionarily conserved β-importin family member Los1 (Exportin-t) has been the only exporter known to execute nuclear export of newly transcribed intron-containing pre-tRNAs. Interestingly, LOS1 is unessential in all tested organisms. As tRNA nuclear export is essential, we previously interrogated the budding yeast proteome to identify candidates that function in tRNA nuclear export. Here, we provide molecular, genetic, cytological, and biochemical evidence that the Mex67-Mtr2 (TAP-p15) heterodimer, best characterized for its essential role in mRNA nuclear export, cofunctions with Los1 in tRNA nuclear export. Inactivation of Mex67 or Mtr2 leads to rapid accumulation of end-matured unspliced tRNAs in the nucleus. Remarkably, merely fivefold overexpression of Mex67-Mtr2 can substitute for Los1 in los1 Δ cells. Moreover, in vivo coimmunoprecipitation assays with tagged Mex67 document that the Mex67 binds tRNAs. Our data also show that tRNA exporters surprisingly exhibit differential tRNA substrate preferences. The existence of multiple tRNA exporters, each with different tRNA preferences, may indicate that the proteome can be regulated by tRNA nuclear export. Thus, our data show that Mex67-Mtr2 functions in primary nuclear export for a subset of yeast tRNAs. © 2017 Chatterjee et al.; Published by Cold Spring Harbor Laboratory Press.

  8. Prefrontal changes in the glutamate-glutamine cycle and neuronal/glial glutamate transporters in depression with and without suicide

    NARCIS (Netherlands)

    Zhao, J.; Verwer, R.W.H.; van Wamelen, D.J.; Qi, X.R.; Gao, S.F.; Lucassen, P.J.; Swaab, D.F.

    2016-01-01

    There are indications for changes in glutamate metabolism in relation to depression or suicide. The glutamate-glutamine cycle and neuronal/glial glutamate transporters mediate the uptake of the glutamate and glutamine. The expression of various components of the glutamate-glutamine cycle and the

  9. Engineering of recombinant Escherichia coli cells co-expressing poly-γ-glutamic acid (γ-PGA) synthetase and glutamate racemase for differential yielding of γ-PGA.

    Science.gov (United States)

    Cao, Mingfeng; Geng, Weitao; Zhang, Wei; Sun, Jibin; Wang, Shufang; Feng, Jun; Zheng, Ping; Jiang, Anna; Song, Cunjiang

    2013-11-01

    Poly-γ-glutamic acid (γ-PGA) is a promising environmental-friendly material with outstanding water solubility, biocompatibility and degradability. However, it is tough to determine the relationship between functional synthetic enzyme and the strains' yield or substrate dependency. We cloned γ-PGA synthetase genes pgsBCA and glutamate racemase gene racE from both L-glutamate-dependent γ-PGA-producing Bacillus licheniformis NK-03 and L-glutamate-independent B. amyloliquefaciens LL3 strains. The deduced RacE and PgsA from the two strains shared the identity of 84.5% and 78.53%, while PgsB and PgsC possessed greater similarity with 93.13% and 93.96%. The induced co-expression of pgsBCA and racE showed that the engineered Escherichia coli strains had the capacity of synthesizing γ-PGA, and LL3 derived PgsBCA had higher catalytic activity and enhanced productivity than NK-03 in Luria-Bertani medium containing glucose or L-glutamate. However, the differential effect was weakened when providing sufficient immediateness L-glutamate substrate, that is, the supply of substrate could be served as the ascendance upon γ-PGA production. Furthermore, RacE integration could enhance γ-PGA yield through improving the preferred d-glutamate content. This is the first report about co-expression of pgsBCA and racE from the two Bacillus strains, which will be of great value for the determination of the biosynthetic mechanism of γ-PGA. © 2013 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  10. Binding of DNA-binding alkaloids berberine and palmatine to tRNA and comparison to ethidium: Spectroscopic and molecular modeling studies

    Science.gov (United States)

    Islam, Md. Maidul; Pandya, Prateek; Chowdhury, Sebanti Roy; Kumar, Surat; Kumar, Gopinatha Suresh

    2008-11-01

    The interaction of two natural protoberberine plant alkaloids berberine and palmatine with tRNA phe was studied using various biophysical techniques and molecular modeling and the data were compared with the binding of the classical DNA intercalator, ethidium. Circular dichroic studies revealed that the tRNA conformation was moderately perturbed on binding of the alkaloids. The cooperative binding of both the alkaloids and ethidium to tRNA was revealed from absorbance and fluorescence studies. Fluorescence quenching studies advanced a conclusion that while berberine and palmatine are partially intercalated, ethidium is fully intercalated on the tRNA molecule. The binding of the alkaloids as well as ethidium stabilized the tRNA melting, and the binding constant evaluated from the averaged optical melting temperature data was in agreement with fluorescence spectral-binding data. Differential scanning calorimetry revealed that the tRNA melting showed three close transitions that were affected on binding of these small molecules. Molecular docking calculations performed showed the preferred regions of binding of these small molecules on the tRNA. Taken together, the results suggest that the binding of the alkaloids berberine and palmatine on the tRNA structure appears to be mostly by partial intercalation while ethidium intercalates fully on the tRNA. These results further advance our knowledge on the molecular aspects on the interaction of these alkaloids to tRNA.

  11. Sexual attraction enhances glutamate transmission in mammalian anterior cingulate cortex

    Directory of Open Access Journals (Sweden)

    Wu Long-Jun

    2009-05-01

    Full Text Available Abstract Functional human brain imaging studies have indicated the essential role of cortical regions, such as the anterior cingulate cortex (ACC, in romantic love and sex. However, the neurobiological basis of how the ACC neurons are activated and engaged in sexual attraction remains unknown. Using transgenic mice in which the expression of green fluorescent protein (GFP is controlled by the promoter of the activity-dependent gene c-fos, we found that ACC pyramidal neurons are activated by sexual attraction. The presynaptic glutamate release to the activated neurons is increased and pharmacological inhibition of neuronal activities in the ACC reduced the interest of male mice to female mice. Our results present direct evidence of the critical role of the ACC in sexual attraction, and long-term increases in glutamate mediated excitatory transmission may contribute to sexual attraction between male and female mice.

  12. Mitochondrial tRNA import in Trypanosoma brucei is independent of thiolation and the Rieske protein

    Czech Academy of Sciences Publication Activity Database

    Paris, Zdeněk; RUBIO, M. A. T.; Lukeš, Julius; Alfonzo, J. D.

    2009-01-01

    Roč. 15, č. 7 (2009), s. 1398-1406 ISSN 1355-8382 R&D Projects: GA ČR GA204/06/1558; GA MŠk LC07032; GA MŠk 2B06129 Institutional research plan: CEZ:AV0Z60220518 Keywords : T. brucei * tRNA import * 2-thiolation * RIC * Rieske * Fe-S cluster Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.198, year: 2009

  13. The enigmatic mitochondrial genome of Rhabdopleura compacta (Pterobranchia reveals insights into selection of an efficient tRNA system and supports monophyly of Ambulacraria

    Directory of Open Access Journals (Sweden)

    Stadler Peter F

    2011-05-01

    Full Text Available Abstract Background The Hemichordata comprises solitary-living Enteropneusta and colonial-living Pterobranchia, sharing morphological features with both Chordata and Echinodermata. Despite their key role for understanding deuterostome evolution, hemichordate phylogeny is controversial and only few molecular data are available for phylogenetic analysis. Furthermore, mitochondrial sequences are completely lacking for pterobranchs. Therefore, we determined and analyzed the complete mitochondrial genome of the pterobranch Rhabdopleura compacta to elucidate deuterostome evolution. Thereby, we also gained important insights in mitochondrial tRNA evolution. Results The mitochondrial DNA of Rhabdopleura compacta corresponds in size and gene content to typical mitochondrial genomes of metazoans, but shows the strongest known strand-specific mutational bias in the nucleotide composition among deuterostomes with a very GT-rich main-coding strand. The order of the protein-coding genes in R. compacta is similar to that of the deuterostome ground pattern. However, the protein-coding genes have been highly affected by a strand-specific mutational pressure showing unusual codon frequency and amino acid composition. This composition caused extremely long branches in phylogenetic analyses. The unusual codon frequency points to a selection pressure on the tRNA translation system to codon-anticodon sequences of highest versatility instead of showing adaptations in anticodon sequences to the most frequent codons. Furthermore, an assignment of the codon AGG to Lysine has been detected in the mitochondrial genome of R. compacta, which is otherwise observed only in the mitogenomes of some arthropods. The genomes of these arthropods do not have such a strong strand-specific bias as found in R. compacta but possess an identical mutation in the anticodon sequence of the tRNALys. Conclusion A strong reversed asymmetrical mutational constraint in the mitochondrial genome of

  14. tRNA modifying enzymes, NSUN2 and METTL1, determine sensitivity to 5-fluorouracil in HeLa cells.

    Directory of Open Access Journals (Sweden)

    Mayumi Okamoto

    2014-09-01

    Full Text Available Nonessential tRNA modifications by methyltransferases are evolutionarily conserved and have been reported to stabilize mature tRNA molecules and prevent rapid tRNA decay (RTD. The tRNA modifying enzymes, NSUN2 and METTL1, are mammalian orthologs of yeast Trm4 and Trm8, which are required for protecting tRNA against RTD. A simultaneous overexpression of NSUN2 and METTL1 is widely observed among human cancers suggesting that targeting of both proteins provides a novel powerful strategy for cancer chemotherapy. Here, we show that combined knockdown of NSUN2 and METTL1 in HeLa cells drastically potentiate sensitivity of cells to 5-fluorouracil (5-FU whereas heat stress of cells revealed no effects. Since NSUN2 and METTL1 are phosphorylated by Aurora-B and Akt, respectively, and their tRNA modifying activities are suppressed by phosphorylation, overexpression of constitutively dephosphorylated forms of both methyltransferases is able to suppress 5-FU sensitivity. Thus, NSUN2 and METTL1 are implicated in 5-FU sensitivity in HeLa cells. Interfering with methylation of tRNAs might provide a promising rationale to improve 5-FU chemotherapy of cancer.

  15. Regional regulation of glutamate signaling during cuprizone-induced demyelination in the brain.

    Science.gov (United States)

    Azami Tameh, Abolfazl; Clarner, Tim; Beyer, Cordian; Atlasi, Mohammad Ali; Hassanzadeh, Gholamreza; Naderian, Homayoun

    2013-10-01

    Glutamate excitotoxicity is associated with a wide range of neurodegenerative disorders and also seems to be involved in the pathology of demyelinating disorders such as multiple sclerosis (MS). Cuprizone-induced toxic demyelination shows clear characteristics of MS such as demyelination and axonal damage without the involvement of the innate immune system. In this study, we have evaluated glutamate signaling during cuprizone-induced demyelination in the white and gray matter of mouse brain by studying the expression of ionotropic and metabotropic glutamate-receptors and -transporters by Affymetrix gene array analysis, followed by real-time PCR and western blot analysis. Cellular localization of glutamate transporters was investigated by fluorescence double-labeling experiments. Comparing white and gray matter areas, the expression of glutamate receptors was region-specific. Among NMDA receptor subunits, NR2A was up-regulated in the demyelinated corpus callosum (CC), whereas the metabotropic glutamate receptor mGluR2 was down-regulated in demyelinated gray matter. Glutamate-aspartate transporter (GLAST) co-localizing with GFAP(+) astrocytes was increased in both demyelinated CC and telencephalic cortex, whereas Slc1a4 transporter was up-regulated only in CC. Our data indicate that cuprizone treatment affects glutamate-receptors and -transporters differently in gray and white matter brain areas revealing particularly regulation of GLAST and Slc1a4 compared with other genes. This might have an important influence on brain-region selective sensitivity to neurotoxic compounds and the progression of demyelination as has been reported for MS and other demyelinating neurological diseases. Copyright © 2013 Elsevier GmbH. All rights reserved.

  16. Effects of phosphoenolpyruvate carboxylase desensitization on glutamic acid production in Corynebacterium glutamicum ATCC 13032.

    Science.gov (United States)

    Wada, Masaru; Sawada, Kazunori; Ogura, Kotaro; Shimono, Yuta; Hagiwara, Takuya; Sugimoto, Masakazu; Onuki, Akiko; Yokota, Atsushi

    2016-02-01

    Phosphoenolpyruvate carboxylase (PEPC) in Corynebacterium glutamicum ATCC13032, a glutamic-acid producing actinobacterium, is subject to feedback inhibition by metabolic intermediates such as aspartic acid and 2-oxoglutaric acid, which implies the importance of PEPC in replenishing oxaloacetic acid into the TCA cycle. Here, we investigated the effects of feedback-insensitive PEPC on glutamic acid production. A single amino-acid substitution in PEPC, D299N, was found to relieve the feedback control by aspartic acid, but not by 2-oxoglutaric acid. A simple mutant, strain R1, having the D299N substitution in PEPC was constructed from ATCC 13032 using the double-crossover chromosome replacement technique. Strain R1 produced glutamic acid at a concentration of 31.0 g/L from 100 g/L glucose in a jar fermentor culture under biotin-limited conditions, which was significantly higher than that of the parent, 26.0 g/L (1.19-fold), indicative of the positive effect of desensitized PEPC on glutamic acid production. Another mutant, strain DR1, having both desensitized PEPC and PYK-gene deleted mutations, was constructed in a similar manner using strain D1 with a PYK-gene deleted mutation as the parent. This mutation had been shown to enhance glutamic acid production in our previous study. Although marginal, strain D1 produced higher glutamic acid, 28.8 g/L, than ATCC13032 (1.11-fold). In contrast, glutamic acid production by strain DR-1 was elevated up to 36.9 g/L, which was 1.42-fold higher than ATCC13032 and significantly higher than the other three strains. The results showed a synergistic effect of these two mutations on glutamic acid production in C. glutamicum. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  17. Sequence-dependent base-stacking stabilities guide tRNA folding energy landscapes.

    Science.gov (United States)

    Li, Rongzhong; Ge, Heming W; Cho, Samuel S

    2013-10-24

    The folding of bacterial tRNAs with disparate sequences has been observed to proceed in distinct folding mechanisms despite their structural similarity. To explore the folding landscapes of tRNA, we performed ion concentration-dependent coarse-grained TIS model MD simulations of several E. coli tRNAs to compare their thermodynamic melting profiles to the classical absorbance spectra of Crothers and co-workers. To independently validate our findings, we also performed atomistic empirical force field MD simulations of tRNAs, and we compared the base-to-base distances from coarse-grained and atomistic MD simulations to empirical base-stacking free energies. We then projected the free energies to the secondary structural elements of tRNA, and we observe distinct, parallel folding mechanisms whose differences can be inferred on the basis of their sequence-dependent base-stacking stabilities. In some cases, a premature, nonproductive folding intermediate corresponding to the Ψ hairpin loop must backtrack to the unfolded state before proceeding to the folded state. This observation suggests a possible explanation for the fast and slow phases observed in tRNA folding kinetics.

  18. MMB-GUI: a fast morphing method demonstrates a possible ribosomal tRNA translocation trajectory.

    Science.gov (United States)

    Tek, Alex; Korostelev, Andrei A; Flores, Samuel Coulbourn

    2016-01-08

    Easy-to-use macromolecular viewers, such as UCSF Chimera, are a standard tool in structural biology. They allow rendering and performing geometric operations on large complexes, such as viruses and ribosomes. Dynamical simulation codes enable modeling of conformational changes, but may require considerable time and many CPUs. There is an unmet demand from structural and molecular biologists for software in the middle ground, which would allow visualization combined with quick and interactive modeling of conformational changes, even of large complexes. This motivates MMB-GUI. MMB uses an internal-coordinate, multiscale approach, yielding as much as a 2000-fold speedup over conventional simulation methods. We use Chimera as an interactive graphical interface to control MMB. We show how this can be used for morphing of macromolecules that can be heterogeneous in biopolymer type, sequence, and chain count, accurately recapitulating structural intermediates. We use MMB-GUI to create a possible trajectory of EF-G mediated gate-passing translocation in the ribosome, with all-atom structures. This shows that the GUI makes modeling of large macromolecules accessible to a wide audience. The morph highlights similarities in tRNA conformational changes as tRNA translocates from A to P and from P to E sites and suggests that tRNA flexibility is critical for translocation completion. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Growth-Rate Dependent Regulation of tRNA Level and Charging in Bacillus licheniformis.

    Science.gov (United States)

    Ferro, Iolanda; Liebeton, Klaus; Ignatova, Zoya

    2017-10-13

    Cellular growth crucially depends on protein synthesis and the abundance of translational components. Among them, aminoacyl-tRNAs play a central role in biosynthesis and shape the kinetics of mRNA translation, thus influencing protein production. Here, we used microarray-based approaches to determine the charging levels and tRNA abundance of Bacillus licheniformis. We observed an interesting cross-talk among tRNA expression, charging pattern, and growth rate. For a large subset of tRNAs, we found a co-regulated and augmented expression at high growth rate. Their tRNA aminoacylation level is kept relatively constant through riboswitch-regulated expression of the cognate aminoacyl-tRNA-synthetase (AARS). We show that AARSs with putative riboswitch-controlled expression are those charging tRNAs with amino acids which disfavor cell growth when individually added to the nutrient medium. Our results suggest that the riboswitch-regulated AARS expression in B. licheniformis is a powerful mechanism not only to maintain a constant ratio of aminoacyl-tRNA independent of the growth rate but concomitantly to control the intracellular level of free amino acids. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Snapshots of Dynamics in Synthesizing N6-isopentenyladenosine at tRNA Anticodon†,‡

    Science.gov (United States)

    Chimnaronk, Sarin; Forouhar, Farhad; Sakai, Junichi; Yao, Min; Tron, Cecile M.; Atta, Mohamed; Fontecave, Marc; Hunt, John F.; Tanaka, Isao

    2009-01-01

    Bacterial and eukaryotic transfer RNAs that decode codons starting with uridine have a hydrophobically-hypermodified adenosine at the position 37 (A37) adjacent to the 3′-end of the anticodon, which is essential for efficient and highly accurate protein translation by the ribosome. However, it remains unclear how the corresponding tRNAs are selected to be modified by alkylation at the correct position of the adenosine base. We have determined a series of the crystal structures of bacterial tRNA isopentenyltransferase (MiaA) in apo- and tRNA-bound forms, which completely render snapshots of substrate selections during modification of RNA. A compact evolutionary inserted domain (herein ‘swinging domain’) in MiaA that exhibits as a highly mobile entity moves around the catalytic domain as likely to reach and trap the tRNA substrate. Thereby, MiaA clamps the anticodon stem loop of tRNA substrate between the catalytic and swinging domains, where the two conserved elongated residues from the swinging domain pinch the two flanking A36 and A38 together to squeeze out A37 into the reaction tunnel. The site-specific isopentenylation of RNA is thus ensured by a characteristic pinch-and-flip mechanism and by a reaction tunnel to confine the substrate selection. Furthermore, combining information from soaking experiments with structural comparisons, we propose a mechanism for the ordered substrate-binding of MiaA. PMID:19435325

  1. Alteration of protein function by a silent polymorphism linked to tRNA abundance.

    Directory of Open Access Journals (Sweden)

    Sebastian Kirchner

    2017-05-01

    Full Text Available Synonymous single nucleotide polymorphisms (sSNPs are considered neutral for protein function, as by definition they exchange only codons, not amino acids. We identified an sSNP that modifies the local translation speed of the cystic fibrosis transmembrane conductance regulator (CFTR, leading to detrimental changes to protein stability and function. This sSNP introduces a codon pairing to a low-abundance tRNA that is particularly rare in human bronchial epithelia, but not in other human tissues, suggesting tissue-specific effects of this sSNP. Up-regulation of the tRNA cognate to the mutated codon counteracts the effects of the sSNP and rescues protein conformation and function. Our results highlight the wide-ranging impact of sSNPs, which invert the programmed local speed of mRNA translation and provide direct evidence for the central role of cellular tRNA levels in mediating the actions of sSNPs in a tissue-specific manner.

  2. Alteration of protein function by a silent polymorphism linked to tRNA abundance.

    Science.gov (United States)

    Kirchner, Sebastian; Cai, Zhiwei; Rauscher, Robert; Kastelic, Nicolai; Anding, Melanie; Czech, Andreas; Kleizen, Bertrand; Ostedgaard, Lynda S; Braakman, Ineke; Sheppard, David N; Ignatova, Zoya

    2017-05-01

    Synonymous single nucleotide polymorphisms (sSNPs) are considered neutral for protein function, as by definition they exchange only codons, not amino acids. We identified an sSNP that modifies the local translation speed of the cystic fibrosis transmembrane conductance regulator (CFTR), leading to detrimental changes to protein stability and function. This sSNP introduces a codon pairing to a low-abundance tRNA that is particularly rare in human bronchial epithelia, but not in other human tissues, suggesting tissue-specific effects of this sSNP. Up-regulation of the tRNA cognate to the mutated codon counteracts the effects of the sSNP and rescues protein conformation and function. Our results highlight the wide-ranging impact of sSNPs, which invert the programmed local speed of mRNA translation and provide direct evidence for the central role of cellular tRNA levels in mediating the actions of sSNPs in a tissue-specific manner.

  3. Desensitization of metabotropic glutamate receptors in neuronal cultures

    NARCIS (Netherlands)

    Catania, M. V.; Aronica, E.; Sortino, M. A.; Canonico, P. L.; Nicoletti, F.

    1991-01-01

    Preexposure of cultured cerebellar neurons to glutamate reduced the stimulation of polyphosphoinositide (PPI) hydrolysis induced by subsequent addition of glutamate without affecting the response to the muscarinic receptor agonist carbamylcholine. Desensitization of glutamate-stimulated PPI

  4. Structure–function relations in the NTPase domain of the antiviral tRNA ribotoxin Escherichia coli PrrC

    International Nuclear Information System (INIS)

    Meineke, Birthe; Shuman, Stewart

    2012-01-01

    Breakage of tRNA by Escherichia coli anticodon nuclease PrrC (EcoPrrC) underlies a host antiviral response to phage T4 infection. Expression of EcoPrrC is cytocidal in yeast, signifying that PrrC ribotoxicity crosses phylogenetic domain boundaries. EcoPrrC consists of an N-terminal NTPase module that resembles ABC transporters and a C-terminal nuclease module that is sui generis. PrrC homologs are prevalent in many other bacteria. Here we report that Haemophilus influenzae PrrC is toxic in E. coli and yeast. To illuminate structure–activity relations, we conducted a new round of mutational analysis of EcoPrrC guided by primary structure conservation among toxic PrrC homologs. We indentify 17 candidate active site residues in the NTPase module that are essential for toxicity in yeast when EcoPrrC is expressed at high gene dosage. Their functions could be educed by integrating mutational data with the atomic structure of the transition-state complex of a homologous ABC protein.

  5. Towards an Integrative Understanding of tRNA Aminoacylation-Diet-Host-Gut Microbiome Interactions in Neurodegeneration.

    Science.gov (United States)

    Paley, Elena L; Perry, George

    2018-03-26

    Transgenic mice used for Alzheimer's disease (AD) preclinical experiments do not recapitulate the human disease. In our models, the dietary tryptophan metabolite tryptamine produced by human gut microbiome induces tryptophanyl-tRNA synthetase (TrpRS) deficiency with consequent neurodegeneration in cells and mice. Dietary supplements, antibiotics and certain drugs increase tryptamine content in vivo. TrpRS catalyzes tryptophan attachment to tRNA trp at initial step of protein biosynthesis. Tryptamine that easily crosses the blood-brain barrier induces vasculopathies, neurodegeneration and cell death via TrpRS competitive inhibition. TrpRS inhibitor tryptophanol produced by gut microbiome also induces neurodegeneration. TrpRS inhibition by tryptamine and its metabolites preventing tryptophan incorporation into proteins lead to protein biosynthesis impairment. Tryptophan, a least amino acid in food and proteins that cannot be synthesized by humans competes with frequent amino acids for the transport from blood to brain. Tryptophan is a vulnerable amino acid, which can be easily lost to protein biosynthesis. Some proteins marking neurodegenerative pathology, such as tau lack tryptophan. TrpRS exists in cytoplasmic (WARS) and mitochondrial (WARS2) forms. Pathogenic gene variants of both forms cause TrpRS deficiency with consequent intellectual and motor disabilities in humans. The diminished tryptophan-dependent protein biosynthesis in AD patients is a proof of our model-based disease concept.

  6. Structure-function relations in the NTPase domain of the antiviral tRNA ribotoxin Escherichia coli PrrC

    Energy Technology Data Exchange (ETDEWEB)

    Meineke, Birthe; Shuman, Stewart, E-mail: s-shuman@ski.mskcc.org

    2012-06-05

    Breakage of tRNA by Escherichia coli anticodon nuclease PrrC (EcoPrrC) underlies a host antiviral response to phage T4 infection. Expression of EcoPrrC is cytocidal in yeast, signifying that PrrC ribotoxicity crosses phylogenetic domain boundaries. EcoPrrC consists of an N-terminal NTPase module that resembles ABC transporters and a C-terminal nuclease module that is sui generis. PrrC homologs are prevalent in many other bacteria. Here we report that Haemophilus influenzae PrrC is toxic in E. coli and yeast. To illuminate structure-activity relations, we conducted a new round of mutational analysis of EcoPrrC guided by primary structure conservation among toxic PrrC homologs. We indentify 17 candidate active site residues in the NTPase module that are essential for toxicity in yeast when EcoPrrC is expressed at high gene dosage. Their functions could be educed by integrating mutational data with the atomic structure of the transition-state complex of a homologous ABC protein.

  7. Oxidative Stress in Retinal Muller Cells contributes to Dysfunction of Retinal Glutamate Uptake and Altered Protein Expression

    DEFF Research Database (Denmark)

    Toft-Kehler, Anne Katrine; Skytt, Dorte Marie; Kolko, Miriam

    2015-01-01

    Purpose: The viability of retinal ganglion cells (RGC) is essential to maintain the neuronal function of the retina. Müller cells (MC) are assumed to be vital in neuroprotection of the RGC. In this study, we evaluate the ability of oxidative stressed and energy restricted MC to remove glutamate...... from the extracellular space and evaluate related changes in gene and protein expressions. Methods: The human Müller glial cell line, MIO-M1, kindly provided by Astrid Limb, was used in all experiments. Changes in glutamate uptake were evaluated by kinetic uptake studies using 3H......-L-glutamate in oxidative stressed MC. The cell viability and mitochondrial function were evaluated by LDH and MTT assays, respectively. The expression of glutamate receptors as well as apoptotic and oxidative stress genes were evaluated by qPCR. By means of Western blot analysis the gene regulations were confirmed...

  8. Modeling of glutamate-induced dynamical patterns

    DEFF Research Database (Denmark)

    Faurby-Bentzen, Christian Krefeld; Zhabotinsky, A.M.; Laugesen, Jakob Lund

    2009-01-01

    Based on established physiological mechanisms, the paper presents a detailed computer model, which supports the hypothesis that temporal lobe epilepsy may be caused by failure of glutamate reuptake from the extracellular space. The elevated glutamate concentration causes an increased activation o...

  9. Glutamate Fermentation-2: Mechanism of L-Glutamate Overproduction in Corynebacterium glutamicum.

    Science.gov (United States)

    Hirasawa, Takashi; Wachi, Masaaki

    The nonpathogenic coryneform bacterium, Corynebacterium glutamicum, was isolated as an L-glutamate-overproducing microorganism by Japanese researchers and is currently utilized in various amino acid fermentation processes. L-Glutamate production by C. glutamicum is induced by limitation of biotin and addition of fatty acid ester surfactants and β-lactam antibiotics. These treatments affect the cell surface structures of C. glutamicum. After the discovery of C. glutamicum, many researchers have investigated the underlying mechanism of L-glutamate overproduction with respect to the cell surface structures of this organism. Furthermore, metabolic regulation during L-glutamate overproduction by C. glutamicum, particularly, the relationship between central carbon metabolism and L-glutamate biosynthesis, has been investigated. Recently, the role of a mechanosensitive channel protein in L-glutamate overproduction has been reported. In this chapter, mechanisms of L-glutamate overproduction by C. glutamicum have been reviewed.

  10. Competitive inhibition of glutamate dehydrogenase reaction.

    Science.gov (United States)

    Choudhury, Rajarshi; Punekar, Narayan S

    2007-06-12

    Irrespective of their pyridine nucleotide specificity, all glutamate dehydrogenases share a common chemical mechanism that involves an enzyme bound 'iminoglutarate' intermediate. Three compounds, structurally related to this intermediate, were tested for the inhibition of purified NADP-glutamate dehydrogenases from two Aspergilli, as also the bovine liver NAD(P)-glutamate dehydrogenase. 2-Methyleneglutarate, closely resembling iminoglutarate, was a potent competitive inhibitor of the glutamate dehydrogenase reaction. This is the first report of a non-aromatic structure with a better glutamate dehydrogenase inhibitory potency than aryl carboxylic acids such as isophthalate. A suitably located 2-methylene group to mimic the iminium ion could be exploited to design inhibitors of other amino acid dehydrogenases.

  11. Pseudoscorpion mitochondria show rearranged genes and genome-wide reductions of RNA gene sizes and inferred structures, yet typical nucleotide composition bias

    Directory of Open Access Journals (Sweden)

    Ovchinnikov Sergey

    2012-03-01

    Full Text Available Abstract Background Pseudoscorpions are chelicerates and have historically been viewed as being most closely related to solifuges, harvestmen, and scorpions. No mitochondrial genomes of pseudoscorpions have been published, but the mitochondrial genomes of some lineages of Chelicerata possess unusual features, including short rRNA genes and tRNA genes that lack sequence to encode arms of the canonical cloverleaf-shaped tRNA. Additionally, some chelicerates possess an atypical guanine-thymine nucleotide bias on the major coding strand of their mitochondrial genomes. Results We sequenced the mitochondrial genomes of two divergent taxa from the chelicerate order Pseudoscorpiones. We find that these genomes possess unusually short tRNA genes that do not encode cloverleaf-shaped tRNA structures. Indeed, in one genome, all 22 tRNA genes lack sequence to encode canonical cloverleaf structures. We also find that the large ribosomal RNA genes are substantially shorter than those of most arthropods. We inferred secondary structures of the LSU rRNAs from both pseudoscorpions, and find that they have lost multiple helices. Based on comparisons with the crystal structure of the bacterial ribosome, two of these helices were likely contact points with tRNA T-arms or D-arms as they pass through the ribosome during protein synthesis. The mitochondrial gene arrangements of both pseudoscorpions differ from the ancestral chelicerate gene arrangement. One genome is rearranged with respect to the location of protein-coding genes, the small rRNA gene, and at least 8 tRNA genes. The other genome contains 6 tRNA genes in novel locations. Most chelicerates with rearranged mitochondrial genes show a genome-wide reversal of the CA nucleotide bias typical for arthropods on their major coding strand, and instead possess a GT bias. Yet despite their extensive rearrangement, these pseudoscorpion mitochondrial genomes possess a CA bias on the major coding strand. Phylogenetic

  12. Conformation and functioning of tRNAs: cross-linked tRNAs as substrate for tRNA nucleotidyl-transferase and aminoacyl synthetases

    International Nuclear Information System (INIS)

    Carre, D.S.; Thomas, G.; Favre, A.

    1974-01-01

    The behavior of mixed E. coli tRNAs ''cross-linked'' by irradiation with near ultraviolet light (310-400 nm) has been compared to that of the intact molecules in two enzymatic processes. No change in the rate and extent of the repair of the pCpCpA 3' terminus of tRNA by purified E. coli tRNA nucleotidyltransferase can be detected. In contrast, complex data were obtained in the acylation reaction. They can be understood using other tRNA specific modifications as well as our present knowledge of E. coli tRNA sequences and rare base content [fr

  13. Exploring the interaction of Azure dyes with t-RNA by hybrid spectroscopic and computational approaches and its applications toward human lung cancer cell line.

    Science.gov (United States)

    Rajan, Dhanya; Ilanchelian, Malaichamy

    2018-03-01

    In the present study, in depth characterization of binding aspects of Azure A (AZA) and Azure B (AZB) with transfer Ribonucleic acid (t-RNA) from Escherichia coli (E.coli) is investigated using spectroscopic techniques. The absorbance and fluorescence properties of these dyes have been remarkably changed upon binding with t-RNA. Significant changes in the absorption maxima of the dyes evidence the t-RNA induced metachromasy and the binding clearly revealed the high affinity of AZA and AZB to t-RNA. Strong emission polarization of the bound dyes and strong energy transfer from the guanine base pairs of t-RNA suggested intercalative binding interaction. The stoichiometry of AZA and AZB with t-RNA complexes are determined by the Benesi-Hildebrand plot from emission data. The negative values of free energy change indicated the involvement of hydrophobic forces and noncovalent interactions in the complexation of both the dyes with t-RNA. The 3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) colorimetric assay in A-549 human lung cancer cell lines reveals that binding of t-RNA reduces the toxicity of AZA and AZB. The utility of the present work explores the potential binding applicability of these dyes to t-RNA for their development as effective therapeutic agents and its target at molecular level for the treatment of diseases like cancer. Copyright © 2018. Published by Elsevier B.V.

  14. Glutamate synapses in human cognitive disorders.

    Science.gov (United States)

    Volk, Lenora; Chiu, Shu-Ling; Sharma, Kamal; Huganir, Richard L

    2015-07-08

    Accumulating data, including those from large genetic association studies, indicate that alterations in glutamatergic synapse structure and function represent a common underlying pathology in many symptomatically distinct cognitive disorders. In this review, we discuss evidence from human genetic studies and data from animal models supporting a role for aberrant glutamatergic synapse function in the etiology of intellectual disability (ID), autism spectrum disorder (ASD), and schizophrenia (SCZ), neurodevelopmental disorders that comprise a significant proportion of human cognitive disease and exact a substantial financial and social burden. The varied manifestations of impaired perceptual processing, executive function, social interaction, communication, and/or intellectual ability in ID, ASD, and SCZ appear to emerge from altered neural microstructure, function, and/or wiring rather than gross changes in neuron number or morphology. Here, we review evidence that these disorders may share a common underlying neuropathy: altered excitatory synapse function. We focus on the most promising candidate genes affecting glutamatergic synapse function, highlighting the likely disease-relevant functional consequences of each. We first present a brief overview of glutamatergic synapses and then explore the genetic and phenotypic evidence for altered glutamate signaling in ID, ASD, and SCZ.

  15. A radiometric microassay for glutamic acid decarboxylase

    International Nuclear Information System (INIS)

    Maderdrut, J.L.; North Carolina Univ., Chapel Hill

    1979-01-01

    A simple method for purifying L-[ 3 H] glutamic acid and incubation conditions suitable for estimating L-glutamic acid decarboxylase activity are described. Routine and recycled cation-exchange procedure for separating γ-aminobutyric acid from L-glutamate are outlined and compared. Recycling increases the sensitivity of the cation-exchange method by 6-7 fold. L-Glutamate decarboxylase activity can be measured reliably in samples of embryonic neural tissue having wet-weights of approximately 1 μg. The cation-exchange method is compared with the anion-exchange and CO 2 -trapping methods. L-Glutamate decarboxylase activity has been detected in the lumbar spinal cord of the chick embryo at Day 21/4 (stage 14) using the cation-exchange method. This is 5-6 days earlier than L-glutamate decarboxylase activity has been detected in embryonic neural tissue by previous investigators. L-Glutamate decarboxylase is present in the lumbar spinal cord at least as early as the birth of the first lumbar spinal cord neurons and at least 1-2 days before the initiation of synaptogenesis. (author)

  16. Neuronal Glud1 (glutamate dehydrogenase 1) over-expressing mice: increased glutamate formation and synaptic release, loss of synaptic activity, and adaptive changes in genomic expression.

    Science.gov (United States)

    Michaelis, E K; Wang, X; Pal, R; Bao, X; Hascup, K N; Wang, Y; Wang, W-T; Hui, D; Agbas, A; Choi, I-Y; Belousov, A; Gerhardt, G A

    2011-09-01

    Glutamate dehydrogenase 1 (GLUD1) is a mitochondrial enzyme expressed in all tissues, including brain. Although this enzyme is expressed in glutamatergic pathways, its function as a regulator of glutamate neurotransmitter levels is still not well defined. In order to gain an understanding of the role of GLUD1 in the control of glutamate levels and synaptic release in mammalian brain, we generated transgenic (Tg) mice that over-express this enzyme in neurons of the central nervous system. The Tg mice have increased activity of GLUD, as well as elevated levels and increased synaptic and depolarization-induced release of glutamate. These mice suffer age-associated losses of dendritic spines, nerve terminals, and neurons. The neuronal losses and dendrite structural changes occur in select regions of the brain. At the transcriptional level in the hippocampus, cells respond by increasing the expression of genes related to neurite growth and synapse formation, indications of adaptive or compensatory responses to the effects of increases in the release and action of glutamate at synapses. Because these Tg mice live to a relatively old age they are a good model of the effects of a "hyperglutamatergic" state on the aging process in the nervous system. The mice are also useful in defining the molecular pathways affected by the over-activation of GLUD in glutamatergic neurons of the brain and spinal cord. Copyright © 2011 Elsevier Ltd. All rights reserved.

  17. AMPK Activation Affects Glutamate Metabolism in Astrocytes

    DEFF Research Database (Denmark)

    Voss, Caroline Marie; Pajęcka, Kamilla; Stridh, Malin H

    2015-01-01

    acid (TCA) cycle was studied using high-performance liquid chromatography analysis supplemented with gas chromatography-mass spectrometry technology. It was found that AMPK activation had profound effects on the pathways involved in glutamate metabolism since the entrance of the glutamate carbon...... skeleton into the TCA cycle was reduced. On the other hand, glutamate uptake into the astrocytes as well as its conversion to glutamine catalyzed by glutamine synthetase was not affected by AMPK activation. Interestingly, synthesis and release of citrate, which are hallmarks of astrocytic function, were...

  18. Glutamate transporters combine transporter- and channel-like features

    NARCIS (Netherlands)

    Slotboom, DJ; Konings, WN; Lolkema, JS

    2001-01-01

    Glutamate transporters in the mammalian central nervous system have a unique position among secondary transport proteins as they exhibit glutamate-gated chloride-channel activity in addition to glutamate-transport activity. In this article, the available data on the structure of the glutamate

  19. Metabolic fate and function of dietary glutamate in the gut

    Science.gov (United States)

    Glutamate is a major constituent of dietary protein and is also consumed in many prepared foods as an additive in the form of monosodium glutamate. Evidence from human and animal studies indicates that glutamate is a major oxidative fuel for the gut and that dietary glutamate is extensively metabol...

  20. Emerging aspects of dietary glutamate metabolism in the developing gut

    Science.gov (United States)

    Glutamate is a major constituent of dietary protein and is also consumed in many prepared foods as a flavour additive in the form of monosodium glutamate (MSG). Evidence from human and animal studies indicates that glutamate is the major oxidative fuel for the gut and that dietary glutamate is exten...

