WorldWideScience

Sample records for tritons pruzhne rozsyiyannya

  1. Triton burnup in JET

    International Nuclear Information System (INIS)

    Chipsham, E.; Jarvis, O.N.; Sadler, G.

    1989-01-01

    Triton burnup measurements have been made at JET using time-integrated copper activation and time-resolved silicon detector techniques. The results confirm the classical nature of both the confinement and the slowing down of the 1 MeV tritons in a plasma. (author) 8 refs., 3 figs

  2. Global Warming on Triton

    Science.gov (United States)

    Elliot, J. L.; Hammel, H. B.; Wasserman, L. H.; Franz, O. G.; McDonald, S. W.; Person, M. J.; Olkin, C. B.; Dunham, E. J.; Spencer, J. R.; Stansberry, J. A.; hide

    1998-01-01

    Triton, Neptune's largest moon, has been predicted to undergo significant seasonal changes that would reveal themselves as changes in its mean frost temperature. But whether this temperature should at the present time be increasing, decreasing or constant depends on a number of parameters (such as the thermal properties of the surface, and frost migration patterns) that are unknown. Here we report observations of a recent stellar occultation by Triton which, when combined with earlier results, show that Triton has undergone a period of global warming since 1989. Our most conservative estimates of the rate of temperature and surface-pressure increase during this period imply that the atmosphere is doubling in bulk every 10 years, significantly faster than predicted by any published frost model for Triton. Our result suggests that permanent polar caps on Triton play a c dominant role in regulating seasonal atmospheric changes. Similar processes should also be active on Pluto.

  3. Collisional Cascades Following Triton's Capture

    Science.gov (United States)

    Cuk, Matija; Hamilton, Douglas P.; Stewart-Mukhopadhyay, Sarah T.

    2017-10-01

    Neptune's moon Triton is widely thought to have been captured from heliocentric orbit, most likely through binary dissociation (Agnor and Hamilton, 2006). Triton's original eccentric orbit must have been subsequently circularized by satellite tides (Goldreich et al. 1989). Cuk and Gladman (2005) found that Kozai oscillations make early tidal evolution inefficient, and have proposed that collisions between Triton and debris from pre-existing satellites was the dominant mechanism of shrinking Triton's large post-capture orbit. However, Cuk and Hamilton (DPS 2016), using numerical simulations and results of Stewart and Leinhardt (2012), have found that collisions between regular satellites are unlikely to be destructive, while collisions between prograde moons and Triton are certainly erosive if not catastrophic. An obvious outcome would be pre-existing moon material gradually grinding down Triton and making it reaccrete in the local Laplace plane, in conflict with Triton's large current inclination. We propose that the crucial ingredient for understanding the early evolution of the Neptunian system are the collisions between the moons and the prograde and retrograde debris originating from the pre-existing moons and Triton. In particular, we expect early erosive impact(s) on Triton to generate debris that will, in subsequent collisions, disrupt the regular satellites. If the retrograde material were to dominate at some planetocentric distances, the end result may be a large cloud or disk of retrograde debris that would be accreted by Triton, shrinking Triton's orbit. Some of the prograde debris could survive in a compact disk interior to Triton's pericenter, eventually forming the inner moons of Neptune. We will present results of numerical modeling of these complex dynamical processes at the meeting.

  4. Triton's streaks as windblown dust

    Science.gov (United States)

    Sagan, Carl; Chyba, Christopher

    1990-01-01

    Explanations for the surface streaks observed by Voyager 2 on Triton's southern hemisphere are discussed. It is shown that, despite Triton's tenuous atmosphere, low-cohesion dust trains with diameters of about 5 micron or less may be carried into suspension by aeolian surface shear stress, given expected geostrophic wind speeds of about 10 m/s. For geyser-like erupting dust plumes, it is shown that dust-settling time scales and expected wind velocities can produce streaks with length scales in good agreement with those of the streaks. Thus, both geyserlike eruptions or direct lifting by surface winds appear to be viable mechanisms for the origin of the streaks.

  5. Color and chemistry on Triton

    Science.gov (United States)

    Thompson, W. Reid; Sagan, Carl

    1990-01-01

    The surface of Triton is very bright but shows subtle yellow to peach hues which probably arise from the production of colored organic compounds from CH4 + N2 and other simple species. In order to investigate possible relationships between chemical processes and the observed surface distribution of chromophores, the surface units are classified according to color/albedo properties, the rates of production of organic chromophores by the action of ultraviolet light and high-energy charged particles is estimated, and rates, spectral properties, and expected seasonal redistribution processes are compared to suggest possible origins of the colors seen on Triton's surface.

  6. Redesigning TRACER trial after TRITON.

    Science.gov (United States)

    Serebruany, Victor L

    2015-10-15

    Designing of smart clinical trials is critical for regulatory approval and future drug utilization. Importantly, trial design should be reconsidered if the interim analyses suggest unexpected harm, or conflicting results were yielded from the other trials within the same therapeutic area. With regard to antiplatelet agents, the perfect example is redesigning of the ongoing PRoFESS trial by eliminating aspirin from clopidogrel arm after the earlier MATCH trial results became available. The goal was to aseess the unchanged TRACER trial design in light of the evidence yielded from the earlier completed TRITON trial. TRACER was designed as a triple versus dual antiplatelet trial in NSTEMI patients with no previous long-term outcome data supporting such aggressive strategy. TRITON data represented dual versus dual antiplatelet therapy, and became available before TRACER enrollment starts revealing prasugrel front-loaded early vascular benefit predominantly in STEMI patients with the growing over time bleeding and cancer risks. Moreover, large prasugrel NSTEMI TRITON cohort exhibited trend towards excess mortality in experimental arm warning against aggressive TRACER design. The long-term TRITON results in general, and especially in the NSTEMI patients challenge unchanged TRACER trial design. Applying dual, rather than triple antiplatelet therapy protocol modification should be considered in TRACER to minimize bleeding, cancer, and non-cardiovascular death risks. Copyright © 2015. Published by Elsevier Ireland Ltd.

  7. Description of the Triton reactor; Pile Triton, rapport descriptif

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1967-09-01

    The Triton reactor is an enriched uranium pool type reactor. It began operation in 1959, after a divergence made on the June 30 the same year. Devoted to studies of radiation protection, its core can be displaced in the longitudinal direction. The pool can be separated in two unequal compartments by a wall. The Triton core is placed in a small compartment, the Nereide core in the big compartment. A third compartment without water is called Naiade II, is separated by a concrete wall in which is made a window closed by an aluminium plate (2.50 m x 2.70 m). The Naiade II hole is useful for protection experiments using the Nereide core. After a complete refitting, the power of the triton reactor that reached progressively from 1.2 MW to 2 MW, then 3 MW has reached in August 1965 6.5 MW. The reactor has been specialized in irradiations in fix position, the core become fix, the nereide core has been hung mobile. Since it has been used for structure materials irradiation, for radioelements fabrication and fundamental research. The following descriptions are valid for the period after August 1965. [French] Le reacteur Triton est un reacteur piscine, a uranium enrichi. Il est entre en fonctionnement en 1959, apres une divergence effectuee le 30 juin de cette meme annee. Destine a des etudes de protection contre les rayonnements, son coeur pouvait se deplacer dans le sens longitudinal. La piscine peut etre separee en deux compartiments inegaux par un batardeau. Le coeur triton est place dans le petit compartiment, le coeur Nereide dans le grand compartiment. Un troisieme compartiment sans eau, appele Naiade II, est separe par une paroi en beton dans laquelle est amenagee une fenetre obturee par une plaque d'aluminium (2,50 m x 2,70 m). La fosse Naiade II sert a des experiences de protection utilisant le coeur nereide. Apres une refonte complete, la puissance du reacteur triton qui etait passee progressivement de 1,2 MW a 2 MW, puis 3 MW, a atteint en aout 1965 6, 5 MW

  8. Exploring Triton with multiple landers

    Science.gov (United States)

    Balint, Tibor S.

    2005-01-01

    In our pathway for Outer Planetary Exploration several mission concepts were considered, based on the proposed JIMO mission architecture. This paper describes a JIMO follow-on mission concept to Neptunes largest moon. Triton is a target of interest for outer solar system studies. It has a highly inclined retrograde orbit, suggesting that it may have been a Kuiper Belt object captured by Neptune. Given this assumption its composition, which may include organic materials, would be of significant scientific interest.

  9. Description of the Triton reactor

    International Nuclear Information System (INIS)

    1967-09-01

    The Triton reactor is an enriched uranium pool type reactor. It began operation in 1959, after a divergence made on the June 30 the same year. Devoted to studies of radiation protection, its core can be displaced in the longitudinal direction. The pool can be separated in two unequal compartments by a wall. The Triton core is placed in a small compartment, the Nereide core in the big compartment. A third compartment without water is called Naiade II, is separated by a concrete wall in which is made a window closed by an aluminium plate (2.50 m x 2.70 m). The Naiade II hole is useful for protection experiments using the Nereide core. After a complete refitting, the power of the triton reactor that reached progressively from 1.2 MW to 2 MW, then 3 MW has reached in August 1965 6.5 MW. The reactor has been specialized in irradiations in fix position, the core become fix, the nereide core has been hung mobile. Since it has been used for structure materials irradiation, for radioelements fabrication and fundamental research. The following descriptions are valid for the period after August 1965 [fr

  10. Triton Blushes: A Clue to Global Warming?

    Science.gov (United States)

    Buratti, B. J.; Hicks, M. D.; Newburn, R. L., Jr.

    1998-01-01

    The large Neptunian satellite Triton is a geologically active body that apparently undergoes complex seasonal changes in its 165 year journey around the sun. Because it is the vehicle for the seasonal transport of volatiles, Triton's atmosphere is expected to undergo large changes in temperature and pressure on a time scale of decades.

  11. Did Triton Destroy Neptune's First Moons?

    Science.gov (United States)

    Kohler, Susanna

    2017-11-01

    Neptunes moon system is not what we would expect for a gas giant in our solar system. Scientists have now explored the possibility that Neptune started its life with an ordinary system of moons that was later destroyed by the capture of its current giant moon, Triton.An Odd SystemOur current understanding of giant-planet formation predicts a period of gas accretion to build up the large size of these planets. According to models, the circumplanetary gas disks that surround the planets during this time then become the birthplaces of the giant planets satellite systems, producing systems of co-planar and prograde (i.e., orbiting in the same direction as the planets rotation) satellites similar to the many-moon systems of Jupiter or Saturn.Tritons orbit is tilted relative to the inner Neptunian satellite orbits. [NASA, ESA, and A. Feild (STScI)]Neptune, however, is quirky. This gas giant has surprisingly few satellites only 14 compared to, say, the nearly 70 moons of Jupiter and most of them are extremely small. One of Neptunes moons is an exception to this, however: Triton, which contains 99.7% of the mass of Neptunes entire satellite system!Tritons orbit has a number of unusual properties. The orbit is retrograde Triton orbits in the opposite direction as Neptunes rotation which is unique behavior among large moons in our solar system. Tritons orbit is also highly inclined, and yet the moons path is nearly circular and lies very close to Neptune.The distribution of impact velocities in the authors simulations for primordial satellite interactions with Triton, in three cases of different satellite mass ratios. In the low-mass case a third of the mass ratio of the Uranian satellite system 88% of simulations ended with Triton surviving on its high-inclination orbit. The survival rate was only 12% in the high-mass case. [Adapted from Rufu et al. 2017]How did this monster of a satellite get its strange properties, and why is Neptunes system so odd compared to what we

  12. The Atmospheric Structure of Triton and Pluto

    Science.gov (United States)

    Elliot, James L.

    1998-01-01

    The goal of this research was to better determine the atmospheric structures of Triton and Pluto through further analysis of three occultation data sets obtained with the Kuiper Airborne Observatory (KAO.) As the research progressed, we concentrated our efforts on the Triton data, as this appeared to be the most fruitful. Three papers have been prepared as a result of this research. The first paper presents new results about Triton's atmospheric structure from the analysis of all ground-based stellar occultation data recorded to date, including one single-chord occultation recorded on 1993 July 10 and nine occultation lightcurves from the double-star event on 1995 August 14. These stellar occultation observations made both in the visible and in the infrared have good spatial coverage of Triton, including the first Triton central-flash observations, and are the first data to probe the altitude level 20-100 km on Triton. The small-planet lightcurve model of J. L. Elliot and L. A. Young was generalized to include stellar flux refracted by the far limb, and then fitted to the data. Values of the pressure, derived from separate immersion and emersion chords, show no significant trends with latitude, indicating that Triton's atmosphere is spherically symmetric at approximately 50 km altitude to within the error of the measurements; however, asymmetry observed in the central flash indicates the atmosphere is not homogenous at the lowest levels probed (approximately 20 km altitude). From the average of the 1995 occultation data, the equivalent isothermal temperature of the atmosphere is 47 plus or minus 1 K and the atmospheric pressure at 1400 km radius (approximately 50 km altitude) is 1.4 plus or minus 0.1 microbar. Both of these are not consistent with a model based on Voyager UVS and RSS observations in 1989. The atmospheric temperature from the occultation is 5 K colder than that predicted by the model and the observed pressure is a factor of 1.8 greater than the

  13. SOME PHYSICOCHEMICAL PROPERTIES OF OCTYLPHENOL ETHOXYLATE NONIONICS (TRITON X-100, TRITON X-114 AND TRITON X-405 AND THE TEMPERATURE EFFECT ON THIS PROPERTIES

    Directory of Open Access Journals (Sweden)

    Taliha Sidim

    2016-11-01

    Full Text Available Surface tensions and condutvities of aqueous solutions of nonionic surfactants at various concentrations were measured at diffferent temperatures.The critical micelle concentration (CMC of aqueous solutions of three different octylphenol ethoxylate nonionics(Triton X-114, Triton X-100 and Triton X-405 are determined at different temperatures.The effect of the ethylene oxide chain length and temperature on the CMC is also determined.

  14. A simple and realistic triton wave function

    International Nuclear Information System (INIS)

    Lomnitz-Adler, J.; Pandharipande, V.R.

    1980-01-01

    We propose a simple triton wave function that consists of a product of three correlation operators operating on a three-body spin-isospin state. This wave function is formally similar to that used in the recent variational theories of nuclear matter, the main difference being in the long-range behavior of the correlation operators. Variational calculations are carried out with the Reid potential, using this wave function in the so-called 'symmetrized product' and 'independent pair' forms. The triton energy and density distributions obtained with the symmetrized product wave function agree with those obtained in Faddeev and other variational calculations using harmonic oscillator states. The proposed wave function and calculational methods can be easily generalized to treat the four-nucleon α-particle. (orig.)

  15. Triton - Stratospheric molecules and organic sediments

    Science.gov (United States)

    Thompson, W. Reid; Singh, Sushil K.; Khare, B. N.; Sagan, Carl

    1989-01-01

    Continuous-flow plasma discharge techniques show production rates of hydrocarbons and nitriles in N2 + CH4 atmospheres appropriate to the stratosphere of Titan, and indicate that a simple eddy diffusion model together with the observed electron flux quantitatively matches the Voyager IRIS observations for all the hydrocarbons, except for the simplest ones. Charged particle chemistry is very important in Triton's stratosphere. In the more CH4-rich case of Titan, many hydrocarbons and nitriles are produced in high yield. If N2 is present, the CH4 fraction is low, but hydrocarbons and nitriles are produced in fair yield, abundances of HCN and C2H2 in Triton's stratosphere exceed 10 to the 19th molecules/sq cm per sec, and NCCN, C3H4, and other species are predicted to be present. These molecules may be detected by IRIS if the stratosphere is as warm as expected. Both organic haze and condensed gases will provide a substantial UV and visible opacity in Triton's atmosphere.

  16. Calculation of triton confinement and burn-up in tokamaks

    International Nuclear Information System (INIS)

    Anderson, D.; Battistoni, P.

    1987-01-01

    An analytical investigation is made of the confinement and subsequent burn-up of fusion produced tritons in a deuterium Tokamak plasma. Explicit approximations are obtained for the triton confinement factor, clearly displaying the scaling with physical parameters. The importance of pitch angle scattering losses during the triton slowing down is also estimated. A comparison with experiments and numerical calculations on the FT Tokamak slows good qualitative agreement. (authors)

  17. Malignant Triton Tumor (MTT) of the neck

    DEFF Research Database (Denmark)

    Sørensen, Kristine Bjørndal; Godballe, Christian; Krogdahl, Annelise

    2006-01-01

    Malignant Triton Tumor (MTT) is a rare, malignant periphere nerve sheath tumor with rhabdomyoblastic differentiation. One third of described MTT's were located at the head and neck region. One third of these are associated with neurofibromatosis type 1. MTT most often appears in the third decade....... MTT's are very aggressive tumors with early metastases and the overall survival is poor (26%). Therefore, early diagnosis and correct treatment is of utmost importance. We report a case of MTT of the left supraclavicular region in a 41-year-old man. We present the pathological findings, both light...

  18. Escaping 1 MeV tritons in TFTR

    International Nuclear Information System (INIS)

    Zweben, S.J.; Strachan, J.D.; Boivin, R.; Cavallo, A.; Fredrickson, E.D.; McGuire, K.; Mynick, H.E.; White, R.B.

    1989-01-01

    1 MeV tritons created by D-D reactions can simulate the 'single-particle' behavior expected with 3.5 MeV D-T alphas, since the gyroradii and slowing-down of these two particles are similar. This paper describes measurements of the flux of escaping 1 MeV tritons from the TFTR plasma during high power D 0 →D neutral beam injection, and shows that in most cases the observed triton loss is consistent with the classical (single-particle) first-orbit loss model. In this model tritons are lost if their first orbit intersects the wall due to their large banana width, while almost all tritons confined on their first orbit should stay confined until thermalized. The triton detectors are ZnS(Ag) scintillator screens housed in light-tight boxes located just outside the plasma boundary at the bottom of the TFTR vessel. They are particle 'pinhole' cameras which can resolve the triton flux vs. pitch angle (to ±5 o ), energy (to ±50 %), and time (to <20 μsec). The 2-D images of triton flux onto these scintillators are optically coupled to either an intensified TV camera or to photomultiplyer tubes for fast time resolution. The soft x-ray background in an earlier prototype has been eliminated. Although there are presently 8 such detectors in TFTR, this paper discusses results from only the detector located just below the vessel center (R=259 cm, r=102 cm). Note that the '1 MeV triton' signal discussed below also has about a 30 % contribution from 3 MeV protons; however, since these two particles have identical gyroradii they should behave alike. 5 refs., 5 figs

  19. Evidence for the di-triton resonance in 6He

    International Nuclear Information System (INIS)

    Akimune, H.; Yamagata, T.; Nakayama, S.

    2002-01-01

    A di-triton cluster state at highly excited energies in 6 He has been investigated via the ( 7 Li, 7 Be) reaction with an incident energy of 65 MeV/A. Decay charged-particles from excited states in 6 He were measured in coincidence with 7 Be ejectiles using solid-state detectors. A prominent bump was observed at E x =18 MeV in the binary triton decay channel. The branching ratio of the binary triton decay channel from this bump was 100% based on the spectrum decomposition analysis. (author)

  20. Deuteron-, triton - and alpha - clusters in nuclear matter

    International Nuclear Information System (INIS)

    Bando, H.; Coelho, H.T.; Delfino, A.

    1981-01-01

    It is studied with a simple model how deuteron-, triton- and α-clusters behave concerning their cluster structure identities during the scatterring process and just after reaching nuclear matter of finite size. (Author) [pt

  1. Triton Hopper: Exploring Neptune's Captured Kuiper Belt Object

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose a hopper vehicle using a radioisotope thermal rocket engine, using in-situ propellant, to explore Neptune's moon Triton. This moon is thought to be a...

  2. Voyager IRIS Measurements of Triton's Thermal Emission: Impllications for Pluto?

    Science.gov (United States)

    Stansberry, John A.; Spencer, John; Linscott, Ivan

    2015-11-01

    The New Horizons Pluto encounter data set includes unique observations obtained using the Radio Science experiment to measure the night-side thermal emission at centimeter wavelengths, well beyond the emission peak (in the 70 to 100 micron range). 26 years ago the Voyager 2 Infrared Interferometer Spectrometer (IRIS) obtained spectra in the 30 - 50 micron wavelength range to try and detect thermal emission from Pluto's sibling, Triton. Conrath etal. (1989) analyzed 16 of the IRIS spectra of Triton's dayside and derived a weak limit of 36 K - 41 K. We have analysed those, and an additional 75 spectra, to refine the limits on the temperature of Triton's surface, and to explore diurnal differences in the thermal emission. Triton results from other Voyager instruments provide important constraints on our interpretation of the IRIS data, as do Spitzer measurements of Pluto's thermal emission.For unit-emissivity, average temperature is 34 K, inconsistent with the pressure of Triton's atmosphere (13 - 19 microbar), the presence of beta-phase nitrogen ice on the surface, and the likely presence ofwarm regions on the surface. The atmospheric pressure requires nitrogen ice temperatures of 37.4 K - 38.1 K, which in turn requires emissivity of 0.31--0.53. Such a low emissivity in this spectral region might be expected if the surface is dominated by nitrogen or methane ice. Averages of data subsets show evidence for brightness temperature variations across Triton's surface. Surprisingly, the data seem to indicate that Triton's nightside equatorial region was warmer than on the dayside.These Voyager results for Triton provide a useful context for interpreting New Horizons and ALMA observations of emission from Pluto in the sub-millimeter and centimeter region. JWST will be capable of detecting Triton's and Pluto's 10 - 28 micron thermal emission, although scattered light from Neptune may be an issue for the Triton. Combined with new capabilities of ALMA to measure the sub

  3. Pluto and Triton: Interactions Between Volatiles and Dynamics

    Science.gov (United States)

    Rubincam, D. P.

    2001-01-01

    Volatiles moving across the surfaces of Pluto and Triton can give rise to interesting dynamical consequences. Conversely, measurement of dynamical states can help constrain the movement of volatiles and interior structure of both bodies. Polar wander may theoretically occur on both Triton and Pluto. Triton's obliquity is low, so that the equatorial regions receive more insolation than the poles. Hence there is a tendency for nitrogen ice to sublime at the equator and condense at the poles, creating polar caps. If the nitrogen supply is large enough, then these caps could move in approximately 10(exp 5) years the global equivalent of 200 m of ice to the poles. At this point the equatorial moment of inertia becomes larger than the moment of inertia measured about the rotation axis, so that Triton overbalances and becomes dynamically unstable. The satellite then undergoes polar wander, restoring stability when the new equator contains the excess matter. Hence the pole may be continually wandering. Neptune raises a permanent tidal bulge on Triton, so that the satellite's surface is elongated like a football, with the long axis pointing at Neptune. This is expected to be the axis about which the pole wanders. Volatile migration would resurface the satellite to some depth and wandering would disturb leading side/trailing side crater statistics. Additional information is contained in the original extended abstract.

  4. Triton burnup measurements in KSTAR using a neutron activation system

    Science.gov (United States)

    Jo, Jungmin; Cheon, MunSeong; Kim, Jun Young; Rhee, T.; Kim, Junghee; Shi, Yue-Jiang; Isobe, M.; Ogawa, K.; Chung, Kyoung-Jae; Hwang, Y. S.

    2016-11-01

    Measurements of the time-integrated triton burnup for deuterium plasma in Korea Superconducting Tokamak Advanced Research (KSTAR) have been performed following the simultaneous detection of the d-d and d-t neutrons. The d-d neutrons were measured using a 3He proportional counter, fission chamber, and activated indium sample, whereas the d-t neutrons were detected using activated silicon and copper samples. The triton burnup ratio from KSTAR discharges is found to be in the range 0.01%-0.50% depending on the plasma conditions. The measured burnup ratio is compared with the prompt loss fraction of tritons calculated with the Lorentz orbit code and the classical slowing-down time. The burnup ratio is found to increase as plasma current and classical slowing-down time increase.

  5. A thermal model for the seasonal nitrogen cycle on Triton

    Science.gov (United States)

    Hansen, Candice J.; Paige, David A.

    1992-01-01

    The seasonal N2-cycle model presently used to characterize such observed phenomena on Triton as atmospheric pressure and surface albedo features at the time of the Voyager encounter incorporates diurnal and seasonal subsurface heat conduction, and can account for the heat capacity of N2 frost deposits. The results obtained by this model differ from those of previous studies in that they do not predict the seasonal freezing-out of the Triton atmosphere; even for a wide range of input parameters, the bright southern polar cap is seen as rather unlikely to be N2. The results support the microphysical arguments for the presence of either dark or smooth translucent N2 frosts on the Triton surface.

  6. Use of resistant mutants to study the interaction of triton X-100 with Staphylococcus aureus.

    OpenAIRE

    Raychaudhuri, D; Chatterjee, A N

    1985-01-01

    Staphylococcus aureus mutants resistant to the nonionic detergent Triton X-100, isolated from the wild-type strain H and the autolysin-deficient strain RUS3, could grow and divide in broth containing 5% (vol/vol) Triton X-100, while growth of the parental strains was markedly inhibited above the critical micellar concentration (0.02%) of the detergent. Growth-inhibitory concentrations of Triton X-100 killed wild-type cells without demonstrable cellular lysis. Triton X-100 stimulated autolysin...

  7. APPLICATION OF TRITON X-100 COATED POLY VINYL ...

    African Journals Online (AJOL)

    Preferred Customer

    including sodium dodecyl sulfate (SDS), Triton X-100, cetyltrimethylammonium bromide. (CTAB) and n-dodecytrimethylammonium bromide (DTAB) with the purity of analytical grade was purchased from E. Merck, Darmstadt, Germany and were used as received. Doubly distilled deionized water was used throughout.

  8. A study of triton radiative capture in some light nuclei

    International Nuclear Information System (INIS)

    Schaeffer, Michel.

    1975-01-01

    The aim of this work is to complete the knowledge of the nucleon Giant Dipole Resonance (G.D.R.) by means of the study of radiative capture of complex particles: tritons. The following reactions were studied: 12 C(t,γ 0 ) 15 N, 16 O(t,γ) 19 F, 20 Ne(t,γ) 23 Na, 24 Mg(t,γ 0 ) 27 Al, 24 Mg(t,γ 1 ) 27 Al*, 23 Na(t,γ 0 ) 26 Mg, 23 Na(t,γ) 26 Mg* between between 1.5 and 3.5MeV incident triton energy. The detector was a 25x30cm NaI(Tl) crystal [fr

  9. Pulse radiolysis of Triton X-100 aqueous solution

    International Nuclear Information System (INIS)

    Perkowski, J.; Mayer, J.

    1990-01-01

    Pulse radiolysis of deaerated aqueous solutions of 4 · 10 -5 -2.4 · 10 -3 mol · dm -3 Triton X-100 gives rise to a transient species originating from the reactions of OH radicals and H atoms. The rate constants of these reactions were found to be 8.8 · 10 9 mol -1 · dm 3 · s -1 and 1.25 · 10 9 mol -1 · dm 3 · s -1 , respectively, for Triton X-100 concentrations below CMC. The corresponding transient species were found to decay according to second order kinetics. The mechanism of the reactions, including concentration effects is discussed. (author) 18 refs.; 3 figs

  10. Simulation of triton burn-up in JET plasmas

    Energy Technology Data Exchange (ETDEWEB)

    Loughlin, M.J.; Balet, B.; Jarvis, O.N.; Stubberfield, P.M. [Commission of the European Communities, Abingdon (United Kingdom). JET Joint Undertaking

    1994-07-01

    This paper presents the first triton burn-up calculations for JET plasmas using the transport code TRANSP. Four hot ion H-mode deuterium plasmas are studied. For these discharges, the 2.5 MeV emission rises rapidly and then collapses abruptly. This phenomenon is not fully understood but in each case the collapse phase is associated with a large impurity influx known as the ``carbon bloom``. The peak 14 MeV emission occurs at this time, somewhat later than that of the 2.5 MeV neutron peak. The present results give a clear indication that there are no significant departures from classical slowing down and spatial diffusion for tritons in JET plasmas. (authors). 7 refs., 3 figs., 1 tab.

  11. Triton X-100 catalyzed synthesis of α-aminophosphonates

    Directory of Open Access Journals (Sweden)

    Nemallapudi Bakthavatchala Reddy

    2016-09-01

    Full Text Available Synthesis of α-aminophosphonates by a three-component condensation of an aldehyde, amines and dialkyl phosphites in the presence of a non-ionic surfactant Triton X-100 catalyst at 70 °C in aqueous medium is accomplished. The advantages are high yield, mild reaction conditions, simple work-up and eco-friendliness. All the newly-synthesized compounds (4a–j exhibited moderate in vitro antibacterial and antifungal activities.

  12. Structure of Triton's atmosphere from the occultation of Tr176

    Science.gov (United States)

    Sicardy, B.; Mousis, O.; Beisker, W.; Hummel, E.; Hubbard, W. B.; Hill, R.; Reitsema, H. J.; Anderson, P.; Ball, L.; Downs, B.; Hutcheon, S.; Moy, M.; Nielsen, G.; Pink, I.; Walters, R.

    1998-09-01

    The occultation of the star Tr176 by Triton (Mc Donald & Elliot, AJ 109, 1352, 1995) was observed on 18 July 1997 from three stations in Queensland, Australia (Bundaberg, Ducabrook and Lochington) and one station in Texas, USA (Brownsville). All observations were made with CCD (no filter) and with portable C14 telescopes, except at Bundaberg, where a fixed 48-cm telescope was used. Time sampling rate ranges from 0.33 sec (Bundaberg) to 0.66 sec (Ducabrook and Lochington), with the intermediate value 0.5 sec at Brownsville. Isothermal fits were performed to the lightcurves in order to determine the isothermal temperature, T_iso, and the radius at half-level, R_{1/2}, of Triton's atmosphere (assumed to be composed of pure N_2). Considering the level of noise, we cannot detect any departure from isothermal profiles, and we do not see any deviations from spherical shape. A global fit yields T_iso = 53.7 +/- 2 K and R_{1/2} = 1456 +/- 3 km. We also derive the pressure at 1400 km: p1400 = 1.9 +/- 0.3 mu bars. We will discuss these results and compare them with previous works obtained by Voyager teams from the 1989 observations, and by Olkin et al. (Icarus 129, 178, 1997), who analyze two Triton occultations observed in July 1993 (Tr60) and August 1995 (Tr148). We observe a general increase of pressure at 1400 km, since Olkin et al. derive p1400 = 1.4 +/- 0.1 mu bars from the Tr148 event. This result is actually confirmed by a recent work by Elliot et al., (Nature 393, 765 1998), who note a global warming on Triton, based in particular on a new HST occultation observation in November 1997 (Tr180).

  13. Neptune's Triton: A moon rich in dry ice and carbon

    Science.gov (United States)

    Prentice, A. J. R.

    1989-01-01

    The encounter of the spacecraft Voyager 2 with Neptune and its large satellite Triton in August 1989 will provide a crucial test of ideas regarding the origin and chemical composition of the outer solar system. In this pre-encounter publication, the possibility is quantified that Titron is a captured moon which, like Pluto and Charon, originally condensed as a major planetesimal within the gas ring that was shed by the contracting protosolar cloud at Neptune's orbit. Ideas of supersonic convective turbulence are used to compute the gas pressure, temperature and rat of catalytic synthesis of CH4, CO2, and C(s) within the protosolar cloud, assuming that all C is initially present as CO. The calculations lead to a unique composition for Triton, Pluto, Charon: each body consists of, by mass, 18 1/2 percent solid CO2 ice, 4 percent graphite, 1/2 percent CH4 ice, 29 percent methanated water ice and 48 percent of anhydrous rock. This mix has a density consistent with that of the Pluto-Charon system and yields a predicted mean density for Triton of 2.20 + or - 0.5 g/cu cm, for satellite radius equal to 1,750 km.

  14. Psychoanalytic and musical ambiguity: the tritone in gee, officer krupke.

    Science.gov (United States)

    Jaffee Nagel, Julie

    2010-02-01

    The poignant and timeless Broadway musical West Side Story is viewed from the standpoint of taking musical forms as psychoanalytic data. The musical configuration of notes called the tritone (or diabolus in musica) is taken as a sonic metaphor expressing ambiguity both in musical vocabulary and in mental life. The tritone, which historically and harmonically represents instability, is heard throughout the score and emphasizes the intrapsychic, interpersonal, and social dramas that unfold within and between the two gangs in West Side Story. Particular emphasis is given to the comic but exceedingly sober song Gee, Officer Krupke. Bernstein's sensitivity to the ambiguity and tension inherent in the tritone in West Side Story is conceptualized as an intersection of music theory and theories of mind; this perspective holds implications for clinical practice and transports psychoanalytic concepts from the couch to the Broadway stage and into the community to address the complexities of love, hate, aggression, prejudice, and violence. Ultimately, West Side Story cross-pollinates music and theater, as well as music and psychoanalytic concepts.

  15. Pitch jnd and the tritone paradox: The linguistic nexus

    Science.gov (United States)

    Safari, Kourosh

    2002-11-01

    Previous research has shown a connection between absolute pitch (the ability to name a specific pitch in the absence of any reference) and native competence in a tone language (Deutsch, 1990). In tone languages, tone is one of the features which determines the lexical meaning of a word. This study investigates the relationship between native competence in a tone language and the just noticeable difference of pitch. Furthermore, the tritone paradox studies have shown that subjects hear two tritones (with bell-shaped spectral envelopes) as either ascending or descending depending on their linguistic backgrounds (Deutsch, 1987). It is hypothesized that the native speakers of tone languages have a higher JND for pitch, and hear the two tones of the tritone paradox as ascending, whereas, native speakers of nontone languages hear them as descending. This study will indicate the importance of early musical training for the development of acute tone sensitivity. It will also underline the importance of language and culture in the way it shapes our musical understanding. The significance of this study will be in the areas of music education and pedagogy.

  16. Comparative calculations and parametric studies using HELIOS and TRITON. Technical report; Vergleichsrechnungen und Parameterstudien mit HELIOS und TRITON. Technischer Bericht

    Energy Technology Data Exchange (ETDEWEB)

    Sommer, Fabian

    2017-05-15

    In the frame of the project ''evaluation and feasibility of a validation for computational codes for criticality and burnout calculations for the use in systems with boiling water reactor fuel'' the burnout code HELIOS for the calculation of inventories was used which allows due to the fast routines Monte-Carlo based sensitivity and uncertainty analyses. The calculated neutron multiplication factor for the HELIOS based calculations were compared with TRITON results.

  17. Oxygen effect in the radiolysis of triton X-100 aqueous solution

    International Nuclear Information System (INIS)

    Perkowski, J.; Mayer, J.

    1994-01-01

    Experiments with Triton X-100 as a model surfactant were performed under steady-state conditions, using deoxygenated solutions as well as those saturated with N 2 O, O 2 or N 2 O/O 2 mixtures. The Triton x-100 decomposition yield was dependent on the O 2 content of the irradiated system. Oxygen promoted surfactant decomposition in aqueous solution containing only Triton X-100. (author) 13 refs.; 1 tab

  18. Neuroprotection of Grape Seed Extract and Pyridoxine against Triton-Induced Neurotoxicity

    Directory of Open Access Journals (Sweden)

    Heba M. Abdou

    2016-01-01

    Full Text Available Triton WR-1339 administration causes neurotoxicity. Natural products and herbal extracts can attenuate cerebral injury. In the present study, we investigated the neuroprotective role of grape seed extract and/or vitamin B6 against triton-induced neurotoxicity. Thirty-five adult male albino rats of the Sprague-Dawley strain, weighing 140–145 g, were divided into five groups: control, triton, grape seed extract + triton, grape seed extract + triton + vitamin B6, and vitamin B6 + triton. The hematological and biochemical analyses were carried out. Alteration in iNOS mRNA gene expression was determined using reverse-transcriptase PCR analysis. In addition, qualitative DNA fragmentation was examined using agarose gel electrophoresis. Triton-treatment caused significant disturbances in the hematological parameters, the neurological functions, and the antioxidant profile. Also, triton significantly increased the iNOS mRNA expression and DNA damage. Our results showed that grape seed extract and/or vitamin B6 could attenuate all the examined parameters. These natural substances could exhibit protective effects against triton-induced neurological damage because of their antioxidative and antiapoptotic capacities.

  19. Removal of Bound Triton X-100 from Purified Bovine Heart Cytochrome bc1

    OpenAIRE

    Varhač, Rastislav; Robinson, Neal C.; Musatov, Andrej

    2009-01-01

    Cytochrome bc1 isolated from Triton X-100 solubilized mitochondrial membranes contains up to 120 nmol of Triton X-100 bound per nmol of the enzyme. Purified cytochrome bc1 is fully active; however, protein bound Triton X-100 significantly interferes with structural studies of the enzyme. Removal of Triton X-100 bound to bovine cytochrome bc1 was accomplished by incubation with Bio-Beads SM-2 in presence of sodium cholate. Sodium cholate is critical since it does not interfere with the adsorpt...

  20. TRITON: graphic software for rational engineering of enzymes.

    Science.gov (United States)

    Damboský, J; Prokop, M; Koca, J

    2001-01-01

    Engineering of the catalytic properties of enzymes requires knowledge about amino acid residues interacting with the transition state of the substrate. TRITON is a graphic software package for modelling enzymatic reactions for the analysis of essential interactions between the enzyme and its substrate and for in silico construction of protein mutants. The reactions are modelled using semi-empirical quantum-mechanic methods and the protein mutants are constructed by homology modelling. The users are guided through the calculation and data analysis by wizards.

  1. A new cartography for the Triton and Nereide reactors

    International Nuclear Information System (INIS)

    Debiar, A.; Loverini, M.J.; Annibal, M.

    1997-01-01

    Triton and Nereide are two reactors from the first generation of pool type reactors, and have been dismantled between 1982 and 1986; they are to be used as a test and certification station for dismantling materials. Since 1993, they are continuously monitored. In 1983, a first reactivity balance was carried out, showing an equivalent residual activity inferior to 1.3 curie, which was followed by the classification of the facilities and its thorough cleaning. A new cartography of the radiological state of the site is in course, before its final decommissioning

  2. Investigation of fusion proton and triton emission in ASDEX

    International Nuclear Information System (INIS)

    Leinberger, U.

    1991-01-01

    A diagnostic method of measuring the fusion rate profile was developed on ASDEX. The collimated protons and tritons from d-d fusion reaction are simultaneously detected by a semiconductor counter at a single position in the vacuum vessel for different viewing directions. The detection efficiency profiles for these viewing directions are numerically calculated from the measured currents in the coils and assumed plasma current distributions. Folding the detection efficiency profile with a fusion rate profile yields the proton and triton fluxes to the detector. Comparison with measured fluxes allows one to find a fusion rate profile in agreement with the experimental data. In certain cases the detection efficiency profile strongly on the plasma current density profile, and information on the current distribution in the plasma can thus be achieved. It was proved that the spectra from rotating plasmas are in accordance with the theory of a rotating thermal plasma. Deviations can only be found in the case of strong vignetting of the detection efficiency by structures in the vacuum vessel. (orig.)

  3. Charge-exchange reactions with a secondary triton beam

    CERN Document Server

    Sherrill, B M; Austin, S M; Bazin, D; Berg, A; Berg, G P A; Caggiano, J; Daito, I; Fujimura, H; Fujita, Y; Fujiwara, M; Hara, K; Harakeh, M N; Jänecke, J; Kawabata, T; Navin, A; Roberts, D A; Steiner, M

    1999-01-01

    A secondary triton beam from fragmentation of 560-MeV alpha-particles has been used in a high-resolution (t, sup 3 He) charge-exchange experiment at intermediate bombarding energies. The experiment was carried out at the National Superconducting Cyclotron Laboratory using a sup 4 He beam from the K1200 cyclotron. The radioactive triton beam of (0.5-1.0)x10 sup 6 particles/s with a mean energy of 350 MeV was produced in a production target of the A1200 fragment separator and transported to the target position of the S800 magnetic spectrometer. Ray-tracing and dispersion-matching techniques were employed to detect sup 3 He particles from the sup 1 sup 2 C(t, sup 3 He) sup 1 sup 2 B reaction near 0 deg. . An energy resolution of DELTA E approx 160 keV or DELTA E/E approx 4.6x10 sup - sup 4 (FWHM) was achieved. This is an improvement over our previous results and opens the possibility for studying high-resolution (n,p)-type reactions at intermediate bombarding energies. (author)

  4. Non-immunological precipitation by the neutral detergent triton X-100 in agar gel diffusion.

    OpenAIRE

    Mansheim, B J; Stenstrom, M L

    1980-01-01

    Triton X-100 can be used to clarify vague immunoprecipitin lines from bacterial antigens; however, non-immunological precipitation can lead to mistaken interpretation of immunodiffusion results. If Triton X-100 is added directly to the gel during preparation rather than to the antigen well, this detergent artifact can be eliminated.

  5. Interactions of dipeptides with Triton X-100 in aqueous solution: A volumetric and spectroscopic study

    International Nuclear Information System (INIS)

    Yan, Zhenning; Wu, Shuangyan; Pan, Qi; Geng, Rui; Gu, Bixin; Wang, Jianji

    2014-01-01

    Highlights: • The values of V 2,ϕ o and Δ t V° are positive. • Interactions of Triton X-100 with charged and polar groups of dipeptides dominate. • Addition of dipeptide in water decreases the c cmc and the aggregation number of Triton X-100. • The affinity between dipeptide and Triton X-100 micelle increases with the increase in the length of alkyl chain of peptides. • Triton X-100 interacts with dipeptides more weakly than SDS. -- Abstract: The interactions of dipeptides with Triton X-100 in aqueous solution have been investigated by means of density, fluorescence spectroscopy and UV–vis spectroscopy. The standard partial molar volume (V 2,ϕ o ), standard partial molar volume of transfer for dipeptide from water to aqueous Triton X-100 solution (Δ t V o ) and partial molar expansibility (E ϕ o ) have been calculated from density data. Fluorescence spectroscopy was used to estimate the critical micellar concentration (c cmc ) and micelle aggregation number of Triton X-100 in aqueous dipeptide solutions. Effects of temperature and hydrocarbon chain length of dipeptides on the volumetric properties of dipeptide and critical micelle concentration (c cmc ) of Triton X-100 were examined. The pyrene fluorescence spectra were also used to study the change of micropolarity produced by the interactions of Triton X-100 with dipeptides. From the results of UV–vis absorption spectra, the binding constant between dipeptide and Triton X-100 above the c cmc was determined. The results have been interpreted in terms of solute–solvent interactions and structural changes in the mixed solutions

  6. The Sendai triton calculation with three-nucleon potentials

    International Nuclear Information System (INIS)

    Sasakawa, T.

    1986-01-01

    Where can we see the effects of quarks remains a fundamental question in nuclear theory physics. A bold approach is to try to reproduce physical quantities theoretically by utilizing a quark picture with imagination. A conservative but safer approach may be to study the triton as thoroughly as possible using realistic two- and three-nucleon potentials. We are taking the latter approach. In fact, our calculation of the EMC effect, which was one thought to be a realization of the quark-gluon picture of nuclei, suggests that we might not have to make recourse to this picture. The calculation was done for 3 He, while experimental data for 4 He are shown. We hope that an experiment for 3 He is done soon, to check whether our conservative approach actually works for the EMC effect. (orig./WL)

  7. Role of triton X-100 and hydrothermal treatment on the morphological features of nanoporous hydroxyapatite nanorods

    Energy Technology Data Exchange (ETDEWEB)

    Iyyappan, E.; Wilson, P., E-mail: catwils@gmail.com; Sheela, K.; Ramya, R.

    2016-06-01

    Hydroxyapatite (HA) particles were synthesized using Ca(NO{sub 3}){sub 2}·4H{sub 2}O and (NH{sub 4}){sub 2}HPO{sub 4} as precursors with varying contents of non-ionic surfactant viz., triton X-100 (organic modifier) via co-precipitation method followed by hydrothermal treatment. The prepared HA particles have been characterized by X-ray diffraction (XRD), Fourier Transform Infrared spectroscopy (FT-IR), Energy Dispersive X-ray Analysis (EDX), High Resolution Scanning Electron Microscopy (HRSEM), High Resolution Transmission Electron Microscopy (HRTEM) and Nitrogen adsorption–desorption experiments. The XRD and FTIR studies indicate the formation of HA phase in all the synthesized samples. The specific roles of triton X-100 and hydrothermal treatment in dispersing and in directing the crystal growth respectively have been discussed by comparing the observations from individual experiments using triton X-100 and hydrothermal treatment with that of combined protocol involving both. The plausible mechanism for the individual roles of both triton X-100 and hydrothermal treatment have been proposed. - Highlights: • Nanoporous HA nanorods are synthesized via triton X-100 assisted hydrothermal treatment. • Triton X-100 hinder the agglomeration of HA primary particles • Hydrothermal treatment increase the aspect ratio of the HA particles • Oriented attachment of HA particles occurs under hydrothermal treatment facilitated by triton X-100 stabilized HA collides • The percentage of mesopore volume is higher for hydrothermally treated samples.

  8. Role of triton X-100 and hydrothermal treatment on the morphological features of nanoporous hydroxyapatite nanorods

    International Nuclear Information System (INIS)

    Iyyappan, E.; Wilson, P.; Sheela, K.; Ramya, R.

    2016-01-01

    Hydroxyapatite (HA) particles were synthesized using Ca(NO 3 ) 2 ·4H 2 O and (NH 4 ) 2 HPO 4 as precursors with varying contents of non-ionic surfactant viz., triton X-100 (organic modifier) via co-precipitation method followed by hydrothermal treatment. The prepared HA particles have been characterized by X-ray diffraction (XRD), Fourier Transform Infrared spectroscopy (FT-IR), Energy Dispersive X-ray Analysis (EDX), High Resolution Scanning Electron Microscopy (HRSEM), High Resolution Transmission Electron Microscopy (HRTEM) and Nitrogen adsorption–desorption experiments. The XRD and FTIR studies indicate the formation of HA phase in all the synthesized samples. The specific roles of triton X-100 and hydrothermal treatment in dispersing and in directing the crystal growth respectively have been discussed by comparing the observations from individual experiments using triton X-100 and hydrothermal treatment with that of combined protocol involving both. The plausible mechanism for the individual roles of both triton X-100 and hydrothermal treatment have been proposed. - Highlights: • Nanoporous HA nanorods are synthesized via triton X-100 assisted hydrothermal treatment. • Triton X-100 hinder the agglomeration of HA primary particles • Hydrothermal treatment increase the aspect ratio of the HA particles • Oriented attachment of HA particles occurs under hydrothermal treatment facilitated by triton X-100 stabilized HA collides • The percentage of mesopore volume is higher for hydrothermally treated samples

  9. Triton X-100 as a complete liquid scintillation cocktail for counting aqueous solutions and ionic nutrient salts

    International Nuclear Information System (INIS)

    Reed, D.W.

    1984-01-01

    Triton X-100, used alone, was found to act as a complete liquid scintillation cocktail. Triton X-100 acted as a scintillator and the effect was not due to Cerenkov radiation. A variety of other commercially available surfactants also acted as scintillators, but with different levels of efficiency. Triton X-100/water combinations were suitable for counting aqueous solutions of 33 P and 86 Rb and the count rate was stable over extended periods of time. Triton X-100/toluene combinations also yielded high counting efficiencies. Triton X-100 was more sensitive to quenching than standard cocktails containing fluors. (author)

  10. Triton burnup study using scintillating fiber detector on JT-60U

    Energy Technology Data Exchange (ETDEWEB)

    Harano, Hideki [Japan Atomic Energy Research Inst., Naka, Ibaraki (Japan). Naka Fusion Research Establishment

    1997-09-01

    The DT fusion reactor cannot be realized without knowing how the fusion-produced 3.5 MeV {alpha} particles behave. The {alpha} particles` behavior can be simulated using the 1 MeV triton. To investigate the 1 MeV triton`s behavior, a new type of directional 14 MeV neutron detector, scintillating fiber (Sci-Fi) detector has been developed and installed on JT-60U in the cooperation with LANL as part of a US-Japan collaboration. The most remarkable feature of the Sci-Fi detector is that the plastic scintillating fibers are employed for the neutron sensor head. The Sci-Fi detector measures and extracts the DT neutrons from the fusion radiation field in high time resolution (10 ms) and wide dynamic range (3 decades). Triton burnup analysis code TBURN has been made in order to analyze the time evolution of DT neutron emission rate obtained by the Sci-Fi detector. The TBURN calculations reproduced the measurements fairly well, and the validity of the calculation model that the slowing down of the 1 MeV triton was classical was confirmed. The Sci-Fi detector`s directionality indicated the tendency that the DT neutron emission profile became more and more peaked with the time progress. In this study, in order to examine the effect of the toroidal field ripple on the triton burnup, R{sub p}-scan and n{sub e}-scan experiments have been performed. The R{sub p}-scan experiment indicates that the triton`s transport was increased as the ripple amplitude over the triton became larger. In the n{sub e}-scan experiment, the DT neutron emission showed the characteristic changes after the gas puffing injection. It was theoretically confirmed that the gas puffing was effective for the collisionality scan. (J.P.N.) 127 refs.

  11. Utilization of Triton X-100 and polyethylene glycols during surfactant-mediated biodegradation of diesel fuel

    International Nuclear Information System (INIS)

    Wyrwas, Bogdan; Chrzanowski, Łukasz; Ławniczak, Łukasz; Szulc, Alicja; Cyplik, Paweł; Białas, Wojciech; Szymański, Andrzej; Hołderna-Odachowska, Aleksandra

    2011-01-01

    Highlights: ► Efficient degradation of Triton X-100 under both aerobic and aerobic conditions. ► Triton X-100 was most likely degraded via the ‘central fission’ mechanism. ► Preferential degradation of Triton X-100 over diesel oil. ► The presence of surfactants decreased diesel oil biodegradation efficiency. - Abstract: The hypothesis regarding preferential biodegradation of surfactants applied for enhancement of microbial hydrocarbons degradation was studied. At first the microbial degradation of sole Triton X-100 by soil isolated hydrocarbon degrading bacterial consortium was confirmed under both full and limited aeration with nitrate as an electron acceptor. Triton X-100 (600 mg/l) was utilized twice as fast for aerobic conditions (t 1/2 = 10.3 h), compared to anaerobic conditions (t 1/2 = 21.8 h). HPLC/ESI-MS analysis revealed the preferential biodegradation trends in both components classes of commercial Triton X-100 (alkylphenol ethoxylates) as well as polyethylene glycols. The obtained results suggest that the observed changes in the degree of ethoxylation for polyethylene glycol homologues occurred as a consequence of the ‘central fission’ mechanism during Triton X-100 biodegradation. Subsequent experiments with Triton X-100 at approx. CMC concentration (150 mg/l) and diesel oil supported our initial hypothesis that the surfactant would become the preferred carbon source even for hydrocarbon degrading bacteria. Regardless of aeration regimes Triton X-100 was utilized within 48–72 h. Efficiency of diesel oil degradation was decreased in the presence of surfactant for aerobic conditions by approx. 25% reaching 60 instead of 80% noted for experiments without surfactant. No surfactant influence was observed for anaerobic conditions.

  12. The influence of thermal inertia on temperatures and frost stability on Triton

    Science.gov (United States)

    Spencer, John R.; Moore, Jeffrey M.

    1992-01-01

    It is presently argued, in view of (1) a thermal inertia model for the surface of Triton which (like previous ones) predicts a monotonic recession of permanent N2 deposits toward the poles and very little seasonal N2 frost in the southern hemisphere, and (2) new spectroscopic evidence for nonvolatile CO2 on Triton's bright southern hemisphere, that much of that bright southern material is not N2. Such bright southern hemisphere volatiles may allow the formation of seasonal frosts, thereby helping to explain the observed spectroscopic changes of Triton during the last decade.

  13. Surfactant-enhanced remediation of a trichloroethene-contaminated aquifer. 1. Transport of triton X-100

    Science.gov (United States)

    Smith, J.A.; Sahoo, D.; Mclellan, H.M.; Imbrigiotta, T.E.

    1997-01-01

    Transport of a nonionic surfactant (Triton X-100) at aqueous concentrations less than 400 mg/L through a trichloroethene-contaminated sand-and-gravel aquifer at Picatinny Arsenal, NJ, has been studied through a series of laboratory and field experiments. In the laboratory, batch and column experiments were conducted to quantify the rate and amount of Triton X-100 sorption to the aquifer sediments. In the field, a 400 mg/L aqueous Triton X-100 solution was injected into the aquifer at a rate of 26.5 L/min for a 35-d period. The transport of Triton X-100 was monitored by sampling and analysis of groundwater at six locations surrounding the injection well. Equilibrium batch sorption experiments showed that Triton X-100 sorbs strongly and nonlinearly to the field soil with the sharpest inflection point of the isotherm occurring at an equilibrium aqueous Triton X-100 concentration close to critical micelle concentration. Batch, soil column, and field experimental data were analyzed with zero-, one-, and two- dimensional (respectively) transient solute transport models with either equilibrium or rate-limited sorption. These analyses reveal that Triton X- 100 sorption to the aquifer solids is slow relative to advective and dispersive transport and that an equilibrium sorption model cannot simulate accurately the observed soil column and field data. Comparison of kinetic sorption parameters from batch, column, and field transport data indicate that both physical heterogeneities and Triton X-100 mass transfer between water and soil contribute to the kinetic transport effects.Transport of a nonionic surfactant (Triton X-100) at aqueous concentrations less than 400 mg/L through a trichloroethene-contaminated sand-and-gravel aquifer was studied. Equilibrium batch sorption experiments showed that Triton X-100 sorbs strongly and nonlinearly to the field soil with the sharpest inflection point of the isotherm occurring at an equilibrium aqueous Triton X-100 concentration close to

  14. TAO/TRITON, RAMA, and PIRATA Buoys, Quarterly, 2000-present, Longwave Radiation

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has quarterly Incoming Longwave Radiation data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  15. TAO/TRITON, RAMA, and PIRATA Buoys, Monthly, 2000-present, Longwave Radiation

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has monthly Incoming Longwave Radiation data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  16. TAO/TRITON, RAMA, and PIRATA Buoys, Daily, 2000-present, Longwave Radiation

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has daily Incoming Longwave Radiation data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  17. TAO/TRITON, RAMA, and PIRATA Buoys, 5-Day, 2000-present, Longwave Radiation

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has 5-day Incoming Longwave Radiation data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  18. TAO/TRITON, RAMA, and PIRATA Buoys, 5-Day, 1980-present, Position

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has 5-day Position data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  19. TAO/TRITON, RAMA, and PIRATA Buoys, Daily, 1980-present, Position

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has daily Position data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  20. TAO/TRITON, RAMA, and PIRATA Buoys, Daily, 1991-present, Net Shortwave Radiation

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has daily Net Shortwave Radiation data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  1. TAO/TRITON, RAMA, and PIRATA Buoys, Monthly, 2000-present, Net Longwave Radiation

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has monthly Net Longwave Radiation data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  2. TAO/TRITON, RAMA, and PIRATA Buoys, Daily, 1998-present, Barometric (Air) Pressure

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has daily Barometric (Air) Pressure data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  3. TAO/TRITON, RAMA, and PIRATA Buoys, Quarterly, 1977-present, Air Temperature

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has quarterly Air Temperature data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  4. TAO/TRITON, RAMA, and PIRATA Buoys, Quarterly, 1987-present, Salinity

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has quarterly Salinity data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  5. TAO/TRITON, RAMA, and PIRATA Buoys, Monthly, 1989-present, Wind Stress

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has monthly Wind Stress data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  6. TAO/TRITON, RAMA, and PIRATA Buoys, Monthly, 1980-present, Position

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has monthly Position data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  7. TAO/TRITON, RAMA, and PIRATA Buoys, Quarterly, 1980-present, Position

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has quarterly Position data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  8. TAO/TRITON, RAMA, and PIRATA Buoys, Daily, 1977-present, Currents

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has daily Currents data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  9. TAO/TRITON, RAMA, and PIRATA Buoys, Monthly, 1992-present, Sea Surface Salinity

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has monthly Sea Surface Salinity data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  10. TAO/TRITON, RAMA, and PIRATA Buoys, Monthly, 2000-present, Buoyancy Flux

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has monthly Buoyancy Flux data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  11. TAO/TRITON, RAMA, and PIRATA Buoys, 5-Day, 2000-present, Net Longwave Radiation

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has 5-day Net Longwave Radiation data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  12. TAO/TRITON, RAMA, and PIRATA Buoys, Monthly, 1987-present, Potential Density Anomaly

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has monthly Potential Density Anomaly (sigma-theta) data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  13. TAO/TRITON, RAMA, and PIRATA Buoys, Monthly, 1989-present, Sensible Heat Flux

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has monthly Sensible Heat Flux data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  14. TAO/TRITON, RAMA, and PIRATA Buoys, Daily, 1989-present, Sensible Heat Flux

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has daily Sensible Heat Flux data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  15. TAO/TRITON, RAMA, and PIRATA Buoys, Quarterly, 1977-present, Temperature

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has quarterly Temperature data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  16. Radiation chemistry connection with the positronium formation in aqueous solution of triton X-100

    International Nuclear Information System (INIS)

    Das, S.K.; Ganguly, B.N.

    1996-01-01

    Positronium formation bears its connection to radiation chemical phenomenon. This has been demonstrated here to probe the micelle formation and further structural changes in Triton X-100 surfactant solution. (author). 6 refs., 3 figs

  17. Effects of sawtooth crashes on beam ions and fusion product tritons in JET

    International Nuclear Information System (INIS)

    Marcus, F.B.; Hone, M.A.; Jarvis, O.N.; Loughlin, M.J.; Sadler, G.