  1. Limited diagnostic value of enzyme analysis in patients with mitochondrial tRNA mutations

    DEFF Research Database (Denmark)

    Wibrand, Flemming; Jeppesen, Tina Dysgaard; Frederiksen, Anja L

    2010-01-01

    We evaluated the diagnostic value of respiratory chain (RC) enzyme analysis of muscle in adult patients with mitochondrial myopathy (MM). RC enzyme activity was measured in muscle biopsies from 39 patients who carry either the 3243A>G mutation, other tRNA point mutations, or single, large......, respectively, in these three groups. The results indicate that RC enzyme analysis in muscle is not a sensitive test for MM in adults. In these patients, abnormal muscle histochemistry appears to be a better predictor ofMM....

  2. Alteration of protein function by a silent polymorphism linked to tRNA abundance

    OpenAIRE

    Kirchner, Sebastian; Cai, Zhiwei; Rauscher, Robert; Kastelic, Nicolai; Anding, Melanie; Czech, Andreas; Kleizen, Bertrand; Ostedgaard, Lynda S.; Braakman, Ineke; Sheppard, David N.; Ignatova, Zoya

    2017-01-01

    Synonymous single nucleotide polymorphisms (sSNPs) are considered neutral for protein function, as by definition they exchange only codons, not amino acids. We identified an sSNP that modifies the local translation speed of the cystic fibrosis transmembrane conduc-tance regulator (CFTR), leading to detrimental changes to protein stability and function. This sSNP introduces a codon pairing to a low-abundance tRNA that is particularly rare in human bronchial epithelia, but not in other human ti...

  3. Glutamate Receptor Stimulation Up-Regulates Glutamate Uptake in Human Müller Glia Cells.

    Science.gov (United States)

    López-Colomé, Ana María; López, Edith; Mendez-Flores, Orquidia G; Ortega, Arturo

    2016-07-01

    Glutamate, the main excitatory amino acid in the vertebrate retina, is a well know activator of numerous signal transduction pathways, and has been critically involved in long-term synaptic changes acting through ionotropic and metabotropic glutamate receptors. However, recent findings underlining the importance of intensity and duration of glutamate stimuli for specific neuronal responses, including excitotoxicity, suggest a crucial role for Na(+)-dependent glutamate transporters, responsible for the removal of this neurotransmitter from the synaptic cleft, in the regulation of glutamate-induced signaling. Transporter proteins are expressed in neurons and glia cells, albeit most of glutamate uptake occurs in the glial compartment. Within the retina, Müller glia cells are in close proximity to glutamatergic synapses and participate in the recycling of glutamate through the glutamate/glutamine shuttle. In this context, we decided to investigate a plausible role of glutamate as a regulatory signal for its own transport in human retinal glia cells. To this end, we determined [(3)H]-D-aspartate uptake in cultures of spontaneously immortalized human Müller cells (MIO-M1) exposed to distinct glutamatergic ligands. A time and dose-dependent increase in the transporter activity was detected. This effect was dependent on the activation of the N-methyl D-aspartate subtype of glutamate receptors, due to a dual effect: an increase in affinity and an augmented expression of the transporter at the plasma membrane, as established via biotinylation experiments. Furthermore, a NMDA-dependent association of glutamate transporters with the cystoskeletal proteins ezrin and glial fibrillary acidic protein was also found. These results add a novel mediator of the glutamate transporter modulation and further strengthen the notion of the critical involvement of glia cells in synaptic function.

  4. Construction of a potentiometric glutamate biosensor for determination of glutamate in some real samples.

    Science.gov (United States)

    Y Lmaz, Demet; Karaku, Emine

    2011-12-01

    The potentiometric glutamate biosensor based on ammonium-selective poly(vinylchloride) (PVC) membrane electrode was constructed by chemically immobilizing glutamate oxidase. Ammonium ions produced after an enzymatic reaction were determined potentiometrically. We determined the optimum working conditions of the biosensor such as buffer concentration, buffer pH, lifetime, response time, linear working range, kinetic constants (K(m) and V(max)) of glutamate oxidase enzyme used for biosensor construction values, and other response characteristics. Additionally, glutamate assay in some real samples such as chicken bullion, healthy human serum, and commercial multipower amino acid mixture were also successfully carried out. The results showed good agreement with previously reported values.

  5. Mechanism for the activation of glutamate receptors

    Science.gov (United States)

    Scientists at the NIH have used a technique called cryo-electron microscopy to determine a molecular mechanism for the activation and desensitization of ionotropic glutamate receptors, a prominent class of neurotransmitter receptors in the brain and spina

  6. Biobased synthesis of acrylonitrile from glutamic acid

    NARCIS (Netherlands)

    Notre, le J.E.L.; Scott, E.L.; Franssen, M.C.R.; Sanders, J.P.M.

    2011-01-01

    Glutamic acid was transformed into acrylonitrile in a two step procedure involving an oxidative decarboxylation in water to 3-cyanopropanoic acid followed by a decarbonylation-elimination reaction using a palladium catalyst

  7. Mitochondrial glutamate carriers from Drosophila melanogaster: biochemical, evolutionary and modeling studies.

    Science.gov (United States)

    Lunetti, Paola; Cappello, Anna Rita; Marsano, René Massimiliano; Pierri, Ciro Leonardo; Carrisi, Chiara; Martello, Emanuela; Caggese, Corrado; Dolce, Vincenza; Capobianco, Loredana

    2013-10-01

    The mitochondrial carriers are members of a family of transport proteins that mediate solute transport across the inner mitochondrial membrane. Two isoforms of the glutamate carriers, GC1 and GC2 (encoded by the SLC25A22 and SLC25A18 genes, respectively), have been identified in humans. Two independent mutations in SLC25A22 are associated with severe epileptic encephalopathy. In the present study we show that two genes (CG18347 and CG12201) phylogenetically related to the human GC encoding genes are present in the D. melanogaster genome. We have functionally characterized the proteins encoded by CG18347 and CG12201, designated as DmGC1p and DmGC2p respectively, by overexpression in Escherichia coli and reconstitution into liposomes. Their transport properties demonstrate that DmGC1p and DmGC2p both catalyze the transport of glutamate across the inner mitochondrial membrane. Computational approaches have been used in order to highlight residues of DmGC1p and DmGC2p involved in substrate binding. Furthermore, gene expression analysis during development and in various adult tissues reveals that CG18347 is ubiquitously expressed in all examined D. melanogaster tissues, while the expression of CG12201 is strongly testis-biased. Finally, we identified mitochondrial glutamate carrier orthologs in 49 eukaryotic species in order to attempt the reconstruction of the evolutionary history of the glutamate carrier function. Comparison of the exon/intron structure and other key features of the analyzed orthologs suggests that eukaryotic glutamate carrier genes descend from an intron-rich ancestral gene already present in the common ancestor of lineages that diverged as early as bilateria and radiata. © 2013.

  8. Temperature-sensitive glutamate dehydrogenase mutants of Salmonella typhimurium.

    OpenAIRE

    Dendinger, S M; Brenchley, J E

    1980-01-01

    Mutants of Salmonella typhimurium defective in glutamate dehydrogenase activity were isolated in parent strains lacking glutamate synthase activity by localizcd mutagenesis or by a general mutagenesis combined with a cycloserine enrichment for glutamate auxotrophs. Two mutants with temperature-sensitive phenotypes had glutamate dehydrogenase activities that were more thermolabile than that of an isogenic control strain. Eight other mutants had less than 10% of the wild-type glutamate dehydrog...

  9. Intracellular synthesis of glutamic acid in Bacillus methylotrophicus SK19.001, a glutamate-independent poly(γ-glutamic acid)-producing strain.

    Science.gov (United States)

    Peng, Yingyun; Zhang, Tao; Mu, Wanmeng; Miao, Ming; Jiang, Bo

    2016-01-15

    Bacillus methylotrophicus SK19.001 is a glutamate-independent strain that produces poly(γ-glutamic acid) (γ-PGA), a polymer of D- and L-glutamic acids that possesses applications in food, the environment, agriculture, etc. This study was undertaken to explore the synthetic pathway of intracellular L- and D-glutamic acid in SK19.001 by investigating the effects of tricarboxylic acid cycle intermediates and different amino acids as metabolic precursors on the production of γ-PGA and analyzing the activities of the enzymes involved in the synthesis of L- and D-glutamate. Tricarboxylic acid cycle intermediates and amino acids could participate in the synthesis of γ-PGA via independent pathways in SK19.001. L-Aspartate aminotransferase, L-glutaminase and L-glutamate synthase were the enzymatic sources of L-glutamate. Glutamate racemase was responsible for the formation of D-glutamate for the synthesis of γ-PGA, and the synthetase had stereoselectivity for glutamate substrate. The enzymatic sources of L-glutamate were investigated for the first time in the glutamate-independent γ-PGA-producing strain, and multiple enzymatic sources of L-glutamate were verified in SK19.001, which will benefit efforts to improve production of γ-PGA with metabolic engineering strategies. © 2015 Society of Chemical Industry.

  10. New pleiotropic effects of eliminating a rare tRNA from Streptomyces coelicolor, revealed by combined proteomic and transcriptomic analysis of liquid cultures

    Directory of Open Access Journals (Sweden)

    Hotchkiss Graham

    2007-08-01

    Full Text Available Abstract Background In Streptomyces coelicolor, bldA encodes the only tRNA for a rare leucine codon, UUA. This tRNA is unnecessary for growth, but is required for some aspects of secondary metabolism and morphological development. We describe a transcriptomic and proteomic analysis of the effects of deleting bldA on cellular processes during submerged culture: conditions relevant to the industrial production of antibiotics. Results At the end of rapid growth, a co-ordinated transient up-regulation of about 100 genes, including many for ribosomal proteins, was seen in the parent strain but not the ΔbldA mutant. Increased basal levels of the signal molecule ppGpp in the mutant strain may be responsible for this difference. Transcripts or proteins from a further 147 genes classified as bldA-influenced were mostly expressed late in culture in the wild-type, though others were significantly transcribed during exponential growth. Some were involved in the biosynthesis of seven secondary metabolites; and some have probable roles in reorganising metabolism after rapid growth. Many of the 147 genes were "function unknown", and may represent unknown aspects of Streptomyces biology. Only two of the 147 genes contain a TTA codon, but some effects of bldA could be traced to TTA codons in regulatory genes or polycistronic operons. Several proteins were affected post-translationally by the bldA deletion. There was a statistically significant but weak positive global correlation between transcript and corresponding protein levels. Different technical limitations of the two approaches were a major cause of discrepancies in the results obtained with them. Conclusion Although deletion of bldA has very conspicuous effects on the gross phenotype, the bldA molecular phenotype revealed by the "dualomic" approach has shown that only about 2% of the genome is affected; but this includes many previously unknown effects at a variety of different levels, including post

  11. Glutamine, glutamate, and arginine-based acid resistance in Lactobacillus reuteri.

    Science.gov (United States)

    Teixeira, Januana S; Seeras, Arisha; Sanchez-Maldonado, Alma Fernanda; Zhang, Chonggang; Su, Marcia Shu-Wei; Gänzle, Michael G

    2014-09-01

    This study aimed to determine whether glutamine deamidation improves acid resistance of Lactobacillus reuteri, and to assess whether arginine, glutamine, and glutamate-mediated acid resistance are redundant or complementary mechanisms of acid resistance. Three putative glutaminase genes, gls1, gls2, and gls3, were identified in L. reuteri 100-23. All three genes were expressed during growth in mMRS and wheat sourdough. L. reuteri consistently over-expressed gls3 and the glutamate decarboxylase gadB. L. reuteri 100-23ΔgadB over-expressed gls3 and the arginine deiminase gene adi. Analysis of the survival of L. reuteri in acidic conditions revealed that arginine conversion is effective at pH of 3.5 while glutamine or glutamate conversion were effective at pH of 2.5. Arginine conversion increased the pHin but not ΔΨ; glutamate decarboxylation had only a minor effect on the pHin but increased the ΔΨ. This study demonstrates that glutamine deamidation increases the acid resistance of L. reuteri independent of glutamate decarboxylase activity. Arginine and glutamine/glutamate conversions confer resistance to lactate at pH of 3.5 and phosphate at pH of 2.5, respectively. Knowledge of L. reuteri's acid resistance improves the understanding of the adaptation of L. reuteri to intestinal ecosystems, and facilitates the selection of probiotic and starter cultures. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. The frequency of translational misreading errors in E. coli is largely determined by tRNA competition

    Science.gov (United States)

    Kramer, Emily B.; Farabaugh, Philip J.

    2007-01-01

    Estimates of missense error rates (misreading) during protein synthesis vary from 10−3 to 10−4 per codon. The experiments reporting these rates have measured several distinct errors using several methods and reporter systems. Variation in reported rates may reflect real differences in rates among the errors tested or in sensitivity of the reporter systems. To develop a more accurate understanding of the range of error rates, we developed a system to quantify the frequency of every possible misreading error at a defined codon in Escherichia coli. This system uses an essential lysine in the active site of firefly luciferase. Mutations in Lys529 result in up to a 1600-fold reduction in activity, but the phenotype varies with amino acid. We hypothesized that residual activity of some of the mutant genes might result from misreading of the mutant codons by tRNALys UUUU, the cognate tRNA for the lysine codons, AAA and AAG. Our data validate this hypothesis and reveal details about relative missense error rates of near-cognate codons. The error rates in E. coli do, in fact, vary widely. One source of variation is the effect of competition by cognate tRNAs for the mutant codons; higher error frequencies result from lower competition from low-abundance tRNAs. We also used the system to study the effect of ribosomal protein mutations known to affect error rates and the effect of error-inducing antibiotics, finding that they affect misreading on only a subset of near-cognate codons and that their effect may be less general than previously thought. PMID:17095544

  13. Structure and Activity of an Aminoacyl-tRNA Synthetase that Charges tRNA with Nitro-Tryptophan

    Energy Technology Data Exchange (ETDEWEB)

    Buddha,M.; Crane, B.

    2005-01-01

    The most divergent of two tryptophanyl tRNA synthetases (TrpRS II) found in Deinococcus radiodurans interacts with a nitric oxide synthase protein that produces 4-nitro-tryptophan (4-NRP). TrpRS II efficiently charges transfer RNATrp with 4-NRP and 5-hydroxy-tryptophan (5-HRP). The crystal structures of TrpRS II bound to tryptophan and 5-HRP reveal residue substitutions that accommodate modified indoles. A class of auxiliary bacterial TrpRSs conserve this capacity to charge tRNA with nonstandard amino acids.

  14. tRNA Derived smallRNAs: smallRNAs Repertoire Has Yet to Be Decoded in Plants

    Directory of Open Access Journals (Sweden)

    Gaurav Sablok

    2017-07-01

    Full Text Available Among several smallRNAs classes, microRNAs play an important role in controlling the post-transcriptional events. Next generation sequencing has played a major role in extending the landscape of miRNAs and revealing their spatio-temporal roles in development and abiotic stress. Lateral evolution of these smallRNAs classes have widely been seen with the recently emerging knowledge on tRNA derived smallRNAs. In the present perspective, we discussed classification, identification and roles of tRNA derived smallRNAs across plants and their potential involvement in abiotic and biotic stresses.

  15. Orthogonal use of a human tRNA synthetase active site to achieve multi-functionality

    Science.gov (United States)

    Zhou, Quansheng; Kapoor, Mili; Guo, Min; Belani, Rajesh; Xu, Xiaoling; Kiosses, William B.; Hanan, Melanie; Park, Chulho; Armour, Eva; Do, Minh-Ha; Nangle, Leslie A.; Schimmel, Paul; Yang, Xiang-Lei

    2011-01-01

    Protein multi-functionality is an emerging explanation for the complexity of higher organisms. In this regard, while aminoacyl tRNA synthetases catalyze amino acid activation for protein synthesis, some also act in pathways for inflammation, angiogenesis, and apoptosis. How multiple functions evolved and their relationship to the active site is not clear. Here structural modeling analysis, mutagenesis, and cell-based functional studies show that the potent angiostatic, natural fragment of human TrpRS associates via Trp side chains that protrude from the cognate cellular receptor VE-cadherin. Modeling indicates that (I prefer the way it was because the conclusion was reached not only by modeling, but more so by experimental studies.)VE-cadherin Trp side chains fit into the Trp-specific active site of the synthetase. Thus, specific side chains of the receptor mimic (?) amino acid substrates and expand the functionality of the active site of the synthetase. We propose that orthogonal use of the same active site may be a general way to develop multi-functionality of human tRNA synthetases and other proteins. PMID:20010843

  16. Immunopurification of the suppressor tRNA dependent rabbit β-globin readthrough protein

    International Nuclear Information System (INIS)

    Hatfield, D.; Thorgeirsson, S.S.; Copeland, T.D.; Oroszlan, S.; Bustin, M.

    1988-01-01

    In mammalian cells, the rabbit β-globin readthrough protein is the only known example of a naturally occurring readthrough protein which does not involve a viral system. To provide an efficient means for its isolation, detection, and study, the authors elicited specific antibodies against this unique protein. The 22 amino acid peptide corresponding to the readthrough portion of this protein was synthesized, coupled to keyhole limpet hemocyanin, and injected into sheep. Specific antibodies to the peptide were produced as demonstrated by the enzyme-linked immunosorbent assay technique and by immunoblotting. The antibodies did not react with globin. The rabbit β-globin readthrough protein was separated from globin and other reticulocyte proteins by polyacrylamide gel electrophoresis and visualized by silver staining or by labeling with [ 35 S] methionine. Incorporation of [ 35 S] methionine into the readthrough protein was significantly enhanced upon addition of an opal suppressor tRNA to reticulocyte lysates. Immunoblotting revealed that the readthrough protein also occurs in lysates without added suppressor tRNA. The antibodies were purified on an affi-gel column which had been coupled with the peptide antigen. The readthrough protein was then purified from reticulocytes by immunoaffinity chromatography and by high-performance liquid chromatography. The results provide conclusive evidence that the β-globin readthrough protein is naturally occurring in rabbit reticulocytes

  17. 2'-O-methylation in mRNA disrupts tRNA decoding during translation elongation.

    Science.gov (United States)

    Choi, Junhong; Indrisiunaite, Gabriele; DeMirci, Hasan; Ieong, Ka-Weng; Wang, Jinfan; Petrov, Alexey; Prabhakar, Arjun; Rechavi, Gideon; Dominissini, Dan; He, Chuan; Ehrenberg, Måns; Puglisi, Joseph D

    2018-03-01

    Chemical modifications of mRNA may regulate many aspects of mRNA processing and protein synthesis. Recently, 2'-O-methylation of nucleotides was identified as a frequent modification in translated regions of human mRNA, showing enrichment in codons for certain amino acids. Here, using single-molecule, bulk kinetics and structural methods, we show that 2'-O-methylation within coding regions of mRNA disrupts key steps in codon reading during cognate tRNA selection. Our results suggest that 2'-O-methylation sterically perturbs interactions of ribosomal-monitoring bases (G530, A1492 and A1493) with cognate codon-anticodon helices, thereby inhibiting downstream GTP hydrolysis by elongation factor Tu (EF-Tu) and A-site tRNA accommodation, leading to excessive rejection of cognate aminoacylated tRNAs in initial selection and proofreading. Our current and prior findings highlight how chemical modifications of mRNA tune the dynamics of protein synthesis at different steps of translation elongation.

  18. Cross-Talk between Dnmt2-Dependent tRNA Methylation and Queuosine Modification

    Directory of Open Access Journals (Sweden)

    Ann E. Ehrenhofer-Murray

    2017-02-01

    Full Text Available Enzymes of the Dnmt2 family of methyltransferases have yielded a number of unexpected discoveries. The first surprise came more than ten years ago when it was realized that, rather than being DNA methyltransferases, Dnmt2 enzymes actually are transfer RNA (tRNA methyltransferases for cytosine-5 methylation, foremost C38 (m5C38 of tRNAAsp. The second unanticipated finding was our recent discovery of a nutritional regulation of Dnmt2 in the fission yeast Schizosaccharomyces pombe. Significantly, the presence of the nucleotide queuosine in tRNAAsp strongly stimulates Dnmt2 activity both in vivo and in vitro in S. pombe. Queuine, the respective base, is a hypermodified guanine analog that is synthesized from guanosine-5’-triphosphate (GTP by bacteria. Interestingly, most eukaryotes have queuosine in their tRNA. However, they cannot synthesize it themselves, but rather salvage it from food or from gut microbes. The queuine obtained from these sources comes from the breakdown of tRNAs, where the queuine ultimately was synthesized by bacteria. Queuine thus has been termed a micronutrient. This review summarizes the current knowledge of Dnmt2 methylation and queuosine modification with respect to translation as well as the organismal consequences of the absence of these modifications. Models for the functional cooperation between these modifications and its wider implications are discussed.

  19. The complete mitochondrial genome sequence of the hydrothermal vent galatheid crab Shinkaia crosnieri (Crustacea: Decapoda: Anomura: A novel arrangement and incomplete tRNA suite

    Directory of Open Access Journals (Sweden)

    Yang Jin-Shu

    2008-05-01

    Full Text Available Abstract Background Metazoan mitochondrial genomes usually consist of the same 37 genes. Such genes contain useful information for phylogenetic analyses and evolution modelling. Although complete mitochondrial genomes have been determined for over 1,000 animals to date, hydrothermal vent species have, thus far, remained excluded due to the scarcity of collected specimens. Results The mitochondrial genome of the hydrothermal vent galatheid crab Shinkaia crosnieri is 15,182 bp in length, and is composed of 13 protein-coding genes, two ribosomal RNA genes and only 18 transfer RNA genes. The total AT content of the genome, as is typical for decapods, is 72.9%. We identified a non-coding control region of 327 bp according to its location and AT-richness. This is the smallest control region discovered in crustaceans so far. A mechanism of cytoplasmic tRNA import was addressed to compensate for the four missing tRNAs. The S. crosnieri mitogenome exhibits a novel arrangement of mitochondrial genes. We investigated the mitochondrial gene orders and found that at least six rearrangements from the ancestral pancrustacean (crustacean + hexapod pattern have happened successively. The codon usage, nucleotide composition and bias show no substantial difference with other decapods. Phylogenetic analyses using the concatenated nucleotide and amino acid sequences of the 13 protein-coding genes prove consistent with the previous classification based upon their morphology. Conclusion The present study will supply considerable data of use for both genomic and evolutionary research on hydrothermal vent ecosystems. The mitochondrial genetic characteristics of decapods are sustained in this case of S. crosnieri despite the absence of several tRNAs and a number of dramatic rearrangements. Our results may provide evidence for the immigrating hypothesis about how vent species originate.

  20. The complete mitochondrial genome sequence of the hydrothermal vent galatheid crab Shinkaia crosnieri (Crustacea: Decapoda: Anomura): a novel arrangement and incomplete tRNA suite.

    Science.gov (United States)

    Yang, Jin-Shu; Nagasawa, Hiromichi; Fujiwara, Yoshihiro; Tsuchida, Shinji; Yang, Wei-Jun

    2008-05-30

    Metazoan mitochondrial genomes usually consist of the same 37 genes. Such genes contain useful information for phylogenetic analyses and evolution modelling. Although complete mitochondrial genomes have been determined for over 1,000 animals to date, hydrothermal vent species have, thus far, remained excluded due to the scarcity of collected specimens. The mitochondrial genome of the hydrothermal vent galatheid crab Shinkaia crosnieri is 15,182 bp in length, and is composed of 13 protein-coding genes, two ribosomal RNA genes and only 18 transfer RNA genes. The total AT content of the genome, as is typical for decapods, is 72.9%. We identified a non-coding control region of 327 bp according to its location and AT-richness. This is the smallest control region discovered in crustaceans so far. A mechanism of cytoplasmic tRNA import was addressed to compensate for the four missing tRNAs. The S. crosnieri mitogenome exhibits a novel arrangement of mitochondrial genes. We investigated the mitochondrial gene orders and found that at least six rearrangements from the ancestral pancrustacean (crustacean + hexapod) pattern have happened successively. The codon usage, nucleotide composition and bias show no substantial difference with other decapods. Phylogenetic analyses using the concatenated nucleotide and amino acid sequences of the 13 protein-coding genes prove consistent with the previous classification based upon their morphology. The present study will supply considerable data of use for both genomic and evolutionary research on hydrothermal vent ecosystems. The mitochondrial genetic characteristics of decapods are sustained in this case of S. crosnieri despite the absence of several tRNAs and a number of dramatic rearrangements. Our results may provide evidence for the immigrating hypothesis about how vent species originate.

  1. Reducing lactate secretion by ldhA Deletion in L-glutamate- producing strain Corynebacterium glutamicum GDK-9.

    Science.gov (United States)

    Zhang, Dalong; Guan, Dan; Liang, Jingbo; Guo, Chunqian; Xie, Xixian; Zhang, Chenglin; Xu, Qingyang; Chen, Ning

    2014-01-01

    L-lactate is one of main byproducts excreted in to the fermentation medium. To improve L-glutamate production and reduce L-lactate accumulation, L-lactate dehydrogenase-encoding gene ldhA was knocked out from L-glutamate producing strain Corynebacterium glutamicum GDK-9, designated GDK-9ΔldhA. GDK-9ΔldhA produced approximately 10.1% more L-glutamate than the GDK-9, and yielded lower levels of such by-products as α-ketoglutarate, L-lactate and L-alanine. Since dissolved oxygen (DO) is one of main factors affecting L-lactate formation during L-glutamate fermentation, we investigated the effect of ldhA deletion from GDK-9 under different DO conditions. Under both oxygen-deficient and high oxygen conditions, L-glutamate production by GDK-9ΔldhA was not higher than that of the GDK-9. However, under micro-aerobic conditions, GDK-9ΔldhA exhibited 11.61% higher L-glutamate and 58.50% lower L-alanine production than GDK-9. Taken together, it is demonstrated that deletion of ldhA can enhance L-glutamate production and lower the unwanted by-products concentration, especially under micro-aerobic conditions.

  2. Polyamines Are Critical for the Induction of the Glutamate Decarboxylase-dependent Acid Resistance System in Escherichia coli *

    Science.gov (United States)

    Chattopadhyay, Manas K.; Tabor, Herbert

    2013-01-01

    As part of our studies on the biological functions of polyamines, we have used a mutant of Escherichia coli that lacks all the genes for polyamine biosynthesis for a global transcriptional analysis on the effect of added polyamines. The most striking early response to the polyamine addition is the increased expression of the genes for the glutamate-dependent acid resistance system (GDAR) that is important for the survival of the bacteria when passing through the acid environment of the stomach. Not only were the two genes for glutamate decarboxylases (gadA and gadB) and the gene for glutamate-γ-aminobutyrate antiporter (gadC) induced by the polyamine addition, but the various genes involved in the regulation of this system were also induced. We confirmed the importance of polyamines for the induction of the GDAR system by direct measurement of glutamate decarboxylase activity and acid survival. The effect of deletions of the regulatory genes on the GDAR system and the effects of overproduction of two of these genes were also studied. Strikingly, overproduction of the alternative σ factor rpoS and of the regulatory gene gadE resulted in very high levels of glutamate decarboxylase and almost complete protection against acid stress even in the absence of any polyamines. Thus, these data show that a major function of polyamines in E. coli is protection against acid stress by increasing the synthesis of glutamate decarboxylase, presumably by increasing the levels of the rpoS and gadE regulators. PMID:24097985

  3. Systematic analyses of glutamine and glutamate metabolisms across different cancer types.

    Science.gov (United States)

    Tian, Yuan; Du, Wei; Cao, Sha; Wu, Yue; Dong, Ning; Wang, Yan; Xu, Ying

    2017-11-07

    Glutamine and glutamate are known to play important roles in cancer biology. However, no detailed information is available in terms of their levels of involvement in various biological processes across different cancer types, whereas such knowledge could be critical for understanding the distinct characteristics of different cancer types. Our computational study aimed to examine the functional roles of glutamine and glutamate across different cancer types. We conducted a comparative analysis of gene expression data of cancer tissues versus normal control tissues of 11 cancer types to understand glutamine and glutamate metabolisms in cancer. Specifically, we developed a linear regression model to assess differential contributions by glutamine and/or glutamate to each of seven biological processes in cancer versus control tissues. While our computational predictions were consistent with some of the previous observations, multiple novel predictions were made: (1) glutamine is generally not involved in purine synthesis in cancer except for breast cancer, and is similarly not involved in pyridine synthesis except for kidney cancer; (2) glutamine is generally not involved in ATP production in cancer; (3) glutamine's contribution to nucleotide synthesis is minimal if any in cancer; (4) glutamine is not involved in asparagine synthesis in cancer except for bladder and lung cancers; and (5) glutamate does not contribute to serine synthesis except for bladder cancer. We comprehensively predicted the roles of glutamine and glutamate metabolisms in selected metabolic pathways in cancer tissues versus control tissues, which may lead to novel approaches to therapeutic development targeted at glutamine and/or glutamate metabolism. However, our predictions need further functional validation.

  4. The application of glutamic acid alpha-decarboxylase for the valorization of glutamic acid

    NARCIS (Netherlands)

    Lammens, T.M.; Biase, De Daniela; Franssen, M.C.R.; Scott, E.L.; Sanders, J.P.M.

    2009-01-01

    Glutamic acid is an important constituent of waste streams from biofuels production. It is an interesting starting material for the synthesis of nitrogen containing bulk chemicals, thereby decreasing the dependency on fossil fuels. On the pathway from glutamic acid to a range of molecules, the

  5. The Degradation of 14C-Glutamic Acid by L-Glutamic Acid Decarboxylase.

    Science.gov (United States)

    Dougherty, Charles M; Dayan, Jean

    1982-01-01

    Describes procedures and semi-micro reaction apparatus (carbon dioxide trap) to demonstrate how a particular enzyme (L-Glutamic acid decarboxylase) may be used to determine the site or sites of labeling in its substrate (carbon-14 labeled glutamic acid). Includes calculations, solutions, and reagents used. (Author/SK)

  6. Examining tRNA 3'-ends inEscherichia coli: teamwork between CCA-adding enzyme, RNase T, and RNase R.

    Science.gov (United States)

    Wellner, Karolin; Czech, Andreas; Ignatova, Zoya; Betat, Heike; Mörl, Mario

    2018-03-01

    tRNA maturation and quality control are crucial for proper functioning of these transcripts in translation. In several organisms, defective tRNAs were shown to be tagged by poly(A) or CCACCA tails and subsequently degraded by 3'-exonucleases. In a deep-sequencing analysis of tRNA 3'-ends, we detected the CCACCA tag also in Escherichia coli However, this tag closely resembles several 3'-trailers of tRNA precursors targeted for maturation and not for degradation. Here, we investigate the ability of two important exonucleases, RNase R and RNase T, to distinguish tRNA precursors with a native 3'-trailer from tRNAs with a CCACCA tag. Our results show that the degrading enzyme RNase R breaks down both tRNAs primed for degradation as well as precursor transcripts, indicating that it is a rather nonspecific RNase. RNase T, a main processing exonuclease involved in trimming of 3'-trailers, is very inefficient in converting the CCACCA-tagged tRNA into a mature transcript. Hence, while both RNases compete for trailer-containing tRNA precursors, the inability of RNase T to process CCACCA tails ensures that defective tRNAs cannot reenter the functional tRNA pool, representing a safeguard to avoid detrimental effects of tRNAs with erroneous integrity on protein synthesis. Furthermore, these data indicate that the RNase T-mediated end turnover of the CCA sequence represents a means to deliver a tRNA to a repeated quality control performed by the CCA-adding enzyme. Hence, originally described as a futile side reaction, the tRNA end turnover seems to fulfill an important function in the maintenance of the tRNA pool in the cell. © 2018 Wellner et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  7. A Novel Amperometric Glutamate Biosensor Based on Glutamate Oxidase Adsorbed on Silicalite

    Science.gov (United States)

    Soldatkina, O. V.; Soldatkin, O. O.; Kasap, B. Ozansoy; Kucherenko, D. Yu.; Kucherenko, I. S.; Kurc, B. Akata; Dzyadevych, S. V.

    2017-04-01

    In this work, we developed a new amperometric biosensor for glutamate detection using a typical method of glutamate oxidase (GlOx) immobilization via adsorption on silicalite particles. The disc platinum electrode ( d = 0.4 mm) was used as the amperometric sensor. The procedure of biosensor preparation was optimized. The main parameters of modifying amperometric transducers with a silicalite layer were determined along with the procedure of GlOx adsorption on this layer. The biosensors based on GlOx adsorbed on silicalite demonstrated high sensitivity to glutamate. The linear range of detection was from 2.5 to 450 μM, and the limit of glutamate detection was 1 μM. It was shown that the proposed biosensors were characterized by good response reproducibility during hours of continuous work and operational stability for several days. The developed biosensors could be applied for determination of glutamate in real samples.

  8. Purification and characterization of gamma poly glutamic acid from newly Bacillus licheniformis NRC20.

    Science.gov (United States)

    Tork, Sanaa E; Aly, Magda M; Alakilli, Saleha Y; Al-Seeni, Madeha N

    2015-03-01

    γ-poly glutamic acid (γ-PGA) has received considerable attention for pharmaceutical and biomedical applications. γ-PGA from the newly isolate Bacillus licheniformis NRC20 was purified and characterized using diffusion distance agar plate, mass spectrometry and thin layer chromatography. All analysis indicated that γ-PGA is a homopolymer composed of glutamic acid. Its molecular weight was determined to be 1266 kDa. It was composed of L- and D-glutamic acid residues. An amplicon of 3050 represents the γ-PGA-coding genes was obtained, sequenced and submitted in genbank database. Its amino acid sequence showed high similarity with that obtained from B. licheniformis strains. The bacterium NRC 20 was independent of L-glutamic acid but the polymer production enhanced when cultivated in medium containing L-glutamic acid as the sole nitrogen source. Finally we can conclude that γ-PGA production from B. licheniformis NRC20 has many promised applications in medicine, industry and nanotechnology. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Glutamate uptake is important for osmoregulation and survival in the rice pathogen Burkholderia glumae.

    Directory of Open Access Journals (Sweden)

    Yongsung Kang

    Full Text Available Bacteria exhibit an optimal growth rate in culture media with sufficient nutrients at an optimal temperature and pH. In addition, the concentration of solutes plays a critical role in bacterial growth and survival. Glutamate is known to be a major anionic solute involved in osmoregulation and the bacterial cell's response to changes in solute concentration. To determine how glutamate uptake is involved in osmoregulation in the rice bacterial pathogen Burkholderia glumae BGR1, we mutated the gltI gene encoding a periplasmic substrate binding protein of a glutamate transport system to abolish glutamate uptake, and monitored the growth of the gltI null mutant in Luria-Bertani medium. We found that the gltI null mutant showed a slower growth rate than the wild-type strain and experienced hyperosmotic stress resulting in water loss from the cytoplasm in stationary phase. When the incubation time was extended, the mutant population collapsed due to the hyperosmotic stress. The gltI null mutant exhibited loss of adaptability under both hypoosmotic and hyperosmotic stresses. The growth rate of the gltI null mutant was restored to the level of wild-type growth by exogenous addition of glycine betaine to the culture medium, indicating that glycine betaine is a compatible solute in B. glumae. These results indicate that glutamate uptake from the environment plays a key role in osmoregulation in B. glumae.

  10. Several RNase T2 enzymes function in induced tRNA and rRNA turnover in the ciliate Tetrahymena

    DEFF Research Database (Denmark)

    Andersen, Kasper Langebjerg; Collins, Kathleen

    2012-01-01

    RNA fragments continued to accumulate, with only a minor change in fragment profile in one strain. We therefore generated strains lacking pairwise combinations of the top three candidates for Rnt2 tRNases. Each of these strains showed a distinct starvation-specific profile of tRNA and rRNA fragment accumulation...

  11. N(6)-methyladenosine in mRNA disrupts tRNA selection and translation-elongation dynamics.

    Science.gov (United States)

    Choi, Junhong; Ieong, Ka-Weng; Demirci, Hasan; Chen, Jin; Petrov, Alexey; Prabhakar, Arjun; O'Leary, Seán E; Dominissini, Dan; Rechavi, Gideon; Soltis, S Michael; Ehrenberg, Måns; Puglisi, Joseph D

    2016-02-01

    N(6)-methylation of adenosine (forming m(6)A) is the most abundant post-transcriptional modification within the coding region of mRNA, but its role during translation remains unknown. Here, we used bulk kinetic and single-molecule methods to probe the effect of m(6)A in mRNA decoding. Although m(6)A base-pairs with uridine during decoding, as shown by X-ray crystallographic analyses of Thermus thermophilus ribosomal complexes, our measurements in an Escherichia coli translation system revealed that m(6)A modification of mRNA acts as a barrier to tRNA accommodation and translation elongation. The interaction between an m(6)A-modified codon and cognate tRNA echoes the interaction between a near-cognate codon and tRNA, because delay in tRNA accommodation depends on the position and context of m(6)A within codons and on the accuracy level of translation. Overall, our results demonstrate that chemical modification of mRNA can change translational dynamics.

  12. In vitro studies on tRNA annealing and reverse transcription with mutant HIV-1 RNA templates

    NARCIS (Netherlands)

    Beerens, N.; Berkhout, B.

    2000-01-01

    The human immunodeficiency virus type 1 (HIV-1) RNA genome encodes a semistable stem-loop structure, the U5-PBS hairpin, which occludes part of the tRNA primer binding site (PBS). In previous studies, we demonstrated that mutations that alter the stability of the U5-PBS hairpin inhibit virus

  13. An entropy based analysis of the relationship between the DOW JONES Index and the TRNA Sentiment series

    NARCIS (Netherlands)

    D.E. Allen (David); M.J. McAleer (Michael); A.K. Singh (Abhay)

    2016-01-01

    textabstractThis paper features an analysis of the relationship between the DOW JONES Industrial Average Index (DJIA) and a sentiment news series using daily data obtained from the Thomson Reuters News Analytics (TRNA)1 provided by SIRCA (The Securities Industry Research Centre of the Asia Pacic).

  14. The nucleotide sequence of histidine tRNA gamma of Drosophila melanogaster.

    OpenAIRE

    Altwegg, M; Kubli, E

    1980-01-01

    The nucleotide sequence of D. melanogaster histidine tRNA gamma was determined to be: pG-G-C-C-G-U-G-A-U-C-G-U-C-psi-A-G-D-G-G-D-D-A-G-G-A-C-C-C-C-A-C-G-psi-U-G-U-G- m1G-C-C-G-U-G-G-U-A-A-C-C-m5C-A-G-G-U-psi-C-G-m1A-A-U-C-C-U-G-G-U-C-A-C-G-G-m5C -A-C-C-AOH. An additional unpaired G is found at the 5' end, and the T in the TpsiC loop is replaced by a U.

  15. Integrated Analysis of the Transcriptome and Metabolome of Corynebacterium glutamicum during Penicillin-Induced Glutamic Acid Production.

    Science.gov (United States)

    Hirasawa, Takashi; Saito, Masaki; Yoshikawa, Katsunori; Furusawa, Chikara; Shmizu, Hiroshi

    2018-01-11

    Corynebacterium glutamicum is known for its ability to produce glutamic acid and has been utilized for the fermentative production of various amino acids. Glutamic acid production in C. glutamicum is induced by penicillin. In this study, the transcriptome and metabolome of C. glutamicum is analyzed to understand the mechanism of penicillin-induced glutamic acid production. Transcriptomic analysis with DNA microarray revealed that expression of some glycolysis- and TCA cycle-related genes, which include those encoding the enzymes involved in conversion of glucose to 2-oxoglutaric acid, is upregulated after penicillin addition. Meanwhile, expression of some TCA cycle-related genes, encoding the enzymes for conversion of 2-oxoglutaric acid to oxaloacetic acid, and the anaplerotic reactions decreased. In addition, expression of NCgl1221 and odhI, encoding proteins involved in glutamic acid excretion and inhibition of the 2-oxoglutarate dehydrogenase, respectively, is upregulated. Functional category enrichment analysis of genes upregulated and downregulated after penicillin addition revealed that genes for signal transduction systems are enriched among upregulated genes, whereas those for energy production and carbohydrate and amino acid metabolisms are enriched among the downregulated genes. As for the metabolomic analysis using capillary electrophoresis time-of-flight mass spectrometry, the intracellular content of most metabolites of the glycolysis and the TCA cycle decreased dramatically after penicillin addition. Overall, these results indicate that the cellular metabolism and glutamic acid excretion are mainly optimized at the transcription level during penicillin-induced glutamic acid production by C. glutamicum. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Simulating movement of tRNA through the ribosome during hybrid-state formation.

    Science.gov (United States)

    Whitford, Paul C; Sanbonmatsu, Karissa Y

    2013-09-28

    Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

  17. Formation of tRNA granules in the nucleus of heat-induced human cells

    Energy Technology Data Exchange (ETDEWEB)

    Miyagawa, Ryu [Radioisotope Center, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan); Department of Biological Science, Graduate School of Science, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8654 (Japan); Mizuno, Rie [Radioisotope Center, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan); Watanabe, Kazunori, E-mail: watanabe@ric.u-tokyo.ac.jp [Radioisotope Center, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan); Ijiri, Kenichi [Radioisotope Center, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan); Department of Biological Science, Graduate School of Science, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8654 (Japan)

    2012-02-03

    Highlights: Black-Right-Pointing-Pointer tRNAs are tranlocated into the nucleus in heat-induced HeLa cells. Black-Right-Pointing-Pointer tRNAs form the unique granules in the nucleus. Black-Right-Pointing-Pointer tRNA ganules overlap with nuclear stress granules. -- Abstract: The stress response, which can trigger various physiological phenomena, is important for living organisms. For instance, a number of stress-induced granules such as P-body and stress granule have been identified. These granules are formed in the cytoplasm under stress conditions and are associated with translational inhibition and mRNA decay. In the nucleus, there is a focus named nuclear stress body (nSB) that distinguishes these structures from cytoplasmic stress granules. Many splicing factors and long non-coding RNA species localize in nSBs as a result of stress. Indeed, tRNAs respond to several kinds of stress such as heat, oxidation or starvation. Although nuclear accumulation of tRNAs occurs in starved Saccharomyces cerevisiae, this phenomenon is not found in mammalian cells. We observed that initiator tRNA{sup Met} (Meti) is actively translocated into the nucleus of human cells under heat stress. During this study, we identified unique granules of Meti that overlapped with nSBs. Similarly, elongator tRNA{sup Met} was translocated into the nucleus and formed granules during heat stress. Formation of tRNA granules is closely related to the translocation ratio. Then, all tRNAs may form the specific granules.

  18. Monosodium glutamate for simple photometric iron analysis

    Science.gov (United States)

    Prasetyo, E.

    2018-01-01

    Simple photometric method for iron analysis using monosodium glutamate (MSG) was proposed. The method could be used as an alternative method, which was technically simple, economic, quantitative, readily available, scientifically sound and environmental friendly. Rapid reaction of iron (III) with glutamate in sodium chloride-hydrochloric acid buffer (pH 2) to form red-brown complex was served as a basis in the photometric determination, which obeyed the range of iron (III) concentration 1.6 – 80 µg/ml. This method could be applied to determine iron concentration in soil with satisfactory results (accuracy and precision) compared to other photometric and atomic absorption spectrometry results.

  19. The structure of glutamate transporters shows channel-like features

    NARCIS (Netherlands)

    Slotboom, DJ; Konings, WN; Lolkema, JS

    2001-01-01

    Neuronal and glial glutamate transporters remove the excitatory neurotransmitter glutamate from the synaptic cleft and thus prevent neurotoxicity, The proteins belong to a large family of secondary transporters, which includes transporters from a variety of bacterial, archaeal and eukaryotic

  20. Familial dysautonomia (FD) patients have reduced levels of the modified wobble nucleoside mcm(5)s(2)U in tRNA.

    Science.gov (United States)

    Karlsborn, Tony; Tükenmez, Hasan; Chen, Changchun; Byström, Anders S

    2014-11-21

    Familial dysautonomia (FD) is a recessive neurodegenerative genetic disease. FD is caused by a mutation in the IKBKAP gene resulting in a splicing defect and reduced levels of full length IKAP protein. IKAP homologues can be found in all eukaryotes and are part of a conserved six subunit protein complex, Elongator complex. Inactivation of any Elongator subunit gene in multicellular organisms cause a wide range of phenotypes, suggesting that Elongator has a pivotal role in several cellular processes. In yeast, there is convincing evidence that the main role of Elongator complex is in formation of modified wobble uridine nucleosides in tRNA and that their absence will influence translational efficiency. To date, no study has explored the possibility that FD patients display defects in formation of modified wobble uridine nucleosides as a consequence of reduced IKAP levels. In this study, we show that brain tissue and fibroblast cell lines from FD patients have reduced levels of the wobble uridine nucleoside 5-methoxycarbonylmethyl-2-thiouridine (mcm(5)s(2)U). Our findings indicate that FD could be caused by inefficient translation due to lower levels of wobble uridine nucleosides. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Regulation of Synaptic Transmission by Ambient Extracellular Glutamate

    OpenAIRE

    FEATHERSTONE, DAVID E.; SHIPPY, SCOTT A.

    2007-01-01

    Many neuroscientists assume that ambient extracellular glutamate concentrations in the nervous system are biologically negligible under nonpathological conditions. This assumption is false. Hundreds of studies over several decades suggest that ambient extracellular glutamate levels in the intact mammalian brain are ~0.5 to ~5 μM. This has important implications. Glutamate receptors are desensitized by glutamate concentrations significantly lower than needed for receptor activation; 0.5 to 5 μ...

  2. 21 CFR 182.1047 - Glutamic acid hydrochloride.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Glutamic acid hydrochloride. 182.1047 Section 182.1047 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... Food Substances § 182.1047 Glutamic acid hydrochloride. (a) Product. Glutamic acid hydrochloride. (b...

  3. Neuroexcitatory amino acids: 4-methylene glutamic acid derivatives : Short Communication.

    Science.gov (United States)

    Receveur, J M; Roumestant, M L; Viallefont, P

    1995-12-01

    A short synthesis of 4-methylene glutamic acid was achieved. Under thermal conditions the corresponding anhydride reacted with 2,3 dimethylbutadiene to afford the corresponding DIELS-ALDER adduct in good yield. L-4-methylene glutamic acid essentially acts on glutamate metabotropic receptors and is as potent as L-Glu in producing IPs.

  4. A survey of green plant tRNA 3'-end processing enzyme tRNase Zs, homologs of the candidate prostate cancer susceptibility protein ELAC2

    Directory of Open Access Journals (Sweden)

    Wang Zhikang

    2011-07-01

    Full Text Available Abstract Background tRNase Z removes the 3'-trailer sequences from precursor tRNAs, which is an essential step preceding the addition of the CCA sequence. tRNase Z exists in the short (tRNase ZS and long (tRNase ZL forms. Based on the sequence characteristics, they can be divided into two major types: bacterial-type tRNase ZS and eukaryotic-type tRNase ZL, and one minor type, Thermotoga maritima (TM-type tRNase ZS. The number of tRNase Zs is highly variable, with the largest number being identified experimentally in the flowering plant Arabidopsis thaliana. It is unknown whether multiple tRNase Zs found in A. thaliana is common to the plant kingdom. Also unknown is the extent of sequence and structural conservation among tRNase Zs from the plant kingdom. Results We report the identification and analysis of candidate tRNase Zs in 27 fully sequenced genomes of green plants, the great majority of which are flowering plants. It appears that green plants contain multiple distinct tRNase Zs predicted to reside in different subcellular compartments. Furthermore, while the bacterial-type tRNase ZSs are present only in basal land plants and green algae, the TM-type tRNase ZSs are widespread in green plants. The protein sequences of the TM-type tRNase ZSs identified in green plants are similar to those of the bacterial-type tRNase ZSs but have distinct features, including the TM-type flexible arm, the variant catalytic HEAT and HST motifs, and a lack of the PxKxRN motif involved in CCA anti-determination (inhibition of tRNase Z activity by CCA, which prevents tRNase Z cleavage of mature tRNAs. Examination of flowering plant chloroplast tRNA genes reveals that many of these genes encode partial CCA sequences. Based on our results and previous studies, we predict that the plant TM-type tRNase ZSs may not recognize the CCA sequence as an anti-determinant. Conclusions Our findings substantially expand the current repertoire of the TM-type tRNase ZSs and hint

  5. Influence of Glutamic Acid on the Properties of Poly(xylitol glutamate sebacate Bioelastomer

    Directory of Open Access Journals (Sweden)

    Weifu Dong

    2013-11-01

    Full Text Available In order to further improve the biocompatibility of xylitol based poly(xylitol sebacate (PXS bioelastomer, a novel kind of amino acid based poly(xylitol glutamate sebacate (PXGS has been successfully prepared in this work by melt polycondensation of xylitol, N-Boc glutamic acid and sebacic acid. Differential scanning calorimetry (DSC results indicated the glass-transition temperatures could be decreased by feeding N-Boc glutamic acid. In comparison to PXS, PXGS exhibited comparable tensile strength and much higher elongation at break at the same ratio of acid/xylitol. The introduction of glutamic acid increased the hydrophilicity and in vitro degradation rate of the bioelastomer. It was found that PXGS exhibited excellent properties, such as tensile properties, biodegradability and hydrophilicity, which could be easily tuned by altering the feeding monomer ratios. The amino groups in the PXGS polyester side chains are readily functionalized, thus the biomelastomers can be considered as potential biomaterials for biomedical application.

  6. the effect of monosodium glutamate (msg)

    African Journals Online (AJOL)

    Uwaifoh

    2012-03-30

    Mar 30, 2012 ... Neuronal vulnerability in mouse models of Huntington's disease: Membrane channel protein changes. J Neurosci Res; 80: 634 - 645. Ashaolu, J.O., Ukwenya, V.O., Okonoboh, A.B., Ghazal, O.K. and Jimoh A.A.G. (2011). Effect of monosodium glutamate on hematological parameters in Wistar rats.

  7. L-glutamate Receptor In Paramecium

    Science.gov (United States)

    Bernal-Martínez, Juan; Ortega-Soto, Arturo

    2004-09-01

    Behavioral, electrophysiological and biochemical experiments were performed in order to establish the presence of a glutamate receptor in the ciliate Paramecium. It was found that an AMPA/KA receptor is functionally expressed in Paramecium and that this receptor is immunologically and fillogenetically related to the AMPA/KA receptor present in vertebrates.

  8. Monosodium glutamate: Potentials at inducing prostate pathologies ...

    African Journals Online (AJOL)

    The health implication of the alteration could be compounded by the opposing response elicited by increasing the concentration of either MSG or DW. Key words: Monosodium glutamate, total acid phosphatase, prostatic acid phosphatase, prostate cancer, prostatitis, benign prostate hyperplasia, infertility. African Journal of ...

  9. Glutamate mediated astrocytic filtering of neuronal activity.

    Directory of Open Access Journals (Sweden)

    Gilad Wallach

    2014-12-01

    Full Text Available Neuron-astrocyte communication is an important regulatory mechanism in various brain functions but its complexity and role are yet to be fully understood. In particular, the temporal pattern of astrocyte response to neuronal firing has not been fully characterized. Here, we used neuron-astrocyte cultures on multi-electrode arrays coupled to Ca2+ imaging and explored the range of neuronal stimulation frequencies while keeping constant the amount of stimulation. Our results reveal that astrocytes specifically respond to the frequency of neuronal stimulation by intracellular Ca2+ transients, with a clear onset of astrocytic activation at neuron firing rates around 3-5 Hz. The cell-to-cell heterogeneity of the astrocyte Ca2+ response was however large and increasing with stimulation frequency. Astrocytic activation by neurons was abolished with antagonists of type I metabotropic glutamate receptor, validating the glutamate-dependence of this neuron-to-astrocyte pathway. Using a realistic biophysical model of glutamate-based intracellular calcium signaling in astrocytes, we suggest that the stepwise response is due to the supralinear dynamics of intracellular IP3 and that the heterogeneity of the responses may be due to the heterogeneity of the astrocyte-to-astrocyte couplings via gap junction channels. Therefore our results present astrocyte intracellular Ca2+ activity as a nonlinear integrator of glutamate-dependent neuronal activity.

  10. Glutamate Mediated Astrocytic Filtering of Neuronal Activity

    Science.gov (United States)

    Herzog, Nitzan; De Pittà, Maurizio; Jacob, Eshel Ben; Berry, Hugues; Hanein, Yael

    2014-01-01

    Neuron-astrocyte communication is an important regulatory mechanism in various brain functions but its complexity and role are yet to be fully understood. In particular, the temporal pattern of astrocyte response to neuronal firing has not been fully characterized. Here, we used neuron-astrocyte cultures on multi-electrode arrays coupled to Ca2+ imaging and explored the range of neuronal stimulation frequencies while keeping constant the amount of stimulation. Our results reveal that astrocytes specifically respond to the frequency of neuronal stimulation by intracellular Ca2+ transients, with a clear onset of astrocytic activation at neuron firing rates around 3-5 Hz. The cell-to-cell heterogeneity of the astrocyte Ca2+ response was however large and increasing with stimulation frequency. Astrocytic activation by neurons was abolished with antagonists of type I metabotropic glutamate receptor, validating the glutamate-dependence of this neuron-to-astrocyte pathway. Using a realistic biophysical model of glutamate-based intracellular calcium signaling in astrocytes, we suggest that the stepwise response is due to the supralinear dynamics of intracellular IP3 and that the heterogeneity of the responses may be due to the heterogeneity of the astrocyte-to-astrocyte couplings via gap junction channels. Therefore our results present astrocyte intracellular Ca2+ activity as a nonlinear integrator of glutamate-dependent neuronal activity. PMID:25521344

  11. Amperometric L-glutamate biosensor based on bacterial cell-surface displayed glutamate dehydrogenase

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Bo [Laboratory for Biosensing, Key Laboratory of Biofuels, and Shandong Provinicial Key Laboratory of Energy Genetics, Qingdao Institute of Bioenergy & Bioprocess Technology, Chinese Academy of Sciences, 189 Songling Road, Qingdao 266101 (China); University of Chinese Academy of Sciences, 19A Yuquan Road, Beijing 100049 (China); Zhang, Shu [Laboratory for Biosensing, Key Laboratory of Biofuels, and Shandong Provinicial Key Laboratory of Energy Genetics, Qingdao Institute of Bioenergy & Bioprocess Technology, Chinese Academy of Sciences, 189 Songling Road, Qingdao 266101 (China); Key Laboratory of Marine Chemistry Theory and Technology of Ministry of Education, Ocean University of China, 238 Songling Road, Qingdao 266100 (China); Lang, Qiaolin [Laboratory for Biosensing, Key Laboratory of Biofuels, and Shandong Provinicial Key Laboratory of Energy Genetics, Qingdao Institute of Bioenergy & Bioprocess Technology, Chinese Academy of Sciences, 189 Songling Road, Qingdao 266101 (China); Song, Jianxia; Han, Lihui [Key Laboratory of Marine Chemistry Theory and Technology of Ministry of Education, Ocean University of China, 238 Songling Road, Qingdao 266100 (China); Liu, Aihua, E-mail: liuah@qibebt.ac.cn [Laboratory for Biosensing, Key Laboratory of Biofuels, and Shandong Provinicial Key Laboratory of Energy Genetics, Qingdao Institute of Bioenergy & Bioprocess Technology, Chinese Academy of Sciences, 189 Songling Road, Qingdao 266101 (China); University of Chinese Academy of Sciences, 19A Yuquan Road, Beijing 100049 (China)

    2015-07-16

    Highlights: • E. coli surface-dispalyed Gldh exhibiting excellent enzyme activity and stability. • Sensitive amperometric biosensor for glutamate using Gldh-bacteria and MWNTs. • The glutamate biosensor exhibited high specificity and stability. - Abstract: A novel L-glutamate biosensor was fabricated using bacteria surface-displayed glutamate dehydrogenase (Gldh-bacteria). Here the cofactor NADP{sup +}-specific dependent Gldh was expressed on the surface of Escherichia coli using N-terminal region of ice nucleation protein (INP) as the anchoring motif. The cell fractionation assay and SDS-PAGE analysis indicated that the majority of INP-Gldh fusion proteins were located on the surface of cells. The biosensor was fabricated by successively casting polyethyleneimine (PEI)-dispersed multi-walled carbon nanotubes (MWNTs), Gldh-bacteria and Nafion onto the glassy carbon electrode (Nafion/Gldh-bacteria/PEI-MWNTs/GCE). The MWNTs could not only significantly lower the oxidation overpotential towards NAPDH, which was the product of NADP{sup +} involving in the oxidation of glutamate by Gldh, but also enhanced the current response. Under the optimized experimental conditions, the current–time curve of the Nafion/Gldh-bacteria/PEI-MWNTs/GCE was performed at +0.52 V (vs. SCE) by amperometry varying glutamate concentration. The current response was linear with glutamate concentration in two ranges (10 μM–1 mM and 2–10 mM). The low limit of detection was estimated to be 2 μM glutamate (S/N = 3). Moreover, the proposed biosensor is stable, specific, reproducible and simple, which can be applied to real samples detection.

  12. Strontium D-Glutamate Hexahydrate and Strontium Di(hydrogen L-glutamate) Pentahydrate

    DEFF Research Database (Denmark)

    Christgau, Stephan; Odderhede, Jette; Stahl, Kenny

    2005-01-01

    Sr(C5H7NO4)] center dot 6H(2)O, ( I), and [Sr(C5H8NO4)(2)] center dot 5H(2)O, (II), both crystallize with similar strontium - glutamate - water layers. In ( I), the neutral layers are connected through hydrogen bonds by water molecules, while in ( II), the positively charged layers are connected...... through hydrogen bonds and electrostatic interactions by interleaving layers of hydrogen glutamate anions and water molecules....

  13. ¹³C-metabolic enrichment of glutamate in glutamate dehydrogenase mutants of Saccharomyces cerevisiae.

    Science.gov (United States)

    Tang, Yijin; Sieg, Alex; Trotter, Pamela J

    2011-10-20

    Glutamate dehydrogenases (GDH) interconvert α-ketoglutarate and glutamate. In yeast, NADP-dependent enzymes, encoded by GDH1 and GDH3, are reported to synthesize glutamate from α-ketoglutarate, while an NAD-dependent enzyme, encoded by GDH2, catalyzes the reverse. Cells were grown in acetate/raffinose (YNAceRaf) to examine the role(s) of these enzymes during aerobic metabolism. In YNAceRaf the doubling time of wild type, gdh2Δ, and gdh3Δ cells was comparable at ∼4 h. NADP-dependent GDH activity (Gdh1p+Gdh3p) in wild type, gdh2Δ, and gdh3Δ was decreased ∼80% and NAD-dependent activity (Gdh2p) in wild type and gdh3Δ was increased ∼20-fold in YNAceRaf as compared to glucose. Cells carrying the gdh1Δ allele did not divide in YNAceRaf, yet both the NADP-dependent (Gdh3p) and NAD-dependent (Gdh2p) GDH activity was ∼3-fold higher than in glucose. Metabolism of [1,2-(13)C]-acetate and analysis of carbon NMR spectra were used to examine glutamate metabolism. Incorporation of (13)C into glutamate was nearly undetectable in gdh1Δ cells, reflecting a GDH activity at glutamate carbons indicates a decreased rate of glutamate biosynthesis from acetate in gdh2Δ and gdh3Δ strains as compared to wild type. Further, the relative complexity of (13)C-isotopomers at early time points was noticeably greater in gdh3Δ as compared to wild type and gdh2Δ cells. These in vivo data show that Gdh1p is the primary GDH enzyme and Gdh2p and Gdh3p play evident roles during aerobic glutamate metabolism. Copyright © 2010 Elsevier GmbH. All rights reserved.

  14. Systemic administration of monosodium glutamate elevates intramuscular glutamate levels and sensitizes rat masseter muscle afferent fibers.

    Science.gov (United States)

    Cairns, Brian E; Dong, Xudong; Mann, Mandeep K; Svensson, Peter; Sessle, Barry J; Arendt-Nielsen, Lars; McErlane, Keith M

    2007-11-01

    There is evidence that elevated tissue concentrations of glutamate may contribute to pain and sensitivity in certain musculoskeletal pain conditions. In the present study, the food additive monosodium glutamate (MSG) was injected intravenously into rats to determine whether it could significantly elevate interstitial concentrations of glutamate in the masseter muscle and whether MSG administration could excite and/or sensitize slowly conducting masseter afferent fibers through N-methyl-D-aspartate (NMDA) receptor activation. The interstitial concentration of glutamate after systemic injection of isotonic phosphate-buffered saline (control) or MSG (10 and 50mg/kg) was measured with a glutamate-selective biosensor. The pre-injection baseline interstitial concentration of glutamate in the rat masseter muscle was 24+/-11 microM. Peak interstitial concentration after injection of 50mg/kg MSG was 63+/-18 microM and remained elevated above baseline for approximately 18 min. In vivo single unit recording experiments were undertaken to assess the effect of MSG (50mg/kg) on masseter afferent fibers. Injection of MSG evoked a brief discharge in one afferent fiber, and significantly decreased ( approximately 25%) the average afferent mechanical threshold (n=10) during the first 5 min after injection of MSG. Intravenous injection of ketamine (1mg/kg), 5 min prior to MSG, prevented the MSG-induced decreases in the mechanical threshold of masseter afferent fibers. The present results indicate that a 2- to 3-fold elevation in interstitial glutamate levels in the masseter muscle is sufficient to excite and induce afferent mechanical sensitization through NMDA receptor activation. These findings suggest that modest elevations of interstitial glutamate concentration could alter musculoskeletal pain sensitivity in humans.

  15. Hyperpolarized [1-13C] glutamate: a metabolic imaging biomarker of IDH1 mutational status in glioma.

    Science.gov (United States)

    Chaumeil, Myriam M; Larson, Peder E Z; Woods, Sarah M; Cai, Larry; Eriksson, Pia; Robinson, Aaron E; Lupo, Janine M; Vigneron, Daniel B; Nelson, Sarah J; Pieper, Russell O; Phillips, Joanna J; Ronen, Sabrina M

    2014-08-15

    Mutations of the isocitrate dehydrogenase 1 (IDH1) gene are among the most prevalent in low-grade glioma and secondary glioblastoma, represent an early pathogenic event, and are associated with epigenetically driven modulations of metabolism. Of particular interest is the recently uncovered relationship between the IDH1 mutation and decreased activity of the branched-chain amino acid transaminase 1 (BCAT1) enzyme. Noninvasive imaging methods that can assess BCAT1 activity could therefore improve detection of mutant IDH1 tumors and aid in developing and monitoring new targeted therapies. BCAT1 catalyzes the transamination of branched-chain amino acids while converting α-ketoglutarate (α-KG) to glutamate. Our goal was to use (13)C magnetic resonance spectroscopy to probe the conversion of hyperpolarized [1-(13)C] α-KG to hyperpolarized [1-(13)C] glutamate as a readout of BCAT1 activity. We investigated two isogenic glioblastoma lines that differed only in their IDH1 status and performed experiments in live cells and in vivo in rat orthotopic tumors. Following injection of hyperpolarized [1-(13)C] α-KG, hyperpolarized [1-(13)C] glutamate production was detected both in cells and in vivo, and the level of hyperpolarized [1-(13)C] glutamate was significantly lower in mutant IDH1 cells and tumors compared with their IDH1-wild-type counterparts. Importantly however, in our cells the observed drop in hyperpolarized [1-(13)C] glutamate was likely mediated not only by a drop in BCAT1 activity, but also by reductions in aspartate transaminase and glutamate dehydrogenase activities, suggesting additional metabolic reprogramming at least in our model. Hyperpolarized [1-(13)C] glutamate could thus inform on multiple mutant IDH1-associated metabolic events that mediate reduced glutamate production. ©2014 American Association for Cancer Research.

  16. Deletion of glutamate dehydrogenase 1 (Glud1) in the central nervous system affects glutamate handling without altering synaptic transmission

    DEFF Research Database (Denmark)

    Frigerio, Francesca; Karaca, Melis; De Roo, Mathias

    2012-01-01

    Glutamate dehydrogenase (GDH), encoded by GLUD1, participates in the breakdown and synthesis of glutamate, the main excitatory neurotransmitter. In the CNS, besides its primary signaling function, glutamate is also at the crossroad of metabolic and neurotransmitter pathways. Importance of brain G...

  17. Amperometric L-glutamate biosensor based on bacterial cell-surface displayed glutamate dehydrogenase.

    Science.gov (United States)

    Liang, Bo; Zhang, Shu; Lang, Qiaolin; Song, Jianxia; Han, Lihui; Liu, Aihua

    2015-07-16

    A novel L-glutamate biosensor was fabricated using bacteria surface-displayed glutamate dehydrogenase (Gldh-bacteria). Here the cofactor NADP(+)-specific dependent Gldh was expressed on the surface of Escherichia coli using N-terminal region of ice nucleation protein (INP) as the anchoring motif. The cell fractionation assay and SDS-PAGE analysis indicated that the majority of INP-Gldh fusion proteins were located on the surface of cells. The biosensor was fabricated by successively casting polyethyleneimine (PEI)-dispersed multi-walled carbon nanotubes (MWNTs), Gldh-bacteria and Nafion onto the glassy carbon electrode (Nafion/Gldh-bacteria/PEI-MWNTs/GCE). The MWNTs could not only significantly lower the oxidation overpotential towards NAPDH, which was the product of NADP(+) involving in the oxidation of glutamate by Gldh, but also enhanced the current response. Under the optimized experimental conditions, the current-time curve of the Nafion/Gldh-bacteria/PEI-MWNTs/GCE was performed at +0.52 V (vs. SCE) by amperometry varying glutamate concentration. The current response was linear with glutamate concentration in two ranges (10 μM-1 mM and 2-10 mM). The low limit of detection was estimated to be 2 μM glutamate (S/N=3). Moreover, the proposed biosensor is stable, specific, reproducible and simple, which can be applied to real samples detection. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Microbial production of poly-γ-glutamic acid.

    Science.gov (United States)

    Sirisansaneeyakul, Sarote; Cao, Mingfeng; Kongklom, Nuttawut; Chuensangjun, Chaniga; Shi, Zhongping; Chisti, Yusuf

    2017-09-05

    Poly-γ-glutamic acid (γ-PGA) is a natural, biodegradable and water-soluble biopolymer of glutamic acid. This review is focused on nonrecombinant microbial production of γ-PGA via fermentation processes. In view of its commercial importance, the emphasis is on L-glutamic acid independent producers (i.e. microorganisms that do not require feeding with the relatively expensive amino acid L-glutamic acid to produce γ-PGA), but glutamic acid dependent production is discussed for comparison. Strategies for improving production, reducing costs and using renewable feedstocks are discussed.

  19. Euglena gracilis chloroplast transfer RNA transcription units. I. Physical map of the transfer RNA gene loci.

    Science.gov (United States)

    Orozco, E M; Hallick, R B

    1982-03-25

    The locations of transfer RNA genes with respect to the restriction endonuclease cleavage map of Euglena gracilis Klebs, strain Z Pringsheim chloroplast DNA have been determined. Purified chloroplast tRNAs were treated with snake venom phosphodiesterase to remove the 3'-CCA terminus, and radioactively labeled by the action of Escherichia coli tRNA nucleotidyltransferase in the presence of [alpha-32P]CTP. Chloroplast DNA was treated individually and with combinations of the enzymes Bal I, Bam HI, Eco RI, Pst I, Pvu II, Sal I, and Xho I. The location of tRNA genes with respect to the cleavage sites for these enzymes was determined by hybridization of the 32P-labeled tRNAs to membrane filter blots of the chloroplast DNA restriction nuclease fragments following gel electrophoresis. The 145-kilobase pair genome was resolved into nine areas of strong tRNA hybridization, separated by areas of weak or no tRNA hybridization. The loci of tRNA genes are within the Eco RI fragments Eco A, B, G, H, I, J', P, Q, and V.

  20. Inhibitors of glutamate dehydrogenase block sodium-dependent glutamate uptake in rat brain membranes

    Directory of Open Access Journals (Sweden)

    Brendan S Whitelaw

    2013-09-01

    Full Text Available We recently found evidence for anatomic and physical linkages between the astroglial Na+-dependent glutamate transporters (GLT-1/EAAT2 and GLAST/EAAT1 and mitochondria. In these same studies, we found that the glutamate dehydrogenase (GDH inhibitor, epigallocatechin-monogallate (EGCG, inhibits both glutamate oxidation and Na+-dependent glutamate uptake in astrocytes. In the present study, we extend this finding by exploring the effects of EGCG on Na+-dependent L-[3H]-glutamate (Glu uptake in crude membranes (P2 prepared from rat brain cortex. In this preparation, uptake is almost exclusively mediated by GLT-1. EGCG inhibited L-[3H]-Glu uptake in cortical membranes with an IC50 value of 230 µM. We also studied the effects of two additional inhibitors of GDH, hexachlorophene (HCP and bithionol (BTH. Both of these compounds also caused concentration-dependent inhibition of glutamate uptake in cortical membranes. Pre-incubating with HCP for up to 15 min had no greater effect than that observed with no pre-incubation, showing that the effects occur rapidly. HCP decreased the Vmax for glutamate uptake without changing the Km, consistent with a non-competitive mechanism of action. EGCG, HCP, and BTH also inhibited Na+-dependent transport of D-[3H]-aspartate (Asp, a non-metabolizable substrate, and [3H]-γ-aminobutyric acid (GABA. In contrast to the forebrain, glutamate uptake in crude cerebellar membranes (P2 is likely mediated by GLAST (EAAT1. Therefore, the effects of these compounds were examined in cerebellar membranes. In this region, none of these compounds had any effect on uptake of either L-[3H]-Glu or D-[3H]-Asp, but they all inhibited [3H]-GABA uptake. Together these studies suggest that GDH is preferentially required for glutamate uptake in forebrain as compared to cerebellum, and GDH may be required for GABA uptake as well. They also provide further evidence for a functional linkage between glutamate transport and mitochondria.

  1. Microsensors for in vivo Measurement of Glutamate in Brain Tissue

    Directory of Open Access Journals (Sweden)

    Miranda van der Zeyden

    2008-11-01

    Full Text Available Several immobilized enzyme-based electrochemical biosensors for glutamate detection have been developed over the last decade. In this review, we compare first and second generation sensors. Structures, working mechanisms, interference prevention, in vitro detection characteristics and in vivo performance are summarized here for those sensors that have successfully detected brain glutamate in vivo. In brief, first generation sensors have a simpler structure and are faster in glutamate detection. They also show a better sensitivity to glutamate during calibration in vitro. For second generation sensors, besides their less precise detection, their fabrication is difficult to reproduce, even with a semi-automatic dip-coater. Both generations of sensors can detect glutamate levels in vivo, but the reported basal levels are different. In general, second generation sensors detect higher basal levels of glutamate compared with the results obtained from first generation sensors. However, whether the detected glutamate is indeed from synaptic sources is an issue that needs further attention.

  2. Glutamate Efflux at the Blood-Brain Barrier

    DEFF Research Database (Denmark)

    Cederberg-Helms, Hans Christian; Uhd-Nielsen, Carsten; Brodin, Birger

    2014-01-01

    L-Glutamate is considered the most important excitatory amino acid in the mammalian brain. Strict control of its concentration in the brain interstitial fluid is important to maintain neurotransmission and avoid excitotoxicity. The role of astrocytes in handling L-glutamate transport and metabolism...... is well known, however endothelial cells may also play an important role through mediating brain-to-blood L-glutamate efflux. Expression of excitatory amino acid transporters has been demonstrated in brain endothelial cells of bovine, human, murine, rat and porcine origin. These can account for high...... affinity concentrative uptake of L-glutamate from the brain interstitial fluid into the capillary endothelial cells. The mechanisms in between L-glutamate uptake in the endothelial cells and L-glutamate appearing in the blood are still unclear and may involve a luminal transporter for L-glutamate...

  3. Effect of anoxia and Polyscias filicifolia Bailey biomass tincture on the activity of tRNA and aminoacyl-tRNA synthetases in isolated pig heart.

    Science.gov (United States)

    Kasauskas, Artūras; Rodovicius, Hiliaras; Viezeliene, Dale; Lazauskas, Robertas

    2009-01-01

    The aim of this study was to investigate effect of anoxia and Polyscias filicifolia Bailey biomass tincture on the activities of different tRNA and aminoacyl-tRNA synthetases in isolated pig heart. The isolated pig heart was perfused according to the modified method of Langendorf, using an artificial blood circulation apparatus. Anoxia 20 min in duration was performed by perfusion of isolated heart with Krebs-Henseleit bicarbonate buffer saturated with gas mixture (95% N(2) and 5% CO(2)). Control heart was perfused with the same buffer saturated with gas mixture (95% O(2) and 5% CO(2)). Effect of Polyscias filicifolia Bailey biomass tincture was evaluated by perfusion of isolated heart with a buffer containing tincture. Total tRNA and aminoacyl-tRNA synthetases were isolated from pig heart. Activities of tRNA and aminoacyl-tRNA synthetases were measured by the aminoacylation reaction using C(14)-amino acids. Anoxia 20 min in duration has caused a decrease in the acceptor activity of tRNA and increase in the activities of aminacyl-tRNA synthetases. Polyscias filicifolia Bailey tincture did not affect the acceptor activity of tRNA and activities aminacyl-tRNA synthetases. After 20-min anoxic perfusion with the buffer containing Polyscias filicifolia Bailey biomass tincture, the acceptor activities of tRNA increased to the control value and activities of aminacyl-tRNA synthetases reached the control value. The acceptor activity of tRNA from isolated pig heart decreased and activities of aminacyl-tRNA synthetases increased under anoxia. Perfusion with buffer containing tincture of Polyscias filicifolia Bailey biomass restored acceptor activities of tRNA and activities of aminacyl-tRNA synthetases.

  4. The structure of the hypothetical protein smu.1377c from Streptococcus mutans suggests a role in tRNA modification

    International Nuclear Information System (INIS)

    Fu, Tian-Min; Liu, Xiang; Li, Lanfen; Su, Xiao-Dong

    2010-01-01

    The crystal structure of smu.1377c, a hypothetical protein from S. mutans, shows a similar fold to Sua5-YciO-YrdC-family proteins and indicates its functional role in tRNA modification. Members of the Sua5-YciO-YrdC protein family are found in both eukaryotes and prokaryotes and possess a conserved α/β twisted open-sheet fold. The Escherichia coli protein YrdC has been shown to be involved in modification of tRNA. The crystal structure of smu.1377c, a hypothetical protein from Streptococcus mutans, has been determined to 2.25 Å resolution. From structure analysis and comparison, it is shown that smu.1377c is a member of the Sua5-YciO-YrdC family and that it may play the same role as E. coli YrdC

  5. Initiation factor 2, tRNA, and 50S subunits cooperatively stabilize mRNAs on the ribosome during initiation

    Science.gov (United States)

    Masuda, Tomoaki; Petrov, Alexey N.; Iizuka, Ryo; Funatsu, Takashi; Puglisi, Joseph D.; Uemura, Sotaro

    2012-01-01

    Initiation factor 2 (IF2) is a key factor in initiation of bacterial protein synthesis. It recruits initiator tRNA to the small ribosomal subunit and facilitates joining of the large ribosomal subunit. Using reconstituted translation system of Escherichia coli and optical tweezers, we directly measure the rupture force between single ribosomal complexes and mRNAs for initiation complexes in the presence and the absence of IF2. We demonstrate that IF2 together with codon recognition by initiator tRNA increases the force required to dislocate mRNA from the ribosome complexes; mRNA stabilization by IF2 required the presence of a joined 50S subunit, and was independent of bound guanine nucleotide. IF2 thus helps lock the 70S ribosome over the start codon during initiation, thus maintaining reading frame. Our results show how mRNA is progressively stabilized on the ribosome through distinct steps of initiation. PMID:22411833

  6. Conservation of tRNA and rRNA 5-methylcytosine in the kingdom Plantae.

    Science.gov (United States)

    Burgess, Alice Louise; David, Rakesh; Searle, Iain Robert

    2015-08-14

    Post-transcriptional methylation of RNA cytosine residues to 5-methylcytosine (m(5)C) is an important modification that regulates RNA metabolism and occurs in both eukaryotes and prokaryotes. Yet, to date, no transcriptome-wide identification of m(5)C sites has been undertaken in plants. Plants provide a unique comparative system for investigating the origin and evolution of m(5)C as they contain three different genomes, the nucleus, mitochondria and chloroplast. Here we use bisulfite conversion of RNA combined with high-throughput IIlumina sequencing (RBS-seq) to identify single-nucleotide resolution of m(5)C sites in non-coding ribosomal RNAs and transfer RNAs of all three sub-cellular transcriptomes across six diverse species that included, the single-celled algae Nannochloropsis oculata, the macro algae Caulerpa taxifolia and multi-cellular higher plants Arabidopsis thaliana, Brassica rapa, Triticum durum and Ginkgo biloba. Using the plant model Arabidopsis thaliana, we identified a total of 39 highly methylated m(5)C sites in predicted structural positions of nuclear tRNAs and 7 m(5)C sites in rRNAs from nuclear, chloroplast and mitochondrial transcriptomes. Both the nucleotide position and percent methylation of tRNAs and rRNAs m(5)C sites were conserved across all species analysed, from single celled algae N. oculata to multicellular plants. Interestingly the mitochondrial and chloroplast encoded tRNAs were devoid of m(5)C in A. thaliana and this is generally conserved across Plantae. This suggests independent evolution of organelle methylation in animals and plants, as animal mitochondrial tRNAs have m(5)C sites. Here we characterize 5 members of the RNA 5-methylcytosine family in Arabidopsis and extend the functional characterization of TRDMT1 and NOP2A/OLI2. We demonstrate that nuclear tRNA methylation requires two evolutionarily conserved methyltransferases, TRDMT1 and TRM4B. trdmt1 trm4b double mutants are hypersensitive to the antibiotic hygromycin B

  7. Degradation of nucleic acids with ozone. II. Degradation of yeast RNA, yeast phenylalanine tRNA and tobacco mosaic virus RNA.