    1994-01-01

    The effect of a sawtooth crash on the radial distribution of the slowing down fusion product tritons and on beams ions, is examined with measurements of the 2.5 MeV and 14 MeV neutron emission line-integrals before and after sawtooth crashes. In deuterium discharges, the 14 MeV neutron production was wholly attributable to burnup of the 1 MeV fusion product tritons from d-d fusion. The local emissivity of 14 MeV neutrons, and hence of the profile of thermalizing tritons, is shown to be only weakly affected by crashes in the discharges studied. This is in contradiction with the apparent behaviour of injected beam ions as deduced from a study of the considerable changes in local emissivity of the 2.5 MeV neutrons. Nevertheless, the behaviour of the fusion product tritons is consistent with the scaling of the beam injected deuterium. 1 ref., 6 figs

  18. TAO/TRITON, RAMA, and PIRATA Buoys, Quarterly, 1989-present, Sensible Heat Flux

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has quarterly Sensible Heat Flux data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  19. TAO/TRITON, RAMA, and PIRATA Buoys, 5-Day, 1989-present, Relative Humidity

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has 5-day Relative Humidity data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  20. TAO/TRITON, RAMA, and PIRATA Buoys, Quarterly, 1989-present, Relative Humidity

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has quarterly Relative Humidity data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  1. TAO/TRITON, RAMA, and PIRATA Buoys, Monthly, 1989-present, Relative Humidity

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has monthly Relative Humidity data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  2. TAO/TRITON, RAMA, and PIRATA Buoys, Daily, 1989-present, Relative Humidity

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has daily Relative Humidity data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  3. Binding Of Ferrocyphen By Sds, Ctab And Triton X-100 In Water ...

    African Journals Online (AJOL)

    SDS), cetyltrimethylammonium bromide (CTAB) and Triton X-100 surfactants was studied spectrophotometrically in water-ethanol medium. The equilibrium binding constant (Kb) and the number of binding sites (n) per surfactant monomer were ...

  4. TAO/TRITON, RAMA, and PIRATA Buoys, 5-Day, 1989-present, Wind Stress

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has 5-day Wind Stress data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  5. TAO/TRITON, RAMA, and PIRATA Buoys, Quarterly, 1988-2015, ADCP

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has quarterly Acoustic Doppler Current Profiler (ADCP) water currents data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA...

  6. TAO/TRITON, RAMA, and PIRATA Buoys, 5-Day, 1988-2015, ADCP

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has 5-day Acoustic Doppler Current Profiler (ADCP) water currents data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA...

  7. TAO/TRITON, RAMA, and PIRATA Buoys, Quarterly, 1997-present, Heat Flux Due To Rain

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has quarterly Heat Flux Due To Rain data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  8. TAO/TRITON, RAMA, and PIRATA Buoys, 5-Day, 1997-present, Precipitation

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has 5-day Precipitation data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  9. TAO/TRITON, RAMA, and PIRATA Buoys, Quarterly, 1901-present, Downgoing Shortwave Radiation

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has quarterly Downgoing Shortwave Radiation data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  10. TAO/TRITON, RAMA, and PIRATA Buoys, Monthly, 1991-present, Downgoing Shortwave Radiation

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has monthly Downgoing Shortwave Radiation data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  11. TAO/TRITON, RAMA, and PIRATA Buoys, Monthly, 1997-present, Precipitation

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has monthly Precipitation data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  12. TAO/TRITON, RAMA, and PIRATA Buoys, 5-Day, 1991-present, Downgoing Shortwave Radiation

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has 5-day Downgoing Shortwave Radiation data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  13. TAO/TRITON, RAMA, and PIRATA Buoys, Daily, 1991-present, Downgoing Shortwave Radiation

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has daily Downgoing Shortwave Radiation data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  14. TAO/TRITON, RAMA, and PIRATA Buoys, Quarterly, 1997-present, Precipitation

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has quarterly Precipitation data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  15. TAO/TRITON, RAMA, and PIRATA Buoys, Daily, 1989-present, Wind Stress

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has daily Wind Stress data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  16. TAO/TRITON, RAMA, and PIRATA Buoys, Monthly, 1998-present, Barometric (Air) Pressure

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has monthly Barometric (Air) Pressure data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  17. TAO/TRITON, RAMA, and PIRATA Buoys, 5-Day, 1992-present, Sea Surface Salinity

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has 5-day Sea Surface Salinity data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  18. TAO/TRITON, RAMA, and PIRATA Buoys, Daily, 2000-present, Net Longwave Radiation

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has daily Net Longwave Radiation data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  19. TAO/TRITON, RAMA, and PIRATA Buoys, Monthly, 1992-present, Sigma-Theta

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has monthly Sigma-Theta (Potential Density Anomaly) data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  20. TAO/TRITON, RAMA, and PIRATA Buoys, 5-Day, 1997-present, Evaporation Minus Precipitation

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has 5-day Evaporation Minus Precipitation data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  1. TAO/TRITON, RAMA, and PIRATA Buoys, Monthly, 1977-present, Currents

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has monthly Currents data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  2. TAO/TRITON, RAMA, and PIRATA Buoys, Monthly, 1977-present, 20C Isotherm Depth

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has monthly 20C Isotherm Depth data (the depth at which the ocean temperature is 20C) from the TAO/TRITON (Pacific Ocean,...

  3. TAO/TRITON, RAMA, and PIRATA Buoys, Daily, 1989-present, Evaporation

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has daily Evaporation data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  4. TAO/TRITON, RAMA, and PIRATA Buoys, Daily, 1997-present, Evaporation Minus Precipitation

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has daily Evaporation Minus Precipitation data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  5. Effects of sawtooth crashes on beam ions and fusion product tritons in JET

    Energy Technology Data Exchange (ETDEWEB)

    Marcus, F.B.; Hone, M.A.; Jarvis, O.N.; Loughlin, M.J.; Sadler, G. [Commission of the European Communities, Abingdon (United Kingdom). JET Joint Undertaking; Adams, J.M.; Bond, D.S.; Watkins, N. [UKAEA Harwell Lab. (United Kingdom). Energy Technology Div.; Howarth, P.J.A. [Birmingham Univ. (United Kingdom)

    1994-07-01

    The effect of a sawtooth crash on the radial distribution of the slowing down fusion product tritons and on beams ions, is examined with measurements of the 2.5 MeV and 14 MeV neutron emission line-integrals before and after sawtooth crashes. In deuterium discharges, the 14 MeV neutron production was wholly attributable to burnup of the 1 MeV fusion product tritons from d-d fusion. The local emissivity of 14 MeV neutrons, and hence of the profile of thermalizing tritons, is shown to be only weakly affected by crashes in the discharges studied. This is in contradiction with the apparent behaviour of injected beam ions as deduced from a study of the considerable changes in local emissivity of the 2.5 MeV neutrons. Nevertheless, the behaviour of the fusion product tritons is consistent with the scaling of the beam injected deuterium. 1 ref., 6 figs.

  6. TAO/TRITON, RAMA, and PIRATA Buoys, Monthly, 1989-present, Evaporation

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has monthly Evaporation data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  7. TAO/TRITON, RAMA, and PIRATA Buoys, Daily, 1992-present, Sea Surface Salinity

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has daily Sea Surface Salinity data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  8. TAO/TRITON, RAMA, and PIRATA Buoys, 5-Day, 1977-present, Temperature

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has 5-day Temperature data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  9. TAO/TRITON, RAMA, and PIRATA Buoys, Quarterly, 1980-present, Heat Content

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has quarterly Heat Content data from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/ ), RAMA (Indian Ocean,...

  10. Photochemical assessment of UO2+2 complexation in Triton X-100 micellar system

    International Nuclear Information System (INIS)

    Das, S.K.; Ganguly, B.N.

    1994-01-01

    This is a report on the spectral characteristics of UO 2 +2 in the excited state in the Triton X-100 micellar medium. The downward curving of the Stern-Volmer plot explains the two kinds of populations of UO 2 +2 upon micellization. A blue shift of the quenched emission is ascribed due to the collisional encounter of UO 2 +2 with the head groups of Triton X-100. (author). 5 refs., 2 figs

  11. Fluorometric sensing of Triton X-100 based organized media in water by a MOF

    Energy Technology Data Exchange (ETDEWEB)

    Dey, Biswajit, E-mail: bdeychem@gmail.com [Department of Chemistry, Visva-Bharati University, Santiniketan 731235 (India); Mondal, Ranjan Kumar; Dhibar, Subhendu [Department of Chemistry, Visva-Bharati University, Santiniketan 731235 (India); Chattopadhyay, Asoke Prasun [Department of Chemistry, University of Kalyani, Kalyani 741235 (India); Bhattacharya, Subhash Chandra [Department of Chemistry, Jadavpur University, Kolkata 700032 (India)

    2016-04-15

    The fluorescent property of the aqueous solution of a metal organic framework (MOF) of Mn(II), having a sedimentary rocks like microstructure in solid-state, has been investigated. The luminescent feature of the the aqueous solution of MOF has been employed for studying the interactions of MOF with different surfactants including neutral, cationic, and anionic types in water medium. Interestingly, the MOF can very selective sense Triton X-100 based micelle in water medium. During the sensing process the fluorescent monomer of the MOF gets accommodated at the palisade layer of Triton X-100 in water medium and this has also been justified by simple fluorescence spectral and FE-SEM microstructural analysis. Thus, a MOF of Mn(II) can act as a selective fluorescent sensor for Triton X-100 based organized medium in water. - Highlights: • Microstructural and crystallographic studies of a water-soluble MOF are performed. • The luminescent property of MOF in water medium is explored. • The interaction between Triton X-100 and the MOF in water medium is studied by fluorometric and microstructural analysis. • The MOF acts as a selective fluorometric sensor for the Triton X-100 based organized media in water. • The monomer of MOF presents in the Triton X-100 micelle in water.

  12. Fluorometric sensing of Triton X-100 based organized media in water by a MOF

    International Nuclear Information System (INIS)

    Dey, Biswajit; Mondal, Ranjan Kumar; Dhibar, Subhendu; Chattopadhyay, Asoke Prasun; Bhattacharya, Subhash Chandra

    2016-01-01

    The fluorescent property of the aqueous solution of a metal organic framework (MOF) of Mn(II), having a sedimentary rocks like microstructure in solid-state, has been investigated. The luminescent feature of the the aqueous solution of MOF has been employed for studying the interactions of MOF with different surfactants including neutral, cationic, and anionic types in water medium. Interestingly, the MOF can very selective sense Triton X-100 based micelle in water medium. During the sensing process the fluorescent monomer of the MOF gets accommodated at the palisade layer of Triton X-100 in water medium and this has also been justified by simple fluorescence spectral and FE-SEM microstructural analysis. Thus, a MOF of Mn(II) can act as a selective fluorescent sensor for Triton X-100 based organized medium in water. - Highlights: • Microstructural and crystallographic studies of a water-soluble MOF are performed. • The luminescent property of MOF in water medium is explored. • The interaction between Triton X-100 and the MOF in water medium is studied by fluorometric and microstructural analysis. • The MOF acts as a selective fluorometric sensor for the Triton X-100 based organized media in water. • The monomer of MOF presents in the Triton X-100 micelle in water.

  13. Association of nerve growth factor receptors with the triton X-100 cytoskeleton of PC12 cells

    International Nuclear Information System (INIS)

    Vale, R.D.; Ignatius, M.J.; Shooter, E.M.

    1985-01-01

    Triton X-100 solubilizes membranes of PC12 cells and leaves behind a nucleus and an array of cytoskeletal filaments. Nerve growth factor (NGF) receptors are associated with this Triton X-100-insoluble residue. Two classes of NGF receptors are found on PC12 cells which display rapid and slow dissociating kinetics. Although rapidly dissociating binding is predominant (greater than 75%) in intact cells, the majority of binding to the Triton X-100 cytoskeleton is slowly dissociating (greater than 75%). Rapidly dissociating NGF binding on intact cells can be converted to a slowly dissociating form by the plant lectin wheat germ agglutinin (WGA). This lectin also increases the number of receptors which associate with the Triton X-100 cytoskeleton by more than 10-fold. 125 I-NGF bound to receptors can be visualized by light microscopy autoradiography in Triton X-100-insoluble residues of cell bodies, as well as growth cones and neurites. The WGA-induced association with the cytoskeleton, however, is not specific for the NGF receptor. Concentrations of WGA which change the Triton X-100 solubility of membrane glycoproteins are similar to those required to alter the kinetic state of the NGF receptor. Both events may be related to the crossbridging of cell surface proteins induced by this multivalent lectin

  14. Resistance of human erythrocyte membranes to Triton X-100 and C12E8.

    Science.gov (United States)

    Crepaldi Domingues, Cleyton; Ciana, Annarita; Buttafava, Armando; Balduini, Cesare; de Paula, Eneida; Minetti, Giampaolo

    2009-01-01

    Lipid rafts are microdomains enriched in cholesterol and sphingolipids that contain specific membrane proteins. The resistance of domains to extraction by nonionic detergents at 4 degrees C is the commonly used method to characterize these structures that are operationally defined as detergent-resistant membranes (DRMs). Because the selectivity of different detergents in defining membrane rafts has been questioned, we have compared DRMs from human erythrocytes prepared with two detergents: Triton X-100 and C12E8. The DRMs obtained presented a cholesterol/protein mass ratio three times higher than in the whole membrane. Flotillin-2 was revealed in trace amounts in DRMs obtained with C12E8, but it was almost completely confined within the DRM fraction with Triton X-100. Differently, stomatin was found distributed in DRM and non-DRM fractions for both detergents. We have also measured the order parameter (S) of nitroxide spin labels inserted into DRMs by means of electron paramagnetic resonance. The 5- and 16-stearic acid spin label revealed significantly higher S values for DRMs obtained with either Triton X-100 or C12E8 in comparison to intact cells, while the difference in the S values between Triton X-100 and C12E8 DRMs was not statistically significant. Our results suggest that although the acyl chain packing is similar in DRMs prepared with either Triton X-100 or C12E8 detergent, protein content is dissimilar, with flotillin-2 being selectively enriched in Triton X-100 DRMs.

  15. FTIR AND NMR STUDIES OF ADSORBED TRITON X-114 IN MCM-41 MATERIALS

    Directory of Open Access Journals (Sweden)

    Paulina Taba

    2010-06-01

    Full Text Available One source of water pollutions is caused by the high use of surface-active agents (surfactants by industries and households. As a consequence, it is required to remove such substances from the environment One of the important and widely used methods for removal of substances from solution is adsorption. In this research, MCM-41 and its modification MCM41-TMCS were used to adsorb nonionic surfactant, Triton X-114. FTIR and NMR methods were used to study the interaction between the surfactants and the adsorbents. MCM-41 was synthesized hydrothermally at 100 oC and its modification was conducted by silylation of MCM-41 with trimethylchloro silane (MCM41-TMCS. Both unmodified and modified MCM-41 can adsorb the surfactant. The amount adsorbed in the unmodified material is higher than that in the modified one. The interaction of Triton X-114 with MCM-41 was hydrogen bonding between the silanol groups in MCM-41 and hydroxyl groups of Triton X-114. For modified samples, Triton X-114 interacted with alkylsilyl groups mostly through hydrophobic interaction. It is more likely that the interaction was through C12, C13, C26 and C27 of Triton X-114.    Keywords: FTIR, NMR, adsorbed Triton X-114, MCM-41 materials

  16. Solvation dynamics in triton-X-100 and triton-X-165 micelles: Effect of micellar size and hydration

    Science.gov (United States)

    Kumbhakar, Manoj; Nath, Sukhendu; Mukherjee, Tulsi; Pal, Haridas

    2004-09-01

    Dynamic Stokes' shift measurements using coumarin 153 as the fluorescence probe have been carried out to study solvation dynamics in two nonionic micelles, viz., triton-X-100 (TX-100) and triton-X-165 (TX-165). In both the micelles, the solvent relaxation dynamics is biexponential in nature. While the fast solvation time τs1 is seen to be almost similar for both the micelles, the slow solvation time τs2 is found to be appreciably smaller in TX-165 than in TX-100 micelle. Dynamic light scattering measurements indicate that the TX-165 micelles are substantially smaller in size than that of TX-100. Assuming similar core size for both the micelles, as expected from the similar chemical structures of the nonpolar ends for both the surfactants, the Palisade layer is also indicated to be substantially thinner for TX-165 micelles than that of TX-100. The aggregation number of TX-165 micelles is also found to be substantially smaller than that of TX-100 micelles. Fluorescence spectral studies of C153 dye in the two micelles indicate that the Palisade layer of TX-165 micelles is more polar than that of TX-100 micelles. Fluorescence anisotropy measurements indicate that the microviscosity in the Palisade layer of TX-165 micelles is also lower than that of TX-100 micelles. Based on these results it is inferred that the structure of the Palisade layer of TX-165 micelles is quite loose and have higher degree hydration in comparison to that of TX-100 micelles. Due to these structural differences in the Palisade layers of TX-165 and TX-100 micelles the solvation dynamics is faster in the former micelles than in the latter. It has been further inferred that in the present systems the collective response of the water molecules at somewhat away from the probes is responsible for the faster component of the solvation time, which does not reflect much of the structural changes of the micellar Palisade layer. On the contrary, the slower solvation time component, which is mainly due to

  17. Polarized triton scattering from 26Mg, 27Al and 28Si at 17 MeV

    International Nuclear Information System (INIS)

    Hardekopf, R.A.; Brown, R.E.; Correll, F.D.; Ohlsen, G.G.

    1980-01-01

    Differential-cross-section and analyzing-power angular distributions were measured for 17 MeV tritons elastically scattered from targets of 26 Mg, 27 Al, and 28 Si in the angular range 20 to 160 0 . The experiment was performed at the Los Alamos Scientific Laboratory Van de Graaff facility using the Lamb-shift polarized triton source and the supercube scattering chamber. A pair of detector telescopes with angular resolutions of +-0.4 0 detected the reaction products, with mass identification and storage performed by an on-line computer. The triton beam intensity available at the target was about 70 nA with a polarization of 0.77. The target thicknesses were about 3 mg/cm 2 , although thinner targets were used for the 27 Al forward-angle data

  18. Burnup of fusion produced tritons and 3He ions in PLT and PDX

    International Nuclear Information System (INIS)

    Heidbrink, W.W.; Chrien, R.E.; Strachan, J.D.

    1982-09-01

    The d(d,p)t and d(d,n) 3 He fusion reactions produce 1 MeV tritons and 0.8 MeV 3 He ions which can subsequently undergo d(t,n)α and d( 3 He,p)α fusion reactions. The magnitude of this triton and 3 He ion burnup was measured on the PLT and PDX tokamaks by detection of the 14 MeV neutron and 15 MeV proton emission. In discharges with B/sub phi/ greater than or equal to 2 T, the measured 3 He burnup agrees well with predictions based on classical theories of ion confinement and slowing down, while the triton burnup was about four times lower than theoretically predicted. In discharges with weaker toroidal fields, the burnup of both ions fell by more than a factor of ten

  19. A photochemical study of uranyl ion interaction with the Triton X-100 micellar system

    International Nuclear Information System (INIS)

    Das, S.K.; Ganguly, B.N.

    1996-01-01

    This is a report on the spectroscopic characteristics of UO 2 2+ in the excited state in Triton X-100 micellar medium. It also indicates some important results of viscosity and surface tension measurements of the system which have direct relevance to the spectroscopic investigation in the excited state. The quenching of the UO 2 2+ fluorescence due to Triton X-100, upon micellization in the aqueous medium, reveals two kinds of microenvironments of the fluorophore from the Stern-Volmer plot. This has been verified by flash photolytic measurements. A blue shift of the quenched emission spectrum is ascribed to the collisional encounter of UO 2 1 + with the head groups of Triton X-100

  20. Effect of xylanase, urea, Tween and Triton additives on bioethanol production of corn stover

    Science.gov (United States)

    Xin, Xiu; Lu, Jie; Yang, Rui-Feng; Song, Wen-jing; Li, Hai-ming; Wang, Hai-song; Zhou, Jing-hui

    2017-03-01

    Corn stover is a potential source of renewable biomass for conversion to bioethanol. Fed-batch semi-simultaneous saccharifcation and fermentation (S-SSF) of corn stover pretreated by liquid hot water (LHW) was investigated. The present study aimed to confirm the influence of xylanase, urea, Tween and Triton additives on bioethanol. Results show that the positive effect of xylanase, urea, Tween was observed. High ethanol concentration requires the addition of xylanase in the stage of saccharification. The optimal amount of xylanase was 0.2 g/g biomass and addition of Triton (Triton X-100) increases the effect of xylanase. Urea has a promotion effect on the whole fermentation process.When adding 0.1% urea in the fermentation stage,the best promoting rate is 24.2%. In the longitudinal comparison of the Tween series, under the same experimental conditions, the promoting effect of Tween series: Tween 40 > Tween 80 > Tween 20 > Tween 60.

  1. Four-channel ZnS scintillator measurements of escaping tritons in TFTR

    Energy Technology Data Exchange (ETDEWEB)

    Zweben, S.J.

    1988-10-01

    A four-channel scintillation detector capable of measuring tritons, protons, and alphas escaping from a tokamak plasma was operated during the 1986 run period of the Tokamak Fusion Test Reactor (TFTR). Signals consistent with the expected 1 MeV triton behavior have been observed during deuterium operation. Backgrounds associated with neutrons, gammas, and soft x-rays have been evaluated in situ. Such a detector should be capable of measuring escaping alphas during the D/T phase of TFTR. 16 refs., 10 figs.

  2. EFFECT OF VITIS VINIFERA AGAINST TRITON X 100 INDUCED HYPERLIPIDAEMIA IN RATS

    OpenAIRE

    Masani YA; Mathew N; Chakraborty M; Kamath JV

    2012-01-01

    To evaluate the effect of Vitis vinfera fruit juice (VVFJ) against Triton X 100 induced hyperlipidaemia. Wister strain rats were treated with atorvastatin (ATOR-10mg/kg, p.o.), low and high dose of Vitis vinifera fruit juice (VVFJ- 100 and 500mg/kg) orally for 0, 24 and 44 hours after treated with Triton X 100 (400mg/kg, p.o). 4 hour after the last dose, blood was collected from all the animals and the separated serum was subjected for the estimation of serum lipoproteins level such as Trigly...

  3. Chemiluminescence determination of surfactant Triton X-100 in environmental water with luminol-hydrogen peroxide system

    Directory of Open Access Journals (Sweden)

    Qiu Chaokun

    2009-07-01

    Full Text Available Abstract Background The rapid, simple determination of surfactants in environmental samples is essential because of the extensive use and its potential as contaminants. We describe a simple, rapid chemiluminescence method for the direct determination of the non-ionic surfactant Triton X-100 (polyethylene glycol tert-octylphenyl ether in environmental water samples. The optimized experimental conditions were selected, and the mechanism of the Luminol-H2O2-Triton X-100 chemiluminesence system was also studied. Results The novel chemiluminescence method for the determination of non-ionic surfactant Triton X-100 was based on the phenomenon that Triton X-100 greatly enhanced the CL signal of the luminol-H2O2 system. The alkaline medium of luminol and the pH value obviously affected the results. Luminol concentration and hydrogen peroxide concentration also affected the results. The optimal conditions were: Na2CO3 being the medium, pH value 12.5, luminol concentration 1.0 × 10-4 mol L-1, H2O2 concentration 0.4 mol L-1. The possible mechanism was studied and proposed. Conclusion Under the optimal conditions, the standard curve was drawn up and quotas were evaluated. The linear range was 2 × 10-4 g·mL-1-4 × 10-2 g·mL-1 (w/v, and the detection limit was 3.97 × 10-5 g·mL-1 Triton X-100 (w/v. The relative standard deviation was less than 4.73% for 2 × 10-2 g·mL-1 (w/v Triton X-100 (n = 7. This method has been applied to the determination of Triton X-100 in environmental water samples. The desirable recovery ratio was between 96%–102% and the relative standard deviation was 2.5%–3.3%. The luminescence mechanism was also discussed in detail based on the fluorescence spectrum and the kinetic curve, and demonstrated that Triton X-100-luminol-H2O2 was a rapid reaction.

  4. Triton-3He relative and differential flows and the high density behavior of nuclear symmetry

    International Nuclear Information System (INIS)

    Yong, Gaochan; Li, Baoan; Chen, Liewen

    2010-01-01

    Using a transport model coupled with a phase-space coalescence after-burner we study the triton- 3 He relative and differential transverse flows in semi-central 132 Sn + 124 Sn reactions at a beam energy of 400 MeV/nucleon. We find that the triton- 3 He pairs carry interesting information about the density dependence of the nuclear symmetry energy. The t- 3 He relative flow can be used as a particularly powerful probe of the high-density behavior of the nuclear symmetry energy. (author)

  5. Four-channel ZnS scintillator measurements of escaping tritons in TFTR

    International Nuclear Information System (INIS)

    Zweben, S.J.

    1988-10-01

    A four-channel scintillation detector capable of measuring tritons, protons, and alphas escaping from a tokamak plasma was operated during the 1986 run period of the Tokamak Fusion Test Reactor (TFTR). Signals consistent with the expected 1 MeV triton behavior have been observed during deuterium operation. Backgrounds associated with neutrons, gammas, and soft x-rays have been evaluated in situ. Such a detector should be capable of measuring escaping alphas during the D/T phase of TFTR. 16 refs., 10 figs

  6. Permeabilization and lysis of Pseudomonas pseudoalcaligenes cells by triton X-100 for efficient production of D-malate

    NARCIS (Netherlands)

    Werf, M.J. van der; Hartmans, S.; Tweel, W.J.J. van den

    1995-01-01

    Pseudomonas pseudoalcaligenes can only form d-malate from maleate after incubation of the cells with a solvent or a detergent. The effect of the detergent Triton X-100 on d-malate production was studied in more detail. The longer the cells were incubated with Triton X-100, the higher was the

  7. Tritons for the study of the charge-exchange reactions with the LHE streamer chamber: status and some possibilities

    International Nuclear Information System (INIS)

    Avramenko, S.A.; Belikov, Yu.A.; Golokhvastov, A.I.; Kirillov, A.D.; Khorozov, S.A.; Komolov, L.N.; Lukstin'sh, Yu.; Rukoyatkin, P.A.

    1997-01-01

    The 6 and 9 GeV/c secondary tritons, produced in the 4 He+A→ 3 H+X reaction, were used to study the charge-exchange reactions using a streamer chamber in magnetic field. The triton formation schemes, the beam parameters achieved as well as a way to reduce the beam momentum spread are given in the paper

  8. Modeling of the water gap in BWR fuel elements using SCALE/TRITON; Modellierung des Wasserspalts bei SWR-BE mit SCALE/TRITON

    Energy Technology Data Exchange (ETDEWEB)

    Tittelbach, S.; Chernykh, M. [WTI Wissenschaftlich-Technische Ingenieurberatung GmbH, Juelich (Germany)

    2012-11-01

    The authors show that an adequate modeling of the water gap in BWR fuel element models using the code TRITON requires an explicit consideration of the Dancoff factors. The analysis of three modeling options reveals that considering the moderating effects of the water gap coolant for the peripheral fuel elements the resulting deviations of the U-235 and Pu-239 concentrations are significantly reduced. The increased temporal calculation efforts are justified with respect to the burnup credits for criticality safety analyses.

  9. Sorption of Triton X-100 on soil organic matter fractions: kinetics and isotherms.

    Science.gov (United States)

    Zhang, Guangzhi; Hu, Hao; Sun, Weiling; Ni, Jinren

    2009-01-01

    Kinetics and isotherms of Triton X-100 sorption on soil, base-extracted soil (BE), humic acid (HA) and humin (HM) were investigated respectively to get better understanding on characteristics of the surfactant sorption onto different soil organic matters (SOMs). It was demonstrated that the kinetics results could be satisfactorily described by the pseudo-second order model. The half of the time to reach equilibrium (t1/2) for different sorbents followed the sequence of soil > HA > BE > HM. Furthermore, the calculated equilibrium sorption capacity (C(eq)) was found in the sequence of HA > BE > HM > soil, which agreed well with the experimental results. The isotherms of Triton X-100 sorption on soil and HA could be well described by the S-type isotherm, but BE and HM by the L-type. The isotherms of all the four sorbents were found reasonably fitted to the Langmuir equation. The K(d) value, defined as the ratio of Triton X-100 in sorbent and in the equilibrium solution for given concentrations, generally followed the order of HM > HA > soil > BE. Separated HM and HA showed high affinity for Triton X-100, but the HA and HM in soil and BE were tightly bounded by the minerals. Thus, the HA on the soil surface might dominate the sorption, whereas the bounded HM would play a key role upon the surfactants being penetrated inside the soil.

  10. Optimized triton X-114 assisted lipopolysaccharide (LPS) removal method reveals the immunomodulatory effect of food proteins

    NARCIS (Netherlands)

    Teodorowicz, Malgorzata; Perdijk, Olaf; Verhoek, Iris; Govers, Coen; Savelkoul, Huub F.J.; Tang, Yongfu; Wichers, Harry; Broersen, Kerensa

    2017-01-01

    Scope Investigations into the immunological response of proteins is often masked by lipopolysaccharide (LPS) contamination. We report an optimized Triton X-114 (TX-114) based LPS extraction method for β-lactoglobulin (BLG) and soy protein extract suitable for cell-based immunological assays.

  11. Optimized triton X-114 assisted lipopolysaccharide (LPS) removal method reveals the immunomodulatory effect of food proteins

    NARCIS (Netherlands)

    Teodorowicz, Malgorzata; Perdijk, Olaf; Verhoek, Iris; Govers, Coen; Savelkoul, Huub F.J.; Tang, Yongfu; Wichers, Harry; Broersen, Kerensa

    2017-01-01

    Scope Investigations into the immunological response of proteins is often masked by lipopolysaccharide (LPS) contamination. We report an optimized Triton X-114 (TX-114) based LPS extraction method for β-lactoglobulin (BLG) and soy protein extract suitable for cell-based immunological assays. Methods

  12. Tuning intermicellar potential of Triton X-100– anthranilic acid mixed ...

    Indian Academy of Sciences (India)

    Structural parameters of micelles formed by Triton X-100 in the presence of solubilized anthranilic acid at different pH values was investigated using light scattering and small angle neutron scattering. Analysis of the SANS data indicate that micelles are oblate ellipsoidal in nature with little variation in the dimensions, in the ...

  13. Thermophysical and spectroscopic studies of room temperature ionic liquid, 1-butyl-3-methylimidazolium hexafluorophosphate in Tritons

    International Nuclear Information System (INIS)

    Chaudhary, Ganga Ram; Bansal, Shafila; Mehta, S.K.; Ahluwalia, A.S.

    2012-01-01

    Highlights: ► Thermophysical studies of new formulations of [BMIM][PF 6 ]+TX(45,100) have been made. ► Strong intermolecular interactions between [BMIM][PF 6 ] and TX (45, 100) is observed. ► Magnitude of interactions increases with the addition of oxyethylene groups in TX. ► With rise in temperature, intermolecular interactions increases. ► Spectroscopic studies show that interactions are via aromatic rings of RTIL and TX. - Abstract: The thermophysical properties viz. density ρ, speed of sound u, and specific conductivity κ of pure room temperature ionic liquid (1-butyl-3-methylimidazolium hexafluorophosphate) and its binary formulations with Triton X-45 and Triton X-100 have been studied over the entire composition range at different temperatures (293.15 to 323.15) K. Excess molar volume V E , deviation in isentropic compressibility ΔK S , partial molar excess volume V i E , deviation in partial molar isentropic compressibility ΔK S,i , deviation in specific conductivity Δκ have also been estimated and analysed. Spectroscopic properties (IR, 1 H and 13 C NMR) of these mixtures have been investigated in order to understand the structural and interactional behaviour of formulations studied. The magnitude of interactions between the two components increases with addition of number of oxyethylene groups in Tritons and with rise in temperature. Spectroscopic measurements indicate that interactions are mainly taking place through the five member ring of room temperature ionic liquid and six member ring of Tritons.

  14. Tuning intermicellar potential of Triton X-100– anthranilic acid mixed ...

    Indian Academy of Sciences (India)

    the attractive interaction between the micelles diminishes. The interaction potential between Triton X-100 micelles can be thought of as the sum of the attractive van der Walls interaction and Coulombic repulsion due to charged anthranilic molecules on the surface of the micelles. Assuming a Yukawa form of the potential for ...

  15. The asymptotic D-state to S-state ratio of triton

    Indian Academy of Sciences (India)

    dictions of the asymptotic D-state to S-state ratio of triton are calculated to more fully evaluate the adequacy of the ... deuteron radiative capture was also calculated at thermal neutron energies, using pionless. EFT up to N2LO ... necessary for this work and the derivation of the integral equation describing neutron– deuteron ...

  16. TAO/TRITON, RAMA, and PIRATA Buoys, 5-Day, 1977-present, 20C Isotherm Depth

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has 5-day 20C Isotherm Depth data (the depth at which the ocean temperature is 20C) from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/...

  17. Energy transfer in triton-X 100 micelles: a fluorescence study

    Science.gov (United States)

    Saha, D. C.; Ray, K.; Misra, T. N.

    2000-03-01

    The study of fluorescence energy transfer from the phenyl groups of the micellar triton X-100 (TX-100) to solubilised 1-pyrene butyric acid (PBA) has been carried out. Through the analysis of the donor fluorescence quenching energy transfer efficiency has been determined. The observed donor-acceptor separation suggests that pyrene molecules are distributed uniformly in the micellar core.

  18. Separation of Methylene Blue Dye from Aqueous Solution Using Triton X-114 Surfactant

    Directory of Open Access Journals (Sweden)

    Arunagiri Appusamy

    2014-01-01

    Full Text Available In this study, the interaction energy between Triton X-114 surfactant + methylene blue or water and methylene blue + water was investigated using Hartree-Fock (HF theory with 6-31G* basis set. The results of structures and interaction energies show that these complexes have good physical and chemical interactions at atom and molecular levels. However, the Triton X-114 surfactant + methylene blue complex shows stronger molecular interaction compared to other complexes systems. The order of the interaction energy is 4303.472023 (Triton X-114 surfactant + water > -1222.962 (methylene blue + water > -3573.28 (Triton X-114 surfactant + methylene blue kJ·mole−1. Subsequently, the cloud point extraction was carried out for 15 ppm of methylene blue in a mixture at 313.15 and 323.15 K over the surfactant concentration range from 0.01 M to 0.1 M. From the measured data, the excess molar volume was calculated for both phases. The results show a positive deviation in the dilute phase and a negative deviation in the surfactant rich phase. It is confirmed that the interaction between Triton X-114 and methylene blue is stronger than other complex systems due to the presence of chemical and structural orientation. The concentration of dyes and surfactant in the feed mixture and temperature effect in both phases has been studied. In addition, the thermodynamics feasibility and efficiency of the process have also been investigated.

  19. ICE MINERALOGY ACROSS AND INTO THE SURFACES OF PLUTO, TRITON, AND ERIS

    International Nuclear Information System (INIS)

    Tegler, S. C.; Grundy, W. M.; Olkin, C. B.; Young, L. A.; Romanishin, W.; Cornelison, D. M.; Khodadadkouchaki, R.

    2012-01-01

    We present three near-infrared spectra of Pluto taken with the Infrared Telescope Facility and SpeX, an optical spectrum of Triton taken with the MMT and the Red Channel Spectrograph, and previously published spectra of Pluto, Triton, and Eris. We combine these observations with a two-phase Hapke model and gain insight into the ice mineralogy on Pluto, Triton, and Eris. Specifically, we measure the methane-nitrogen mixing ratio across and into the surfaces of these icy dwarf planets. In addition, we present a laboratory experiment that demonstrates it is essential to model methane bands in spectra of icy dwarf planets with two methane phases—one highly diluted by nitrogen and the other rich in methane. For Pluto, we find bulk, hemisphere-averaged, methane abundances of 9.1% ± 0.5%, 7.1% ± 0.4%, and 8.2% ± 0.3% for sub-Earth longitudes of 10°, 125°, and 257°. Application of the Wilcoxon rank sum test to our measurements finds these small differences are statistically significant. For Triton, we find bulk, hemisphere-averaged, methane abundances of 5.0% ± 0.1% and 5.3% ± 0.4% for sub-Earth longitudes of 138° and 314°. Application of the Wilcoxon rank sum test to our measurements finds the differences are not statistically significant. For Eris, we find a bulk, hemisphere-averaged, methane abundance of 10% ± 2%. Pluto, Triton, and Eris do not exhibit a trend in methane-nitrogen mixing ratio with depth into their surfaces over the few centimeter range probed by these observations. This result is contrary to the expectation that since visible light penetrates deeper into a nitrogen-rich surface than the depths from which thermal emission emerges, net radiative heating at depth would drive preferential sublimation of nitrogen leading to an increase in the methane abundance with depth.

  20. Protective effect of Tritone (Livosone) on oxidative DNA damage and its hepatoprotective potential against various hepatotoxic agent in wistar rats.

    Science.gov (United States)

    Medhekar, Sheetal Kashinath; Jadhav, Tejas Pandurang; Sasane, Vishal Sadashiv; Shende, Vikas Suresh; Aloorkar, Nagesh Hanmantrao; Chincholkar, Anjali Baburao; Soman, Girish Sudhakar; Kulkarni, Ajit Shankarrao

    2017-03-02

    To evaluate antioxidant activity, DNA damage inhibition and hepatoprotecitve potential of polyherbal formulation Tritone (Livosone). In vitro antioxidant activity of Tritone formulation was performed by using DPPH assay. Hepatoprotecitve potential of Tritone was evaluated against various hepatotoxic agents including Paracetamol (2g/kg b. wt p.o. single dose on 15th day), Galactosamine (400mg/kg b. wt. i.p. single dose on 8th day) and Alcohol (30% p.o.1ml/100g of rat for 15days). Tritone formulation at the doses of (40.5, 81 and 162mg/kg) and standard silymarin (100mg/kg) and Liv52 (270mg/kg) were administered p.o. The hepatoprotective assessment was done by estimating biochemical parameters: SGOT, SGPT, ALP and Total Bilirubin total protein and ChE levels. Additionally histopathological and DNA fragmentation study of Tritone was also performed. Administration of hepatotoxins (paracetamol, D-GaiN and alcohol) in experimental animals showed significant biochemical, histological deterioration and DNA fragmentation. Pretreatment with Tritone (Livosone) shows significant reduction in serum SGOT, SGPT, ALP and total bilirubin levels and shows significant elevation in total protein and cholinesterase (ChE) levels compared to groups treated with hepatotoxic agents. Histopathological observations of rat liver pretreated with Tritone (Livosone) shows significant protection against hepatic damage. Inhibition of DNA fragmentation by Tritone indicates protective effect of formulation on liver at molecular level. Finally all the results were compared with standard drugs Silymarin and Liv52. Correlation of antioxidant activity, biochemical results, histopathological changes and inhibition of DNA damage after treatment with Tritone shows maximum hepatoprotective potential at dose 81mg/kg and 162mg/kg. Copyright © 2016 Elsevier GmbH. All rights reserved.

  1. Triton X-100 inhibits agonist-induced currents and suppresses benzodiazepine modulation of GABA(A) receptors in Xenopus oocytes

    DEFF Research Database (Denmark)

    Søgaard, Rikke; Ebert, Bjarke; Klaerke, Dan

    2009-01-01

    Changes in lipid bilayer elastic properties have been proposed to underlie the modulation of voltage-gated Na(+) and L-type Ca(2+) channels and GABA(A) receptors by amphiphiles. The amphiphile Triton X-100 increases the elasticity of lipid bilayers at micromolar concentrations, assessed from its...... effects on gramicidin channel A appearance rate and lifetime in artificial lipid bilayers. In the present study, the pharmacological action of Triton-X 100 on GABA(A) receptors expressed in Xenopus laevis oocytes was examined. Triton-X 100 inhibited GABA(A) alpha(1)beta(3)gamma(2S) receptor currents...... in a noncompetitive, time- and voltage-dependent manner and increased the apparent rate and extent of desensitization at 10 muM, which is 30 fold below the critical micelle concentration. In addition, Triton X-100 induced picrotoxin-sensitive GABA(A) receptor currents and suppressed allosteric modulation...

  2. Adsorption of triton X100 and potassium hydrogen phthalate on granular activated carbon from date pits

    Energy Technology Data Exchange (ETDEWEB)

    Merzougui, Z.; Nedjah, S.; Azoudj, Y.; Addoun, F. [Laboratoire d' etude physic-chimique des materiaux et application a l' environnement, Faculte de Chimie, USTHB (Algeria)], E-mail: zmerzougi@yahoo.fr

    2011-07-01

    Activated carbons, thanks to their versatility, are being used in the water treatment sector to absorb pollutants. Several factors influence the adsorption capacity of activated carbon and the aim of this study was to assess the effects of the porous texture and chemical nature of activated carbons on the adsorption of triton X100 and potassium hydrogen phthalate. Activated carbons used in this study were prepared from date pits with ZnCl2, KOH and H3PO4 by carbonization without adjuvant and adsorption of triton X100 and potassium hydrogen phthalate was conducted at 298K. Results showed that activated carbons prepared from date pits have a great potential for removing organic and inorganic pollutants from water and that the adsorption potential depends on the degree of activation of the activated carbons and on the compounds to absorb. This study highlighted that an increase of the carbon surface area and porosity results in a better adsorption capacity.

  3. Synthesis and characterization of novel N-substituted poly aniline by Triton X-100

    International Nuclear Information System (INIS)

    Arsalani, N.; Khavei, M.; Entezami, A. A.

    2003-01-01

    A new N-substituted poly aniline is synthesized by insertion of polyether chain in the form of Triton X-100 onto the poly aniline backbone. In the preparation method, firstly the emeraldine base poly aniline was reacted with Na H to produce the N-anionic doped poly aniline and then contacted with chlorinated Triton X-100. The prepared N-substituted poly aniline was characterized by UV-vis, FTIR, 1 H NMR spectroscopy techniques and elemental analysis. The physical properties of synthesized polymer such as electrical conductivity, thermal and electro activity properties were also studied. The prepared polymer has good solubility in common organic solvents such as T HF and chloroform

  4. Positronium reactions in the Triton X-100-p-nitro phenol system

    International Nuclear Information System (INIS)

    Kumar Das, S.; Nandi Ganguly, B.

    1997-01-01

    The positronium reactions have been used as a probe to study the solubilization of p-nitro phenol within the micellar phase of a Triton X-100 solution and the corresponding changes in the molecular association phenomenon. The presence of p-nitro phenol resulted in an enhancement of micellization which has been corroborated by surface tension measurements. This paper also lays emphasis on the secondary aggregation phenomenon of Triton X-100 molecules at the far post-micellar stage (∼ 10-15 mM). The solubilization of p-nitro phenol at various stages of aggregation has been discussed through the interaction with positronium atoms by setting up a kinetic model and reaction equilibria. (author)

  5. Radiolytic syntheses of hollow UO2 nanospheres in Triton X-100-based lyotropic liquid crystals

    International Nuclear Information System (INIS)

    Wang, Yongming; Chen, Qingde; Shen, Xinghai

    2017-01-01

    Hollow nanospheres (φ: 60-80 nm, wall thickness: 10-20 nm), consisted of UO 2 nanoparticles (φ: 3-5 nm), were successfully prepared in a Triton X-100-water (50:50, w/w) hexagonal lyotropic liquid crystal (LLC) by γ-irradiation, where water soluble ammonium uranyl tricarbonate was added as precursor. The product was stable at least up to 300 C. Furthermore, whether the nanospheres were hollow or not, and the wall thickness of the hollow nanospheres could be easily controlled via adjusting dose rate. While in the Triton X-100 based micellar systems, only solid nanospheres were obtained. At last, a possible combination mechanism containing adsorption, aggregation and fracturing processes was proposed.

  6. Tritons and tritides as the solute and diffusing species in ceramic tritium breeders

    International Nuclear Information System (INIS)

    Fischer, A.K.; Johnson, C.E.

    1987-01-01

    Intragranular diffusion of tritium is an inherent participant in the process of releasing tritium from lithium-containing ceramics that are used to breed tritium in a fusion reactor. The nature of this transport is reviewed in terms of the understanding established for the mechanism of hydrogen migration in other oxides, namely, that the diffusing species is the proton and that it moves from oxide ion to oxide ion, thereby giving rise to apparent hydroxide migration. Analogously, the triton, transiently bonded to successive oxides and forming successive tritoxides, is taken to be the dominant migrating species in ceramic breeders. In addition, tritide becomes a significant participant at low oxygen activity. The relationship of tritons and tritides as the migrating species to the observed release of both reduced and oxidized forms can be understood in terms of the thermodynamic conditions that prevail. Mechanisms exist that can be proposed to rationalize the participation of these species

  7. Present state and chemical evolution of the atmospheres of Titan, Triton, and Pluto

    International Nuclear Information System (INIS)

    Lunine, J.I.; Atreya, S.K.; Pollack, J.B.

    1989-01-01

    An evaluation is made of the current understanding of the atmospheres of Titan, Triton, and Pluto, as well as of theoretical models for their origin and evolution. All three atmospheres contain methane, while Titan, and probably Triton, have nitrogen. The primary driver in the evolution of the Titan atmosphere has been the irreversible photolysis of methane. If a surface reservoir of liquid methane exists to resupply the atmosphere, it is subject to enrichment in ethane due to the long-term photolysis of methane. The key issue in the origin and early evolution of Titan's atmosphere is the source of molecular nitrogen; two schemes for the conversion of ammonia to nitrogen have been considered

  8. Delivery of Optical Contrast Agents using Triton-X100, Part 1: Reversible permeabilization of live cells for intracellular labeling

    OpenAIRE

    van de Ven, Anne L; Adler-Storthz, Karen; Richards-Kortum, Rebecca

    2009-01-01

    Effective delivery of optical contrast agents into live cells remains a significant challenge. We sought to determine whether Triton-X100, a detergent commonly used for membrane isolation and protein purification, could be used to effectively and reversibly permeabilize live cells for delivery of targeted optical contrast agents. Although Triton-X100 is widely recognized as a good cell permeabilization agent, no systematic study has evaluated the efficiency, reproducibility, and reversibility...

  9. Solid methane on Triton and Pluto - 3- to 4-micron spectrophotometry

    Science.gov (United States)

    Spencer, John R.; Buie, Marc W.; Bjoraker, Gordon L.

    1990-01-01

    Methane has been identified in the Pluto/Charon system on the basis of absorption features in the reflectance spectrum at 1.5 and 2.3 microns; attention is presently given to observations of a 3.25 micron-centered deep absorption feature in Triton and Pluto/Charon system reflectance spectra. This absorption may indicate the presence of solid methane, constituting either the dominant surface species or a mixture with a highly transparent substance, such as N2 frost.

  10. A rare case of retroperitoneal malignant triton tumor invading renal vein and small intestine

    Directory of Open Access Journals (Sweden)

    Mijović Žaklina

    2013-01-01

    Full Text Available Introduction. Malignant Triton tumor is a very rare malignant peripheral nerve sheath tumor with rhabdomyosarcomatous differentiation. Most of those tumors occur in patients with von Recklinghausen’s disease or as a late complication of irradiation and commonly seen in the head, neck, extremities and trunk. Case report. We reported retroperitoneal malignant Triton tumor in a 57-year-old female patient. Skin lesions were not present, and there was no family history of neurofibromatosis or previous irradiation. The presented case is one of a few recorded in the specialized literature that occurs in the retroperitoneal space in sporadic form. In this case, tumor consisted of a multilobular mass was in close relation with the abdominal aorta and inferior vena cava and involved the renal vein with gross invasion of the small intestine. The patient underwent total resection of the tumor and left nefrectomy was performed. The small intestine 10 cm in length was also resected and end-to-end anastomosis was conducted. The postoperative course was uneventful and the patient was discharged from the hospital ten days after the surgery. Conclusion. Diagnostically, it is crucial to recognize this uncommon histological variant because malignant Triton tumor has a worse prognosis than classic malignant peripheral nerve sheath tumor does. The use of the immunohistochemistry is essential in making the correct diagnosis. Only appropriate pathological evaluation supported by immunostaining with S-100 protein and desmin confirmed the diagnosis. Aggressive surgical management treatment improves the prognosis of such cases with adjuvant radiotherapy.

  11. Spectral-motion aftereffects and the tritone paradox among Canadian subjects.

    Science.gov (United States)

    Dawe, L A; Platt, J R; Welsh, E

    1998-02-01

    The effect of spectral motion on the tritone paradox was investigated by pretesting subjects residing in southwestern Ontario, Canada, on the tritone task, presenting them with a continuous ascending or descending chromatic scale created using Shepard tones, and then retesting them on the tritone task. Results indicated a negative-motion aftereffect that affected the orientation of the pitch class circle. Differential effects of perceived pitch height on the lower portion of the pitch class circle and of adaptation on the upper portion of the pitch class circle were found in the pre- and postadaptation data, respectively. The implications of this dissociation are discussed. In addition, since our subjects lived relatively close to the U.S. border, the experimental pretests allowed us to examine the hypothesis that a canonical American pitch template similar to that found among "Californian" subjects (Deutsch, 1991) is propagated by linguistic influences of media such as television and radio (Ragozzine & Deutsch, 1994). A survey of our subjects indicated that overall, the majority of time engaged in listening to the radio and watching television or movies was spent with American sources. Despite this, and despite the fact that subjects had widely varying language and cultural backgrounds, a tight distribution of peak-pitch classes was found that is indicative of a "British" pitch template (Deutsch, 1991) for every subject tested.

  12. Hypolipidemic action of chrysin on Triton WR-1339-induced hyperlipidemia in female C57BL/6 mice

    Directory of Open Access Journals (Sweden)

    Micheli Stéfani Zarzecki

    2014-01-01

    Full Text Available Chrysin (5,7-dihydroxyflavone is a flavonoid, natural component of traditional medicinal herbs, present in honey, propolis and many plant extracts. The objective of this study was to investigate the hypolipidemic properties of chrysin on Triton WR-1339-induced hyperlipidemia in female C57BL/6 mice. Triton WR-1339 was administered intraperitoneally (400 mg/kg to overnight-fasted mice to develop acute hyperlipidemia. Chrysin was administered orally (10 mg/kg 30 min before Triton WR-1339. At 24 h after Triton WR-1339 injection, blood samples were collected to measure plasma lipid levels. The hepatic thiobarbituric acid reactive substances (TBARS, carbonyl content, non-protein sulfhydryl (NPSH and ascorbic acid (AA levels, as well as catalase (CAT and superoxide dismutase (SOD activity were recorded. Chrysin administration significantly decreased total cholesterol levels. In addition, it partially decreased non-high density lipoprotein-cholesterol and triglycerides levels in plasma of hyperlipidaemic mice. In addition chrysin administration prevented the increase on TBARS levels and prevented the decrease in SOD activity induced by Triton WR-1339. These findings indicated that chrysin was able to decrease plasma lipids concentration and that its antioxidant properties was, at least in part, involved in the hypolipidaemic action of chrysin.

  13. Origin and Evolution of Nitrogen on Titan, Enceladus, Triton, and Pluto

    Science.gov (United States)

    Atreya, S. K.; Niemann, H. B.; Mahaffy, P. R.; Owen, T. C.

    2007-01-01

    Nitrogen, together with carbon, hydrogen, oxygen, phosphorus and sulfur (CHNOPS), plays a central role in life as we know it. Indeed, molecular nitrogen is the most abundant component of the terrestrial atmosphere, and second only to carbon dioxide on Mars and Venus. The Voyager and Cassini-Huygens observations show that copious nitrogen is present on Titan also, comprising some 95% by volume of this moon's 1500 millibar atmosphere. After water vapor, it may be the most abundant (4%) of the gases around tiny Enceladus, as revealed by the recent Cassini observations. A thin nitrogen atmosphere is found even on the coldest of the solar system bodies, Triton and Pluto. The available evidence on nitrogen isotopes and the heavy noble gases suggests that Titan acquired its nitrogen largely in the form of ammonia. Subsequent chemical evolution, beginning with the photolysis of NH3 on primordial Titan, led to the nitrogen atmosphere we see on Titan today. This is also the scenario for the origin of nitrogen on the terrestrial planets. Contrary to Titan, the colder outer solar system objects, Triton and Pluto, neither had the luxury of receiving much arnmonia in the first place, nor of photolyzing whatever little ammonia they did receive in the planetesimals that formed them. On the other hand, it is plausible the planetesimals were capable of trapping and delivering molecular nitrogen directly to Triton and Pluto, unlike Titan. The origin of nitrogen on Enceladus is somewhat enigmatic. A scenario similar to Titan's, but with a role for the interior processes, may be at work. In this paper, we will discuss the source and loss of nitrogen for the above objects, and why Ganymede, the largest moon in the solar system, is nitrogen starved.

  14. Dengue virus inactivation by minipool TnBP/Triton X-45 treatment of plasma and cryoprecipitate.

    Science.gov (United States)

    Burnouf, T; Chou, M-L; Cheng, L-H; Li, Z-R; Wu, Y-W; El-Ekiaby, M; Tsai, K-H

    2013-01-01

    A minipool solvent/detergent (S/D; 1% TnBP/1% Triton X-45; 31°C) process was developed for viral inactivation of plasma and cryoprecipitate used for transfusion. The goal of this study was to determine the rate and extent of inactivation of dengue virus (DENV) during this process. DENV-1 was propagated using C6/36 mosquito cells to an infectivity titre close to 9 log and spiked (10% v/v) into individual plasma and cryoprecipitate samples from two distinct donors. Samples were taken right after spiking and during viral inactivation treatment by 1% TnBP-1% Triton X-45 at 31°C. DENV-1 infectivity was assessed on Vero E6 cells by a focus-forming assay (FFA). Culture medium and complement-inactivated plasma were used as experimental controls. Experiments were done in duplicate. DENV-1 infectivity was 7·5 log in spiked plasma and 7·1 and 7·3 log in spiked cryoprecipitate. There was no loss of DENV-1 infectivity in the spiked materials, nor in the controls not subjected to S/D treatment. No infectivity was found in plasma and cryoprecipitate subjected to S/D treatment at the first time-point evaluated (10 min). DENV-1 was strongly inactivated in plasma and cryoprecipitate, respectively, within 10 min of 1% TnBP/1% Triton X-45 treatment at 31°C. These data provide a reassurance of the safety of such S/D-treated plasma and cryoprecipitate with regard to the risk of transmission of all DENV serotypes and other flaviviruses. © 2012 The Author(s). Vox Sanguinis © 2012 International Society of Blood Transfusion.

  15. TRITON vs POLARIS. Comparison Between Two Modules for LWRs Modelling in SCALE 6.2

    Energy Technology Data Exchange (ETDEWEB)

    Labarile, A.; Barrachina, T.; Miró, R.; Verdú, G.

    2015-07-01

    -One of them challenges more important in the research of reactors nuclear is the development of codes of best estimate that allow decrease them uncertainties of them calculations increasing the reliability of the results. You will also need sensitivity and uncertainty analysis and validation of the implemented code. This work offers a comparison of two modules of SCALE-6.2 for the case of a reactor's water to pressure (PWR). Based is in data from plant of the reactor Three thousands Island-1 is has calculated the keff and the cross sections effective with two modules in two dimensions (2-D) of the program SCALE: TRITON and POLARIS. TRITON is a module already validated for the calculation of the transport as POLARIS is located in distribution from end of the 2014. The objective is to compare the results of keff and cross sections of two simulations, and carry out a sensitivity analysis and uncertainty of the results. In TRITON and POLARIS calculations have been made to fuel elements of the PWR Three thousand Island-1, in two different configurations (with and without control rods), condition of stop in hot (HZP) and condition of full power (HFP). The results are presented in this work. A good correlation between the results of two simulations has found and, in addition, POLARIS module has presented less computational time and good stability in the parameters. After having compared the results obtained, a sensitivity analysis has been carried out to confirm the validation of two modules and study the influence of uncertainties in the calculation of the fuel element. (Author)

  16. Retroperitoneal "triton" tumor. Report of a case and review of literature

    Directory of Open Access Journals (Sweden)

    Palacios Acosta José Martín

    2014-07-01

    Full Text Available The triton tumor was described in 1932 by Masson, as a peripheral nerve sheath malignancy with rabdomioblástica differentiation. The retroperitoneal location is extremely rare, only nine cases have been reported in children. The clinical picture depends on the size of the tumor and the organs involved, their retroperitoneal location is usually asymptomatic. The mainstay of treatment is the surgical excision of the tumor. We report the case of a child with retroperitoneal location of the tumor. A complete resection of it was performed. The patient had an uneventful postoperative course. He is currently under control. There is no evidence of relapse.

  17. Diagnosis of spontaneous bacterial peritonitis: Role of tween 80 and triton X in ascitic fluid cultures

    Directory of Open Access Journals (Sweden)

    Iyer R

    2009-01-01

    Full Text Available A patient with alcoholic cirrhosis of the liver, portal hypertension with hepatic encephalopathy and spontaneous bacterial peritonitis (SBP was admitted in an obtunded condition. Attempts at delineating the aetiology of the SBP using conventional cultures as well as automated systems were not successful. The use of non-anionic surfactant agents such as Tween 80-incorporated blood agar and Triton X treatment of the specimens facilitated the growth of Klebsiella pneumoniae from the ascitic fluid, which otherwise would have been concluded to represent culture-negative neutrocytic ascites. Thus, the use of the aforementioned agents could be explored in elucidating the aetiology of body cavity infections when conventional methods fail.

  18. Kinetics of solubilization with Triton X-100 of egg-yolk lecithin bilayers containing cholesterol

    OpenAIRE

    Hobai, Stefan

    2001-01-01

    The titration solubilization of multilamellar egg-yolk lecithin liposomes (MLV-EYL) with Triton X-100 was studied by rectangular optical diffusimetric measurements as a function of cholesterol (Chol) concentration. It was determinated the variation of optic percentage diffu-sion (per mmol surfactant), DDif%/mmol TX-100, in the course of solubilization of MLV-EYL-Chol system with TX-100 10mM. The statistical analysis of the titration curves can reveal the contribution of cholesterol to the sta...