    Science.gov (United States)

    Shinriki, N; Ishizaki, K; Ikehata, A; Yoshizaki, T; Nomura, A; Miura, K; Mizuno, Y

    1981-10-27

    The degradation of a mixture of four 5'-ribonucleotides (AMP, GMP, CMP and UMP), yeast RNA, yeast phenylalanine tRNA, and tobacco mosaic virus RNA (TMV-RNA) with ozone (concentration in inlet gas, 0.1-0.5 mg/l) was examined in a phosphate buffer (pH 6.9). In the case of the mixture, GMP alone was degraded in the initial stage. In the ozonization of yeast RNA, the guanine moiety was less vulnerable to attack by ozone than in the case of free GMP, but it again degraded most rapidly among the four nucleotides. In the treatment of tRNA with ozone, the guanine moiety degraded first. When the numbers of degraded nucleotides reached 4.8 (remaining amino acid acceptor activity was 3.6%), the polyacrylamide gel electrophoresis of the ozonized tRNA gave a single band with the same mobility as that of the intact tRNA. It is evident that ozonolysis of tRNA proceeded without cleavage of the polynucleotide chain. In the case of TMV-RNA, the loss of the infectivity by ozone proceeded rapidly within 30 min and was followed by preferential degradation of the guanine moiety. The outstanding lability of the guanine moiety observed in each case is discussed in connection with the inactivation of tRNA and TMV-RNA.

  8. Glutamate alteration of glutamic acid decarboxylase (GAD) in GABAergic neurons: the role of cysteine proteases.

    Science.gov (United States)

    Monnerie, Hubert; Le Roux, Peter D

    2008-09-01

    Brain cell vulnerability to neurologic insults varies greatly, depending on their neuronal subpopulation. Among cells that survive a pathological insult such as ischemia or brain trauma, some may undergo morphological and/or biochemical changes that could compromise brain function. We previously reported that surviving cortical GABAergic neurons exposed to glutamate in vitro displayed an NMDA receptor (NMDAR)-mediated alteration in the levels of the GABA synthesizing enzyme glutamic acid decarboxylase (GAD65/67) [Monnerie, H., Le Roux, P., 2007. Reduced dendrite growth and altered glutamic acid decarboxylase (GAD) 65- and 67-kDa isoform protein expression from mouse cortical GABAergic neurons following excitotoxic injury in vitro. Exp. Neurol. 205, 367-382]. In this study, we examined the mechanisms by which glutamate excitotoxicity caused a change in cortical GABAergic neurons' GAD protein levels. Removing extracellular calcium prevented the NMDAR-mediated decrease in GAD protein levels, measured using Western blot techniques, whereas inhibiting calcium entry through voltage-gated calcium channels had no effect. Glutamate's effect on GAD protein isoforms was significantly attenuated by preincubation with the cysteine protease inhibitor N-Acetyl-L-Leucyl-L-Leucyl-L-norleucinal (ALLN). Using class-specific protease inhibitors, we observed that ALLN's effect resulted from the blockade of calpain and cathepsin protease activities. Cell-free proteolysis assay confirmed that both proteases were involved in glutamate-induced alteration in GAD protein levels. Together these results suggest that glutamate-induced excitotoxic stimulation of NMDAR in cultured cortical neurons leads to altered GAD protein levels from GABAergic neurons through intracellular calcium increase and protease activation including calpain and cathepsin. Biochemical alterations in surviving cortical GABAergic neurons in various disease states may contribute to the altered balance between excitation

  9. Neuronal Activity and Glutamate Uptake Decrease Mitochondrial Mobility in Astrocytes and Position Mitochondria Near Glutamate Transporters

    Science.gov (United States)

    Jackson, Joshua G.; O'Donnell, John C.; Takano, Hajime; Coulter, Douglas A.

    2014-01-01

    Within neurons, mitochondria are nonuniformly distributed and are retained at sites of high activity and metabolic demand. Glutamate transport and the concomitant activation of the Na+/K+-ATPase represent a substantial energetic demand on astrocytes. We hypothesized that mitochondrial mobility within astrocytic processes might be regulated by neuronal activity and glutamate transport. We imaged organotypic hippocampal slice cultures of rat, in which astrocytes maintain their highly branched morphologies and express glutamate transporters. Using time-lapse confocal microscopy, the mobility of mitochondria within individual astrocytic processes and neuronal dendrites was tracked. Within neurons, a greater percentage of mitochondria were mobile than in astrocytes. Furthermore, they moved faster and farther than in astrocytes. Inhibiting neuronal activity with tetrodotoxin (TTX) increased the percentage of mobile mitochondria in astrocytes. Mitochondrial movement in astrocytes was inhibited by vinblastine and cytochalasin D, demonstrating that this mobility depends on both the microtubule and actin cytoskeletons. Inhibition of glutamate transport tripled the percentage of mobile mitochondria in astrocytes. Conversely, application of the transporter substrate d-aspartate reversed the TTX-induced increase in the percentage of mobile mitochondria. Inhibition of reversed Na+/Ca2+ exchange also increased the percentage of mitochondria that were mobile. Last, we demonstrated that neuronal activity increases the probability that mitochondria appose GLT-1 particles within astrocyte processes, without changing the proximity of GLT-1 particles to VGLUT1. These results imply that neuronal activity and the resulting clearance of glutamate by astrocytes regulate the movement of astrocytic mitochondria and suggest a mechanism by which glutamate transporters might retain mitochondria at sites of glutamate uptake. PMID:24478345

  10. Modafinil attenuates reinstatement of cocaine seeking: role for cystine-glutamate exchange and metabotropic glutamate receptors.

    Science.gov (United States)

    Mahler, Stephen V; Hensley-Simon, Megan; Tahsili-Fahadan, Pouya; LaLumiere, Ryan T; Thomas, Charles; Fallon, Rebecca V; Kalivas, Peter W; Aston-Jones, Gary

    2014-01-01

    Modafinil may be useful for treating stimulant abuse, but the mechanisms by which it acts to do so are unknown. Indeed, a primary effect of modafinil is to inhibit dopamine transport, which typically promotes rather than inhibits motivated behavior. Therefore, we examined the role of nucleus accumbens extracellular glutamate and the group II metabotropic glutamate receptor (mGluR2/3) in modafinil effects. One group of rats was trained to self-administer cocaine for 10 days and extinguished, then given priming injections of cocaine to elicit reinstatement. Modafinil (300 mg/kg, intraperitoneal) inhibited reinstated cocaine seeking (but did not alter extinction responding by itself), and this effect was prevented by pre-treatment with bilateral microinjections of the mGluR2/3 antagonist LY-341495 (LY) into nucleus accumbens core. No reversal of modafinil effects was seen after unilateral accumbens core LY, or bilateral LY in the rostral pole of accumbens. Next, we sought to explore effects of modafinil on extracellular glutamate levels in accumbens after chronic cocaine. Separate rats were administered non-contingent cocaine, and after 3 weeks of withdrawal underwent accumbens microdialysis. Modafinil increased extracellular accumbens glutamate in chronic cocaine, but not chronic saline-pre-treated animals. This increase was prevented by reverse dialysis of cystine-glutamate exchange or voltage-dependent calcium channel antagonists. Voltage-dependent sodium channel blockade partly attenuated the increase in glutamate, but mGluR1 blockade did not. We conclude that modafinil increases extracellular glutamate in nucleus accumbens from glial and neuronal sources in cocaine-exposed rats, which may be important for its mGluR2/3-mediated antirelapse properties. © 2012 The Authors, Addiction Biology © 2012 Society for the Study of Addiction.

  11. Developmental expression of glutamate transporters and glutamate dehydrogenase in astrocytes of the postnatal rat hippocampus.

    Science.gov (United States)

    Kugler, Peter; Schleyer, Verena

    2004-01-01

    Glutamate is the major excitatory transmitter in the CNS and plays distinct roles in a number of developmental events. Its extracellular concentration, which mediates these activities, is regulated by glutamate transporters in glial cells and neurons. In the present study, we have used nonradioactive in situ hybridization, immunocytochemistry, and immunoblotting to show the cellular and regional expression of the high-affinity glutamate transporters GLAST (EAAT1) and generic GLT1 (EAAT2; glial form of GLT1) in the rat hippocampus during postnatal development (P1-60). The results of transporter expression were compared with the localization and activity pattern of glutamate dehydrogenase (GDH), an important glutamate-metabolizing enzyme. The study showed that both transporters and GDH were demonstrable at P1 (day of birth). The expression of GLAST (detected by in situ hybridization and immunocytochemistry) in the early postnatal development was higher than GLT1. Thereafter, the expression of both transporters increased, showing adult levels at between P20 and P30 (detected by in situ hybridization and immunoblotting). At these time points, the expression of GLT1 appeared to be significantly higher than the GLAST expression. GLT1 and GLAST proteins were demonstrable only in astrocytes. The increase of GDH activities (steepest increase from P5-P8), which were localized preferentially in astrocytes, was in agreement with the increase of transporter expression, preferentially with that of GLT1. These observations suggest that the extent of glutamate transporter expression and of glutamate-metabolizing GDH activity in astrocytes is intimately correlated with the formation of glutamatergic synapses in the developing hippocampus. 2004 Wiley-Liss, Inc.

  12. A subcomplex of human mitochondrial RNase P is a bifunctional methyltransferase--extensive moonlighting in mitochondrial tRNA biogenesis.

    Science.gov (United States)

    Vilardo, Elisa; Nachbagauer, Christa; Buzet, Aurélie; Taschner, Andreas; Holzmann, Johann; Rossmanith, Walter

    2012-12-01

    Transfer RNAs (tRNAs) reach their mature functional form through several steps of processing and modification. Some nucleotide modifications affect the proper folding of tRNAs, and they are crucial in case of the non-canonically structured animal mitochondrial tRNAs, as exemplified by the apparently ubiquitous methylation of purines at position 9. Here, we show that a subcomplex of human mitochondrial RNase P, the endonuclease removing tRNA 5' extensions, is the methyltransferase responsible for m(1)G9 and m(1)A9 formation. The ability of the mitochondrial tRNA:m(1)R9 methyltransferase to modify both purines is uncommon among nucleic acid modification enzymes. In contrast to all the related methyltransferases, the human mitochondrial enzyme, moreover, requires a short-chain dehydrogenase as a partner protein. Human mitochondrial RNase P, thus, constitutes a multifunctional complex, whose subunits moonlight in cascade: a fatty and amino acid degradation enzyme in tRNA methylation and the methyltransferase, in turn, in tRNA 5' end processing.

  13. Trying on tRNA for Size: RNase P and the T-box Riboswitch as Molecular Rulers

    Directory of Open Access Journals (Sweden)

    Jinwei Zhang

    2016-04-01

    Full Text Available Length determination is a fundamental problem in biology and chemistry. Numerous proteins measure distances on linear biopolymers to exert effects with remarkable spatial precision. Recently, ruler-like devices made of noncoding RNAs have been structurally and biochemically characterized. Two prominent examples are the RNase P ribozyme and the T-box riboswitch. Both act as molecular calipers. The two RNAs clamp onto the elbow of tRNA (or pre-tRNA and make distance measurements orthogonal to each other. Here, we compare and contrast the molecular ruler characteristics of these RNAs. RNase P appears pre-configured to measure a fixed distance on pre-tRNA to ensure the fidelity of its maturation. RNase P is a multiple-turnover ribozyme, and its rigid structure efficiently selects pre-tRNAs, cleaves, and releases them. In contrast, the T-box is flexible and segmented, an architecture that adapts to the intrinsically flexible tRNA. The tripartite T-box inspects the overall shape, anticodon sequence, and aminoacylation status of an incoming tRNA while it folds co-transcriptionally, leading to a singular, conditional genetic switching event. The elucidation of the structures and mechanisms of action of these two RNA molecular rulers may augur the discovery of new RNA measuring devices in noncoding and viral transcriptomes, and inform the design of artificial RNA rulers.

  14. Main subunits of ionotropic glutamate receptors are expressed in isolated rat brain microvessels

    Czech Academy of Sciences Publication Activity Database

    Šťastný, František; Schwendt, M.; Lisý, Václav; Ježová, D.

    2002-01-01

    Roč. 24, č. 1 (2002), s. 93-96 ISSN 0161-6412 R&D Projects: GA ČR GA305/99/1317; GA ČR GA309/99/0211 Grant - others:VEGA(SK) 2/6084 Institutional research plan: CEZ:AV0Z5011922 Keywords : Glutamate receptor * gene expression and binding * blood-brain barrier Subject RIV: FH - Neurology Impact factor: 0.969, year: 2002

  15. Glutamate-Dependent BMAL1 Regulation in Cultured Bergmann Glia Cells.

    Science.gov (United States)

    Chi-Castañeda, Donají; Waliszewski, Stefan M; Zepeda, Rossana C; Hernández-Kelly, Luisa C R; Caba, Mario; Ortega, Arturo

    2015-05-01

    Glutamate, the major excitatory amino acid, activates a wide variety of signal transduction cascades. This neurotransmitter is involved in photic entrainment of circadian rhythms, which regulate physiological and behavioral functions. The circadian clock in vertebrates is based on a transcription-translation feedback loop in which Brain and muscle aryl hydrocarbon receptor nuclear translocator (ARNT)-like protein 1 (BMAL1) acts as transcriptional activator of others clock genes. This protein is expressed in nearly all suprachiasmatic nucleus neurons, as well as in the granular layer of the cerebellum. In this context, we decided to investigate the role of glutamate in the molecular mechanisms involved in the processes of transcription/translation of BMAL1 protein. To this end, primary cultures of chick cerebellar Bergmann glial cells were stimulated with glutamatergic ligands and we found that BMAL1 levels increased in a dose- and time dependent manner. Additionally, we studied the phosphorylation of serine residues in BMAL1 under glutamate stimulation and we were able to detect an increase in the phosphorylation of this protein. The increased expression of BMAL1 is most probably the result of a stabilization of the protein after it has been phosphorylated by the cyclic AMP-dependent protein kinase and/or the Ca(2+)/diacylglycerol dependent protein kinase. The present results strongly suggest that glutamate participates in regulating BMAL1 in glial cells and that these cells might prove to be important in the control of circadian rhythms in the cerebellum.

  16. Independent and additive effects of glutamic acid and methionine on yeast longevity.

    Science.gov (United States)

    Wu, Ziyun; Song, Lixia; Liu, Shao Quan; Huang, Dejian

    2013-01-01

    It is established that glucose restriction extends yeast chronological and replicative lifespan, but little is known about the influence of amino acids on yeast lifespan, although some amino acids were reported to delay aging in rodents. Here we show that amino acid composition greatly alters yeast chronological lifespan. We found that non-essential amino acids (to yeast) methionine and glutamic acid had the most significant impact on yeast chronological lifespan extension, restriction of methionine and/or increase of glutamic acid led to longevity that was not the result of low acetic acid production and acidification in aging media. Remarkably, low methionine, high glutamic acid and glucose restriction additively and independently extended yeast lifespan, which could not be further extended by buffering the medium (pH 6.0). Our preliminary findings using yeasts with gene deletion demonstrate that glutamic acid addition, methionine and glucose restriction prompt yeast longevity through distinct mechanisms. This study may help to fill a gap in yeast model for the fast developing view that nutrient balance is a critical factor to extend lifespan.

  17. Neuromodulatory Effect of Thymoquinone in Attenuating Glutamate-Mediated Neurotoxicity Targeting the Amyloidogenic and Apoptotic Pathways

    Directory of Open Access Journals (Sweden)

    Ibram Amin Fouad

    2018-04-01

    Full Text Available Overexposure of the glutamatergic N-methyl-d-aspartate (NMDA receptor to the excitatory neurotransmitter l-glutamic acid leads to neuronal cell death by excitotoxicity as a result of increased intracellular Ca2+, mitochondrial dysfunction, and apoptosis. Moreover, it was previously reported that prolonged activation of the NMDA receptor increased beta-amyloid (Aβ levels in the brain. Thymoquinone (TQ, the active constituent of Nigella sativa seeds, has been shown to have potent antioxidant and antiapoptotic effects. The aim of the present study was to explore the neuromodulatory effects of different doses of TQ (2.5 and 10 mg/kg against apoptotic cell death and Aβ formation resulting from glutamate administration in rats using vitamin E as a positive control. Behavioral changes were assessed using Y-maze and Morris water maze tests for evaluating spatial memory and cognitive functions. Caspase-3, Lactate dehydrogenase, Aβ-42, and cytochrome c gene expression were determined. TQ-treated groups showed significant decreases in the levels of all tested biochemical and behavioral parameters compared with the glutamate-treated group. These findings demonstrated that TQ has a promising neuroprotective activity against glutamate-induced neurotoxicity and this effect is mediated through its anti-amyloidogenic, antioxidant, and antiapoptotic activities.

  18. tRNA Modification and Genetic Code Variations in Animal Mitochondria

    Directory of Open Access Journals (Sweden)

    Kimitsuna Watanabe

    2011-01-01

    Full Text Available In animal mitochondria, six codons have been known as nonuniversal genetic codes, which vary in the course of animal evolution. They are UGA (termination codon in the universal genetic code changes to Trp codon in all animal mitochondria, AUA (Ile to Met in most metazoan mitochondria, AAA (Lys to Asn in echinoderm and some platyhelminth mitochondria, AGA/AGG (Arg to Ser in most invertebrate, Arg to Gly in tunicate, and Arg to termination in vertebrate mitochondria, and UAA (termination to Tyr in a planaria and a nematode mitochondria, but conclusive evidence is lacking in this case. We have elucidated that the anticodons of tRNAs deciphering these nonuniversal codons (tRNATrp for UGA, tRNAMet for AUA, tRNAAsn for AAA, and tRNASer and tRNAGly for AGA/AGG are all modified; tRNATrp has 5-carboxymethylaminomethyluridine or 5-taurinomethyluridine, tRNAMet has 5-formylcytidine or 5-taurinomethyluridine, tRNASer has 7-methylguanosine and tRNAGly has 5-taurinomethyluridine in their anticodon wobble position, and tRNAAsn has pseudouridine in the anticodon second position. This review aims to clarify the structural relationship between these nonuniversal codons and the corresponding tRNA anticodons including modified nucleosides and to speculate on the possible mechanisms for explaining the evolutional changes of these nonuniversal codons in the course of animal evolution.

  19. Metabolic and chemical regulation of tRNA modification associated with taurine deficiency and human disease

    Science.gov (United States)

    Asano, Kana; Suzuki, Takeo; Saito, Ayaka; Wei, Fan-Yan; Ikeuchi, Yoshiho; Numata, Tomoyuki; Tanaka, Ryou; Yamane, Yoshihisa; Yamamoto, Takeshi; Goto, Takanobu; Kishita, Yoshihito; Murayama, Kei; Ohtake, Akira; Okazaki, Yasushi; Tomizawa, Kazuhito; Sakaguchi, Yuriko

    2018-01-01

    Abstract Modified uridine containing taurine, 5-taurinomethyluridine (τm5U), is found at the anticodon first position of mitochondrial (mt-)transfer RNAs (tRNAs). Previously, we reported that τm5U is absent in mt-tRNAs with pathogenic mutations associated with mitochondrial diseases. However, biogenesis and physiological role of τm5U remained elusive. Here, we elucidated τm5U biogenesis by confirming that 5,10-methylene-tetrahydrofolate and taurine are metabolic substrates for τm5U formation catalyzed by MTO1 and GTPBP3. GTPBP3-knockout cells exhibited respiratory defects and reduced mitochondrial translation. Very little τm5U34 was detected in patient’s cells with the GTPBP3 mutation, demonstrating that lack of τm5U results in pathological consequences. Taurine starvation resulted in downregulation of τm5U frequency in cultured cells and animal tissues (cat liver and flatfish). Strikingly, 5-carboxymethylaminomethyluridine (cmnm5U), in which the taurine moiety of τm5U is replaced with glycine, was detected in mt-tRNAs from taurine-depleted cells. These results indicate that tRNA modifications are dynamically regulated via sensing of intracellular metabolites under physiological condition. PMID:29390138

  20. Differentiating analogous tRNA methyltransferases by fragments of the methyl donor

    Science.gov (United States)

    Lahoud, Georges; Goto-Ito, Sakurako; Yoshida, Ken-ichi; Ito, Takuhiro; Yokoyama, Shigeyuki; Hou, Ya-Ming

    2011-01-01

    Bacterial TrmD and eukaryotic-archaeal Trm5 form a pair of analogous tRNA methyltransferase that catalyze methyl transfer from S-adenosyl methionine (AdoMet) to N1 of G37, using catalytic motifs that share no sequence or structural homology. Here we show that natural and synthetic analogs of AdoMet are unable to distinguish TrmD from Trm5. Instead, fragments of AdoMet, adenosine and methionine, are selectively inhibitory of TrmD rather than Trm5. Detailed structural information of the two enzymes in complex with adenosine reveals how Trm5 escapes targeting by adopting an altered structure, whereas TrmD is trapped by targeting due to its rigid structure that stably accommodates the fragment. Free energy analysis exposes energetic disparities between the two enzymes in how they approach the binding of AdoMet versus fragments and provides insights into the design of inhibitors selective for TrmD. PMID:21602303

  1. Differentiating analogous tRNA methyltransferases by fragments of the methyl donor.

    Science.gov (United States)

    Lahoud, Georges; Goto-Ito, Sakurako; Yoshida, Ken-Ichi; Ito, Takuhiro; Yokoyama, Shigeyuki; Hou, Ya-Ming

    2011-07-01

    Bacterial TrmD and eukaryotic-archaeal Trm5 form a pair of analogous tRNA methyltransferase that catalyze methyl transfer from S-adenosyl methionine (AdoMet) to N(1) of G37, using catalytic motifs that share no sequence or structural homology. Here we show that natural and synthetic analogs of AdoMet are unable to distinguish TrmD from Trm5. Instead, fragments of AdoMet, adenosine and methionine, are selectively inhibitory of TrmD rather than Trm5. Detailed structural information of the two enzymes in complex with adenosine reveals how Trm5 escapes targeting by adopting an altered structure, whereas TrmD is trapped by targeting due to its rigid structure that stably accommodates the fragment. Free energy analysis exposes energetic disparities between the two enzymes in how they approach the binding of AdoMet versus fragments and provides insights into the design of inhibitors selective for TrmD.

  2. Impaired RNA splicing of 5'-regulatory sequences of the astroglial glutamate transporter EAAT2 in human astrocytoma

    NARCIS (Netherlands)

    Münch, C.; Penndorf, A.; Schwalenstöcker, B.; Troost, D.; Ludolph, A. C.; Ince, P.; Meyer, T.

    2001-01-01

    A loss of the glutamate transporter EAAT2 has been reported in the neoplastic transformation of astrocytic cells and astrocytoma. The RNA expression of EAAT2 and five 5'-regulatory splice variants was investigated to identify alterations of the post-transcriptional EAAT2 gene regulation in human

  3. The Glutamine-Glutamate/GABA Cycle

    DEFF Research Database (Denmark)

    Walls, Anne B; Waagepetersen, Helle S; Bak, Lasse Kristoffer

    2015-01-01

    The operation of a glutamine-glutamate/GABA cycle in the brain consisting of the transfer of glutamine from astrocytes to neurons and neurotransmitter glutamate or GABA from neurons to astrocytes is a well-known concept. In neurons, glutamine is not only used for energy production and protein...... synthesis, as in other cells, but is also an essential precursor for biosynthesis of amino acid neurotransmitters. An excellent tool for the study of glutamine transfer from astrocytes to neurons is [(14)C]acetate or [(13)C]acetate and the glial specific enzyme inhibitors, i.e. the glutamine synthetase...... inhibitor methionine sulfoximine and the tricarboxylic acid cycle (aconitase) inhibitors fluoro-acetate and -citrate. Acetate is metabolized exclusively by glial cells, and [(13)C]acetate is thus capable when used in combination with magnetic resonance spectroscopy or mass spectrometry, to provide...

  4. Binding thermodynamics of a glutamate transporter homologue

    Science.gov (United States)

    Reyes, Nicolas; Oh, SeCheol; Boudker, Olga

    2013-01-01

    Glutamate transporters catalyze concentrative uptake of the neurotransmitter into glial cells and neurons. Their transport cycle involves binding and release of the substrate on the extra- and intracellular sides of the plasma membranes, and translocation of the substrate-binding site across the lipid bilayers. The energy of the ionic gradients, mainly sodium, fuels the cycle. Here, we used a cross-linking approach to trap a glutamate transporter homologue from Pyrococcus horikoshii in key conformational states with substrate-binding site facing either the extracellular or intracellular sides of the membrane to study their binding thermodynamics. We show that the chemical potential of sodium ions in solution is exclusively coupled to substrate binding and release, and not to substrate translocation. Despite the structural symmetry, the binding mechanisms are distinct on the opposite sides of the membrane and more complex than the current models suggest. PMID:23563139

  5. Synaptically evoked glutamate transporter currents in Spinal Dorsal Horn Astrocytes

    Directory of Open Access Journals (Sweden)

    Dougherty Patrick M

    2009-07-01

    Full Text Available Abstract Background Removing and sequestering synaptically released glutamate from the extracellular space is carried out by specific plasma membrane transporters that are primarily located in astrocytes. Glial glutamate transporter function can be monitored by recording the currents that are produced by co-transportation of Na+ ions with the uptake of glutamate. The goal of this study was to characterize glutamate transporter function in astrocytes of the spinal cord dorsal horn in real time by recording synaptically evoked glutamate transporter currents. Results Whole-cell patch clamp recordings were obtained from astrocytes in the spinal substantia gelatinosa (SG area in spinal slices of young adult rats. Glutamate transporter currents were evoked in these cells by electrical stimulation at the spinal dorsal root entry zone in the presence of bicuculline, strychnine, DNQX and D-AP5. Transporter currents were abolished when synaptic transmission was blocked by TTX or Cd2+. Pharmacological studies identified two subtypes of glutamate transporters in spinal astrocytes, GLAST and GLT-1. Glutamate transporter currents were graded with stimulus intensity, reaching peak responses at 4 to 5 times activation threshold, but were reduced following low-frequency (0.1 – 1 Hz repetitive stimulation. Conclusion These results suggest that glutamate transporters of spinal astrocytes could be activated by synaptic activation, and recording glutamate transporter currents may provide a means of examining the real time physiological responses of glial cells in spinal sensory processing, sensitization, hyperalgesia and chronic pain.

  6. Glutamine and glutamate as vital metabolites

    Directory of Open Access Journals (Sweden)

    Newsholme P.

    2003-01-01

    Full Text Available Glucose is widely accepted as the primary nutrient for the maintenance and promotion of cell function. This metabolite leads to production of ATP, NADPH and precursors for the synthesis of macromolecules such as nucleic acids and phospholipids. We propose that, in addition to glucose, the 5-carbon amino acids glutamine and glutamate should be considered to be equally important for maintenance and promotion of cell function. The functions of glutamine/glutamate are many, i.e., they are substrates for protein synthesis, anabolic precursors for muscle growth, they regulate acid-base balance in the kidney, they are substrates for ureagenesis in the liver and for hepatic and renal gluconeogenesis, they act as an oxidative fuel for the intestine and cells of the immune system, provide inter-organ nitrogen transport, and act as precursors of neurotransmitter synthesis, of nucleotide and nucleic acid synthesis and of glutathione production. Many of these functions are interrelated with glucose metabolism. The specialized aspects of glutamine/glutamate metabolism of different glutamine-utilizing cells are discussed in the context of glucose requirements and cell function.

  7. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  8. Vitamin E-Mediated Modulation of Glutamate Receptor Expression in an Oxidative Stress Model of Neural Cells Derived from Embryonic Stem Cell Cultures

    Directory of Open Access Journals (Sweden)

    Afifah Abd Jalil

    2017-01-01

    Full Text Available Glutamate is the primary excitatory neurotransmitter in the central nervous system. Excessive concentrations of glutamate in the brain can be excitotoxic and cause oxidative stress, which is associated with Alzheimer’s disease. In the present study, the effects of vitamin E in the form of tocotrienol-rich fraction (TRF and alpha-tocopherol (α-TCP in modulating the glutamate receptor and neuron injury markers in an in vitro model of oxidative stress in neural-derived embryonic stem (ES cell cultures were elucidated. A transgenic mouse ES cell line (46C was differentiated into a neural lineage in vitro via induction with retinoic acid. These cells were then subjected to oxidative stress with a significantly high concentration of glutamate. Measurement of reactive oxygen species (ROS was performed after inducing glutamate excitotoxicity, and recovery from this toxicity in response to vitamin E was determined. The gene expression levels of glutamate receptors and neuron-specific enolase were elucidated using real-time PCR. The results reveal that neural cells derived from 46C cells and subjected to oxidative stress exhibit downregulation of NMDA, kainate receptor, and NSE after posttreatment with different concentrations of TRF and α-TCP, a sign of neurorecovery. Treatment of either TRF or α-TCP reduced the levels of ROS in neural cells subjected to glutamate-induced oxidative stress; these results indicated that vitamin E is a potent antioxidant.

  9. Glutamate production from ammonia via glutamate dehydrogenase 2 activity supports cancer cell proliferation under glutamine depletion.

    Science.gov (United States)

    Takeuchi, Yukiko; Nakayama, Yasumune; Fukusaki, Eiichiro; Irino, Yasuhiro

    2018-01-01

    Cancer cells rapidly consume glutamine as a carbon and nitrogen source to support proliferation, but the cell number continues to increase exponentially after glutamine is nearly depleted from the medium. In contrast, cell proliferation rates are strongly depressed when cells are cultured in glutamine-free medium. How cancer cells survive in response to nutrient limitation and cellular stress remains poorly understood. In addition, rapid glutamine catabolism yields ammonia, which is a potentially toxic metabolite that is secreted into the extracellular space. Here, we show that ammonia can be utilized for glutamate production, leading to cell proliferation under glutamine-depleted conditions. This proliferation requires glutamate dehydrogenase 2, which synthesizes glutamate from ammonia and α-ketoglutarate and is expressed in MCF7 and T47D cells. Our findings provide insight into how cancer cells survive under glutamine deprivation conditions and thus contribute to elucidating the mechanisms of tumor growth. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. A novel glutamate transport system in poly(γ-glutamic acid)-producing strain Bacillus subtilis CGMCC 0833.

    Science.gov (United States)

    Wu, Qun; Xu, Hong; Zhang, Dan; Ouyang, Pingkai

    2011-08-01

    Bacillus subtilis CGMCC 0833 is a poly(γ-glutamic acid) (γ-PGA)-producing strain. It has the capacity to tolerate high concentration of extracellular glutamate and to utilize glutamate actively. Such a high uptake capacity was owing to an active transport system for glutamate. Therefore, a specific transport system for L-glutamate has been observed in this strain. It was a novel transport process in which glutamate was symported with at least two protons, and an inward-directed sodium gradient had no stimulatory effect on it. K(m) and V(m) for glutamate transport were estimated to be 67 μM and 152 nmol⁻¹ min⁻¹ mg⁻¹ of protein, respectively. The transport system showed structural specificity and stereospecificity and was strongly dependent on extracellular pH. Moreover, it could be stimulated by Mg²⁺, NH₄⁺, and Ca²⁺. In addition, the glutamate transporter in this strain was studied at the molecular level. As there was no important mutation of the transporter protein, it appeared that the differences of glutamate transporter properties between this strain and other B. subtilis strains were not due to the differences of the amino acid sequence and the structure of transporter protein. This is the first extensive report on the properties of glutamate transport system in γ-PGA-producing strain.

  11. siRNA knock down of glutamate dehydrogenase in astrocytes affects glutamate metabolism leading to extensive accumulation of the neuroactive amino acids glutamate and aspartate.

    Science.gov (United States)

    Skytt, Dorte M; Klawonn, Anna M; Stridh, Malin H; Pajęcka, Kamilla; Patruss, Yasar; Quintana-Cabrera, Ruben; Bolaños, Juan P; Schousboe, Arne; Waagepetersen, Helle S

    2012-09-01

    Glutamate is the most abundant excitatory neurotransmitter in the brain and astrocytes are key players in sustaining glutamate homeostasis. Astrocytes take up the predominant part of glutamate after neurotransmission and metabolism of glutamate is necessary for a continuous efficient removal of glutamate from the synaptic area. Glutamate may either be amidated by glutamine synthetase or oxidatively metabolized in the mitochondria, the latter being at least to some extent initiated by oxidative deamination by glutamate dehydrogenase (GDH). To explore the particular importance of GDH for astrocyte metabolism we have knocked down GDH in cultured cortical astrocytes employing small interfering RNA (siRNA) achieving a reduction of the enzyme activity by approximately 44%. The astrocytes were incubated for 2h in medium containing either 1.0mM [(15)NH(4)(+)] or 100 μM [(15)N]glutamate. For those exposed to [(15)N]glutamate an additional 100 μM was added after 1h. Metabolic mapping was performed from isotope incorporation measured by mass spectrometry into relevant amino acids of cell extracts and media. The contents of the amino acids were measured by HPLC. The (15)N incorporation from [(15)NH(4)(+)] into glutamate, aspartate and alanine was decreased in astrocytes exhibiting reduced GDH activity. However, the reduced GDH activity had no effect on the cellular contents of these amino acids. This supports existing in vivo and in vitro studies that GDH is predominantly working in the direction of oxidative deamination and not reductive amination. In contrast, when exposing the astrocytes to [(15)N]glutamate, the reduced GDH activity led to an increased (15)N incorporation into glutamate, aspartate and alanine and a large increase in the content of glutamate and aspartate. Surprisingly, this accumulation of glutamate and net-synthesis of aspartate were not reflected in any alterations in either the glutamine content or labeling, but a slight increase in mono labeling of

  12. Convergence of dopamine and glutamate signalling onto striatal ERK activation in response to drugs of abuse.

    Directory of Open Access Journals (Sweden)

    Emma eCahill

    2014-01-01

    Full Text Available Despite their distinct targets, all addictive drugs commonly abused by humans evoke increases in dopamine (DA concentration within the striatum. The main DA G-Protein Coupled Receptors (GPCRs expressed by medium-sized spiny neurons (MSNs of the striatum are the D1R and D2R, which are positively and negatively coupled to cAMP/protein kinase A (PKA signalling, respectively. These two DA GPCRs are largely segregated into distinct neuronal populations, where they are co-expressed with glutamate receptors in dendritic spines. Direct and indirect interactions between DA GPCRs and glutamate receptors are the molecular basis by which DA modulates glutamate transmission and controls striatal plasticity and behaviour induced by drugs of abuse. A major downstream target of striatal D1R is the Extracellular signal-Regulated Kinase (ERK kinase pathway. ERK activation by drugs of abuse behaves as a key integrator of D1R and glutamate NMDAR signalling. Once activated, ERK can trigger chromatin remodelling and induce gene expression that permits long-term cellular alterations and drug-induced morphological and behavioural changes. Besides the classical cAMP/PKA pathway, downstream of D1R, recent evidence implicates a cAMP-independent crosstalk mechanism by which the D1R potentiates NMDAR-mediated calcium influx and ERK activation. The mounting evidence of reciprocal modulation of DA and glutamate receptors adds further intricacy to striatal synaptic signalling and is liable to prove relevant for addictive drug-induced signalling, plasticity and behaviour. Herein, we review the evidence that built our understanding of the consequences of this synergistic signalling for the actions of drugs of abuse.

  13. From the Cover: Glutamate antagonists limit tumor growth

    Science.gov (United States)

    Rzeski, Wojciech; Turski, Lechoslaw; Ikonomidou, Chrysanthy

    2001-05-01

    Neuronal progenitors and tumor cells possess propensity to proliferate and to migrate. Glutamate regulates proliferation and migration of neurons during development, but it is not known whether it influences proliferation and migration of tumor cells. We demonstrate that glutamate antagonists inhibit proliferation of human tumor cells. Colon adenocarcinoma, astrocytoma, and breast and lung carcinoma cells were most sensitive to the antiproliferative effect of the N-methyl-D-aspartate antagonist dizocilpine, whereas breast and lung carcinoma, colon adenocarcinoma, and neuroblastoma cells responded most favorably to the -amino-3-hydroxy-5-methyl-4-isoxazole-propionate antagonist GYKI52466. The antiproliferative effect of glutamate antagonists was Ca2+ dependent and resulted from decreased cell division and increased cell death. Morphological alterations induced by glutamate antagonists in tumor cells consisted of reduced membrane ruffling and pseudopodial protrusions. Furthermore, glutamate antagonists decreased motility and invasive growth of tumor cells. These findings suggest anticancer potential of glutamate antagonists.

  14. Glutamate Transporters in the Blood-Brain Barrier

    DEFF Research Database (Denmark)

    Helms, Hans Christian Cederberg; Nielsen, Carsten Uhd; Waagepetersen, Helle Sønderby

    2017-01-01

    The amino acid L-glutamate serves a number of roles in the central nervous system, being an excitatory neurotransmitter, metabolite, and building block in protein synthesis. During pathophysiological events, where L-glutamate homeostasis cannot be maintained, the increased brain interstitial fluid...... studies have demonstrated blood-to-brain transport of L-glutamate, at least during pathological events. A number of studies have shown that brain endothelial cells express excitatory amino acid transporters, which may account for abluminal concentrative uptake of L-glutamate into the capillary endothelial...... concentration of L-glutamate causes excitotoxicity. A tight control of the brain interstitial fluid L-glutamate levels is therefore imperative, in order to maintain optimal neurotransmission and to avoid such excitotoxicity. The blood-brain barrier, i.e., the endothelial lining of the brain capillaries...

  15. [Determination of glutamic acid in biological material by capillary electrophoresis].

    Science.gov (United States)

    Narezhnaya, E; Krukier, I; Avrutskaya, V; Degtyareva, A; Igumnova, E A

    2015-01-01

    The conditions for the identification and determination of Glutamic acid by capillary zone electrophoresis without their preliminary derivatization have been optimized. The effect of concentration of buffer electrolyte and pH on determination of Glutamic acid has been investigated. It is shown that the 5 Mm borate buffer concentration and a pH 9.15 are optimal. Quantitative determination of glutamic acid has been carried out using a linear dependence between the concentration of the analyte and the area of the peak. The accuracy and reproducibility of the determination are confirmed by the method "introduced - found". Glutamic acid has been determined in the placenta homogenate. The duration of analysis doesn't exceed 30 minutes. The results showed a decrease in the level of glutamic acid in cases of pregnancy complicated by placental insufficiency compared with the physiological, and this fact allows to consider the level of glutamic acid as a possible marker of complicated pregnancy.

  16. Bidirectional regulation of thermotaxis by glutamate transmissions in Caenorhabditis elegans.

    Science.gov (United States)

    Ohnishi, Noriyuki; Kuhara, Atsushi; Nakamura, Fumiya; Okochi, Yoshifumi; Mori, Ikue

    2011-04-06

    In complex neural circuits of the brain, massive information is processed with neuronal communication through synaptic transmissions. It is thus fundamental to delineate information flows encoded by various kinds of transmissions. Here, we show that glutamate signals from two distinct sensory neurons bidirectionally affect the same postsynaptic interneuron, thereby producing the opposite behaviours. EAT-4/VGLUT (vesicular glutamate transporter)-dependent glutamate signals from AFD thermosensory neurons inhibit the postsynaptic AIY interneurons through activation of GLC-3/GluCl inhibitory glutamate receptor and behaviourally drive migration towards colder temperature. By contrast, EAT-4-dependent glutamate signals from AWC thermosensory neurons stimulate the AIY neurons to induce migration towards warmer temperature. Alteration of the strength of AFD and AWC signals led to significant changes of AIY activity, resulting in drastic modulation of behaviour. We thus provide an important insight on information processing, in which two glutamate transmissions encoding opposite information flows regulate neural activities to produce a large spectrum of behavioural outputs.

  17. Expression of glutamate transporter, GABRA6, serine proteinase inhibitor 2 and low levels of glutamate and GABA in the brain of knock-out mouse for Canavan disease.

    Science.gov (United States)

    Surendran, Sankar; Rady, Peter L; Michals-Matalon, Kimberlee; Quast, Michael J; Rassin, David K; Campbell, Gerald A; Ezell, Ed L; Wei, Jingna; Tyring, Stephen K; Szucs, Sylvia; Matalon, Reuben

    2003-08-30

    Canavan disease (CD) is an autosomal recessive leukodystrophy characterized by spongy degeneration of the brain. The clinical features of CD are hypotonia, megalencephaly, and mental retardation leading to early death. While aspartoacylase (ASPA) activity increases with age in the wild type mouse brain, there is no ASPA activity in the CD mouse brain. So far ASPA deficiency and elevated NAA have been ascribed with the CD. Other factors affecting the brain that result from ASPA deficiency may lead pathophysiology of CD. The NMR spectra and amino acid analysis showed lower levels of glutamate and gamma-aminobutyric acid in the CD mouse brain compared to the wild type. Microarray gene expression on CD mouse brain showed glutamate transporter-EAAT4 and gamma-aminobutyric acid-A receptor, subunit alpha6 (GABRA6) were lower 9.7- and 119.1-fold, respectively. Serine proteinase inhibitor 2 (Spi2) was 29.9-fold higher in the CD mouse brain compared to the wild type. The decrease of GABRA6 and high expression of Spi2 in CD mouse brain were also confirmed by real-time RT-PCR. This first report showing abnormal expression of EAAT4, GABRA6, Spi2 combined with lower levels of glutamate and GABA are likely to be associated with the pathophysiology of CD.

  18. Relationship between Increase in Astrocytic GLT-1 Glutamate Transport and Late-LTP

    Science.gov (United States)

    Pita-Almenar, Juan D.; Zou, Shengwei; Colbert, Costa M.; Eskin, Arnold

    2012-01-01

    Na[superscript +]-dependent high-affinity glutamate transporters have important roles in the maintenance of basal levels of glutamate and clearance of glutamate during synaptic transmission. Interestingly, several studies have shown that basal glutamate transport displays plasticity. Glutamate uptake increases in hippocampal slices during early…

  19. Virus-induced gene silencing of RPC5-like subunit of RNA polymerase III caused pleiotropic effects in Nicotiana benthamiana

    Science.gov (United States)

    In eukaryotic cells, RNA polymerase III is highly conserved, contains 17 subunits and transcribes housekeeping genes such as ribosomal 50S rRNA, tRNA and other small RNAs. Functional roles of the RPC5 are poorly characterized in the literature. In this work, we report that virus-induced gene silenci...

  20. Bidirectional regulation of thermotaxis by glutamate transmissions in Caenorhabditis elegans

    OpenAIRE

    Ohnishi, Noriyuki; Kuhara, Atsushi; Nakamura, Fumiya; Okochi, Yoshifumi; Mori, Ikue

    2011-01-01

    In complex neural circuits of the brain, massive information is processed with neuronal communication through synaptic transmissions. It is thus fundamental to delineate information flows encoded by various kinds of transmissions. Here, we show that glutamate signals from two distinct sensory neurons bidirectionally affect the same postsynaptic interneuron, thereby producing the opposite behaviours. EAT-4/VGLUT (vesicular glutamate transporter)-dependent glutamate signals from AFD thermosenso...

  1. Pharmacological Treatment of Glutamate Excitotoxicity Following Traumatic Brain Injury

    Science.gov (United States)

    2009-01-14

    In 1969, Olney found that subcutaneous injection of monosodium glutamate resulted in necrotic brain lesions in the hypothalamus of newborn mice...Thesis: "Pharmacological Treatment of Glutamate Excitotoxicity Following Traumatic Brain Injury" Name of Candidate: Michael Doh Molecular & Cell...TYPE 3. DATES COVERED 00-00-2009 to 00-00-2009 4. TITLE AND SUBTITLE Pharmacological Treatment Of Glutamate Excitotoxicity Following Traumatic

  2. NADPH-dependent glutamate dehydrogenase in Penicillium chrysogenum is involved in regulation of beta-lactam production

    DEFF Research Database (Denmark)

    Thykær, Jette; Kildegaard, Kanchana Rueksomtawin; Noorman, H.

    2008-01-01

    The interactions between the ammonium assimilatory pathways and beta-lactam production were investigated by disruption of the NADPH-dependent glutamate dehydrogenase gene (gdhA) in two industrial beta-lactam-producing strains of Penicillium chrysogenum. The strains used were an adipoyl-7-ADCA...... continued beta-lactam production for the reference strains whereas the Delta gdhA strains remained non-productive under all conditions. By overexpressing the NAD-dependent glutamate dehydrogenase, the specific growth rate could be restored, but still no beta-lactam production was detected. The results...... indicate that the NADPH-dependent glutamate dehydrogenase may be directly or indirectly involved in the regulation of beta-lactann production in industrial strains of P. chrysogenum....

  3. Modular pathway engineering of Corynebacterium glutamicum for production of the glutamate-derived compounds ornithine, proline, putrescine, citrulline, and arginine.

    Science.gov (United States)

    Jensen, Jaide V K; Eberhardt, Dorit; Wendisch, Volker F

    2015-11-20

    The glutamate-derived bioproducts ornithine, citrulline, proline, putrescine, and arginine have applications in the food and feed, cosmetic, pharmaceutical, and chemical industries. Corynebacterium glutamicum is not only an excellent producer of glutamate but also of glutamate-derived products. Here, engineering targets beneficial for ornithine production were identified and the advantage of rationally constructing a platform strain for the production of the amino acids citrulline, proline, and arginine, and the diamine putrescine was demonstrated. Feedback alleviation of N-acetylglutamate kinase, tuning of the promoter of glutamate dehydrogenase gene gdh, lowering expression of phosphoglucoisomerase gene pgi, along with the introduction of a second copy of the arginine biosynthesis operon argCJB(A49V,M54V)D into the chromosome resulted in a C. glutamicum strain producing ornithine with a yield of 0.52 g ornithine per g glucose, an increase of 71% as compared to the parental ΔargFRG strain. Strains capable of producing 0.41 g citrulline per g glucose, 0.29 g proline per g glucose, 0.30 g arginine per g glucose, and 0.17 g putrescine per g glucose were derived from the ornithine-producing platform strain by plasmid-based overexpression of appropriate pathway modules with one to three genes. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Glutamate monitoring in vitro and in vivo: recent progress in the field of glutamate biosensors

    DEFF Research Database (Denmark)

    Rieben, Nathalie Ines; Rose, Nadia Cherouati; Martinez, Karen Laurence

    2009-01-01

    Glutamate is the major excitatory neurotransmitter in the mammalian central nervous system. It is involved in numerous important brain functions such as learning, memory and cognition, as well as the development and plasticity of the central nervous system. In order to ensure efficient signal...... transmission, glutamate is highly compartmentalized. Prolonged elevated extracellular levels of glutamate have been shown to be excitotoxic with the result of neuronal cell death ultimately. Furthermore, alterations in glutamate levels have been shown to be linked to several neurodegenerative disorders...... such as Alzheimer's, Parkinson's and Huntington's diseases, as well as ischemic stroke and amyotrophic lateral sclerosis. Accurate measurement of glutamate levels in vitro and in vivo for a better understanding of the physiological and pathological role of glutamate in neurotransmission has remained challenging...

  5. Dances with black widow spiders: dysregulation of glutamate signalling enters centre stage in ADHD.

    Science.gov (United States)

    Lesch, K P; Merker, S; Reif, A; Novak, M

    2013-06-01

    Attention-deficit/hyperactivity disorder (ADHD) is a common neurodevelopmental disorder with impairments across the lifespan. The persistence of ADHD is associated with considerable liability to neuropsychiatric co-morbidity such as depression, anxiety and substance use disorder. The substantial heritability of ADHD is well documented and recent genome-wide analyses for risk genes revealed synaptic adhesion molecules (e.g. latrophilin-3, LPHN3; fibronectin leucine-rich repeat transmembrane protein-3, FLRT3), glutamate receptors (e.g. metabotropic glutamate receptor-5, GRM5) and mediators of intracellular signalling pathways (e.g. nitric oxide synthase-1, NOS1). These genes encode principal components of the molecular machinery that connects pre- and postsynaptic neurons, facilitates glutamatergic transmission, controls synaptic plasticity and empowers intersecting neural circuits to process and refine information. Thus, identification of genetic variation affecting molecules essential for the formation, specification and function of excitatory synapses is refocusing research efforts on ADHD pathogenesis to include the long-neglected glutamate system. Copyright © 2012 Elsevier B.V. and ECNP. All rights reserved.

  6. Analysis of L-glutamic acid fermentation by using a dynamic metabolic simulation model of Escherichia coli.

    Science.gov (United States)

    Nishio, Yousuke; Ogishima, Soichi; Ichikawa, Masao; Yamada, Yohei; Usuda, Yoshihiro; Masuda, Tadashi; Tanaka, Hiroshi

    2013-09-22

    Understanding the process of amino acid fermentation as a comprehensive system is a challenging task. Previously, we developed a literature-based dynamic simulation model, which included transcriptional regulation, transcription, translation, and enzymatic reactions related to glycolysis, the pentose phosphate pathway, the tricarboxylic acid (TCA) cycle, and the anaplerotic pathway of Escherichia coli. During simulation, cell growth was defined such as to reproduce the experimental cell growth profile of fed-batch cultivation in jar fermenters. However, to confirm the biological appropriateness of our model, sensitivity analysis and experimental validation were required. We constructed an L-glutamic acid fermentation simulation model by removing sucAB, a gene encoding α-ketoglutarate dehydrogenase. We then performed systematic sensitivity analysis for L-glutamic acid production; the results of this process corresponded with previous experimental data regarding L-glutamic acid fermentation. Furthermore, it allowed us to predicted the possibility that accumulation of 3-phosphoglycerate in the cell would regulate the carbon flux into the TCA cycle and lead to an increase in the yield of L-glutamic acid via fermentation. We validated this hypothesis through a fermentation experiment involving a model L-glutamic acid-production strain, E. coli MG1655 ΔsucA in which the phosphoglycerate kinase gene had been amplified to cause accumulation of 3-phosphoglycerate. The observed increase in L-glutamic acid production verified the biologically meaningful predictive power of our dynamic metabolic simulation model. In this study, dynamic simulation using a literature-based model was shown to be useful for elucidating the precise mechanisms involved in fermentation processes inside the cell. Further exhaustive sensitivity analysis will facilitate identification of novel factors involved in the metabolic regulation of amino acid fermentation.

  7. GABA and glutamate pathways are spatially and developmentally affected in the brain of Mecp2-deficient mice.

    Directory of Open Access Journals (Sweden)

    Rita El-Khoury

    Full Text Available Proper brain functioning requires a fine-tuning between excitatory and inhibitory neurotransmission, a balance maintained through the regulation and release of glutamate and GABA. Rett syndrome (RTT is a rare genetic disorder caused by mutations in the methyl-CpG binding protein 2 (MECP2 gene affecting the postnatal brain development. Dysfunctions in the GABAergic and glutamatergic systems have been implicated in the neuropathology of RTT and a disruption of the balance between excitation and inhibition, together with a perturbation of the electrophysiological properties of GABA and glutamate neurons, were reported in the brain of the Mecp2-deficient mouse. However, to date, the extent and the nature of the GABA/glutamate deficit affecting the Mecp2-deficient mouse brain are unclear. In order to better characterize these deficits, we simultaneously analyzed the GABA and glutamate levels in Mecp2-deficient mice at 2 different ages (P35 and P55 and in several brain areas. We used a multilevel approach including the quantification of GABA and glutamate levels, as well as the quantification of the mRNA and protein expression levels of key genes involved in the GABAergic and glutamatergic pathways. Our results show that Mecp2-deficient mice displayed regional- and age-dependent variations in the GABA pathway and, to a lesser extent, in the glutamate pathway. The implication of the GABA pathway in the RTT neuropathology was further confirmed using an in vivo treatment with a GABA reuptake inhibitor that significantly improved the lifespan of Mecp2-deficient mice. Our results confirm that RTT mouse present a deficit in the GABAergic pathway and suggest that GABAergic modulators could be interesting therapeutic agents for this severe neurological disorder.

  8. Deep Sequencing of Serum Small RNAs Identifies Patterns of 5′ tRNA Half and YRNA Fragment Expression Associated with Breast Cancer

    Directory of Open Access Journals (Sweden)

    Joseph M. Dhahbi

    2014-01-01

    Full Text Available Small noncoding RNAs circulating in the blood may serve as signaling molecules because of their ability to carry out a variety of cellular functions. We have previously described tRNA- and YRNA-derived small RNAs circulating as components of larger complexes in the blood of humans and mice; the characteristics of these small RNAs imply specific processing, secretion, and physiological regulation. In this study, we have asked if changes in the serum abundance of these tRNA and YRNA fragments are associated with a diagnosis of cancer. We used deep sequencing and informatics analysis to catalog small RNAs in the sera of breast cancer cases and normal controls. 5′ tRNA halves and YRNA fragments are abundant in both groups, but we found that a breast cancer diagnosis is associated with changes in levels of specific subtypes. This prompted us to look at existing sequence datasets of serum small RNAs from 42 breast cancer cases, taken at the time of diagnosis. We find significant changes in the levels of specific 5′ tRNA halves and YRNA fragments associated with clinicopathologic characteristics of the cancer. Although these findings do not establish causality, they suggest that circulating 5′ tRNA halves and YRNA fragments with known cellular functions may participate in breast cancer syndromes and have potential as circulating biomarkers. Larger studies with multiple types of cancer are needed to adequately evaluate their potential use for the development of noninvasive cancer screening.

  9. Affinity labeling of Escherichia coli phenylalanyl-tRNA synthetase at the binding site for tRNA

    International Nuclear Information System (INIS)

    Hountondji, C.; Schmitter, J.M.; Beauvallet, C.; Blanquet, S.

    1987-01-01

    Periodate-oxidized tRNA/sup Phe/ (tRNA/sub ox//sup Phe/) behaves as a specific affinity label of tetrameric Escherichia coli phenylalanyl-tRNA synthetase (PheRS). Reaction of the α 2 β 2 enzyme with tRNA/sub ox//sup Phe/ results in the loss of tRNA/sup Phe/ aminoacylation activity with covalent attachment of 2 mol of tRNA dialdehyde/mol of enzyme, in agreement with the stoichiometry of tRNA binding. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of the PheRS-[ 14 C]tRNA/sub ox//sup Phe/ covalent complex indicates that the large (α, M/sub r/ 87K) subunit of the enzyme interacts with the 3'-adenosine of tRNA/sub ox//sup Phe/. The [ 14 C]tRNA-labeled chymotryptic peptides of PheRS were purified by both gel filtration and reverse-phase high-performance liquid chromatography. The radioactivity was almost equally distributed among three peptides: Met-Lys[Ado]-Phe, Ala-Asp-Lys[Ado]-Leu, and Lys-Ile-Lys[Ado]-Ala. These sequences correspond to residues 1-3, 59-62, and 104-107, respectively, in the N-terminal region of the 795 amino acid sequence of the α subunit. It is noticeable that the labeled peptide Ala-Asp-Lys-Leu is adjacent to residues 63-66 (Arg-Val-Thr-Lys). The latter sequence was just predicted to resemble the proposed consensus tRNA CCA binding region Lys-Met-Ser-Lys-Ser, as deduced from previous affinity labeling studies on E. coli methionyl- and tyrosyl-tRNA synthetases

  10. In situ measurement of glutamate concentrations in the periportal, intermediate, and pericentral zones of rat liver

    NARCIS (Netherlands)

    Geerts, W. J.; Jonker, A.; Boon, L.; Meijer, A. J.; Charles, R.; van Noorden, C. J.; Lamers, W. H.

    1997-01-01

    We developed a quantitative histochemical assay for measurement of local glutamate concentrations in cryostat sections of rat liver. Deamination of glutamate by glutamate dehydrogenase (GDH) was coupled to the production of formazan and formazan precipitation was used for colorimetric visualization.

  11. Identification and characterization of a bacterial glutamic peptidase.

    Science.gov (United States)

    Jensen, Kenneth; Østergaard, Peter R; Wilting, Reinhard; Lassen, Søren F

    2010-12-01

    Glutamic peptidases, from the MEROPS family G1, are a distinct group of peptidases characterized by a catalytic dyad consisting of a glutamate and a glutamine residue, optimal activity at acidic pH and insensitivity towards the microbial derived protease inhibitor, pepstatin. Previously, only glutamic peptidases derived from filamentous fungi have been characterized. We report the first characterization of a bacterial glutamic peptidase (pepG1), derived from the thermoacidophilic bacteria Alicyclobacillus sp. DSM 15716. The amino acid sequence identity between pepG1 and known fungal glutamic peptidases is only 24-30% but homology modeling, the presence of the glutamate/glutamine catalytic dyad and a number of highly conserved motifs strongly support the inclusion of pepG1 as a glutamic peptidase. Phylogenetic analysis places pepG1 and other putative bacterial and archaeal glutamic peptidases in a cluster separate from the fungal glutamic peptidases, indicating a divergent and independent evolution of bacterial and fungal glutamic peptidases. Purification of pepG1, heterologously expressed in Bacillus subtilis, was performed using hydrophobic interaction chromatography and ion exchange chromatography. The purified peptidase was characterized with respect to its physical properties. Temperature and pH optimums were found to be 60°C and pH 3-4, in agreement with the values observed for the fungal members of family G1. In addition, pepG1 was found to be pepstatin-insensitive, a characteristic signature of glutamic peptidases. Based on the obtained results, we suggest that pepG1 can be added to the MEROPS family G1 as the first characterized bacterial member.

  12. Identification and characterization of a bacterial glutamic peptidase

    Directory of Open Access Journals (Sweden)

    Jensen Kenneth

    2010-12-01

    Full Text Available Abstract Background Glutamic peptidases, from the MEROPS family G1, are a distinct group of peptidases characterized by a catalytic dyad consisting of a glutamate and a glutamine residue, optimal activity at acidic pH and insensitivity towards the microbial derived protease inhibitor, pepstatin. Previously, only glutamic peptidases derived from filamentous fungi have been characterized. Results We report the first characterization of a bacterial glutamic peptidase (pepG1, derived from the thermoacidophilic bacteria Alicyclobacillus sp. DSM 15716. The amino acid sequence identity between pepG1 and known fungal glutamic peptidases is only 24-30% but homology modeling, the presence of the glutamate/glutamine catalytic dyad and a number of highly conserved motifs strongly support the inclusion of pepG1 as a glutamic peptidase. Phylogenetic analysis places pepG1 and other putative bacterial and archaeal glutamic peptidases in a cluster separate from the fungal glutamic peptidases, indicating a divergent and independent evolution of bacterial and fungal glutamic peptidases. Purification of pepG1, heterologously expressed in Bacillus subtilis, was performed using hydrophobic interaction chromatography and ion exchange chromatography. The purified peptidase was characterized with respect to its physical properties. Temperature and pH optimums were found to be 60°C and pH 3-4, in agreement with the values observed for the fungal members of family G1. In addition, pepG1 was found to be pepstatin-insensitive, a characteristic signature of glutamic peptidases. Conclusions Based on the obtained results, we suggest that pepG1 can be added to the MEROPS family G1 as the first characterized bacterial member.

  13. Rat odontoblasts may use glutamate to signal dentin injury.

    Science.gov (United States)

    Cho, Yi Sul; Ryu, Chang Hyun; Won, Jong Hwa; Vang, Hue; Oh, Seog Bae; Ro, Jin Young; Bae, Yong Chul

    2016-10-29

    Accumulating evidence indicates that odontoblasts act as sensor cells, capable of triggering action potentials in adjacent pulpal nociceptive axons, suggesting a paracrine signaling via a currently unknown mediator. Since glutamate can mediate signaling by non-neuronal cells, and peripheral axons may express glutamate receptors (GluR), we hypothesized that the expression of high levels of glutamate, and of sensory receptors in odontoblasts, combined with an expression of GluR in adjacent pulpal axons, is the morphological basis for odontoblastic sensory signaling. To test this hypothesis, we investigated the expression of glutamate, the thermo- and mechanosensitive ion channels transient receptor potential vanilloid 1 (TRPV1), transient receptor potential ankyrin 1 (TRPA1), and TWIK-1-related K+channel (TREK-1), and the glutamate receptor mGluR5, in a normal rat dental pulp, and following dentin injury. We also examined the glutamate release from odontoblast in cell culture. Odontoblasts were enriched with glutamate, at the level as high as in adjacent pulpal axons, and showed immunoreactivity for TRPV1, TRPA1, and TREK-1. Pulpal sensory axons adjacent to odontoblasts expressed mGluR5. Both the levels of glutamate in odontoblasts, and the expression of mGluR5 in nearby axons, were upregulated following dentin injury. The extracellular glutamate concentration was increased significantly after treating of odontoblast cell line with calcium permeable ionophore, suggesting glutamate release from odontoblasts. These findings lend morphological support to the hypothesis that odontoblasts contain glutamate as a potential neuroactive substance that may activate adjacent pulpal axons, and thus contribute to dental pain and hypersensitivity. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.

  14. Glutamate Dehydrogenase Is Required by Mycobacterium bovis BCG for Resistance to Cellular Stress.

    Directory of Open Access Journals (Sweden)

    James L Gallant

    Full Text Available We recently reported on our success to generate deletion mutants of the genes encoding glutamate dehydrogenase (GDH and glutamine oxoglutarate aminotransferase (GOGAT in M. bovis BCG, despite their in vitro essentiality in M. tuberculosis. We could use these mutants to delineate the roles of GDH and GOGAT in mycobacterial nitrogen metabolism by using M. bovis BCG as a model for M. tuberculosis specifically. Here, we extended our investigation towards the involvement of GDH and GOGAT in other aspects of M. bovis BCG physiology, including the use of glutamate as a carbon source and resistance to known phagosomal stresses, as well as in survival inside macrophages. We find that gdh is indispensable for the utilization of glutamate as a major carbon source, in low pH environments and when challenged with nitric oxide. On the other hand, the gltBD mutant had increased viability under low pH conditions and was unaffected by a challenge with nitric oxide. Strikingly, GDH was required to sustain M. bovis BCG during infection of both murine RAW 264.7 and bone-marrow derived and macrophages, while GOGAT was not. We conclude that the catabolism of glutamate in slow growing mycobacteria may be a crucial function during infection of macrophage cells and demonstrate a novel requirement for M. bovis BCG GDH in the protection against acidic and nitrosative stress. These results provide strong clues on the role of GDH in intracellular survival of M. tuberculosis, in which the essentiality of the gdh gene complicates knock out studies making the study of the role of this enzyme in pathogenesis difficult.

  15. Glutamate Dehydrogenase Is Required by Mycobacterium bovis BCG for Resistance to Cellular Stress.

    Science.gov (United States)

    Gallant, James L; Viljoen, Albertus J; van Helden, Paul D; Wiid, Ian J F

    2016-01-01

    We recently reported on our success to generate deletion mutants of the genes encoding glutamate dehydrogenase (GDH) and glutamine oxoglutarate aminotransferase (GOGAT) in M. bovis BCG, despite their in vitro essentiality in M. tuberculosis. We could use these mutants to delineate the roles of GDH and GOGAT in mycobacterial nitrogen metabolism by using M. bovis BCG as a model for M. tuberculosis specifically. Here, we extended our investigation towards the involvement of GDH and GOGAT in other aspects of M. bovis BCG physiology, including the use of glutamate as a carbon source and resistance to known phagosomal stresses, as well as in survival inside macrophages. We find that gdh is indispensable for the utilization of glutamate as a major carbon source, in low pH environments and when challenged with nitric oxide. On the other hand, the gltBD mutant had increased viability under low pH conditions and was unaffected by a challenge with nitric oxide. Strikingly, GDH was required to sustain M. bovis BCG during infection of both murine RAW 264.7 and bone-marrow derived and macrophages, while GOGAT was not. We conclude that the catabolism of glutamate in slow growing mycobacteria may be a crucial function during infection of macrophage cells and demonstrate a novel requirement for M. bovis BCG GDH in the protection against acidic and nitrosative stress. These results provide strong clues on the role of GDH in intracellular survival of M. tuberculosis, in which the essentiality of the gdh gene complicates knock out studies making the study of the role of this enzyme in pathogenesis difficult.

  16. Novel Inhibitors Complexed with Glutamate Dehydrogenase

    Science.gov (United States)

    Li, Ming; Smith, Christopher J.; Walker, Matthew T.; Smith, Thomas J.

    2009-01-01

    Mammalian glutamate dehydrogenase (GDH) is a homohexameric enzyme that catalyzes the reversible oxidative deamination of l-glutamate to 2-oxoglutarate using NAD(P)+ as coenzyme. Unlike its counterparts from other animal kingdoms, mammalian GDH is regulated by a host of ligands. The recently discovered hyperinsulinism/hyperammonemia disorder showed that the loss of allosteric inhibition of GDH by GTP causes excessive secretion of insulin. Subsequent studies demonstrated that wild-type and hyperinsulinemia/hyperammonemia forms of GDH are inhibited by the green tea polyphenols, epigallocatechin gallate and epicatechin gallate. This was followed by high throughput studies that identified more stable inhibitors, including hexachlorophene, GW5074, and bithionol. Shown here are the structures of GDH complexed with these three compounds. Hexachlorophene forms a ring around the internal cavity in GDH through aromatic stacking interactions between the drug and GDH as well as between the drug molecules themselves. In contrast, GW5074 and bithionol both bind as pairs of stacked compounds at hexameric 2-fold axes between the dimers of subunits. The internal core of GDH contracts when the catalytic cleft closes during enzymatic turnover. None of the drugs cause conformational changes in the contact residues, but all bind to key interfaces involved in this contraction process. Therefore, it seems likely that the drugs inhibit enzymatic turnover by inhibiting this transition. Indeed, this expansion/contraction process may play a major role in the inter-subunit communication and allosteric regulation observed in GDH. PMID:19531491

  17. Glutamate Receptors in Neuroinflammatory Demyelinating Disease

    Directory of Open Access Journals (Sweden)

    2006-01-01

    Full Text Available Multiple sclerosis (MS is a chronic demyelinating disease of the human central nervous system (CNS. The condition predominantly affects young adults and is characterised by immunological and inflammatory changes in the periphery and CNS that contribute to neurovascular disruption, haemopoietic cell invasion of target tissues, and demyelination of nerve fibres which culminate in neurological deficits that relapse and remit or are progressive. The main features of MS can be reproduced in the inducible animal counterpart, experimental autoimmune encephalomyelitis (EAE. The search for new MS treatments invariably employs EAE to determine drug activity and provide a rationale for exploring clinical efficacy. The preclinical development of compounds for MS has generally followed a conventional, immunotherapeutic route. However, over the past decade, a group of compounds that suppress EAE but have no apparent immunomodulatory activity have emerged. These drugs interact with the N-methyl-D-aspartate (NMDA and α -amino-3-hydroxy-5-isoxazolepropionic acid (AMPA/kainate family of glutamate receptors reported to control neurovascular permeability, inflammatory mediator synthesis, and resident glial cell functions including CNS myelination. The review considers the importance of the glutamate receptors in EAE and MS pathogenesis. The use of receptor antagonists to control EAE is also discussed together with the possibility of therapeutic application in demyelinating disease.

  18. Influence of the glutamic acid content of the diet on the catabolic rate of labelled glutamic acid in rats. 3

    International Nuclear Information System (INIS)

    Simon, O.; Wilke, A.; Bergner, H.

    1984-01-01

    Mal rats received during a 8 days experimental feeding period diets with different contents in glutamic acid. The daily feed intake was restricted to the energy maintenance level of 460 kJ/kg/sup 0.75/. The diet contained a mixture of L-amino acids corresponding to the pattern of egg protein except glutamic acid. Glutamic acid was added successively at 10 levels (0 to 14.8 % of dry matter) and the resulting diets were fed to groups of 4 animals each. At the end of the experimental feeding period 14 C- and 15 N-labelled glutamic acid were applied by intragastric infusion. CO 2 and 14 CO 2 excretion was measured during the following 4 hours and the urinary N and 15 N excretion during the following 24 hours. The CO 2 excretion decreased from 53 to 44 mmol CO 2 /100g body weight with increasing levels of dietary glutamic acid. This change seems to result from the increasing proportion of amino acids as an energetic fuel. While the amount of oxidized glutamic acid increased with increasing supplements of glutamic acid the relative 14 CO 2 excretion decreased from 57 to 48 % of the applied radioactivity. The urinary 15 N excretion during 24 hours was 31 % of the given amount of 15 N if no glutamic acid was included in the diet. This proportion increased successively up to 52 % in the case of the highest supply of glutamic acid. Because the total N excretion increased at the same extent as the 15 N excretion a complete mixing of the NH 2 groups resulting from glutamic acid due to desamination with the ammonia pool was assumed. No correlation between glutamic acid content of the diet and specific radioactivity of CO 2 or atom-% 15 N excess of urinary N was observed. (author)

  19. Application of a glutamate microsensor to brain tissue

    NARCIS (Netherlands)

    Oldenziel, Weite Hendrik

    2006-01-01

    The amino acid l-glutamate is one of the most important neurotransmitters in the central nervous system (CNS). It is involved in many physiological processes and consequently in the pathophysiology of several psychiatric, neurological and neurodegenerative disorders. Therefore, glutamate is an

  20. Histochemical Studies of the Effects of Monosodium Glutamate on ...

    African Journals Online (AJOL)

    Background: Monosodium glutamate (MSG) is a commonly used food additive and there is growing concern that excitotoxins such as MSG play a critical role in the development of several hepatic disorders. Objectives: The histochemical effect of monosodium glutamate was investigated on the liver of adult Wistar rats.

  1. probing the cob(ii)alamin conductor hypothesis with glutamate ...

    African Journals Online (AJOL)

    dell

    Glutamate mutase activity was also demonstrated upon incubation of GlmS and E with 3',5'- ... overproduced in E.coli (Huhta et al. 2001,. Huhta et ..... Biochemistry. 37: 9704-9715. Buckel W 2001 Unusual enzymes involved in five pathways of glutamate fermentation. Appl. Microbiol. Biotechnol. 57: 263-273. Buckel W and ...

  2. Glutamate and Neurotrophic Factors in Neuronal Plasticity and Disease

    Science.gov (United States)

    Mattson, Mark P.

    2008-01-01

    Glutamate’s role as a neurotransmitter at synapses has been known for 40 years, but glutamate has since been shown to regulate neurogenesis, neurite outgrowth, synaptogenesis and neuron survival in the developing and adult mammalian nervous system. Cell surface glutamate receptors are coupled to Ca2+ influx and release from endoplasmic reticulum stores which causes rapid (kinase- and protease-mediated) and delayed (transcription-dependent) responses that change the structure and function of neurons. Neurotrophic factors and glutamate interact to regulate developmental and adult neuroplasticity. For example, glutamate stimulates the production of brain-derived neurotrophic factor (BDNF) which, in turn, modifies neuronal glutamate sensitivity, Ca2+ homeostasis and plasticity. Neurotrophic factors may modify glutamate signalling directly, by changing the expression of glutamate receptor subunits and Ca2+-regulating proteins, and also indirectly by inducing the production of antioxidant enzymes, energy-regulating proteins and anti-apoptotic Bcl2 family members. Excessive activation of glutamate receptors, under conditions of oxidative and metabolic stress, may contribute to neuronal dysfunction and degeneration in diseases ranging from stroke and Alzheimer’s disease to psychiatric disorders. By enhancing neurotrophic factor signalling, environmental factors such as exercise and dietary energy restriction, and chemicals such as antidepressants may optimize glutamatergic signalling and protect against neurological disorders. PMID:19076369

  3. A review of glutamate's role in traumatic brain injury mechanisms

    Science.gov (United States)

    Good, Cameron H.

    2013-05-01

    Glutamate is the primary excitatory neurotransmitter used by the central nervous system (CNS) for synaptic communication, and its extracellular concentration is tightly regulated by glutamate transporters located on nearby astrocytes. Both animal models and human clinical studies have demonstrated elevated glutamate levels immediately following a traumatic brain event, with the duration and severity of the rise corresponding to prognosis. This rise in extracellular glutamate likely results from a combination of excessive neurotransmitter release from damaged neurons and down regulation of uptake mechanisms in local astrocytes. The immediate results of a traumatic event can lead to necrotic tissue in severely injured regions, while prolonged increases in excitatory transmission can cause secondary excitotoxic injury through activation of delayed apoptotic pathways. Initial TBI animal studies utilized a variety of broad glutamate receptor antagonists to successfully combat secondary injury mechanisms, but unfortunately this same strategy has proven inconclusive in subsequent human trials due to deleterious side effects and heterogeneity of injuries. More recent treatment strategies have utilized specific glutamate receptor subunit antagonists in an effort to minimize side effects and have shown promising results. Future challenges will be detecting the concentration and kinetics of the glutamate rise following injury, determining which patient populations could benefit from antagonist treatment based on their extracellular glutamate concentrations and when drugs should be administered to maximize efficacy.

  4. Microscopic picture of the aqueous solvation of glutamic acid

    NARCIS (Netherlands)

    Leenders, E.J.M.; Bolhuis, P.G.; Meijer, E.J.

    2008-01-01

    We present molecular dynamics simulations of glutamic acid and glutamate solvated in water, using both density functional theory (DFT) and the Gromos96 force field. We focus on the microscopic aspects of the solvation−particularly on the hydrogen bond structures and dynamics−and investigate the

  5. Some Properties of Glutamate Dehydrogenase from the Marine Red ...

    African Journals Online (AJOL)

    Keywords: ammonia assimilation, glutamate dehydrogenase, GDH, Gracilaria sordida, red alga, enzyme activity. Glutamate dehydrogenases (GDH, EC ... Anabolic functions could be assimilation of ammonia released during photorespiration and synthesis of N-rich transport compounds. Western Indian Ocean Journal of ...

  6. Surface grafting of poly(L-glutamates). 3. Block copolymerization

    NARCIS (Netherlands)

    Wieringa, RH; Siesling, EA; Werkman, PJ; Vorenkamp, EJ; Schouten, AJ

    2001-01-01

    This paper describes for the first time the synthesis of surface-grafted AB-block copolypeptides, consisting of poly(gamma -benzyl L-glutamate) (PBLG) as the A-block and poly(gamma -methyl L-glutamate) (PMLG) as the B-block. Immobilized primary amine groups of (,gamma -aminopropyl)triethoxysilane

  7. 21 CFR 522.1125 - Hemoglobin glutamer-200 (bovine).

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Hemoglobin glutamer-200 (bovine). 522.1125 Section... (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS IMPLANTATION OR INJECTABLE DOSAGE FORM NEW ANIMAL DRUGS § 522.1125 Hemoglobin glutamer-200 (bovine). (a) Specifications. Each 125 milliliter bag contains 13...

  8. Electrochemical Synthesis of Polypyrrole Layers Doped with Glutamic Ions

    NARCIS (Netherlands)

    Meteleva-Fischer, Yulia V.; Von Hauff, Elizabeth; Parisi, Juergen

    2009-01-01

    Electrochemically synthesized polypyrrole thin films doped with glutamic ions were investigated as interesting materials for potential use as molecularly selective surfaces. Pyrrole and glutamate interact in aqueous solution, resulting in the formation of a prominent band at 240 nm in the absorption

  9. Dietary glutamate will not affect pain in fibromyalgia

    NARCIS (Netherlands)

    Geenen, R.; Janssens, E.L.; Jacobs, J.W.G.; Staveren, van W.A.

    2004-01-01

    Injection of glutamate into the masseter muscle has been suggested-to evoke an increase in intensity of and sensitivity to pain. A case study showed that a diet low in monosodium glutamate (MSG) might accomplish pain relief in fibromyalgia (FM). To clarify the possible pain-modulating effect of

  10. Histological Studies of the Effects of Monosodium Glutamate on the ...

    African Journals Online (AJOL)

    Background: Monosodium glutamate (MSG) is a commonly used food additive and there is growing concern that this may play a critical role in the aethiopathogenesis of anovulatory infertility. Objectives: The effect of monosodium glutamate (MSG) used as food additive on the ovaries of adult Wistar rat was investigated.

  11. Riluzole partially rescues age-associated, but not LPS-induced, loss of glutamate transporters and spatial memory.

    Science.gov (United States)

    Brothers, Holly M; Bardou, Isabelle; Hopp, Sarah C; Kaercher, Roxanne M; Corona, Angela W; Fenn, Ashley M; Godbout, Jonathan P; Wenk, Gary L

    2013-12-01

    Impaired memory may result from synaptic glutamatergic dysregulation related to chronic neuroinflammation. GLT1 is the primary excitatory amino acid transporter responsible for regulating extracellular glutamate levels in the hippocampus. We tested the hypothesis that if impaired spatial memory results from increased extracellular glutamate due to age or experimentally induced chronic neuroinflammation in the hippocampus, then pharmacological augmentation of the glutamate transporter GLT1 will attenuate deficits in a hippocampal-dependent spatial memory task. The profile of inflammation-related genes and proteins associated with normal aging, or chronic neuroinflammation experimentally-induced via a four-week LPS infusion into the IV(th) ventricle, were correlated with performance in the Morris water maze following treatment with Riluzole, a drug that can enhance glutamate clearance by increasing GLT1 expression. Age-associated inflammation was qualitatively different from LPS-induced neuro-inflammation in young rats. LPS produced a pro-inflammatory phenotype characterized by increased IL-1ß expression in the hippocampus, whereas aging was not associated with a strong central pro-inflammatory response but with a mixed peripheral immune phenotype. Riluzole attenuated the spatial memory impairment, the elevation of serum cytokines and the decrease in GLT1 gene expression in Aged rats, but had no effect on young rats infused with LPS. Our findings highlight the therapeutic potential of reducing glutamatergic function upon memory impairment in neurodegenerative diseases associated with aging.