  19. Triton X-114 cloud point extraction to subfractionate blood plasma proteins for two-dimensional gel electrophoresis

    DEFF Research Database (Denmark)

    Jessen, Flemming; Wulff, Tune

    2015-01-01

    A simple and reproducible procedure for enrichment of a plasma protein subfraction suitable for two-dimensional polyacrylamide gel electrophoresis (2DE) was developed, using a Triton X-114-based cloud point extraction (CPE). Appropriate conditions for such a CPE procedure were found by SDS......-PAGE to be a plasma protein concentration of about 10mg/ml in 3% (w/v) Triton X-114. 2DE of proteins obtained by CPE of 400μl of human plasma revealed about 200 spots constituting a spot pattern very different from the pattern of total plasma. The CPE procedure only had a limited contribution to the technical......-sterol acyltransferase, serum amyloid A, and serum paraoxonase/arylesterase 1, which are proteins of a hydrophobic nature, as in plasma they relate to lipoprotein particles. Thus, Triton X-114-based CPE is a simple plasma prefractionation tool, attractive for detailed 2DE studies of hydrophobic plasma proteins...

  20. Heat transfer in nucleate pool boiling of aqueous SDS and triton X-100 solutions

    Energy Technology Data Exchange (ETDEWEB)

    Wasekar, Vivek M. [Tata Steel Limited, Department of Research and Development, Jamshedpur (India)

    2009-09-15

    Variation in degree of surface wettability is presented through the application of Cooper's correlative approach (h{proportional_to}M{sup -0.5}q{sub w}''0.67) for computing enhancement ({phi}) in nucleate pool boiling of aqueous solutions of SDS and Triton X-100 and its presentation with Marangoni parameter ({chi}) that represents the dynamic convection effects due to surface tension gradients. Dynamic spreading coefficient defined as {sigma} {sub dyn}N{sub a}, which relates spreading and wetting characteristics with the active nucleation site density on the heated surface and bubble evolution process, represents cavity filling and activation process and eliminates the concentration dependence of nucleate pool boiling heat transfer in boiling of aqueous surfactant solutions. Using the dynamic spreading coefficient ({sigma}{sub dyn}N{sub a}=0.09q{sub w}''0.71), correlation predictions within {+-}15% for both SDS and triton X-100 solutions for low heat flux boiling condition (q{sub w}''{<=} 100 kW/m {sup 2}) characterised primarily by isolated bubble regime are presented. (orig.)

  1. Effect of the treatment with Euterpe oleracea Mart. oil in rats with Triton-induced dyslipidemia.

    Science.gov (United States)

    E Souza, Belmira S Faria; Carvalho, Helison O; Ferreira, Irlon M; da Cunha, Edilson L; Barros, Albenise Santana; Taglialegna, Talisson; Carvalho, José C T

    2017-06-01

    Dyslipidemias are defined as changes in lipid metabolism that have abnormal concentrations of lipids or lipoproteins in the bloodstream. Chronic increase in triglyceride and low-density lipoprotein (LDL-c) levels are known as risk factors for the atherogenesis process as well as other cardiovascular diseases (CVDs). The magnitude of the problems caused by dyslipidemias impels research by new agents that act in the prevention and control. Thus, products from the Amazonian biodiversity, such as Euterpe oleracea oil (OFEO), rich in unsaturated fatty acids (UFAs), constitutes a study source for the treatment of alterations in lipid metabolism. The present study aims to investigate the effect of OFEO treatment in rats with Triton-induced dyslipidemia (Tyloxapol WR1339). The physicochemical and chromatographic results confirmed the chemical composition of OFEO with a predominance of UFAs (67.83%), with Oleic acid being the majority (54.32%). At Triton-induced dyslipidemia, the animals treated with OFEO and Simvastatin showed a significant reduction in total cholesterol levels, with values ​​of 121.7±29.5 (pdyslipidemia, acting as antihypercholesterolemic and antihypertriglyceridemic, thus possibly contributing as a preventive agent for CVDs. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  2. Evaluation of hypolipidemic Marrubium vulgare effect in Triton WR-1339-induced hyperlipidemia in mice.

    Science.gov (United States)

    Ibrahim, Abeer Y; Hendawy, Saber F; Elsayed, Ahmed A A; Omer, Elsayed A

    2016-05-01

    To evaluate the hypocholesterolemic and hypotriglyceridemic activities of four Marrbium vulgare herb extracts using Triton WR-1339-induced hyperlipidemia in mice. Hyperlipidemia was developed by intraperitoneal injection of Triton (200 mg/kg body weight). The animals were divided into main four groups of eight mice each: normal control group, hyperlipidemic control group, hyperlipidemic plus tween-40 control and treated group. The fourth one was divided into four subgroups, petroleum ether extract group, chloroform extract group, ethyl acetate extract group and methanol extract treated group each of them contains two sub-sub group for treating animals with two doses at 0.1 and 0.25 LD50. After 7 h and 24 h of treatment, the intragastric administration of all extracts caused a significant decrease of plasma total cholesterol. Triglyceride levels were also significantly lowered by all extracts while petroleum ether produced the lowest decreasing level. Similar results were observed for LDL-cholesterol concentrations. Furthermore, more polar extracts (methanol and ethyl acetate)-soluble fractions showed a significant ameliorative action on elevated atherogenic index (AI) and LDL/HDL-C ratios, while these atherogenic markers were not statistically suppressed by the chloroform and petroleum ether-soluble extract. The findings indicated that Marrubium may contain polar products able to lower plasma lipid concentrations and might be beneficial in treatment of hyperlipidemia and atherosclerosis. Copyright © 2016 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.

  3. Time-resolved triton burnup measurement using the scintillating fiber detector in the Large Helical Device

    Science.gov (United States)

    Ogawa, K.; Isobe, M.; Nishitani, T.; Murakami, S.; Seki, R.; Nakata, M.; Takada, E.; Kawase, H.; Pu, N.; LHD Experiment Group

    2018-03-01

    Time-resolved measurement of triton burnup is performed with a scintillating fiber detector system in the deuterium operation of the large helical device. The scintillating fiber detector system is composed of the detector head consisting of 109 scintillating fibers having a diameter of 1 mm and a length of 100 mm embedded in the aluminum substrate, the magnetic registrant photomultiplier tube, and the data acquisition system equipped with 1 GHz sampling rate analogies to digital converter and the field programmable gate array. The discrimination level of 150 mV was set to extract the pulse signal induced by 14 MeV neutrons according to the pulse height spectra obtained in the experiment. The decay time of 14 MeV neutron emission rate after neutral beam is turned off measured by the scintillating fiber detector. The decay time is consistent with the decay time of total neutron emission rate corresponding to the 14 MeV neutrons measured by the neutron flux monitor as expected. Evaluation of the diffusion coefficient is conducted using a simple classical slowing-down model FBURN code. It is found that the diffusion coefficient of triton is evaluated to be less than 0.2 m2 s-1.

  4. Bioavailability of hydrocarbons to bacterial consortia during Triton X-100 mediated biodegradation in aqueous media.

    Science.gov (United States)

    Pęziak, Daria; Piotrowska, Aleksandra; Marecik, Roman; Lisiecki, Piotr; Woźniak, Marta; Szulc, Alicja; Ławniczak, Łukasz; Chrzanowski, Łukasz

    2013-01-01

    The aim of our study was to investigate the effect of Triton X-100 on the biodegradation efficiency of hexadecane and phenanthrene carried out by two bacterial consortia. It was established that the tested consortia were not able to directly uptake compounds closed in micelles. It was observed that in micellar systems the nonionic synthetic surfactant was preferentially degraded (the degradation efficiency of Triton X-100 after 21 days was 70% of the initial concentration - 500 mg/l), followed by a lesser decomposition of hydrocarbon released from the micelles (30% for hexadecane and 20% for phenanthrene). However, when hydrocarbons were used as the sole carbon source, 70% of hexadecane and 30% of phenanthrene were degraded. The degradation of the surfactant did not contribute to notable shifts in bacterial community dynamics, as determined by Real-Time PCR. The obtained results suggest that if surfactant-supplementation is to be used as an integral part of a bioremediation process, then possible bioavailability decrease due to entrapment of the contaminant into surfactant micelles should also be taken into consideration, as this phenomenon may have a negative impact on the biodegradation efficiency. Surfactant-induced mobilization of otherwise recalcitrant hydrocarbons may contribute to the spreading of contaminants in the environment and prevent their biodegradation.

  5. Interactions between selected bile salts and Triton X-100 or sodium lauryl ether sulfate

    Directory of Open Access Journals (Sweden)

    Ćirin Dejan M

    2011-12-01

    Full Text Available Abstract Background In order to develop colloidal drug carriers with desired properties, it is important to determine physico-chemical characteristics of these systems. Bile salt mixed micelles are extensively studied as novel drug delivery systems. The objective of the present investigation is to develop and characterize mixed micelles of nonionic (Triton X-100 or anionic (sodium lauryl ether sulfate surfactant having oxyethylene groups in the polar head and following bile salts: cholate, deoxycholate and 7-oxodeoxycholate. Results The micellization behaviour of binary anionic-nonionic and anionic-anionic surfactant mixtures was investigated by conductivity and surface tension measurements. The results of the study have been analyzed using Clint's, Rubingh's, and Motomura's theories for mixed binary systems. The negative values of the interaction parameter indicate synergism between micelle building units. It was noticed that Triton X-100 and sodium lauryl ether sulfate generate the weakest synergistic interactions with sodium deoxycholate, while 7-oxodeoxycholate creates the strongest attractive interaction with investigated co-surfactants. Conclusion It was concluded that increased synergistic interactions can be attributed to the larger number of hydrophilic groups at α side of the bile salts. Additionally, 7-oxo group of 7-oxodeoxycholate enhance attractive interactions with selected co-surfactants more than 7-hydroxyl group of sodium cholate.

  6. SCALE Continuous-Energy Monte Carlo Depletion with Parallel KENO in TRITON

    International Nuclear Information System (INIS)

    Goluoglu, Sedat; Bekar, Kursat B.; Wiarda, Dorothea

    2012-01-01

    The TRITON sequence of the SCALE code system is a powerful and robust tool for performing multigroup (MG) reactor physics analysis using either the 2-D deterministic solver NEWT or the 3-D Monte Carlo transport code KENO. However, as with all MG codes, the accuracy of the results depends on the accuracy of the MG cross sections that are generated and/or used. While SCALE resonance self-shielding modules provide rigorous resonance self-shielding, they are based on 1-D models and therefore 2-D or 3-D effects such as heterogeneity of the lattice structures may render final MG cross sections inaccurate. Another potential drawback to MG Monte Carlo depletion is the need to perform resonance self-shielding calculations at each depletion step for each fuel segment that is being depleted. The CPU time and memory required for self-shielding calculations can often eclipse the resources needed for the Monte Carlo transport. This summary presents the results of the new continuous-energy (CE) calculation mode in TRITON. With the new capability, accurate reactor physics analyses can be performed for all types of systems using the SCALE Monte Carlo code KENO as the CE transport solver. In addition, transport calculations can be performed in parallel mode on multiple processors.

  7. Crude soybean hull peroxidase treatment of phenol in synthetic and real wastewater: enzyme economy enhanced by Triton X-100.

    Science.gov (United States)

    Steevensz, Aaron; Madur, Sneha; Feng, Wei; Taylor, Keith E; Bewtra, Jatinder K; Biswas, Nihar

    2014-02-05

    Soybean peroxidase (SBP)-catalyzed removal of phenol from wastewater has been demonstrated as a feasible wastewater treatment strategy and a non-ionic surfactant, Triton X-100, has the potential for increasing the enzyme economy of the process. Systematic studies on the enzyme-surfactant system have been lacking as well as demonstration of its applicability to industrial wastewater. This paper addresses those two gaps, the latter based on real wastewater from alkyd resin manufacture. The minimum effective Triton X-100 concentrations for crude SBP-catalyzed phenol conversion (≥95%) over 1-10 mM showed a linear trend. To illustrate translation of such lab results to real-world samples, this data were used to optimize crude SBP needed for phenol conversion over that concentration range. Triton X-100 increases enzyme economy by 10- to 13-fold. This treatment protocol was directly applied to tote-scale (700-1000 L) treatment of alkyd resin wastewater, with phenol ranging from 7 to 28 mM and total organic carbon content of >40 g/L, using a crude SBP extract derived from dry soybean hulls by simple aqueous elution. This extract can be used to remove phenol from a complex industrial wastewater and the process is markedly more efficient in the presence of Triton X-100. The water is thus rendered amenable to conventional biological treatment whilst the hulls could still be used in feed, thus adding further value to the crop. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Neuropeptides encoded within a neural transcriptome of the giant triton snail Charonia tritonis, a Crown-of-Thorns Starfish predator.

    Science.gov (United States)

    Bose, U; Suwansa-Ard, S; Maikaeo, L; Motti, C A; Hall, M R; Cummins, S F

    2017-12-01

    Neuropeptides represent a diverse class of signaling molecules originating from neural tissues. These chemical modulators orchestrate complex physiological events including those associated with growth and reproduction. De novo transcriptome sequencing of a cerebral ganglion library of the endangered giant triton snail (Charonia tritonis) was undertaken in an effort to identify key neuropeptides that control or influence its physiology. The giant triton snail is considered a primary predator of the corallivore Acanthaster planci (Crown-of-Thorns Starfish) that is responsible for a significant loss in coral cover on reefs in the Indo-Pacific. The transcriptome library was assembled into contigs, and then bioinformatic analysis was used to identify a repertoire of 38 giant triton snail neuropeptide precursor genes, and various isoforms, that encode conserved molluscan neuropeptides. C. tritonis neuropeptides show overall precursor organisation consistent with those of other molluscs. These include those neuropeptides associated with mollusc reproduction such as the APGWamide, buccalin, conopressin, gonadotropin-releasing hormone (GnRH), NKY and egg-laying hormone. These data provide a foundation for further studies targeted towards the functional characterisation of neuropeptides to further understand aspects of the biology of the giant triton snail, such as elucidating its reproductive neuroendocrine pathway to allow the development of knowledge based captive breeding programs. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Hypolipidemic effect and antioxidant activity of glycoprotein isolated from Ulmus davidiana Nakai in Triton WR-1339-treated mouse.

    Science.gov (United States)

    Ko, Jeong-Hyeon; Lee, Sei-Jung; Lim, Kye-Taek

    2007-01-01

    The glycoprotein isolated from Ulmus davidiana Nakai (UDN) (UDN glycoprotein) has a molecular weight of 116 kDa and consists of 78.65% carbohydrate content and 21.35% protein content. In the present study, we investigated the hypolipidemic effect of UDN glycoprotein on Triton WR-1339-induced mice. With pretreatment with UDN glycoprotein, the triacylglycerol (TAG), total cholesterol and low density lipoprotein-cholesterol (LDL-C) concentrations were significantly reduced, whereas high density lipoprotein-cholesterol (HDL-C) concentration was increased in the plasma of Triton WR-1339-induced mice. With respect to antioxidative activity, UDN glycoprotein significantly decreased the level of thiobarbituric acid reactive substances (TBARS) and improved activities of catalase and glutathione peroxidase (GPx), without an apparent change of superoxide dismutase (SOD) activity. Also UDN glycoprotein significantly increased nitric oxide (NO) production in Triton WR-1339-induced mice. These results indicate that UDN glycoprotein has a hypolipidemic effect, possesses antioxidant activity and has an ability to stimulate NO production. Thus, we speculate that UDN glycoprotein is an example of natural compound that lowers plasma lipid level together with having an antioxidant function in Triton WR-1339-induced mice.

  10. Determination of the ratio of axial-vector-to-vector weak coupling constants for beta decay of triton

    CERN Document Server

    Akulov, Y A

    2002-01-01

    Data on the chemical shifts of half-lives for atomic and molecular tritium were used to determine the ratio of axial-vector-to-vector weak coupling constants for beta decay of triton (G sub A /G sub V) sub t = -1.2646 +- 0.0035

  11. Polypyrrole nanoparticles fabricated via Triton X-100 micelles template approach and their acetone gas sensing property

    Energy Technology Data Exchange (ETDEWEB)

    Li, Fake; Li, Hang [Department of Clinical Laboratory Medcine, Research Institute of Surgery, Daping Hospital, Third Military Medical University, Chongqing 400042 (China); Jiang, Hongmin [26th Research Institute, Chinese Electronics Scientific and Technical Group Company, Chongqing 400060 (China); Zhang, Kejun; Chang, Kai; Jia, Shuangrong; Jiang, Wenbin; Shang, Ya; Lu, Weiping [Department of Clinical Laboratory Medcine, Research Institute of Surgery, Daping Hospital, Third Military Medical University, Chongqing 400042 (China); Deng, Shaoli, E-mail: dengsl072@yahoo.com.cn [Department of Clinical Laboratory Medcine, Research Institute of Surgery, Daping Hospital, Third Military Medical University, Chongqing 400042 (China); Chen, Ming, E-mail: chenming1971@yahoo.com [Department of Clinical Laboratory Medcine, Research Institute of Surgery, Daping Hospital, Third Military Medical University, Chongqing 400042 (China)

    2013-09-01

    Nano-scaled polypyrrole (PPy) particles have been successfully synthesized with the help of Triton X-100 micelles via soft template approach. The polypyrrole nanoparticles have been spin-coated on surface acoustic wave (SAW) transducers to demonstrate their sensing capability toward acetone gas exposure. Field Emission Scanning Electron Microscopes (FE-SEM) and Fourier transform infrared (FT-IR) spectroscopy have been utilized to characterize these PPy nanoparticles. The PPy nanoparticles have an average diameter of 95 nm. The responses of the sensors are linearly associated with the acetone concentrations in the range from 5.5 ppm to 80 ppm. In response to 5.5 ppm acetone exposure, the response and recovery time are 9 s and 8.3 s, respectively. SAW sensors coated with PPy nanoparticles were potentially useful to detect acetone.

  12. Polypyrrole nanoparticles fabricated via Triton X-100 micelles template approach and their acetone gas sensing property

    International Nuclear Information System (INIS)

    Li, Fake; Li, Hang; Jiang, Hongmin; Zhang, Kejun; Chang, Kai; Jia, Shuangrong; Jiang, Wenbin; Shang, Ya; Lu, Weiping; Deng, Shaoli; Chen, Ming

    2013-01-01

    Nano-scaled polypyrrole (PPy) particles have been successfully synthesized with the help of Triton X-100 micelles via soft template approach. The polypyrrole nanoparticles have been spin-coated on surface acoustic wave (SAW) transducers to demonstrate their sensing capability toward acetone gas exposure. Field Emission Scanning Electron Microscopes (FE-SEM) and Fourier transform infrared (FT-IR) spectroscopy have been utilized to characterize these PPy nanoparticles. The PPy nanoparticles have an average diameter of 95 nm. The responses of the sensors are linearly associated with the acetone concentrations in the range from 5.5 ppm to 80 ppm. In response to 5.5 ppm acetone exposure, the response and recovery time are 9 s and 8.3 s, respectively. SAW sensors coated with PPy nanoparticles were potentially useful to detect acetone.

  13. A comparison study of the 1MeV triton burn-up in JET using the HECTOR and SOCRATE codes

    International Nuclear Information System (INIS)

    Gorini, G.; Kovanen, M.A.

    1988-01-01

    The burn-up of the 1MeV tritons in deuterium plasmas has been measured in JET for various plasma conditions. To interpret these measurements the containment, slowing down and burn-up of fast tritons needs to be modelled with a reasonable accuracy. The numerical code SOCRATE has been written for this specific purpose and a second code, HECTOR, has been adapted to study the triton burn-up problem. In this paper we compare the results from the two codes in order to exclude possible errors in the numerical models, to assess their accuracy and to study the sensitivity of the calculation to various physical effects. (author)

  14. Pharmacological Screening ofTrachyspermum ammifor Antihyperlipidemic Activity in Triton X-100 Induced Hyperlipidemia Rat Model.

    Science.gov (United States)

    Saleem, Uzma; Riaz, Saba; Ahmad, Bashir; Saleem, Mohammad

    2017-12-01

    Mortality rate is increasing due to cardiovascular problems throughout the world. These cardiac problems are directly associated with dyslipidemia. The aim of this study was to evaluate the antihyperlipidemic effect of aqueous extract and methanol extract of Trachyspermum ammi at 1 g/kg, 3 g/kg, and 5 g/kg dose levels in rats. For this purpose, 45 male albino rats were used and randomly divided into nine equal groups ( n = 5). The lipid levels were increased after 24 h of single intraperitoneal injection of Triton X-100 (100 mg/kg) in rats. Aqueous and methanol extracts equivalent to 1 g/kg, 3 g/kg, and 5 g/kg were administered orally to the rats for 21 days. Atorvastatin (10 mg/kg) was used as standard drug. Blood samples were collected at 0, 2 nd , 9 th , 16 th , and 23 rd day by a direct cardiac puncture in Vacuette ® heparin tubes. Serum was separated and then analyzed for lipid profile, liver function test (LFT), and renal function test (RFT) using standard diagnostic kits. Results showed that extracts at 3 g/kg and 5 g/kg decreased the levels of total cholesterol, triglyceride, and low-density lipoprotein and increased high-density lipoprotein concentration in serum. T. ammi also decreased LFT and RFT parameters at the end of the study. T. ammi possessed antioxidant and antihyperlipidemic activities along with hepato- and nephro-protective effects. Aqueous and methanol extracts of T. ammi were administered orally at 1-, 3-, and 5 g/kg doses to hyperlipidemic rats (Triton X-100 induced hyperlipidemia) and atorvastatin (10 mg/kg, orally) was used as standard drug. Methanol extract at 5 g/kg showed antihyperlipidemic effect that is identical to that of standard drug. Abbreviations Used: LDL: Low-density lipoprotein; TC: Total cholesterol; VLDL: Very low-density lipoprotein; HDL: High-density lipoprotein; T. ammi : Trachyspermum ammi ; WHO: World Health Organization; CAD: Coronary artery disease; BHT: Butylated hydroxytoluene; BUN: Blood urea nitrogen; AST

  15. Pharmacological Screening of Trachyspermum ammi for Antihyperlipidemic Activity in Triton X-100 Induced Hyperlipidemia Rat Model

    Science.gov (United States)

    Saleem, Uzma; Riaz, Saba; Ahmad, Bashir; Saleem, Mohammad

    2017-01-01

    Background: Mortality rate is increasing due to cardiovascular problems throughout the world. These cardiac problems are directly associated with dyslipidemia. Aim: The aim of this study was to evaluate the antihyperlipidemic effect of aqueous extract and methanol extract of Trachyspermum ammi at 1 g/kg, 3 g/kg, and 5 g/kg dose levels in rats. Materials and Methods: For this purpose, 45 male albino rats were used and randomly divided into nine equal groups (n = 5). The lipid levels were increased after 24 h of single intraperitoneal injection of Triton X-100 (100 mg/kg) in rats. Aqueous and methanol extracts equivalent to 1 g/kg, 3 g/kg, and 5 g/kg were administered orally to the rats for 21 days. Atorvastatin (10 mg/kg) was used as standard drug. Blood samples were collected at 0, 2nd, 9th, 16th, and 23rd day by a direct cardiac puncture in Vacuette® heparin tubes. Serum was separated and then analyzed for lipid profile, liver function test (LFT), and renal function test (RFT) using standard diagnostic kits. Results: Results showed that extracts at 3 g/kg and 5 g/kg decreased the levels of total cholesterol, triglyceride, and low-density lipoprotein and increased high-density lipoprotein concentration in serum. T. ammi also decreased LFT and RFT parameters at the end of the study. Conclusion: T. ammi possessed antioxidant and antihyperlipidemic activities along with hepato- and nephro-protective effects. SUMMARY Aqueous and methanol extracts of T. ammi were administered orally at 1-, 3-, and 5 g/kg doses to hyperlipidemic rats (Triton X-100 induced hyperlipidemia) and atorvastatin (10 mg/kg, orally) was used as standard drug. Methanol extract at 5 g/kg showed antihyperlipidemic effect that is identical to that of standard drug. Abbreviations Used: LDL: Low-density lipoprotein; TC: Total cholesterol; VLDL: Very low-density lipoprotein; HDL: High-density lipoprotein; T. ammi: Trachyspermum ammi; WHO: World Health Organization; CAD: Coronary artery disease; BHT

  16. Methods for constraining surface properties and volatile migration on Phoebe, Triton, Pluto, and the moon

    Science.gov (United States)

    Miller, Charles Frederick

    The surface properties and surface volatile content of rocky bodies contain clues as to the formation and subsequent evolution of our Solar System. Many Solar System bodies retain essentially pristine subsurface volatiles, but their surface volatiles have often undergone chemical processing from UV irradiation and heating from impacts over millennia. The result is a wide range of surface properties observed today. We analyze the surfaces of these primitive bodies with the goal of deducing their evolutionary history. To this end, we employed three targeted analysis methods to characterize the surface properties and/or volatile distribution of three Solar System satellites. We derived photometric properties of Saturn's moon Phoebe from observations taken at low solar phase angles and corn-pared these results to those published for other Solar System objects. We conclude that Phoebe's surface has similarities to both Jupiter family comets and Kuiper Belt Objects (KBOs), supporting the conjecture that Phoebe migrated to Saturn the outer Solar System. We converted a General Circulation Model (GCM) to simulate the atmospheric motion of Neptune's moon Triton. We used this model to investigate the effect of N2 surface frosts on Triton's global atmospheric circulation. Our simulations identified specific atmospheric thermal conditions that led to wind speeds and directions consistent with the motion of erupting geysers captured by Voyager 2 images. Finally, we developed an 3-D n-body ballistic plume model to analyze the geometry and dynamics of the ejecta plume created by the impact of the Lunar CRater Observation and Sensing Satellite (LCROSS) on the Moon. LCROSS was designed to detect water content in lunar regolith, but also served as a test bed for comparing the properties of a large-scale, controlled impact with laboratory impact experiments. By comparing plume simulation results to our observations of the LCROSS impact, we confirmed the predictions that the LCROSS

  17. Description of WWER-440 fuel assembly 3D depletion model developed with TRITON6 code (SCALE 6.0)

    International Nuclear Information System (INIS)

    2014-07-01

    One of the key components strongly influencing the accuracy of burnup credit methodology is precision of spent nuclear fuel isotopic composition prediction. To enhance the accuracy of spent nuclear fuel isotopic composition prediction modeling 3D depletion model of WWER-440 nuclear fuel was developed by TRITON6. TRITON6 couples ORIGEN-S depletion code with 3D neutron transport solver KENO-VI. This kind of coupling allows updating the ORIGEN-S cross-section libraries by 3D problem-dependent neutron fluxes computed by KENO-VI hence significantly improving the accuracy of isotopic composition predications. WWER-440 fuel assembly destructive experimental results carried out by RIAR Dimitrovgrad are planned to be used for verification and validation of developed model. Therefore WWER-440 fuel assembly model was developed with taking into account peculiarities in destructive experimental results

  18. Radiolytic syntheses of hollow UO{sub 2} nanospheres in Triton X-100-based lyotropic liquid crystals

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yongming; Chen, Qingde; Shen, Xinghai [Peking Univ., Beijing (China). Fundamental Science on Radiochemistry and Radiation Chemistry Lab.

    2017-08-01

    Hollow nanospheres (φ: 60-80 nm, wall thickness: 10-20 nm), consisted of UO{sub 2} nanoparticles (φ: 3-5 nm), were successfully prepared in a Triton X-100-water (50:50, w/w) hexagonal lyotropic liquid crystal (LLC) by γ-irradiation, where water soluble ammonium uranyl tricarbonate was added as precursor. The product was stable at least up to 300 C. Furthermore, whether the nanospheres were hollow or not, and the wall thickness of the hollow nanospheres could be easily controlled via adjusting dose rate. While in the Triton X-100 based micellar systems, only solid nanospheres were obtained. At last, a possible combination mechanism containing adsorption, aggregation and fracturing processes was proposed.

  19. OSS (Outer Solar System): A fundamental and planetary physics mission to Neptune, Triton and the Kuiper Belt

    OpenAIRE

    Christophe, Bruno; Spilker, Linda J.; Anderson, John D.; André, Nicolas; Asmar, Sami W.; Aurnou, Jonathan; Banfield, Don; Barucci, Antonella; Bertolami, Orfeu; Bingham, Robert; Brown, Patrick; Cecconi, Baptiste; Courty, Jean-Michel; Dittus, Hansjörg; Fletcher, Leigh N.

    2011-01-01

    The present OSS mission continues a long and bright tradition by associating the communities of fundamental physics and planetary sciences in a single mission with ambitious goals in both domains. OSS is an M-class mission to explore the Neptune system almost half a century after flyby of the Voyager 2 spacecraft. Several discoveries were made by Voyager 2, including the Great Dark Spot (which has now disappeared) and Triton's geysers. Voyager 2 revealed the dynamics of Neptune's atmosphere a...

  20. Colorimetric detection of melamine in milk based on Triton X-100 modified gold nanoparticles and its paper-based application

    Science.gov (United States)

    Gao, Nan; Huang, Pengcheng; Wu, Fangying

    2018-03-01

    In this study, we have developed a method for rapid, highly efficient and selective detection of melamine. The negatively charged citrate ions form an electrostatic layer on gold nanoparticles (AuNPs) and keep the NPs dispersed and stable. When citrate-capped AuNPs were further modified with Triton X-100, it stabilized the AuNPs against the conditions of high ionic strength and a broad pH range. However, the addition of melamine caused the destabilization and aggregation of NPs. This may be attributed to the interaction between melamine and the AuNPs through the ligand exchange with citrate ions on the surface of AuNPs leading Triton X-100 to be removed. As a result, the AuNPs were unstable, resulting in the aggregation. The aggregation induced a wine red-to-blue color change, and a new absorption peak around 630 nm appeared. Triton X-100-AuNPs could selectively detect melamine at the concentration as low as 5.1 nM. This probe was successfully applied to detect melamine in milk. Furthermore, paper-based quantitative detection system using this colorimetric probe was also demonstrated by integrating with a smartphone.

  1. The role of Triton surfactant in anisotropic etching of {1 1 0} reflective planes on (1 0 0) silicon

    Science.gov (United States)

    Resnik, Drago; Vrtacnik, Danilo; Aljancic, Uros; Mozek, Matej; Amon, Slavko

    2005-06-01

    Etching characteristics and properties of {1 1 0} silicon crystal planes used as 45° optical mirrors for deflecting optical beams from/to optical fibers were investigated. Fiber aligning grooves and passive mirror-like planes were realized by wet micromachining of (1 0 0) silicon in KOH IPA and TMAH IPA systems. Implementation of Triton-x-100 surfactant as an additive to 25% TMAH in anisotropic etching of {1 1 0} silicon passive mirror planes is reported and discussed. It was found that Triton-x-100 contents in the range of 10 200 ppm to the 25% TMAH water etchant significantly increase the anisotropy mostly by decreasing the {1 1 0} etch rate and retaining the {1 0 0} etch rate. It is also shown that {1 1 0} surface roughness is substantially improved compared to two other etching systems. Furthermore, efficient convex corner underetching reduction is demonstrated. The results of optical characterization of passive mirrors with 632 nm incident light show reduced scattering of reflected optical beam due to improved microroughness for mirrors made by TMAH Triton. For the reflection of the optical beam with 1.33 µm and 1.54 µm wavelengths, sputtered layer of gold is used as reflective coating on silicon mirrors thus increasing the reflected optical beam intensity by an additional 8%.

  2. Large transient nonproton ion movements in purple membrane suspensions are abolished by solubilization in Triton X-100.

    Science.gov (United States)

    Marinetti, T; Mauzerall, D

    1986-09-01

    Light-induced release/uptake of both protons and other ions cause transient changes in conductivity in suspensions of purple membrane (PM) fragments (Marinetti, Tim, and David Mauzerall, 1983, Proc. Natl. Acad. Sci. USA, 80:178-180). We find that the release/uptake of nonproton ions with quantum yield greater than 1 is observed at most pHs and ionic strengths. Only at both low pH and low ionic strength is the conductivity transient mostly due to protons. Our hypothesis is that during the photocycle, changes occur in the PM's dense surface charge distribution that result in changes in the number of counterions bound or condensed at the membrane surface. To test this, the PM structure was perturbed with the nonionic detergent Triton X-100. Immediately after addition, Triton does not abolish the nonproton ion movements; in fact at low detergent concentrations (0.02% vol/vol) the signal amplitudes increased considerably. However, when PM is completely solubilized into monomers in Triton, the conductivity transients are due to protons alone, though at lower quantum yield compared with native PM. These results suggest that changes in the surface charge distribution in native PM's photocycle could contribute to proton transfer between the aqueous phase and bR itself.

  3. Characterization of the Recombinant Thermostable Lipase (Pf2001 from Pyrococcus furiosus: Effects of Thioredoxin Fusion Tag and Triton X-100

    Directory of Open Access Journals (Sweden)

    Sylvia Maria Campbell Alquéres

    2011-01-01

    Full Text Available In this work, the lipase from Pyrococcus furiosus encoded by ORF PF2001 was expressed with a fusion protein (thioredoxin in Escherichia coli. The purified enzymes with the thioredoxin tag (TRX−PF2001Δ60 and without the thioredoxin tag (PF2001Δ60 were characterized, and various influences of Triton X-100 were determined. The optimal temperature for both enzymes was 80°C. Although the thioredoxin presence did not influence the optimum temperature, the TRX−PF2001Δ60 presented specific activity twice lower than the enzyme PF2001Δ60. The enzyme PF2001Δ60 was assayed using MUF-acetate, MUF-heptanoate, and MUF-palmitate. MUF-heptanoate was the preferred substrate of this enzyme. The chelators EDTA and EGTA increased the enzyme activity by 97 and 70%, respectively. The surfactant Triton X-100 reduced the enzyme activity by 50% and lowered the optimum temperature to 60°C. However, the thermostability of the enzyme PF2001Δ60 was enhanced with Triton X-100.

  4. Triton, deuteron and proton responses of the CR-39 track detector

    Energy Technology Data Exchange (ETDEWEB)

    Yamauchi, Tomoya; Matsumoto, Hiroyoshi; Oda, Keiji [Kobe Univ. of Mercantile Marine (Japan)

    1996-07-01

    In the present study, we assessed the response of the CR-39 detector to proton, deuteron and triton from their etch-pit growth curves obtained by multi-step etching technique and the difference among their track registration properties was discussed. In order to avoid incorrect evaluation due to the missing track effect, particle irradiation was performed at various incident energies. The response function, S(R), etch rate ratio, S, as a function of the residual range, R, was experimentally evaluated for all hydrogen isotopes by this method. In the next, we obtained another form of response functions of S(E), S({beta}) and S(LET{sub 200}), which were presented as functions of the particle energy, E, the particle velocity, {beta}(=v/c), and the linear energy transfer in the case where the cut-off energy is 200 eV, LET{sub 200}, respectively. These information will be useful also in understanding the fundamentals of the latent track formation mechanism in the plastic track detectors. (J.P.N.)

  5. TRITON, 3-D Multi-Region Neutron Diffusion Burnup with Criticality Search

    International Nuclear Information System (INIS)

    1974-01-01

    1 - Nature of physical problem solved: TRITON is a multigroup diffusion depletion program in three dimensions (x,y,z). In addition to the straight K eff calculation, three types of criticality searches are possible - diluted control isotope search, region-wise smeared control isotope search, region-wise smeared control isotope search, region-wise smeared control isotope boundary search (the control isotope can be smeared over one region or over a group of regions called a control bank). The depletion equations are solved region-wise. More than one microscopic cross section library can be used in the various regions of the reactor. The same is true for self-shielding factors. Such sets of data can be changed at pre-determined time steps. 2 - Method of solution: The mathematical model employed for the solution of the finite difference equations, which is derived from a seven-point approximation of diffusion equations, is an on-line Chebyshev semi- iterative method. 3 - Restrictions on the complexity of the problem: Maximum number of: library sets: 1; self-shielding sets: 10; compositions: 100; self-shielding coefficients: 6000; groups: 10; fuel isotopes: 30; fission products: 29; isotopes: 50; burnable isotopes: 40; control banks: 100; mesh points: 15000; regions: 400; time steps: 100; control areas: 100; small time steps: 200; elements in the control list: 400; x planes: 100; y planes: 100; z planes: 100

  6. Dielectric properties of water in Triton X-100 (nonionic detergent)-water mixtures

    International Nuclear Information System (INIS)

    Asami, Koji

    2007-01-01

    Dielectric measurements were carried out for mixtures of Triton X-100 (TX, a nonionic detergent with a poly(ethylene oxide) chain) and water with or without electrolytes over a frequency range of 1 MHz to 10 GHz to study the structure and dynamics of water molecules in the mixtures. Dielectric relaxation was found above 100 MHz, being assigned to the dielectric relaxation of water. The intensity of the dielectric relaxation was proportional to the water content above 0 deg. C. Below the freezing temperature of bulk water, the relaxation intensity decreased at TX concentrations (C TX ) below 50 wt% at -10 deg. Cand below 60 wt% at -20 deg. Cbecause frozen water shifts the dielectric relaxation to a frequency region far below 1 MHz. This indicated that there is no bulk water at C TX above 50 wt% and that at least two water molecules per ethylene oxide (EO) unit are tightly associated with the ethylene oxide chain. The low-frequency conductivity of the mixtures of TX and electrolyte solutions was well represented by Bruggeman's mixture equation at C TX below 40 wt%, if two water molecules per EO unit form an insulating shell surrounding TX micelles

  7. Comparison of results for burning with BWR reactors CASMO and SCALE 6.2 (TRITON / NEWT)

    International Nuclear Information System (INIS)

    Mesado, C.; Miro, R.; Barrachina, T.; Verdu, G.

    2014-01-01

    In this paper we compare the results from two codes burned, CASMO and SCALE 6.2 (TRITON). To do this, is simulated all segments corresponding to a boiling water reactor (BWR) using both codes. In addition, to account for different working points, simulations changing the instantaneous variables, these are repeated: void fractions (6 points), fuel temperature (6 points) and control rods (two points), with a total of 72 possible combinations of different instantaneous variables for each segment. After all simulations are completed for each segment, we can reorder the obtained cross sections, as SCALE CASMO both, to create a library of compositions nemtab format. This format is accepted by the neutronic code of nodal diffusion, PARCS v2.7. Finally compares the results obtained with PARCS and with the SIMULATE3 -SIMTAB methodology to level of full reactor. Also, we have made use of the KENO-VI and MCDANCOFF modules belonging to SCALE. The first is a Monte Carlo transport code with which you can validate the value of the multiplier, the second has been used to obtain values of Dancoff factor and increase the accuracy of model SCALE. (Author)

  8. A Case of Malignant Peripheral Nerve Sheath Tumor with Rhabdomyoblastic Differentiation: Malignant Triton Tumor

    Directory of Open Access Journals (Sweden)

    Kenichiro Mae

    2013-12-01

    Full Text Available Malignant peripheral nerve sheath tumors (MPNST constitute a rare variety of soft tissue sarcomas thought to originate from Schwann cells or pluripotent cells of the neural crest. Malignant triton tumor (MTT, a very rare, highly aggressive soft tissue tumor, is a subgroup of MPNST and is comprised of malignant Schwann cells coexisting with malignant rhabdomyoblasts. We herein report the case of a 24-year-old man who presented a subcutaneous mass in his right thigh. The mass was removed surgically in its entirety and radiation therapy was applied locally to prevent tumor regrowth. Nonetheless, the patient died 10 months after surgery from metastases to the lung and brain. He presented neither cafe-au-lait spots nor cutaneous neurofibromas. The histopathology showed a transition from a neurofibroma to an MTT, making this the second report of an MTT arising from a neurofibroma without neurofibromatosis type 1, an autosomal dominant disorder with which 50-70% of tumors reported in previous studies were associated. A histopathological examination using immunostaining with desmin confirmed this diagnosis. MTT has a poorer prognosis than MPNST and should therefore be regarded as a distinct clinical entity.

  9. Studies of Triton X-165-beta-cyclodextrin interactions using both extrinsic and intrinsic fluorescence.

    Science.gov (United States)

    Mahata, Atanu; Bose, Debosreeta; Ghosh, Debanjana; Jana, Barnali; Bhattacharya, Bhaswati; Sarkar, Deboleena; Chattopadhyay, Nitin

    2010-07-15

    The interaction of beta-cyclodextrin with the non-ionic micelle-forming surfactant Triton X-165 (TX-165) has been studied using steady state fluorescence and fluorescence anisotropy techniques. Both extrinsic and intrinsic fluorescence have been exploited for the purpose. Phenosafranin (PSF), a cationic phenazinium dye, has been used as the extrinsic probe while fluorescence of TX-165 has served as the intrinsic one. PSF shows discernible interactions with both TX-165 and beta-CD. The experimental results reveal that the extent of interaction of PSF with TX-165 is greater than with beta-CD. However, addition of beta-CD to a micellar solution of TX-165 containing PSF leads to a disruption of the micelles whereby the fluorophore is released from the micellar environment to the bulk aqueous phase. It has been substantiated that an inclusion complex is formed between the non-ionic surfactant and the cyclodextrin. A 1:1 stoichiometry of the TX-165-beta-CD inclusion complex has been proposed. Such a complexation between TX-165 and beta-CD results in an inhibition in the micellization process of TX-165 leading to an enhancement in the apparent CMC value. The inferences are drawn from a series of experiments, viz., binding studies, determination of micropolarity, heavy-ion quenching studies and steady state fluorescence anisotropy experiments monitoring both extrinsic and intrinsic fluorescences. Copyright 2010 Elsevier Inc. All rights reserved.

  10. Time-dependent association between platelet-bound fibrinogen and the Triton X-100 insoluble cytoskeleton

    International Nuclear Information System (INIS)

    Peerschke, E.I.

    1991-01-01

    Previous studies indicated a correlation between the formation of EDTA-resistant (irreversible) platelet-fibrinogen interactions and platelet cytoskeleton formation. The present study explored the direct association of membrane-bound fibrinogen with the Triton X-100 insoluble cytoskeleton of aspirin-treated, gel-filtered platelets, activated but not aggregated with 20 mumol/L adenosine diphosphate (ADP) or 150 mU/mL human thrombin (THR) when bound fibrinogen had become resistant to dissociation by EDTA. Conversion of exogenous 125I-fibrinogen to fibrin was prevented by adding Gly-Pro-Arg and neutralizing THR with hirudin before initiating binding studies. After 60 minutes at 22 degrees C, the cytoskeleton of ADP-treated platelets contained 20% +/- 12% (mean +/- SD, n = 14) of membrane-bound 125I-fibrinogen, representing 10% to 50% of EDTA-resistant fibrinogen binding. The THR-activated cytoskeleton contained 45% +/- 15% of platelet bound fibrinogen, comprising 80% to 100% of EDTA-resistant fibrinogen binding. 125I-fibrinogen was not recovered with platelet cytoskeletons if binding was inhibited by the RGDS peptide, excess unlabeled fibrinogen, or disruption of the glycoprotein (GP) IIb-IIIa complex by EDTA-treatment. Both development of EDTA-resistant fibrinogen binding and fibrinogen association with the cytoskeleton were time dependent and reached maxima 45 to 60 minutes after fibrinogen binding to stimulated platelets. Although a larger cytoskeleton formed after platelet stimulation with thrombin as compared with ADP, no change in cytoskeleton composition was noted with development of EDTA-resistant fibrinogen binding

  11. Thermodynamics of non-ionic surfactant Triton X-100-cationic surfactants mixtures at the cloud point

    International Nuclear Information System (INIS)

    Batigoec, Cigdem; Akbas, Halide; Boz, Mesut

    2011-01-01

    Highlights: → Non-ionic surfactants are used as emulsifier and solubilizate in such as textile, detergent and cosmetic. → Non-ionic surfactants occur phase separation at temperature as named the cloud point in solution. → Dimeric surfactants have attracted increasing attention due to their superior surface activity. → The positive values of ΔG cp 0 indicate that the process proceeds nonspontaneous. - Abstract: This study investigates the effects of gemini and conventional cationic surfactants on the cloud point (CP) of the non-ionic surfactant Triton X-100 (TX-100) in aqueous solutions. Instead of visual observation, a spectrophotometer was used for measurement of the cloud point temperatures. The thermodynamic parameters of these mixtures were calculated at different cationic surfactant concentrations. The gemini surfactants of the alkanediyl-α-ω-bis (alkyldimethylammonium) dibromide type, on the one hand, with different alkyl groups containing m carbon atoms and an ethanediyl spacer, referred to as 'm-2-m' (m = 10, 12, and 16) and, on the other hand, with -C 16 alkyl groups and different spacers containing s carbon atoms, referred to as '16-s-16' (s = 6 and 10) were synthesized, purified and characterized. Additions of the cationic surfactants to the TX-100 solution increased the cloud point temperature of the TX-100 solution. It was accepted that the solubility of non-ionic surfactant containing polyoxyethylene (POE) hydrophilic chain was a maximum at the cloud point so that the thermodynamic parameters were calculated at this temperature. The results showed that the standard Gibbs free energy (ΔG cp 0 ), the enthalpy (ΔH cp 0 ) and the entropy (ΔS cp 0 ) of the clouding phenomenon were found positive in all cases. The standard free energy (ΔG cp 0 ) increased with increasing hydrophobic alkyl chain for both gemini and conventional cationic surfactants; however, it decreased with increasing surfactant concentration.

  12. Hypolipidaemic activity of aqueous Ocimum basilicum extract in acute hyperlipidaemia induced by triton WR-1339 in rats and its antioxidant property.

    Science.gov (United States)

    Amrani, Souliman; Harnafi, Hicham; Bouanani, Nour El Houda; Aziz, Mohammed; Caid, Hana Serghini; Manfredini, Stefano; Besco, Elena; Napolitano, Mariarosaria; Bravo, Elena

    2006-12-01

    Hyperlipidaemia, atherosclerosis and related diseases are becoming a major health problem in developing countries. Ocimum basilicum is one of the medicinal plants widely used in Morocco to reduce plasma cholesterol and to reduce the risk of atherosclerosis-related diseases. However, mechanisms underlying the reported hypolipidaemic effect of this plant have not been investigated. This study evaluates the lipid lowering effect of aqueous Ocimum basilicum extract in Triton WR-1339-induced hyperlipidaemic rats. Hyperlipidaemia was developed in animals by intraperitoneal injection of Triton (200 mg/kg). After injection of Triton the animals were divided into three treatment groups: hyperlipidaemic, hyperlipidaemic plus herb extract and hyperlipidaemic plus fenofibrate treated rats. At 7 h after the Triton injection, levels of plasma cholesterol, triglycerides and LDL-cholesterol in rats treated also with the Ocimum basilicum extract (0.5 g/100 g body weight) were, respectively, 50%, 83% and 79% lower than Triton-treated rats and HDL-cholesterol was 129% higher than in rats given Triton alone. At 24 h following Ocimum basilicum administration, total cholesterol, triglycerides and LDL-cholesterol levels decreased by 56%, 63% and 68%, respectively, in comparison with the Triton treated group and HDL-cholesterol was not increased significantly. The hypolipidaemic effect exerted by Ocimum basilicum extract was markedly stronger than the effect induced by fenofibrate treatments. Further it was demonstrated that Ocimum basilicum aqueous extract displayed a very high antioxidant power. These results indicate that Ocimum basilicum extract may contain hypolipidaemic and antioxidant substances and its use as a therapeutic tool in hyperlipidaemic subjects may be of benefit and encourage further investigation in this field.

  13. Inhibitory effect of non-ionic surfactants of the TRITON-X series on the corrosion of carbon steel in sulphuric acid

    International Nuclear Information System (INIS)

    Fuchs-Godec, R.

    2007-01-01

    The corrosion inhibition characteristics of non-ionic surfactants of the TRITON-X series, known as TRITON-X-100 and TRITON-X-405, on stainless steel (SS) type X4Cr13 in sulphuric acid were investigated by potentiodynamic polarisation measurements. It was found that these surfactants act as good inhibitors of the corrosion of stainless steel in 2 mol L -1 H 2 SO 4 solution, but the inhibition efficiency strongly depends on the electrode potential. The polarisation data showed that the non-ionic surfactants used in this study acted as mixed-type inhibitors and adsorb on the stainless steel surface, in agreement with the Flory-Huggins adsorption isotherm. Calculated ΔG ads values are -57.79 kJ mol -1 for TRITON-X-100, and -87.5 kJ mol -1 for TRITON-X-405. From the molecular structure it can be supposed that these surfactants adsorb on the metal surface through two lone pairs of electrons on the oxygen atoms of the hydrophilic head group, suggesting a chemisorption mechanism

  14. Membrane-surfactant interactions. The role of surfactant in mitochondrial complex III-phospholipid-Triton X-100 mixed micelles

    International Nuclear Information System (INIS)

    Valpuesta, J.M.; Arrondo, J.L.; Barbero, M.C.; Pons, M.; Goni, F.M.

    1986-01-01

    Complex III (ubiquinol-cytochrome c reductase) was purified from beef heart mitochondria in the form of protein-phospholipid-Triton X-100 mixed micelles (about 1:80:100 molar ratio). Detergent may be totally removed by sucrose density gradient centrifugation, and the resulting lipoprotein complexes retain full enzyme activity. In order to understand the role of surfactant in the mixed micelles, and the interaction of Triton X-100 with integral membrane proteins and phospholipid bilayers, both the protein-lipid-surfactant mixed micelles and the detergent-free lipoprotein system were examined from the point of view of particle size and ultrastructure, enzyme activity, tryptophan fluorescence quenching, 31P NMR, and Fourier transform infrared spectroscopy. The NMR and IR spectroscopic studies show that surfactant withdrawal induces a profound change in phospholipid architecture, from a micellar to a lamellar-like phase. However, electron microscopic observations fail to reveal the existence of lipid bilayers in the absence of detergent. We suggest that, under these conditions, the lipid:protein molar ratio (80:1) is too low to permit the formation of lipid bilayer planes, but the relative orientation and mobility of phospholipids with respect to proteins is similar to that of the lamellar phase. Protein conformational changes are also detected as a consequence of surfactant removal. Fourier transform infrared spectroscopy indicates an increase of peptide beta-structure in the absence of Triton X-100; changes in the amide II/amide I intensity ratio are also detected, although the precise meaning of these observations is unclear

  15. Malignant Triton Tumor of the Sciatic Nerve as a Secondary Malignancy after Extended Field Radiotherapy and Chemotherapy of Hodgkin's Disease

    Directory of Open Access Journals (Sweden)

    Mirko Nitsche

    2014-03-01

    Full Text Available Late effects of therapy for Hodgkin's disease include secondary malignancies like leukemia, lymphoma or solid tumors developing after long periods of latency. Ionizing radiation often causes the last group. The highest risks have been described for induced breast and lung cancers. We are the first to report a malignant triton tumor (MTT as a secondary malignancy after radiotherapy and chemotherapy for Hodgkin's lymphoma. MTT is a very rare subtype of malignant peripheral nerve sheath tumors with rhabdomyoblastic differentiation and an aggressive course of disease.

  16. Spectrofotometric determination of copper in sugar cane spirit using biquinoline in the presence of ethanol and Triton X-100.

    Science.gov (United States)

    do Nascimento Rocha, Sarah Adriana; Dantas, Alaílson Falcão; Jaeger, Helena Valli; Costa, Antônio Celso Spínola; Leão, Elsimar dos Santos; Gonçalves, Mara Rúbia

    2008-12-15

    The present paper proposes a method for molecular spectrophotometric determination of copper in sugar cane spirits. The copper(I) reacts with biquinoline forming a pink complex with maximum absorption at 545 nm. The reaction occurs in the presence of hydroxylamine, ethanol and Triton X-100 tensioative. Determination of copper is possible in a linear range 0.2-20.0 mgL(-1) with a detection limit 0.05 mgL(-1). The great advantages of the proposed methodology are the elimination of liquid-liquid extraction step and the use of toxic organics solvents, like dioxane, to dissolve the reagent.

  17. Lead preconcentration in synthetic samples with triton x-114 in the cloud point extraction and analysis by atomic absorption (EAAF)

    International Nuclear Information System (INIS)

    Zegarra Pisconti, Marixa; Cjuno Huanca, Jesus

    2015-01-01

    A methodology was developed about lead preconcentration in water samples that were added dithizone as complexing agent, previously dissolved in the nonionic surfactant Triton X-114, until the formation of the critical micelle concentration and the cloud point temperature. The centrifuged system gave a precipitate with high concentrations of Pb (II) that was measured by atomic absorption spectroscopy with flame (EAAF). The method has proved feasible to be implemented as a method of preconcentration and analysis of Pb in aqueous samples with concentrations less than 1 ppm. Several parameters were evaluated to obtain a percentage recovery of 89.8%. (author)

  18. Thermodynamics of non-ionic surfactant Triton X-100-cationic surfactants mixtures at the cloud point

    Energy Technology Data Exchange (ETDEWEB)

    Batigoec, Cigdem [Department of Chemistry, Faculty of Sciences, Trakya University, 22030 Edirne (Turkey); Akbas, Halide, E-mail: hakbas34@yahoo.com [Department of Chemistry, Faculty of Sciences, Trakya University, 22030 Edirne (Turkey); Boz, Mesut [Department of Chemistry, Faculty of Sciences, Trakya University, 22030 Edirne (Turkey)

    2011-12-15

    Highlights: > Non-ionic surfactants are used as emulsifier and solubilizate in such as textile, detergent and cosmetic. > Non-ionic surfactants occur phase separation at temperature as named the cloud point in solution. > Dimeric surfactants have attracted increasing attention due to their superior surface activity. > The positive values of {Delta}G{sub cp}{sup 0} indicate that the process proceeds nonspontaneous. - Abstract: This study investigates the effects of gemini and conventional cationic surfactants on the cloud point (CP) of the non-ionic surfactant Triton X-100 (TX-100) in aqueous solutions. Instead of visual observation, a spectrophotometer was used for measurement of the cloud point temperatures. The thermodynamic parameters of these mixtures were calculated at different cationic surfactant concentrations. The gemini surfactants of the alkanediyl-{alpha}-{omega}-bis (alkyldimethylammonium) dibromide type, on the one hand, with different alkyl groups containing m carbon atoms and an ethanediyl spacer, referred to as 'm-2-m' (m = 10, 12, and 16) and, on the other hand, with -C{sub 16} alkyl groups and different spacers containing s carbon atoms, referred to as '16-s-16' (s = 6 and 10) were synthesized, purified and characterized. Additions of the cationic surfactants to the TX-100 solution increased the cloud point temperature of the TX-100 solution. It was accepted that the solubility of non-ionic surfactant containing polyoxyethylene (POE) hydrophilic chain was a maximum at the cloud point so that the thermodynamic parameters were calculated at this temperature. The results showed that the standard Gibbs free energy ({Delta}G{sub cp}{sup 0}), the enthalpy ({Delta}H{sub cp}{sup 0}) and the entropy ({Delta}S{sub cp}{sup 0}) of the clouding phenomenon were found positive in all cases. The standard free energy ({Delta}G{sub cp}{sup 0}) increased with increasing hydrophobic alkyl chain for both gemini and conventional cationic

  19. Micelle size modulation and phase behavior in MEGA-10/Triton X-100 mixtures

    Energy Technology Data Exchange (ETDEWEB)

    Naous, M., E-mail: elzahraadz@yahoo.fr; Molina-Bolívar, J.A.; Ruiz, C. Carnero, E-mail: ccarnero@uma.es

    2014-12-20

    Highlights: • The size of micelles was studied as a function of the micellar composition, NaCl addition and temperature. • Cloud point can be modulated by changing both micellar composition and NaCl addition. • The energetic quantities at the cloud point were evaluated and discussed. - Abstract: This paper reports the effect of temperature and NaCl addition on micelle size and phase behavior in mixtures of N-decanoyl-N-methylglucamide (MEGA-10) and p-tert-octyl-phenoxy polyethylene (9.5) ether (Triton X-100 or TX100). The size of mixed micelles, as determined by dynamic light scattering (DLS), was found to increase with temperature but to be less pronounced at higher proportions of MEGA-10 in the solution. The cloud point was found to increase with an initial increase in the percentage of sugar-based surfactant in the mixture. This phase separation was sensitive to the presence of NaCl in the micellar solution, which induced a cloud point depression, thereby suggesting that the presence of electrolyte produces a marked alteration of the hydration layer of micelles. A thermodynamic analysis was performed assuming the clouding phenomenon to be a liquid–liquid phase-separation process. The resulting ΔG{sub CP}{sup 0} values were positive for all solutions. The cloud point process was exothermic in nature for the mixed micellar system, as proven by the negative value of ΔH{sub CP}{sup 0}. The process was more exothermic as the proportion of sugar-based surfactant in the mixed micelle increased (with and without NaCl in the solution). Furthermore, the negative values of ΔS{sub CP}{sup 0} indicate that the association of micelles in the clouding phenomenon is entropically unfavorable. It was observed from the enthalpy–temperature plots that the change in heat capacity is negative, thus indicating the important role played by dehydration in this thermodynamic process. This study found that the enthalpy–entropy compensation relationship holds for this

  20. Förster Resonance Energy Transfer (FRET) from Triton X-100 to 4-benzothiazol-2-yl-phenol: Varying FRET efficiency with CMC of the donor (Triton X-100)

    International Nuclear Information System (INIS)

    Paul, Bijan Kumar; Ganguly, Aniruddha; Karmakar, Saswati; Guchhait, Nikhil

    2013-01-01

    A heterocyclic compound viz., 4-benzothiazol-2-yl-phenol (4B2YP) has been synthesized and its photophysics have been examined through steady-state absorption, emission and time resolved emission spectroscopic techniques, in brief. Then 4B2YP has been exploited as an acceptor in the Förster Resonance Energy Transfer (FRET) process from photoexcited benzene aromatic nucleus of Triton X-100 (TX-100) surfactant. Dependence of the energy transfer efficiency on the donor concentration with respect to its critical micelle concentration (CMC) is clearly reflected in the study. High values of Stern–Volmer constant (K SV ) for quenching of the donor fluorescence in the presence of the acceptor suggest the operation of long-range dipole–dipole interaction in the course of energy transfer process, while the inference is aptly supported from time resolved fluorescence decay results. Experimental results show maximum FRET efficiency at the CMC of the donor (TX-100). -- Highlights: • FRET from neutral surfactant Triton X-100 to chromophore 4-benzothiazol-2-yl-phenol. • Steady state and time resolved spectroscopy. • Long-range dipole–dipole interaction responsible for FRET. • FRET efficiency as a measure of CMC of surfactant

  1. Förster Resonance Energy Transfer (FRET) from Triton X-100 to 4-benzothiazol-2-yl-phenol: Varying FRET efficiency with CMC of the donor (Triton X-100)

    Energy Technology Data Exchange (ETDEWEB)

    Paul, Bijan Kumar, E-mail: bijan.paul.chem.cu@gmail.com [Department of Chemistry, University of Calcutta, 92 A.P.C. Road, Calcutta 700009 (India); Ganguly, Aniruddha [Department of Chemistry, University of Calcutta, 92 A.P.C. Road, Calcutta 700009 (India); Karmakar, Saswati [Department of Chemistry, Sree Chaitanya College, Habra, North 24 Parganas (India); Guchhait, Nikhil, E-mail: nguchhait@yahoo.com [Department of Chemistry, University of Calcutta, 92 A.P.C. Road, Calcutta 700009 (India)

    2013-11-15

    A heterocyclic compound viz., 4-benzothiazol-2-yl-phenol (4B2YP) has been synthesized and its photophysics have been examined through steady-state absorption, emission and time resolved emission spectroscopic techniques, in brief. Then 4B2YP has been exploited as an acceptor in the Förster Resonance Energy Transfer (FRET) process from photoexcited benzene aromatic nucleus of Triton X-100 (TX-100) surfactant. Dependence of the energy transfer efficiency on the donor concentration with respect to its critical micelle concentration (CMC) is clearly reflected in the study. High values of Stern–Volmer constant (K{sub SV}) for quenching of the donor fluorescence in the presence of the acceptor suggest the operation of long-range dipole–dipole interaction in the course of energy transfer process, while the inference is aptly supported from time resolved fluorescence decay results. Experimental results show maximum FRET efficiency at the CMC of the donor (TX-100). -- Highlights: • FRET from neutral surfactant Triton X-100 to chromophore 4-benzothiazol-2-yl-phenol. • Steady state and time resolved spectroscopy. • Long-range dipole–dipole interaction responsible for FRET. • FRET efficiency as a measure of CMC of surfactant.

  2. [EFFECT OF TRITON X-100 ON LIPOSOME MEDIATED BONE MORPHOGENETIC PROTEIN 2 BY TRANSFECTION OF RAT BONE MARROW MESENCHYMAL STEM CELLS].

    Science.gov (United States)

    Xia, Delin; Huang, Mingke; Fu, Guangxing; Ma, Zheng; Wu, Shuangjiang; Zhou, Hangyu

    2015-01-01

    To study the effect of Triton X-100 promoting liposome-mediated bone morphogenetic protein 2 (BMP-2) gene transfection of rat bone marrow mesenchymal stem cells (BMSCs). BMSCs were separated and cultured from the femur and tibia of healthy Wistar rats (8-week-old, male). The 3rd passage BMSCs identified by detecting the surface antigen were used to transfect. The optimum concentration of Triton X-100 for liposome mediated gene transfection was determined with ELISA meter by the way of MTT. In optimum concentration of Triton X-100, liposome mediated BMP-2 gene was transfected to BMSCs. The experiment was divided into 3 groups according to types of trasfection agents: BMSCs were transfected with Triton X-100+liposome+BMP-2 (experimental group), with liposome+ BMP-2 (conventional transfection group), and untransfected BMSCs served as blank control group. After 48 hours of transfecting, the green fluorescent protein (GFP) in cells was detected through inverted fluorescence microscope. After 72 hours of transfection, real-time fluorescence quantitative PCR was applied to measure the mRNA expression of BMP-2. 0.01% Triton X-100 was determined to be the optimum concentration for not only making the BMSCs maintain vitality, but also achieving a certain effect on BMSCs. After trasfecting for 48 hours, GFP was observed through inverted fluorescence microscope in the experimental group and conventional transfection group, but was not observed in the blank control group. After trasfecting for 72 hours, the relative BMP-2 mRNA expression level was 5.94 ± 0.12 in the experimental group, and was 4.99 ± 0.08 in the conventional transfection group, showing significant difference (t = 360.28, P = 0.02). The transfection efficiency was increased by 19% in the experimental group. 0.010% Triton X-100 can promote the liposome mediated BMP-2 gene transfection of rat BMSUs, and can improve the transfection efficiency.

  3. Modeling of neutron emission spectroscopy in JET discharges with fast tritons from (T)D ion cyclotron heating

    International Nuclear Information System (INIS)

    Tardocchi, M.; Gorini, G.; Andersson Sunden, E.; Conroy, S.; Ericsson, G.; Gatu Johnson, M.; Giacomelli, L.; Hellesen, C.; Hjalmarsson, A.; Kaellne, J.; Ronchi, E.; Sjoestrand, H.; Weiszflog, M.; Johnson, T.; Lamalle, P. U.

    2006-01-01

    The measurement of fast ion populations is one of the diagnostic capabilities provided by neutron emission spectroscopy (NES). NES measurements were carried out during JET trace tritium campaign with the magnetic proton recoil neutron spectrometer. A favorable plasma scenario is (T)D where the resulting 14 MeV neutron yield is dominated by suprathermal emission from energetic tritons accelerated by radio frequency at their fundamental cyclotron frequency. Information on the triton distribution function has been derived from NES data with a simple model based on two components referred to as bulk (B) and high energy (HE). The HE component is based on strongly anisotropic tritium distribution that can be used for routine best-fit analysis to provide tail temperature values (T HE ). This article addresses to what extent the T HE values are model dependent by comparing the model above with a two-temperature (bi-) Maxwellian model featuring parallel and perpendicular temperatures. The bi-Maxwellian model is strongly anisotropic and frequently used for radio frequency theory

  4. A calculational procedure for neutronic and depletion analysis of Molten-Salt reactors based on SCALE6/TRITON

    International Nuclear Information System (INIS)

    Sheu, R.J.; Chang, J.S.; Liu, Y.-W. H.

    2011-01-01

    Molten-Salt Reactors (MSRs) represent one of the selected categories in the GEN-IV program. This type of reactor is distinguished by the use of liquid fuel circulating in and out of the core, which makes it possible for online refueling and salt processing. However, this operation characteristic also complicates the modeling and simulation of reactor core behaviour using conventional neutronic codes. The TRITON sequence in the SCALE6 code system has been designed to provide the combined capabilities of problem-dependent cross-section processing, rigorous treatment of neutron transport, and coupled with the ORIGEN-S depletion calculations. In order to accommodate the simulation of dynamic refueling and processing scheme, an in-house program REFRESH together with a run script are developed for carrying out a series of stepwise TRITON calculations, that makes the work of analyzing the neutronic properties and performance of a MSR core design easier. As a demonstration and cross check, we have applied this method to reexamine the conceptual design of Molten Salt Actinide Recycler & Transmuter (MOSART). This paper summarizes the development of the method and preliminary results of its application on MOSART. (author)

  5. Cholesterol Oxidase/Triton X-100 Parked Microelectrodes for the Detection of Cholesterol in Plasma Membrane at Single Cells.

    Science.gov (United States)

    Xu, Haiyan; Zhou, Shuai; Jiang, Dechen; Chen, Hong-Yuan

    2018-01-16

    The classic electrochemical analysis of plasma membrane cholesterol at single cells utilizes a cholesterol oxidase modified microelectrode that oxidizes local cholesterol efflux from the plasma membrane to generate hydrogen peroxide for the electrochemical quantification. In this letter, a mixture of cholesterol oxidase and Triton X-100 was filled in the microcapillary that could park at the Pt layer coated tip due to slow hydrodynamic flow. During the contact of the tip with the cellular membrane, Triton X-100 at the tip permeabilized the contacted membrane to release cholesterol for the reaction with cholesterol oxidase. As compared with the linkage of cholesterol oxidase at the electrode surface, the oxidase parked in aqueous solution at the tip had a higher turnover rate resulting in larger electrochemical signal for single cell analysis. More charge collected at acyl-coA:cholesterol acyltransferase (ACAT) inhibited cells supported that this novel detection strategy could monitor the flunctation of membrane cholesterol at single cells. The successful detection of plasma membrane cholesterol at single cells using the oxidase parked microelectrode will provide a special strategy for the fabrication of biosensor that permits the integration of more molecules without functional groups at the electrode to measure active and inactive molecules in the plasma membrane. Moreover, the larger electrochemical signals collected could further increase the spatial resolution for single cell electrochemical analysis.

  6. Study of the {sup 6}He wave function by the {sup 6}He(p,t){sup 4}He transfer reaction: contribution of the triton-triton configuration; Etude de la fonction d'onde de l' {sup 6}He par la reaction de transfert {sup 6}He(p,t){sup 4}He: contribution de la configuration a deux tritons

    Energy Technology Data Exchange (ETDEWEB)

    Giot, L

    2003-10-01

    This work is devoted to the study of the importance of the alpha-2n and triton-triton configurations in He{sup 6}. We measured at GANIL, the angular distribution of the transfer reaction He{sup 6}(p,t)He{sup 4} at 25 A.MeV with the SPEG spectrometer coupled to the MUST array. The forward and backward c.m. angles were obtained with SPEG. The coincidences of the MUST modules provide the intermediate angles. The elastic scattering He{sup 6}(p,p)He{sup 6}, measured at the same time with the SPEG spectrometer, sets the optical potential He{sup 6}+p for the entrance channel of the transfer reaction. DWBA and coupled channels calculations allow to study the sensitivity to the possible different channels of the He{sup 6}+p system and specially the He{sup 6} breakup with discretized-continuum channels. The comparison between the theoretical and experimental He{sup 6}(p,t)He{sup 4} differential cross-section gives a spectroscopic factor close to 1 for the alpha-2n configuration and between 0.06 and 0.09 for the t-t configuration. (author)

  7. A small-angle neutron scattering study of the structure of graphitized carbon black aggregates in Triton X-100/water solutions

    DEFF Research Database (Denmark)

    Garamus, V.M.; Pedersen, J.S.

    1998-01-01

    The structure of graphitized carbon black (CB) aggregates dispersed in water solutions with a non-ionic surfactant are studied by small-angle neutron scattering using contrast variation by heavy/light water mixing. The addition of CB to Triton X-100/water mixtures shifts the critical micelle...

  8. Comparative proteomics of Staphylococcus aureus and the response of methicillin-resistant and methicillin-sensitive strains to Triton X-100

    DEFF Research Database (Denmark)

    Cordwell, Stuart J; Larsen, Martin Røssel; Cole, Rebecca T

    2002-01-01

    . Comparative maps were used to characterize the S. aureus response to treatment with Triton X-100 (TX-100), a detergent that has been shown to reduce methicillin resistance independently of an interaction with the mecA-encoded penicillin-binding protein 2a. In response to growth of the bacteria in the presence...

  9. Molecular basis of interactions between mitochondrial proteins and hydroxyapatite in the presence of Triton X-100, as revealed by proteomic and recombinant techniques.

    Science.gov (United States)

    Yamamoto, Takenori; Tamaki, Haruna; Katsuda, Chie; Nakatani, Kiwami; Terauchi, Satsuki; Terada, Hiroshi; Shinohara, Yasuo

    2013-08-02

    Hydroxyapatite chromatography is a very important step in the purification of voltage-dependent anion channels (VDACs) and several members of solute carrier family 25 (Slc25) from isolated mitochondria. In the presence of Triton X-100, VDACs and Slc25 members present a peculiar property, i.e., a lack of interaction with hydroxyapatite, resulting in their presence in the flow-through fraction of hydroxyapatite chromatography. This property has allowed selective isolation of VDACs and Slc25 members from a mixture of total mitochondrial proteins. However, the reason why only these few proteins are selectively obtained in the presence of Triton X-100 from the flow-though fraction of hydroxyapatite chromatography has not yet been adequately understood. In this study, when we examined the protein species in the flow-through fractions by proteomic analysis, VDAC isoforms, Slc25 members, and some other membrane proteins were identified. All the mitochondrial proteins had in common high hydrophobicity over their entire protein sequences. When the proteins were fused to soluble proteins, the fused proteins showed affinity for hydroxyapatite even in the presence of Triton X-100. Based on these results, we discussed the molecular basis of the interactions between proteins and hydroxyapatite in the presence of Triton X-100. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Extraction and separation of tungsten (VI) from aqueous media with Triton X-100-ammonium sulfate-water aqueous two-phase system without any extractant.

    Science.gov (United States)

    Yongqiang Zhang; Tichang Sun; Tieqiang Lu; Chunhuan Yan

    2016-11-25

    An aqueous two-phase system composed of Triton X-100-(NH 4 ) 2 SO 4 -H 2 O was proposed for extraction and separation of tungsten(VI) from aqueous solution without using any extractant. The effects of aqueous pH, concentration of ammonium sulfate, Triton X-100 and tungsten, extracting temperature on the extraction of tungsten were investigated. The extraction of tungsten has remarkable relationship with aqueous pH and are to above 90% at pH=1.0-3.0 under studied pH range (pH=1.0-7.0) and increases gradually with increasing Triton X-100 concentration, but decreases slightly with increasing ammonium sulfate concentration. The extraction percentage of tungsten is hardly relevant to temperature but its distribution coefficient linearly increases with increasing temperature within 303.15-343.15K. The distribution coefficient of tungsten increases with the increase of initial tungsten concentration (0.1-3%) and temperature (303.15 K-333.15K). The solubilization capacity of tungsten in Triton X-100 micellar phase is independent of temperature. FT-IR analysis reveals that there is no evident interaction between polytungstate anion and ether oxygen unit in Triton X-100, and DLS analysis indicates that zeta potential of Triton X-100 micellar phase have a little change from positive to negative after extracting tungsten. Based on the above-mentioned results, it can be deduced that polytungstate anions are solubilized in hydrophilic outer shell of Triton X-100 micelles by electrostatic attraction depending on its relatively high hydrophobic nature. The stripping of tungsten is mainly influenced by temperature and can be easily achieved to 95% in single stage stripping. The tungsten (VI) is separated out from solution containing Fe(III), Co(II), Ni(II), Cu(II), Zn(II), Al(III), Cr(III) and Mn(II) under the suitable conditions. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Convergence of triton asymptotic wave function for hyperspherical harmonics expansion with two nucleon Reid soft core potential

    Energy Technology Data Exchange (ETDEWEB)

    Bhattacharyya, S.; Das, T.K. (Physics Department, Calcutta University, 92 A.P.C. Road, Calcutta 700009 (India)); Kanta, K.P. (Physics Department, Burdwan University, Burdwan 713104 (India)); Ghosh, A.K. (Sainthia Avedananda Mahavidyalaya, Sainthia, Birbhum, W. B. (India))

    1994-10-01

    The asymptotic normalization constants (ANC) [ital C][sub 0] and [ital C][sub 2] of the triton have been calculated by the hyperspherical harmonics expansion method with the Reid soft core potential (no three body force). The results do not agree with the corresponding calculations by the Faddeev method, when only a few hyperspherical partial waves are included. However Schneider's convergence theorems on hyperspherical expansion allow one to extrapolate the results for a large number of partial waves and then they agree fairly well with the Faddeev results. This indicates that even though the hyperspherical expansion for the asymptotic wave function is very slow, a convergent and reliable wave function is attained by extrapolation of a relatively small-sized calculation.

  12. Cloud Point Extraction of Toxic Reactive Black 5 Dye from Water Samples Using Triton X-100 as Nonionic Surfactant

    Directory of Open Access Journals (Sweden)

    Raziyeh Mousavi

    2011-01-01

    Full Text Available A surfactant mediated cloud point extraction (CPE procedure has been developed to remove color from wastewater containing reactive black 5, using triton x-100 (TX-100 as non-ionic surfactant. The effects of the concentration of the surfactant, pH, temperature and salt concentration on the different concentrations of dye have been studied and optimum conditions were obtained for the removal of reactive black 5 (RB 5. The concentration of RB 5 in the dilute phase was measured using UV-Vis spectrophotometer. It was found that the separation of phases was complete and the recovery of RB 5 was very effective in the presence of NaCl as an electrolyte. The results showed that up to 600 mg L-1 of RB 5 can quantitatively be removed (>97% by cloud point extraction procedure in a single extraction using optimum conditions.

  13. Low-Grade Malignant Triton Tumor of the Neck: A Case Report and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Taissir Omar

    2014-01-01

    Full Text Available Rhabdomyoblastic differentiation in a malignant peripheral nerve sheath tumor (MPNST is termed malignant triton tumor (MTT, a rare neoplasm that poses a diagnostic dilemma in the differential diagnosis of neck masses and portends poor prognosis. We report a sporadic case of MTT of the neck in a 23-year-old female. We present the pathological findings. Immunohistochemistry confirmed the neurogenic origin with S-100 expression and the rhabdomyoblastic differentiation with desmin and vimentin positivity. Radical surgical excision was done. After 4 years there were no signs of recurrence or distant metastasis. The clinical, microscopic, and long-term follow-up of this case are consistent with those of a low-grade malignancy.

  14. Cloud point extraction for the determination of heavy metals by nonionic surfactant Triton X-100 and PAN

    International Nuclear Information System (INIS)

    Cabrera Puig, I.; Perez Gramatges, A.

    2006-01-01

    A novel methodology for extraction and preconcentration of trace metals based on cloud point phenomenon was applied to the analysis of Co(II), Cu(II), Cd(II), Pb(II) y Ni(II) in a certified reference material (CRM), using Triton X-100 as nonionic surfactant, and AAS for the determination. Different parameters that can influence the extraction efficiency were studied, such as pH and ionic strength of the solution. The precision, accuracy and detection limits of the method were determined using a CRM from the Environmental Analysis Laboratory of InSTEC. We applied our methodology to the detection of the metals in naturals waters (Almendares river and tap water) . The data obtained presented in this work is part of the validation file of the proposed analytical procedure for the determination of heavy metals

  15. OSS (Outer Solar System): a fundamental and planetary physics mission to Neptune, Triton and the Kuiper Belt

    Science.gov (United States)

    Christophe, B.; Spilker, L. J.; Anderson, J. D.; André, N.; Asmar, S. W.; Aurnou, J.; Banfield, D.; Barucci, A.; Bertolami, O.; Bingham, R.; Brown, P.; Cecconi, B.; Courty, J.-M.; Dittus, H.; Fletcher, L. N.; Foulon, B.; Francisco, F.; Gil, P. J. S.; Glassmeier, K. H.; Grundy, W.; Hansen, C.; Helbert, J.; Helled, R.; Hussmann, H.; Lamine, B.; Lämmerzahl, C.; Lamy, L.; Lehoucq, R.; Lenoir, B.; Levy, A.; Orton, G.; Páramos, J.; Poncy, J.; Postberg, F.; Progrebenko, S. V.; Reh, K. R.; Reynaud, S.; Robert, C.; Samain, E.; Saur, J.; Sayanagi, K. M.; Schmitz, N.; Selig, H.; Sohl, F.; Spilker, T. R.; Srama, R.; Stephan, K.; Touboul, P.; Wolf, P.

    2012-10-01

    The present OSS (Outer Solar System) mission continues a long and bright tradition by associating the communities of fundamental physics and planetary sciences in a single mission with ambitious goals in both domains. OSS is an M-class mission to explore the Neptune system almost half a century after the flyby of the Voyager 2 spacecraft. Several discoveries were made by Voyager 2, including the Great Dark Spot (which has now disappeared) and Triton's geysers. Voyager 2 revealed the dynamics of Neptune's atmosphere and found four rings and evidence of ring arcs above Neptune. Benefiting from a greatly improved instrumentation, a mission as OSS would result in a striking advance in the study of the farthest planet of the solar system. Furthermore, OSS would provide a unique opportunity to visit a selected Kuiper Belt object subsequent to the passage of the Neptunian system. OSS would help consolidate the hypothesis of the origin of Triton as a Kuiper Belt object captured by Neptune, and to improve our knowledge on the formation of the solar system. The OSS probe would carry instruments allowing precise tracking of the spacecraft during the cruise. It would facilitate the best possible tests of the laws of gravity in deep space. These objectives are important for fundamental physics, as they test General Relativity, our current theoretical description of gravitation, but also for cosmology, astrophysics and planetary science, as General Relativity is used as a tool in all these domains. In particular, the models of solar system formation uses General Relativity to describe the crucial role of gravity. OSS is proposed as an international cooperation between ESA and NASA, giving the capability for ESA to launch an M-class mission towards the farthest planet of the solar system, and to a Kuiper Belt object. The proposed mission profile would allow to deliver a 500 kg class spacecraft. The design of the probe is mainly constrained by the deep space gravity test in order

  16. Physical profile data collected in the Equatorial Pacific during cruises to service the TAO/TRITON array, a network of deep ocean moored buoys, February 23 - December 16, 2005 (NODC Accession 0002644)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — During 2005, CTD data were collected in the equatorial Pacific Ocean during cruises to service the TAO/TRITON array, a network of deep ocean moored buoys to support...

  17. Physical profile and meteorological data from CTD casts during cruises to service the TAO/TRITON buoys in the equatorial Pacific from 02 March 2002 to 22 November 2002 (NODC Accession 0000945)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Physical profile data and meteorological data were collected from CTD casts in the equatorial Pacific Ocean during cruises to to service the TAO/TRITON buoy array....

  18. The Equilibrium and Pre-equilibrium Triton Emission Spectra of Some Target Nuclei for ( n, xt) Reactions up to 45 MeV Energy

    Science.gov (United States)

    Tel, E.; Kaplan, A.; Aydın, A.; Özkorucuklu, S.; Büyükuslu, H.; Yıldırım, G.

    2010-08-01

    Although there have been significant research and development studies on the inertial and magnetic fusion reactor technology, there is still a long way to go to penetrate commercial fusion reactors to the energy market. Tritium self-sufficiency must be maintained for a commercial power plant. For self-sustaining (D-T) fusion driver tritium breeding ratio should be greater than 1.05. So, working out the systematics of ( n,t) reaction cross sections and triton emission differential data are important for the given reaction taking place on various nuclei at different energies. In this study, ( n,xt) reactions for some target nuclei as 16O, 27Al, 59Co and 209Bi have been investigated up to 45 MeV incident neutron energy. In the calculations of the triton emission spectra, the pre-equilibrium and equilibrium effects have been used. The calculated results have been compared with the experimental data taken from the literature.

  19. High-Yield and Sustainable Production of Phosphatidylserine in Purely Aqueous Solutions via Adsorption of Phosphatidylcholine on Triton-X-100-Modified Silica.

    Science.gov (United States)

    Zhang, Xiaoli; Li, Binglin; Wang, Jiao; Li, Huanyu; Zhao, Binxia

    2017-12-13

    Triton X-100 was covalently bound to a surface of silica and acted as an anchor molecule to facilitate the adsorption of phosphatidylcholine (PC) in a purely aqueous solution. The silica-adsorbed PC obtained was successfully used for phospholipase D (PLD)-mediated transphosphatidylation in the production of phosphatidylserine (PS). Organic solvents were completely avoided in the whole production process. The PC loading and PS yield reached 98.9 and 99.0%, respectively. Two adsorption models were studied, and the relevant parameters were calculated to help us understand the adsorption and reaction processes deeply. In addition, the silica-adsorbed PC provides a promising way to continuously biosynthesize PS. A packed-bed reactor was employed to demonstrate the process flow of the continuous production of PS. The recyclability and stability of the Triton-X-100-modified silica were excellent, as demonstrated by its use 30 times during continuous operation without any loss of the productivity.

  20. Rho-kinase inhibition attenuates calcium-induced contraction in β-escin but not Triton X-100 permeabilized rabbit femoral artery.

    Science.gov (United States)

    Clelland, Lyndsay J; Browne, Brendan M; Alvarez, Silvina M; Miner, Amy S; Ratz, Paul H

    2011-09-01

    K+-depolarization (KCl) of smooth muscle has long been known to cause Ca2+-dependent contraction, but only recently has this G protein-coupled receptor (GPCR)-independent stimulus been associated with rhoA kinase (ROCK)-dependent myosin light chain (MLC) phosphatase inhibition and Ca2+ sensitization. This study examined effects of ROCK inhibition on the concentration-response curves (CRCs) generated in femoral artery by incrementally adding increasing concentrations of KCl to intact tissues, and Ca2+ to tissues permeabilized with Triton X-100, β-escin and α-toxin. For a comparison, tissue responses were assessed also in the presence of protein kinase C (PKC) and MLC kinase inhibition. The ROCK inhibitor H-1152 induced a strong concentration-dependent inhibition of a KCl CRC. A relatively low GF-109203X concentration (1 μM) sufficient to inhibit conventional PKC isotypes also inhibited the KCl CRC but did not affect the maximum tension. ROCK inhibitors had no effect on the Ca2+ CRC induced in Triton X-100 or α-toxin permeabilized tissues, but depressed the maximum contraction induced in β-escin permeabilized tissue. GF-109203X at 1 μM depressed the maximum Ca2+-dependent contraction induced in α-toxin permeabilized tissue and had no effect on the Ca2+ CRC induced in Triton X-100 permeabilized tissue. The MLC kinase inhibitor wortmannin (1 μM) strongly depression the Ca2+ CRCs in tissues permeabilized with Triton X-100, α-toxin and β-escin. H-1152 inhibited contractions induced by a single exposure to a submaximum [Ca2+] (pCa 6) in both rabbit and mouse femoral arteries. These data indicate that β-escin permeabilized muscle preserves GPCR-independent, Ca2+- and ROCK-dependent, Ca2+ sensitization.

  1. The influence of Triton X-100 surfactant on the morphology and properties of zinc sulfide nanoparticles for applications in azo dyes degradation

    International Nuclear Information System (INIS)

    Dumbrava, Anca; Berger, Daniela; Prodan, Gabriel; Matei, Cristian; Moscalu, Florin; Diacon, Aurel

    2017-01-01

    Herein we report the synthesis, by two different routes, of ZnS nanoparticles capped with Triton X-100 (TX), which were characterized by X-ray diffraction, transmission electron microscopy, high resolution electron microscopy, selected area electron diffraction, energy dispersive X-ray spectroscopy, FTIR spectroscopy, UV–visible spectroscopy, photoluminescence spectroscopy, and surface area measurements. The TX-capped ZnS nanopowders have a very good photocatalytic activity and high specific surface area, depending on the synthesis route; e.g. an azo dye solution is almost complete photobleached in only 60 min (a photocatalytic activity of 97.79%) using TX-capped ZnS nanopowder, with specific surface area of 191 m 2 /g, and further a photocatalytic activity of 99.75% was achieved in 120 min. Based on the photocatalytic results, the ZnS nanopowders can be considered suitable catalysts for a green, very efficient and quick strategy for removing of organic pollutants from wastewaters. - Highlights: • Triton X-100 was used as surfactant in ZnS nanopowders synthesis by two methods. • Triton X-capped ZnS nanoparticles with high specific surface area were synthesized. • A very high capacity for bleaching an azo dye solution was evidenced. • Some of ZnS powders properties were crucially modified by the synthesis technique.

  2. Phase behaviour and microstructure of the micro-emulsions composed of cholinium-based ionic liquid, Triton X-100 and water

    International Nuclear Information System (INIS)

    Pei, Yuanchao; Huang, Yanjie; Li, Lin; Wang, Jianji

    2014-01-01

    Highlights: • The microemulsions composed of cholinium-based ionic liquid, Triton X-100 and water have been prepared and characterised. • Ternary phase diagrams of the microemulsions have been established at T = 298.15 K. • The microemulsions exhibit IL-in-water, bicontinuous and water-in-IL microstructures. • Droplets with the size smaller than 20 nm are formed in these IL-based microemulsions. - Abstract: In this paper, micro-emulsions composed of cholinium-based ionic liquids (ILs), octylphenol ethoxylate (Triton X-100) and water were prepared. These ternary systems were found to be stable over 12 months at room temperature. Their phase behaviour was investigated by using cloud titrations, and their microstructures were characterised by means of cyclic voltammetry and electrical conductance measurements at T = 298.15 K. It was shown that the micro-emulsions exhibited IL-in-water, bi-continuous and water-in-IL microstructures. Dynamic light scattering data suggest that Triton X-100 forms micelles in water, which were swelled by the ILs added. Droplets with the size about 20 nm were formed in these IL-based micro-emulsions, and the droplet size increased with the increase of the IL concentrations. These IL-based micro-emulsions may have potential in drug delivery, chemical reactions and nanomaterial preparation as a new type of nanoreactors

  3. The influence of Triton X-100 surfactant on the morphology and properties of zinc sulfide nanoparticles for applications in azo dyes degradation

    Energy Technology Data Exchange (ETDEWEB)

    Dumbrava, Anca, E-mail: adumbrava@univ-ovidius.ro [Department of Chemistry and Chemical Engineering, Ovidius University of Constanta, 124 Mamaia Blvd., Constanta 900527 (Romania); Berger, Daniela, E-mail: danaberger01@yahoo.com [University Politehnica of Bucharest, Department of Inorganic Chemistry, Physical Chemistry and Electrochemistry, Polizu Street 1-7, Bucharest 011061 (Romania); Prodan, Gabriel [Electron Microscopy Laboratory, Ovidius University of Constanta, 124 Mamaia Blvd., Constanta 900527 (Romania); Matei, Cristian [University Politehnica of Bucharest, Department of Inorganic Chemistry, Physical Chemistry and Electrochemistry, Polizu Street 1-7, Bucharest 011061 (Romania); Moscalu, Florin [Department of Physics, Ovidius University of Constanta, 124 Mamaia Blvd., Constanta 900527 (Romania); Diacon, Aurel [University Politehnica of Bucharest, Department of Bioresources and Polymer Science, Polizu Street 1-7, Bucharest 011061 (Romania)

    2017-06-01

    Herein we report the synthesis, by two different routes, of ZnS nanoparticles capped with Triton X-100 (TX), which were characterized by X-ray diffraction, transmission electron microscopy, high resolution electron microscopy, selected area electron diffraction, energy dispersive X-ray spectroscopy, FTIR spectroscopy, UV–visible spectroscopy, photoluminescence spectroscopy, and surface area measurements. The TX-capped ZnS nanopowders have a very good photocatalytic activity and high specific surface area, depending on the synthesis route; e.g. an azo dye solution is almost complete photobleached in only 60 min (a photocatalytic activity of 97.79%) using TX-capped ZnS nanopowder, with specific surface area of 191 m{sup 2}/g, and further a photocatalytic activity of 99.75% was achieved in 120 min. Based on the photocatalytic results, the ZnS nanopowders can be considered suitable catalysts for a green, very efficient and quick strategy for removing of organic pollutants from wastewaters. - Highlights: • Triton X-100 was used as surfactant in ZnS nanopowders synthesis by two methods. • Triton X-capped ZnS nanoparticles with high specific surface area were synthesized. • A very high capacity for bleaching an azo dye solution was evidenced. • Some of ZnS powders properties were crucially modified by the synthesis technique.

  4. Streamlined Membrane Proteome Preparation for Shotgun Proteomics Analysis with Triton X-100 Cloud Point Extraction and Nanodiamond Solid Phase Extraction

    Directory of Open Access Journals (Sweden)

    Minh D. Pham

    2016-05-01

    Full Text Available While mass spectrometry (MS plays a key role in proteomics research, characterization of membrane proteins (MP by MS has been a challenging task because of the presence of a host of interfering chemicals in the hydrophobic protein extraction process, and the low protease digestion efficiency. We report a sample preparation protocol, two-phase separation with Triton X-100, induced by NaCl, with coomassie blue added for visualizing the detergent-rich phase, which streamlines MP preparation for SDS-PAGE analysis of intact MP and shot-gun proteomic analyses. MP solubilized in the detergent-rich milieu were then sequentially extracted and fractionated by surface-oxidized nanodiamond (ND at three pHs. The high MP affinity of ND enabled extensive washes for removal of salts, detergents, lipids, and other impurities to ensure uncompromised ensuing purposes, notably enhanced proteolytic digestion and down-stream mass spectrometric (MS analyses. Starting with a typical membranous cellular lysate fraction harvested with centrifugation/ultracentrifugation, MP purities of 70%, based on number (not weight of proteins identified by MS, was achieved; the weight-based purity can be expected to be much higher.

  5. Solvent extraction of lanthanoid, yttrium and some polyvalent metal ions with phosphoric acid esters of Triton X-100

    International Nuclear Information System (INIS)

    Yoshida, Isao; Hirasawa, Jun'ichi; Tsumagari, Hiroto; Ueno, Keihei; Takagi, Makoto.

    1986-01-01

    Polyoxyethylene chain-containing nonionic surfactant, Triton X-100 (decaethyleneglycol mono(4-(1,1,3,3-tetramethylbutyl)phenyl) ether; ROH) was derived to phosphate mono-, di-, and tri-esters RH 2 PO 4 , R 2 HPO 4 and R 3 PO 4 ; abbreviated as MTP, DTP and TTP, respectively) and the metal extraction behavior of these phosphate esters was studied in 1,2-dichloroethane-water system with particular emphasis on lanthanoid(III), yttrium(III), and some other polyvalent metal ions. The extraction was carried out at pH 2 in the presence (for TTP) or in the absence (for MTP and DTP) of picric acid. The metal extraction ability of these extractants followed the order of MTP > DTP > TTP under these extraction conditions. In the extraction by MTP and DTP, the extractability of lanthanoid ions increased with the increase in their atomic number. Mean separation factor of thirteen pairs of adjacent lanthanoids was evaluated to be 1.7 for MTP and 1.4 for DTP. On the other hand, the corresponding values for TTP was almost unity. None of these compounds practically extracted other polyvalent metal ions except iron ion. Iron(III) ion was extracted with MTP and with DTP to a similar level to those of lanthanoid ions. (author)

  6. UV-A photooxidation of β-carotene in Triton X-100 micelles by nitrodiphenyl ether herbicides

    International Nuclear Information System (INIS)

    Orr, G.L.; Hogan, M.E.

    1985-01-01

    Photooxidation of β-carotene in Triton X-100 micelles was stimulated by lipophilic nitrodiphenyl ether herbicides at concentrations as low as 5 μM after 15 min in UV radiation (UV-A between 315 and 400 nm). Bleaching of β-carotene by acifluorfen-methyl [methyl 5-[2-chloro-4-(trifluoromethyl)phenoxy]-2-nitrobenzoate] was proportional to UV-A intensity and independent of pH. White light (400-700 nm) alone was without effect. At pH 6.5, 100 μM acifluorfen [sodium 5-[2-chloro-4-(trifluoromethyl)phenoxy]-2-nitrobenzoate], a water-soluble nitrodiphenyl ether, stimulated photooxidation of β-carotene after 15 min in UV-A radiation. Activity of 200 μM acifluorfen was enhanced at pHs between 3.5 and 6.5. The chlorodiphenyl ether analogue of acifluorfen-methyl, methyl 5-[2-chloro-4-(trifluoromethyl)phenoxy]-2-chlorobenzoate, exhibited little activity at 200 μM and 200 μM phenyl ether was without effect. Activation energy for acifluorfen-methyl stimulated β-carotene photooxidation near 20 and 30 0 C was 40.3 and 5.6 kJ mol -1 , respectively. Subsequent to UV-A exposure and placement into darkness no further bleaching of β-carotene was detected, indicating that reactive species were generated only in light and consumed quickly in darkness

  7. Effects of gamma radiation on phase behaviour and critical micelle concentration of Triton X-100 aqueous solutions

    International Nuclear Information System (INIS)

    Valdes Diaz, G.; Rodriguez-Calvo, S.; Perez-Gramatges, A.; Rapado-Paneque, M.; Fernandez-Lima, F. A.; Ponciano, C. R.; Silveira, E. F. . E-mail. apgram@instec.cu

    2007-01-01

    Ionising radiation used for sterilisation can have an effect on the physico-chemical properties of pharmaceutically relevant excipient systems, affecting therefore the stability of the formulation. The effect of gamma irradiation on the phase behaviour (cloud point - CP) and critical micelle concentration (CMC) of aqueous solutions of Triton X-100, used as a model nonionic surfactant, is investigated in this paper. Micellar solutions irradiated with ?-rays in a dose range between 0 and 70 kGy, including the sterilisation range of pharmaceutical preparations, were analysed using mass spectrometry. Results show a slight shift in molecular mass distribution of ethoxylated surfactant, which indicates degradation of polyethoxylated chains by water radical attacks. This fact, combined with the formation of cross-linked species, is considered to be responsible for the decrease observed in CP and CMC values of micellar solutions at all absorbed doses. There is no spectroscopic evidence of radiation damage to aromatic ring or hydrocarbon tail of surfactant. Models based on Flory-Huggins theory were employed to estimate CP from changes in mass distribution and to obtain cross-linking fractions. (Author)

  8. Design and operation of the pellet charge exchange diagnostic for measurement of energetic confined alphas and tritons on TFTR

    International Nuclear Information System (INIS)

    Medley, S.S.; Duong, H.H.

    1996-05-01

    Radially-resolved energy and density distributions of the energetic confined alpha particles in D-T experiments on TFTR are being measured by active neutral particle analysis using low-Z impurity pellet injection. When injected into a high temperature plasma, an impurity pellet (e.g. Lithium or Boron) rapidly ablates forming an elongated cloud which is aligned with the magnetic field and moves with the pellet. This ablation cloud provides a dense target with which the alpha particles produced in D-T fusion reactions can charge exchange. A small fraction of the alpha particles incident on the pellet ablation cloud will be converted to helium neutrals whose energy is essentially unchanged by the charge transfer process. By measuring the resultant helium neutrals escaping from the plasma using a mass and energy resolving charge exchange analyzer, this technique offers a direct measurement of the energy distribution of the incident high-energy alpha particles. Other energetic ion species can be detected as well, such as tritons generated in D-D plasmas and H or He 3 RF-driven minority ion tails. The diagnostic technique and its application on TFTR are described in detail

  9. Trichobothrial mediation of an aquatic escape response: Directional jumps by the fishing spider, Dolomedes triton, foil frog attacks

    Directory of Open Access Journals (Sweden)

    Robert B. Suter

    2003-07-01

    Full Text Available Fishing spiders (Pisauridae frequent the surfaces of ponds and streams and thereby expose themselves to predation by a variety of aquatic and semi-aquatic vertebrates. To assess the possibility that the impressive jumps of fishing spiders from the water surface function in evading attacks by frogs, attacks by bullfrogs (Rana catesbiana and green frogs (R. clamitans on Dolomedes triton were studied. Both the attack dynamics of the frogs and the evasive behaviors of the spiders were recorded at 250 frames per second. A freeze-dried bullfrog, propelled toward spiders with acceleration, posture, and position that approximated the natural attack posture and dynamics, was used to assess the spiders' behavior. Qualitatively, the spiders responded to these mock-attacks just as they had to attacks by live frogs: jumping (N=29 jumps, 56.9% of instances, rearing the legs nearest the attacking frog (N=15, 29.4%, or showing no visible response (N=7, 13.7%. Spiders that jumped always did so away (in the vertical plane from the attack (mean =137° vs. vertical at 90° or horizontally toward the frog at 0°. The involvement of the trichobothria (leg hairs sensitive to air movements, and the eyes as sensory mediators of the evasion response was assessed. Spiders with deactivated trichobothria were significantly impaired relative to intact and sham-deactivated spiders, and relative to spiders in total darkness. Thus, functional trichobothria, unlike the eyes, are both necessary and sufficient mediators of the evasion response. Measurements of air flow during frog attacks suggest that an exponential rise in flow velocity is the airborne signature of an attack.

  10. Multinuclear NMR characterization of CTAB-hexanol-water, sodium oleate-butanol-water and triton X-100-decanol-water microemulsions

    International Nuclear Information System (INIS)

    Nagy, J.B.; Bodart-Ravet, I.; Derouane, E.G.; Gourgue, A.; Verfaillie, J.P.

    1989-01-01

    Multinuclear NMR is a very valuable tool to characterize micellar systems or microemulsions. It allows one to determine c.m.c. values, to study the dissolution of organic molecules, the solvation of cations and anions, the structural changes occurring in a ternary diagram, the mobility of the molecules, etc. This review paper essentially deals with the characterization of cationic (CTAB-hexanol-water), anionic (sodium oleate-butanol-water) and neutral (Triton X-100-decanol-water) reversed micelles. The use of paramagnetic ions [Ni(II), CO(II), Fe(III), etc.] is particularly emphasized to characterize the site of solubilization and their interaction with surfactant and cosurfactant molecules 13 C-NMR). It is concluded, that the metallic ions are basically solvated in the inner water cores and one or more hexanol molecules are included in their first coordination shells in the CTAB-hexanol-water microemulsions. In the Triton X-100-decanol-water microemulsions, both decanol and Triton X-100 molecules enter the first coordination shell of Co(II) ions which are dissolved in both aqeous water cores and the organic medium. 19 F-NMR of a fluorinated probe molecule is particularly useful to study the size of the inner water cores. The method is based on the partition of the molecules between the interface and the organic medium. However, this method has to be applied with great care, and the computed data have to be compared to other physico-chemical results. Both 19 F- and 23 Na-NMR results show a great variation of the behaviour of the sodium oleate-butanol-water system in the so-called bicontinuous region. The Na + ions are oriented independently on a hypothetical inverse micellar droplet. (author). 43 refs.; 18 figs.; 7 tabs

  11. Comparative proteomics of Staphylococcus aureus and the response of methicillin-resistant and methicillin-sensitive strains to Triton X-100

    DEFF Research Database (Denmark)

    Cordwell, Stuart J; Larsen, Martin Røssel; Cole, Rebecca T

    2002-01-01

    profiles of S. aureus strains COL (methicillin-resistant) and 8325 (methicillin-sensitive). Reference mapping via this approach identified 377 proteins that corresponded to 266 distinct ORFs. Amongst these identified proteins were 14 potential virulence factors. The production of 41 'hypothetical' proteins....... Comparative maps were used to characterize the S. aureus response to treatment with Triton X-100 (TX-100), a detergent that has been shown to reduce methicillin resistance independently of an interaction with the mecA-encoded penicillin-binding protein 2a. In response to growth of the bacteria in the presence...

  12. ATP-induced reactivation of ram testicular, cauda epididymal, and ejaculated spermatozoa extracted with Triton X-100.

    Science.gov (United States)

    White, I G; Voglmayr, J K

    1986-02-01

    It was possible to demembrante and reactivate not only freshly collected testicular, cauda epididymal, and ejaculated ram sperm but also sperm that had been stored for several days at 0 degrees C and for several months at -196 degrees C in rete testis fluid or egg yolk citrate media. Sperm were usually washed free of seminal plasma before demembranation, but this was not essential for reactivation. Bovine serum albumin (1.0%) in the wash medium increased the survival of sperm, but more than 0.25% in the extraction medium decreased reactivation. A macro-molecular component of cauda epididymal fluid also inhibited the reactivation of testicular sperm. Triton X-100 concentrations between 0.01% and 1.00% in the extraction medium were satisfactory for demembranating the sperm. Rapid cooling (i.e., cold shock) mimicked the effect of detergent in making the sperm responsive to added ATP and demonstrated that damage to ram sperm in cold shock does not involve the axoneme. Ejaculated and cauda sperm were reactivated immediately on addition of ATP and activity persisted for up to 10 min. Testicular sperm, on the other hand, required about 4 min to become fully reactivated. The optimal ATP concentration for activation of sperm was 0.1-1.0 mM. Magnesium ions (0.1-1.0 mM) were important for reactivation, and testicular sperm required a higher magnesium concentration than did cauda or ejaculated sperm. Manganese ions were almost as effective as magnesium for reactivating cauda epididymal and ejaculated sperm. Cobalt and cadmium ions were much less active for cauda and ejaculated sperm and none of these ions were effective for testicular sperm. Fluoride (25-50 mM) inhibited reactivation. The presence of 50 microM cAMP in the extraction medium or preincubation of testicular sperm with theophylline or caffeine increased low levels of activation, but this was not evident with ejaculated or cauda sperm. We conclude that the motor apparatus is already functionally assembled in

  13. Simultaneous Spectrophotometric Determination of Copper, Nickel, and Zinc Using 1-(2-Thiazolylazo)-2-Naphthol in the Presence of Triton X-100 Using Chemometric Methods

    International Nuclear Information System (INIS)

    Low, Kah Hin; Zain, Sharifuddin Md; Abas, Mhd. Radzi; Misran, Misni; Mohd, Mustafa Ali

    2009-01-01

    Multivariate models were developed for the simultaneous spectrophotometric determination of copper (II), nickel (II) and zinc (II) in water with 1-(2-thiazolylazo)-2-naphthol as chromogenic reagent in the presence of Triton X-100. To overcome the drawback of spectral interferences, principal component regression (PCR) and partial least square (PLS) multivariate calibration approaches were applied. Performances were validated with several test sets, and their results were then compared. In general, no significant difference in analytical performance between PLS and PCR models. The root mean square error of prediction (RMSEP) using three components for Cu 2+ , Ni 2+ and Zn 2+ were 0.018, 0.010, 0.011 ppm, respectively. Figures of merit such as sensitivity, analytical sensitivity, limit of detection (LOD) were also estimated. High reliability was achieved when the proposed procedure was applied to simultaneous determination of Cu 2+ , Ni 2+ and Zn 2+ in synthetic mixture and tap water

  14. Cloud point extraction and speciation of iron(3) of 10-7-10-6 M level using 8-quinolinol derivatives and triton X-100

    International Nuclear Information System (INIS)

    Ohashi, K.; Ougiyanagi, J.; Choi, S.Y.; Ito, H.; Imura, H.

    2001-01-01

    The cloud point extraction behaviour, specification, and determination of traces of iron(III) with 8-quinolinol derivatives (HA), such as 8-quinolinol (HQ), 2-methyl-8-quinolinol (HMQ), and 2-methyl-5-octyl-oxy-methyl-8-quinolinol (HMO 8 Q) were investigated. Above pH 4.0, more than 95% of iron(III) was extracted with 5.00 x 10 -2 M HQ, HMQ, and HMO 8 Q in 4 (v/v)% Triton X-100. The proposed method was applied to the determination of iron(III) in the Riverine Water Reference (JAC 0031 and JAC 0032) by graphite furnace atomic absorption spectrometry. The results agreed well with the certified values within 2% of the RSD. (authors)

  15. Separation of Cr(III) from Cr(VI) by Triton X-100 Cerium (Iv) Phosphate as a Surface Active Ion Exchanger

    International Nuclear Information System (INIS)

    El-Azony, K.M.; Ismail Aydia, M.; El-Mohty, A.A.

    2010-01-01

    A new and simple high-performance liquid chromatography (HPLC) method with ultraviolet (UV) detection has been developed for the determination of both Cr (III) and Cr (VI) ions. Chromium species were determined by HPLC using a stationary phase consisting of a reversed phase column (Nucleosil phenyl column; 250 mm x 4.6 mm,5 μm), and a mobile phase consisting of a mixture of methanol: water(70 : 30 v/v), in which the complexing agent di-(2-ethylhexyl) phosphoric acid (DEHPA) was dissolved. The UV detection was carried out at wavelength 650 nm. Separation of Cr (III) from Cr (VI) on Triton X-100 cerium(IV) phosphate(TX-100 CeP) as a surface active ion exchanger was investigated. TX-100 CeP has been synthesized, characterized using IR, X-Ray, TGA/DTA and elemental analysis. The ion exchange capacity and chemical stability in different HCl concentration have been studied

  16. Conductometric study of sodium dodecyl sulfate - nonionic surfactant (Triton X-100, Tween 20, Tween 60, Tween 80 or Tween 85 mixed micelles in aqueous solution

    Directory of Open Access Journals (Sweden)

    Ćirin Dejan M.

    2012-01-01

    Full Text Available The present study is concerned with the determination of the critical micelle concentration (cmc of mixed micelles of sodium dodecyl sulfate with one of five nonionic surfactants (Triton X-100, Tween 20, Tween 60, Tween 80 or Tween 85 from conductance measurements. Based on the calculated values of the β parameters we have noticed that SDS-nonionic surfactants mostly showed strong synergistic effect. It was found that nonionic surfactants with mainly longer and more hydrophobic tail show stronger interactions with hydrophobic part of SDS, thus expressing stronger synergism. In SDS-Tween 80 binary system the strongest synergistic effect was noticed. SDS-Tween 85 micellar system showed antagonistic effect, most probably because the presence of the double bond in its three hydrophobic tails (three C18 tails makes it sterically rigid.

  17. Obtaining Soluble Folded Proteins from Inclusion Bodies Using Sarkosyl, Triton X-100, and CHAPS: Application to LB and M9 Minimal Media.

    Science.gov (United States)

    Massiah, Michael A; Wright, Katharine M; Du, Haijuan

    2016-04-01

    This unit describes a straightforward and efficient method of using sarkosyl to solubilize and recover difficult recombinant proteins, such as GST- and His6 -tagged fusion proteins, that are overexpressed in E. coli. This protocol is especially useful for rescuing recombinant proteins overexpressed in M9 minimal medium. Sarkosyl added to lysis buffers helps with both protein solubility and cell lysis. Higher percentage sarkosyl (up to 10%) can extract >95% of soluble protein from inclusion bodies. In the case of sarkosyl-solubilized GST-fusion proteins, batch-mode affinity purification requires addition of a specific ratio of Triton X-100 and CHAPS, while sarkosyl-solubilized His6 -tagged fusion proteins can be directly purified on Ni(2+) resin columns. Proteins purified by this method could be widely used in biological assays, structure analysis and mass spectrum assay. Copyright © 2016 John Wiley & Sons, Inc.

  18. Two-step preparation of nano-scaled magnetic chitosan particles using Triton X-100 reversed-phase water-in-oil microemulsion system

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Zhengkun; Jiang, Feihong [College of Food Science and Engineering, Northwest A and F University, Yangling, Shaanxi 712100 (China); Lee, Tung-Ching, E-mail: lee@aesop.rutgers.edu [Department of Food Science, Rutgers, the State University of New Jersey, 65 Dudley Road, New Brunswick, NJ 08901 (United States); Yue, Tianli, E-mail: yuetl305@nwsuaf.edu.cn [College of Food Science and Engineering, Northwest A and F University, Yangling, Shaanxi 712100 (China)

    2013-12-25

    Highlights: •A new two-step route for nano-scaled magnetic chitosan particles preparation. •Triton X-100 reversed-phase microemulsion system was used for chitosan coating. •Narrow size distribution of magnetic chitosan nanoparticles was achieved. •Quantitative evaluation of recoverability for the magnetic chitosan nanoparticles. -- Abstract: A new two-step route for the preparation of nano-scaled magnetic chitosan particles has been developed, different from reported one-step in situ preparation and two-step preparation method of reversed-phase suspension, Triton X-100 reversed-phase water-in-oil microemulsion encapsulation method was employed in coating the pre-prepared Fe{sub 3}O{sub 4} nanoparticles with chitosan. The resultant magnetic chitosan particles owned a narrow size distribution ranging from 50 to 92 nm. X-ray diffraction patterns (XRD) indicated that the chitosan coating procedure did not change the spinal structure of Fe{sub 3}O{sub 4} magnetic nanoparticles. The results of Fourier transform infrared (FTIR) analysis and thermogravimetric analysis (TGA) demonstrated that the chitosan was coated on Fe{sub 3}O{sub 4} nanoparticles and its average mass content was ∼50%. The saturated magnetization of the magnetic Fe{sub 3}O{sub 4}/chitosan nanoparticles reached 18.62 emu/g, meanwhile, the nanoparticles showed the characteristics of superparamagnetism. The magnetic chitosan nanoparticles showed a high recoverability of 99.99% in 10 min when pH exceeded 4. The results suggested that the as-prepared magnetic chitosan particles were nano-scaled with a narrow size distribution and a high recoverability.

  19. Two-step preparation of nano-scaled magnetic chitosan particles using Triton X-100 reversed-phase water-in-oil microemulsion system

    International Nuclear Information System (INIS)

    Zhou, Zhengkun; Jiang, Feihong; Lee, Tung-Ching; Yue, Tianli

    2013-01-01

    Highlights: •A new two-step route for nano-scaled magnetic chitosan particles preparation. •Triton X-100 reversed-phase microemulsion system was used for chitosan coating. •Narrow size distribution of magnetic chitosan nanoparticles was achieved. •Quantitative evaluation of recoverability for the magnetic chitosan nanoparticles. -- Abstract: A new two-step route for the preparation of nano-scaled magnetic chitosan particles has been developed, different from reported one-step in situ preparation and two-step preparation method of reversed-phase suspension, Triton X-100 reversed-phase water-in-oil microemulsion encapsulation method was employed in coating the pre-prepared Fe 3 O 4 nanoparticles with chitosan. The resultant magnetic chitosan particles owned a narrow size distribution ranging from 50 to 92 nm. X-ray diffraction patterns (XRD) indicated that the chitosan coating procedure did not change the spinal structure of Fe 3 O 4 magnetic nanoparticles. The results of Fourier transform infrared (FTIR) analysis and thermogravimetric analysis (TGA) demonstrated that the chitosan was coated on Fe 3 O 4 nanoparticles and its average mass content was ∼50%. The saturated magnetization of the magnetic Fe 3 O 4 /chitosan nanoparticles reached 18.62 emu/g, meanwhile, the nanoparticles showed the characteristics of superparamagnetism. The magnetic chitosan nanoparticles showed a high recoverability of 99.99% in 10 min when pH exceeded 4. The results suggested that the as-prepared magnetic chitosan particles were nano-scaled with a narrow size distribution and a high recoverability

  20. Monitoring corrosion and corrosion control of iron in HCl by non-ionic surfactants of the TRITON-X series - Part III. Immersion time effects and theoretical studies

    International Nuclear Information System (INIS)

    Amin, Mohammed A.; Ahmed, M.A.; Arida, H.A.; Kandemirli, Fatma; Saracoglu, Murat; Arslan, Taner; Basaran, Murat A.

    2011-01-01

    Graphical abstract: . Display Omitted Research highlights: → The inhibition effect of TX-100, TX-165 and TX-305 on iron corrosion in 1.0 M HCl was studied. → TX-305 inhibited iron corrosion more effectively than TX-100 and TX-165. → In most cases, inhibition efficiency increased with time during the first 60 min of immersion, then decreased. → Calculated quantum chemical parameters confirmed the experimental inhibition efficiencies of the tested surfactants. - Abstract: The inhibition performance of three selected non-ionic surfactants of the TRITON-X series, namely TRITONX-100 (TX-100), TRITON-X-165 (TX-165) and TRITON-X-305 (TX-305), on the corrosion of iron was studied in 1.0 M HCl solutions as a function of inhibitor concentration (0.01-0.20 g L -1 ) and immersion time (0.0-8 h) at 298 K. Measurements were conducted based on Tafel polarization, LPR and impedance studies. At high frequencies, the impedance spectrum showed a depressed capacitive loop in the complex impedance plane, whose diameter is a function of the immersion time and the type and concentration of the introduced surfactant. In all cases, an inductive loop was observed in the low frequency and this could be attributed to the adsorption behavior. The inhibition efficiency increased with immersion time, reached a maximum and then decreased. This was attributed to the orientation change of adsorbed surfactant molecules. TX-305 inhibited iron corrosion more effectively than TX-100 and TX-165. The frontier orbital energies, the energy gap between frontier orbitals, dipole moments (μ), charges on the C and O atoms, the polarizabilities, and the quantum chemical descriptors were calculated. The quantum chemical calculation results inferred that for the HOMO representing the condensed Fukui function for an electrophilic attack (f k + ), the contributions belong to the phenyl group and the oxygen atom attached to the phenyl group for each tested surfactant. Quantitative structure

  1. High transmittance cadmium oxysulfide Cd(S,O) buffer layer grown by triton X-100 mediated chemical bath deposition for thin-film heterojunction solar cells

    Science.gov (United States)

    Ballipinar, Faruk; Rastogi, A. C.

    2017-01-01

    Polycrystalline 100-190 nm Cd(S,O) n-type semiconductor thin films of high transparency in the visible range are deposited by a surfactant Triton X-100 mediated chemical bath deposition process. The crystalline structure of the films revealed by X-ray diffraction data shows a cubic-CdO phase signified by (111) and (200) planes alongside the (002), (220), and (110) planes from hexagonal-CdS. The invariance of the 2θ position of the (002) CdS diffraction is interpreted in terms of the growth of the composite film essentially by the formation of a dilute interstitial alloy of CdO and CdS. This is confirmed by Raman spectra which, besides the CdS 1LO and 2LO modes at 300 and 600 cm-1, also show Raman lines from CdO at 1098 cm-1 and 952 cm-1 assigned as overtone of 2LO phonon modes and 556 cm-1 due to band crossing between LO and TO modes of CdO. Optical spectra of Cd(S,O) films show a median transmittance of >85% compared to ˜70% for CdS films in the 550-1000 nm wavelength range. The Cd(S,O) films show optical bandgap varying from 2.34 to 2.26 eV with increasing CdO fraction but retain high sub-bandgap transmission and sharp band edge threshold. The Cd(S,O) films thus offer an alternative to the CdS buffer layer in the heterojunction solar cells, which has major shortcoming of poor stability and high sub-bandgap absorption. The photoluminescence spectra of Cd(S,O) films show three green bands, of which one is the near band edge transition at 511.5 nm, the same as in CdS, the second band at 526.0 nm that red shifted from the CdS position is due to shallow donor-acceptor defects arising from structural change due to CdO, and the third band at 543.6 nm (2.28 eV) originates from direct band transition in CdO. The growth mechanism of Cd(S,O) films is described, which invokes that the Triton X-100 molecule modifies the microenvironment around adsorbed [Cd(NH3)4]2+ species, thereby inducing two concurrent reactions, one with SH- species that cause CdS formation and the

  2. Estabilización y desestabilización por adsorción sobre coloides modelo de Triton X-100

    Directory of Open Access Journals (Sweden)

    Romero-Cano, M. S.