  12. Astrocytes revisited: concise historic outlook on glutamate homeostasis and signaling

    Science.gov (United States)

    Parpura, Vladimir; Verkhratsky, Alexei

    2012-01-01

    Astroglia is a main type of brain neuroglia, which includes many cell sub-types that differ in their morphology and physiological properties and yet are united by the main function, which is the maintenance of brain homeostasis. Astrocytes employ a variety of mechanisms for communicating with neuronal networks. The communication mediated by neurotransmitter glutamate has received a particular attention. Glutamate is de novo synthesized exclusively in astrocytes; astroglia-derived glutamine is the source of glutamate for neurons. Glutamate is released from both neurons and astroglia through exocytosis, although various other mechanisms may also play a role. Glutamate-activated specific receptors trigger excitatory responses in neurons and astroglia. Here we overview main properties of glutamatergic transmission in neuronal-glial networks and identify some future challenges facing the field. PMID:23275317

  13. Why should cancer biologists care about tRNAs? tRNA synthesis, mRNA translation and the control of growth.

    Science.gov (United States)

    Grewal, Savraj S

    2015-07-01

    Transfer RNAs (tRNAs) are essential for mRNA translation. They are transcribed in the nucleus by RNA polymerase III and undergo many modifications before contributing to cytoplasmic protein synthesis. In this review I highlight our understanding of how tRNA biology may be linked to the regulation of mRNA translation, growth and tumorigenesis. First, I review how oncogenes and tumour suppressor signalling pathways, such as the PI3 kinase/TORC1, Ras/ERK, Myc, p53 and Rb pathways, regulate Pol III and tRNA synthesis. In several cases, this regulation contributes to cell, tissue and body growth, and has implications for our understanding of tumorigenesis. Second, I highlight some recent work, particularly in model organisms such as yeast and Drosophila, that shows how alterations in tRNA synthesis may be not only necessary, but also sufficient to drive changes in mRNA translation and growth. These effects may arise due to both absolute increases in total tRNA levels, but also changes in the relative levels of tRNAs in the overall pool. Finally, I review some recent studies that have revealed how tRNA modifications (amino acid acylation, base modifications, subcellular shuttling, and cleavage) can be regulated by growth and stress cues to selectively influence mRNA translation. Together these studies emphasize the importance of the regulation of tRNA synthesis and modification as critical control points in protein synthesis and growth. This article is part of a Special Issue entitled: Translation and Cancer. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Genome-wide analysis of tRNA charging and activation of the eIF2 kinase Gcn2p.

    Science.gov (United States)

    Zaborske, John M; Narasimhan, Jana; Jiang, Li; Wek, Sheree A; Dittmar, Kimberly A; Freimoser, Florien; Pan, Tao; Wek, Ronald C

    2009-09-11

    When cells are subjected to nutritional stress, uncharged tRNAs accumulate and activate Gcn2p phosphorylation of eukaryotic initiation factor-2 (eIF2) and the general amino acid control pathway. The Gcn2p regulatory domain homologous to histidyl-tRNA synthetases is proposed to bind to uncharged tRNA, directly contributing to activation of Gcn2p. Here we apply a microarray technology to analyze genome-wide changes in tRNA charging in yeast upon activation of Gcn2p in response to amino acid starvation and high salinity, a stress not directly linked to nutritional deficiency. This microarray technology is applicable for all eukaryotic cells. Strains were starved for histidine, leucine, or tryptophan and shown to rapidly induce Gcn2p phosphorylation of eIF2. The relative charging level of all tRNAs was measured before and after starvation, and Gcn2p activation and the intracellular levels of the starved amino acid correlate with the observed decrease in tRNA charging. Interestingly, in some cases, tRNAs not charged with the starved amino acid became deacylated more rapidly than tRNAs charged with the starved amino acid. This increase in uncharged tRNA levels occurred although the intracellular levels for these non-starved amino acids remained unchanged. Additionally, treatment of a wild-type strain with high salinity stress showed transient changes in the charging of several different tRNAs. These results suggest that Gcn2p can be activated by many different tRNA species in the cell. These results also depict a complex cellular relationship between tRNA charging, amino acid availability, and non-nutrient stress. These relationships are best revealed by simultaneous monitoring of the charging level of all tRNAs.

  15. Targeting ribonucleic acids by toxic small molecules: structural perturbation and energetics of interaction of phenothiazinium dyes thionine and toluidine blue O to tRNA phe.

    Science.gov (United States)

    Paul, Puja; Kumar, Gopinatha Suresh

    2013-12-15

    This study was designed to examine the toxic interaction of two phenothiazinium dyes thionine (TO) and toluidine blue O (TBO) with tRNA(phe) by spectroscopic and calorimetric techniques. While phenothiazinium dye complexation with DNA is known, their bindings to RNA are not fully investigated. The non cooperative binding of both the dyes to tRNA was revealed from absorbance and fluorescence studies. From absorption, steady-state emission, the effect of ferrocyanide ion-induced steady-state fluorescence quenching, circular dichroism, the mode of binding of these dyes into the tRNA helix has been substantiated to be principally by intercalative in nature. Both dyes enhanced the thermal stability of tRNA. Circular dichroism studies provided evidence for the structural perturbations associated with the tRNA structure with induction of optical activity in the CD inactive dye molecules. Results from isothermal titration calorimetry experiments suggested that the binding of both dyes was predominantly entropy driven with a smaller but favorable enthalpy term that increased with temperature. The binding was dependent on the Na(+) concentration, but had a larger non-electrostatic contribution to the Gibbs energy. A small heat capacity value and the enthalpy-entropy compensation in the energetics of the interaction characterized the binding of the dyes to tRNA. This study confirms that the tRNA(phe) binding affinity is greater for TO compared to TBO. The utility of the present work lies in understanding the potential binding and consequent damage to tRNA by these toxic dyes in their development as therapeutic agents. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

    2004-01-01

    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  17. Mutational analysis of the mitochondrial 12S rRNA and tRNASer(UCN) genes in Tunisian patients with nonsyndromic hearing loss

    International Nuclear Information System (INIS)

    Mkaouar-Rebai, Emna; Tlili, Abdelaziz; Masmoudi, Saber; Louhichi, Nacim; Charfeddine, Ilhem; Amor, Mohamed Ben; Lahmar, Imed; Driss, Nabil; Drira, Mohamed; Ayadi, Hammadi; Fakhfakh, Faiza

    2006-01-01

    We explored the mitochondrial 12S rRNA and the tRNA Ser(UCN) genes in 100 Tunisian families affected with NSHL and in 100 control individuals. We identified the mitochondrial A1555G mutation in one out of these 100 families and not in the 100 control individuals. Members of this family harbouring the A1555G mutation showed phenotypic heterogeneity which could be explained by an eventual nuclear-mitochondrial interaction. So, we have screened three nuclear genes: GJB2, GJB3, and GJB6 but we have not found correlation between the phenotypic heterogeneity and variants detected in these genes. We explored also the entire mitochondrial 12S rRNA and the tRNA Ser(UCN) genes. We detected five novel polymorphisms: T742C, T794A, A813G, C868T, and C954T, and 12 known polymorphisms in the mitochondrial 12S rRNA gene. None of the 100 families or the 100 controls were found to carry mutations in the tRNA Ser(UCN) gene. We report here First mutational screening of the mitochondrial 12S rRNA and the tRNA Ser(UCN) genes in the Tunisian population which describes the second family harbouring the A1555G mutation in Africa and reveals novel polymorphisms in the mitochondrial 12S rRNA gene

  18. Structure, Mechanism, and Specificity of a Eukaryal tRNA Restriction Enzyme Involved in Self-Nonself Discrimination

    Directory of Open Access Journals (Sweden)

    Anupam K. Chakravarty

    2014-04-01

    Full Text Available tRNA restriction by anticodon nucleases underlies cellular stress responses and self-nonself discrimination in a wide range of taxa. Anticodon breakage inhibits protein synthesis, which, in turn, results in growth arrest or cell death. The eukaryal ribotoxin PaT secreted by Pichia acaciae inhibits growth of Saccharomyces cerevisiae via cleavage of tRNAGln(UUG. We find that recombinant PaT incises a synthetic tRNAGln(UUG stem-loop RNA by transesterification at a single site 3′ of the wobble uridine, yielding 2′,3′-cyclic phosphate and 5′-OH ends. Incision is suppressed by replacement of the wobble nucleobase with adenine or guanine. The crystal structure of PaT reveals a distinctive fold and active site, essential components of which are demonstrated by mutagenesis. Pichia acaciae evades self-toxicity via a distinctive intracellular immunity protein, ImmPaT, which binds PaT and blocks nuclease activity. Our results highlight the evolutionary diversity of tRNA restriction and immunity systems.

  19. Three-Dimensional Algebraic Models of the tRNA Code and 12 Graphs for Representing the Amino Acids.

    Science.gov (United States)

    José, Marco V; Morgado, Eberto R; Guimarães, Romeu Cardoso; Zamudio, Gabriel S; de Farías, Sávio Torres; Bobadilla, Juan R; Sosa, Daniela

    2014-08-11

    Three-dimensional algebraic models, also called Genetic Hotels, are developed to represent the Standard Genetic Code, the Standard tRNA Code (S-tRNA-C), and the Human tRNA code (H-tRNA-C). New algebraic concepts are introduced to be able to describe these models, to wit, the generalization of the 2n-Klein Group and the concept of a subgroup coset with a tail. We found that the H-tRNA-C displayed broken symmetries in regard to the S-tRNA-C, which is highly symmetric. We also show that there are only 12 ways to represent each of the corresponding phenotypic graphs of amino acids. The averages of statistical centrality measures of the 12 graphs for each of the three codes are carried out and they are statistically compared. The phenotypic graphs of the S-tRNA-C display a common triangular prism of amino acids in 10 out of the 12 graphs, whilst the corresponding graphs for the H-tRNA-C display only two triangular prisms. The graphs exhibit disjoint clusters of amino acids when their polar requirement values are used. We contend that the S-tRNA-C is in a frozen-like state, whereas the H-tRNA-C may be in an evolving state.

  20. Role of spinal cord glutamate transporter during normal sensory transmission and pathological pain states

    Directory of Open Access Journals (Sweden)

    Stephens Robert L

    2005-10-01

    Full Text Available Abstract Glutamate is a neurotransmitter critical for spinal excitatory synaptic transmission and for generation and maintenance of spinal states of pain hypersensitivity via activation of glutamate receptors. Understanding the regulation of synaptically and non-synaptically released glutamate associated with pathological pain is important in exploring novel molecular mechanisms and developing therapeutic strategies of pathological pain. The glutamate transporter system is the primary mechanism for the inactivation of synaptically released glutamate and the maintenance of glutamate homeostasis. Recent studies demonstrated that spinal glutamate transporter inhibition relieved pathological pain, suggesting that the spinal glutamate transporter might serve as a therapeutic target for treatment of pathological pain. However, the exact function of glutamate transporter in pathological pain is not completely understood. This report will review the evidence for the role of the spinal glutamate transporter during normal sensory transmission and pathological pain conditions and discuss potential mechanisms by which spinal glutamate transporter is involved in pathological pain.

  1. Glutamic Acid Residues in HIV-1 p6 Regulate Virus Budding and Membrane Association of Gag.

    Science.gov (United States)

    Friedrich, Melanie; Setz, Christian; Hahn, Friedrich; Matthaei, Alina; Fraedrich, Kirsten; Rauch, Pia; Henklein, Petra; Traxdorf, Maximilian; Fossen, Torgils; Schubert, Ulrich

    2016-04-25

    The HIV-1 Gag p6 protein regulates the final abscission step of nascent virions from the cell membrane by the action of its two late (L-) domains, which recruit Tsg101 and ALIX, components of the ESCRT system. Even though p6 consists of only 52 amino acids, it is encoded by one of the most polymorphic regions of the HIV-1 gag gene and undergoes various posttranslational modifications including sumoylation, ubiquitination, and phosphorylation. In addition, it mediates the incorporation of the HIV-1 accessory protein Vpr into budding virions. Despite its small size, p6 exhibits an unusually high charge density. In this study, we show that mutation of the conserved glutamic acids within p6 increases the membrane association of Pr55 Gag followed by enhanced polyubiquitination and MHC-I antigen presentation of Gag-derived epitopes, possibly due to prolonged exposure to membrane bound E3 ligases. The replication capacity of the total glutamic acid mutant E0A was almost completely impaired, which was accompanied by defective virus release that could not be rescued by ALIX overexpression. Altogether, our data indicate that the glutamic acids within p6 contribute to the late steps of viral replication and may contribute to the interaction of Gag with the plasma membrane.

  2. Glutamate-induced glutamate release: A proposed mechanism for calcium bursting in astrocytes

    Science.gov (United States)

    Larter, Raima; Craig, Melissa Glendening

    2005-12-01

    Here we present a new model for the generation of complex calcium-bursting patterns in astrocytes, a type of brain cell recently implicated in a variety of neural functions including memory formation. The model involves two positive feedback processes, in which the key feedback species are calcium ion and glutamate. The latter is the most abundant excitatory neurotransmitter in the brain and has been shown to be involved in bidirectional communication between astrocytes and nearby neurons. The glutamate feedback process considered here is shown to be critical for the generation of complex bursting oscillations in the astrocytes and to, perhaps, code for information which may be passed from neuron to neuron via the astrocyte. These processes may be involved in memory storage and formation as well as in mechanisms which lead to dynamical diseases such as epilepsy.

  3. Calcium regulates glutamate dehydrogenase and poly-γ-glutamic acid synthesis in Bacillus natto.

    Science.gov (United States)

    Meng, Yonghong; Dong, Guiru; Zhang, Chen; Ren, Yuanyuan; Qu, Yuling; Chen, Weifeng

    2016-04-01

    To study the effect of Ca(2+) on glutamate dehydrogenase (GDH) and its role in poly-γ-glutamic acid (γ-PGA) synthesis in Bacillus natto HSF 1410. When the concentration of Ca(2+) varied from 0 to 0.1 g/l in the growth medium of B. natto HSF 1410, γ-PGA production increased from 6.8 to 9.7 g/l, while GDH specific activity and NH4Cl consumption improved from 183 to 295 U/mg and from 0.65 to 0.77 g/l, respectively. GDH with α-ketoglutarate as substrate primarily used NADPH as coenzyme with a K m of 0.08 mM. GDH was responsible for the synthesis of endogenous glutamate. The specific activity of GDH remained essentially unchanged in the presence of CaCl2 (0.05-0.2 g/l) in vitro. However, the specific activity of GDH and its expression was significantly increased by CaCl2 in vivo. Therefore, the regulation of GDH and PGA synthesis by Ca(2+) is an intracellular process. Calcium regulation may be an effective approach for producing γ-PGA on an industrial scale.

  4. Glutamate and GABA as rapid effectors of hypothalamic peptidergic neurons

    Directory of Open Access Journals (Sweden)

    Cornelia eSchöne

    2012-11-01

    Full Text Available Vital hypothalamic neurons regulating hunger, wakefulness, reward-seeking, and body weight are often defined by unique expression of hypothalamus-specific neuropeptides. Gene-ablation studies show that some of these peptides, notably orexin/hypocretin (hcrt/orx, are themselves critical for stable states of consciousness and metabolic health. However, neuron-ablation studies often reveal more severe phenotypes, suggesting key roles for co-expressed transmitters. Indeed, most hypothalamic neurons, including hcrt/orx cells, contain fast transmitters glutamate and GABA, as well as several neuropeptides. What are the roles and relations between different transmitters expressed by the same neuron? Here, we consider signaling codes for releasing different transmitters in relation to transmitter and receptor diversity in behaviorally-defined, widely-projecting peptidergic neurons, such as hcrt/orx cells. We then discuss latest optogenetic studies of endogenous transmitter release from defined sets of axons in situ, which suggest that recently-characterized vital peptidergic neurons (e.g. hcrt/orx, proopiomelanocortin , and agouti-related peptide cells, as well as classical modulatory neurons (e.g. dopamine and acetylcholine cells, all use fast transmitters to control their postsynaptic targets. These optogenetic insights are complemented by recent observations of behavioral deficiencies caused by genetic ablation of fast transmission from specific neuropeptidergic and aminergic neurons. Powerful and fast (millisecond-scale GABAergic and glutamatergic signaling from neurons previously considered to be primarily modulatory raises new questions about the roles of slower co-transmitters they co-express.

  5. Glutamate and GABA in appetite regulation

    Directory of Open Access Journals (Sweden)

    Teresa Cardoso Delgado

    2013-08-01

    Full Text Available Appetite is regulated by a coordinated interplay between gut, adipose tissue and brain. A primary site for the regulation of appetite is the hypothalamus where interaction between orexigenic neurons, expressing Neuropeptide Y/Agouti-related protein, and anorexigenic neurons, expressing Pro-opiomelanocortin cocaine/Amphetamine-related transcript, controls energy homeostasis. Within the hypothalamus, several peripheral signals have been shown to modulate the activity of these neurons, including the orexigenic peptide ghrelin and the anorexigenic hormones insulin and leptin. In addition to the accumulated knowledge on neuropeptide signaling, presence and function of amino acid neurotransmitters in key hypothalamic neurons brought a new light into appetite regulation. Therefore, the principal aim of this review will be to describe the current knowledge of the role of amino acid neurotransmitters in the mechanism of neuronal activation during appetite regulation and the associated neuronal-astrocytic metabolic coupling mechanisms.Glutamate and GABA dominate synaptic transmission in the hypothalamus and administration of their receptors agonists into hypothalamic nuclei stimulates feeding. By using 13C High-Resolution Magic Angle Spinning Nuclear Magnetic Resonance spectroscopy based analysis, the Cerdán group has shown that increased neuronal firing in mice hypothalamus, as triggered by appetite during the feeding-fasting paradigm, may stimulate the use of lactate as neuronal fuel leading to increased astrocytic glucose consumption and glycolysis. Moreover, fasted mice showed increased hypothalamic [2-13C]GABA content, which may be explained by the existence of GABAergic neurons in key appetite regulation hypothalamic nuclei. Interestingly, increased [2-13C]GABA concentration in the hypothalamus of fasted animals appears to result mainly from reduction in GABA metabolizing pathways, rather than increased GABA synthesis by augmented activity of the

  6. Posttranslational Modification Biology of Glutamate Receptors and Drug Addiction

    Directory of Open Access Journals (Sweden)

    Li-Min eMao

    2011-03-01

    Full Text Available Posttranslational covalent modifications of glutamate receptors remain a hot topic. Early studies have established that this family of receptors, including almost all ionotropic and metabotropic glutamate receptor subtypes, undergoes active phosphorylation at serine, threonine, or tyrosine residues on their intracellular domains. Recent evidence identifies several glutamate receptor subtypes to be direct substrates for palmitoylation at cysteine residues. Other modifications such as ubiquitination and sumoylation at lysine residues also occur to certain glutamate receptors. These modifications are dynamic and reversible in nature and are regulatable by changing synaptic inputs. The regulated modifications significantly impact the receptor in many ways, including interrelated changes in biochemistry (synthesis, subunit assembling and protein-protein interactions, subcellular redistribution (trafficking, endocytosis, synaptic delivery and clustering, and physiology, usually associated with changes in synaptic plasticity. Glutamate receptors are enriched in the striatum and cooperate closely with dopamine to regulate striatal signaling. Emerging evidence shows that modification processes of striatal glutamate receptors are sensitive to addictive drugs, such as psychostimulants (cocaine and amphetamines. Altered modifications are believed to be directly linked to enduring receptor/synaptic plasticity and drug-seeking. This review summarizes several major types of modifications of glutamate receptors and analyzes the role of these modifications in striatal signaling and in the pathogenesis of psychostimulant addiction.

  7. Role of aminotransferases in glutamate metabolism of human erythrocytes

    Energy Technology Data Exchange (ETDEWEB)

    Ellinger, James J. [University of Wisconsin-Madison, Department of Biochemistry (United States); Lewis, Ian A. [Princeton University, Lewis-Sigler Institute for Integrative Genomics (United States); Markley, John L., E-mail: markley@nmrfam.wisc.edu [University of Wisconsin-Madison, Department of Biochemistry (United States)

    2011-04-15

    Human erythrocytes require a continual supply of glutamate to support glutathione synthesis, but are unable to transport this amino acid across their cell membrane. Consequently, erythrocytes rely on de novo glutamate biosynthesis from {alpha}-ketoglutarate and glutamine to maintain intracellular levels of glutamate. Erythrocytic glutamate biosynthesis is catalyzed by three enzymes, alanine aminotransferase (ALT), aspartate aminotransferase (AST), and glutamine aminohydrolase (GA). Although the presence of these enzymes in RBCs has been well documented, the relative contributions of each pathway have not been established. Understanding the relative contributions of each biosynthetic pathway is critical for designing effective therapies for sickle cell disease, hemolytic anemia, pulmonary hypertension, and other glutathione-related disorders. In this study, we use multidimensional {sup 1}H-{sup 13}C nuclear magnetic resonance (NMR) spectroscopy and multiple reaction mode mass spectrometry (MRM-MS) to measure the kinetics of de novo glutamate biosynthesis via AST, ALT, and GA in intact cells and RBC lysates. We show that up to 89% of the erythrocyte glutamate pool can be derived from ALT and that ALT-derived glutamate is subsequently used for glutathione synthesis.

  8. Dysfunctional TCA-Cycle Metabolism in Glutamate Dehydrogenase Deficient Astrocytes.

    Science.gov (United States)

    Nissen, Jakob D; Pajęcka, Kamilla; Stridh, Malin H; Skytt, Dorte M; Waagepetersen, Helle S

    2015-12-01

    Astrocytes take up glutamate in the synaptic area subsequent to glutamatergic transmission by the aid of high affinity glutamate transporters. Glutamate is converted to glutamine or metabolized to support intermediary metabolism and energy production. Glutamate dehydrogenase (GDH) and aspartate aminotransferase (AAT) catalyze the reversible reaction between glutamate and α-ketoglutarate, which is the initial step for glutamate to enter TCA cycle metabolism. In contrast to GDH, AAT requires a concomitant interconversion of oxaloacetate and aspartate. We have investigated the role of GDH in astrocyte glutamate and glucose metabolism employing siRNA mediated knock down (KD) of GDH in cultured astrocytes using stable and radioactive isotopes for metabolic mapping. An increased level of aspartate was observed upon exposure to [U-(13) C]glutamate in astrocytes exhibiting reduced GDH activity. (13) C Labeling of aspartate and TCA cycle intermediates confirmed that the increased amount of aspartate is associated with elevated TCA cycle flux from α-ketoglutarate to oxaloacetate, i.e. truncated TCA cycle. (13) C Glucose metabolism was elevated in GDH deficient astrocytes as observed by increased de novo synthesis of aspartate via pyruvate carboxylation. In the absence of glucose, lactate production from glutamate via malic enzyme was lower in GDH deficient astrocytes. In conclusions, our studies reveal that metabolism via GDH serves an important anaplerotic role by adding net carbon to the TCA cycle. A reduction in GDH activity seems to cause the astrocytes to up-regulate activity in pathways involved in maintaining the amount of TCA cycle intermediates such as pyruvate carboxylation as well as utilization of alternate substrates such as branched chain amino acids. © 2015 Wiley Periodicals, Inc.

  9. Δ(1-pyrroline-5-carboxylate/glutamate biogenesis is required for fungal virulence and sporulation.

    Directory of Open Access Journals (Sweden)

    Ziting Yao

    Full Text Available Proline dehydrogenase (Prodh and Δ(1-pyrroline-5-carboxylate dehydrogenase (P5Cdh are two key enzymes in the cellular biogenesis of glutamate. Recombinant Prodh and P5Cdh proteins of the chestnut blight fungus Cryphonectria parasitica were investigated and showed activity in in vitro assays. Additionally, the C. parasitica Prodh and P5Cdh genes were able to complement the Saccharomyces cerevisiae put1 and put2 null mutants, respectively, to allow these proline auxotrophic yeast mutants to grow on media with proline as the sole source of nitrogen. Deletion of the Prodh gene in C. parasitica resulted in hypovirulence and a lower level of sporulation, whereas deletion of P5Cdh resulted in hypovirulence though no effect on sporulation; both Δprodh and Δp5cdh mutants were unable to grow on minimal medium with proline as the sole nitrogen source. In a wild-type strain, the intracellular level of proline and the activity of Prodh and P5Cdh increased after supplementation of exogenous proline, though the intracellular Δ(1-pyrroline-5-carboxylate (P5C content remained unchanged. Prodh and P5Cdh were both transcriptionally down-regulated in cells infected with hypovirus. The disruption of other genes with products involved in the conversion of arginine to ornithine, ornithine and glutamate to P5C, and P5C to proline in the cytosol did not appear to affect virulence; however, asexual sporulation was reduced in the Δpro1 and Δpro2 mutants. Taken together, our results showed that Prodh, P5Cdh and related mitochondrial functions are essential for virulence and that proline/glutamate pathway components may represent down-stream targets of hypovirus regulation in C. parasitica.

  10. Quantitative Analysis of Glutamate Receptors in Glial Cells from the Cortex of GFAP/EGFP Mice Following Ischemic Injury: Focus on NMDA Receptors.

    Science.gov (United States)

    Dzamba, David; Honsa, Pavel; Valny, Martin; Kriska, Jan; Valihrach, Lukas; Novosadova, Vendula; Kubista, Mikael; Anderova, Miroslava

    2015-11-01

    Cortical glial cells contain both ionotropic and metabotropic glutamate receptors. Despite several efforts, a comprehensive analysis of the entire family of glutamate receptors and their subunits present in glial cells is still missing. Here, we provide an overall picture of the gene expression of ionotropic (AMPA, kainate, NMDA) and the main metabotropic glutamate receptors in cortical glial cells isolated from GFAP/EGFP mice before and after focal cerebral ischemia. Employing single-cell RT-qPCR, we detected the expression of genes encoding subunits of glutamate receptors in GFAP/EGFP-positive (GFAP/EGFP(+)) glial cells in the cortex of young adult mice. Most of the analyzed cells expressed mRNA for glutamate receptor subunits, the expression of which, in most cases, even increased after ischemic injury. Data analyses disclosed several classes of GFAP/EGFP(+) glial cells with respect to glutamate receptors and revealed in what manner their expression correlates with the expression of glial markers prior to and after ischemia. Furthermore, we also examined the protein expression and functional significance of NMDA receptors in glial cells. Immunohistochemical analyses of all seven NMDA receptor subunits provided direct evidence that the GluN3A subunit is present in GFAP/EGFP(+) glial cells and that its expression is increased after ischemia. In situ and in vitro Ca(2+) imaging revealed that Ca(2+) elevations evoked by the application of NMDA were diminished in GFAP/EGFP(+) glial cells following ischemia. Our results provide a comprehensive description of glutamate receptors in cortical GFAP/EGFP(+) glial cells and may serve as a basis for further research on glial cell physiology and pathophysiology.

  11. In vitro evidence for the brain glutamate efflux hypothesis

    DEFF Research Database (Denmark)

    Helms, Hans Christian; Madelung, Rasmus; Waagepetersen, Helle Sønderby

    2012-01-01

    -glutamate homeostasis. Transendothelial transport- and accumulation studies of (3) H-L-glutamate, (3) H-L-aspartate, and (3) H-D-aspartate in an electrically tight bovine endothelial/rat astrocyte blood-brain barrier coculture model were performed. After 6 days in culture, the endothelium displayed transendothelial......The concentration of the excitotoxic amino acid, L-glutamate, in brain interstitial fluid is tightly regulated by uptake transporters and metabolism in astrocytes and neurons. The aim of this study was to investigate the possible role of the blood-brain barrier endothelium in brain L...

  12. Clearance of glutamate inside the synapse and beyond.

    Science.gov (United States)

    Bergles, D E; Diamond, J S; Jahr, C E

    1999-06-01

    The heated debate over the level of postsynaptic receptor occupancy by transmitter has not been extinguished - indeed, new evidence is fanning the flames. Recent experiments using two-photon microscopy suggest that the concentration of glutamate in the synaptic cleft does not attain levels previously suggested. In contrast, recordings from glial cells and studies of extrasynaptic receptor activation indicate that significant quantities of glutamate escape from the cleft following exocytosis. Determining the amount of glutamate efflux from the synaptic cleft and the distance it diffuses is critical to issues of synaptic specificity and the induction of synaptic plasticity.

  13. Improved poly-γ-glutamic acid production in Bacillus amyloliquefaciens by modular pathway engineering.

    Science.gov (United States)

    Feng, Jun; Gu, Yanyan; Quan, Yufen; Cao, Mingfeng; Gao, Weixia; Zhang, Wei; Wang, Shufang; Yang, Chao; Song, Cunjiang

    2015-11-01

    A Bacillus amyloliquefaciens strain with enhanced γ-PGA production was constructed by metabolically engineering its γ-PGA synthesis-related metabolic networks: by-products synthesis, γ-PGA degradation, glutamate precursor synthesis, γ-PGA synthesis and autoinducer synthesis. The genes involved in by-products synthesis were firstly deleted from the starting NK-1 strain. The obtained NK-E7 strain with deletions of the epsA-O (responsible for extracellular polysaccharide synthesis), sac (responsible for levan synthesis), lps (responsible for lipopolysaccharide synthesis) and pta (encoding phosphotransacetylase) genes, showed increased γ-PGA purity and slight increase of γ-PGA titer from 3.8 to 4.15 g/L. The γ-PGA degrading genes pgdS (encoding poly-gamma-glutamate depolymerase) and cwlO (encoding cell wall hydrolase) were further deleted. The obtained NK-E10 strain showed further increased γ-PGA production from 4.15 to 9.18 g/L. The autoinducer AI-2 synthetase gene luxS was deleted in NK-E10 strain and the resulting NK-E11 strain showed comparable γ-PGA titer to NK-E10 (from 9.18 to 9.54 g/L). In addition, we overexpressed the pgsBCA genes (encoding γ-PGA synthetase) in NK-E11 strain; however, the overexpression of these genes led to a decrease in γ-PGA production. Finally, the rocG gene (encoding glutamate dehydrogenase) and the glnA gene (glutamine synthetase) were repressed by the expression of synthetic small regulatory RNAs in NK-E11 strain. The rocG-repressed NK-anti-rocG strain exhibited the highest γ-PGA titer (11.04 g/L), which was 2.91-fold higher than that of the NK-1 strain. Fed-batch cultivation of the NK-anti-rocG strain resulted in a final γ-PGA titer of 20.3g/L, which was 5.34-fold higher than that of the NK-1 strain in shaking flasks. This work is the first report of a systematically metabolic engineering approach that significantly enhanced γ-PGA production in a B. amyloliquefaciens strain. The engineering strategies explored here are

  14. Naphthazarin protects against glutamate-induced neuronal death via activation of the Nrf2/ARE pathway.

    Science.gov (United States)

    Son, Tae Gen; Kawamoto, Elisa M; Yu, Qian-Sheng; Greig, Nigel H; Mattson, Mark P; Camandola, Simonetta

    2013-04-19

    Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. We previously screened several natural phytochemicals and identified plumbagin as a novel activator of the Nrf2/ARE pathway that can protect neurons against ischemic injury. Here we extended our studies to natural and synthetic derivatives of plumbagin. We found that 5,8-dimethoxy-1,4-naphthoquinone (naphthazarin) is a potent activator of the Nrf2/ARE pathway, up-regulates the expression of Nrf2-driven genes in primary neuronal and glial cultures, and protects neurons against glutamate-induced excitotoxicity. Published by Elsevier Inc.

  15. The Influence of Glutamate on Axonal Compound Action Potential In Vitro.

    Science.gov (United States)

    Abouelela, Ahmed; Wieraszko, Andrzej

    2016-01-01

    Background  Our previous experiments demonstrated modulation of the amplitude of the axonal compound action potential (CAP) by electrical stimulation. To verify assumption that glutamate released from axons could be involved in this phenomenon, the modification of the axonal CAP induced by glutamate was investigated. Objectives  The major objective of this research is to verify the hypothesis that axonal activity would trigger the release of glutamate, which in turn would interact with specific axonal receptors modifying the amplitude of the action potential. Methods  Segments of the sciatic nerve were exposed to exogenous glutamate in vitro, and CAP was recorded before and after glutamate application. In some experiments, the release of radioactive glutamate analog from the sciatic nerve exposed to exogenous glutamate was also evaluated. Results  The glutamate-induced increase in CAP was blocked by different glutamate receptor antagonists. The effect of glutamate was not observed in Ca-free medium, and was blocked by antagonists of calcium channels. Exogenous glutamate, applied to the segments of sciatic nerve, induced the release of radioactive glutamate analog, demonstrating glutamate-induced glutamate release. Immunohistochemical examination revealed that axolemma contains components necessary for glutamatergic neurotransmission. Conclusion  The proteins of the axonal membrane can under the influence of electrical stimulation or exogenous glutamate change membrane permeability and ionic conductance, leading to a change in the amplitude of CAP. We suggest that increased axonal activity leads to the release of glutamate that results in changes in the amplitude of CAPs.

  16. Fabrication of Implantable, Enzyme-Immobilized Glutamate Sensors for the Monitoring of Glutamate Concentration Changes in Vitro and in Vivo

    Directory of Open Access Journals (Sweden)

    Tina T.-C. Tseng

    2014-06-01

    Full Text Available Glutamate sensors based on the immobilization of glutamate oxidase (GlutOx were prepared by adsorption on electrodeposited chitosan (Method 1 and by crosslinking with glutaraldehyde (Method 2 on micromachined platinum microelectrodes. It was observed that glutamate sensors prepared by Method 1 have faster response time (<2 s and lower detection limit (2.5 ± 1.1 μM compared to that prepared by Method 2 (response time: <5 sec and detection limit: 6.5 ± 1.7 μM; glutamate sensors prepared by Method 2 have a larger linear detection range (20–352 μM and higher sensitivity (86.8 ± 8.8 nA·μM−1·cm−2, N = 12 compared to those prepared by Method 1 (linear detection range: 20–217 μM and sensitivity: 34.9 ± 4.8 nA·μM−1·cm−2, N = 8. The applicability of the glutamate sensors in vivo was also demonstrated. The glutamate sensors were implanted into the rat brain to monitor the stress-induced extracellular glutamate release in the hypothalamus of the awake, freely moving rat.

  17. A structured RNA motif is involved in correct placement of the tRNA(3)(Lys) primer onto the human immunodeficiency virus genome

    NARCIS (Netherlands)

    Beerens, N.; Klaver, B.; Berkhout, B.

    2000-01-01

    Human immunodeficiency virus type 1 (HIV-1) reverse transcription is primed by the cellular tRNA(3)(Lys) molecule that binds with its 3'-terminal 18 nucleotides to the fully complementary primer-binding site (PBS) on the viral RNA genome. Besides this complementarity, annealing of the primer may be

  18. Reduced replication of human immunodeficiency virus type 1 mutants that use reverse transcription primers other than the natural tRNA(3Lys)

    NARCIS (Netherlands)

    Das, A. T.; Klaver, B.; Berkhout, B.

    1995-01-01

    Replication of the human immunodeficiency virus type 1 (HIV-1) and other retroviruses involves reverse transcription of the viral RNA genome into a double-stranded DNA. This reaction is primed by the cellular tRNA(3Lys) molecule, which binds to a complementary sequence in the viral genome, referred

  19. The tRNA primer activation signal in the human immunodeficiency virus type 1 genome is important for initiation and processive elongation of reverse transcription

    NARCIS (Netherlands)

    Beerens, Nancy; Berkhout, Ben

    2002-01-01

    Human immunodeficiency virus type 1 (HIV-1) reverse transcription is primed by the cellular tRNA(3)(Lys) molecule, which binds, with its 3'-terminal 18 nucleotides (nt), to a complementary sequence in the viral genome, the primer-binding site (PBS). Besides PBS-anti-PBS pairing, additional

  20. Functional identification of glutamate cysteine ligase and glutathione synthetase in the marine yeast Rhodosporidium diobovatum

    Science.gov (United States)

    Kong, Min; Wang, Fengjuan; Tian, Liuying; Tang, Hui; Zhang, Liping

    2018-02-01

    Glutathione (GSH) fulfills a variety of metabolic functions, participates in oxidative stress response, and defends against toxic actions of heavy metals and xenobiotics. In this study, GSH was detected in Rhodosporidium diobovatum by high-performance liquid chromatography (HPLC). Then, two novel enzymes from R. diobovatum were characterized that convert glutamate, cysteine, and glycine into GSH. Based on reverse transcription PCR, we obtained the glutathione synthetase gene ( GSH2), 1866 bp, coding for a 56.6-kDa protein, and the glutamate cysteine ligase gene ( GSH1), 2469 bp, coding for a 90.5-kDa protein. The role of GSH1 and GSH2 for the biosynthesis of GSH in the marine yeast R. diobovatum was determined by deletions using the CRISPR-Cas9 nuclease system and enzymatic activity. These results also showed that GSH1 and GSH2 were involved in the production of GSH and are thus being potentially useful to engineer GSH pathways. Alternatively, pET- GSH constructed using vitro recombination could be used to detect the function of genes related to GSH biosynthesis. Finally, the fermentation parameters determined in the present study provide a reference for industrial GSH production in R. diobovatum.

  1. Effect of metabotropic glutamate receptor 3 genotype on N-acetylaspartate levels and neurocognition in non-smoking, active alcoholics

    OpenAIRE

    Xia, Yan; Ma, Dongying; Hu, Jian; Tang, Chunling; Wu, Zheng; Liu, Lei; Xin, Feng

    2012-01-01

    Abstract Background We studied the effects of single nucleotide polymorphisms (SNPs) in the metabotropic glutamate receptor 3 (GRM3) gene on brain N-acetylaspartate (NAA) concentrations and executive function (EF) skills in non-smoking, active alcoholics, and evaluated associations between these variables. Methods SNPs (rs6465084, rs1468412, and rs2299225) in GRM3 were genotyped in 49 male, non-smoking, alcohol-dependent patients and 45 healthy control subjects using ligase detection reaction...