    2000-08-01

    Full Text Available The colloidal stability of polystyrene particles with different surface functional groups (sulfate and carboxyl has been studied after adsorption of Triton X-100. The coverage degree and the medium pH were the main factors in this study. Three different types of colloidal stabilization were found, which can be clasified as a function of the relationship between the atractive interaction energy (VA, Van der Waals type and the steric interaction energy (VS, repulsive type: electrostatic (VS = 0, electrosteric (VS < ⎥VA⎥, and steric (VS > ⎥VA⎥. The main difference between these stabilization types is the response against the electrolyte concentration: the first and second cases are affected by electrolyte addition, while the third one does not.

    Se ha estudiado la estabilidad coloidal de partículas de poliestireno con diferente funcionalidad superficial (sulfato y carboxilo después de la adsorción de Triton X-100. El grado de recubrimiento y el pH del medio fueron variables fundamentales en el estudio. Se han encontrado tres tipos diferentes de estabilización coloidal que pueden clasificarse en función de la relación entre la energía de interacción atractiva de van der Waals (VA y la energía de interacción repulsiva de origen estérico (VS: electrostático (VS = 0, electroestérico (VS < ⎥VA⎥ y estérico (VS >⎥VA⎥. La diferencia fundamental entre estos tres tipos de estabilización es la respuesta frente a la concentración de electrolito: los dos primeros son sensibles a la adición del mismo mientras que el último no lo es. Adicionalmente se han encontrado fenómenos de desestabilización, no predichos por la teoría DLVO extendida, los cuales dependen de la funcionalidad superficial, del grado de recubrimiento y del pH del medio de dispersión.

  3. Monitoring corrosion and corrosion control of iron in HCl by non-ionic surfactants of the TRITON-X series - Part II. Temperature effect, activation energies and thermodynamics of adsorption

    International Nuclear Information System (INIS)

    Amin, Mohammed A.; Ahmed, M.A.; Arida, H.A.; Arslan, Taner; Saracoglu, Murat; Kandemirli, Fatma

    2011-01-01

    Research highlights: → TX-305 exhibits inhibiting properties for iron corrosion more than TX-165 and TX 100. → Inhibition efficiency increases with temperature, suggesting chemical adsorption. → The three tested surfactants act as mixed-type inhibitors with cathodic predominance. → Validation of corrosion rates measured by Tafel extrapolation method is confirmed. - Abstract: The inhibition characteristics of non-ionic surfactants of the TRITON-X series, namely TRITON-X-100 (TX-100), TRITON-X-165 (TX-165) and TRITON-X-305 (TX-305), on the corrosion of iron was studied in 1.0 M HCl solutions as a function of inhibitor concentration (0.005-0.075 g L -1 ) and solution temperature (278-338 K). Measurements were conducted based on Tafel extrapolation method. Electrochemical frequency modulation (EFM), a non-destructive corrosion measurement technique that can directly give values of corrosion current without prior knowledge of Tafel constants, is also presented. Experimental corrosion rates determined by the Tafel extrapolation method were compared with corrosion rates obtained by the EFM technique and an independent method of chemical analysis. The chemical method of confirmation of the corrosion rates involved determination of the dissolved cation, using ICP-AES (inductively coupled plasma atomic emission spectrometry). The aim was to confirm validation of corrosion rates measured by the Tafel extrapolation method. Results obtained showed that, in all cases, the inhibition efficiency increased with increase in temperature, suggesting that chemical adsorption occurs. The adsorptive behaviour of the three surfactants followed Temkin-type isotherm. The standard free energies of adsorption decreased with temperature, reflecting better inhibition performance. These findings confirm chemisorption of the tested inhibitors. Thermodynamic activation functions of the dissolution process were also calculated as a function of each inhibitor concentration. All the results

  4. Phenolic extract from Ocimum basilicum restores lipid metabolism in Triton WR-1339-induced hyperlipidemic mice and prevents lipoprotein-rich plasma oxidation

    Directory of Open Access Journals (Sweden)

    Ilham Touiss

    2017-03-01

    Full Text Available In this study we investigated the hypolipidemic and anti-lipoprotein-oxidation activities of phenolic extract from sweet basil a popular culinary herb. The hypolipidemic activity was studied in mice model injected intraperitoneally with Triton WR-1339 at a dose of 200 mg/kg body weight. The animals were grouped as follows: normolipidemic control group (n = 8, hyperlipidemic control group (n = 8 and phenolic extract-treated group (n = 8 at a dose of 200 mg/kg body weight. After 7 h and 24 h treatment, the oral administration of the phenolic extract exerts a significant reduction of plasma total cholesterol, triglycerides and LDL-cholesterol concentrations (P < 0.001. On the other hand, we demonstrated that the phenolic extract prevents plasma lipid oxidation by 16% (P < 0.001, 20% (P < 0.001, 32% (P < 0.001 and 44% (P < 0.001 at a doses of 10, 25, 50 and 100 μg/mL, respectively. The results were compared with ascorbic acid used as standard synthetic antioxidant. HPLC analysis shows that the extract contains 4 major phenolics and is especially rich in rosmarinic acid. This finding indicates that the phenolic extract might be beneficial in lowering hyperlipidemia and preventing atherosclerosis.

  5. Experimental measurements of low temperature rate coefficients for neutral-neutral reactions of interest for atmospheric chemistry of Titan, Pluto and Triton: reactions of the CN radical.

    Science.gov (United States)

    Morales, Sébastien B; Le Picard, Sébastien D; Canosa, André; Sims, Ian R

    2010-01-01

    The kinetics of the reactions of cyano radical, CN (X2sigma+) with three hydrocarbons, propane (CH3CH2CH3), propene (CH3CH=CH2) and 1-butyne (CH[triple band]CCH2CH3) have been studied over the temperature range of 23-298 K using a CRESU (Cinétique de Réaction en Ecoulement Supersonique Uniforme or Reaction Kinetics in Uniform Supersonic Flow) apparatus combined with the pulsed laser photolysis-laser induced fluorescence technique. These reactions are of interest for the cold atmospheres of Titan, Pluto and Triton, as they might participate in the formation of nitrogen and carbon bearing molecules, including nitriles, that are thought to play an important role in the formation of hazes and biological molecules. All three reactions are rapid with rate coefficients in excess of 10(-10) cm3 molecule(-1) s(-1) at the lowest temperatures of this study and show behaviour characteristic of barrierless reactions. Temperature dependences, different for each reaction, are compared to those used in the most recent photochemical models of Titan's atmosphere.

  6. Separation of Cr(III) from Cr(VI) by Triton X-100 cerium(IV) phosphate as a surface active ion exchanger

    International Nuclear Information System (INIS)

    El-Azony, K.M.; Ismail Aydia, M.; El-Mohty, A.A.

    2011-01-01

    Triton X-100 cerium(IV) phosphate (TX-100CeP) was synthesized and characterized by using IR, X-ray, TGA/DT and the elemental analysis. The chemical stability of TX-100CeP versus the different concentrations of HCl acid was studied before and after its exposure to the radiation dose (30 K Gray). The effect of HCl concentration on separation of Cr(III) from Cr(VI) by using TX-100CeP as surface active ion exchanger was also studied. A novel method was achieved for the quantifying of Cr(III) and Cr(VI) ions by using the high-performance liquid chromatography (HPLC) at wavelength 650 nm, a stationary phase consists of reversed phase column (Nucleosil phenyl column; 250 x 4.6 mm, 5 μm), and a mobile phase consists of 0.001 M di-(2-ethylhexyl) phosphoric acid (DEHPA) in methanol:water (70:30 v/v). The retention times were 7.0 and 8.5 min, for the Cr(III) and Cr(VI), respectively. The exchange capacity of Cr(III) was quantified (2.1 meq/g) onto the TX-100CeP. (author)

  7. Electrochemical characterization of Si in tetra-methyl ammonium hydroxide (TMAH) and TMAH:Triton-X-100 solutions under white light effects

    Science.gov (United States)

    Conway, Elizabeth M.; Cunnane, Vincent J.

    2002-03-01

    An experimental study of the electrochemical characteristics of the silicon/tetra-methyl ammonium hydroxide (TMAH) junction under dark and white light conditions are investigated for both n- and p-type Si. The presence of Triton-X-100 (TX100) in the TMAH solution under white light conditions is also studied. Cyclic voltammetry (CV) and ex situ atomic force microscopy (AFM) are employed to study the white light effects on the etching characteristics of silicon in TMAH and TMAH:TX100. It was found that the passivation peak potential shifted significantly for both n- and p-type Si under white light conditions. The positions of the flatband potential for n- and p-type Si were predicted by CV under illumination. Finally, etch rate studies and preliminary surface roughness measurements were performed on p(100) Si in TMAH under both dark and white light conditions. These latter studies concluded that a reduction in the vertical surface roughness occurred in the presence of white light.

  8. Impact of ultrasonication time on elution of super heavy oil and its biomarkers from aging soils using a Triton X-100 micellar solution

    International Nuclear Information System (INIS)

    Ji Guodong; Zhou Guohui

    2010-01-01

    An ultrasound-enhanced elution system with Triton X-100 solution was used to remediate aging soils contaminated with super heavy oil. We used GC/MS, SEM, and X-ray diffraction (XRD) to analyze the effect of ultrasonic time (0-1800 s) on the elution of super heavy oil and its three characteristic biomarkers (C 26-34 17α 25-norhopanes, C 26-28 triaromatic steroid [TAS], and C 27-29 methyl triaromatic steroid [MTAS]). The oil and biomarkers remaining in the treated soils followed similar second-order functions with increasing ultrasonication times. Biomarker elution was closely related to carbon numbers in the marker. For C 26-34 17α 25-norhopanes, the smaller molecules were more readily eluted during 0-360 s ultrasound. This trend was reversed upon application of ultrasound during 1080-1800 s, with improved elution of larger molecules and elution followed a similar second-order function. For C 26-28 TAS, smaller molecules were more readily eluted but the elution of larger molecules followed a similar second-order function. For C 27-29 MTAS, elution of larger molecules was close to that of C 26-34 17α 25-norhopanes. Results of SEM and XRD indicated that the mineral and chemical compositions of soils eluted at ultrasonication times of 1080-1800 s closely resembled clean soils.

  9. Picosecond studies of excitation transport in a finite volume: The clustered transport system octadecyl rhodamine B in triton X-100 micelles

    International Nuclear Information System (INIS)

    Ediger, M.D.; Domingue, R.P.; Fayer, M.D.

    1984-01-01

    A detailed experimental and theoretical examination of electronic excited state transport in the finite volume system, octadecyl rhodamine B molecules in triton X-100 micelles, is presented. Picosecond fluorescence mixing and transient grating techniques were used to examine systems in which the average number of chromophores per micelle ranged from 0.1 to 11. Because of the clustering of chromophores in the small micelles, the energy transport observed is extremely efficient. A statistical mechanical theory, based on a density expansion with a Pade approximant, is developed for donor--donor transport on a spherical surface. This theory accurately accounts for the experimental data with only the micelle radius as an adjustable parameter. The radius obtained from this procedure is in good agreement with determinations by other methods. This demonstrates that quantitative information about the spatial extent of chromophore distributions in small volumes can be obtained when appropriate finite volume energy transport theories are employed. It is shown that theories developed for infinite volumes are not applicable to systems such as the ones considered here. Finally the partitioning of rhodamine B and octadecyl rhodamine B between aqueous and micellar phases is measured, and lifetimes and rotation times are reported

  10. Improvement on D-xylose to Xylitol Biotransformation by Candida guilliermondii Using Cells Permeabilized with Triton X-100 and Selected Process Conditions.

    Science.gov (United States)

    Cortez, Daniela Vieira; Mussatto, Solange I; Roberto, Inês Conceição

    2016-11-01

    Cells of Candida guilliermondii permeabilized with Triton X-100 were able to efficiently produce xylitol from a medium composed only by D-xylose and MgCl 2 ·6H 2 O in potassium phosphate buffer, at 35 °C and pH 6.5. Under these conditions, the results were similar to those obtained when cofactor and co-substrate or nutrients were added to the medium (about 95 % D-xylose was assimilated producing 42 g/L of xylitol, corresponding to 0.80 g/g yield and 2.65 g/L h volumetric productivity). Furthermore, the permeabilized cells kept the D-xylose assimilation in about 90 % and the xylitol production in approx. 40 g/L during three bioconversion cycles of 16 h each. These values are highly relevant when compared to others reported in the literature using enzyme technology and fermentative process, thereby demonstrating the effectiveness of the proposed method. The present study reveals that the use of permeabilized cells is an interesting alternative to obtain high xylitol productivity using low cost medium formulation. This approach may allow the future development of xylitol production from xylose present in lignocellulosic biomass, with additional potential for implementation in biorefinery strategies.

  11. Synergistic Cardioprotective Effects of Combined Chromium Picolinate and Atorvastatin Treatment in Triton X-100-Induced Hyperlipidemia in Rats: Impact on Some Biochemical Markers.

    Science.gov (United States)

    Shafik, Noha M; Baalash, Amal; Ebeid, Abla M

    2017-12-01

    Hyperlipidemia is one of the major risk factors for atherosclerosis and ischemic heart disease. Chromium (Cr) mineral is playing a crucial role in glucose and lipid homeostasis. The aim of this study was to evaluate the protective effects of combined chromium picolinate (CrPic) and atorvastatin treatment against hyperlipidemia-induced cardiac injury. Seventy-five male albino rats were divided into five groups (15 rats each). Hyperlipidemia was induced by intraperitoneal injection of a single dose of Triton X-100 (300 mg/kg body weight (b.w) (group ІІ). Treatment of hyperlipidemic rats was induced by daily administration of CrPic at a dose of 200 μg/kg b.w/day (group ІІІ), atorvastatin at a dose of 10 mg/kg/day (group IV), and combined treatment with both (group V) by gavage for 7 days. At the end of experiment, serum and heart tissues were obtained. Hyperlipidemia was confirmed by histopathology of heart tissues, marked serum dyslipidemia, increased atherogenic indices, and values of ischemia-modified albumin. In addition to increased values of proprotein convertase subtilisin/kexin type 9, activity of 3-hydroxy-3-methylglutaryl coenzyme A reductase enzyme and high relative expression levels of pentraxin-3 were observed. However, paraoxonase-1 activity was markedly decreased in the hyperlipidemic group. Significant improvement in all assessed parameters was observed in the rat group treated with both CrPic and atorvastatin. It can be concluded that combined CrPic and atorvastatin treatments had synergistic cardioprotective effects against hyperlipidemia which may be through modulating atherosclerosis as well as cardiac and aortic damage and/or activation of anti-inflammatory and anti-oxidant pathways, thus reversing endothelial dysfunction.

  12. Chemical synthesis of flower-like hybrid Cu(OH)2/CuO electrode: Application of polyvinyl alcohol and triton X-100 to enhance supercapacitor performance.

    Science.gov (United States)

    Shinde, S K; Fulari, V J; Kim, D-Y; Maile, N C; Koli, R R; Dhaygude, H D; Ghodake, G S

    2017-08-01

    In this research article, we report hybrid nanomaterials of copper hydroxide/copper oxide (Cu(OH) 2 /CuO). A thin films were prepared by using a facile and cost-effective successive ionic layer adsorption and reaction (SILAR) method. As-synthesized and hybrid Cu(OH) 2 /CuO with two different surfactants polyvinyl alcohol (PVA) and triton-X 100 (TRX-100) was prepared having distinct morphological, structural, and supercapacitor properties. The surface of the thin film samples were examined by scanning electron microscopy (SEM). A nanoflower-like morphology of the Cu(OH) 2 /CuO nanostructures arranged vertically was evidenced on the stainless steel substrate. The surface was well covered by nanoflake-like morphology and formed a uniform Cu(OH) 2 /CuO nanostructures after treating with surfactants. X-ray diffraction patterns were used to confirm the hybrid phase of Cu(OH) 2 /CuO materials. The electrochemical properties of the pristine Cu(OH) 2 /CuO, PVA:Cu(OH) 2 /CuO, TRX-100:Cu(OH) 2 /CuO films were observed by cyclic voltammetry, galvanostatic charge/discharge, and electrochemical impedance spectroscopy technique. The electrochemical examination reveals that the Cu(OH) 2 /CuO electrode has excellent specific capacitance, 292, 533, and 443Fg -1 with pristine, PVA, and TRX-100, respectively in 1M Na 2 SO 4 electrolyte solution. The cyclic voltammograms (CV) of Cu(OH) 2 /CuO electrode shows positive role of the PVA and TRX-100 to enhance supercapacitor performance. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Toltrazuril mixed nanomicelle delivery system based on sodium deoxycholate-Brij C20 polyethylene ether-triton x100: Characterization, solubility, and bioavailability study.

    Science.gov (United States)

    Zhang, Li; Ren, Dandan; Zhou, Jianyu; Peng, Guangneng; Shu, Gang; Yuan, Zhixiang; Shi, Fei; Zhao, Ling; Yin, Lizi; Fan, Guoqing; Liu, Chang; Fu, Hualin

    2018-03-01

    Toltrazuril (Tol) is a broad-spectrum anticoccidiosis drug that is widely used in the prevention and treatment of coccidiosis infection in poultry and mammals. However, the drug has poor aqueous solubility (25 °C, 0.41 μg/mL), and its dose escalation for systemic administration remains challenging. We engineered a Tol mixed nanomicelle (TMNM) delivery system based on sodium deoxycholate-Brij C20 polyethylene ether-triton x100 (NaDC-Brij58-Tx100) as surfactants by film hydration method. The physical properties of TMNM were characterized, and the pharmacokinetic parameters of Tol and TMNM were compared. The average particle size, drug loading, saturated solubility, and critical micelle concentration (CMC) of the TMNM system were 12.28 ± 0.48 nm, 3.38 ± 0.12%, 3921.70 ± 0.01 μg/mL (8170-fold compared with Tol), and 0.0172 mg/mL, respectively. Transmission electron microscopy (TEM), scanning electron microscopy (SEM) micrographs, differential scanning calorimetry (DSC) and X-ray diffraction (XRD) were performed, and the results showed TMNM formation. Furthermore, the TMNM had greater bioavailability (215%) than the Tol solution. The significant increase in the drug solubility and bioavailability of TMNM suggested the TMNM is a potential oral and parenteral delivery system for Tol and has wide application prospects in the clinical context. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Intermolecular electron transfer between coumarin dyes and aromatic amines in Triton-X-100 micellar solutions: Evidence for Marcus inverted region

    International Nuclear Information System (INIS)

    Kumbhakar, Manoj; Nath, Sukhendu; Mukherjee, Tulsi; Pal, Haridas

    2004-01-01

    Photoinduced electron transfer (ET) between coumarin dyes and aromatic amines has been investigated in Triton-X-100 micellar solutions and the results have been compared with those observed earlier in homogeneous medium. Significant static quenching of the coumarin fluorescence due to the presence of high concentration of amines around the coumarin fluorophore in the micelles has been observed in steady-state fluorescence studies. Time-resolved studies with nanosecond resolutions mostly show the dynamic part of the quenching for the excited coumarin dyes by the amine quenchers. A correlation of the quenching rate constants, estimated from the time-resolved measurements, with the free energy changes (ΔG 0 ) of the ET reactions shows the typical bell shaped curve as predicted by Marcus outer-sphere ET theory. The inversion in the ET rates for the present systems occurs at an exergonicity (-ΔG 0 ) of ∼0.7-0.8 eV, which is unusually low considering the polarity of the Palisade layer of the micelles where the reactants reside. Present results have been rationalized on the basis of the two dimensional ET model assuming that the solvent relaxation in micellar media is much slower than the rate of the ET process. Detailed analysis of the experimental data shows that the diffusional model of the bimolecular quenching kinetics is not applicable for the ET reactions in the micellar solutions. In the present systems, the reactions can be better visualized as equivalent to intramolecular electron transfer processes, with statistical distribution of the donors and acceptors in the micelles. A low electron coupling (V el ) parameter is estimated from the correlation of the experimentally observed and the theoretically calculated ET rates, which indicates that the average donor-acceptor separation in the micellar ET reactions is substantially larger than for the donor-acceptor contact distance. Comparison of the V el values in the micellar solution and in the donor

  15. Intermolecular electron transfer between coumarin dyes and aromatic amines in Triton-X-100 micellar solutions: Evidence for Marcus inverted region

    Science.gov (United States)

    Kumbhakar, Manoj; Nath, Sukhendu; Mukherjee, Tulsi; Pal, Haridas

    2004-02-01

    Photoinduced electron transfer (ET) between coumarin dyes and aromatic amines has been investigated in Triton-X-100 micellar solutions and the results have been compared with those observed earlier in homogeneous medium. Significant static quenching of the coumarin fluorescence due to the presence of high concentration of amines around the coumarin fluorophore in the micelles has been observed in steady-state fluorescence studies. Time-resolved studies with nanosecond resolutions mostly show the dynamic part of the quenching for the excited coumarin dyes by the amine quenchers. A correlation of the quenching rate constants, estimated from the time-resolved measurements, with the free energy changes (ΔG0) of the ET reactions shows the typical bell shaped curve as predicted by Marcus outer-sphere ET theory. The inversion in the ET rates for the present systems occurs at an exergonicity (-ΔG0) of ~0.7-0.8 eV, which is unusually low considering the polarity of the Palisade layer of the micelles where the reactants reside. Present results have been rationalized on the basis of the two dimensional ET model assuming that the solvent relaxation in micellar media is much slower than the rate of the ET process. Detailed analysis of the experimental data shows that the diffusional model of the bimolecular quenching kinetics is not applicable for the ET reactions in the micellar solutions. In the present systems, the reactions can be better visualized as equivalent to intramolecular electron transfer processes, with statistical distribution of the donors and acceptors in the micelles. A low electron coupling (Vel) parameter is estimated from the correlation of the experimentally observed and the theoretically calculated ET rates, which indicates that the average donor-acceptor separation in the micellar ET reactions is substantially larger than for the donor-acceptor contact distance. Comparison of the Vel values in the micellar solution and in the donor-acceptor close

  16. Non-ionic detergent Triton X-114 Based vortex- synchronized matrix solid-phase dispersion method for the simultaneous determination of six compounds with various polarities from Forsythiae Fructus by ultra high-performance liquid chromatography.

    Science.gov (United States)

    Du, Kunze; Li, Jin; Tian, Fei; Chang, Yan-Xu

    2018-02-20

    A simple nonionic detergent - based vortex- synchronized matrix solid-phase dispersion (ND-VSMSPD) method was developed to extract bioactive compounds in Forsythiae Fructus coupled with ultra high-performance liquid chromatography (UHPLC). Nonionic detergent Triton 114 was firstly used as a green elution reagent in vortex- synchronized MSPD procedure. The optimum parameters were investigated to attain the best results, including Florisil as sorbent, 2mL 10% (v/v) nonionic detergent Triton X-114 as the elution reagent, 1:1 of sample/sorbent ratio, grinding for 3min, and whirling for 2min. The recoveries of the six compounds in Forsythiae Fructus were in the range of 95-104% (RSD vortex- synchronized MSPD, which required lower sample, reagent and time, were higher than the normal MSPD and the traditional ultrasonic-assisted extraction. Consequently, this developed vortex- synchronized MSPD coupled with simple UHPLC method could be efficiently applies to extract and analyze the target compounds in real Forsythiae Fructus samples. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Determination of trace amounts of nickel(II) with α-(2-Benzimidazolyl)-α',α''-(N-5-nitro-2-pyridyl hydrazone) toluene in the presence of triton X-100 by fluorescence method

    International Nuclear Information System (INIS)

    Park, Chan Il; Kim, Hyun Soo; Cha, Ki Won

    2000-01-01

    A method is described for the fluorimetric determination of nicke, based on the formation of Ni(II)-α-(2-Benzimidazolyl)-α',α''-(N-5-nitro-2-pyridyl hydrazone)-toluene complex in the presence of a non-ionic surfactant. The complex has practically no fluorescence in the absence of surfactant, but the addition of Triton X-100 makes possible the fluorimetric determination of low concentrations of Ni(II) as it enhances the fluorescence intensity of the complex by up to about 5-fold. This method is very sensitive and selective for the direct determination of nickel ion. The optimum conditions are a Triton X-100 concentration of 2.0 mL (5.0%, v/v) and pH 9.0 ± 0.2 (ammonium chloride-ammonia buffer). The fluorescence is measured at 337 nm of emission wavelength under 300 nm of excitation wavelength. The fluorescence intensity is a linear function of the concentration of Ni(II) in the range 5-70 ng/mL, and the detection limit is 2.0 ng/mL. The proposed method has been successfully applied to the determination of trace amounts of Ni(II) in food and human hair samples

  18. Some Calculated (p,α Cross-Sections Using the Alpha Particle Knock-On and Triton Pick-Up Reaction Mechanisms: An Optimisation of the Single-Step Feshbach–Kerman–Koonin (FKK Theory

    Directory of Open Access Journals (Sweden)

    Felix S. Olise

    2016-04-01

    Full Text Available The Feshbach–Kerman–Koonin (FKK multi-step direct (MSD theory of pre-equilibrium reactions has been used to compute the single-step cross-sections for some (p,α reactions using the knock-on and pick-up reaction mechanisms at two incident proton energies. For the knock-on mechanism, the reaction was assumed to have taken place by the direct ejection of a preformed alpha cluster in a shell-model state of the target. But the reaction was assumed to have taken place by the pick-up of a preformed triton cluster (also bound in a shell-model state of the target core by the incident proton for the pick-up mechanism. The Yukawa forms of potential were used for the proton-alpha (for the knock-on process and proton-triton (for the pick-up process interaction and several parameter sets for the proton and alpha-particle optical potentials. The calculated cross-sections for both mechanisms gave satisfactory fits to the experimental data. Furthermore, it has been shown that some combinations of the calculated distorted wave Born approximation cross-sections for the two reaction mechanisms in the FKK MSD theory are able to give better fits to the experimental data, especially in terms of range of agreement. In addition, the theory has been observed to be valid over a wider range of energy.

  19. Application of Triton X-100 coated poly vinyl chloride as new solid phase for preconcentration of Fe3+, Cu2+ and Zn2+ ions and their flame atomic absorption spectrometric determinations

    Directory of Open Access Journals (Sweden)

    Mehrorang Ghaedi

    2010-04-01

    Full Text Available A selective, sensitive and efficient method for preconcentration of trace amounts of Cu(II, Fe(II and Zn(II ions based on the uptake of their complexes with 3-((indolin-3-yl(phenylmethylindoline (IYPMI loaded on Triton X-100 coated poly vinyl chloride has been reported. The influences of the analytical parameters including pH, ligand amount, surfactant type and concentration, eluting condition and sample volume on metal ions recovery were investigated. The method has been successfully applied for the extraction of these ions content in some real samples of soil and plants. The extraction efficiency was > 97% with low relative standard deviation (RSD < 2.4% and the preconcentration factor of 90 (5 mL elution volume for a 450 mL of sample volume.

  20. Production of deuterons, tritons, 3He nuclei, and their antinuclei in p p collisions at √{s }=0.9 , 2.76, and 7 TeV

    Science.gov (United States)

    Acharya, S.; Adam, J.; Adamová, D.; Adolfsson, J.; Aggarwal, M. M.; Aglieri Rinella, G.; Agnello, M.; Agrawal, N.; Ahammed, Z.; Ahmad, N.; Ahn, S. U.; Aiola, S.; Akindinov, A.; Al-Turany, M.; Alam, S. N.; Alba, J. L. B.; Albuquerque, D. S. D.; Aleksandrov, D.; Alessandro, B.; Alfaro Molina, R.; Alici, A.; Alkin, A.; Alme, J.; Alt, T.; Altenkamper, L.; Altsybeev, I.; Alves Garcia Prado, C.; Andrei, C.; Andreou, D.; Andrews, H. A.; Andronic, A.; Anguelov, V.; Anson, C.; Antičić, T.; Antinori, F.; Antonioli, P.; Anwar, R.; Aphecetche, L.; Appelshäuser, H.; Arcelli, S.; Arnaldi, R.; Arnold, O. W.; Arsene, I. C.; Arslandok, M.; Audurier, B.; Augustinus, A.; Averbeck, R.; Azmi, M. D.; Badalá, A.; Baek, Y. W.; Bagnasco, S.; Bailhache, R.; Bala, R.; Baldisseri, A.; Ball, M.; Baral, R. C.; Barbano, A. M.; Barbera, R.; Barile, F.; Barioglio, L.; Barnaföldi, G. G.; Barnby, L. S.; Barret, V.; Bartalini, P.; Barth, K.; Bartsch, E.; Basile, M.; Bastid, N.; Basu, S.; Batigne, G.; Batyunya, B.; Batzing, P. C.; Bearden, I. G.; Beck, H.; Bedda, C.; Behera, N. K.; Belikov, I.; Bellini, F.; Bello Martinez, H.; Bellwied, R.; Beltran, L. G. E.; Belyaev, V.; Bencedi, G.; Beole, S.; Bercuci, A.; Berdnikov, Y.; Berenyi, D.; Bertens, R. A.; Berzano, D.; Betev, L.; Bhasin, A.; Bhat, I. R.; Bhati, A. K.; Bhattacharjee, B.; Bhom, J.; Bianchi, A.; Bianchi, L.; Bianchi, N.; Bianchin, C.; Bielčík, J.; Bielčíková, J.; Bilandzic, A.; Biro, G.; Biswas, R.; Biswas, S.; Blair, J. T.; Blau, D.; Blume, C.; Boca, G.; Bock, F.; Bogdanov, A.; Boldizsár, L.; Bombara, M.; Bonomi, G.; Bonora, M.; Book, J.; Borel, H.; Borissov, A.; Borri, M.; Botta, E.; Bourjau, C.; Bratrud, L.; Braun-Munzinger, P.; Bregant, M.; Broker, T. A.; Broz, M.; Brucken, E. J.; Bruna, E.; Bruno, G. E.; Budnikov, D.; Buesching, H.; Bufalino, S.; Buhler, P.; Buncic, P.; Busch, O.; Buthelezi, Z.; Butt, J. B.; Buxton, J. T.; Cabala, J.; Caffarri, D.; Caines, H.; Caliva, A.; Calvo Villar, E.; Camerini, P.; Capon, A. A.; Carena, F.; Carena, W.; Carnesecchi, F.; Castillo Castellanos, J.; Castro, A. J.; Casula, E. A. R.; Ceballos Sanchez, C.; Cerello, P.; Chandra, S.; Chang, B.; Chapeland, S.; Chartier, M.; Chattopadhyay, S.; Chattopadhyay, S.; Chauvin, A.; Cheshkov, C.; Cheynis, B.; Chibante Barroso, V.; Chinellato, D. D.; Cho, S.; Chochula, P.; Chojnacki, M.; Choudhury, S.; Chowdhury, T.; Christakoglou, P.; Christensen, C. H.; Christiansen, P.; Chujo, T.; Chung, S. U.; Cicalo, C.; Cifarelli, L.; Cindolo, F.; Cleymans, J.; Colamaria, F.; Colella, D.; Collu, A.; Colocci, M.; Concas, M.; Conesa Balbastre, G.; Conesa Del Valle, Z.; Connors, M. E.; Contreras, J. G.; Cormier, T. M.; Corrales Morales, Y.; Cortés Maldonado, I.; Cortese, P.; Cosentino, M. R.; Costa, F.; Costanza, S.; Crkovská, J.; Crochet, P.; Cuautle, E.; Cunqueiro, L.; Dahms, T.; Dainese, A.; Danisch, M. C.; Danu, A.; Das, D.; Das, I.; Das, S.; Dash, A.; Dash, S.; de, S.; de Caro, A.; de Cataldo, G.; de Conti, C.; de Cuveland, J.; de Falco, A.; de Gruttola, D.; De Marco, N.; de Pasquale, S.; de Souza, R. D.; Degenhardt, H. F.; Deisting, A.; Deloff, A.; Deplano, C.; Dhankher, P.; di Bari, D.; di Mauro, A.; di Nezza, P.; di Ruzza, B.; Dietel, T.; Dillenseger, P.; Divià, R.; Djuvsland, Ø.; Dobrin, A.; Domenicis Gimenez, D.; Dönigus, B.; Dordic, O.; Doremalen, L. V. R.; Dubey, A. K.; Dubla, A.; Ducroux, L.; Duggal, A. K.; Dukhishyam, M.; Dupieux, P.; Ehlers, R. J.; Elia, D.; Endress, E.; Engel, H.; Epple, E.; Erazmus, B.; Erhardt, F.; Espagnon, B.; Esumi, S.; Eulisse, G.; Eum, J.; Evans, D.; Evdokimov, S.; Fabbietti, L.; Faivre, J.; Fantoni, A.; Fasel, M.; Feldkamp, L.; Feliciello, A.; Feofilov, G.; Fernández Téllez, A.; Ferretti, A.; Festanti, A.; Feuillard, V. J. G.; Figiel, J.; Figueredo, M. A. S.; Filchagin, S.; Finogeev, D.; Fionda, F. M.; Floris, M.; Foertsch, S.; Foka, P.; Fokin, S.; Fragiacomo, E.; Francescon, A.; Francisco, A.; Frankenfeld, U.; Fronze, G. G.; Fuchs, U.; Furget, C.; Furs, A.; Fusco Girard, M.; Gaardhøje, J. J.; Gagliardi, M.; Gago, A. M.; Gajdosova, K.; Gallio, M.; Galvan, C. D.; Ganoti, P.; Garabatos, C.; Garcia-Solis, E.; Garg, K.; Gargiulo, C.; Gasik, P.; Gauger, E. F.; Gay Ducati, M. B.; Germain, M.; Ghosh, J.; Ghosh, P.; Ghosh, S. K.; Gianotti, P.; Giubellino, P.; Giubilato, P.; Gladysz-Dziadus, E.; Glässel, P.; Gomëz Coral, D. M.; Gomez Ramirez, A.; Gonzalez, A. S.; González-Zamora, P.; Gorbunov, S.; Görlich, L.; Gotovac, S.; Grabski, V.; Graczykowski, L. K.; Graham, K. L.; Greiner, L.; Grelli, A.; Grigoras, C.; Grigoriev, V.; Grigoryan, A.; Grigoryan, S.; Gronefeld, J. M.; Grosa, F.; Grosse-Oetringhaus, J. F.; Grosso, R.; Gruber, L.; Guber, F.; Guernane, R.; Guerzoni, B.; Gulbrandsen, K.; Gunji, T.; Gupta, A.; Gupta, R.; Guzman, I. B.; Haake, R.; Hadjidakis, C.; Hamagaki, H.; Hamar, G.; Hamon, J. C.; Haque, M. R.; Harris, J. W.; Harton, A.; Hassan, H.; Hatzifotiadou, D.; Hayashi, S.; Heckel, S. T.; Hellbär, E.; Helstrup, H.; Herghelegiu, A.; Hernandez, E. G.; Herrera Corral, G.; Herrmann, F.; Hess, B. A.; Hetland, K. F.; Hillemanns, H.; Hills, C.; Hippolyte, B.; Hladky, J.; Hohlweger, B.; Horak, D.; Hornung, S.; Hosokawa, R.; Hristov, P.; Hughes, C.; Humanic, T. J.; Hussain, N.; Hussain, T.; Hutter, D.; Hwang, D. S.; Iga Buitron, S. A.; Ilkaev, R.; Inaba, M.; Ippolitov, M.; Irfan, M.; Islam, M. S.; Ivanov, M.; Ivanov, V.; Izucheev, V.; Jacak, B.; Jacazio, N.; Jacobs, P. M.; Jadhav, M. B.; Jadlovsky, J.; Jaelani, S.; Jahnke, C.; Jakubowska, M. J.; Janik, M. A.; Jayarathna, P. H. S. Y.; Jena, C.; Jena, S.; Jercic, M.; Jimenez Bustamante, R. T.; Jones, P. G.; Jusko, A.; Kalinak, P.; Kalweit, A.; Kang, J. H.; Kaplin, V.; Kar, S.; Karasu Uysal, A.; Karavichev, O.; Karavicheva, T.; Karayan, L.; Karczmarczyk, P.; Karpechev, E.; Kebschull, U.; Keidel, R.; Keijdener, D. L. D.; Keil, M.; Ketzer, B.; Khabanova, Z.; Khan, P.; Khan, S. A.; Khanzadeev, A.; Kharlov, Y.; Khatun, A.; Khuntia, A.; Kielbowicz, M. M.; Kileng, B.; Kim, B.; Kim, D.; Kim, D. J.; Kim, H.; Kim, J. S.; Kim, J.; Kim, M.; Kim, M.; Kim, S.; Kim, T.; Kirsch, S.; Kisel, I.; Kiselev, S.; Kisiel, A.; Kiss, G.; Klay, J. L.; Klein, C.; Klein, J.; Klein-Bösing, C.; Klewin, S.; Kluge, A.; Knichel, M. L.; Knospe, A. G.; Kobdaj, C.; Kofarago, M.; Köhler, M. K.; Kollegger, T.; Kondratiev, V.; Kondratyeva, N.; Kondratyuk, E.; Konevskikh, A.; Konyushikhin, M.; Kopcik, M.; Kour, M.; Kouzinopoulos, C.; Kovalenko, O.; Kovalenko, V.; Kowalski, M.; Koyithatta Meethaleveedu, G.; Králik, I.; Kravčáková, A.; Kreis, L.; Krivda, M.; Krizek, F.; Kryshen, E.; Krzewicki, M.; Kubera, A. M.; Kučera, V.; Kuhn, C.; Kuijer, P. G.; Kumar, A.; Kumar, J.; Kumar, L.; Kumar, S.; Kundu, S.; Kurashvili, P.; Kurepin, A.; Kurepin, A. B.; Kuryakin, A.; Kushpil, S.; Kweon, M. J.; Kwon, Y.; La Pointe, S. L.; La Rocca, P.; Lagana Fernandes, C.; Lai, Y. S.; Lakomov, I.; Langoy, R.; Lapidus, K.; Lara, C.; Lardeux, A.; Lattuca, A.; Laudi, E.; Lavicka, R.; Lea, R.; Leardini, L.; Lee, S.; Lehas, F.; Lehner, S.; Lehrbach, J.; Lemmon, R. C.; Lenti, V.; Leogrande, E.; León Monzón, I.; Lévai, P.; Li, X.; Lien, J.; Lietava, R.; Lim, B.; Lindal, S.; Lindenstruth, V.; Lindsay, S. W.; Lippmann, C.; Lisa, M. A.; Litichevskyi, V.; Llope, W. J.; Lodato, D. F.; Loenne, P. I.; Loginov, V.; Loizides, C.; Loncar, P.; Lopez, X.; López Torres, E.; Lowe, A.; Luettig, P.; Luhder, J. R.; Lunardon, M.; Luparello, G.; Lupi, M.; Lutz, T. H.; Maevskaya, A.; Mager, M.; Mahajan, S.; Mahmood, S. M.; Maire, A.; Majka, R. D.; Malaev, M.; Malinina, L.; Mal'Kevich, D.; Malzacher, P.; Mamonov, A.; Manko, V.; Manso, F.; Manzari, V.; Mao, Y.; Marchisone, M.; Mareš, J.; Margagliotti, G. V.; Margotti, A.; Margutti, J.; Marín, A.; Markert, C.; Marquard, M.; Martin, N. A.; Martinengo, P.; Martinez, J. A. L.; Martínez, M. I.; Martínez García, G.; Martinez Pedreira, M.; Masciocchi, S.; Masera, M.; Masoni, A.; Masson, E.; Mastroserio, A.; Mathis, A. M.; Matuoka, P. F. T.; Matyja, A.; Mayer, C.; Mazer, J.; Mazzilli, M.; Mazzoni, M. A.; Meddi, F.; Melikyan, Y.; Menchaca-Rocha, A.; Meninno, E.; Mercado Pérez, J.; Meres, M.; Mhlanga, S.; Miake, Y.; Mieskolainen, M. M.; Mihaylov, D. L.; Mikhaylov, K.; Milosevic, J.; Mischke, A.; Mishra, A. N.; Miśkowiec, D.; Mitra, J.; Mitu, C. M.; Mohammadi, N.; Mohanty, B.; Khan, M. Mohisin; Moreira de Godoy, D. A.; Moreno, L. A. P.; Moretto, S.; Morreale, A.; Morsch, A.; Muccifora, V.; Mudnic, E.; Mühlheim, D.; Muhuri, S.; Mukherjee, M.; Mulligan, J. D.; Munhoz, M. G.; Münning, K.; Munzer, R. H.; Murakami, H.; Murray, S.; Musa, L.; Musinsky, J.; Myers, C. J.; Myrcha, J. W.; Nag, D.; Naik, B.; Nair, R.; Nandi, B. K.; Nania, R.; Nappi, E.; Narayan, A.; Naru, M. U.; Natal da Luz, H.; Nattrass, C.; Navarro, S. R.; Nayak, K.; Nayak, R.; Nayak, T. K.; Nazarenko, S.; Nedosekin, A.; Negrao de Oliveira, R. A.; Nellen, L.; Nesbo, S. V.; Ng, F.; Nicassio, M.; Niculescu, M.; Niedziela, J.; Nielsen, B. S.; Nikolaev, S.; Nikulin, S.; Nikulin, V.; Noferini, F.; Nomokonov, P.; Nooren, G.; Noris, J. C. C.; Norman, J.; Nyanin, A.; Nystrand, J.; Oeschler, H.; Oh, S.; Ohlson, A.; Okubo, T.; Olah, L.; Oleniacz, J.; Oliveira da Silva, A. C.; Oliver, M. H.; Onderwaater, J.; Oppedisano, C.; Orava, R.; Oravec, M.; Ortiz Velasquez, A.; Oskarsson, A.; Otwinowski, J.; Oyama, K.; Pachmayer, Y.; Pacik, V.; Pagano, D.; Pagano, P.; Paić, G.; Palni, P.; Pan, J.; Pandey, A. K.; Panebianco, S.; Papikyan, V.; Pappalardo, G. S.; Pareek, P.; Park, J.; Parmar, S.; Passfeld, A.; Pathak, S. P.; Patra, R. N.; Paul, B.; Pei, H.; Peitzmann, T.; Peng, X.; Pereira, L. G.; Pereira da Costa, H.; Peresunko, D.; Perez Lezama, E.; Peskov, V.; Pestov, Y.; Petráček, V.; Petrov, V.; Petrovici, M.; Petta, C.; Pezzi, R. P.; Piano, S.; Pikna, M.; Pillot, P.; Pimentel, L. O. D. L.; Pinazza, O.; Pinsky, L.; Piyarathna, D. B.; Płoskoń, M.; Planinic, M.; Pliquett, F.; Pluta, J.; Pochybova, S.; Podesta-Lerma, P. L. M.; Poghosyan, M. G.; Polichtchouk, B.; Poljak, N.; Poonsawat, W.; Pop, A.; Poppenborg, H.; Porteboeuf-Houssais, S.; Pozdniakov, V.; Prasad, S. K.; Preghenella, R.; Prino, F.; Pruneau, C. A.; Pshenichnov, I.; Puccio, M.; Puddu, G.; Pujahari, P.; Punin, V.; Putschke, J.; Raha, S.; Rajput, S.; Rak, J.; Rakotozafindrabe, A.; Ramello, L.; Rami, F.; Rana, D. B.; Raniwala, R.; Raniwala, S.; Räsänen, S. S.; Rascanu, B. T.; Rathee, D.; Ratza, V.; Ravasenga, I.; Read, K. F.; Redlich, K.; Rehman, A.; Reichelt, P.; Reidt, F.; Ren, X.; Renfordt, R.; Reolon, A. R.; Reshetin, A.; Reygers, K.; Riabov, V.; Ricci, R. A.; Richert, T.; Richter, M.; Riedler, P.; Riegler, W.; Riggi, F.; Ristea, C.; Rodríguez Cahuantzi, M.; Røed, K.; Rogochaya, E.; Rohr, D.; Röhrich, D.; Rokita, P. S.; Ronchetti, F.; Rosas, E. D.; Rosnet, P.; Rossi, A.; Rotondi, A.; Roukoutakis, F.; Roy, A.; Roy, C.; Roy, P.; Rueda, O. V.; Rui, R.; Rumyantsev, B.; Rustamov, A.; Ryabinkin, E.; Ryabov, Y.; Rybicki, A.; Saarinen, S.; Sadhu, S.; Sadovsky, S.; Šafařík, K.; Saha, S. K.; Sahlmuller, B.; Sahoo, B.; Sahoo, P.; Sahoo, R.; Sahoo, S.; Sahu, P. K.; Saini, J.; Sakai, S.; Saleh, M. A.; Salzwedel, J.; Sambyal, S.; Samsonov, V.; Sandoval, A.; Sarkar, D.; Sarkar, N.; Sarma, P.; Sas, M. H. P.; Scapparone, E.; Scarlassara, F.; Schaefer, B.; Scharenberg, R. P.; Scheid, H. S.; Schiaua, C.; Schicker, R.; Schmidt, C.; Schmidt, H. R.; Schmidt, M. O.; Schmidt, M.; Schmidt, N. V.; Schukraft, J.; Schutz, Y.; Schwarz, K.; Schweda, K.; Scioli, G.; Scomparin, E.; Šefčík, M.; Seger, J. E.; Sekiguchi, Y.; Sekihata, D.; Selyuzhenkov, I.; Senosi, K.; Senyukov, S.; Serradilla, E.; Sett, P.; Sevcenco, A.; Shabanov, A.; Shabetai, A.; Shahoyan, R.; Shaikh, W.; Shangaraev, A.; Sharma, A.; Sharma, A.; Sharma, M.; Sharma, M.; Sharma, N.; Sheikh, A. I.; Shigaki, K.; Shou, Q.; Shtejer, K.; Sibiriak, Y.; Siddhanta, S.; Sielewicz, K. M.; Siemiarczuk, T.; Silaeva, S.; Silvermyr, D.; Silvestre, C.; Simatovic, G.; Simonetti, G.; Singaraju, R.; Singh, R.; Singhal, V.; Sinha, T.; Sitar, B.; Sitta, M.; Skaali, T. B.; Slupecki, M.; Smirnov, N.; Snellings, R. J. M.; Snellman, T. W.; Song, J.; Song, M.; Soramel, F.; Sorensen, S.; Sozzi, F.; Spiriti, E.; Sputowska, I.; Srivastava, B. K.; Stachel, J.; Stan, I.; Stankus, P.; Stenlund, E.; Stocco, D.; Storetvedt, M. M.; Strmen, P.; Suaide, A. A. P.; Sugitate, T.; Suire, C.; Suleymanov, M.; Suljic, M.; Sultanov, R.; Šumbera, M.; Sumowidagdo, S.; Suzuki, K.; Swain, S.; Szabo, A.; Szarka, I.; Tabassam, U.; Takahashi, J.; Tambave, G. J.; Tanaka, N.; Tarhini, M.; Tariq, M.; Tarzila, M. G.; Tauro, A.; Tejeda Muñoz, G.; Telesca, A.; Terasaki, K.; Terrevoli, C.; Teyssier, B.; Thakur, D.; Thakur, S.; Thomas, D.; Thoresen, F.; Tieulent, R.; Tikhonov, A.; Timmins, A. R.; Toia, A.; Torres, S. R.; Tripathy, S.; Trogolo, S.; Trombetta, G.; Tropp, L.; Trubnikov, V.; Trzaska, W. H.; Trzeciak, B. A.; Tsuji, T.; Tumkin, A.; Turrisi, R.; Tveter, T. S.; Ullaland, K.; Umaka, E. N.; Uras, A.; Usai, G. L.; Utrobicic, A.; Vala, M.; van der Maarel, J.; van Hoorne, J. W.; van Leeuwen, M.; Vanat, T.; Vande Vyvre, P.; Varga, D.; Vargas, A.; Vargyas, M.; Varma, R.; Vasileiou, M.; Vasiliev, A.; Vauthier, A.; Vázquez Doce, O.; Vechernin, V.; Veen, A. M.; Velure, A.; Vercellin, E.; Vergara Limón, S.; Vernet, R.; Vértesi, R.; Vickovic, L.; Vigolo, S.; Viinikainen, J.; Vilakazi, Z.; Villalobos Baillie, O.; Villatoro Tello, A.; Vinogradov, A.; Vinogradov, L.; Virgili, T.; Vislavicius, V.; Vodopyanov, A.; Völkl, M. A.; Voloshin, K.; Voloshin, S. A.; Volpe, G.; von Haller, B.; Vorobyev, I.; Voscek, D.; Vranic, D.; Vrláková, J.; Wagner, B.; Wang, H.; Wang, M.; Watanabe, D.; Watanabe, Y.; Weber, M.; Weber, S. G.; Weiser, D. F.; Wenzel, S. C.; Wessels, J. P.; Westerhoff, U.; Whitehead, A. M.; Wiechula, J.; Wikne, J.; Wilk, G.; Wilkinson, J.; Willems, G. A.; Williams, M. C. S.; Willsher, E.; Windelband, B.; Witt, W. E.; Yalcin, S.; Yamakawa, K.; Yang, P.; Yano, S.; Yin, Z.; Yokoyama, H.; Yoo, I.-K.; Yoon, J. H.; Yurchenko, V.; Zaccolo, V.; Zaman, A.; Zampolli, C.; Zanoli, H. J. C.; Zardoshti, N.; Zarochentsev, A.; Závada, P.; Zaviyalov, N.; Zbroszczyk, H.; Zhalov, M.; Zhang, H.; Zhang, X.; Zhang, Y.; Zhang, C.; Zhang, Z.; Zhao, C.; Zhigareva, N.; Zhou, D.; Zhou, Y.; Zhou, Z.; Zhu, H.; Zhu, J.; Zichichi, A.; Zimmermann, A.; Zimmermann, M. B.; Zinovjev, G.; Zmeskal, J.; Zou, S.; Alice Collaboration

    2018-02-01

    Invariant differential yields of deuterons and antideuterons in p p collisions at √{s } = 0.9, 2.76 and 7 TeV and the yields of tritons, 3He nuclei, and their antinuclei at √{s } = 7 TeV have been measured with the ALICE detector at the CERN Large Hadron Collider. The measurements cover a wide transverse momentum (pT) range in the rapidity interval |y |integrated yields decrease by a factor of about 1000 for each increase of the mass number with one (anti)nucleon. Furthermore, the deuteron-to-proton ratio is reported as a function of the average charged particle multiplicity at different center-of-mass energies.

  1. Empleo de transectos subacuáticos en estudio preliminar de una población de tritones ibéricos Lissotriton boscai Lataste, 1879 pedomórficos en una laguna de montaña (La Clara, Zamora.

    Directory of Open Access Journals (Sweden)

    MORALES, J., CRUZ, D., DELGADO, P., LIZANA, M., LÓPEZ, V.

    2013-01-01

    Full Text Available Utilizando la técnica de transectos subacuáticos con equipos autónomos de buceo se ha localizado una población invernante de tritones ibéricos Lissotriton boscai Lataste, 1879 que habita en zonas profundas de una laguna de alta montaña en Sierra Segundera, NO de Zamora. Dicha población está formada tanto por larvas invernantes como por ejemplares adultos pedomórficos. En las orillas y zonas someras del litoral de la laguna no se han detectado individuos de la especie en esas fechas. La población de tritones pedomórficos parece seleccionar positivamente las praderas de esfagnos sumergidas a profundidades próximas a la de penetración de la luz. Los humedales profundos en zonas oromediterráneas permitirían habitar a los tritones ibéricos en el límite de su rango altitudinal mediante el desarrollo de esta estrategia fenotípica.

  2. Production of deuterons, tritons, $^{3}$He nuclei and their anti-nuclei in pp collisions at $\\mathbf{\\sqrt{{\\textit s}}}$~=~0.9, 2.76 and 7~TeV

    CERN Document Server

    Acharya, Shreyasi; The ALICE collaboration; Adamova, Dagmar; Adolfsson, Jonatan; Aggarwal, Madan Mohan; Aglieri Rinella, Gianluca; Agnello, Michelangelo; Agrawal, Neelima; Ahammed, Zubayer; Ahmad, Nazeer; Ahn, Sang Un; Aiola, Salvatore; Akindinov, Alexander; Al-turany, Mohammad; Alam, Sk Noor; Bazo Alba, Jose Luis; Silva De Albuquerque, Danilo; Aleksandrov, Dmitry; Alessandro, Bruno; Alfaro Molina, Jose Ruben; Alici, Andrea; Alkin, Anton; Alme, Johan; Alt, Torsten; Altenkamper, Lucas; Altsybeev, Igor; Alves Garcia Prado, Caio; Andrei, Cristian; Andreou, Dimitra; Andrews, Harry Arthur; Andronic, Anton; Anguelov, Venelin; Anson, Christopher Daniel; Anticic, Tome; Antinori, Federico; Antonioli, Pietro; Anwar, Rafay; Aphecetche, Laurent Bernard; Appelshaeuser, Harald; Arcelli, Silvia; Arnaldi, Roberta; Arnold, Oliver Werner; Arsene, Ionut Cristian; Arslandok, Mesut; Audurier, Benjamin; Augustinus, Andre; Averbeck, Ralf Peter; Azmi, Mohd Danish; Badala, Angela; Baek, Yong Wook; Bagnasco, Stefano; Bailhache, Raphaelle Marie; Bala, Renu; Baldisseri, Alberto; Ball, Markus; Baral, Rama Chandra; Barbano, Anastasia Maria; Barbera, Roberto; Barile, Francesco; Barioglio, Luca; Barnafoldi, Gergely Gabor; Barnby, Lee Stuart; Ramillien Barret, Valerie; Bartalini, Paolo; Barth, Klaus; Bartsch, Esther; Basile, Maurizio; Bastid, Nicole; Basu, Sumit; Batigne, Guillaume; Batyunya, Boris; Batzing, Paul Christoph; Bearden, Ian Gardner; Beck, Hans; Bedda, Cristina; Behera, Nirbhay Kumar; Belikov, Iouri; Bellini, Francesca; Bello Martinez, Hector; Bellwied, Rene; Espinoza Beltran, Lucina Gabriela; Belyaev, Vladimir; Bencedi, Gyula; Beole, Stefania; Bercuci, Alexandru; Berdnikov, Yaroslav; Berenyi, Daniel; Bertens, Redmer Alexander; Berzano, Dario; Betev, Latchezar; Bhasin, Anju; Bhat, Inayat Rasool; Bhati, Ashok Kumar; Bhattacharjee, Buddhadeb; Bhom, Jihyun; Bianchi, Antonio; Bianchi, Livio; Bianchi, Nicola; Bianchin, Chiara; Bielcik, Jaroslav; Bielcikova, Jana; Bilandzic, Ante; Biro, Gabor; Biswas, Rathijit; Biswas, Saikat; Blair, Justin Thomas; Blau, Dmitry; Blume, Christoph; Boca, Gianluigi; Bock, Friederike; Bogdanov, Alexey; Boldizsar, Laszlo; Bombara, Marek; Bonomi, Germano; Bonora, Matthias; Book, Julian Heinz; Borel, Herve; Borissov, Alexander; Borri, Marcello; Botta, Elena; Bourjau, Christian; Bratrud, Lars; Braun-munzinger, Peter; Bregant, Marco; Broker, Theo Alexander; Broz, Michal; Brucken, Erik Jens; Bruna, Elena; Bruno, Giuseppe Eugenio; Budnikov, Dmitry; Buesching, Henner; Bufalino, Stefania; Buhler, Paul; Buncic, Predrag; Busch, Oliver; Buthelezi, Edith Zinhle; Bashir Butt, Jamila; Buxton, Jesse Thomas; Cabala, Jan; Caffarri, Davide; Caines, Helen Louise; Caliva, Alberto; Calvo Villar, Ernesto; Camerini, Paolo; Capon, Aaron Allan; Carena, Francesco; Carena, Wisla; Carnesecchi, Francesca; Castillo Castellanos, Javier Ernesto; Castro, Andrew John; Casula, Ester Anna Rita; Ceballos Sanchez, Cesar; Cerello, Piergiorgio; Chandra, Sinjini; Chang, Beomsu; Chapeland, Sylvain; Chartier, Marielle; Chattopadhyay, Subhasis; Chattopadhyay, Sukalyan; Chauvin, Alex; Cheshkov, Cvetan Valeriev; Cheynis, Brigitte; Chibante Barroso, Vasco Miguel; Dobrigkeit Chinellato, David; Cho, Soyeon; Chochula, Peter; Chojnacki, Marek; Choudhury, Subikash; Chowdhury, Tasnuva; Christakoglou, Panagiotis; Christensen, Christian Holm; Christiansen, Peter; Chujo, Tatsuya; Chung, Suh-urk; Cicalo, Corrado; Cifarelli, Luisa; Cindolo, Federico; Cleymans, Jean Willy Andre; Colamaria, Fabio Filippo; Colella, Domenico; Collu, Alberto; Colocci, Manuel; Concas, Matteo; Conesa Balbastre, Gustavo; Conesa Del Valle, Zaida; Connors, Megan Elizabeth; Contreras Nuno, Jesus Guillermo; Cormier, Thomas Michael; Corrales Morales, Yasser; Cortes Maldonado, Ismael; Cortese, Pietro; Cosentino, Mauro Rogerio; Costa, Filippo; Costanza, Susanna; Crkovska, Jana; Crochet, Philippe; Cuautle Flores, Eleazar; Cunqueiro Mendez, Leticia; Dahms, Torsten; Dainese, Andrea; Danisch, Meike Charlotte; Danu, Andrea; Das, Debasish; Das, Indranil; Das, Supriya; Dash, Ajay Kumar; Dash, Sadhana; De, Sudipan; De Caro, Annalisa; De Cataldo, Giacinto; De Conti, Camila; De Cuveland, Jan; De Falco, Alessandro; De Gruttola, Daniele; De Marco, Nora; De Pasquale, Salvatore; Derradi De Souza, Rafael; Franz Degenhardt, Hermann; Deisting, Alexander; Deloff, Andrzej; Deplano, Caterina; Dhankher, Preeti; Di Bari, Domenico; Di Mauro, Antonio; Di Nezza, Pasquale; Di Ruzza, Benedetto; Dietel, Thomas; Dillenseger, Pascal; Divia, Roberto; Djuvsland, Oeystein; Dobrin, Alexandru Florin; Domenicis Gimenez, Diogenes; Donigus, Benjamin; Dordic, Olja; Van Doremalen, Lennart Vincent; Dubey, Anand Kumar; Dubla, Andrea; Ducroux, Laurent; Duggal, Ashpreet Kaur; Dukhishyam, Mallick; Dupieux, Pascal; Ehlers Iii, Raymond James; Elia, Domenico; Endress, Eric; Engel, Heiko; Epple, Eliane; Erazmus, Barbara Ewa; Erhardt, Filip; Espagnon, Bruno; Esumi, Shinichi; Eulisse, Giulio; Eum, Jongsik; Evans, David; Evdokimov, Sergey; Fabbietti, Laura; Faivre, Julien; Fantoni, Alessandra; Fasel, Markus; Feldkamp, Linus; Feliciello, Alessandro; Feofilov, Grigorii; Fernandez Tellez, Arturo; Ferretti, Alessandro; Festanti, Andrea; Feuillard, Victor Jose Gaston; Figiel, Jan; Araujo Silva Figueredo, Marcel; Filchagin, Sergey; Finogeev, Dmitry; Fionda, Fiorella; Floris, Michele; Foertsch, Siegfried Valentin; Foka, Panagiota; Fokin, Sergey; Fragiacomo, Enrico; Francescon, Andrea; Francisco, Audrey; Frankenfeld, Ulrich Michael; Fronze, Gabriele Gaetano; Fuchs, Ulrich; Furget, Christophe; Furs, Artur; Fusco Girard, Mario; Gaardhoeje, Jens Joergen; Gagliardi, Martino; Gago Medina, Alberto Martin; Gajdosova, Katarina; Gallio, Mauro; Duarte Galvan, Carlos; Ganoti, Paraskevi; Garabatos Cuadrado, Jose; Garcia-solis, Edmundo Javier; Garg, Kunal; Gargiulo, Corrado; Gasik, Piotr Jan; Gauger, Erin Frances; De Leone Gay, Maria Beatriz; Germain, Marie; Ghosh, Jhuma; Ghosh, Premomoy; Ghosh, Sanjay Kumar; Gianotti, Paola; Giubellino, Paolo; Giubilato, Piero; Gladysz-dziadus, Ewa; Glassel, Peter; Gomez Coral, Diego Mauricio; Gomez Ramirez, Andres; Sanchez Gonzalez, Andres; Gonzalez Zamora, Pedro; Gorbunov, Sergey; Gorlich, Lidia Maria; Gotovac, Sven; Grabski, Varlen; Graczykowski, Lukasz Kamil; Graham, Katie Leanne; Greiner, Leo Clifford; Grelli, Alessandro; Grigoras, Costin; Grigoryev, Vladislav; Grigoryan, Ara; Grigoryan, Smbat; Gronefeld, Julius Maximilian; Grosa, Fabrizio; Grosse-oetringhaus, Jan Fiete; Grosso, Raffaele; Gruber, Lukas; Guber, Fedor; Guernane, Rachid; Guerzoni, Barbara; Gulbrandsen, Kristjan Herlache; Gunji, Taku; Gupta, Anik; Gupta, Ramni; Bautista Guzman, Irais; Haake, Rudiger; Hadjidakis, Cynthia Marie; Hamagaki, Hideki; Hamar, Gergoe; Hamon, Julien Charles; Haque, Md Rihan; Harris, John William; Harton, Austin Vincent; Hassan, Hadi; Hatzifotiadou, Despina; Hayashi, Shinichi; Heckel, Stefan Thomas; Hellbar, Ernst; Helstrup, Haavard; Herghelegiu, Andrei Ionut; Gonzalez Hernandez, Emma; Herrera Corral, Gerardo Antonio; Herrmann, Florian; Hess, Benjamin Andreas; Hetland, Kristin Fanebust; Hillemanns, Hartmut; Hills, Christopher; Hippolyte, Boris; Hladky, Jan; Hohlweger, Bernhard; Horak, David; Hornung, Sebastian; Hosokawa, Ritsuya; Hristov, Peter Zahariev; Hughes, Charles; Humanic, Thomas; Hussain, Nur; Hussain, Tahir; Hutter, Dirk; Hwang, Dae Sung; Iga Buitron, Sergio Arturo; Ilkaev, Radiy; Inaba, Motoi; Ippolitov, Mikhail; Irfan, Muhammad; Islam, Md Samsul; Ivanov, Marian; Ivanov, Vladimir; Izucheev, Vladimir; Jacak, Barbara; Jacazio, Nicolo; Jacobs, Peter Martin; Jadhav, Manoj Bhanudas; Jadlovsky, Jan; Jaelani, Syaefudin; Jahnke, Cristiane; Jakubowska, Monika Joanna; Janik, Malgorzata Anna; Pahula Hewage, Sandun; Jena, Chitrasen; Jena, Satyajit; Jercic, Marko; Jimenez Bustamante, Raul Tonatiuh; Jones, Peter Graham; Jusko, Anton; Kalinak, Peter; Kalweit, Alexander Philipp; Kang, Ju Hwan; Kaplin, Vladimir; Kar, Somnath; Karasu Uysal, Ayben; Karavichev, Oleg; Karavicheva, Tatiana; Karayan, Lilit; Karczmarczyk, Przemyslaw; Karpechev, Evgeny; Kebschull, Udo Wolfgang; Keidel, Ralf; Keijdener, Darius Laurens; Keil, Markus; Ketzer, Bernhard Franz; Khabanova, Zhanna; Khan, Palash; Khan, Shuaib Ahmad; Khanzadeev, Alexei; Kharlov, Yury; Khatun, Anisa; Khuntia, Arvind; Kielbowicz, Miroslaw Marek; Kileng, Bjarte; Kim, Byungchul; Kim, Daehyeok; Kim, Dong Jo; Kim, Hyeonjoong; Kim, Jinsook; Kim, Jiyoung; Kim, Minjung; Kim, Minwoo; Kim, Se Yong; Kim, Taesoo; Kirsch, Stefan; Kisel, Ivan; Kiselev, Sergey; Kisiel, Adam Ryszard; Kiss, Gabor; Klay, Jennifer Lynn; Klein, Carsten; Klein, Jochen; Klein-boesing, Christian; Klewin, Sebastian; Kluge, Alexander; Knichel, Michael Linus; Knospe, Anders Garritt; Kobdaj, Chinorat; Kofarago, Monika; Kohler, Markus Konrad; Kollegger, Thorsten; Kondratev, Valerii; Kondratyeva, Natalia; Kondratyuk, Evgeny; Konevskikh, Artem; Konyushikhin, Maxim; Kopcik, Michal; Kour, Mandeep; Kouzinopoulos, Charalampos; Kovalenko, Oleksandr; Kovalenko, Vladimir; Kowalski, Marek; Koyithatta Meethaleveedu, Greeshma; Kralik, Ivan; Kravcakova, Adela; Kreis, Lukas; Krivda, Marian; Krizek, Filip; Kryshen, Evgeny; Krzewicki, Mikolaj; Kubera, Andrew Michael; Kucera, Vit; Kuhn, Christian Claude; Kuijer, Paulus Gerardus; Kumar, Ajay; Kumar, Jitendra; Kumar, Lokesh; Kumar, Shyam; Kundu, Sourav; Kurashvili, Podist; Kurepin, Alexander; Kurepin, Alexey; Kuryakin, Alexey; Kushpil, Svetlana; Kweon, Min Jung; Kwon, Youngil; La Pointe, Sarah Louise; La Rocca, Paola; Lagana Fernandes, Caio; Lai, Yue Shi; Lakomov, Igor; Langoy, Rune; Lapidus, Kirill; Lara Martinez, Camilo Ernesto; Lardeux, Antoine Xavier; Lattuca, Alessandra; Laudi, Elisa; Lavicka, Roman; Lea, Ramona; Leardini, Lucia; Lee, Seongjoo; Lehas, Fatiha; Lehner, Sebastian; Lehrbach, Johannes; Lemmon, Roy Crawford; Lenti, Vito; Leogrande, Emilia; Leon Monzon, Ildefonso; Levai, Peter; Li, Xiaomei; Lien, Jorgen Andre; Lietava, Roman; Lim, Bong-hwi; Lindal, Svein; Lindenstruth, Volker; Lindsay, Scott William; Lippmann, Christian; Lisa, Michael Annan; Litichevskyi, Vladyslav; Llope, William; Lodato, Davide Francesco; Lonne, Per-ivar; Loginov, Vitaly; Loizides, Constantinos; Loncar, Petra; Lopez, Xavier Bernard; Lopez Torres, Ernesto; Lowe, Andrew John; Luettig, Philipp Johannes; Luhder, Jens Robert; Lunardon, Marcello; Luparello, Grazia; Lupi, Matteo; Lutz, Tyler Harrison; Maevskaya, Alla; Mager, Magnus; Mahajan, Sanjay; Mahmood, Sohail Musa; Maire, Antonin; Majka, Richard Daniel; Malaev, Mikhail; Malinina, Liudmila; Mal'kevich, Dmitry; Malzacher, Peter; Mamonov, Alexander; Manko, Vladislav; Manso, Franck; Manzari, Vito; Mao, Yaxian; Marchisone, Massimiliano; Mares, Jiri; Margagliotti, Giacomo Vito; Margotti, Anselmo; Margutti, Jacopo; Marin, Ana Maria; Markert, Christina; Marquard, Marco; Martin, Nicole Alice; Martinengo, Paolo; Lucio Martinez, Jose Antonio; Martinez Hernandez, Mario Ivan; Martinez-garcia, Gines; Martinez Pedreira, Miguel; Masciocchi, Silvia; Masera, Massimo; Masoni, Alberto; Masson, Erwann; Mastroserio, Annalisa; Mathis, Andreas Michael; Toledo Matuoka, Paula Fernanda; Matyja, Adam Tomasz; Mayer, Christoph; Mazer, Joel Anthony; Mazzilli, Marianna; Mazzoni, Alessandra Maria; Meddi, Franco; Melikyan, Yuri; Menchaca-rocha, Arturo Alejandro; Meninno, Elisa; Mercado-perez, Jorge; Meres, Michal; Mhlanga, Sibaliso; Miake, Yasuo; Mieskolainen, Matti Mikael; Mihaylov, Dimitar Lubomirov; Mikhaylov, Konstantin; Milosevic, Jovan; Mischke, Andre; Mishra, Aditya Nath; Miskowiec, Dariusz Czeslaw; Mitra, Jubin; Mitu, Ciprian Mihai; Mohammadi, Naghmeh; Mohanty, Bedangadas; Khan, Mohammed Mohisin; Moreira De Godoy, Denise Aparecida; Perez Moreno, Luis Alberto; Moretto, Sandra; Morreale, Astrid; Morsch, Andreas; Muccifora, Valeria; Mudnic, Eugen; Muhlheim, Daniel Michael; Muhuri, Sanjib; Mukherjee, Maitreyee; Mulligan, James Declan; Gameiro Munhoz, Marcelo; Munning, Konstantin; Munzer, Robert Helmut; Murakami, Hikari; Murray, Sean; Musa, Luciano; Musinsky, Jan; Myers, Corey James; Myrcha, Julian Wojciech; Nag, Dipanjan; Naik, Bharati; Nair, Rahul; Nandi, Basanta Kumar; Nania, Rosario; Nappi, Eugenio; Narayan, Amrendra; Naru, Muhammad Umair; Ferreira Natal Da Luz, Pedro Hugo; Nattrass, Christine; Rosado Navarro, Sebastian; Nayak, Kishora; Nayak, Ranjit; Nayak, Tapan Kumar; Nazarenko, Sergey; Nedosekin, Alexander; Negrao De Oliveira, Renato Aparecido; Nellen, Lukas; Nesbo, Simon Voigt; Ng, Fabian; Nicassio, Maria; Niculescu, Mihai; Niedziela, Jeremi; Nielsen, Borge Svane; Nikolaev, Sergey; Nikulin, Sergey; Nikulin, Vladimir; Noferini, Francesco; Nomokonov, Petr; Nooren, Gerardus; Cabanillas Noris, Juan Carlos; Norman, Jaime; Nyanin, Alexander; Nystrand, Joakim Ingemar; Oeschler, Helmut Oskar; Oh, Saehanseul; Ohlson, Alice Elisabeth; Okubo, Tsubasa; Olah, Laszlo; Oleniacz, Janusz; Oliveira Da Silva, Antonio Carlos; Oliver, Michael Henry; Onderwaater, Jacobus; Oppedisano, Chiara; Orava, Risto; Oravec, Matej; Ortiz Velasquez, Antonio; Oskarsson, Anders Nils Erik; Otwinowski, Jacek Tomasz; Oyama, Ken; Pachmayer, Yvonne Chiara; Pacik, Vojtech; Pagano, Davide; Pagano, Paola; Paic, Guy; Palni, Prabhakar; Pan, Jinjin; Pandey, Ashutosh Kumar; Panebianco, Stefano; Papikyan, Vardanush; Pappalardo, Giuseppe; Pareek, Pooja; Park, Jonghan; Parmar, Sonia; Passfeld, Annika; Pathak, Surya Prakash; Patra, Rajendra Nath; Paul, Biswarup; Pei, Hua; Peitzmann, Thomas; Peng, Xinye; Pereira, Luis Gustavo; Pereira Da Costa, Hugo Denis Antonio; Peresunko, Dmitry Yurevich; Perez Lezama, Edgar; Peskov, Vladimir; Pestov, Yury; Petracek, Vojtech; Petrov, Viacheslav; Petrovici, Mihai; Petta, Catia; Peretti Pezzi, Rafael; Piano, Stefano; Pikna, Miroslav; Pillot, Philippe; Ozelin De Lima Pimentel, Lais; Pinazza, Ombretta; Pinsky, Lawrence; Piyarathna, Danthasinghe; Ploskon, Mateusz Andrzej; Planinic, Mirko; Pliquett, Fabian; Pluta, Jan Marian; Pochybova, Sona; Podesta Lerma, Pedro Luis Manuel; Poghosyan, Martin; Polishchuk, Boris; Poljak, Nikola; Poonsawat, Wanchaloem; Pop, Amalia; Poppenborg, Hendrik; Porteboeuf, Sarah Julie; Pozdniakov, Valeriy; Prasad, Sidharth Kumar; Preghenella, Roberto; Prino, Francesco; Pruneau, Claude Andre; Pshenichnov, Igor; Puccio, Maximiliano; Puddu, Giovanna; Pujahari, Prabhat Ranjan; Punin, Valery; Putschke, Jorn Henning; Raha, Sibaji; Rajput, Sonia; Rak, Jan; Rakotozafindrabe, Andry Malala; Ramello, Luciano; Rami, Fouad; Rana, Dhan Bahadur; Raniwala, Rashmi; Raniwala, Sudhir; Rasanen, Sami Sakari; Rascanu, Bogdan Theodor; Rathee, Deepika; Ratza, Viktor; Ravasenga, Ivan; Read, Kenneth Francis; Redlich, Krzysztof; Rehman, Attiq Ur; Reichelt, Patrick Simon; Reidt, Felix; Ren, Xiaowen; Renfordt, Rainer Arno Ernst; Reolon, Anna Rita; Reshetin, Andrey; Reygers, Klaus Johannes; Riabov, Viktor; Ricci, Renato Angelo; Richert, Tuva Ora Herenui; Richter, Matthias Rudolph; Riedler, Petra; Riegler, Werner; Riggi, Francesco; Ristea, Catalin-lucian; Rodriguez Cahuantzi, Mario; Roeed, Ketil; Rogochaya, Elena; Rohr, David Michael; Roehrich, Dieter; Rokita, Przemyslaw Stefan; Ronchetti, Federico; Dominguez Rosas, Edgar; Rosnet, Philippe; Rossi, Andrea; Rotondi, Alberto; Roukoutakis, Filimon; Roy, Ankhi; Roy, Christelle Sophie; Roy, Pradip Kumar; Vazquez Rueda, Omar; Rui, Rinaldo; Rumyantsev, Boris; Rustamov, Anar; Ryabinkin, Evgeny; Ryabov, Yury; Rybicki, Andrzej; Saarinen, Sampo; Sadhu, Samrangy; Sadovskiy, Sergey; Safarik, Karel; Saha, Sumit Kumar; Sahlmuller, Baldo; Sahoo, Baidyanath; Sahoo, Pragati; Sahoo, Raghunath; Sahoo, Sarita; Sahu, Pradip Kumar; Saini, Jogender; Sakai, Shingo; Saleh, Mohammad Ahmad; Salzwedel, Jai Samuel Nielsen; Sambyal, Sanjeev Singh; Samsonov, Vladimir; Sandoval, Andres; Sarkar, Debojit; Sarkar, Nachiketa; Sarma, Pranjal; Sas, Mike Henry Petrus; Scapparone, Eugenio; Scarlassara, Fernando; Schaefer, Brennan; Scharenberg, Rolf Paul; Scheid, Horst Sebastian; Schiaua, Claudiu Cornel; Schicker, Rainer Martin; Schmidt, Christian Joachim; Schmidt, Hans Rudolf; Schmidt, Marten Ole; Schmidt, Martin; Schmidt, Nicolas Vincent; Schukraft, Jurgen; Schutz, Yves Roland; Schwarz, Kilian Eberhard; Schweda, Kai Oliver; Scioli, Gilda; Scomparin, Enrico; Sefcik, Michal; Seger, Janet Elizabeth; Sekiguchi, Yuko; Sekihata, Daiki; Selyuzhenkov, Ilya; Senosi, Kgotlaesele; Senyukov, Serhiy; Serradilla Rodriguez, Eulogio; Sett, Priyanka; Sevcenco, Adrian; Shabanov, Arseniy; Shabetai, Alexandre; Shahoyan, Ruben; Shaikh, Wadut; Shangaraev, Artem; Sharma, Anjali; Sharma, Ankita; Sharma, Mona; Sharma, Monika; Sharma, Natasha; Sheikh, Ashik Ikbal; Shigaki, Kenta; Shou, Qiye; Shtejer Diaz, Katherin; Sibiryak, Yury; Siddhanta, Sabyasachi; Sielewicz, Krzysztof Marek; Siemiarczuk, Teodor; Silaeva, Svetlana; Silvermyr, David Olle Rickard; Silvestre, Catherine Micaela; Simatovic, Goran; Simonetti, Giuseppe; Singaraju, Rama Narayana; Singh, Ranbir; Singhal, Vikas; Sarkar - Sinha, Tinku; Sitar, Branislav; Sitta, Mario; Skaali, Bernhard; Slupecki, Maciej; Smirnov, Nikolai; Snellings, Raimond; Snellman, Tomas Wilhelm; Song, Jihye; Song, Myunggeun; Soramel, Francesca; Sorensen, Soren Pontoppidan; Sozzi, Federica; Spiriti, Eleuterio; Sputowska, Iwona Anna; Srivastava, Brijesh Kumar; Stachel, Johanna; Stan, Ionel; Stankus, Paul; Stenlund, Evert Anders; Stocco, Diego; Storetvedt, Maksim Melnik; Strmen, Peter; Alarcon Do Passo Suaide, Alexandre; Sugitate, Toru; Suire, Christophe Pierre; Suleymanov, Mais Kazim Oglu; Suljic, Miljenko; Sultanov, Rishat; Sumbera, Michal; Sumowidagdo, Suharyo; Suzuki, Ken; Swain, Sagarika; Szabo, Alexander; Szarka, Imrich; Tabassam, Uzma; Takahashi, Jun; Tambave, Ganesh Jagannath; Tanaka, Naoto; Tarhini, Mohamad; Tariq, Mohammad; Tarzila, Madalina-gabriela; Tauro, Arturo; Tejeda Munoz, Guillermo; Telesca, Adriana; Terasaki, Kohei; Terrevoli, Cristina; Teyssier, Boris; Thakur, Dhananjaya; Thakur, Sanchari; Thomas, Deepa; Thoresen, Freja; Tieulent, Raphael Noel; Tikhonov, Anatoly; Timmins, Anthony Robert; Toia, Alberica; Rojas Torres, Solangel; Tripathy, Sushanta; Trogolo, Stefano; Trombetta, Giuseppe; Tropp, Lukas; Trubnikov, Victor; Trzaska, Wladyslaw Henryk; Trzeciak, Barbara Antonina; Tsuji, Tomoya; Tumkin, Alexandr; Turrisi, Rosario; Tveter, Trine Spedstad; Ullaland, Kjetil; Umaka, Ejiro Naomi; Uras, Antonio; Usai, Gianluca; Utrobicic, Antonija; Vala, Martin; Van Der Maarel, Jasper; Van Hoorne, Jacobus Willem; Van Leeuwen, Marco; Vanat, Tomas; Vande Vyvre, Pierre; Varga, Dezso; Diozcora Vargas Trevino, Aurora; Vargyas, Marton; Varma, Raghava; Vasileiou, Maria; Vasiliev, Andrey; Vauthier, Astrid; Vazquez Doce, Oton; Vechernin, Vladimir; Veen, Annelies Marianne; Velure, Arild; Vercellin, Ermanno; Vergara Limon, Sergio; Vernet, Renaud; Vertesi, Robert; Vickovic, Linda; Vigolo, Sonia; Viinikainen, Jussi Samuli; Vilakazi, Zabulon; Villalobos Baillie, Orlando; Villatoro Tello, Abraham; Vinogradov, Alexander; Vinogradov, Leonid; Virgili, Tiziano; Vislavicius, Vytautas; Vodopyanov, Alexander; Volkl, Martin Andreas; Voloshin, Kirill; Voloshin, Sergey; Volpe, Giacomo; Von Haller, Barthelemy; Vorobyev, Ivan; Voscek, Dominik; Vranic, Danilo; Vrlakova, Janka; Wagner, Boris; Wang, Hongkai; Wang, Mengliang; Watanabe, Daisuke; Watanabe, Yosuke; Weber, Michael; Weber, Steffen Georg; Weiser, Dennis Franz; Wenzel, Sandro Christian; Wessels, Johannes Peter; Westerhoff, Uwe; Whitehead, Andile Mothegi; Wiechula, Jens; Wikne, Jon; Wilk, Grzegorz Andrzej; Wilkinson, Jeremy John; Willems, Guido Alexander; Williams, Crispin; Willsher, Emily; Windelband, Bernd Stefan; Witt, William Edward; Yalcin, Serpil; Yamakawa, Kosei; Yang, Ping; Yano, Satoshi; Yin, Zhongbao; Yokoyama, Hiroki; Yoo, In-kwon; Yoon, Jin Hee; Yurchenko, Volodymyr; Zaccolo, Valentina; Zaman, Ali; Zampolli, Chiara; Correa Zanoli, Henrique Jose; Zardoshti, Nima; Zarochentsev, Andrey; Zavada, Petr; Zavyalov, Nikolay; Zbroszczyk, Hanna Paulina; Zhalov, Mikhail; Zhang, Haitao; Zhang, Xiaoming; Zhang, Yonghong; Chunhui, Zhang; Zhang, Zuman; Zhao, Chengxin; Zhigareva, Natalia; Zhou, Daicui; Zhou, You; Zhou, Zhuo; Zhu, Hongsheng; Zhu, Jianhui; Zichichi, Antonino; Zimmermann, Alice; Zimmermann, Markus Bernhard; Zinovjev, Gennady; Zmeskal, Johann; Zou, Shuguang

    2018-02-22

    Invariant differential yields of deuterons and anti-deuterons in pp collisions at $\\sqrt{s}$ = 0.9, 2.76 and 7~TeV and the yields of tritons, $^{3}$He nuclei and their anti-nuclei at $\\sqrt{s}$ = 7~TeV have been measured with the ALICE detector at the LHC. The measurements cover a wide transverse momentum ($p_{\\text{T}}$) range in the rapidity interval $|y|<0.5$, extending both the energy and the $p_{\\text{T}}$ reach of previous measurements up to 3~GeV/$c$ for $A=2$ and 6~GeV/$c$ for $A=3$. The coalescence parameters of (anti-)deuterons and $^{3}\\overline{\\text{He}}$ nuclei exhibit an increasing trend with $p_{\\text{T}}$ and are found to be compatible with measurements in pA collisions at low $p_{\\text{T}}$ and lower energies. The integrated yields decrease by a factor of about 1000 for each increase of the mass number with one (anti-)nucleon. Furthermore, the deuteron-to-proton ratio is reported as a function of the average charged particle multiplicity at different center-of-mass energies.

  3. Confirmatory experiments for the United States Department of Energy Accelerator Production of Tritium Program: Neutron, triton and radionuclide production by thick targets of lead and tungsten bombarded by 800 MeV protons

    International Nuclear Information System (INIS)

    Lisowski, P.W.; Cappiello, M.; Ullmann, J.L.; Gavron, A.; King, J.D.; Laird, R.; Mayo, D.; Waters, L.; Zoeller, C.; Staples, P.

    1994-01-01

    Neutron and Triton Production by 800 MeV Protons: The experiments presented in this report were performed in support of the Accelerator Production of Tritium (APT) project at the Los Alamos Weapons Neutron Research (WNR) facility in order to provide data to benchmark and validate physics simulations used in the APT target/blanket design. An experimental apparatus was built that incorporated many of the features of the neutron source region of the 3 He target/blanket. Those features included a tungsten neutron source, flux traps, neutron moderator, lead backstop, lead multiplying annulus, neutron absorbing blanket and a combination neutron de-coupler and tritium producing gas ( 3 He). The experiments were performed in two separate proton irradiations each with approximately 100 nA-hr of 800 MeV protons. The first irradiation was made with a small neutron moderating blanket, allowing the authors to measure tritium production in the 3 He gas by sampling, and counting the amount of tritium. The second irradiation was performed with a large neutron moderating blanket (light water with a 1% manganese sulfate solution) that allowed them to measure both the tritium production in the central region and the total neutron production. The authors did this by sampling and counting the tritium produced and by measuring the activation of the manganese solution. Results of the three tritium production measurements show large disagreements with each other and therefore with the values predicted using the LAHET-MCNP code system. The source of the discrepancies may lie with the sampling system or adsorption on the tungsten surfaces. The authors discuss tests that may resolve that issue. The data for the total neutron production measurement is much more consistent. Those results show excellent agreement between calculation and experiment

  4. Elastic scattering of tritons by helium-4

    Energy Technology Data Exchange (ETDEWEB)

    Jarmie, N.; Correll, F.D.; Brown, R.E.; Hardekopf, R.A.; Ohlsen, G.G.

    1980-11-01

    Angular distributions of the differential cross section and of the analyzing power have been measured for the /sup 4/He(t,t)/sup 4/He reaction at 19 energies from 6 to 17 MeV. The relative errors of the cross section and analyzing power range from 2.0 to 2.5% and 0.005 to 0.01, respectively, and the scale errors are 1% in each case. Complete data tables are presented, and the experimental procedure is described for the present measurements and for earlier cross-section measurements. Graphs of the data are presented, as well as the curves resulting from an energy-independent phase-shift analysis.

  5. Tritium labeling by thermally generated tritons

    International Nuclear Information System (INIS)

    Morimoto, H.; Williams, P.G.; Saljoughian, M.

    1988-06-01

    The predominant effect of thermal atom irradiation on solid molecules is saturation of their aromatic functions. Only low level of tritium exchange is observed for aliphatic solids. In contrast, liquids whose frozen surface can be rendered somewhat mobile at appropriate temperatures exhibit more exchange than addition. The rank order of effectiveness of several metals in promoting exchange/addition appears similar to the rank order for heterogeneous catalytic hydrogenation. 3 refs., 8 figs

  6. Status report of the Triton/Munich

    International Nuclear Information System (INIS)

    Trinks, U.

    1988-01-01

    At the Accelerator Laboratory of the Universities of Munich a booster for the existing MP-tandem is under construction. The Tritron project was finally funded in January this year. The Tritron is a cyclotron with separated orbits with both the magnets and cavities superconducting. It will increase the ion energies by a factor of 4.9, so a 12 C 6+ -beam will have a maximum energy of 21 MeV/u e.g. The cryostat has a diameter of 3.6 m. The beam is injected at a radius r 1 = 66 cm and extracted after almost 20 turns at r 2 = 145 cm. The turn separation is δR = 4 cm. The bending is made by 12 flat magnet sectors, each consisting of 20 magnetic channels of window frame type. In each channel the magnetic field (∼ 1.4 T) is adjustable individually, so that the beam always can be guided along the spiral orbit. The gradient is alternating from one sector to the next resulting in strong focusing in both transversal directions. In each second intermediate gap a wedge-shaped accelerating cavity of the reentrant type is installed for the 20 parallel beams. The radial cavity length is 1.2 m, the outside width 0.7 m. The radial length of the accelerating lips is 0.9 m, the gap width at injection radius 6 cm, at extraction radius 13 cm. The rf-frequency is ∼ 170 MHz, the maximum voltage at injection U(r 1 ) ≅ 270 kV, at extraction U(r 2 ) ≅ 540 kV per cavity. If the bunchers cross the cavity at a rf-phase with increasing accelerating voltage, they are focused longitudinally, resulting in ∼ 0.2 synchrotron oscillations per turn. The longitudinal focusing causes the rf-phase to change automatically corresponding to the necessary energy gain and to the radial characteristic of the voltage amplitude along the gap. 2 references, 6 figures, 1 table

  7. MQ-4C Triton Unmanned Aircraft System (MQ-4C Triton)

    Science.gov (United States)

    2015-12-01

    designated U.S. and Joint Commanders. The addition of a de -icing capability over the baseline Global Hawk provides operators with the capability to...Functional Capability (IFC) 2 software. The program marked the first use of the Main Operating Base Mission Control System installed at the test hangar at...Based) MCS BLOS and LOS from the MOB (Land Based) MCS BLOS and LOS from MOB (Land Based) MCS ( LOI 4 and 5) BLOS and LOS from MOB (Land Based

  8. nduced hyperlipidemic rats. Methods: Column chromatographic fractionation of butanol fraction of total methanol extract of leaves of Bauhinia variegata (Linn. yields four sub-fractions (sub-fraction A-D. All sub-fractions tested for their anti-hyperlipidemic activity. Sub-fractions administered at a dose of 65 mg/kg (oral to the Triton WR-1339 induced hyperlipidemic rats and total cholesterol, triglycerides, HDL, LDL and VLDL

    Directory of Open Access Journals (Sweden)

    Deepak Kumar

    2012-10-01

    Full Text Available Objective: To investigate the effect and evaluation of Anti-hyperlipidemic activity guided subfraction isolated from total methanolic extract of Bauhinia variegata (Linn. leaves on Triton WR-1339 induced hyperlipidemic rats. Methods: Column chromatographic fractionation of butanol fraction of total methanol extract of leaves of Bauhinia variegata (Linn. yields four subfractions (sub-fraction A-D. All sub-fractions tested for their anti-hyperlipidemic activity. Subfractions administered at a dose of 65 mg/kg (oral to the Triton WR-1339 induced hyperlipidemic rats and total cholesterol, triglycerides, HDL, LDL and VLDL level in the blood were checked. Results: Sub-fraction D showed significant reduction (P<0.05 among four sub-fraction in comparison with standard drug fenofibrate. Conclusions: From the above study it could be concluded that butanol sub-fraction D of Bauhinia variegata (Linn. not only have resulted in significant reduction in cholesterol, triglyceride, LDL, VLDL level but also increases the HDL level at a reduced dose level.

  9. Transfer reactions at the neutron dripline with triton target

    CERN Multimedia

    Two-neutron transfer to $^{9}$Li will populate the ground state of $^{11}$Li as well as low-lying resonances in a way that is complementary to studies of these states performed at higher beam energies. We aim at detecting the charged particles from the transfer reactions as well as neutrons coming from the decay of possible $^{11}$Li resonances.

  10. Triton as a three-nucleon - one-meson problem

    International Nuclear Information System (INIS)

    Noyes, H.P.; Orlowski, M.K.

    1982-06-01

    The standard method for basing nuclear physics on elementary particle physics is to first derive a potential and then use this interaction in the nonrelativistic Schroedinger equation for the nucleonic degrees of freedom. Unfortunately there has never been a consensus as to how to perform the first step. Currently we have dispersion-theoretic models and one-boson-exchange models which contain much the same physics, but which differ in detail; more modern approaches start from quark bags, but again there is no consensus as to whether the bag should be large or small. In this paper we offer an alternative approach in which the mesonic and nucleonic degrees of freedom are put on the same footing

  11. Transfer reactions at the neutron dripline with triton target

    CERN Document Server

    Borge, M J G; Fynbo, H O U; Gomez Camacho, J; Johansen, J; Johansson, H T; Jonson, B; Krücken, R; Kurcewicz, J; Martel, I; Moro, A; Mücher, D; Nilsson, T; Nyman, G; Raabe, R; Randisi, G; Riisager, K; Sambi, S; Sanchez-Benitez, AM; Tengblad, O

    2012-01-01

    Two-neutron transfer to $^{9}$Li will populate the ground state of $^{11}$Li as well as low-lying resonances in a way that is complementary to studies of these states performed at higher beam energies. We aim at detecting the charged particles from the transfer reactions as well as neutrons coming from the decay of possible $^{11}$Li resonances.

  12. Tuning intermicellar potential of Triton X-100– anthranilic acid mixed ...

    Indian Academy of Sciences (India)

    solubilized anthranilic acid at different pH values was investigated using light scattering and small angle neutron scattering. Analysis of the SANS data indicate that micelles are oblate ellipsoidal in nature with little variation in the dimensions, in the investigated pH range (from 0.5 to 6.0). The interaction potential of the ...

  13. Application of Triton X-100 coated poly vinyl chloride as new solid ...

    African Journals Online (AJOL)

    The influences of the analytical parameters including pH, ligand amount, surfactant type and concentration, eluting condition and sample volume on metal ions recovery were investigated. The method has been ... KEY WORDS: Surfactant coated PVC, Atomic absorption spectrometry, Solid phase extraction. Bull. Chem. Soc.

  14. Dissolution Rate, Weathering Mechanics, and Friability of TNT, Comp B, Tritonal, and Octol

    Science.gov (United States)

    2010-02-01

    Pacipitate in 4mL  ACN Figure 66. HPLC profile of the aqueous filter (top) and the dissolved precipitate (bottom). The HPLC data showed that the...Studies on Alaskan training ranges. Sixth International Conference on Remediation of Chlorinated and Recalcitrant Compounds, Monterey, California...Matthew Curnow, and Bonnie Packer 5f. WORK UNIT NUMBER 8. PERFORMING ORGANIZATION REPORT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS

  15. The asymptotic D-state to S-state ratio of triton

    Indian Academy of Sciences (India)

    [16] P F Bedaque, G Rupak, H W Grießhammer and H-W Hammer, Nucl. Phys. A 714, 589 (2003). [17] S R Beane and M J Savage, Nucl. Phys. A 694, 511 (2001). [18] H W Grießhammer, Nucl. Phys. A 760, 110 (2005). [19] T Frederico, S K Adhikari and M S Hussein, Phys. Rev. C 37, 364 (1988). [20] I Borbely et al, Nucl.

  16. TAO/TRITON, RAMA, and PIRATA Buoys, 5-Day, 1980-present, Dynamic Height

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has 5-day Dynamic Height data (a measure of the elevation of the sea level, calculated by integrating the specific volume anomaly of the sea water...

  17. Proton, deuteron and triton emission in 14N + Ag reaction at 52 MeV/nucleon

    International Nuclear Information System (INIS)

    Aleksakhin, V.Yu.; Gostkin, M.I.; Gudima, K.K.

    1998-01-01

    Inclusive energy spectra of p, d, t and multiplicities from the reaction 14 N(Ag, X), X = p, d, t at E/A = 52 MeV were measured. The experimental data are compared with Dubna version of the Cascade Model (DCM) and are analyzed in the framework of the moving source model

  18. The Utilization of Triton X-100 for Enhanced Two-Dimensional Liquid-Phase Proteomics

    OpenAIRE

    Kim, Mina; Lee, Sang-Hee; Min, Jiho; Kobayashi, Fumihisa; Um, Hyun-Ju; Kim, Yang-Hoon

    2011-01-01

    One of the main challenges in proteomics lies in obtaining a high level of reproducible fractionation of the protein samples. Automated two-dimensional liquid phase fractionation (PF2D) system manufactured by Beckman Coulter provides a process well suited for proteome studies. However, the protein recovery efficiency of such system is low when a protocol recommended by the manufacturer is used for metaproteome profiling of environmental sample. In search of an alternative method that can over...

  19. Tuning intermicellar potential of Triton X-100–anthranilic acid mixed ...

    Indian Academy of Sciences (India)

    A similar variation is observed in the cloud point of the micelles with pH. The observed variation in the interaction potential with pH of the micellar solution can be explained in terms of the reversal of charge on anthranilic acid due to shift in the acid–base equilibrium. The variation in interaction potential and cloud point with ...

  20. Cell Motility and Invasiveness of Neurofibromin-Deficient Neural Crest Cells and Malignant Triton Tumor Lines

    National Research Council Canada - National Science Library

    Vogel, Kristine S

    2005-01-01

    .... We have completed our analyses of NfI4- embryonic NOC invasiveness in vitro, and compared effects of neurofibromin deficiency in different embryonic mesenchymal cell populations derived from cranial and trunk regions...

  1. Monte Carlo calculations of triton and 4He nuclei with the Reid potential

    International Nuclear Information System (INIS)

    Lomnitz-Adler, J.; Pandharipande, V.R.; Smith, R.A.

    1981-01-01

    A Monte Carlo method is developed to calculate the binding energy and density distribution of the 3 H and 4 H nuclei for a variational wave function written as a symmetrized product of correlation operators. The upper bounds obtained with the Reid potential are -6.86 +- 0.08 and -22.9 +- 0.5 MeV respectively. The Coulomb interaction in 4 H is ignored. The calculated density distributions have reasonable radii, but they do not show any dip at the center. (orig.)

  2. Pacific Ocean buoy temperature date - TAO/TRITON database & National Buoy Data Center database

    Data.gov (United States)

    U.S. Environmental Protection Agency — Pacific Ocean buoy temperature data. This dataset is associated with the following publication: Carbone, F., M. Landis, C.N. Gencarelli, A. Naccarato, F. Sprovieri,...

  3. WIMSCORE, 2-Group Constant from WIMS-D/4 for Programs TDB, TRITON, CITATION

    International Nuclear Information System (INIS)

    Bartal, Yair

    1991-01-01

    1 - Description of program or function: The code processes the WIMS-D/4 binary output files for producing two-group microscopic Cross sections and macroscopic lattice cell constants (zone and cell macroscopic Cross sections, D, M, and K-infinity) in a more flexible Format needed for reactor burnup codes like CITATION, for reactor dynamics codes like NADYP-W and for other reactor codes. The purpose of the WIMSCORE-ENEA code is to facilitate the automation of data transfer between the cell calculation code WIMS and the diffusion-burnup codes. 2 - Method of solution: The code spatially homogenizes and group collapses the various Cross sections into two-group homogenized microscopic Cross sections using the flux per mesh for each energy group for WIMS multigroup lattice calculations. 3 - Restrictions on the complexity of the problem: None

  4. Different behaviour of GPCRs from rat brain cortex when exposed to Triton X-100

    Czech Academy of Sciences Publication Activity Database

    Rudajev, Vladimír; Stöhr, Jiří; Bouřová, Lenka; Lisý, Václav; Novotný, Jiří; Svoboda, Petr

    2007-01-01

    Roč. 101, Suppl.1 (2007), s. 52-52 ISSN 0022-3042. [European Society for Neurochemistry Meeting /17./. 19.05.2007-22.05.2007, Salamanca] Institutional research plan: CEZ:AV0Z50110509 Keywords : cpo1 * detergent resistant membrane domains * GABAB receptor * Beta-adrenergic receptor Subject RIV: ED - Physiology

  5. Triton and alpha-particle contribution from LiF converter for neutron dosimeter

    CERN Document Server

    Camacho, M E; Balcazar, M

    1999-01-01

    A personnel neutron dosimeter prototype based on chemical and electrochemical etched CR-39 detector, combined with LiF converter, has been calibrated using an ICRP-like phantom, under a heavy-water moderated Californium source neutron spectra; A conversion factor of 1.052+-126 spots cm sup - sup 2 mSv sup - sup 1 was obtained. The sealing properties of the detector holder showed a ten-fold reduction in radon background when it was tested in a high radon atmosphere. A convenient mechanical shock resistance was achieved in LiF converters by sintering to 11 tons pressure LiF powder at 650 deg. C, during one hour.

  6. Zirconium-titanium-phosphate nanoparticles. Triton X-100 based size modification, characterization and application in radiochemical separation

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, R.; Sen, B.; Chattopadhyay, P. [Burdwan Univ. (India). Dept. of Chemistry

    2014-07-01

    Zirconium-titanium-phosphate nanoparticles (ZTP) of different sizes were synthesized using tritron X-100 (polyethylene glycol-p-isooctylphenyl ether) surfactant. The materials were characterized by FTIR and powdered X-ray diffraction (XRD). The structural and morphological details of the material were obtained by scanning electron microscopy (SEM) and transmission electron microscopy (TEM). The SEM study was followed by energy dispersive spectroscopic analysis (EDS) for elemental analysis of the sample. The important peaks of the XRD spectra were analyzed to determine the probable composition of the material. The particle sizes were determined by dynamic light scattering (DLS) method. Ion exchange capacity was measured for different metal ions with sizes of the ZTP nanoparticles and size-dependent ion exchange property of the material was investigated thoroughly. The nanomaterial of the smallest size of around 5 nm was employed to separate carrier-free {sup 137m}Ba from {sup 137}Cs in column chromatographic technique using 1.0 M HNO{sub 3} as eluting agent at pH = 5. (orig.)

  7. Purification and spectroscopic characterization of photosystem II reaction center complexes isolated with or without Triton X-100.

    NARCIS (Netherlands)

    Eijckelhoff, C.; van Roon, H.; Groot, M.L.; van Grondelle, R.; Dekker, J.P.

    1996-01-01

    The pigment composition of the isolated photosystem II reaction center complex in its most stable and pure form currently is a matter of considerable debate. In this contribution, we present a new method based on a combination of gel filtration chromatography and diode array detection to analyze the

  8. ATIVIDADE HIPOLIPIDÊMICA DO DISSELENETO DE DIFENILA NA HIPERLIPIDEMIA INDUZIDA POR TRITON WR-1339 EM CAMUNDONGOS

    OpenAIRE

    Juliana Trevisan da Rocha

    2009-01-01

    Nos mamíferos, o fígado desempenha um papel extremamente importante na manutenção da homeostase do metabolismo dos lipídios plasmáticos. Entretanto, problemas na regulação desses mecanismos têm sido implicados na ocorrência de dislipidemias (alterações na concentração adequada de lipídios no plasma). Nos últimos anos, tem sido evidenciada a existência de uma relação entre os níveis de selênio (Se) e o aumento nas concentrações plasmáticas de lipídios em humanos e animais. Dessa forma, o prese...

  9. Opposing Roles of the Staphylococcus aureus Virulence Regulators, Agr and Sar, in Triton X-100- and Penicillin-Induced Autolysis

    OpenAIRE

    Fujimoto, David F.; Bayles, Kenneth W.

    1998-01-01

    The regulation of murein hydrolases is a critical aspect of peptidoglycan growth and metabolism. In the present study, we demonstrate that mutations within the Staphylococcus aureus virulence factor regulatory genes, agr and sar, affect autolysis, resulting in decreased and increased autolysis rates, respectively. Zymographic analyses of these mutant strains suggest that agr and sar exert their effects on autolysis, in part, by modulating murein hydrolase expression and/or activity.

  10. Effect of flavonoids morin; quercetin and nicotinic acid on lipid metabolism of rats experimentally fed with triton

    Directory of Open Access Journals (Sweden)

    Kelly Fabiane Santos Ricardo

    2001-09-01

    Full Text Available Atherosclerosis is a coronary disease where deposition of lipids in the arteries leads to problems of blood circulation. The present work evaluates the action of the flavonoids morin, quercetin and nicotinic acid isolated in association on lipid metabolism in hyperlipidemic rats. Blood serum levels cholesterol, cholesterol-HDL, and triacylglycerids have been analysed following the intraperitoneal administration of the flavonoid compounds dissolved in propyleneglycol by in doses of 5mg/kg body weight. Quercetin presented the largest percentual reduction of cholesterol. The best results for cholesterol-HDL have been obtained with-nicotinic acid alone while morin-nicotinic acid combination showed the best triacylglycerols results. Results showed that flavonoids could be beneficious in the treatment of coronary diseases.Aterosclerose é uma doença coronária onde a deposição de lipídeos nas artérias leva a problemas na circulação sangüínea. O presente trabalho avalia a ação dos flavonóides morina, quercetina e ácido nicotínico isoladamente e em associação no metabolismo lipídico em ratos hiperlipidêmicos. Foram analisados os níveis de colesterol, colesterol- HDL e triacilgliceróis no soro sangüíneo após administração, via intraperitoneal, dos compostos flavonoídicos dissolvidos em propileno glicol na dose de 5mg/kg de peso corporal. Quercetina mostrou o maior percentual de redução do colesterol. Para colesterol-HDL, os melhores resultados foram obtidos com ácido nicotínico isoladamente, enquanto a associação morina-ácido nicotínico mostrou os melhores resultados para triacilgliceróis. Os resultados mostraram que os flavonóides podem ser benéficos no tratamento de doença coronoriana.

  11. Effects of Benzalkonium Chloride, Proxel LV, P3 Hypochloran, Triton X-100 and DOWFAX 63N10 on anaerobic digestion processes

    DEFF Research Database (Denmark)

    Flores, German Antonio Enriquez; Fotidis, Ioannis; Karakashev, Dimitar Borisov

    2015-01-01

    and continuous (up-flow anaerobic sludge blanket, UASB) reactors with biochemical-industrial wastewater, as substrate. In batch experiments, half-maximal inhibitory concentrations (IC50) for the tested xenobiotics were found to be 13.1, 1003, 311.5 and 24.3 mg L1 for BKC, PRX, DWF and TRX, respectively while HPC...

  12. Variation of genetic diversity in a rapidly expanding population of the greater long-tailed hamster (Tscherskia triton) as revealed by microsatellites.

    Science.gov (United States)

    Xu, Laixiang; Xue, Huiliang; Song, Mingjing; Zhao, Qinghua; Dong, Jingping; Liu, Juan; Guo, Yu; Xu, Tongqin; Cao, Xiaoping; Wang, Fusheng; Wang, Shuqing; Hao, Shushen; Yang, Hefang; Zhang, Zhibin

    2013-01-01

    Genetic diversity is essential for persistence of animal populations over both the short- and long-term. Previous studies suggest that genetic diversity may decrease with population decline due to genetic drift or inbreeding of small populations. For oscillating populations, there are some studies on the relationship between population density and genetic diversity, but these studies were based on short-term observation or in low-density phases. Evidence from rapidly expanding populations is lacking. In this study, genetic diversity of a rapidly expanding population of the Greater long-tailed hamsters during 1984-1990, in the Raoyang County of the North China Plain was studied using DNA microsatellite markers. Results show that genetic diversity was positively correlated with population density (as measured by % trap success), and the increase in population density was correlated with a decrease of genetic differentiation between the sub-population A and B. The genetic diversity tended to be higher in spring than in autumn. Variation in population density and genetic diversity are consistent between sub-population A and B. Such results suggest that dispersal is density- and season-dependent in a rapidly expanding population of the Greater long-tailed hamster. For typically solitary species, increasing population density can increase intra-specific attack, which is a driving force for dispersal. This situation is counterbalanced by decreasing population density caused by genetic drift or inbreeding as the result of small population size. Season is a major factor influencing population density and genetic diversity. Meanwhile, roads, used to be considered as geographical isolation, have less effect on genetic differentiation in a rapidly expanding population. Evidences suggest that gene flow (Nm) is positively correlated with population density, and it is significant higher in spring than that in autumn.

  13. UJI EFEK EKSTRAK ETANOL 96% ANGGUR MERAH (Vitis vinifera TERHADAP PENURUNAN KADAR TRIGLISERIDA PADA TIKUS PUTIH (Rattus Novergicus YANG DIINDUKSI TRITON X-100

    Directory of Open Access Journals (Sweden)

    Frans Saputra

    2017-01-01

    Full Text Available Buah anggur merah diduga memiliki kandungan pterostilbene, resveratrol, proantosianidin dan likopen yang memiliki efek terhadap penurunan kadar trigliserida. Penelitian ini bersifat eksperimental laboratorium dengan metode pre and post test with control group design. Objek penelitian 25 ekor tikus putih jantan, Rattus Novergicus, berat badan 150-200 gram, berumur 3-4 bulan yang dibagi menjadi 5 kelompok dengan teknik simple random sampling, kontrol negatif (aquadest, kontrol positif (Simvastatin 0,2mg/200gramBB/hari, kelompok perlakuan dosis I (100mg/200gramBB/hari, dosis II (250mg/200gramBB/hari, dosis III (500mg/200gramBB/ hari. Ekstrak etanol anggur merah dosis I, dosis II, dosis IIIdapat menurunkan kadar trigliserida darah dengan rerata penurunan secara berturut-turut adalah 147,4mg/dL, 135,2mg/dL, 97,2mg/dL. Pada uji statistic menggunakan one-way ANOVA didapatkan nilai p=0,000 (p<0,05, sehingga terdapat perbedaan signifikan kadar trigliserida darah tikus putih antar kelompok. Ekstrak etanol 96% anggur merah dosis 100mg; 250 dan 500 /200 gramBB/hari dapat menurunkan kadar trigliserida darah tikus putih.   Kata kunci :Ekstrak Anggur Merah, Trigliserida, Rattus Novergicus

  14. Use of triton-WR-1339 (TWR) for a quantitative determination of the lysosomal binding of transuranium elements in the rat liver

    International Nuclear Information System (INIS)

    Gruner, K.R.

    1978-01-01

    The subcellular localisation of 239 Pu and 241 Am in the rat liver was investigated. A biochemical separation method with modified lysosomes was applied for the first time; the method permitted unique statements on the mitochondrial or lysosomal association of transuranium elements. Lysosomal association of 239 Pu and 241 Am between days 4 and 6 after radionuclide injection was most easily detected by follow-up treatment with TWR, i.e. the nonionic detergent was applied 2 days after injection of the radionuclide and 4 days before the onset of the analytical procedure. Extracellular transuranium depots could not be proved to exist neither by comparing absolute retention figures in perfused and nonperfused livers nor by subcellular distribution studies. A quantitative relation between the DTPA mobilisation efficiency in the total liver and the subcellular distribution patterns obtained for americium could be estimated for the period between the first and 18th day after radionuclide injection. It suggests on intracellular effect of DTPA. (orig./MG) [de

  15. Production of deuterons, tritons, He-3 nuclei, and their antinuclei in pp collisions at root s=0.9, 2.76, and 7 TeV

    Czech Academy of Sciences Publication Activity Database

    Acharya, S.; Adamová, Dagmar; Bielčík, J.; Bielčíková, Jana; Brož, M.; Contreras, J. G.; Hladký, Jan; Horák, D.; Křížek, Filip; Kučera, Vít; Kushpil, Svetlana; Lavička, R.; Mareš, Jiří A.; Petráček, V.; Šumbera, Michal; Vaňát, Tomáš; Závada, Petr

    2018-01-01

    Roč. 97, č. 2 (2018), č. článku 024615. ISSN 2469-9985 R&D Projects: GA MŠk(CZ) LG15052 Institutional support: RVO:61389005 ; RVO:68378271 Keywords : ALICE * proton-proton collisions Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders; BF - Elementary Particles and High Energy Physics (FZU-D) OBOR OECD: Nuclear physics; Particles and field physics (FZU-D) Impact factor: 3.820, year: 2016

  16. Rapid Manufacture of Combustion Chambers Using Ductile, High Strength MMCs (1000-803), Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — Triton Systems, Inc. (Triton) proposes to develop a cost-effective manufacturing approach to fabricate combustion chambers for a rocket technology demonstrator...

  17. Optimization, purification and characterization of recombinant L ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin

    2016-08-03

    . SDS was supplied Sigma Aldrich Co. (St, Louis,. USA). Tween 20 and Tween 80 were from Bio Basis Inc. (New. York, NY, USA), and Triton X-100, Triton X-114 and EDTA by. Merck (Darmstadt, Germany). All chemicals were ...

  18. Capecitabine treatment of HCT-15 colon cancer cells induces ...

    African Journals Online (AJOL)

    iodide, Triton X-100, Tris-HCl and trypan blue were supplied by Sigma Chemical Co (St Louis,. MO, USA). ... achieved on 6-15 % SDS-PAGE and the proteins were subsequently transferred onto PVDF membranes. ... permeabilized by treatment with Triton-X 100. (0.3 %) in PBS for 1 h. The non-specific sites blocked with 2 ...

  19. Cytochrome oxidase as an indicator of ice storage and frozen storage

    DEFF Research Database (Denmark)

    Godiksen, Helene; Jessen, Flemming

    2001-01-01

    of 30 degreesC. Maximal activation by Triton X-100 was obtained in a range of 0.62-1.25 mM Triton X-100. The specificity of the assay was high, as cytochrome oxidase was inhibited 98% by 33 muM of the specific inhibitor sodium azide. The coefficient of variation of cytochrome oxidase activity...

  20. Regulation of sodium channel function by bilayer elasticity: the importance of hydrophobic coupling. Effects of Micelle-forming amphiphiles and cholesterol

    DEFF Research Database (Denmark)

    Lundbæk, Jens August; Birn, Pia; Hansen, Anker J

    2004-01-01

    , Triton X-100, and reduced Triton X-100) that make lipid bilayers less "stiff", as measured using gA channels, shift the voltage dependence of sodium channel inactivation toward more hyperpolarized potentials. At low amphiphile concentration, the magnitude of the shift is linearly correlated to the change...

  1. Optimization, purification and characterization of recombinant L ...

    African Journals Online (AJOL)

    The enzyme exhibited about 20 and 60% retention of activity following 100 min incubation at 55 or 40°C, respectively. The activity of enzyme was inhibited by EDTA, Hg2+, Cu2+, Ni2+, and enhanced by Mg2+. Detergents (Tween 20, Tween 80, Triton X-100, and Triton X-114) decreased enzyme activity. DTT and DMSO at ...

  2. Characterization of impregnated GDC nano structures and their functionality in LSM based cathodes

    DEFF Research Database (Denmark)

    Klemensø, Trine; Chatzichristodoulou, Christodoulos; Nielsen, Jimmi

    2012-01-01

    Porous composite cathodes of LSM–YSZ (lanthanum strontium manganite and yttria stabilized zirconia) were impregnated with GDC (gadolinia doped ceria) nano particles. The impregnation process was varied using none or different surfactants (Triton X-45, Triton X-100, P123), and the quantity...

  3. Influence of charged microenvironment on redox potential and ...

    Indian Academy of Sciences (India)

    Unknown

    triton X-100 (Sigma) are from Merck and used as received. The surfactants used are cetyltrimethyl- ammonium bromide (CTAB), triton X-100 (TX-100) and sodiumdodecyl sulphate (SDS). These are cationic, neutral and anionic respectively. Surfactant solutions used are 3% (w/v) surfactant in dimethyl formamide. (DMF).

  4. Intestinal epithelial restitution. Involvement of specific laminin isoforms and integrin laminin receptors in wound closure of a transformed model epithelium

    DEFF Research Database (Denmark)

    Lotz, M M; Nusrat, A; Madara, J L

    1997-01-01

    in a Triton-X-100-insoluble structure at the basal surface and that the staining of this structure is enhanced in cells adjoining wounds. In addition, a Triton-X-100-soluble pool of alpha 6 beta 4, as well as alpha 3 beta 1 and presumably alpha 6 beta 1, was found along lateral surfaces of T84 cells...

  5. Development of a porcine renal extracellular matrix scaffold as a platform for kidney regeneration.

    Science.gov (United States)

    Choi, Seock Hwan; Chun, So Young; Chae, Seon Yeong; Kim, Jin Rae; Oh, Se Heang; Chung, Sung Kwang; Lee, Jin Ho; Song, Phil Hyun; Choi, Gyu-Seog; Kim, Tae-Hwan; Kwon, Tae Gyun

    2015-04-01

    Acellular scaffolds, possessing an intact three-dimensional extracellular matrix (ECM) architecture and biochemical components, are promising for regeneration of complex organs, such as the kidney. We have successfully developed a porcine renal acellular scaffold and analyzed its physical/biochemical characteristics, biocompatibility, and kidney reconstructive potential. Segmented porcine kidney cortexes were treated with either 1% (v/v) Triton X-100 (Triton) or sodium dodecyl sulfate (SDS). Scanning electron microscopy showed both treatments preserved native tissue architecture, including porosity and composition. Swelling behavior was higher in the Triton-treated compared with the SDS-treated scaffold. Maximum compressive strength was lower in the Triton-treated compared with the SDS-treated scaffold. Attenuated total reflective-infrared spectroscopy showed the presence of amide II (-NH) in both scaffolds. Furthermore, richer ECM protein and growth factor contents were observed in the Triton-treated compared with SDS-treated scaffold. Primary human kidney cell adherence, viability, and proliferation were enhanced on the Triton-treated scaffold compared with SDS-treated scaffold. Following murine in vivo implantation, tumorigenecity was absent for both scaffolds after 8 weeks and in the Triton-treated scaffold only, glomeruli-like structure formation and neovascularity were observed. We identified 1% Triton X-100 as a more suitable decellularizing agent for porcine renal ECM scaffolds prior to kidney regeneration. © 2014 Wiley Periodicals, Inc.