  2. Inhibition of the Mitochondrial Glutamate Carrier SLC25A22 in Astrocytes Leads to Intracellular Glutamate Accumulation

    Directory of Open Access Journals (Sweden)

    Emmanuelle Goubert

    2017-05-01

    Full Text Available The solute carrier family 25 (SLC25 drives the import of a large diversity of metabolites into mitochondria, a key cellular structure involved in many metabolic functions. Mutations of the mitochondrial glutamate carrier SLC25A22 (also named GC1 have been identified in early epileptic encephalopathy (EEE and migrating partial seizures in infancy (MPSI but the pathophysiological mechanism of GC1 deficiency is still unknown, hampered by the absence of an in vivo model. This carrier is mainly expressed in astrocytes and is the principal gate for glutamate entry into mitochondria. A sufficient supply of energy is essential for the proper function of the brain and mitochondria have a pivotal role in maintaining energy homeostasis. In this work, we wanted to study the consequences of GC1 absence in an in vitro model in order to understand if glutamate catabolism and/or mitochondrial function could be affected. First, short hairpin RNA (shRNA designed to specifically silence GC1 were validated in rat C6 glioma cells. Silencing GC1 in C6 resulted in a reduction of the GC1 mRNA combined with a decrease of the mitochondrial glutamate carrier activity. Then, primary astrocyte cultures were prepared and transfected with shRNA-GC1 or mismatch-RNA (mmRNA constructs using the Neon® Transfection System in order to target a high number of primary astrocytes, more than 64%. Silencing GC1 in primary astrocytes resulted in a reduced nicotinamide adenine dinucleotide (Phosphate (NAD(PH formation upon glutamate stimulation. We also observed that the mitochondrial respiratory chain (MRC was functional after glucose stimulation but not activated by glutamate, resulting in a lower level of cellular adenosine triphosphate (ATP in silenced astrocytes compared to control cells. Moreover, GC1 inactivation resulted in an intracellular glutamate accumulation. Our results show that mitochondrial glutamate transport via GC1 is important in sustaining glutamate homeostasis in

  3. Glutamate-induced sensitization of rat masseter muscle fibers.

    NARCIS (Netherlands)

    Cairns, B.E.; Gambarota, G.; Svensson, P.; Arendt-Nielsen, L.; Berde, C.B.

    2002-01-01

    In rats, intradermal or intraarticular injection of glutamate or selective excitatory amino acid receptor agonists acting at peripheral excitatory amino acid receptors can decrease the intensity of mechanical stimulation required to evoke nocifensive behaviors, an indication of hyperalgesia. Since

  4. Production of L-glutamic acid by a Bacillus sp.

    Science.gov (United States)

    Chattopadhyay, S P; Banerjee, A K

    1978-01-01

    A strain of Bacillus cereus var. mycoides isolated from Burdwan soil produces L-glutamate in the medium. The strain is able to grow and produce in a synthetic medium but supplementation with casamino acid or yeast extract improves the yield. Maintenance of pH of the fermentation medium near neutrality prolongs the active growth period and improves the yield. Glucose and ammonium nitrate were found to be most suitable carbon and nitrogen sources, respectively. Cane sugar molasses (as a substitute for glucose) significantly stimulated the growth but glutamate production was less. Various B vitamins stimulate the growth and glutamate yield. The yield of glutamate under optimal condition is 5.2 g/l.

  5. Microsensors for in vivo Measurement of Glutamate in Brain Tissue

    NARCIS (Netherlands)

    Qin, Si; van der Zeyden, Miranda; Oldenziel, Weite H.; Cremers, Thomas I. F. H.; Westerink, Ben H. C.

    2008-01-01

    Several immobilized enzyme-based electrochemical biosensors for glutamate detection have been developed over the last decade. In this review, we compare first and second generation sensors. Structures, working mechanisms, interference prevention, in vitro detection characteristics and in vivo

  6. Overexpression and rapid purification of the orfE/rph gene product, RNase PH of Escherichia coli

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank; Andersen, J T; Poulsen, Peter

    1992-01-01

    acid residue protein which was recently identified as the phosphorolytic ribonuclease, RNase PH, that removes nucleotides from the 3' ends of tRNA precursors. In this paper we report the construction of a plasmid, which overexpresses the orfE and pyrE gene products substantially, as well...

  7. Response of regional brain glutamate transaminases of rat to aluminum in protein malnutrition

    OpenAIRE

    Chatterjee Ajay K; Nayak Prasunpriya

    2002-01-01

    Abstract Background The mechanism of aluminum-induced neurotoxicity is not clear. The involvement of glutamate in the aluminium-induced neurocomplications has been suggested. Brain glutamate levels also found to be altered in protein malnutrition. Alterations in glutamate levels as well as glutamate-α-decarboxylase in different regions of rat brain has been reported in response to aluminum exposure. Thus the study of glutamate metabolising enzymes in different brain regions of rats maintained...

  8. Development of Jerusalem artichoke resource for efficient one-step fermentation of poly-(γ-glutamic acid) using a novel strain Bacillus amyloliquefaciens NX-2S.

    Science.gov (United States)

    Qiu, Yibin; Sha, Yuanyuan; Zhang, Yatao; Xu, Zongqi; Li, Sha; Lei, Peng; Xu, Zheng; Feng, Xiaohai; Xu, Hong

    2017-09-01

    This study aimed to develop non-food fermentation for the cost-effective production of poly-(γ-glutamic acid) (γ-PGA) using a novel strain of Bacillus amyloliquefaciens NX-2S. The new isolate assimilated inulin more efficiently than other carbohydrates from Jerusalem artichoke, without hydrolytic treatment. To investigate the effect of inulin on γ-PGA production, the transcript levels of γ-PGA synthetase genes (pgsB, pgsC, pgsA), regulatory genes (comA, degQ, degS), and the glutamic acid biosynthesis gene (glnA) were analyzed; inulin addition upregulated these key genes. Without exogenous glutamate, strain NX-2S could produce 6.85±0.22g/L of γ-PGA during fermentation. Exogenous glutamate greatly enhances the γ-PGA yield (39.4±0.38g/L) and productivity (0.43±0.05g/L/h) in batch fermentation. Our study revealed a potential method of non-food fermentation to produce high-value products. Copyright © 2017. Published by Elsevier Ltd.

  9. Transcriptomic responses in mouse brain exposed to chronic excess of the neurotransmitter glutamate

    Directory of Open Access Journals (Sweden)

    Pal Ranu

    2010-06-01

    Full Text Available Abstract Background Increases during aging in extracellular levels of glutamate (Glu, the major excitatory neurotransmitter in the brain, may be linked to chronic neurodegenerative diseases. Little is known about the molecular responses of neurons to chronic, moderate increases in Glu levels. Genome-wide gene expression in brain hippocampus was examined in a unique transgenic (Tg mouse model that exhibits moderate Glu hyperactivity throughout the lifespan, the neuronal Glutamate dehydrogenase (Glud1 mouse, and littermate 9 month-old wild type mice. Results Integrated bioinformatic analyses on transcriptomic data were used to identify bio-functions, pathways and gene networks underlying neuronal responses to increased Glu synaptic release. Bio-functions and pathways up-regulated in Tg mice were those associated with oxidative stress, cell injury, inflammation, nervous system development, neuronal growth, and synaptic transmission. Increased gene expression in these functions and pathways indicated apparent compensatory responses offering protection against stress, promoting growth of neuronal processes (neurites and re-establishment of synapses. The transcription of a key gene in the neurite growth network, the kinase Ptk2b, was significantly up-regulated in Tg mice as was the activated (phosphorylated form of the protein. In addition to genes related to neurite growth and synaptic development, those associated with neuronal vesicle trafficking in the Huntington's disease signalling pathway, were also up-regulated. Conclusions This is the first study attempting to define neuronal gene expression patterns in response to chronic, endogenous Glu hyperactivity at brain synapses. The patterns observed were characterized by a combination of responses to stress and stimulation of nerve growth, intracellular transport and recovery.

  10. Catalytic activity of bovine glutamate dehydrogenase requires a hexamer structure.

    OpenAIRE

    Bell, E T; Bell, J E

    1984-01-01

    Previous workers have shown that the hexamers of glutamate dehydrogenase are dissociated first into trimers and subsequently into monomers by increasing guanidinium chloride concentrations. In renaturation experiments it is shown that trimers of glutamate dehydrogenase can be reassociated to give the hexamer form of the enzyme, with full regain of activity. Monomeric subunits produced at high guanidinium chloride concentrations cannot be renatured. The trimer form of the enzyme is shown to ha...

  11. Detection and quantitation of glutamate carboxypeptidase II in human blood

    Czech Academy of Sciences Publication Activity Database

    Knedlík, Tomáš; Navrátil, Václav; Vik, V.; Pacík, D.; Šácha, Pavel; Konvalinka, Jan

    2014-01-01

    Roč. 74, č. 7 (2014), s. 768-780 ISSN 0270-4137 R&D Projects: GA ČR GAP304/12/0847 Grant - others:OPPC(CZ) CZ.2.16/3.1.00/24016 Institutional support: RVO:61388963 Keywords : serum marker * glutamate carboxypeptidase II * plasma glutamate carboxypeptidase * prostate cancer * prostate -specific membrane antigen Subject RIV: CE - Biochemistry Impact factor: 3.565, year: 2014

  12. Immunochemical characterization of the brain glutamate binding protein

    International Nuclear Information System (INIS)

    Roy, S.

    1986-01-01

    A glutamate binding protein (GBP) was purified from bovine and rat brain to near homogeneity. Polyclonal antibodies were raised against this protein. An enzyme-linked-immunosorbent-assay was used to quantify and determine the specificity of the antibody response. The antibodies were shown to strongly react with bovine brain GBP and the analogous protein from rat brain. The antibodies did not show any crossreactivity with the glutamate metabolizing enzymes, glutamate dehydrogenase, glutamine synthetase and glutamyl transpeptidase, however it crossreacted moderately with glutamate decarboxylase. The antibodies were also used to define the possible physiologic activity of GBP in synaptic membranes. The antibodies were shown: (i) to inhibit the excitatory amino-acid stimulation of thiocyanate (SCN)flux, (ii) had no effect on transport of L-Glutamic acid across the synaptic membrane, and (iii) had no effect on the depolarization-induced release of L-glutamate. When the anti-GBP antibodies were used to localize and quantify the GBP distribution in various subcellular fractions and in brain tissue samples, it was found that the hippocampus had the highest immunoreactivity followed by the cerebral cortex, cerebellar cortex and caudate-putamen. The distribution of immunoreactivity in the subcellular fraction were as follows: synaptic membranes > crude mitochondrial fraction > homogenate > myelin. In conclusion these studies suggest that: (a) the rat brain GBP and the bovine brain GBP are immunologically homologous protein, (b) there are no structural similarities between the GBP and the glutamate metabolizing enzymes with the exception of glutamate decarboxylase and (c) the subcellular and regional distribution of the GBP immunoreactivity followed a similar pattern as observed for L-[ 3 H]-binding

  13. Glutamic Acid Selective Chemical Cleavage of Peptide Bonds.

    Science.gov (United States)

    Nalbone, Joseph M; Lahankar, Neelam; Buissereth, Lyssa; Raj, Monika

    2016-03-04

    Site-specific hydrolysis of peptide bonds at glutamic acid under neutral aqueous conditions is reported. The method relies on the activation of the backbone amide chain at glutamic acid by the formation of a pyroglutamyl (pGlu) imide moiety. This activation increases the susceptibility of a peptide bond toward hydrolysis. The method is highly specific and demonstrates broad substrate scope including cleavage of various bioactive peptides with unnatural amino acid residues, which are unsuitable substrates for enzymatic hydrolysis.

  14. Update on food safety of monosodium l-glutamate (MSG).

    Science.gov (United States)

    Henry-Unaeze, Helen Nonye

    2017-12-01

    This evidence-based safety review of the flavor enhancer monosodium l-glutamate (MSG) was triggered by its global use and recent studies expressing some safety concerns. This article obtained information through search of evidence-based scientific databases, especially the US National Library of Medicine NIH. (A) MSG is a water-soluble salt of glutamate, a non-essential amino acid, normally synthesized in the body and prevalent in protein foods. (B) MSG is utilized world-wide for its "umami" taste and flavor enhancement qualities, (C) the human body does not discriminate between glutamate present in food and that added as seasoning, (D) glutamate metabolism is compartmentalized in the human body without reported ethnic differences, (E) glutamate does not passively cross biological membranes, (F) food glutamate is completely metabolized by gut cells as energy source and serves as key substrate for other important metabolites in the liver, (G) normal food use of MSG is dose-dependent and self-limiting without elevation in plasma glutamate, (H) the recent EFSA acceptable daily intake (30mg/kg body weight/day) is not attainable when MSG is consumed at normal dietary level, (I) scientists have not been able to consistently elicit reactions in double-blind studies with 'sensitive' individuals using MSG or placebo in food. Based on the above observations (A-I), high quality MSG is safe for all life-cycle stages without respect to ethnic origin or culinary background. MSG researchers are advised to employ appropriate scientific methodologies, consider glutamate metabolism and its normal food use before extrapolating pharmacological rodent studies to humans. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Monosodium glutamate is not likely to be genotoxic.

    Science.gov (United States)

    Rogers, Michael D

    2016-08-01

    The International Glutamate Technical Committee (IGTC) wishes to comment on a recent publication in the Journal entitled "Genotoxicity of monosodium glutamate" (authored by Ataseven N, Yüzbaşıoğlu D, Keskin AÇ and Ünal F) (Ataseven et al. 2016). In particular, we wish to highlight that, in our considered view, the results of this study were inappropriately discussed and that references were selectively used. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Selective charging of tRNA isoacceptors induced by amino-acid starvation

    DEFF Research Database (Denmark)

    Dittmar, K. A.; Sørensen, Michael Askvad; Elf, J.

    2005-01-01

    Aminoacylated (charged) transfer RNA isoacceptors read different messenger RNA codons for the same amino acid. The concentration of an isoacceptor and its charged fraction are principal determinants of the translation rate of its codons. A recent theoretical model predicts that amino-acid...... by isoacceptors that retain high charging can be used for efficient translation of genes that are essential during amino-acid starvation. Selective charging can explain anomalous patterns of codon usage in the genes for different families of proteins....

  17. A Genome Wide Association Study Links Glutamate Receptor Pathway to Sporadic Creutzfeldt-Jakob Disease Risk

    Science.gov (United States)

    Sanchez-Juan, Pascual; Bishop, Matthew T.; Kovacs, Gabor G.; Calero, Miguel; Aulchenko, Yurii S.; Ladogana, Anna; Boyd, Alison; Lewis, Victoria; Ponto, Claudia; Calero, Olga; Poleggi, Anna; Carracedo, Ángel; van der Lee, Sven J.; Ströbel, Thomas; Rivadeneira, Fernando; Hofman, Albert; Haïk, Stéphane; Combarros, Onofre; Berciano, José; Uitterlinden, Andre G.; Collins, Steven J.; Budka, Herbert; Brandel, Jean-Philippe; Laplanche, Jean Louis; Pocchiari, Maurizio; Zerr, Inga; Knight, Richard S. G.; Will, Robert G.; van Duijn, Cornelia M.

    2015-01-01

    We performed a genome-wide association (GWA) study in 434 sporadic Creutzfeldt-Jakob disease (sCJD) patients and 1939 controls from the United Kingdom, Germany and The Netherlands. The findings were replicated in an independent sample of 1109 sCJD and 2264 controls provided by a multinational consortium. From the initial GWA analysis we selected 23 SNPs for further genotyping in 1109 sCJD cases from seven different countries. Five SNPs were significantly associated with sCJD after correction for multiple testing. Subsequently these five SNPs were genotyped in 2264 controls. The pooled analysis, including 1543 sCJD cases and 4203 controls, yielded two genome wide significant results: rs6107516 (p-value=7.62x10-9) a variant tagging the prion protein gene (PRNP); and rs6951643 (p-value=1.66x10-8) tagging the Glutamate Receptor Metabotropic 8 gene (GRM8). Next we analysed the data stratifying by country of origin combining samples from the pooled analysis with genotypes from the 1000 Genomes Project and imputed genotypes from the Rotterdam Study (Total n=12967). The meta-analysis of the results showed that rs6107516 (p-value=3.00x10-8) and rs6951643 (p-value=3.91x10-5) remained as the two most significantly associated SNPs. Rs6951643 is located in an intronic region of GRM8, a gene that was additionally tagged by a cluster of 12 SNPs within our top100 ranked results. GRM8 encodes for mGluR8, a protein which belongs to the metabotropic glutamate receptor family, recently shown to be involved in the transduction of cellular signals triggered by the prion protein. Pathway enrichment analyses performed with both Ingenuity Pathway Analysis and ALIGATOR postulates glutamate receptor signalling as one of the main pathways associated with sCJD. In summary, we have detected GRM8 as a novel, non-PRNP, genome-wide significant marker associated with heightened disease risk, providing additional evidence supporting a role of glutamate receptors in sCJD pathogenesis. PMID:25918841

  18. Plasmodium falciparum glutamate dehydrogenase a is dispensable and not a drug target during erythrocytic development

    LENUS (Irish Health Repository)

    Storm, Janet

    2011-07-14

    Abstract Background Plasmodium falciparum contains three genes encoding potential glutamate dehydrogenases. The protein encoded by gdha has previously been biochemically and structurally characterized. It was suggested that it is important for the supply of reducing equivalents during intra-erythrocytic development of Plasmodium and, therefore, a suitable drug target. Methods The gene encoding the NADP(H)-dependent GDHa has been disrupted by reverse genetics in P. falciparum and the effect on the antioxidant and metabolic capacities of the resulting mutant parasites was investigated. Results No growth defect under low and elevated oxygen tension, no up- or down-regulation of a number of antioxidant and NADP(H)-generating proteins or mRNAs and no increased levels of GSH were detected in the D10Δgdha parasite lines. Further, the fate of the carbon skeleton of [13C] labelled glutamine was assessed by metabolomic studies, revealing no differences in the labelling of α-ketoglutarate and other TCA pathway intermediates between wild type and mutant parasites. Conclusions First, the data support the conclusion that D10Δgdha parasites are not experiencing enhanced oxidative stress and that GDHa function may not be the provision of NADP(H) for reductive reactions. Second, the results imply that the cytosolic, NADP(H)-dependent GDHa protein is not involved in the oxidative deamination of glutamate but that the protein may play a role in ammonia assimilation as has been described for other NADP(H)-dependent GDH from plants and fungi. The lack of an obvious phenotype in the absence of GDHa may point to a regulatory role of the protein providing glutamate (as nitrogen storage molecule) in situations where the parasites experience a limiting supply of carbon sources and, therefore, under in vitro conditions the enzyme is unlikely to be of significant importance. The data imply that the protein is not a suitable target for future drug development against intra

  19. Metabotropic glutamate receptor 5 neuroimaging in schizophrenia.

    Science.gov (United States)

    Akkus, Funda; Treyer, Valerie; Ametamey, Simon M; Johayem, Anass; Buck, Alfred; Hasler, Gregor

    2017-05-01

    The metabotropic glutamate receptor 5 (mGluR5) is a promising drug target for the treatment of schizophrenia. In this study, we compared mGluR5 distribution volume ration (DVR) in subjects with schizophrenia and healthy controls. Given our previous findings, we matched samples for gender, age, and smoking status. Binding to mGluR5 was determined using positron emission tomography and [ 11 C]ABP688, which binds to an allosteric site with high selectivity. DVR in the 15 individuals with schizophrenia did not differ from that of the 15 controls. In both groups, smoking was associated with marked global reductions in mGluR5 availability (on average 23.8%). In nonsmoking subjects with schizophrenia, there was a positive correlation between mGluR5 DVR in the medial orbitofrontal cortex and the use of antipsychotic drugs (r=0.9, p=0.019). Because antipsychotic drugs such as clozapine appeared to have indirect effects on mGluR5 signaling, our findings may be clinically relevant. They also provide promising leads for elucidating the high comorbidity between schizophrenia and tobacco addiction. Low mGluR5 DVR in smokers my represent a risk factor for schizophrenia. Alternatively, smoking may counteract the potential upregulation of mGluR5 by antipsychotic drugs. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Comparative evaluation of glutamate-sensitive radiopharmaceuticals: Technetium-99m-glutamic acid and technetium-99m-diethylenetriaminepentaacetic acid-bis(glutamate) conjugate for tumor imaging.

    Science.gov (United States)

    Kakkar, Dipti; Tiwari, Anjani K; Chuttani, Krishna; Kaul, Ankur; Singh, Harpal; Mishra, Anil K

    2010-12-01

    Single-photon emission computed tomography has become a significant imaging modality with huge potential to visualize and provide information of anatomic dysfunctions that are predictive of future diseases. This imaging tool is complimented by radiopharmaceuticals/radiosubstrates that help in imaging specific physiological aspects of the human body. The present study was undertaken to explore the utility of technetium-99m (⁹⁹(m)Tc)-labeled glutamate conjugates for tumor scintigraphy. As part of our efforts to further utilize the application of chelating agents, glutamic acid was conjugated with a multidentate ligand, diethylenetriaminepentaacetic acid (DTPA). The DTPA-glutamate conjugate [DTPA-bis(Glu)] was well characterized by IR, NMR, and mass spectroscopy. The biological activity of glutamic acid was compared with its DTPA conjugate by radiocomplexation with ⁹⁹(m)Tc (labeling efficiency ≥98%). In vivo studies of both the radiolabeled complexes ⁹⁹(m)Tc-Glu and ⁹⁹(m)Tc-DTPA-bis(Glu) were then carried out, followed by gamma scintigraphy in New Zealand albino rabbits. Improved serum stability of ⁹⁹(m)Tc-labeled DTPA conjugate indicated that ⁹⁹(m)Tc remained bound to the conjugate up to 24 hours. Blood clearance showed a relatively slow washout of the DTPA conjugate when compared with the labeled glutamate. Biodistribution characteristics of the conjugate in Balb/c mice revealed that DTPA conjugation of glutamic acid favors less accumulation in the liver and bone and rapid renal clearance. Tumor scintigraphy in mice showed increasing tumor accumulation, stable up to 4 hours. These preliminary studies show that ⁹⁹(m)Tc-DTPA-bis(Glu) can be a useful radiopharmaceutical for diagnostic applications in single-photon emission computed tomography imaging.

  1. Enhancing poly-γ-glutamic acid production in Bacillus amyloliquefaciens by introducing the glutamate synthesis features from Corynebacterium glutamicum.

    Science.gov (United States)

    Feng, Jun; Quan, Yufen; Gu, Yanyan; Liu, Fenghong; Huang, Xiaozhong; Shen, Haosheng; Dang, Yulei; Cao, Mingfeng; Gao, Weixia; Lu, Xiaoyun; Wang, Yi; Song, Cunjiang; Wang, Shufang

    2017-05-22

    Poly-γ-glutamic acid (γ-PGA) is a valuable polymer with glutamate as its sole precursor. Enhancement of the intracellular glutamate synthesis is a very important strategy for the improvement of γ-PGA production, especially for those glutamate-independent γ-PGA producing strains. Corynebacterium glutamicum has long been used for industrial glutamate production and it exhibits some unique features for glutamate synthesis; therefore introduction of these metabolic characters into the γ-PGA producing strain might lead to increased intracellular glutamate availability, and thus ultimate γ-PGA production. In this study, the unique glutamate synthesis features from C. glutamicum was introduced into the glutamate-independent γ-PGA producing Bacillus amyloliquefaciens NK-1 strain. After introducing the energy-saving NADPH-dependent glutamate dehydrogenase (NADPH-GDH) pathway, the NK-1 (pHT315-gdh) strain showed slightly increase (by 9.1%) in γ-PGA production. Moreover, an optimized metabolic toggle switch for controlling the expression of ɑ-oxoglutarate dehydrogenase complex (ODHC) was introduced into the NK-1 strain, because it was previously shown that the ODHC in C. glutamicum was completely inhibited when glutamate was actively produced. The obtained NK-PO1 (pHT01-xylR) strain showed 66.2% higher γ-PGA production than the NK-1 strain. However, the further combination of these two strategies (introducing both NADPH-GDH pathway and the metabolic toggle switch) did not lead to further increase of γ-PGA production but rather the resultant γ-PGA production was even lower than that in the NK-1 strain. We proposed new metabolic engineering strategies to improve the γ-PGA production in B. amyloliquefaciens. The NK-1 (pHT315-gdh) strain with the introduction of NADPH-GDH pathway showed 9.1% improvement in γ-PGA production. The NK-PO1 (pHT01-xylR) strain with the introduction of a metabolic toggle switch for controlling the expression of ODHC showed 66.2% higher

  2. Glutamate-induced apoptosis in primary cortical neurons is inhibited by equine estrogens via down-regulation of caspase-3 and prevention of mitochondrial cytochrome c release

    Directory of Open Access Journals (Sweden)

    Zhang YueMei

    2005-02-01

    Full Text Available Abstract Background Apoptosis plays a key role in cell death observed in neurodegenerative diseases marked by a progressive loss of neurons as seen in Alzheimer's disease. Although the exact cause of apoptosis is not known, a number of factors such as free radicals, insufficient levels of nerve growth factors and excessive levels of glutamate have been implicated. We and others, have previously reported that in a stable HT22 neuronal cell line, glutamate induces apoptosis as indicated by DNA fragmentation and up- and down-regulation of Bax (pro-apoptotic, and Bcl-2 (anti-apoptotic genes respectively. Furthermore, these changes were reversed/inhibited by estrogens. Several lines of evidence also indicate that a family of cysteine proteases (caspases appear to play a critical role in neuronal apoptosis. The purpose of the present study is to determine in primary cultures of cortical cells, if glutamate-induced neuronal apoptosis and its inhibition by estrogens involve changes in caspase-3 protease and whether this process is mediated by Fas receptor and/or mitochondrial signal transduction pathways involving release of cytochrome c. Results In primary cultures of rat cortical cells, glutamate induced apoptosis that was associated with enhanced DNA fragmentation, morphological changes, and up-regulation of pro-caspase-3. Exposure of cortical cells to glutamate resulted in a time-dependent cell death and an increase in caspase-3 protein levels. Although the increase in caspase-3 levels was evident after 3 h, cell death was only significantly increased after 6 h. Treatment of cells for 6 h with 1 to 20 mM glutamate resulted in a 35 to 45% cell death that was associated with a 45 to 65% increase in the expression of caspase-3 protein. Pretreatment with caspase-3-protease inhibitor z-DEVD or pan-caspase inhibitor z-VAD significantly decreased glutamate-induced cell death of cortical cells. Exposure of cells to glutamate for 6 h in the presence or

  3. Delineation of glutamate pathways and secretory responses in pancreatic islets with β-cell-specific abrogation of the glutamate dehydrogenase.

    Science.gov (United States)

    Vetterli, Laurène; Carobbio, Stefania; Pournourmohammadi, Shirin; Martin-Del-Rio, Rafael; Skytt, Dorte M; Waagepetersen, Helle S; Tamarit-Rodriguez, Jorge; Maechler, Pierre

    2012-10-01

    In pancreatic β-cells, glutamate dehydrogenase (GDH) modulates insulin secretion, although its function regarding specific secretagogues is unclear. This study investigated the role of GDH using a β-cell-specific GDH knockout mouse model, called βGlud1(-/-). The absence of GDH in islets isolated from βGlud1(-/-) mice resulted in abrogation of insulin release evoked by glutamine combined with 2-aminobicyclo[2.2.1]heptane-2-carboxylic acid or l-leucine. Reintroduction of GDH in βGlud1(-/-) islets fully restored the secretory response. Regarding glucose stimulation, insulin secretion in islets isolated from βGlud1(-/-) mice exhibited half of the response measured in control islets. The amplifying pathway, tested at stimulatory glucose concentrations in the presence of KCl and diazoxide, was markedly inhibited in βGlud1(-/-) islets. On glucose stimulation, net synthesis of glutamate from α-ketoglutarate was impaired in GDH-deficient islets. Accordingly, glucose-induced elevation of glutamate levels observed in control islets was absent in βGlud1(-/-) islets. Parallel biochemical pathways, namely alanine and aspartate aminotransferases, could not compensate for the lack of GDH. However, the secretory response to glucose was fully restored by the provision of cellular glutamate when βGlud1(-/-) islets were exposed to dimethyl glutamate. This shows that permissive levels of glutamate are required for the full development of glucose-stimulated insulin secretion and that GDH plays an indispensable role in this process.

  4. Bacterial cell-surface displaying of thermo-tolerant glutamate dehydrogenase and its application in L-glutamate assay.

    Science.gov (United States)

    Song, Jianxia; Liang, Bo; Han, Dongfei; Tang, Xiangjiang; Lang, Qiaolin; Feng, Ruirui; Han, Lihui; Liu, Aihua

    2015-03-01

    In this paper, glutamate dehydrogenase (Gldh) is reported to efficiently display on Escherichia coli cell surface by using N-terminal region of ice the nucleation protein as an anchoring motif. The presence of Gldh was confirmed by SDS-PAGE and enzyme activity assay. Gldh was detected mainly in the outer membrane fraction, suggesting that the Gldh was displayed on the bacterial cell surface. The optimal temperature and pH for the bacteria cell-surface displayed Gldh (bacteria-Gldh) were 70°C and 9.0, respectively. Additionally, the fusion protein retained almost 100% of its initial enzymatic activity after 1 month incubation at 4°C. Transition metal ions could inhibit the enzyme activity to different extents, while common anions had little adverse effect on enzyme activity. Importantly, the displayed Gldh is most specific to l-glutamate reported so far. The bacterial Gldh was enabled to catalyze oxidization of l-glutamate with NADP(+) as cofactor, and the resultant NADPH can be detected spectrometrically at 340nm. The bacterial-Gldh based l-glutamate assay was established, where the absorbance at 340nm increased linearly with the increasing l-glutamate concentration within the range of 10-400μM. Further, the proposed approach was successfully applied to measure l-glutamate in real samples. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Potent protection of ferulic acid against excitotoxic effects of maternal intragastric administration of monosodium glutamate at a late stage of pregnancy on developing mouse fetal brain.

    Science.gov (United States)

    Yu, Lijian; Zhang, Yongping; Ma, Rundi; Bao, Li; Fang, Juanzhi; Yu, Tingxi

    2006-04-01

    The present study was conducted to investigate a possible protection of ferulic acid against excitotoxic effects of maternal intragastric (ig) administration of monosodium glutamate (MSG) at a late stage of pregnancy on developing mouse fetal brain. [(3)H]-labeled glutamate was used as radiotracer to study the effect of ferulic acid on distribution of MSG in mouse fetal brain. MSG dissolved in distilled water (2.0 g/kg body weight, 640 kBq of [(3)H]glutamate/mouse, ig) or/and sodium ferulate (SF) (20, 40, 80 mg/kg body weight, ip), was given to pregnant mice at 17-19 days; the distribution of [(3)H] glutamate in the mouse fetal brains was measured at 30, 60, 90, 120 min after administration of MSG or/and SF. Maternal mice were given MSG (1.0, 2.0, 4.0 g/kg body weight, ig) or/and SF (20, 40, 80 mg/kg body weight, ip) simultaneously at 17-19 days of pregnancy, and then behavioral tests and histopathological observations were used to analyze glutamate-induced functional and morphological changes of the brains of their offspring, and Western blot analysis was performed for examining expressions of bcl-2 and caspase-3. The results showed that SF obviously inhibited the uptake of labeled glutamate in fetal brain. In addition, SF countered the effects of MSG on behavior, histopathology, genetic toxicity, and expression of apoptosis-related gene. The results suggest that ferulic acid is a novel competitive N-methyl-D-aspartate (NMDA) receptor antagonist and neuroprotector. In conclusion, maternal administration of ferulic acid has potent protective effects against glutamate-induced neurotoxicity in their filial mice.

  6. Neonatal monosodium glutamate treatment modifies glutamic acid decarboxylase activity during rat brain postnatal development.

    Science.gov (United States)

    Ureña-Guerrero, Mónica Elisa; López-Pérez, Silvia Josefina; Beas-Zárate, Carlos

    2003-03-01

    Monosodium glutamate (MSG) produces neurodegeneration in several brain regions when it is administered to neonatal rats. From an early embryonic age to adulthood, GABA neurons appear to have functional glutamatergic receptors, which could convert them in an important target for excitotoxic neurodegeneration. Changes in the activity of the GABA synthesizing enzyme, glutamic acid decarboxylase (GAD), have been shown after different neuronal insults. Therefore, this work evaluates the effect of neonatal MSG treatment on GAD activity and kinetics in the cerebral cortex, striatum, hippocampus and cerebellum of the rat brain during postnatal development. Neonatal MSG treatment decreased GAD activity in the cerebral cortex at 21 and 60 postnatal days (PD), mainly due to a reduction in the enzyme affinity (K(m)). In striatum, the GAD activity and the enzyme maximum velocity (V(max)) were increased at PD 60 after neonatal MSG treatment. Finally, in the hippocampus and cerebellum, the GAD activity and V(max) were increased, but the K(m) was found to be lower in the experimental group. The results could be related to compensatory mechanisms from the surviving GABAergic neurons, and suggest a putative adjustment in the GAD isoform expression throughout the development of the postnatal brain, since this enzyme is regulated by the synaptic activity under physiological and/or pathophysiological conditions.

  7. Molecular properties and enhancement of thermostability by random mutagenesis of glutamate dehydrogenase from Bacillus subtilis.

    Science.gov (United States)

    Khan, Md Iqbal Hassan; Ito, Kousuke; Kim, Hyeung; Ashida, Hiroyuki; Ishikawa, Takahiro; Shibata, Hitoshi; Sawa, Yoshihiro

    2005-10-01

    The rocG gene encoding glutamate dehydrogenase from Bacillus subtilis (Bs-GluDH) was cloned, and expressed at considerable magnitude in Escherichia coli. The recombinant Bs-GluDH was purified to homogeneity and has been determined to have a hexameric structure (M(r) 270 kDa) with strict specificity for 2-oxoglutarate and L-glutamate, requiring NADH and NAD+ as cofactors respectively. The enzyme showed low thermostability with T(m) = 41 degrees C due to dissociation of the hexamer. To improve the thermostability of this enzyme, we performed error-prone PCR, introducing random mutagenesis on cloned GluDH. Two single mutant enzymes, Q144R and E27F, were isolated from the final mutant library. Their T(m) values were 61 degrees C and 49 degrees C respectively. Furthermore, Q144R had a remarkably high k(cat) value (435 s(-1)) for amination reaction at 37 degrees C, 1.3 times higher than that of the wild-type. Thus, Q144R can be used as a template gene to modify the substrate specificity of Bs-GluDH for industrial use.

  8. Accelerated pentose utilization by Corynebacterium glutamicum for accelerated production of lysine, glutamate, ornithine and putrescine

    Science.gov (United States)

    Meiswinkel, Tobias M; Gopinath, Vipin; Lindner, Steffen N; Nampoothiri, K Madhavan; Wendisch, Volker F

    2013-01-01

    Summary Because of their abundance in hemicellulosic wastes arabinose and xylose are an interesting source of carbon for biotechnological production processes. Previous studies have engineered several Corynebacterium glutamicum strains for the utilization of arabinose and xylose, however, with inefficient xylose utilization capabilities. To improve xylose utilization, different xylose isomerase genes were tested in C. glutamicum. The gene originating from Xanthomonas campestris was shown to have the highest effect, resulting in growth rates of 0.14 h−1, followed by genes from Bacillus subtilis, Mycobacterium smegmatis and Escherichia coli. To further increase xylose utilization different xylulokinase genes were expressed combined with X. campestris xylose isomerase gene. All combinations further increased growth rates of the recombinant strains up to 0.20 h−1 and moreover increased biomass yields. The gene combination of X. campestris xylose isomerase and C. glutamicum xylulokinase was the fastest growing on xylose and compared with the previously described strain solely expressing E. coli xylose isomerase gene delivered a doubled growth rate. Productivity of the amino acids glutamate, lysine and ornithine, as well as the diamine putrescine was increased as well as final titres except for lysine where titres remained unchanged. Also productivity in medium containing rice straw hydrolysate as carbon source was increased. Funding Information No funding information provided. PMID:23164409

  9. Naphthazarin protects against glutamate-induced neuronal death via activation of the Nrf2/ARE pathway

    International Nuclear Information System (INIS)

    Son, Tae Gen; Kawamoto, Elisa M.; Yu, Qian-Sheng; Greig, Nigel H.; Mattson, Mark P.; Camandola, Simonetta

    2013-01-01

    Highlights: •Naphthazarin activates the Nrf2/ARE pathway. •Naphthazarin induces Nrf2-driven genes in neurons and astrocytes. •Naphthazarin protects neurons against excitotoxicity. -- Abstract: Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. We previously screened several natural phytochemicals and identified plumbagin as a novel activator of the Nrf2/ARE pathway that can protect neurons against ischemic injury. Here we extended our studies to natural and synthetic derivatives of plumbagin. We found that 5,8-dimethoxy-1,4-naphthoquinone (naphthazarin) is a potent activator of the Nrf2/ARE pathway, up-regulates the expression of Nrf2-driven genes in primary neuronal and glial cultures, and protects neurons against glutamate-induced excitotoxicity

  10. Naphthazarin protects against glutamate-induced neuronal death via activation of the Nrf2/ARE pathway

    Energy Technology Data Exchange (ETDEWEB)

    Son, Tae Gen; Kawamoto, Elisa M.; Yu, Qian-Sheng; Greig, Nigel H. [Laboratory of Neurosciences, National Institute on Aging, Intramural Research Program, 251 Bayview Blvd., Baltimore, MD 21224 (United States); Mattson, Mark P. [Laboratory of Neurosciences, National Institute on Aging, Intramural Research Program, 251 Bayview Blvd., Baltimore, MD 21224 (United States); Department of Neuroscience, Johns Hopkins University School of Medicine, Baltimore, MD (United States); Camandola, Simonetta, E-mail: camandolasi@mail.nih.gov [Laboratory of Neurosciences, National Institute on Aging, Intramural Research Program, 251 Bayview Blvd., Baltimore, MD 21224 (United States)

    2013-04-19

    Highlights: •Naphthazarin activates the Nrf2/ARE pathway. •Naphthazarin induces Nrf2-driven genes in neurons and astrocytes. •Naphthazarin protects neurons against excitotoxicity. -- Abstract: Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. We previously screened several natural phytochemicals and identified plumbagin as a novel activator of the Nrf2/ARE pathway that can protect neurons against ischemic injury. Here we extended our studies to natural and synthetic derivatives of plumbagin. We found that 5,8-dimethoxy-1,4-naphthoquinone (naphthazarin) is a potent activator of the Nrf2/ARE pathway, up-regulates the expression of Nrf2-driven genes in primary neuronal and glial cultures, and protects neurons against glutamate-induced excitotoxicity.

  11. Mediator-less highly sensitive voltammetric detection of glutamate using glutamate dehydrogenase/vertically aligned CNTs grown on silicon substrate.