  6. Optical studies on some dyes for liquid solar concentrators

    Energy Technology Data Exchange (ETDEWEB)

    Kondepudi, R.; Srinivasan, S. (Indian Inst. of Tech., Madras. Dept. of Physics (The Netherlands))

    1990-03-01

    Spectral characteristics of some luminescent dyes, derivatives of xanthene and benzoxazinone groups, in a liquid polymer matrix, Triton x-100, have been studied. It is seen that Triton x-100 could serve as a suitable liquid matrix for the luminescent solar concentrators (LSCs). (orig.).

  7. Production and focusing of high-currents beams of relativistic electrons up to high densities

    International Nuclear Information System (INIS)

    Gordeev, A.V.; Korolev, V.D.; Sidorov, Y.L.; Smirnov, V.P.

    1975-01-01

    The results of beam focusing experiments carried out on the ''MS'' and ''Triton'' accelerators are presented. The magnetic insulation of vacuum lines is described. Some experiments on beam focusing in the diode gap with a plasma filling are discussed. (MOW)

  8. Generation and stabilization of whey-based monodisperse naoemulsions using ultra-high pressure homogenization and small amphipathic co-emulsifier combinations

    Science.gov (United States)

    Ultra-high-pressure homogenization (UHPH) was used to generate monodisperse stable peanut oil nanoemulsions within a desired nanosize range (whey protein concentrate (WPC), sodium dodecyl sulfate, Triton X-100 (X100), and zwitterionic sulfobetaine-base...

  9. Physical profile data collected by NOAA Ship Ronald H. Brown and NOAA Ship KA'IMIMOANA during the year 2006 in the equatorial Pacific Ocean, 2006-01 to 2006-11 (NODC Accession 0012641)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — CTD data were collected in the equatorial Pacific Ocean, during 2006, to service the TAO/TRITON array, a network of deep ocean moored buoys to support research and...

  10. A systematics of optical model compound nucleus formation cross sections for neutrons, proton, deuteron, 3He and alpha particle incidents

    International Nuclear Information System (INIS)

    Murata, Toru

    2000-01-01

    Simple formulae to reproduce the optical model compound nucleus formation cross sections for neutron, proton, deuteron, triton, 3 He and alpha particles are presented for target nuclei of light to medium weight mass region. (author)

  11. sodium dodecyl sulphate (SDS)

    Indian Academy of Sciences (India)

    Unknown

    sodium dodecyl sulphate, SDS) showed a marked effect, although there are some reports where cationic (cetyl trimethyl ammonium bromide, CTAB) and neutral (Triton X-100) surfactants have also shown changes in the. *For correspondence ...

  12. Solubilization and purification of Escherichia coli expressed GST ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-10-05

    Lauroylsarcosine (sarkosyl). Briefly, the cell suspension with inclusion body was added with sarkosyl at a final concentration of. 1.5%. After the disruption of cells, the clarified supernatant containing sarkosyl was added with Triton. X-100 ...

  13. Narva linnas valmistati abstraktne skulptuur / Ago Gashkov

    Index Scriptorium Estoniae

    Gashkov, Ago

    2007-01-01

    Zürichi kunstiülikooli lavakujunduse professori Lawrence Walleni loodud titaanplaatidest skulptuur pannakse kokku Triton Titanium GmbH meditsiiniseadmete tehases Narvas. Skulptuur avatakse 6. oktoobril 2007 Soulis tehnoloogiainstituudis

  14. Oceanographic profile temperature, salinity and pressure measurements collected using moored buoy in the Indian Ocean from 2001-2006 (NODC Accession 0002733)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Temperature and salinity measurements in the Equatorial Indian from 2001 to 2006 from the TRITON (TRIANGLE TRANS-OCEAN BUOY NETWORK); JAPAN AGENCY FOR MARINE-EARTH...

  15. Spacecraft Thermal Control System Not Requiring Power, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — The thermal management of spacecraft would be enhanced by dynamic control over surface emissivity in the mid-infrared. In this SBIR program, Triton Systems proposes...

  16. Solvent extraction of lanthanoid and yttrium ions with poly(oxyethylene)alkylphenylether

    International Nuclear Information System (INIS)

    Yoshida, Isao; Takeshita, Ryo-ichi; Ueno, Keihei; Takagi, Makoto.

    1986-01-01

    Solvent extraction of lanthanoid and yttrium ions(M 3+ ) was investigated in a water-dichloroethane system using poly(oxyethylene)-type nonionic surfactants such as Triton X-100 and Triton X-405(L) and picrate ion(A - ) as extraction agent and pairing anion, respectively. The result of extraction studies at various extraction agent concentrations and at various picrate ion concentrations, suggested that the composition of the extracted species was MLA 3 . Among the lanthanoid ions investigated, the ions such as Nd 3+ , Sm 3+ , Eu 3+ , and Gd 3+ gave relatively larger distribution ratios than the other lanthanoid ions, while the yttrium ion was the least extractable among the metal ions investigated. The distribution ratio with extraction agent Triton X-405 was about ten times larger than those with Triton X-100. (author)

  17. Cocompartmentation of proteins and K+ within the living cell

    International Nuclear Information System (INIS)

    Kellermayer, M.; Ludany, A.; Jobst, K.; Szucs, G.; Trombitas, K.; Hazlewood, C.F.

    1986-01-01

    Monolayer H-50 tissue culture cells were treated with Triton X-100 and Brij 58 nonionic detergents, and their electron microscopic morphology along with the release of the intracellular proteins [ 35 S]methionine-labelled and 42 K-labelled K + were studied. Although Triton X-100 was more effective, both detergents removed the lipoid membranes within 5 min. The mobilization and solubilization of the cytoplasmic and nuclear proteins occurred much faster with Triton X-100 than with Brij 58. In Triton X-100-treated cells, the loss of K + was complete within 2 min. The loss of K + from the Brij 58-treated cells was complete only after 10 min and the mobilization of K + showed sigmoid-type release kinetics. These results support the view that most of K + and diffusible proteins are not freely dissolved in the cellular water, but they are cocompartmentalized inside the living cell

  18. Detergent-Resistant Membrane Microdomains Facilitate Ib Oligomer Formation and Biological Activity of Clostridium perfringens Iota-Toxin

    National Research Council Canada - National Science Library

    Hale, Martha

    2004-01-01

    ...) were extracted with cold Triton X-100. Western blotting revealed that Ib oligomers localized in DRMs extracted from Vero, but not MRC-5, cells while monomeric Ib was detected in the detergent-soluble fractions of both cell types...

  19. Results of recent calculations using realistic potentials

    International Nuclear Information System (INIS)

    Friar, J.L.

    1987-01-01

    Results of recent calculations for the triton using realistic potentials with strong tensor forces are reviewed, with an emphasis on progress made using the many different calculational schemes. Several test problems are suggested. 49 refs., 5 figs

  20. Science World Journal - Vol 12, No 4 (2017)

    African Journals Online (AJOL)

    Mebdh) stem bark on Triton X-100 induced hyperlipidaemia · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Mohammed Sani Jaafaru, Ibrahim Deborah Kyomson, Hauwa'u Yakubu Bako, ...

  1. Extracellular acid protease from Aspergillus niger I1: purification and ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-09-15

    Sep 15, 2009 ... with slight modification. The sample was not heated before loading in the gel. After electrophoresis, the gel was submerged in 100 mM glycine−HCl buffer (pH 3.0) containing 2.5% Triton X-100 for 30 min at 4°C, with constant agitation to remove SDS. Triton X-100 was then removed by washing the gel three ...

  2. Assessment of genetic and biochemical diversity of ecologically ...

    African Journals Online (AJOL)

    USER

    2010-03-22

    Mar 22, 2010 ... g sucrose; 1 ml triton-X-100 and pH 8.0 was adjusted with conc. HCl) (Skovgaard and Rosendahl, ... The enzymes were separated by SDS polyacrylamide gel electro- phoresis in a discontinuous buffer ... Triton-x-100, 1 ml) and 2nd washing buffer (50 mM Tris buffer) in shaking condition, and then it was ...

  3. Immunochemically identical hydrophilic and amphiphilic forms of the bovine adrenomedullary dopamine beta-hydroxylase

    DEFF Research Database (Denmark)

    Bjerrum, Ole Jannik; Helle, K B; Bock, Elisabeth Marianne

    1979-01-01

    . The dopamine beta-hydroxylases of the buffer and membrane fractions were antigenically identical, but differed in their amphiphilicity, as demonstrated by the change in precipitation patterns on removal of Triton X-100 from the gel, on charge-shift crossed immunoelectrophoresis and on crossed hydrophobic...... interaction immunoelectrophoresis with phenyl-Sepharose. Furthermore, immunoelectrophoretic analysis in the presence of Triton X-100 plus the cationic detergent cetyltrimethylammonium bromide indicates additional heterogeneity of the membrane-bound dopamine-beta-hydroxylase. By limited proteolysis...

  4. Research Article Special Issue

    African Journals Online (AJOL)

    pc

    2017-10-17

    Oct 17, 2017 ... Field collected ammoniated latex was mixed with Triton X-100 solution (one part of latex to four parts) with 0.125%, followed by stirring at 4℃ for 1 hour. The entire mix sample (Latex and Triton X-100) is stirred to ensure that the protein from all samples is preserved. The time of the stirring process would be ...

  5. Development of cloud point extraction - UV-visible spectrophotometric method for vanadium (V) determination in hydrogeochemical samples

    International Nuclear Information System (INIS)

    Durani, Smeer; Mathur, Neerja; Chowdary, G.S.

    2007-01-01

    The cloud point extraction behavior (CPE) of vanadium (V) using 5,7 dibromo 8-hydroxyquinoline (DBHQ) and triton X 100 was investigated. Vanadium (V) was extracted with 4 ml of 0.5 mg/ml DBHQ and 6 ml of 8% (V/V) triton X 100 at the pH 3.7. A few hydrogeochemical samples were analysed for vanadium using the above method. (author)

  6. Utility of spectral measurements of secondary reaction products

    International Nuclear Information System (INIS)

    Heidbrink, W.E.

    1986-02-01

    The spectra of 15 MeV protons and 14 MeV neutrons produced in the burnup of 0.8 MeV 3 He ions and 1 MeV tritons through the d( 3 He,p)α and d(t,n)α fusion reactions contain information on the velocity distributions of the energetic 3 He ions and tritons. 11 refs., 2 figs

  7. Potential Use of Surface-active Agents for Controlling Mycoplasma Contamination in Animal Cell Cultures

    Science.gov (United States)

    Reynolds, Roberta K.; Hetrick, Frank M.

    1969-01-01

    Seven nonionic detergents, which were determined to be relatively nontoxic to selected animal cell cultures, were tested for their lethal effect on the GDL strain of Mycoplasma hyorhinis. Of the seven detergents tested, five were found to cause complete lysis of the organism in vitro within 24 hr at 37 C. These detergents included Triton WR-1339 and Tweens 20, 40, 60, and 80. When different concentrations of the detergents were tested, Tween 80 was found to be the most effective and Triton WR-1339 the least effective in lysing the mycoplasmata. These same five detergents were used to treat a rat nephroma cell line which was chronically infected with the GDL strain. The mycoplasmata were eliminated from those cultures treated with Triton but they persisted in cultures exposed to the Tween compounds. The Triton-treated cells remained free from infection over a 7-month period, as determined both by cultural methods and fluorescent-antibody staining. The “cure” was effected by treating the cells for either 48 hr with maintenance media containing 1 mg of Triton per ml or for 96 hr with a concentration of 500 μg/ml. Triton was also effective in eliminating the GDL, strain from experimentally infected rat embryo cells after a 48-hr treatment with a concentration of 1 mg/ml. Four other species of Mycoplasma, which were completely lysed by Triton in vitro, were not eliminated from experimentally infected cells by a single treatment with Triton, although the severity of the infection was apparently reduced. Images PMID:4888862

  8. Surfactant assisted electrodeposition of MnO{sub 2} thin films: Improved supercapacitive properties

    Energy Technology Data Exchange (ETDEWEB)

    Dubal, D.P. [Thin Film Physics Laboratory, Department of Physics, Shivaji University, Kolhapur 416004 (M.S.) (India); School of Materials Science and Engineering, Gwangju Institute of Science and Technology, 261 Cheomdan-gwagiro, Buk-gu, Gwangju 500-712 (Korea, Republic of); Kim, W.B. [School of Materials Science and Engineering, Gwangju Institute of Science and Technology, 261 Cheomdan-gwagiro, Buk-gu, Gwangju 500-712 (Korea, Republic of); Lokhande, C.D., E-mail: l_chandrakant@yahoo.com [Thin Film Physics Laboratory, Department of Physics, Shivaji University, Kolhapur 416004 (M.S.) (India)

    2011-10-13

    Highlights: > Effect of Triton X-100 on physico-chemical properties of MnO{sub 2} films. > High supercapacitance of 345 F g{sup -1}. > Charge-discharge, impedance spectroscopy. - Abstract: In order to obtain a high specific capacitance, MnO{sub 2} thin films have been electrodeposited in the presence of a neutral surfactant (Triton X-100). These films were further characterized by means of X-ray diffraction (XRD), Fourier transform infrared (FTIR) spectroscopy, field emission scanning electron microscopy (FESEM) and contact angle measurement. The XRD studies revealed that the electrodeposited MnO{sub 2} films are amorphous and addition of Triton X-100 does not change its amorphous nature. The electrodeposited films of MnO{sub 2} in the presence of the Triton X-100 possess greater porosity and hence greater surface area in relation to the films prepared in the absence of the surfactant. Wettability test showed that the MnO{sub 2} film becomes superhydrophilic from hydrophilic due to Triton X-100. Supercapacitance properties of MnO{sub 2} thin films studied by cyclic voltammetry, galvanostatic charge-discharge cycling and impedance spectroscopy showed maximum supercapacitance for MnO{sub 2} films deposited in presence of Triton X-100 is 345 F g{sup -1}.

  9. Removal of detergents from SDS-inactivated dextransucrase

    International Nuclear Information System (INIS)

    Husman, D.W.; Mayer, R.M.

    1986-01-01

    Dextransucrase, which is rapidly inactivated by SDS, can be reactivated upon the addition of Triton X-100. Purification of the enzyme, in good yield and homogeneity, has been achieved by chromatography in the presence of SDS. The purified enzyme can be reactivated with Triton, but has large amounts of detergents. It was important to develop procedures for their removal. Density gradient centrifugation of SDS-inactivated or Triton-reactivated enzyme, treatment with Extracti-Gel D (Pierce) or chromatography on hydroxyl apatite (HA), have been examined for their effectiveness in providing detergent-free enzyme in good yield. Ultracentrifugation of SDS-inactivated protein provided limited recovery of active enzyme, but suggested that reactivation could be achieved by the simple removal of the detergent. While similar behavior was observed when the enzyme was eluted from Extracti-Gel, it was also shown that the limited recovery was a result of irreversible inactivation of the enzyme. Recovery could be improved if the enzyme was collected in solutions containing Triton, which has been reported to be a stabilizer. Chromatography of SDS-inactivated enzyme on HA also yielded active enzyme. Good recovery was obtained when Triton-reactivated enzyme was employed in these studies. The degree of detergent removal was determined by utilizing radiolabelled SDS and Triton X-100

  10. Comparative removal of solvent and detergent viral inactivating agents from human intravenous immunoglobulin G preparations using SDR HyperD and C18 sorbents.

    Science.gov (United States)

    Burnouf, Thierry; Sayed, Makram A; Radosevich, Miryana; El-Ekiaby, Magdy

    2009-06-01

    The capacity of hydrophobic octadecyl (C18) and SDR HyperD materials to remove the combination of 1% (v/v) solvent (tri-n-butyl phosphate, TnBP) with 1% (v/v) nonionic detergents (Triton X-100 and Triton X-45) used for viral inactivation of plasma-derived polyvalent intravenous immunoglobulin G (IVIG) preparation has been evaluated. Efficient removal of TnBP (SDR HyperD/7 ml of IVIG. Binding capacities of TnBP were greater than 140 mg/g of C18 and greater than 318 mg/g of dry SDR HyperD. Complete removal of Triton X-45 (SDR HyperD/7 ml of IVIG or above, corresponding to binding capacities in excess of 70 mg/g of C18 and in excess of 159 mg/g of dry SDR HyperD. Residual Triton X-100 was less than 30 ppm at a ratio of 4 g/14 ml of immunoglobulin G (IgG) for the C18 sorbent. Triton X-100 was less than 10 ppm when using SDR HyperD at a ratio of 0.66 g/7 ml of IgG, corresponding to a binding capacity of approximately 106 mg of Triton X-100/g of dry SDR HyperD. Good recoveries of IVIG were achieved in the effluent from both sorbents.

  11. Surfactant assisted electrodeposition of MnO2 thin films: Improved supercapacitive properties

    International Nuclear Information System (INIS)

    Dubal, D.P.; Kim, W.B.; Lokhande, C.D.

    2011-01-01

    Highlights: → Effect of Triton X-100 on physico-chemical properties of MnO 2 films. → High supercapacitance of 345 F g -1 . → Charge-discharge, impedance spectroscopy. - Abstract: In order to obtain a high specific capacitance, MnO 2 thin films have been electrodeposited in the presence of a neutral surfactant (Triton X-100). These films were further characterized by means of X-ray diffraction (XRD), Fourier transform infrared (FTIR) spectroscopy, field emission scanning electron microscopy (FESEM) and contact angle measurement. The XRD studies revealed that the electrodeposited MnO 2 films are amorphous and addition of Triton X-100 does not change its amorphous nature. The electrodeposited films of MnO 2 in the presence of the Triton X-100 possess greater porosity and hence greater surface area in relation to the films prepared in the absence of the surfactant. Wettability test showed that the MnO 2 film becomes superhydrophilic from hydrophilic due to Triton X-100. Supercapacitance properties of MnO 2 thin films studied by cyclic voltammetry, galvanostatic charge-discharge cycling and impedance spectroscopy showed maximum supercapacitance for MnO 2 films deposited in presence of Triton X-100 is 345 F g -1 .

  12. Influence of elastase-induced emphysema and the inhalation of an irritant aerosol on deposition and retention of an inhaled insoluble aerosol in Fischer-344 rats

    International Nuclear Information System (INIS)

    Damon, E.G.; Mokler, B.V.; Jones, R.K.

    1983-01-01

    The purpose of this study was to assess the effects of elastase-induced pulmonary emphysema and the inhalation of an irritant aerosol (Triton X-100, a nonionic surfactant similar to those used in a number of pressurized consumer products) on pulmonary deposition and retention of an insoluble test aerosol, 59 FE-labeled Fe 2 O 3 . Untreated rats or rats pretreated by intratracheal in stillation with elastase were exposed to an aerosol of 59 Fe-labeled Fe 2 O 3 either 18 hr or 7 days after exposure to aerosslized Triton X-100 which was administered in doses of 20, 100, or 200 μg/g of lung. Rats pretreated with elastase had significantly lower pulmonary deposition of 59 Fe than the untreated controls (p 2 O 3 was unaffected by pretreatment with Triton X-100. Elastase treatment alone had no effect on retention of Fe 2 O 3 . Triton X-100 administered 18 hr prior to exposure of rats to Fe 2 O 3 aerosol resulted in dose-related increases in whole-body retention of 59 Fe. When rats were exposed to Triton X-100 7 days before exposure to Fe 2 O 3 , increased retention of 59 Fe was noted only in those treated at the highest Triton X-100 dose level (200 μg/g). 20 references, 5 tables

  13. Differential sensitivity to detergents of actin cytoskeleton from nerve endings.

    Science.gov (United States)

    Cubí, Roger; Matas, Lluís A; Pou, Marta; Aguilera, José; Gil, Carles

    2013-11-01

    Detergent-resistant membranes (DRM), an experimental model used to study lipid rafts, are typically extracted from cells by means of detergent treatment and subsequent ultracentrifugation in density gradients, Triton X-100 being the detergent of choice in most of the works. Since lipid rafts are membrane microdomains rich in cholesterol, depletion of this component causes solubilization of DRM with detergent. In previous works from our group, the lack of effect of cholesterol depletion on DRM solubilization with Triton X-100 was detected in isolated rat brain synaptosomes. In consequence, the aim of the present work is to explore reasons for this observation, analyzing the possible role of the actin cytoskeleton, as well as the use of an alternative detergent, Brij 98, to overcome the insensitivity to Triton X-100 of cholesterol-depleted DRM. Brij 98 yields Brij-DRM that are highly dependent on cholesterol, since marker proteins (Flotillin-1 and Thy-1), as well as actin, appear solubilized after MCD treatment. Pretreatment with Latrunculin A results in a significant increase in Flotillin-1, Thy-1 and actin solubilization by Triton X-100 after cholesterol depletion. Studies with transmission electron microscopy show that combined treatment with MCD and Latrunculin A leads to a significant increase in solubilization of DRM with Triton X-100. Thus, Triton-DRM resistance to cholesterol depletion can be explained, at least partially, thanks to the scaffolding action of the actin cytoskeleton, without discarding differential effects of Brij 98 and Triton X-100 on specific membrane components. In conclusion, the detergent of choice is important when events that depend on the actin cytoskeleton are going to be studied. © 2013.

  14. Enhancing the performance of dye-sensitized solar cells by incorporating nanosilicate platelets in gel electrolyte

    KAUST Repository

    Lai, Yi-Hsuan

    2009-10-01

    Two kinds of gel-type dye-sensitized solar cells (DSSCs), composed of two types of electrolytes, were constructed and the respective cell performance was evaluated in this study. One electrolyte, TEOS-Triton X-100 gel, was based on a hybrid organic/inorganic gel electrolyte made by the sol-gel method and the other was based on poly(vinyidene fluoride-co-hexafluoro propylene) (PVDF-HFP) copolymer. TEOS-Triton X-100 gel was based on the reticulate structure of silica, formed by hydrolysis, and condensation of tetraethoxysilane (TEOS), while its organic subphase was a mixture of surfactant (Triton X-100) and ionic liquid electrolytes. Both DSSC gel-type electrolytes were composed of iodine, 1-propy-3-methyl-imidazolium iodide, and 3-methoxypropionitrile to create the redox couple of I3 -/I-. Based on the results obtained from the I-V characteristics, it was found that the optimal iodine concentrations for the TEOS-Triton X-100 gel electrolyte and PVDF-HFP gel electrolyte are 0.05 M and 0.1 M, respectively. Although the increase in the iodine concentration could enhance the short-circuit current density (JSC), a further increase in the iodine concentration would reduce the JSC due to increased dark current. Therefore, the concentration of I2 is a significant factor in determining the performance of DSSCs. In order to enhance cell performance, the addition of nanosilicate platelets (NSPs) in the above-mentioned gel electrolytes was investigated. By incorporating NSP-Triton X-100 into the electrolytes, the JSC of the cells increased due to the decrease of diffusion resistance, while the open circuit voltage (VOC) remained almost the same. As the loading of the NSP-Triton X-100 in the TEOS-Triton X-100 gel electrolyte increased to 0.5 wt%, the JSC and the conversion efficiency increased from 8.5 to 12 mA/cm2 and from 3.6% to 4.7%, respectively. However, the JSC decreased as the loading of NSP-Triton X-100 exceeded 0.5 wt%. At higher NSP-Triton X-100 loading, NSPs acted as

  15. Evaluation of small intestine grafts decellularization methods for corneal tissue engineering.

    Directory of Open Access Journals (Sweden)

    Ana Celeste Oliveira

    Full Text Available Advances in the development of cornea substitutes by tissue engineering techniques have focused on the use of decellularized tissue scaffolds. In this work, we evaluated different chemical and physical decellularization methods on small intestine tissues to determine the most appropriate decellularization protocols for corneal applications. Our results revealed that the most efficient decellularization agents were the SDS and triton X-100 detergents, which were able to efficiently remove most cell nuclei and residual DNA. Histological and histochemical analyses revealed that collagen fibers were preserved upon decellularization with triton X-100, NaCl and sonication, whereas reticular fibers were properly preserved by decellularization with UV exposure. Extracellular matrix glycoproteins were preserved after decellularization with SDS, triton X-100 and sonication, whereas proteoglycans were not affected by any of the decellularization protocols. Tissue transparency was significantly higher than control non-decellularized tissues for all protocols, although the best light transmittance results were found in tissues decellularized with SDS and triton X-100. In conclusion, our results suggest that decellularized intestinal grafts could be used as biological scaffolds for cornea tissue engineering. Decellularization with triton X-100 was able to efficiently remove all cells from the tissues while preserving tissue structure and most fibrillar and non-fibrillar extracellular matrix components, suggesting that this specific decellularization agent could be safely used for efficient decellularization of SI tissues for cornea TE applications.

  16. Effect of Decellularization Protocol on the Mechanical Behavior of Porcine Descending Aorta

    Directory of Open Access Journals (Sweden)

    John C. Fitzpatrick

    2010-01-01

    Full Text Available Enzymatic-detergent decellularization treatments may use a combination of chemical reagents to reduce vascular tissue to sterilized scaffolds, which may be seeded with endothelial cells and implanted with a low risk of rejection. However, these chemicals may alter the mechanical properties of the native tissue and contribute to graft compliance mismatch. Uniaxial tensile data obtained from native and decellularized longitudinal aortic tissue samples was analyzed in terms of engineering stress and fit to a modified form of the Yeoh rubber model. One decellularization protocol used SDS, while the other two used TritonX-100, RNase-A, and DNase-I in combination with EDTA or sodium-deoxycholate. Statistical significance of Yeoh model parameters was determined by paired t-test analysis. The TritonX-100/EDTA and 0.075% SDS treatments resulted in relatively variable mechanical changes and did not effectively lyse VSMCs in aortic tissue. The TritonX-100/sodium-deoxycholate treatment effectively lysed VSMCs and was characterized by less variability in mechanical behavior. The data suggests a TritonX-100/sodium-deoxycholate treatment is a more effective option than TritonX-100/EDTA and SDS treatments for the preparation of aortic xenografts and allografts because it effectively lyses VSMCs and is the least likely treatment, among those considered, to promote a decrease in mechanical compliance.

  17. GABA_A receptor function is regulated by lipid bilayer elasticity

    DEFF Research Database (Denmark)

    Søgaard, Rikke; Werge, Thomas; Berthelsen, Camilla

    2006-01-01

    Docosahexaenoic acid ( DHA) and other polyunsaturated fatty acids ( PUFAs) promote GABA(A) receptor [ (3)H]-muscimol binding, and DHA increases the rate of GABAA receptor desensitization. Triton X-100, a structurally unrelated amphiphile, similarly promotes [ (3)H]-muscimol binding. The mechanism......( s) underlying these effects are poorly understood. DHA and Triton X-100, at concentrations that affect GABAA receptor function, increase the elasticity of lipid bilayers measured as decreased bilayer stiffness using gramicidin channels as molecular force transducers. We have previously shown...... that membrane protein function can be regulated by amphiphile-induced changes in bilayer elasticity and hypothesized that GABAA receptors could be similarly regulated. We therefore studied the effects of four structurally unrelated amphiphiles that decrease bilayer stiffness ( Triton X-100, octyl...

  18. Preparation, Characterization and Performance Studies of Active PVDF Ultrafiltration-Surfactants Membranes Containing PVP as Additive

    International Nuclear Information System (INIS)

    Nur Izzah Md Fadilah; Abdul Rahman Hassan

    2016-01-01

    The role of surfactants in the formation of active Poly(vinylidene fluoride) (PVDF) ultrafiltration (AUF) membranes was studied. The effect combination of surfactants that are Sodium dodecyl sulfate (SDS)/ Tween 80 and Tween 80/ Triton X-100 formulations on performance and morphological structures were investigated for the first time. The influence of surfactants blends on the membrane pores was also examined. Experimental data showed that combination of Tween 80/ Triton X-100 give the highest BSA permeation flux with a value of 285.51 Lm -2 h -1 . With combination of SDS/ Tween 80, the AUF membrane showed the highest protein rejection up to 93 % and 79 % for Bovine Serum Albumin (BSA) and Egg Albumin (EA), respectively. Moreover, membranes characterization demonstrated that the addition of SDS/ Tween 80 and Tween 80/ Triton X-100 were found to affect the performance, surface morphologies and membrane pores of AUF PVDF membranes. (author)

  19. Micellar phase boundaries under the influence of ethyl alcohol

    International Nuclear Information System (INIS)

    Bergeron, Denis E.

    2016-01-01

    The Compton spectrum quenching technique is used to monitor the effect of ethyl alcohol (EtOH) additions on phase boundaries in two systems. In toluenic solutions of the nonionic surfactant, Triton X-100, EtOH shifts the boundary separating the first clear phase from the first turbid phase to higher water:surfactant ratios. In a commonly used scintillant, Ultima Gold AB, the critical micelle concentration is not shifted. The molecular interactions behind the observations and implications for liquid scintillation counting are discussed. - Highlights: • Compton spectrum quenching technique applied to find micellar phase boundaries. • Toluenic Triton X-100 and Ultima Gold AB investigated. • Ethyl alcohol affects phase boundaries in Triton X-100, not in Ultima Gold AB. • Phase boundary observations discussed in terms of relevant molecular interactions.

  20. Comparison of several ethanol productions using xylanase, inorganic salts, surfactant

    Science.gov (United States)

    Wu, Yan; Lu, Jie; Yang, Rui-feng; Song, Wen-jing; Li, Hai-ming; Wang, Hai-song; Zhou, Jing-hui

    2017-03-01

    Liquid hot water (LHW) pretreatment is an effective and environmentally friendly method to produce bioethanol with lignocellulosic materials. Corn stover was pretreated with liquid hot water (LHW) and then subjected to semi-simultaneous saccharification and fermentation (S-SSF) to obtain high ethanol concentration and yield. The present study aimed to confirm the effect of several additives on the fermentation digestibility of unwashed WIS of corn stover pretreated with LHW. So we also investigated the process, such as enzyme addition, inorganic salts, surfactant and different loading Triton. Results show that high ethanol concentration is necessary to add xylanase in the stage of saccharification. The ethanol concentration increased mainly with magnesium ion on fermentation. Comparing with Tween 80, Span 80 and Polyethylene glycol, Triton is the best surfactant. In contrast to using xylanase and Triton respectively, optimization can make up the lack of stamina and improve effect of single inorganic salts.

  1. Endocytosis of GPI-linked membrane folate receptor-alpha.

    Science.gov (United States)

    Rijnboutt, S; Jansen, G; Posthuma, G; Hynes, J B; Schornagel, J H; Strous, G J

    1996-01-01

    GPI-linked membrane folate receptors (MFRs) have been implicated in the receptor-mediated uptake of reduced folate cofactors and folate-based chemotherapeutic drugs. We have studied the biosynthetic transport to and internalization of MFR isoform alpha in KB-cells. MFR-alpha was synthesized as a 32-kD protein and converted in a maturely glycosylated 36-38-kD protein 1 h after synthesis. 32-kD MFR-alpha was completely soluble in Triton X-100 at 0 degree C. In contrast, only 33% of the 36-38-kD species could be solubilized at these conditions whereas complete solubilization was obtained in Triton X-100 at 37 degrees C or in the presence of saponin at 0 degree C. Similar solubilization characteristics were found when MFR-alpha at the plasma membrane was labeled with a crosslinkable 125I-labeled photoaffinity-analog of folic acid as a ligand. Triton X-100-insoluble membrane domains containing MFR-alpha could be separated from soluble MFR-alpha on sucrose flotation gradients. Only Triton X-100 soluble MFR-alpha was internalized from the plasma membrane. The reduced-folate-carrier, an integral membrane protein capable of translocating (anti-)folates across membranes, was completely excluded from the Triton X-100-resistant membrane domains. Internalized MFR-alpha recycled slowly to the cell surface during which it remained soluble in Triton X-100 at 0 degree C. Using immunoelectron microscopy, we found MFR-alpha along the entire endocytic pathway: in clathrin-coated buds and vesicles, and in small and large endosomal vacuoles. In conclusion, our data indicate that a large fraction, if not all, of internalizing MFR-alpha bypasses caveolae.

  2. Investigating the conformation of polymeric dispersant molecules on nanoparticle surface

    International Nuclear Information System (INIS)

    Yasin, S.; Luckham, P.F.; Iqbal, T

    2016-01-01

    Block copolymers are widely used as stabilizers in industrial dispersions. These polymers adsorb on surfaces by an anchor chain and extend by a hydrophilic chain. Scaling model or de Gennes theory has been used to determine the grafting density of the block copolymers. By implementing this theory to the block copolymers, conformation of the polymer molecules as a function of distance between adjacent anchor chains can be determined. The scaling model was applied to a selection of block copolymers (PE/F 103, PE/F 108, NPE1800, Triton X100, Triton X405, Lugalvan BNO12, Hypermer LP1, Hypermer B246 and OLOA 11000) in this study. The cross sectional area sc, distance s (square root of sc) and the Flory radius (end to end dimension of polymer), Rf, for all the polymers was determined. The cross sectional area per PEO (Poly Ethylene Oxide) chain (nm2) was found to be increasing with the size of stabilizing chain. Triton X100 and Lugalvan BNO12 has the smaller stabilizing chains so occupy smaller cross sectional areas whereas PE/F108 and triton X405 have larger number of PEO units and occupy a larger cross sectional area. This shows that stabilizing chain regulates the adsorption amounts that are lower in case of lower number of EO units. The application of de Gennes theory to experimental results suggested brush configuration of adsorbed polymer molecules in case of PE/F 103, PE/F 108, Triton X100, Triton X405, NPE1800, Lugalvan BNO12, Hypermer B246 and OLOA 11000. Whereas, Hypermer LP1 is more likely found to be adsorbed on graphitic carbon black in loops and trains. (author)

  3. Membrane fouling and wetting in membrane distillation and their mitigation by novel membranes with special wettability.

    Science.gov (United States)

    Wang, Zhangxin; Lin, Shihong

    2017-04-01

    Membrane distillation (MD) has been identified as a promising technology to desalinate the hypersaline wastewaters from fracking and other industries. However, conventional hydrophobic MD membranes are highly susceptible to fouling and/or wetting by the hydrophobic and/or amphiphilic constituents in these wastewaters of complex compositions. This study systematically investigates the impact of the surface wetting properties on the membrane wetting and/or fouling behaviors in MD. Specifically, we compare the wetting and fouling resistance of three types of membranes of different wetting properties, including hydrophobic and omniphobic membranes as well as composite membranes with a hydrophobic substrate and a superhydrophilic top surface. We challenged the MD membranes with hypersaline feed solutions that contained a relatively high concentration of crude oil with and without added synthetic surfactants, Triton X-100. We found that the composite membranes with superhydrophilic top surface were robustly resistant to oil fouling in the absence of Triton X-100, but were subject to pore wetting in the presence of Triton X-100. On the other hand, the omniphobic membranes were easily fouled by oil-in-water emulsion without Triton X-100, but successfully sustained stable MD performance with Triton X-100 stabilized oil-in-water emulsion as the feed solution. In contrast, the conventional hydrophobic membranes failed readily regardless whether Triton X-100 was present, although via different mechanisms. These findings are corroborated by contact angle measures as well as oil-probe force spectroscopy. This study provides a holistic picture regarding how a hydrophobic membrane fails in MD and how we can leverage membranes with special wettability to prevent membrane failure in MD operations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Histological Evaluation of Decellularized Skeletal Muscle Tissue Using Two Different Decellularization Agents

    Directory of Open Access Journals (Sweden)

    Hana Hrebíková

    2017-02-01

    Full Text Available The aim of the present study was to determine effect of two decellularized agents, sodium dodecyl sulphate (SDS and Triton X-100, to the skeletal muscle tissue. Final scaffold was evaluated by several histological techniques to analyse preservation of essential structures including collagen and elastic fibres, basement membranes, glycosaminoglycans and also to confirm elimination of nuclear and cytoplasmic components which are redundant in effectively prepared decellularized scaffolds. Comparison of tissue scaffolds processed with different detergents proved that SDS is superior to Triton X-100 as it can effectively decellularize muscle tissue.

  5. Performance of the Defense Acquisition System. 2014 Annual Report

    Science.gov (United States)

    2014-06-13

    Triton C-130 AMP Global Hawk EMD MPS ( F22 UPC) MPS KC-46A MPS MIDS JTRS Contract Start Date 50 Performance of the Defense Acquisition System, 2014...Triton CANES C-130 AMP Global Hawk (EMD) MPS ( F22 UPC) MPS MPS (SEIC) MPS FAB-T MIDS JTRS CVN 78 Contract Start Date 51 Performance of the...F-35 Air Force final margin trend F 35 C-130 AMP Global Hawk EMD MPS ( F22 UPC) FAB-T MPS KC-46A MPS NPOESS Contract Start Date 63 Performance

  6. Test and Evaluation of Architecture-Aware Compiler Environment

    Science.gov (United States)

    2011-11-01

    each other using a high-bandwidth ( DDR 4x 20Gbps) Infiniband network. Intel Xeon E5450 is a CISC out of order processor with two-levels of cache. L1...is 256 KB and L2 is 12 MB. Each node is also connected to 16 GB RAM . 3.2.3 Triton The Triton compute cluster is a Appro Hypergreen cluster based...2.8GHz with 12MB L3 cache and a 6.4 GT/s QPI bus. Memory is 24GB DDR3-1333 RAM (six DIMMS, 4 GB / DIMM). The challenge problems were compiled with

  7. Characterization and partial purification of phospholipase D from human placenta

    DEFF Research Database (Denmark)

    Vinggaard, Anne Marie; Hansen, Harald S.

    1995-01-01

    We report the existence in the human placenta of a phosphatidylcholine- hydrolyzing phospholipase D (PLD) activity, which has been characterized and partially purified. Triton X-100 effectively solubilized PLD from the particulate fraction of human placenta in a dose-dependent manner. However......, Triton X-100 caused decreasing enzyme activities. Maximum transphosphatidylation was obtained with 2% ethanol. The enzyme was found to have a pH optimum of 7.0-7.5 and an apparent K(m) of 33 mol% (or 0.8 mM). Ca and Mg was not required for the enzyme activity. Addition of phosphatidyl-4,5-bisphosphate...

  8. Polarographic behaviour and determination of selenite and tellurite in simple solutions or in a binary mixture

    International Nuclear Information System (INIS)

    Hassan, A.

    1991-01-01

    The polarographic behaviour of simple solutions of selenite and tellurite in 1 M ammonium salts of formate, acetate, tartrate, oxalate, and benzoate solutions in absence and in presence of Triton X-100 as a maximum suppressor and a temperature of 25 O C has been investigated. Schemes for the mechanism of reductions occuring at the DME have been deduced. A method for analytical determination of selenite and tellurite in simple solutions as well as in a binary mixture in the presence of 4-14 . 10 -3 % Triton X-100 is reported. (author)

  9. Hemolytic and toxic properties of Hydra attenuata nematocysts.

    Science.gov (United States)

    Klug, M; Weber, J; Tardent, P

    1989-01-01

    Crude extract prepared from isolated and purified nematocysts (stenoteles, desmonemes, isorhizas) of Hydra attenuata Pall. (Cnidaria, Hydrozoa) contains two main toxic proteins. The first is a hemolysin (100-200,000 mol.wt) which also causes initial spasmodic contractions in larval and adult specimens of Drosophila. Both, hemolytic and neurotoxic activities are inhibited by low concentrations of Triton X-100. The second protein (30-100,000 mol.wt), which is not susceptible to Triton causes long lasting paralysis leading to death of the test animals (LD50 approximately 5 mg crude nematocyst extract per kg). Neither of the toxins is identical with the previously described phospholipase.

  10. Extraction of lipase and protease and characterization of activated sludge from pulp and paper industry.

    Science.gov (United States)

    Karn, Santosh Kr; Kumar, Pradeep; Pan, Xiangliang

    2013-01-01

    Hydrolytic enzymes released by the microorganisms in activated sludge are responsible for the organic matter degradation there; however, the optimal extraction procedure of this valuable resource has not been well established until now. In this study protease and lipase were extracted from activated sludge using ultrasound disintegration combined with a nonionic detergent (Triton X-100) and cation-exchange resin (CER) in combination for the extraction of protease and lipase. It was observed that the concentration of 0.1% and 1% Triton X-100 has a strong influence for the extraction of lipase and protease respectively. Closer study of the enzyme extraction process is essential for different enzymes from activated sludge process.

  11. A survey of liquid scintillation solutions for use in urinalysis

    International Nuclear Information System (INIS)

    Muse, L.A.; Rao, V.

    1976-01-01

    Twelve solutions (Acquosol, Biofluor, Formula 950-A, Instagel, Monophase, Omni Triton, Quantafluor, Scinti Diox, Scintisol-complete, Scintiverse, TLA BBS-3, TLA Triton) have been tested to determine the most satisfactory scintillation cocktails for urinalysis. Each solution was tested; with no quenching material, with 0.5 ml of distilled water, and with 0.5 ml of urine. Samples were counted in a tritium energy window adjusted to discriminate against 14 C, and also in a universal window adjusted to count all β energies. Results are shown tabulated. Loss of counting efficiency with time due to storage in both glass and plastic vials was also determined. (U.K.)

  12. Effects of energy dependent Δ-nucleus optical potential in charge exchange reactions

    International Nuclear Information System (INIS)

    Helgesson, J.; Dmitriev, V.

    1994-01-01

    The Δ-nucleus optical potential from microscopic calculations in nuclear matter is used to study the effects of its energy dependence in charge-exchange (p, n) and ( 3 He, T) reactions. The neutron or triton spectrum is calculated via response function of a finite nucleus accounting for pion renormalization effects and short-range correlations. Only very small effects, 1-2%, were found for ( 3 He, T) reaction where the changes in the high energy part of the triton spectrum are enhanced relative to the low-energy part by ( 3 He, T) form factor. For the (p, n) reaction no visible effects were found. (orig.)

  13. Influence of surface active agents on the detection of beta radiation

    International Nuclear Information System (INIS)

    Mesquita, T.B.; Ruegg, E.F.

    1984-01-01

    It has been studied the efficiency of beta irradiation detection by liquid scintillation counting using the pesticide 14 C-lindane as radiation source and scientillation cocktails containing Triton-X, Arkopal, Tinoventin, Extravon-200, Oswalmida, Bigral, ethanol and methanol. Excepting the last 5 products, which led to a phase formation in the mixture, all other compounds, that are easily available in the local market, proved to be good substitute products for the well known Triton-X, an expensive and restrict emulsifier used for liquid scintillation measurement of aqueous solutions. (Author) [pt

  14. The influence of lipid composition on the barrier properties of band 3-containing lipid vesicles

    NARCIS (Netherlands)

    Hoogevest, P. van; Maine, A.P.M. du; Kruijff, B. de; Gier, J. de

    1984-01-01

    Band 3 protein has been incorporated into lipid vesicles consisting of 94:6 (molar ratio) egg phosphatidylcholine-bovine heart phosphatidylserine or total erythrocyte lipids by means of a Triton X-100 Bio-Beads method, with an additional sonication step prior to the removal of the detergent. This

  15. Cinnamon Extract Improves TNF-a Induced Overproduction of Intestinal ApolipoproteinB-48 Lipoproteins

    Science.gov (United States)

    TNF-alpha stimulates the overproduction of intestinal apolipoproteins. We evaluated whether a water extract of cinnamon (Cinnulin PF®) improved the dyslipidemia induced by TNF-alpha in Triton WR-1339 treated hamsters, and whether Cinnulin PF® inhibits the TNF-alpha-induced over the secretion of apoB...

  16. Cinnamon extract attenuates TNF-alpha-induced intestinal lipoprotein ApoB48 overproduction by regulating inflammatory, insulin, and lipoprotein pathways in enterocytes

    Science.gov (United States)

    We evaluated whether a water extract of cinnamon (CE = Cinnulin PF®) attenuates the dyslipidemia induced by TNF-alpha in Triton WR-1339-treated hamsters, and whether CE inhibited the over-secretion of apoB48-induced by TNF-alpha in enterocytes in a 35S-labelling study. In vivo, oral treatment with C...

  17. Electromagnetic structure of nuclei

    International Nuclear Information System (INIS)

    Arnold, R.G.

    1986-07-01

    A brief review is given of selected topics in the electromagnetic structure of nucleons and nuclei, including nucleon form factors from both quantum chromodynamics and electron scattering data, measurements of the deuteron and triton form factors, quasi-elastic scattering, and the EMC effect. 47 refs., 13 figs

  18. Secondary structure, stability and tetramerisation of recombinant Kv1.1 potassium channel cytoplasmic N-terminal fragment.

    NARCIS (Netherlands)

    Abbott, G.W.; Bloemendal, M.; van Stokkum, I.H.M.; Mercer, E.A.J.; Miller, R.T.; Sewing, S.; Wolters, M.J.J.; Pongs, O.; Srai, S.K.S.

    1997-01-01

    The recombinant N-terminal fragment (amino acids 14-162) of a tetrameric voltage-gated potassium channel (K(V)1.1) has been studied using spectroscopic techniques. Evidence is presented that it forms a tetramer in aqueous solution, whereas when solubilised in 1% Triton X-100 it remains monomeric.

  19. Hypolipidemic, Hypoglycemic and Antioxidant Activities of Flower ...

    African Journals Online (AJOL)

    HP

    1Department of Chemistry, University of Lucknow, Lucknow-226007, 2Division of Biochemistry, Central Drug. Research ... models, viz, triton WR-1339 - induced hyperlipimea in rats as well as fructose-rich high fat diet. To ..... peroxidation in rat liver microsomes in vitro (Note: Change (%) in antioxidant activity is shown in.

  20. Characterization and partial purification of phospholipase D from human placenta

    DEFF Research Database (Denmark)

    Vinggaard, Anne Marie; Hansen, Harald S.

    1995-01-01

    We report the existence in the human placenta of a phosphatidylcholine- hydrolyzing phospholipase D (PLD) activity, which has been characterized and partially purified. Triton X-100 effectively solubilized PLD from the particulate fraction of human placenta in a dose-dependent manner. However...

  1. Introduction to controlled thermonuclear fusion

    International Nuclear Information System (INIS)

    Assis, A.S. de; Rapozo, C.C.

    1988-07-01

    During many centuries the origin of the enormous power output of the sun remained as a mistery. However, in this century, the physicists have discovered that stars get their energy from the fusion of light nuclei (such as deuterons and tritons), and the Einstein's equation, AE = (Am)c 2 , was the way to explain this physical process. (author)

  2. Activated charcoal filter effectively reduces p-benzosemiquinone ...

    Indian Academy of Sciences (India)

    Prakash

    Triton-X100; 0.01 mg/ml aprotinin; 0.005 mg/ml leupeptin;. 0.4 mM phenylmethanesulphonyl fluoride [PMSF]; and 4. mM NaVO4). Lysates were then centrifuged at 20 ... polyacrylamide gel electrophoresis (SDS-PAGE) gel. After electrophoresis, the proteins were electrotransferred to a. PVDF membrane, blocked with 5% ...

  3. Isolation, partial purification and characterization of antifungal ...

    African Journals Online (AJOL)

    SAM

    2014-07-16

    1980) and samples were only dissolved in sample diluting buffer without heating. Briefly after electrophoresis, the gel was washed with 2.5% Triton-X 100 (3 × 20 min) with continual shaking to remove SDS followed by washing ...

  4. Structure and composition of synaptonemal complexes, isolated from rat spermatocytes

    NARCIS (Netherlands)

    Heyting, C.; Dietrich, A. J.; Redeker, E. J.; Vink, A. C.

    1985-01-01

    Synaptonemal complexes (SCs) (structures involved in chromosome pairing during meiosis) were isolated and purified from rat spermatocytes for the purpose of biochemical and morphological analysis. Spermatocytes were lysed in a medium, containing Triton X-100, EDTA and DTT; the resulting swollen

  5. inhibits channel and hemichannel functions inducing cataract

    Indian Academy of Sciences (India)

    2015-06-10

    Jun 10, 2015 ... then either stored at −80◦C or mixed directly with SDS load- ing buffer. The protein concentration was determined using a. BCA protein assay kit (Pierce Chemical). Equal amounts of each sample were loaded onto a 10% SDS-PAGE gel, elec- ... insoluble in 1% Triton X-100, but its monomer was solu-.

  6. Histone gene expression in early development of Xenopus laevis. Analysis of histone mRNA in oocytes and embryos by blot-hybridization and cell-free translation

    NARCIS (Netherlands)

    van Dongen, W. M.; Moorman, A. F.; Destrée, O. H.

    1983-01-01

    This study comprises the hybridization analysis of electrophoretically separated histone mRNAs from oocytes and embryos of Xenopus laevis, and analysis of in vitro translation products of these mRNAs on polyacrylamide gels containing sodium dodecyl sulfate (SDS) or Triton X-100. In oocytes and

  7. Isolation, characterization and Molecular weight Determination of ...

    African Journals Online (AJOL)

    Salwee

    2013-07-10

    Jul 10, 2013 ... chromatography on DEAE-Sepharose. SDS-PAGE revealed molecular mass of 87 kDa. .... activity protein profile on the SDS-PAGE prior to anion exchange chromatography. The anion exchange ... of non-ionic detergent, Triton-X100, at a final concentration of 0.1% and also 0.2 and 5% ethanol and after 3 ...

  8. comparison of protein extraction methods for the leaves of ficus

    African Journals Online (AJOL)

    F. I. Abdullah

    2017-05-01

    May 1, 2017 ... Keywords: Ficus deltoidea; protein extraction; TCA-acetone; phenol-SDS; pH. ... TCA-acetone/phenol-SDS did not improve the protein yield if compared to the single approach of TCA-acetone, but slightly ..... EDTA, 1% Triton X 100, 80% glycerol, 1M DTT and distilled water) and vortexed vigorously.

  9. Enhanced production of subtilisin of Pyrococcus furiosus expressed ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... on SDS-PAGE as compared to theoretical molecular mass of 17.6 kDa. This aberrant electrophoresis mobility could be .... analyze protein expression by 12% SDS-PAGE (Laemmli, 1970). To analyze the expression of .... pellet washed with buffer containing Triton X; lane 4, refolded subtilisin. subjected to ...

  10. Browse Title Index

    African Journals Online (AJOL)

    Items 51 - 100 of 544 ... Vol 9, No 1 (2007), Binding Of Ferrocyphen By Sds, Ctab And Triton X-100 In Water-Ethanol Co-Solvent, Abstract PDF. J Ige, ES Olaseni, O Owoyomi, GO Ogunlusi, O Soriyan. Vol 17, No 3 (2015), Biodegradation of petroleum oils by fungi isolated from oil palm fruit and mechanic village, Abstract PDF.

  11. Molecular cloning and characterization of a cytoplasmic cyclophilin ...

    African Journals Online (AJOL)

    Jane

    2011-08-08

    Aug 8, 2011 ... SDS-PAGE analysis and PPIase assay revealed that the expression product, with PPIase activity, was a fusion .... (Japan); Hepes, Triton X100, chymotrypsin, IPTG (isopropyl-beta-. D-thiogalactopyranoside) and reverse .... SDS-PAGE analysis of prokaryotic expression product and enzyme activity assay.

  12. Pinitol Suppresses Tumor Necrosis Factor-α-Induced Invasion of ...

    African Journals Online (AJOL)

    zymography using 0.1 % gelatin as a substrate. The conditioned medium was mixed with SDS-. PAGE sample buffer in the absence of reducing agent and electrophoresed in 8 % polyacrylamide gel. After electrophoresis, the gels were washed three times with 2.5 % Triton. X-100 in water and then incubated overnight in a.

  13. Cytotoxic T-lymphocyte Antigen-4 Binding to SHP2 Interacting ...

    African Journals Online (AJOL)

    in 1% Triton X-100 lysis buffer, subjected to SDS-PAGE, and immunoblotted with anti-pTyr Ab (upper panel) or anti-SIT Ab (lower panel). Positions of molecular mass markers (kDa) are indicated. C, Densitometric analysis using the Scantjet laser scanner (Hewlett-Packard) of anti-pTyr binding to SIT (B, upper panel). Values ...

  14. Purification of human recombinant granulocyte colony stimulating ...

    African Journals Online (AJOL)

    Ramya

    2012-06-21

    Jun 21, 2012 ... washes Tris and Triton washes were included and the resulting washed samples were loaded in 15% SDS-. PAGE. From the gel it was evident that the impurities were eluted and minimized. The washing efficiency was almost 80% (Figure 1). Solubilisation and refolding. The IB protein was solubilised using ...

  15. Isolation and characterization of a new keratinolytic bacterium that ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-09-15

    Sep 15, 2009 ... Each point represents the mean of three independent experiments. Table 1. The effect of chemical reagents on the keratinase activity of B. licheniformis K-19. Substance group. Compound. Concentration. Relative activity. (%). Control. Detergents. Solvents. Reducing agent. Inhibitors. Triton X-100. SDS.

  16. Study of factor XI deficiency in Khuzestan cattle population of Iran

    African Journals Online (AJOL)

    user

    2011-01-24

    Jan 24, 2011 ... SDS, sodium dodecyl sulfate; PCR, polymerase chain reaction; q, recessive allele. 1990), bovine ... of 1M MgCl2] and 1% Triton-100), they were properly mixed and kept on ice for 2 min. The solution was ... dodecyl sulfate (SDS) and 55 µl proteinase K (10 mg/ml stock), it was incubated on a low-speed ...

  17. Isolation and characterization of a bacteriocin produced by an ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-10-19

    Oct 19, 2009 ... The detergents Tween 20, Tween 80 and sodium dodecyl sulfate. (SDS) were used at a final concentration of 1% (v/v), sodium deoxy- cholate was used at 1 mg mL-1 and Triton X-100 was used at 0.02%. (v/v). DL-Dithiothreitol (DTT), ethylenediamine tetraacetic acid. (EDTA) and trichloroacetic acid (TCA) ...

  18. Authenticating the origin of different shrimp products on the Tunisian ...

    African Journals Online (AJOL)

    KAIS

    2015-07-22

    Jul 22, 2015 ... ... Tris–HCl, the EDTA and the SDS, the duration of the tissue incubation and DNA precipitation. The optimal conditions were used and the result, in term of DNA concentration and purity, were compared to seven published methods including the phenol–chloroform-based approaches, the Triton and CTAB.

  19. The histone H5 variant in Xenopus laevis

    NARCIS (Netherlands)

    Moorman, A. F.; de Boer, P. A.; Linders, M. T.; Charles, R.

    1984-01-01

    The presumptive histone H5 of Xenopus laevis has been characterized by SDS and acid-urea-Triton polyacrylamide gel electrophoresis and compared with chicken histone H5. Chicken H5 has a lower electrophoretic mobility compared to that of Xenopus H5 in both gel systems. It is shown, using a polyclonal

  20. Purification and biochemical characterization of a serine alkaline ...

    African Journals Online (AJOL)

    USER

    2010-08-02

    Aug 2, 2010 ... The enzyme was inactivated by diisopropyl fluorophosphate and phenylmethylsulfonyl fluoride, suggesting that it is a serine protease. The protease was stable in 0.5% SDS and retained 70.3% of its initial activity after 1 h of incubation. It was active in the presence of 3% Triton X-100 with 100% activity.

  1. Luminescence quenching of Ru(phen) by some polymer–cobalt(III ...

    Indian Academy of Sciences (India)

    TECS

    2007-03-20

    Mar 20, 2007 ... geneous environments such as anionic sodium docecyl sulphate (SDS), cationic cetyltrimethylammonium bromide (CTAB) and nonionic Triton X-100 (TX-. 100) micelles. 2. Experimental. 2.1 Materials and methods. The polymer-cobalt(III) complexes, cis-[Co(phen)2. (BPEI)Cl]. 2+ and cis-[Co(bpy)2(BPEI)Cl].

  2. Studies on the proteinaceous gel secretion from the skin of the ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-12-15

    Dec 15, 2009 ... and SDS-PAGE analysis of the proteinaceous gel of catfish, A. ... SDS–PAGE. One dimensional sodium dodecyl sulphate (SDS) poly acrylamide gel electrophoresis (PAGE) was carried out to estimate the mole- cular weight of the ... 0.2% Triton X-100, was defined as percent hemolysis (Park et al.,. 1997).

  3. terminal in Escherichia coli

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-04-24

    Apr 24, 2012 ... Sodium dodecyl sulfite polyacrylamide gel electrophoresis (SDS-. Chen et al. 8251 ... four times in the same buffer without Triton X-100 (Sensen et al.,. 2003). .... from 1 h to 13 h in steps of 1 h (lanes 2 to 14) were extracted and subjected to SDS-PAGE analysis (shown in Figure 3A, arrow indicates.

  4. Van Gölü Çevresinde Toplanan Bazı Toprak Numunelerinden ...

    African Journals Online (AJOL)

    Arafat Ertas

    2013-05-22

    May 22, 2013 ... phosphate buffer pH= 7.8, 1 mM EDTA, 1% Triton-X-100, and 10% glycerol along with several protease inhibitors). Spot test was carried out after which electrophoretic processes were done in accordance with Laemmli (1970). Protein profiles of all cell proteins were determined by SDS electrophoresis ...

  5. Hypoxia stimulates invasion and migration of human cervical cancer ...

    Indian Academy of Sciences (India)

    Hao Xu

    2017-07-25

    Jul 25, 2017 ... UT, USA; BCA protein assay kit and SDS-PAGE Gel Kit from Beyotime Biotechnology, Shanghai, ... lamide gel electrophoresis (SDS-PAGE, Beyotime, Shang- hai, China) for electrophoresis and then ... with 0.1% Triton X-100 made in PBS solution for 10 min. Then washed monolayer 3 times with PBS, block ...

  6. oxidation of acetaldehyde in aqueous micellar

    Indian Academy of Sciences (India)

    Susanta Malik

    dodecyl sulfate (SDS) (SRL, India), N-cetylpyridinium chlo- ride (CPC) (SRL, India), Triton X-100 (TX-100) (SRL, India) and D2O (Sigma Aldrich) and double distilled water were used. All other used chemicals have been purchased in their highest purity state. 2.2 Instrumentation. The necessary solutions were prepared by ...