    Science.gov (United States)

    Gholizadeh, Azam; Shahrokhian, Saeed; zad, Azam Iraji; Mohajerzadeh, Shamsoddin; Vosoughi, Manouchehr; Darbari, Sara; Sanaee, Zeinab

    2012-01-15

    A sensitive glutamate biosensor is prepared based on glutamate dehydrogenase/vertically aligned carbon nanotubes (GLDH, VACNTs). Vertically aligned carbon nanotubes were grown on a silicon substrate by direct current plasma enhanced chemical vapor deposition (DC-PECVD) method. The electrochemical behavior of the synthesized VACNTs was investigated by cyclic voltammetry and electrochemical impedance spectroscopic methods. Glutamate dehydrogenase covalently attached on tip of VACNTs. The electrochemical performance of the electrode for detection of glutamate was investigated by cyclic and differential pulse voltammetry. Differential pulse voltammetric determinations of glutamate are performed in mediator-less condition and also, in the presence of 1 and 5 μM thionine as electron mediator. The linear calibration curve of the concentration of glutamate versus peak current is investigated in a wide range of 0.1-500 μM. The mediator-less biosensor has a low detection limit of 57 nM and two linear ranges of 0.1-20 μM with a sensitivity of 0.976 mA mM(-1) cm(-2) and 20-300 μM with a sensitivity of 0.182 mA mM(-1) cm(-2). In the presence of 1 μM thionine as an electron mediator, the prepared biosensor shows a low detection limit of 68 nM and two linear ranges of 0.1-20 with a calibration sensitivity of 1.17 mA mM(-1) cm(-2) and 20-500 μM with a sensitivity of 0.153 mA mM(-1) cm(-2). The effects of the other biological compounds on the voltammetric behavior of the prepared biosensor and its response stability are investigated. The results are demonstrated that the GLDH/VACNTs electrode even without electron mediator is a suitable basic electrode for detection of glutamate. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Differential effects of repetitive oral administration of monosodium glutamate on interstitial glutamate concentration and muscle pain sensitivity.

    Science.gov (United States)

    Shimada, Akiko; Baad-Hansen, Lene; Castrillon, Eduardo; Ghafouri, Bijar; Stensson, Niclas; Gerdle, Björn; Ernberg, Malin; Cairns, Brian; Svensson, Peter; Svensson Odont, Peter

    2015-02-01

    The aim of this study was to determine the relationship of high daily monosodium glutamate (MSG) consumption with glutamate concentrations in jaw muscle, saliva, and serum, and muscle pain sensitivity in healthy participants. A randomized, double-blinded, placebo-controlled study was conducted to investigate the effect of repetitive consumption of high-dose MSG on glutamate concentration in the masseter muscles measured by microdialysis and muscle pain sensitivity. In five contiguous experimental daily sessions, 32 healthy participants drank MSG (150 mg/kg) or NaCl (24 mg/kg) diluted with a 400 mL soda. The concentrations of glutamate before and after the ingestion were assessed in dialysate and plasma samples on the first and last days. Saliva glutamate concentration was assessed every day. Pressure pain threshold, pressure pain tolerance, autonomic parameters (heart rate, systolic and diastolic blood pressures) and reported side effects also were assessed. No significant change was noted in the baseline concentration of glutamate in the masseter muscle, blood, or saliva, but the peak concentration in the masseter muscle increased significantly between day 1 and 5. A statistically significant increase in systolic and diastolic blood pressures after MSG administration was observed, as well as a significantly higher frequency of reports of nausea and headache in the MSG group. No robust effect of MSG on muscle sensitivity was found. Interstitial glutamate concentration in the masseter muscle is not highly disturbed by excessive repetitive intake of MSG in healthy man. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Increased pain and muscle glutamate concentration after single ingestion of monosodium glutamate by myofascial temporomandibular disorders patients.

    Science.gov (United States)

    Shimada, A; Castrillon, E E; Baad-Hansen, L; Ghafouri, B; Gerdle, B; Wåhlén, K; Ernberg, M; Cairns, B E; Svensson, P

    2016-10-01

    A randomized, double-blinded, placebo-controlled study was conducted to investigate if single monosodium glutamate (MSG) administration would elevate muscle/serum glutamate concentrations and affect muscle pain sensitivity in myofascial temporomandibular disorders (TMD) patients more than in healthy individuals. Twelve myofascial TMD patients and 12 sex- and age-matched healthy controls participated in two sessions. Participants drank MSG (150 mg/kg) or NaCl (24 mg/kg; control) diluted in 400 mL of soda. The concentration of glutamate in the masseter muscle, blood plasma and saliva was determined before and after the ingestion of MSG or control. At baseline and every 15 min after the ingestion, pain intensity was scored on a 0-10 numeric rating scale. Pressure pain threshold, pressure pain tolerance (PPTol) and autonomic parameters were measured. All participants were asked to report adverse effects after the ingestion. In TMD, interstitial glutamate concentration was significantly greater after the MSG ingestion when compared with healthy controls. TMD reported a mean pain intensity of 2.8/10 at baseline, which significantly increased by 40% 30 min post MSG ingestion. At baseline, TMD showed lower PPTols in the masseter and trapezius, and higher diastolic blood pressure and heart rate than healthy controls. The MSG ingestion resulted in reports of headache by half of the TMD and healthy controls, respectively. These findings suggest that myofascial TMD patients may be particularly sensitive to the effects of ingested MSG. WHAT DOES THIS STUDY ADD?': Elevation of interstitial glutamate concentration in the masseter muscle caused by monosodium glutamate (MSG) ingestion was significantly greater in myofascial myofascial temporomandibular disorders (TMD) patients than healthy individuals. This elevation of interstitial glutamate concentration in the masseter muscle significantly increased the intensity of spontaneous pain in myofascial TMD patients. © 2016

  14. Glutamate abnormalities in obsessive compulsive disorder: neurobiology, pathophysiology, and treatment.

    Science.gov (United States)

    Pittenger, Christopher; Bloch, Michael H; Williams, Kyle

    2011-12-01

    Obsessive compulsive disorder is prevalent, disabling, incompletely understood, and often resistant to current therapies. Established treatments consist of specialized cognitive-behavioral psychotherapy and pharmacotherapy with medications targeting serotonergic and dopaminergic neurotransmission. However, remission is rare, and more than a quarter of OCD sufferers receive little or no benefit from these approaches, even when they are optimally delivered. New insights into the disorder, and new treatment strategies, are urgently needed. Recent evidence suggests that the ubiquitous excitatory neurotransmitter glutamate is dysregulated in OCD, and that this dysregulation may contribute to the pathophysiology of the disorder. Here we review the current state of this evidence, including neuroimaging studies, genetics, neurochemical investigations, and insights from animal models. Finally, we review recent findings from small clinical trials of glutamate-modulating medications in treatment-refractory OCD. The precise role of glutamate dysregulation in OCD remains unclear, and we lack blinded, well-controlled studies demonstrating therapeutic benefit from glutamate-modulating agents. Nevertheless, the evidence supporting some important perturbation of glutamate in the disorder is increasingly strong. This new perspective on the pathophysiology of OCD, which complements the older focus on monoaminergic neurotransmission, constitutes an important focus of current research and a promising area for the ongoing development of new therapeutics. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. Metabotropic glutamate receptor 5 may be involved in macrophage plasticity

    Directory of Open Access Journals (Sweden)

    Lali Shanshiashvili

    Full Text Available Abstract Background Macrophages are a functionally heterogeneous cell population and depending on microenvironments they polarize in two main groups: M1 and M2. Glutamic acid and glutamate receptors may participate in the regulation of macrophage plasticity. To investigate the role of glutamatergic systems in macrophages physiology, we performed the transfection of mGluR5 cDNAs into RAW-264.7 cells. Results Comparative analysis of modified (RAW-mGluR5 macrophages and non-modified macrophages (RAW-macrophages has shown that the RAW-mGluR5 macrophages absorbed more glutamate than control cells and the amount of intracellular glutamate correlated with the expression of excitatory amino acid transporters -2 (EAAT-2. Besides, our results have shown that RAW-mGluR5 macrophages expressed a higher level of peroxisome proliferator-activated receptor γ (PPAR-γ and secreted more IL-10, high mobility group box 1 proteins (HMGB1 and Galectin-3 than control RAW-macrophages. Conclusions We propose that elevation of intracellular glutamate and expression of mGluR5 may initiate the metabolic rearrangement in macrophages that could contribute to the formation of an immunosuppressive phenotype.

  16. Distribution of vesicular glutamate transporters in the human brain

    Directory of Open Access Journals (Sweden)

    Erika eVigneault

    2015-03-01

    Full Text Available Glutamate is the major excitatory transmitter in the brain. Vesicular glutamate transporters (VGLUT1-3 are responsible for uploading glutamate into synaptic vesicles. VGLUT1 and VGLUT2 are considered as specific markers of canonical glutamatergic neurons, while VGLUT3 is found in neurons previously shown to use other neurotransmitters than glutamate. Although there exists a rich literature on the localization of these glutamatergic markers in the rodent brain, little is currently known about the distribution of VGLUT1-3 in the human brain. In the present study, using subtype specific probes and antisera, we examined the localization of the three vesicular glutamate transporters in the human brain by in situ hybridization, immunoautoradiography and immunohistochemistry. We found that the VGLUT1 transcript was highly expressed in the cerebral cortex, hippocampus and cerebellum, whereas VGLUT2 mRNA was mainly found in the thalamus and brainstem. VGLUT3 mRNA was localized in scarce neurons within the cerebral cortex, hippocampus, striatum and raphe nuclei. Following immunoautoradiographic labeling, intense VGLUT1- and VGLUT2-immunoreactivities were observed in all regions investigated (cerebral cortex, hippocampus, caudate-putamen, cerebellum, thalamus, amygdala, substantia nigra, raphe while VGLUT3 was absent from the thalamus and cerebellum. This extensive mapping of VGLUT1-3 in human brain reveals distributions that correspond for the most part to those previously described in rodent brains.

  17. Influence of glutamic acid enantiomers on C-mineralization.

    Science.gov (United States)

    Formánek, Pavel; Vranová, Valerie; Lojková, Lea

    2015-02-01

    Seasonal dynamics in the mineralization of glutamic acid enantiomers in soils from selected ecosystems was determined and subjected to a range of treatments: ambient x elevated CO2 level and meadow x dense x thinned forest environment. Mineralization of glutamic acid was determined by incubation of the soil with 2 mg L- or D-glutamic acid g(-1) of dry soil to induce the maximum respiration rate. Mineralization of glutamic acid enantiomers in soils fluctuates over the course of a vegetation season, following a similar trend across a range of ecosystems. Mineralization is affected by environmental changes and management practices, including elevated CO2 level and thinning intensity. L-glutamic acid metabolism is more dependent on soil type as compared to metabolism of its D-enantiomer. The results support the hypothesis that the slower rate of D- compared to L- amino acid mineralization is due to different roles in anabolism and catabolism of the soil microbial community. © 2014 Wiley Periodicals, Inc.

  18. Methylphenidate Increases Glutamate Uptake in Bergmann Glial Cells.

    Science.gov (United States)

    Guillem, Alain M; Martínez-Lozada, Zila; Hernández-Kelly, Luisa C; López-Bayghen, Esther; López-Bayghen, Bruno; Calleros, Oscar A; Campuzano, Marco R; Ortega, Arturo

    2015-11-01

    Glutamate, the main excitatory transmitter in the vertebrate brain, exerts its actions through the activation of specific membrane receptors present in neurons and glial cells. Over-stimulation of glutamate receptors results in neuronal death, phenomena known as excitotoxicity. A family of glutamate uptake systems, mainly expressed in glial cells, removes the amino acid from the synaptic cleft preventing an excessive glutamatergic stimulation and thus neuronal damage. Autism spectrum disorders comprise a group of syndromes characterized by impaired social interactions and anxiety. One or the most common drugs prescribed to treat these disorders is Methylphenidate, known to increase dopamine extracellular levels, although it is not clear if its sedative effects are related to a plausible regulation of the glutamatergic tone via the regulation of the glial glutamate uptake systems. To gain insight into this possibility, we used the well-established model system of cultured chick cerebellum Bergmann glia cells. A time and dose-dependent increase in the activity and protein levels of glutamate transporters was detected upon Methylphenidate exposure. Interestingly, this increase is the result of an augmentation of both the synthesis as well as the insertion of these protein complexes in the plasma membrane. These results favour the notion that glial cells are Methylphenidate targets, and that by these means could regulate dopamine turnover.

  19. The influence of Na+,K+-ATPase on glutamate signaling in neurodegenerative diseases and senescence

    Directory of Open Access Journals (Sweden)

    Paula Fernanda Kinoshita

    2016-06-01

    Full Text Available Decreased Na+,K+-ATPase (NKA activity causes energy deficiency, which is commonly observed in neurodegenerative diseases. The NKA is constituted of three subunits: α, β and γ, with four distinct isoforms of the catalytic α subunit (α1-4. Genetic mutations in the ATP1A2 gene and ATP1A3 gene, encoding the α2 and α3 subunit isoforms, respectively can cause distinct neurological disorders, concurrent to impaired NKA activity. Within the central nervous system (CNS, the α2 isoform is expressed mostly in glial cells and the α3 isoform is neuron-specific. Mutations in ATP1A2 gene can result in familial hemiplegic migraine (FHM2, while mutations in the ATP1A3 gene can cause Rapid-onset dystonia-Parkinsonism (RDP and alternating hemiplegia of childhood (AHC, as well as the cerebellar ataxia, areflexia, pescavus, optic atrophy and sensorineural hearing loss (CAPOS syndrome. Data indicates that the central glutamatergic system is affected by mutations in the α2 isoform, however further investigations are required to establish a connection to mutations in the α3 isoform, especially given the diagnostic confusion and overlap with glutamate transporter disease. The age-related decline in brain α2/3 activity may arise from changes in the cyclic guanosine monophosphate (cGMP and cGMP‐dependent protein kinase (PKG pathway. Glutamate, through nitric oxide synthase (NOS, cGMP and PKG, stimulates brain α2/3 activity, with the glutamatergic N-methyl-D-aspartate (NMDA receptor cascade able to drive an adaptive, neuroprotective response to inflammatory and challenging stimuli, including amyloid‐β. Here we review the NKA, both as an ion pump as well as a receptor that interacts with NMDA, including the role of NKA subunits mutations. Failure of the NKA-associated adaptive response mechanisms may render neurons more susceptible to degeneration over the course of aging.

  20. Binding and release of glutamate from overoxidized polypyrrole via an applied potential for application as a molecular switch

    NARCIS (Netherlands)

    von Hauff, Elizabeth; Meteleva-Fischer, Yulia; Parisi, Jueirgen; Weiler, Reto

    2008-01-01

    The controlled binding and release of glutamate from overoxidized polypyrrole (PPy) films via a variable potential was investigated. Glutamate-doped PPy films were electrochemically deposited from aqueous sodium glutamate electrolytes containing the pyrrole monomer. The resulting polymer films were

  1. Deletion of glutamate delta-1 receptor in mouse leads to aberrant emotional and social behaviors.

    Directory of Open Access Journals (Sweden)

    Roopali Yadav

    Full Text Available The delta family of ionotropic glutamate receptors consists of glutamate δ1 (GluD1 and glutamate δ2 (GluD2 receptors. While the role of GluD2 in the regulation of cerebellar physiology is well understood, the function of GluD1 in the central nervous system remains elusive. We demonstrate for the first time that deletion of GluD1 leads to abnormal emotional and social behaviors. We found that GluD1 knockout mice (GluD1 KO were hyperactive, manifested lower anxiety-like behavior, depression-like behavior in a forced swim test and robust aggression in the resident-intruder test. Chronic lithium rescued the depression-like behavior in GluD1 KO. GluD1 KO mice also manifested deficits in social interaction. In the sociability test, GluD1 KO mice spent more time interacting with an inanimate object compared to a conspecific mouse. D-Cycloserine (DCS administration was able to rescue social interaction deficits observed in GluD1 KO mice. At a molecular level synaptoneurosome preparations revealed lower GluA1 and GluA2 subunit expression in the prefrontal cortex and higher GluA1, GluK2 and PSD95 expression in the amygdala of GluD1 KO. Moreover, DCS normalized the lower GluA1 expression in prefrontal cortex of GluD1 KO. We propose that deletion of GluD1 leads to aberrant circuitry in prefrontal cortex and amygdala owing to its potential role in presynaptic differentiation and synapse formation. Furthermore, these findings are in agreement with the human genetic studies suggesting a strong association of GRID1 gene with several neuropsychiatric disorders including schizophrenia, bipolar disorder, autism spectrum disorders and major depressive disorder.

  2. Chronic glutamate toxicity in neurodegenerative diseases-what is the evidence?

    Directory of Open Access Journals (Sweden)

    Pamela eMaher

    2015-12-01

    Full Text Available Together with aspartate, glutamate is the major excitatory neurotransmitter in the brain. Glutamate binds and activates both ligand-gated ion channels (ionotropic glutamate receptors and a class of G-protein coupled receptors (metabotropic glutamate receptors. Although the intracellular glutamate concentration in the brain is in the millimolar range, the extracellular glutamate concentration is kept in the low micromolar range by the action of excitatory amino acid transporters that import glutamate and aspartate into astrocytes and neurons. Excess extracellular glutamate may lead to excitotoxicity in vitro and in vivo in acute insults like ischemic stroke via the overactivation of ionotropic glutamate receptors. In addition, chronic excitotoxicity has been hypothesized to play a role in numerous neurodegenerative diseases including amyotrophic lateral sclerosis, Alzheimer’s disease and Huntington’s disease. Based on this hypothesis, a good deal of effort has been devoted to develop and test drugs that either inhibit glutamate receptors or decrease extracellular glutamate. In this review, we provide an overview of the different pathways that are thought to lead to an over-activation of the glutamatergic system and glutamate toxicity in neurodegeneration. In addition, we summarize the available experimental evidence for glutamate toxicity in animal models of neurodegenerative diseases.

  3. Dysfunctional TCA-Cycle Metabolism in Glutamate Dehydrogenase Deficient Astrocytes

    DEFF Research Database (Denmark)

    Nissen, Jakob D; Pajęcka, Kamilla; Stridh, Malin H

    2015-01-01

    aminotransferase (AAT) catalyze the reversible reaction between glutamate and α-ketoglutarate, which is the initial step for glutamate to enter TCA cycle metabolism. In contrast to GDH, AAT requires a concomitant interconversion of oxaloacetate and aspartate. We have investigated the role of GDH in astrocyte...... Labeling of aspartate and TCA cycle intermediates confirmed that the increased amount of aspartate is associated with elevated TCA cycle flux from α-ketoglutarate to oxaloacetate, i.e. truncated TCA cycle. (13) C Glucose metabolism was elevated in GDH deficient astrocytes as observed by increased de novo...... synthesis of aspartate via pyruvate carboxylation. In the absence of glucose, lactate production from glutamate via malic enzyme was lower in GDH deficient astrocytes. In conclusions, our studies reveal that metabolism via GDH serves an important anaplerotic role by adding net carbon to the TCA cycle...

  4. Aminotransferase and glutamate dehydrogenase activities in lactobacilli and streptococci

    Directory of Open Access Journals (Sweden)

    Guillermo Hugo Peralta

    Full Text Available ABSTRACT Aminotransferases and glutamate dehydrogenase are two main types of enzymes involved in the initial steps of amino acid catabolism, which plays a key role in the cheese flavor development. In the present work, glutamate dehydrogenase and aminotransferase activities were screened in twenty one strains of lactic acid bacteria of dairy interest, either cheese-isolated or commercial starters, including fifteen mesophilic lactobacilli, four thermophilic lactobacilli, and two streptococci. The strains of Streptococcus thermophilus showed the highest glutamate dehydrogenase activity, which was significantly elevated compared with the lactobacilli. Aspartate aminotransferase prevailed in most strains tested, while the levels and specificity of other aminotransferases were highly strain- and species-dependent. The knowledge of enzymatic profiles of these starter and cheese-isolated cultures is helpful in proposing appropriate combinations of strains for improved or increased cheese flavor.

  5. Zinc and glutamate dehydrogenase in putative glutamatergic brain structures.

    Science.gov (United States)

    Wolf, G; Schmidt, W

    1983-01-01

    A certain topographic parallelism between the distribution of histochemically (TIMM staining) identified zinc and putative glutamatergic structures in the rat brain was demonstrated. Glutamate dehydrogenase as a zinc containing protein is in consideration to be an enzyme synthesizing transmitter glutamate. In a low concentration range externally added zinc ions (10(-9) to 10(-7) M) induced an increase in the activity of glutamate dehydrogenase (GDH) originating from rat hippocampal formation, neocortex, and cerebellum up to 142.4%. With rising molarity of Zn(II) in the incubation medium, the enzyme of hippocampal formation and cerebellum showed a biphasic course of activation. Zinc ions of a concentration higher than 10(-6) M caused a strong inhibition of GDH. The effect of Zn(II) on GDH originating from spinal ganglia and liver led only to a decrease of enzyme activity. These results are discussed in connection with a functional correlation between zinc and putatively glutamatergic system.

  6. The involvement of glutamate in the pathophysiology of depression.

    Science.gov (United States)

    Palucha, A; Pilc, A

    2005-05-01

    In spite of more than 40 years of thorough studies, conventional antidepressants still have many limitations that hinder the effective treatment of depression. It seems that a breakthrough in the therapy of depression will require going beyond a monoamine-based theory of depression. Converging lines of evidence indicate that the glutamatergic system might be a promising target for a novel antidepressant therapy. Both ionotropic glutamate receptor ligands (functional NMDA receptor antagonists and AMPA receptor potentiators) and compounds acting at metabotropic glutamate receptors (mGluRs; group I mGluR antagonists, group II antagonists and group III agonists) produce antidepressant-like activity in several preclinical and some clinical studies. In this review, current knowledge and crucial hypotheses concerning the role of glutamate in the pathophysiology of depression are discussed. 2005 Prous Science. All rights reserved

  7. Foreign body granuloma caused by monosodium glutamate after BCG vaccination.

    Science.gov (United States)

    Chiu, Yao-Kun; Huang, Chao-Cheng; Jeng, Jingyueh; Shiea, Jentaie; Chen, Wei-Jen

    2006-08-01

    We describe a 7-month-old male infant with a foreign body granuloma caused by monosodium glutamate (MSG) after a Bacille Calmette-Guérin (BCG) immunization. A ridged, erythematous, indurated plaque developed over a BCG injection site on his left upper arm 1 month after the first BCG immunization. Biopsy showed multiple noncaseating foreign body granulomas without detectable mycobacteria by both Ziehl-Neelsen stain and polymerase chain reaction assay. Birefringent crystals were identified in the foreign body giant cells with polarized light microscopy. The crystals were further determined to be glutamic acid by the method of fast atom bombardment. Hence, MSG, the only composite of BCG vaccine except the bacillus, was believed to be responsible for the granulomatous foreign body reaction. On review of the literature, we could find no previous report of an adverse reaction of BCG immunization attributable to MSG (glutamic acid).

  8. Crystallization and preliminary X-ray crystallographic analysis of dihydrouridine synthase from Thermus thermophilus and its complex with tRNA

    International Nuclear Information System (INIS)

    Yu, Futao; Tanaka, Yoshikazu; Yamamoto, Shiho; Nakamura, Akiyoshi; Kita, Shunsuke; Hirano, Nagisa; Tanaka, Isao; Yao, Min

    2011-01-01

    Crystals of dihydrouridine synthase from Thermus thermophilus and its complex with tRNA were obtained and X-ray diffraction data were collected to 1.70 and 3.51 Å resolution, respectively. Dihydrouridine synthase (Dus) is responsible for catalyzing dihydrouridine formation in RNA by the reduction of uridine. To elucidate its RNA-recognition mechanism, Dus from Thermus thermophilus (TthDus) and its complex with tRNA were crystallized. Diffraction data sets were collected from crystals of native and selenomethionine-substituted TthDus to resolutions of 1.70 and 2.30 Å, respectively. These crystals belonged to space group P1. Preliminary X-ray crystallographic analysis showed that two molecules of TthDus were contained in an asymmetric unit. In addition, diffraction data were collected to 3.51 Å resolution from a crystal of selenomethionine-substituted TthDus in complex with tRNA, which belonged to space group P4 1 2 1 2. Preliminary structural analysis showed that the asymmetric unit contained two TthDus–tRNA complexes

  9. Therapeutic effects of glutamic acid in piglets challenged with deoxynivalenol.

    Science.gov (United States)

    Wu, Miaomiao; Xiao, Hao; Ren, Wenkai; Yin, Jie; Tan, Bie; Liu, Gang; Li, Lili; Nyachoti, Charles Martin; Xiong, Xia; Wu, Guoyao

    2014-01-01

    The mycotoxin deoxynivalenol (DON), one of the most common food contaminants, primarily targets the gastrointestinal tract to affect animal and human health. This study was conducted to examine the protective function of glutamic acid on intestinal injury and oxidative stress caused by DON in piglets. Twenty-eight piglets were assigned randomly into 4 dietary treatments (7 pigs/treatment): 1) uncontaminated control diet (NC), 2) NC+DON at 4 mg/kg (DON), 3) NC+2% glutamic acid (GLU), and 4) NC+2% glutamic acid + DON at 4 mg/kg (DG). At day 15, 30 and 37, blood samples were collected to determine serum concentrations of CAT (catalase), T-AOC (total antioxidant capacity), H2O2 (hydrogen peroxide), NO (nitric oxide), MDA (maleic dialdehyde), DAO (diamine oxidase) and D-lactate. Intestinal morphology, and the activation of Akt/mTOR/4EBP1 signal pathway, as well as the concentrations of H2O2, MDA, and DAO in kidney, liver and small intestine, were analyzed at day 37. Results showed that DON significantly (Pglutamic acid supplementation according to the change of oxidative parameters in blood and tissues. Meanwhile, DON caused obvious intestinal injury from microscopic observations and permeability indicators, which was alleviated by glutamic acid supplementation. Moreover, the inhibition of DON on Akt/mTOR/4EBP1 signal pathway was reduced by glutamic acid supplementation. Collectively, these data suggest that glutamic acid may be a useful nutritional regulator for DON-induced damage manifested as oxidative stress, intestinal injury and signaling inhibition.

  10. Synthesis of edatrexate (2-13C-glutamate)

    International Nuclear Information System (INIS)

    DeGraw, J.I.; Colwell, W.T.; Jue, Thomas

    1997-01-01

    The experimental antitumor drug Edatrexate, labeled with 99% 13 C at the 2-position of the glutamate acid group was required for 13 C-magnetic resonance spectroscopy studies in biological media. Coupling of 2,4-diamino-4-deoxy-10-ethyl-10-deazapteroic acid with diethyl L-2- 13 C-glutamate as promoted by BOP reagent afforded Edatrexate (2- 13 C-glu) diethyl ester in 60% yield following purification by column chromatography. Saponification by aqueous NaOH in 2-methoxyethanol gave the target molecule in 44% yield or 26% overall. (author)

  11. Glutamatergic or GABAergic neuron-specific, long-term expression in neocortical neurons from helper virus-free HSV-1 vectors containing the phosphate-activated glutaminase, vesicular glutamate transporter-1, or glutamic acid decarboxylase promoter.

    Science.gov (United States)

    Rasmussen, Morten; Kong, Lingxin; Zhang, Guo-rong; Liu, Meng; Wang, Xiaodan; Szabo, Gabor; Curthoys, Norman P; Geller, Alfred I

    2007-05-04

    Many potential uses of direct gene transfer into neurons require restricting expression to one of the two major types of forebrain neurons, glutamatergic or GABAergic neurons. Thus, it is desirable to develop virus vectors that contain either a glutamatergic or GABAergic neuron-specific promoter. The brain/kidney phosphate-activated glutaminase (PAG), the product of the GLS1 gene, produces the majority of the glutamate for release as neurotransmitter, and is a marker for glutamatergic neurons. A PAG promoter was partially characterized using a cultured kidney cell line. The three vesicular glutamate transporters (VGLUTs) are expressed in distinct populations of neurons, and VGLUT1 is the predominant VGLUT in the neocortex, hippocampus, and cerebellar cortex. Glutamic acid decarboxylase (GAD) produces GABA; the two molecular forms of the enzyme, GAD65 and GAD67, are expressed in distinct, but largely overlapping, groups of neurons, and GAD67 is the predominant form in the neocortex. In transgenic mice, an approximately 9 kb fragment of the GAD67 promoter supports expression in most classes of GABAergic neurons. Here, we constructed plasmid (amplicon) Herpes Simplex Virus (HSV-1) vectors that placed the Lac Z gene under the regulation of putative PAG, VGLUT1, or GAD67 promoters. Helper virus-free vector stocks were delivered into postrhinal cortex, and the rats were sacrificed 4 days or 2 months later. The PAG or VGLUT1 promoters supported approximately 90% glutamatergic neuron-specific expression. The GAD67 promoter supported approximately 90% GABAergic neuron-specific expression. Long-term expression was observed using each promoter. Principles for obtaining long-term expression from HSV-1 vectors, based on these and other results, are discussed. Long-term glutamatergic or GABAergic neuron-specific expression may benefit specific experiments on learning or specific gene therapy approaches. Of note, promoter analyses might identify regulatory elements that determine

  12. The complete mitochondrial genome of Sesarmops sinensis reveals gene rearrangements and phylogenetic relationships in Brachyura.

    Science.gov (United States)

    Tang, Bo-Ping; Xin, Zhao-Zhe; Liu, Yu; Zhang, Dai-Zhen; Wang, Zheng-Fei; Zhang, Hua-Bin; Chai, Xin-Yue; Zhou, Chun-Lin; Liu, Qiu-Ning

    2017-01-01

    Mitochondrial genome (mitogenome) is very important to understand molecular evolution and phylogenetics. Herein, in this study, the complete mitogenome of Sesarmops sinensis was reported. The mitogenome was 15,905 bp in size, and contained 13 protein-coding genes (PCGs), two ribosomal RNA (rRNA) genes, 22 transfer RNA (tRNA) genes, and a control region (CR). The AT skew and the GC skew are both negative in the mitogenomes of S. sinensis. The nucleotide composition of the S. sinensis mitogenome was also biased toward A + T nucleotides (75.7%). All tRNA genes displayed a typical mitochondrial tRNA cloverleaf structure, except for the trnS1 gene, which lacked a dihydroxyuridine arm. S. sinensis exhibits a novel rearrangement compared with the Pancrustacean ground pattern and other Brachyura species. Based on the 13 PCGs, the phylogenetic analysis showed that S. sinensis and Sesarma neglectum were clustered on one branch with high nodal support values, indicating that S. sinensis and S. neglectum have a sister group relationship. The group (S. sinensis + S. neglectum) was sister to (Parasesarmops tripectinis + Metopaulias depressus), suggesting that S. sinensis belongs to Grapsoidea, Sesarmidae. Phylogenetic trees based on amino acid sequences and nucleotide sequences of mitochondrial 13 PCGs using BI and ML respectively indicate that section Eubrachyura consists of four groups clearly. The resulting phylogeny supports the establishment of a separate subsection Potamoida. These four groups correspond to four subsections of Raninoida, Heterotremata, Potamoida, and Thoracotremata.

  13. Lack of cardioprotection from metabolic support with glutamine or glutamate in a porcine coronary occlusion model

    DEFF Research Database (Denmark)

    Kristensen, Jens; Mæng, Michael; Mortensen, Ulrik

    2005-01-01

    vascular resistance, while glutamate preserved cardiac output during infusion. CONCLUSION: Substrate supplementation with the anaplerotic precursors glutamine and glutamate is ineffective as adjunctive therapy for severe myocardial ischemia. Beneficial effects documented in less complex experimental...

  14. Increased glutamate levels in the vitreous of patients with retinal detachment

    NARCIS (Netherlands)

    Diederen, R.; Heij, La E.C.; Deutz, N.E.P.; Kijlstra, A.; Kessels, A.G.H.; Eijk, van H.M.; Liem, A.T.A.; Dieudonne, S.; Hendrikse, F.

    2006-01-01

    Experimental models have implicated glutamate in the irreversible damage to retinal cells following retinal detachment. In this retrospective study we investigated a possible role for glutamate and other amino acid neurotransmitters during clinical rhegmatogenous retinal detachment (RRD). Undiluted

  15. Microdialysis as a tool for in vivo investigation of glutamate transport capacity in rat brain

    DEFF Research Database (Denmark)

    Bruhn, T; Christensen, Thomas; Diemer, Nils Henrik

    1995-01-01

    The role of glutamate as a possible mediator of neurodegeneration is well described, and the homeostasis of extracellular glutamate is considered of major importance when addressing the pathogenesis of excitatory neurodegeneration. Applying the 'indicator diffusion' method to the microdialysis te...

  16. Proteomic interrogation of androgen action in prostate cancer cells reveals roles of aminoacyl tRNA synthetases.

    Directory of Open Access Journals (Sweden)

    Adaikkalam Vellaichamy

    2009-09-01

    Full Text Available Prostate cancer remains the most common malignancy among men in United States, and there is no remedy currently available for the advanced stage hormone-refractory cancer. This is partly due to the incomplete understanding of androgen-regulated proteins and their encoded functions. Whole-cell proteomes of androgen-starved and androgen-treated LNCaP cells were analyzed by semi-quantitative MudPIT ESI- ion trap MS/MS and quantitative iTRAQ MALDI- TOF MS/MS platforms, with identification of more than 1300 high-confidence proteins. An enrichment-based pathway mapping of the androgen-regulated proteomic data sets revealed a significant dysregulation of aminoacyl tRNA synthetases, indicating an increase in protein biosynthesis- a hallmark during prostate cancer progression. This observation is supported by immunoblot and transcript data from LNCaP cells, and prostate cancer tissue. Thus, data derived from multiple proteomics platforms and transcript data coupled with informatics analysis provides a deeper insight into the functional consequences of androgen action in prostate cancer.

  17. Formylation of initiator tRNA methionine in procaryotic protein synthesis: in vivo polarity in lactose operon expression.

    Science.gov (United States)

    Petersen, H U; Joseph, E; Ullmann, A; Danchin, A

    1978-01-01

    Eucaryotic and procaryotic organisms differ in two aspects of their translation machinery: polycistronic messengers are expressed as a sequence of individual proteins only in procaryotes, and the initiation of protein synthesis proceeds with an initiator tRNA which is found to be modified (formylated) in procaryotes and not in eucaryotes. In the present study, we show that formylation is required in vivo for the coordinate expression of the Escherichia coli lactose operon. Our experiments are consistent with a translation mechanism using dissociated ribosomes at the 5' end of the mRNA in a reaction that is only weakly dependent on formylation at this initiation step; the ribosomes then travel along the messenger and can reinitiate after the intracistronic barrier without dissociation. This latter initiation step is strongly dependent on the level of formylation: a low level of the formyl group, obtained by the antifolic agent trimethoprim, induces a strong polarity in the expression of the lactose operon. There exist mutant strains in which this polarity is much less apparent than in the wild type. We show here that such is the case of rpsL mutants. Ribosomes mutated in the S12 protein (rpsL) are found to be much more easily dissociated than the wild type. This might explain why the expression of the lactose operon on rpsL strains remains coordinated when the intracellular level of formylation is decreased. PMID:98518

  18. Evolutionary Limitation and Opportunities for Developing tRNA Synthetase Inhibitors with 5-Binding-Mode Classification

    Directory of Open Access Journals (Sweden)

    Pengfei Fang

    2015-12-01

    Full Text Available Aminoacyl-tRNA synthetases (aaRSs are enzymes that catalyze the transfer of amino acids to their cognate tRNAs as building blocks for translation. Each of the aaRS families plays a pivotal role in protein biosynthesis and is indispensable for cell growth and survival. In addition, aaRSs in higher species have evolved important non-translational functions. These translational and non-translational functions of aaRS are attractive for developing antibacterial, antifungal, and antiparasitic agents and for treating other human diseases. The interplay between amino acids, tRNA, ATP, EF-Tu and non-canonical binding partners, had shaped each family with distinct pattern of key sites for regulation, with characters varying among species across the path of evolution. These sporadic variations in the aaRSs offer great opportunity to target these essential enzymes for therapy. Up to this day, growing numbers of aaRS inhibitors have been discovered and developed. Here, we summarize the latest developments and structural studies of aaRS inhibitors, and classify them with distinct binding modes into five categories.

  19. Binding interactions between yeast tRNA ligase and a precursor transfer ribonucleic acid containing two photoreactive uridine analogues

    International Nuclear Information System (INIS)

    Tanner, N.K.; Hanna, M.M.; Abelson, J.

    1988-01-01

    Yeast tRNA ligase, from Saccharomyces cerevisiae, is one of the protein components that is involved in the splicing reaction of intron-containing yeast precursor tRNAs. It is an unusual protein because it has three distinct catalytic activities. It functions as a polynucleotide kinase, as a cyclic phosphodiesterase, and as an RNA ligase. We have studied the binding interactions between ligase and precursor tRNAs containing two photoreactive uridine analogues, 4-thiouridine and 5-bromouridine. When irradiated with long ultraviolet light, RNA containing these analogues can form specific covalent bonds with associated proteins. In this paper, we show that 4-thiouridine triphosphate and 5-bromouridine triphosphate were readily incorporated into a precursor tRNA(Phe) that was synthesized, in vitro, with bacteriophage T7 RNA polymerase. The analogue-containing precursor tRNAs were authentic substrates for the two splicing enzymes that were tested (endonuclease and ligase), and they formed specific covalent bonds with ligase when they were irradiated with long-wavelength ultraviolet light. We have determined the position of three major cross-links and one minor cross-link on precursor tRNA(Phe) that were located within the intron and near the 3' splice site. On the basis of these data, we present a model for the in vivo splicing reaction of yeast precursor tRNAs

  20. CARACTERIZACIÓN DEL TALLO ACEPTOR DEL tRNA MEDIANTE DESCRIPTORES LOCALES BASADOS EN CARGAS PARCIALES

    Directory of Open Access Journals (Sweden)

    Ray Marín

    2009-04-01

    Full Text Available En este trabajo se caracteriza la distribución de carga del tallo aceptor del tRNA, considerando todas las posibles combinaciones de pares Watson-Crick. El estudio se realizó con 256 fragmentos moleculares de 10 nucleótidos que modelan los tres primeros pares del tallo aceptor, la base diferenciadora y el extremo CCA. Para caracterizar los nucleótidos se proponen dos descriptores locales basados en la distribución de carga de las base nitrogenada de cada nucleótido, los cuales se calculan a partir de las cargas parciales de Mulliken obtenidas de cálculos HF/6-31G. La caracterización y clasificación de los tallos según estos descriptores mostró como la base diferenciadora tiene un comportamiento particular respecto a los demás nucleótidos del tallo y una fuerte influencia sobre el extremo CCA. La clasificación de nueve variaciones del tallo aceptor del tRNAAla mostró una buena relación estructura-actividad que pone en evidencia la bondad de los descriptores propuestos para caracterizar de manera local la distribución de carga de estas biomoléculas.