  7. isolated from Trichoderma harzianum

    African Journals Online (AJOL)

    SAM

    2014-05-21

    May 21, 2014 ... After SDS-PAGE, the chitinase was regenerated by the removal of SDS with purified. Triton X-100. After purification with Ni-NTA coloumn to bind to 6x His Tag the recombinant protein was found to be 42 kDa on SDS-PAGE as shown in Figure 1. The purified recombinant protein fractions extracted from.

  8. Purification and characterization of a new cold active lipase, EnL A ...

    African Journals Online (AJOL)

    SONU

    2015-06-03

    Jun 3, 2015 ... SDS PAGE analysis revealed that the protein is monomeric with a MW of ˜54 kDa and zymogram .... Triton X-100 and 10 mg of gum arabic. The mixture was incubated at 30°C for 30 min ... The molecular weight of the purified lipase was determined by SDS-. PAGE using Laemmli method (Laemmli, 1970).

  9. Author Details

    African Journals Online (AJOL)

    Ogunlusi, GO. Vol 9, No 1 (2007) - Articles Binding Of Ferrocyphen By Sds, Ctab And Triton X-100 In Water-Ethanol Co-Solvent Abstract PDF. ISSN: 0794-4896. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and ...

  10. Development of a Cytocompatible Scaffold from Pig Immature Testicular Tissue Allowing Human Sertoli Cell Attachment, Proliferation and Functionality

    Directory of Open Access Journals (Sweden)

    Maxime Vermeulen

    2018-01-01

    Full Text Available Cryopreservation of immature testicular tissue before chemo/radiotherapy is the only option to preserve fertility of cancer-affected prepubertal boys. To avoid reintroduction of malignant cells, development of a transplantable scaffold by decellularization of pig immature testicular tissue (ITT able to support decontaminated testicular cells could be an option for fertility restoration in these patients. We, therefore, compared decellularization protocols to produce a cytocompatible scaffold. Fragments of ITT from 15 piglets were decellularized using three protocols: sodium dodecyl sulfate (SDS-Triton (ST, Triton-SDS-Triton (TST and trypsin 0.05%/ethylenediaminetetraacetic acid (EDTA 0.02%-Triton (TET with varying detergent concentrations. All protocols were able to lower DNA levels. Collagen retention was demonstrated in all groups except ST 1%, and a significant decrease in glycosaminoglycans was observed in the TST 1% and TET 1% groups. When Sertoli cells (SCs were cultured with decellularized tissue, no signs of cytotoxicity were detected. A higher SC proliferation rate and greater stem cell factor secretion were observed than with SCs cultured without scaffold. ST 0.01% and TET 3% conditions offered the best compromise in terms of DNA elimination and extracellular matrix (ECM preservation, while ensuring good attachment, proliferation and functionality of human SCs. This study demonstrates the potential of using decellularized pig ITT for human testicular tissue engineering purposes.

  11. Expression of recombinant Streptokinase from local Egyptian ...

    African Journals Online (AJOL)

    Jane

    2011-08-17

    Aug 17, 2011 ... Enzyme activity assays. Zymography. Samples were run on 12% of PAGE with PBS but water in the separating gel was replaced by human plasma diluted (1:5). After running, the gel was soaked in 1% Triton X100 for 2 h. The solution was changed every 1 h to remove SDS for renaturation of the enzyme.

  12. Methanol Extract of Polyopes lancifolius Suppresses Tumor ...

    African Journals Online (AJOL)

    supernatants were collected and then subjected to sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS–. PAGE) in 10 % polyacrylamide gels copolymerized with 1 mg/ml of gelatin. After electrophoresis, the gels were washed several times in 2.5 % Triton X-100 for 1 h at room temperature to remove SDS and ...

  13. Error Correcting Codes

    Indian Academy of Sciences (India)

    focused pictures of Triton, Neptune's largest moon. This great feat was in no small measure due to the fact that the sophisticated communication system on Voyager had an elaborate error correcting scheme built into it. At Jupiter and Saturn, a convolutional code was used to enhance the reliability of transmission, and at ...

  14. A Dictyostelium discoideum mutant exhibiting calcium-dependent, high-level detergent resistance.

    OpenAIRE

    Madigan, S J; Whitbread, J A; Katz, E R

    1990-01-01

    We report the isolation of a mutant of the cellular slime mold Dictyostelium discoideum that is highly resistant to the lethal action of the nonionic detergent Triton X-100. The resistance is completely dependent on the presence of divalent cations, of which Ca2+ is the most effective.

  15. Solvent Effects on the Micelle - Influenced Aquation Reactions of ...

    African Journals Online (AJOL)

    The relative rates of the micelle-catalyzed/inhibited aquation reactions of the complexes: Fe(Ph2Phen), Fe(Me2Phen) and Fe(MePhen were investigated in ethylene glycol, water and aqueous acetone. The pseudo first oder rate constant, K vs (Triton X-100) profiles reveal that at all the (TX-100) concentration ranges ...

  16. The role of specific interactions on dynamical processes in a room ...

    Indian Academy of Sciences (India)

    Administrator

    bmim+][PF–. 6]/Triton X-100/ water ternary system.42 The outcome of this investi- gation indicates that for hydrophobic solute C153, the solvation and rotational relaxation times remain unchanged with an increase in the mole ratio of the ionic liquid ...

  17. In vivo ameliorative effect of methanolic extract of Boswellia dalzielli ...

    African Journals Online (AJOL)

    Twenty five male albino rats 2-3 months old (150-210) g were distributed randomly into five groups [Group 1: normal control received 200 μL normal saline daily for 3 weeks, Group 2: hyperlipidemic control induced by a single dose of Triton X-100 (150 mg/kg body weight) subcutaneously, followed by oral administration of ...

  18. DNA characterization and polymorphism of KISS1 gene in Egyptian ...

    African Journals Online (AJOL)

    Aghomotsegin

    2015-07-29

    Jul 29, 2015 ... described by Miller et al. (1988) with minor modifications. Briefly, blood samples were mixed with cold 2x sucrose-triton and centrifuged at 5000 rpm for 15 min at 4°C. The nuclear pellet was suspended in lysis buffer, sodium dodecyl sulfate and proteinase K and incubated overnight in a shaking water bath ...

  19. Inhibitory activity of a water-soluble morin derivative on phosphatase ...

    African Journals Online (AJOL)

    enoh

    2012-03-01

    pH 7.5), 200 mM NaCl, 5% (v/v) glycerol, and 0.04%. (v/v) β-mercaptoethanol. After cell lysis by sonication, the His- tagged protein was ... (v/v) Triton X-100, and 4 µM 6,8-difluoro-4-methy-lumbelliferyl phosphate (DiFMUP).

  20. The relation between the PST1 restriction fragment length ...

    African Journals Online (AJOL)

    Triton X-100 lysis method.17 DNA (1 - 3 ~g) was amplified by. PCR using 1 unit of Taq1 polymerase in 50 ~l of reaction mixture containing polymerase buffer and 1 pmol of oligonucleotides. The primers used were: 5' GAGCGCTCTCGAGGAGTACAC 3' [bp 2238 - 2258] and. 5' GACTGGCTTCCACTGCTGTGC 3' [bp 2956 ...

  1. Urtica dioica Induces Cytotoxicity in Human Prostate Carcinoma ...

    African Journals Online (AJOL)

    In order to evaluate the involvement of caspases in UD-AQ induced cytotoxicity, the activities of caspase 3 and 9 were measured using a colorimetric assay. Following treatment of. LNCaP cells with UD-AQ extract (50 µg/ml) in 6- well plates, cells were collected by centrifugation and lysed with lysis buffer (1 % Triton X-100,.

  2. Amoebapore is an important virulence factor of Entamoeba histolytica

    Indian Academy of Sciences (India)

    Unknown

    this release or leakage is not yet understood, but it was certainly not due to lysis of trophozoites since it was not ... detergent (Triton X-100, 0⋅2%) (Bracha and Mirelman. 1984), whereas unexposed control bacteria are .... able to lyse bacterial spheroplasts, it is still not clear if the ratio between the different isoforms bears any ...

  3. Light and electron microscope assessment of the lytic activity of ...

    African Journals Online (AJOL)

    The Microcystis cells were exposed to copper, B. mycoides B16 and Triton X-100, in order to ascertain the level of cell membrane damage. The membrane cell damage ... The electron microscopy observations appeared to reveal at least two mechanisms of Microcystis lysis (contact and parasitism). The light and electron ...

  4. Anticonvulsant, Antimicrobial and Cytotoxic Activities of Berberis ...

    African Journals Online (AJOL)

    RBC lysis (%) = (As/At)100 ……………….. (1) where As and At are the absorbance of sample and triton X-100, respectively. HPLC analysis. Phenolic compounds present in the ethyl acetate fraction of the plant were estimated by HPLC using a procedure with some modification as mentioned by Sultana [16]. The sample for ...

  5. Inhibitory Effect of Berberine on Zeste Homolog 2 (Ezh2 ...

    African Journals Online (AJOL)

    dissolved matter. Bio-Rad protein assay (Bio-Rad, Hercules, CA, USA) was used for estimation of protein concentration. Proteins were separated on ... 0.3 % Triton X-100 for 20 min at 4 oC. The cells were then boiled in water to expose the DNA.

  6. DNA isolation protocols affect the detection limit of PCR approaches of bacteria in samples from the human gastrointestinal tract

    NARCIS (Netherlands)

    Zoetendal, E.G.; Ben-Amor, K.; Akkermans, A.D.L.; Abee, T.; Vos, de W.M.

    2001-01-01

    A major concern in molecular ecological studies is the lysis efficiency of different bacteria in a complex ecosystem. We used a PCR-based 16S rDNA approach to determine the effect of two DNA isolation protocols (i.e. the bead beating and Triton-X100 method) on the detection limit of seven

  7. DNA damage by the cobalt (II) and zinc (II) complexes of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-03

    Sep 3, 2008 ... overnight at 4°C containing 1% Triton X-100 and 10% dimethylsulfoxide, added just before use. Two slides were prepared from each control and treatment group under dimmed light conditions. After lysis, the slides were placed on an horizontal gel electrophoresis unit filled with fresh electrophoretic buffer ...

  8. Combined strategies for the improvement of heterologous ...

    African Journals Online (AJOL)

    use

    2011-12-14

    Dec 14, 2011 ... medium could reduce cell lysis and protease release, and increase expression level and recombinant proteins purity .... 0.1% of Triton X-100 in. NTA buffer was added to maintain the stability of the ... Furthermore, the lower cell lysis and proteolytic activity were usually obtained by lowering the methanol ...

  9. Download this PDF file

    African Journals Online (AJOL)

    favourably distributed into the micellar phase where the aquation reaction is faster. This can be attributed to the high activity of the available but limited H,0, most of which forms the water pools in the lamellar structure [17] proposed for Triton X-100 micelles. However, as complex concentration increases, its solubilization into ...

  10. Distribution, phosphorylation, and activities of Hsp25 in heat-stressed H9c2 myoblasts : a functional link to cytoprotection

    NARCIS (Netherlands)

    Bryantsev, AL; Loktionova, SA; Ilyinskaya, OP; Tararak, EM; Kampinga, HH; Kabakov, AE

    The behavior of the endogenous heat shock protein 25 (Hsp25) in heat-stressed rat H9c2 myoblasts was studied. After mild or severe heating, this protein became less extractable with Triton X-100 and displayed characteristic immunofluorescence patterns, namely (1) granules in the nucleus, and (2)

  11. Event reconstruction techniques for Si (strip)-CsI (Tl) telescope for VECC charged particle array

    International Nuclear Information System (INIS)

    Rana, T.K.; Banerjee, K.; Kundu, S.; Dey, A.; Bhattacharya, C.; Bhattacharya, S.; Meena, J.K.; Mukherjee, G.; Ghosh, T.K.; Gupta, D.

    2006-01-01

    A 4π charged particle detector array is being developed as a part of the nuclear physics experimental facility for the superconducting cyclotron, which is under construction at VECC, Kolkata. The energy loss in the Si-strip ΔE detector has been calculated for protons, deuterons, tritons and alphas at different energies by using the code TRIM

  12. Effects of extremely low frequency electromagnetic fields on growth ...

    African Journals Online (AJOL)

    Jane

    2011-08-22

    Aug 22, 2011 ... the extracts was analyzed under reducing conditions by the SDS– ... and 0.025% (w/v) triton X-100 and appropriate amount of shoot or ..... SDS-PAGE results. Table 3 explains the total protein content of the exposed seedlings and the control plants studied. The amount of the total protein decreased for the ...

  13. Reduction of angiocidin contributes to decreased HepG2 cell ...

    African Journals Online (AJOL)

    EB

    2013-09-03

    Sep 3, 2013 ... Tris, 5 mM EDTA pH7.5, 1% Triton X-100, and supplemented with 1mM PMSF). BCA Protein. Assay Reagent kit (Pierce) was used to determine the protein concentration. Equal amounts of protein. (10ug) were separated by SDS-PAGE and transferred to PVDF membranes. The membranes were blocked in ...

  14. Expression, purification and characterization of Oryza sativa L. NAD ...

    African Journals Online (AJOL)

    Jane

    2011-10-17

    Oct 17, 2011 ... Triton X-100 and 1 mmol/L PMSF). And lysozyme (a final concentration of ... polyacrylamide gel electrophoresis (SDS-PAGE) and proteins were visualized with Coomassie Brilliant ... OsNAD-ME1 that were induced with 1 mmol/L IPTG for different times, and were analyzed on SDS-PAGE. Lane 1, molecular.

  15. Tamoxifen inhibits astrocytic JAK2/STAT3 pathway in rats with ...

    African Journals Online (AJOL)

    signaling pathway [6,7]. During activation of spinal astrocytes, inhibition of the JAK-STAT3 pathway can reduce the pain response, as well as peripheral nerve injury hyperexcitability in. SDH neurons [8]. Inhibition of the cytokine ... Technology, Danvers, MA, USA) in a mixture of. PBS and 0.3% Triton X-100, 5 % (v/v) donkey.

  16. Gibberella fujikuroi complex

    African Journals Online (AJOL)

    SAM

    2014-03-19

    Mar 19, 2014 ... Therefore, the increase in activity with the addition of Triton X-100, with no increase in biomass, may be due to the detergent effect by increasing the permeability of the cell wall, and con- sequently increasing the secretion of the enzyme by the cell. Although, the cost of culture medium is an important.

  17. Author Details

    African Journals Online (AJOL)

    Ige, J. Vol 9, No 1 (2007) - Articles Binding Of Ferrocyphen By Sds, Ctab And Triton X-100 In Water-Ethanol Co-Solvent Abstract PDF. ISSN: 0794-4896. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and Conditions of ...

  18. Synthesis of bimetallic nanocompositions AuxPd1-x/γ-Al2O3 for catalytic CO oxidation

    Science.gov (United States)

    Zaytsev, S. Yu.; Plyusnin, P. E.; Slavinskaya, E. M.; Shubin, Yu. V.

    2017-11-01

    Colloidal suspensions of AuxPd1-x nanoalloys were prepared via hydrazine co-reduction of [AuCl4]- and [PdCl4]2- complex anions in aqueous solution. High molecular weight polymeric compounds polyvinylpyrrolidone (PVP), polyvinyl alcohol (PVA), and cryptoionic surfactants (AF-6 and AF-12 neonols, Triton X-100) were used as surface capping agents. Nanoparticles prepared under different experimental conditions were immobilized on γ-Al2O3 supports. The removal of the capping agents from the surface of the active particles was achieved through calcination of samples in oxidative atmosphere (air, 500 °C). This pretreatment of the catalysts significantly enhances their performance. Powder XRD, TEM, and EDX were employed to characterize the structure, size, and composition of the AuxPd1-x/γ-Al2O3 catalysts. The immobilized particles consist of uniformly mixed alloys having multi-domain face-centered cubic structure with typical crystallite size of 3-6 nm. The activity of the prepared samples was examined with temperature-programmed CO oxidation reaction (TP-CO+O2). Triton X-100 surfactant is superior in a number of parameters. Among all AuxPd1-x/γ-Al2O3 catalysts tested, the one stabilized with Triton X-100 (0.4%Au-0.2%Pd@Triton X-100) was found to have the highest activity for conversion of CO into CO2.

  19. 3H and 3He nucleus structure by Faddeev equations in the configuration space

    International Nuclear Information System (INIS)

    Laverne, A.

    1973-06-01

    To solve the triton problem, Faddeev equations are solved in configuration space. The method is described (algorithm) together with some results with nucleon-nucleon potentials such as Reid potential and Tourreil and Sprung potential. A comparative study with helium 3 is given [fr

  20. Antimicrobial, hemolytic and thrombolytic activities of some new N ...

    African Journals Online (AJOL)

    Triton X-100 and phosphate buffer saline (PBS) were employed as references. Thrombolytic activity assay. Thrombolytic activity was assayed according to. Mannan et al [16] using a bovine blood sample. PBS and streptokinase were employed as references. Activity was determined by the following equation, where X ...

  1. Browse Title Index

    African Journals Online (AJOL)

    Items 1 - 50 of 273 ... Vol 12, No 4 (2017), In vivo ameliorative effect of methanolic extract of Boswellia dalzielli Hutch (Mebdh) stem bark on Triton X-100 induced hyperlipidaemia, Abstract PDF. Mohammed Sani Jaafaru, Ibrahim Deborah Kyomson, Hauwa'u Yakubu Bako, Peter Maitalata Waziri, Yahaya Yakubu, Mohammed ...

  2. Multiple growth hormone-binding proteins are expressed on insulin-producing cells

    DEFF Research Database (Denmark)

    Møldrup, A; Billestrup, N; Thorn, N A

    1989-01-01

    and intracellular organelles are low in GH-binding activity. The plasma membrane-bound activity is soluble in Triton X-100 with intact hormone binding characteristics. The apparent KD in detergent solution is estimated to 18 ng/ml (8 x 10(-10) M). 125I-hGH-affinity cross-linking to intact and detergent...

  3. The antibacterial activities of some plant-derived triterpenes ...

    African Journals Online (AJOL)

    The checkerboard method was used to determine the antibiotictriterpene interactions while the cytosolic lactate dehydrogenase test was used to determine the membrane damaging potentials of the triterpenes in comparison to 3% Triton X-100. Results: The triterpenes RA3, RA5, SF1 and SF2 had activities against 86.4%, ...

  4. DDT uptake by arbuscular mycorrhizal alfalfa and depletion in soil as influenced by soil application of a non-ionic surfactant

    International Nuclear Information System (INIS)

    Wu Naiying; Zhang Shuzhen; Huang Honglin; Shan Xiaoquan; Christie, Peter; Wang Youshan

    2008-01-01

    A greenhouse pot experiment was conducted to investigate the colonization of alfalfa roots by the arbuscular mycorrhizal (AM) fungus Glomus etunicatum and application of the non-ionic surfactant Triton X-100 on DDT uptake by alfalfa and depletion in soil. Mycorrhizal colonization led to an increase in the accumulation of DDT in roots but a decrease in shoots. The combination of AM inoculation and Triton X-100 application enhanced DDT uptake by both the roots and shoots. Application of Triton X-100 gave much lower residual concentrations of DDT in the bulk soil than in the rhizosphere soil or in the bulk soil without Triton X-100. AM colonization significantly increased bacterial and fungal counts and dehydrogenase activity in the rhizosphere soil. The combined AM inoculation of plants and soil application of surfactant may have potential as a biotechnological approach for the decontamination of soil polluted with DDT. - Combined colonization of alfalfa roots by an arbuscular mycorrhizal fungus and addition of non-ionic surfactant to the soil promoted root and shoot uptake and soil dissipation of DDT

  5. (HN1) strain of Aspergillus niger

    African Journals Online (AJOL)

    login123

    2016-09-26

    Sep 26, 2016 ... Tween-20, Tween-80, Tributyrin, Triton-X-100 and glucose were used to investigate their effect on extracellular lipase production by both LPF-5 and HN1 strain. These carbon sources were added individually to the production medium at a constant concentration. (1%, w/v) by replacing the original carbon ...

  6. Microvillar membrane microdomains exist at physiological temperature. Role of galectin-4 as lipid raft stabilizer revealed by "superrafts"

    DEFF Research Database (Denmark)

    Braccia, Anita; Villani, Maristella; Immerdal, Lissi

    2003-01-01

    function and even existence in vivo. The nonionic detergent Brij 98 was used to isolate lipid rafts from microvillar membrane vesicles of intestinal brush borders at physiological temperature to compare with rafts, obtained by "conventional" extraction using Triton X-100 at low temperature. Microvillar...

  7. A neutral endopeptidase in the microvillar membrane of pig intestine. Partial purification and properties

    DEFF Research Database (Denmark)

    Danielsen, Erik Michael; Vyas, J P; Kenny, A J

    1980-01-01

    An enzyme hydrolysing [125I]iodo-insulin B chain was enriched in preparations of intestinal microvilli. The activity could be solubilized by Triton X-100 and was partially (76-fold) purified. It was very sensitive to inhibition by phosphoramidon and was also inhibited by chelating agents. In its...

  8. Optimization of culture media for extracellular expression of ...

    African Journals Online (AJOL)

    Purpose: To investigate the enhancement of streptokinase extracellular expression in Escherichia coli by adjusting culture media. Methods: Screening of 10 chemical factors (EDTA, peptone, glycine, triton X-100, glycerol, K2HPO4,. KH2PO4, Ca2+ (calcium chloride), yeast and NaCl) in order to increase the secretion of ...

  9. Virosome and ISCOM vaccines against Newcastle disease: preparation, characterization and immunogenicity

    NARCIS (Netherlands)

    Homhuan, A.; Prakongpan, S.; Poomvises, P.; Maas, H.A.; Krommelin, D.; Kersten, G.; Jiskoot, W.

    2004-01-01

    The purpose of this study was to prepare and characterize virosomes and ISCOMs containing envelope proteins of Newcastle disease virus (NDV) and to evaluate their immunogenicity in target animals (chickens). Virosomes were prepared by solubilization of virus with either Triton X-100 or octyl

  10. Phenotypic, Proteomic, and Genomic Characterization of a Putative ABC-Transporter Permease Involved in Listeria monocytogenes Biofilm Formation

    DEFF Research Database (Denmark)

    Zhu, Xinna; Liu, Weibing; Lametsch, René

    2011-01-01

    Δ1771 was more sensitive to Triton X-100 and less resistant to cationic antibiotics, which might be explained by the down-regulation of dlt operon in this deletant and the fact that dlt involves the incorporation of D-alanine residues into lipoteichoic acids, resulting in a positive net charge...

  11. Stability of solubilized benzodiazepine receptors

    NARCIS (Netherlands)

    Janssen, M.J; Ensing, K; de Zeeuw, R.A

    1997-01-01

    According to the observations of other researchers, benzodiazepine receptors solubilized with sodium deoxycholate are unstable, but stability can be improved by exchanging deoxycholate for Triton X-100. In our experiments we conclude that the choice of detergent is not the restrictive factor for the

  12. A soft and conductive PDMS-PEG block copolymer as a compliant electrode for dielectric elastomers

    DEFF Research Database (Denmark)

    A Razak, Aliff Hisyam; Szabo, Peter; Skov, Anne Ladegaard

    -methyl pyrrolidinone) with 1 wt% of surfactant (Triton X-100). The dispersion of MWCNTs in PDMS-PEG systemis shown in figure 2 where MWCNTs (dark areas) are well-distributed in the system indicating an acceptable dispersional though some big clusters appear in the optical microscope image. The conductivity of 4 phr...

  13. Production of muons for fusion catalysis in a magnetic mirror configuration. Revision 1

    International Nuclear Information System (INIS)

    Moir, R.W.; Chapline, G.F. Jr.

    1986-01-01

    For muon-catalyzed fusion to be of practical interest, a very efficient means of producing muons must be found. We describe a scheme for producing muons that may be more energy efficient than any heretofore proposed. There are, in particular, some potential advantages of creating muons from collisions of high energy tritons confined in a magnetic mirror configuration. If one could catalyze 200 fusions per muon and employ a uranium blanket that would multiply the neutron energy by a factor of 10, one might produce electricity with an overall plant efficiency (ratio of electric energy produced to nuclear energy released) approaching 30%. One possible near term application of a muon-producing magnetic-mirror scheme would be to build a high-flux neutron source for radiation damage studies. The careful arrangement of triton orbits will result in many of the π - 's being produced near the axis of the magnetic mirror. The pions quickly decay into muons, which are transported into a small (few-cm-diameter) reactor chamber producing approximately 1-MW/m 2 neutron flux on the chamber walls, using a laboratory accelerator and magnetic mirror. The costs of construction and operation of the triton injection accelerator probably introduces most of the uncertainty in the viability of this scheme. If a 10-μA, 600 MeV neutral triton accelerator could be built for less than $100 million and operated cheaply enough, one might well bring muon-catalyzed fusion into practical use

  14. Syndecan-4 associates with alpha-actinin

    DEFF Research Database (Denmark)

    Greene, Daniel K; Tumova, Sarka; Couchman, John R

    2002-01-01

    during the formation of focal adhesions. To date, a direct link between syndecan-4 and the cytoskeleton has remained elusive. We now demonstrate by Triton X-100 extraction immunoprecipitation and in vitro binding assays that the focal adhesion component alpha-actinin interacts with syndecan-4 in a beta...

  15. Immunoelectrophoretic studies on pig intestinal brush border proteins

    DEFF Research Database (Denmark)

    Danielsen, Erik Michael; Sjöström, H; Norén, O

    1977-01-01

    Brush borders were prepared from pig intestinal mucosa and the membrane proteins solubilized with either Triton X-100 or papain. Proteins, thus released, were used as antigens to raise antisera in rabbits. The immunoglobulin G fractions were isolated and shown by the double layer immunofluorescence...

  16. Biosynthesis of intestinal microvillar proteins. Evidence for an intracellular sorting taking place in, or shortly after, exit from the Golgi complex

    DEFF Research Database (Denmark)

    Danielsen, E M; Cowell, G M

    1985-01-01

    the Mg2+-precipitated fraction were equally well protected from proteolytic cleavage (in the absence of Triton X-100). This indicates that the basolateral plasma membrane is unlikely to be involved in the post-Golgi transport of newly synthesized aminopeptidase N and suggests instead a direct delivery...

  17. An Evaluation of Emulsions in Wear-Metal-in-Oil Analyses | Fischer ...

    African Journals Online (AJOL)

    The oil samples were treated with acid and emulsified in water (1% w/w) using tetralin as a solvent and Triton X-100 as a surfactant. The performance characteristics (detection limits, accuracy, precision and spike recovery) of the emulsion methodology were evaluated. The calibration for the emulsion method compared ...

  18. Multiple states of the Tyr318Leu mutant of dihydroorotate dehydrogenase revealed by single molecule kinetics

    DEFF Research Database (Denmark)

    Shi, J.; Palfey, B.A.; Dertouzos, J.

    2004-01-01

    , with some molecules going through the on-off cycles 5-fold faster than others, however, there is no detectable dynamic disorder in DHOD turnover. When 0.1% reduced Triton X-100, a detergent that more closely simulates the natural membrane environment, is added, our data suggest the degree of static...

  19. Tong et al., Okmen and Turkcan Afr J Tradit Complement Altern Med ...

    African Journals Online (AJOL)

    cadewumi

    (NGS) and 0.5% Triton X-100. Then the samples were incubated in the primary antibody. The rabbit polyclonal antibody, which was raised in the rat against 21, amino acid peptide corresponding to the C-terminus of the rat capsaicin receptor protein (Zhongshan Goldenbridge Biotechnology. Co. Ltd, China), was used at ...

  20. Extracellular proteolytic activity of Deinococcus geothermalis ...

    African Journals Online (AJOL)

    Nonionic detergents like Triton X-100 and Tween 80 did not affect catalytic properties. It suggested that the enzyme produced by D. geothermalis could be used as a component of detergents. Keywords: Deinococcus geothermalis, alkaline protease, detergents, thermostability. African Journal of Biotechnology Vol. 12(25) ...

  1. Electrophoretic demonstration of glycoproteins, lipoproteins, and phosphoproteins in human and bovine enamel

    DEFF Research Database (Denmark)

    Kirkeby, S; Moe, D; Bøg-Hansen, T C

    1990-01-01

    enamel a number of high molecular weight proteins could be demonstrated after ethylenediaminetetra-acetic acid demineralization and subsequent Triton X-100 extraction. These proteins are suggested to be lipoproteins. Phosphoproteins could only be visualized in enamel matrix from the tooth germs....

  2. Determination of total selenium and Se-77 in isotopically enriched human samples by ICP-dynamic reaction cell-MS

    DEFF Research Database (Denmark)

    Sloth, Jens Jørgen; Larsen, Erik Huusfeldt; Bügel, Susanne H.

    2003-01-01

    and the digested faecal samples were diluted using an aqueous diluent containing 0.5% Triton X-100, 2% nitric acid and 3% methanol. Selenium was detected as Se-76, Se-77 and Se-80 by ICP- DRC- MS. Selenium originating from the natural isotope abundance yeast and other selenium sources from the diet was determined...

  3. Identification and localization of a soluble antigen, Ag2, of 136 kDa from Plasmodium falciparum in vitro cultures

    DEFF Research Database (Denmark)

    Jakobsen, P H; Grellier, P; Theander, T G

    1991-01-01

    as a duplet with molecular masses of 136 and 120 kDa when tested by immunoblotting. Immunoprecipitation experiments on Triton X-100 extracted antigens from synchronized cultures showed that the antigen was synthesized in the schizont stage. Ag2 was located near the surface of schizonts in the parasitophorous...

  4. Author Details

    African Journals Online (AJOL)

    Gyutorwa, Joseph Samson. Vol 12, No 4 (2017) - Articles In vivo ameliorative effect of methanolic extract of Boswellia dalzielli Hutch (Mebdh) stem bark on Triton X-100 induced hyperlipidaemia. Abstract PDF. ISSN: 1597-6343. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors ...

  5. Heparan sulfate proteoglycans of rat embryo fibroblasts. A hydrophobic form may link cytoskeleton and matrix components

    DEFF Research Database (Denmark)

    Woods, A; Couchman, J R; Höök, M

    1985-01-01

    oligosaccharides. Treatment of living cells with 0.2% Triton X-100, which retained stress fibers and extracellular matrix but solubilized cell membranes, released a proportion of the smaller HSPG together with the heparan sulfate oligosaccharides. The cytoskeleton-matrix residue remaining after detergent...

  6. Experimental investigation of thermophysical properties, entropy generation and convective heat transfer for a nitrogen-doped graphene nanofluid in a laminar flow regime

    DEFF Research Database (Denmark)

    Mehrali, Mohammad; Sadeghinezhad, Emad; Rosen, Marc A.

    2016-01-01

    Nitrogen-doped graphene (NDG) nanofluids are prepared using a two-step method in an aqueous solution of 0.025. wt% Triton X-100 as a surfactant with various nanosheets at several concentrations (0.01, 0.02, 0.04, 0.06. wt%). The results are reported of experiments on the thermal conductivity...

  7. Synthesis of TOPO-capped Nanocrystals of Copper Sulphide from a ...

    African Journals Online (AJOL)

    hexyl)sulphosuccinate sodium salt.6 In all reports except in the case of aqueous sols, the particles have been poorly character- ized. Haram et al.7 reported the synthesis of copper sulphide nanoparticles by reacting a copper ammonia complex with an equimolar thiourea solution in Triton-X 100 water-in-oil microemulsions.

  8. Enhanced sensitivity of Cypridina luciferin analog (CLA) chemiluminescence for the detection of O2- with non ionic detergents

    NARCIS (Netherlands)

    Osman, A.M.; Laane, C.; Hilhorst, R.

    2000-01-01

    Superoxide anion-triggered chemiluminescence of Cypridina luciferin analogue (CLA), 2-methyl-6-phenyl-3,7-dohydroimidazo[1,2-]pyrazin-3-one, is enhanced by non-ionic detergents such as Tween 20, Triton X-100 and Tween 80. At the concentration of 0.6øv/v) the largest increase (2.7-fold) of CLA light

  9. Detergent-Mediated Reconstitution of Membrane Proteins

    NARCIS (Netherlands)

    Knol, J; Sjollema, K.A; Poolman, B.

    1998-01-01

    The efficiency of reconstitution of the lactose transport protein (LacS) of Streptococcus thermophilus is markedly higher with Triton X-100 than with other detergents commonly employed to mediate the membrane insertion. To rationalize these differences, the lipid/detergent structures that are formed

  10. Characterization of reconstituted partially purified glycerophosphate acyltransferase from Escherichia coli

    NARCIS (Netherlands)

    Kessels, J.M.M.; Bosch, H. van den

    1982-01-01

    A modification of the method of Snider and Kennedy (J. Bacteriol. (1977) 130, 1072–1083) was worked out to solubilize sn-glycero-3-phosphate acyltransferase from whole cells by Triton X-100. The solubilized preparation was used for a systematic study of the reconstitution of enzymatic activity as

  11. Potential role for MATER in cytoplasmic lattice formation in murine oocytes.

    Directory of Open Access Journals (Sweden)

    Boram Kim

    2010-09-01

    Full Text Available Mater and Padi6 are maternal effect genes that are first expressed during oocyte growth and are required for embryonic development beyond the two-cell stage in the mouse. We have recently found that PADI6 localizes to, and is required for the formation of, abundant fibrillar Triton X-100 (Triton insoluble structures termed the oocyte cytoplasmic lattices (CPLs. Given their similar expression profiles and mutant mouse phenotypes, we have been testing the hypothesis that MATER also plays a role in CPL formation and/or function.Herein, we show that PADI6 and MATER co-localize throughout the oocyte cytoplasm following Triton extraction, suggesting that MATER co-localizes with PADI6 at the CPLs. Additionally, the solubility of PADI6 was dramatically increased in Mater(tm/tm oocytes following Triton extraction, suggesting that MATER is involved in CPL nucleation. This prediction is supported by transmission electron microscopic analysis of Mater(+/+ and Mater(tm/tm germinal vesicle stage oocytes which illustrated that volume fraction of CPLs was reduced by 90% in Mater(tm/tm oocytes compared to Mater(+/+ oocytes.Taken together, these results suggest that, similar to PADI6, MATER is also required for CPL formation. Given that PADI6 and MATER are essential for female fertility, these results not only strengthen the hypothesis that the lattices play a critical role in mediating events during the oocyte-to-embryo transition but also increase our understanding of the molecular nature of the CPLs.

  12. Identification and localization of a soluble antigen, Ag2, of 136 kDa from Plasmodium falciparum in vitro cultures

    DEFF Research Database (Denmark)

    Jakobsen, P H; Grellier, P; Theander, T G

    1991-01-01

    as a duplet with molecular masses of 136 and 120 kDa when tested by immunoblotting. Immunoprecipitation experiments on Triton X-100 extracted antigens from synchronized cultures showed that the antigen was synthesized in the schizont stage. Ag2 was located near the surface of schizonts in the parasitophorous...

  13. The lateral distribution of intramembrane particles in the erythrocyte membrane and recombinant vesicles

    NARCIS (Netherlands)

    Gerritsen, A.; Verkleij, A.J.; Deenen, L.L.M. van

    1979-01-01

    Triton X-100 (in concentrations which did not cause a significant solubilization of membrane material) caused aggregation of the intramembrane particles of human erythrocyte ghosts. Ghosts from which the extrinsic proteins had been removed by alkali treatment showed a temperature-induced

  14. Targeting Histone Abnormality in Triple Negative Breast Cancer

    Science.gov (United States)

    2016-08-01

    of Investigative Dermatology ♦Translational Oncology Book chapters: ♦ Handbook of Epigenetics, Second Edition, Elsevier 4. Editorial Boards 2011...Cells were collected and fixed with 70% ethanol. The cell pellet was then treated with 1% TritonX-100. Cells were subsequently resuspended in 50 μg/ml

  15. Solubilization and partial characterization of a microsomal high affinity GTPase

    International Nuclear Information System (INIS)

    Nicchitta, C.; Williamson, J.R.

    1987-01-01

    Isolated rat liver microsomes release sequestered Ca 2+ following addition of GTP. In contrast to permeabilized cells, GTP dependent microsomal Ca 2+ release requires low concentrations of polyethylene glycol (PEG). They have identified a microsomal, PEG-sensitive high affinity GTPase which shares a number of characteristics with the GTP-dependent Ca 2+ release system. To aid in further characterization of this activity they have initiated studies on the solubilization and purification of the microsomal GTPases. When microsomes are solubilized under the following conditions (150 mM NaCl, 5 mg protein/ml, 1% Triton X-114) PEG sensitive GTPase activity selectively partitions into the detergent rich phase of the Triton X-114 extract. As observed in intact microsomal membranes the Triton X-114 soluble GTPase is maximally stimulated by 3% PEG. Half maximal stimulation is observed at 1% PEG. PEG increases the Vmax of this activity; no effects on Km were observed. The Km for GTP of the detergent soluble GTPase is 5 μM. This GTPase is sensitive to inhibition by sulfhydryl reagents. PEG-sensitive GTPase activity was completely inhibited in the presence of 25 μM p-hydroxymercuribenzoate (PHMB); half maximal inhibition was observed at 5 μM. Labeling of the Triton X-114 extract with the photosensitive compound [ 32 P] 8-azido GTP indicated the presence of two prominent GTP binding proteins of approximate molecular weights 17 and 54 kD

  16. Breakup of 42 MeV Li projectiles in the fields of C and Au nuclei ...

    Indian Academy of Sciences (India)

    Physics Department, Virginia Commonwealth University, Richmond, Virginia 23284-2000, USA. ¿. RIKEN, 2-1 Hirosawa, Wako, Saitama 351-01, Japan. Nuclear Physics Division, Bhabha Atomic Research Centre, Mumbai 400 085, India. Abstract. Inclusive cross sections of a particles and tritons from the breakup of 42 MeV ...

  17. Institutional Advancement: A Marketing Perspective. Part II: A Status Report, 1978-79.

    Science.gov (United States)

    Moriarty, Daniel F.

    This follow-up report examines the status of the recruitment and retention strategies implemented by Triton College in 1978 as part of an effort to utilize the marketing concept in identifying and meeting changing educational needs. The report first provides operational definitions for "institutional advancement,""marketing concept,""promotion,"…

  18. Effect of Surfactants on Plasmid DNA Stability and Release from ...

    African Journals Online (AJOL)

    Purpose: To evaluate the effect of surfactants on plasmid DNA during preparation and release from polylactic glycolide (PLGA) microspheres. Methods: Various surfactants, both ionic and non-ionic (Span, Tween, Triton X100, cetyltrimethylammonium bromide and sodium dodecyl sulphate), were added during the ...

  19. Untitled

    African Journals Online (AJOL)

    The bulky ferrocyphen [Dicyano-bis-(1, 10-. Phenanthroline) Iron lll complex, with significant hydrophobic character and the three surfactants, SDS. (sodium dodecylsulphate), CTAB. (cetyltrimethylammonium bromide) and Triton X-. 100 were especially selected for their overall varying hydrophobicity. Since binding in some ...

  20. Effect of surfactants on the morphology of FeSe films fabricated from ...

    Indian Academy of Sciences (India)

    All the films were prepared via similar experimental conditions (temperature, flow rate, concentration, solvent system and reactor type) except the use of three different concentrations of two different surfactants i.e., triton and span. Seven thin films were characterized with PXRD, SEM, AFM, EDS and EDS mapping.

  1. Enhanced production of pigments by addition of surfactants in submerged fermentation of Monascus purpureus H1102.

    Science.gov (United States)

    Wang, Yonghui; Zhang, Bobo; Lu, Liping; Huang, Yan; Xu, Ganrong

    2013-10-01

    The production of pigments by Monascus spp. has attracted increasing attention. Modification of the cell membrane structure by addition of surfactants has proved to be effective for the secretion of intracellular metabolites. Hence in this study the effects and underlying mechanism of surfactants on the production of pigments in submerged fermentation of Monascus purpureus H1102 were systematically investigated. Various surfactants exerted significant but different impacts on the biomass and production of pigments. The maximum production of pigment (304.3 U mL(-1) ) and highest extracellular/intracellular pigment ratio (1.46) were achieved when 15 g L(-1) Triton X-100 was added at 24 h of fermentation, corresponding to significant increases of 88.4 and 240% respectively compared with the control. Meanwhile, the concentration of citrinin (0.94 mg L(-1) ) was 20.6% lower than that of the control. A further study on the fatty acid composition of M. purpureus H1102 showed that the unsaturated/saturated fatty acid ratio and the index of unsaturated fatty acid increased significantly with the addition of Triton X-100. The addition of surfactant Triton X-100 could greatly enhance the production of pigment. It was suggested that Triton X-100 facilitated the secretion of intracellular pigment and therefore enhanced pigment production accordingly. © 2013 Society of Chemical Industry.

  2. Investigation of the $^{9}$Li + $^{2}$H $\\to ^{8}$Li + t reaction at REX-ISOLDE

    CERN Document Server

    Jeppesen, H B; Nilsson, T; Ames, F

    2006-01-01

    The one-neutron transfer reaction has been investigated in an inverse kinematics experiment by bombarding a deuterated polypropylene target with a 2.36 MeV/u $^{9}$Li beam from the post-accelerator REX-ISOLDE at CERN. Excitation energies in $^{8}$Li as well as angular distributions of the tritons were obtained and spectroscopic factors deduced.

  3. Realistic non-local potentials from inverse scattering theory for the3S1−3D1nucleon-nucleon interaction

    Directory of Open Access Journals (Sweden)

    P.H.L. Groenenboom

    1978-03-01

    Full Text Available Rank-three and -four separable3S1−3D1potentials have been constructed which reproduce the experimental phase shifts and a realistic deuteron wave function. The off-shell behaviour has been investigated and triton binding energies were calculated.

  4. Effect of surfactants on the morphology of FeSe films fabricated from ...

    Indian Academy of Sciences (India)

    ... solvent system and reactor type) except the use of three different concentrations of two different surfactants i.e., triton and span. Seven thin films were characterized with PXRD, SEM, AFM, EDS and EDS mapping. The mechanism of the interaction of surfactant with MeP2F was determined with cyclic voltammetry (CV) and ...

  5. Accelerator-based neutron source using a cold deuterium target with degenerate electrons

    Directory of Open Access Journals (Sweden)

    R. E. Phillips

    2013-07-01

    Full Text Available A neutron generator is considered in which a beam of tritons is incident on a hypothetical cold deuterium target with degenerate electrons. The energy efficiency of neutron generation is found to increase substantially with electron density. Recent reports of potential targets are discussed.

  6. Asymmetric incorporation of Na+, K+-ATPase into phospholipid vesicles

    NARCIS (Netherlands)

    Jackson, R.L.; Verkleij, A.J.; Zoelen, E.J.J. van; Lane, L.K.; Schwartz, A.; Deenen, L.L.M. van

    Purified lamb kidney Na+, K+-ATPase, consisting solely of the Mτ = 95,000 catalytic subunit and the Mτ- 44,000 glycoprotein, was solubilized with Triton X-100 and incorporated into unilamellar phospholipid vesicles. Freeze-fracture electron microscopy of the vesicles showed intramembranous particles

  7. Effect of mesoporous g-C3N4 substrate on catalytic oxidation of CO over Co3O4

    Science.gov (United States)

    Yang, Heng; Lv, Kangle; Zhu, Junjiang; Li, Qin; Tang, Dingguo; Ho, Wingkei; Li, Mei; Carabineiro, Sónia A. C.

    2017-04-01

    Mesoporous graphitic carbon nitride (mpg-CN) was synthesized using Triton X-100, a surfactant containing a hydrophilic polyethylene oxide group and a tert-octyl-phenyl hydrophobic moiety, as a soft template. The obtained mpg-CN was used as a support for Co3O4, and this supported catalyst was used for CO oxidation. The effects of the amount of Triton X-100, weight ratio of Co3O4 to mpg-CN and calcination temperature on the catalytic performances for CO oxidation of Co3O4/mpg-CN composites were systematically studied. It was found that the presence of Triton X-100 not only retarded the polymerization of dicyandiamide, but also affected the microstructure of Co3O4. Bubbles formed because of the hydrophobic group of the surfactant Triton X-100 can be act as a soft template for the synthesis of mesoporous g-C3N4. The enhanced catalytic activity of Co3O4/mpg-CN was attributed to a synergistic effect, enlarged BET surface areas, increased Co3+ and lattice oxygen contents, and the porous structure of mpg-CN support. The high stability of 12.5% Co3O4/mpg-CN(1.0) makes it a promising catalyst for practical applications.

  8. Electric dipole moments of light nuclei from {chi}EFT

    Energy Technology Data Exchange (ETDEWEB)

    Higa, Renato [Instituto de Fisica, Universidade de Sao Paulo, C.P. 66318, 05314-970, Sao Paulo, SP (Brazil)

    2013-03-25

    I present recent calculations of EDMs of light nuclei using chiral effective field theory techniques. At leading-order, we argue that they can be expressed in terms of six CP-violating low-energy constants. With our expressions, eventual non-zero measurements of EDMs of deuteron, helion, and triton can be combined to disentangle the different sources of CP-violation.

  9. Hypolipidemic Activity of Prosopis cineraria L (Druce) Fruit Extract ...

    African Journals Online (AJOL)

    Purpose: To investigate the hypolipidemic potential of the 70 % ethanol fruit extract of Prosopis cineraria (Fabaceae) (Et. PCF) in triton-induced hyperlipidemia in rats. Methods: Et-PCF was obtained by pulverizing whole dried fruits and extracting with 70 % ethanol. Adult Sprague Dawley rats were divided into six groups of ...

  10. Extracellular release of acid phosphatase from blood stream forms ...

    African Journals Online (AJOL)

    Phase separation of the extracts using the detergent Triton X-114 (TX-114), resulted in protein partitioning into aqueous and detergent phases. ACP activity was higher in the detergent phases (56.2 μmol/min and 28.8 μmol/min) of WPE and ESE respectively. ACP activity recorded in the aqueous phases of WPE and EPE ...

  11. SUSTAINED HYPERLIPEMIA INDUCED IN RABBITS BY MEANS OF INTRAVENOUSLY INJECTED SURFACE-ACTIVE AGENTS

    Science.gov (United States)

    Kellner, Aaron; Correll, James W.; Ladd, Anthony T.

    1951-01-01

    The intravenous injection of the surface-active agents Tween 80 and Triton A20 into rabbits fed a normal diet resulted in marked and sustained elevations of the cholesterol, phospholipid, and total lipid content of their blood. The increase in phospholipid in general paralleled that of the blood cholesterol. The implications of the findings are briefly discussed. PMID:14824409

  12. Hypolipidemic effect of aqueous leaf extract of carmona microphylla ...

    African Journals Online (AJOL)

    Purpose: To investigate the hypolipidemic effects of the aqueous leaf extract of Carmona microphylla (Lam.) G. Don. (CAE) in vitro and in vivo. Methods: The lipid-lowering effect of CAE was investigated in oleic acid (OA)-induced steatosis in HepG2 liver cells, as well as in high-fat diet (HFD)- and triton WR-1339 ...

  13. OceanSITES PIRATA daily in-situ data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This file contains daily real-time and delayed-mode in-situ data from one of the Tropical Atmosphere/Ocean (TAO)/TRITON, Pilot Research Moored Array in the Tropical...

  14. Association of vinculin to the platelet cytoskeleton during thrombin-induced aggregation

    NARCIS (Netherlands)

    Asyee, G. M.; Sturk, A.; Muszbek, L.

    1987-01-01

    Vinculin is a protein generally believed to be involved in membrane-cytoskeleton interaction, and its presence in platelets has been verified earlier. Here we show that in resting bovine platelets, vinculin is not associated with the Triton-insoluble cytoskeletal fraction but becomes incorporated

  15. Nonequivalence of alpha-bungarotoxin binding sites in the native nicotinic receptor molecule

    International Nuclear Information System (INIS)

    Conti-Tronconi, B.M.; Tang, F.; Walgrave, S.; Gallagher, W.

    1990-01-01

    In the native, membrane-bound form of the nicotinic acetylcholine receptor (M-AcChR) the two sites for the cholinergic antagonist alpha-bungarotoxin (alpha-BGT) have different binding properties. One site has high affinity, and the M-AcChR/alpha-BGT complexes thus formed dissociate very slowly, similar to the complexes formed with detergent-solubilized AcChR (S-AcChR). The second site has much lower affinity (KD approximately 59 +/- 35 nM) and forms quickly reversible complexes. The nondenaturing detergent Triton X-100 is known to solubilize the AcChR in a form unable, upon binding of cholinergic ligands, to open the ion channel and to become desensitized. Solubilization of the AcChR in Triton X-100 affects the binding properties of this second site and converts it to a high-affinity, slowly reversible site. Prolonged incubation of M-AcChR at 4 degrees C converts the low-affinity site to a high-affinity site similar to those observed in the presence of Triton X-100. Although the two sites have similar properties when the AcChR is solubilized in Triton X-100, their nonequivalence can be demonstrated by the effect on alpha-BGT binding of concanavalin A, which strongly reduces the association rate of one site only. The Bmax of alpha-BGT to either Triton-solubilized AcChR or M-AcChR is not affected by the presence of concanavalin A. Occupancy of the high-affinity, slowly reversible site in M-AcChR inhibits the Triton X-100 induced conversion to irreversibility of the second site. At difference with alpha-BGT, the long alpha-neurotoxin from Naja naja siamensis venom (alpha-NTX) binds with high affinity and in a very slowly reversible fashion to two sites in the M-AcChR. We confirm here that Triton-solubilized AcChR or M-AcChR binds in a very slowly reversible fashion the same amount of alpha-NTX

  16. Slowing down of alpha particles in ICF DT plasmas

    Science.gov (United States)

    He, Bin; Wang, Zhi-Gang; Wang, Jian-Guo

    2018-01-01

    With the effects of the projectile recoil and plasma polarization considered, the slowing down of 3.54 MeV alpha particles is studied in inertial confinement fusion DT plasmas within the plasma density range from 1024 to 1026 cm-3 and the temperature range from 100 eV to 200 keV. It includes the rate of the energy change and range of the projectile, and the partition fraction of its energy deposition to the deuteron and triton. The comparison with other models is made and the reason for their difference is explored. It is found that the plasmas will not be heated by the alpha particle in its slowing down the process once the projectile energy becomes close to or less than the temperature of the electron or the deuteron and triton in the plasmas. This leads to less energy deposition to the deuteron and triton than that if the recoil of the projectile is neglected when the temperature is close to or higher than 100 keV. Our model is found to be able to provide relevant, reliable data in the large range of the density and temperature mentioned above, even if the density is around 1026 cm-3 while the deuteron and triton temperature is below 500 eV. Meanwhile, the two important models [Phys. Rev. 126, 1 (1962) and Phys. Rev. E 86, 016406 (2012)] are found not to work in this case. Some unreliable data are found in the last model, which include the range of alpha particles and the electron-ion energy partition fraction when the electron is much hotter than the deuteron and triton in the plasmas.

  17. Rhodococcus erythropolis ATCC 25544 as a suitable source of cholesterol oxidase: cell-linked and extracellular enzyme synthesis, purification and concentration

    Directory of Open Access Journals (Sweden)

    García-Carmona Francisco F

    2002-03-01

    Full Text Available Abstract Background The suitability of the strain Rhodococcus erythropolis ATCC 25544 grown in a two-liter fermentor as a source of cholesterol oxidase has been investigated. The strain produces both cell-linked and extracellular cholesterol oxidase in a high amount, that can be extracted, purified and concentrated by using the detergent Triton X-114. Results A spray-dry method of preparation of the enzyme inducer cholesterol in Tween 20 was found to be superior in both convenience and enzyme synthesis yield to one of heat-mixing. Both were similar as far as biomass yield is concerned. Cell-linked cholesterol oxidase was extracted with Triton X-114, and this detergent was also used for purification and concentration, following temperature-induced detergent phase separation. Triton X-114 was utilized to purify and to concentrate the cell-linked and the extracellular enzyme. Cholesterol oxidase was found mainly in the resulting detergent-rich phase. When Triton X-114 concentration was set to 6% w/v the extracellular, but not the cell-extracted enzyme, underwent a 3.4-fold activation after the phase separation process. This result is interpreted in the light of interconvertible forms of the enzyme that do not seem to be in equilibrium. Fermentation yielded 360 U/ml (672 U/ml after activation, 36% of which was extracellular (65% after activation. The Triton X-114 phase separation step yielded 11.6-fold purification and 20.3-fold concentration. Conclusions The results of this work may make attractive and cost-effective the implementation of this bacterial strain and this detergent in a purification-based industrial production scheme of commercial cholesterol oxidase.

  18. Two-nucleon transfer reactions with form factor models

    International Nuclear Information System (INIS)

    Osman, A.

    1980-04-01

    The theory of two-nucleon transfer reactions is considered. Nuclear reactions are considered with triton or 3 He particles which are used as projectiles in stripping reactions and as detected particles in pick-up reactions. In each channel we have a four-particle problem, three of them are nucleons and the fourth is a heavy particle. These transfer reactions are studied on the basis of the generaled R-matrix method. Different channel functions of the sub-clusters in the triton and 3 He particles are included. Model form factors are obtained and are used in two-nucleon transfer reactions. Differential cross-sections of different two-nucleon transfer reactions are calculated and are found in good agreement with the experimental data. The correct normalization and spectroscopic factors are obtained. (author)

  19. Real-time three-dimensional imaging of epidermal splitting and removal by high-definition optical coherence tomography

    DEFF Research Database (Denmark)

    Boone, Marc; Draye, Jean Pierre; Verween, Gunther

    2014-01-01

    and decellularization. Human skin samples were incubated with four different agents: Dispase II, NaCl 1 M, sodium dodecyl sulphate (SDS) and Triton X-100. Epidermal splitting, dermo-epidermal junction, acellularity and 3-D architecture of dermal matrices were evaluated by High-definition optical coherence tomography...... of the lamina densa with dispase II and above the lamina densa (in the lamina lucida) with NaCl. The 3-D architecture of dermal papillae and dermis was more affected by Dispase II on HD-OCT which corresponded with histopathologic (orcein staining) fragmentation of elastic fibres. With SDS treatment......, the epidermal removal was incomplete as remnants of the epidermal basal cell layer remained attached to the basement membrane on the dermis. With Triton X-100 treatment, the epidermis was not removed. In conclusion, HD-OCT imaging permits real-time 3-D visualization of the impact of selected agents on human...

  20. Optimizing Perfusion-Decellularization Methods of Porcine Livers for Clinical-Scale Whole-Organ Bioengineering

    Directory of Open Access Journals (Sweden)

    Qiong Wu

    2015-01-01

    Full Text Available Aim. To refine the decellularization protocol of whole porcine liver, which holds great promise for liver tissue engineering. Methods. Three decellularization methods for porcine livers (1% sodium dodecyl sulfate (SDS, 1% Triton X-100 + 1% sodium dodecyl sulfate, and 1% sodium deoxycholate + 1% sodium dodecyl sulfate were studied. The obtained liver scaffolds were processed for histology, residual cellular content analysis, and extracellular matrix (ECM components evaluation to investigate decellularization efficiency and ECM preservation. Rat primary hepatocytes were seeded into three kinds of scaffold to detect the biocompatibility. Results. The whole liver decellularization was successfully achieved following all three kinds of treatment. SDS combined with Triton had a high efficacy of cellular removal and caused minimal disruption of essential ECM components; it was also the most biocompatible procedure for primary hepatocytes. Conclusion. We have refined a novel, standardized, time-efficient, and reproducible protocol for the decellularization of whole liver which can be further adapted to liver tissue engineering.

  1. Status and verification strategy for ITER neutronics

    Energy Technology Data Exchange (ETDEWEB)

    Loughlin, Michael, E-mail: michael.loughlin@iter.org [ITER Organization, Route de Vinon sur Verdon, 13115 Saint Paul Lez Durance (France); Angelone, Maurizio [Associazione EURATOM-ENEA Sulla Fusione, Via E. Fermi 45, I-00044 Frascati, Roma (Italy); Batistoni, Paola [Associazione EURATOM-ENEA Sulla Fusione, Via E. Fermi 45, I-00044 Frascati, Roma (Italy); JET-EFDA, Culham Science Centre, Abingdon OX14 3DB (United Kingdom); Bertalot, Luciano [ITER Organization, Route de Vinon sur Verdon, 13115 Saint Paul Lez Durance (France); Eskhult, Jonas [Studsvik Nuclear AB, SE-611 Nyköping (Sweden); Konno, Chikara [Japan Atomic Energy Agency Tokai-mura, Naka-gun, Ibaraki-ken 319-1195 (Japan); Pampin, Raul [F4E Fusion for Energy, Josep Pla 2, Torres Diagonal Litoral B3, Barcelona 08019 (Spain); Polevoi, Alexei; Polunovskiy, Eduard [ITER Organization, Route de Vinon sur Verdon, 13115 Saint Paul Lez Durance (France)

    2014-10-15

    The paper summarizes the current status of neutronics at ITER and a first set of proposals for experimental programmes to be conducted in the early operational life-time of ITER are described for the more crucial areas. These include a TF coils heating benchmark, a streaming benchmark and streaming measurements by activation on ITER itself. Also on ITER the measurement of activated water from triton burn-up should be planned and performed. This will require the measurement of triton burn-up in DD phase. Measurements of neutron flux in the tokamak building during DD operations should also be carried out. The use of JET for verification of shut down dose rate estimates is desirable. Other facilities to examine the production and behaviour of activated corrosion products and the shielding properties of concretes to high energy (6 MeV) gamma-rays are recommended.

  2. Graphite furnace atomic absorption spectrometric determination of vanadium after cloud point extraction in the presence of graphene oxide

    Science.gov (United States)

    López-García, Ignacio; Marín-Hernández, Juan José; Hernández-Córdoba, Manuel

    2018-05-01

    Vanadium (V) and vanadium (IV) in the presence of a small concentration of graphene oxide (0.05 mg mL-1) are quantitatively transferred to the coacervate obtained with Triton X-114 in a cloud point microextraction process. The surfactant-rich phase is directly injected into the graphite atomizer of an atomic absorption spectrometer. Using a 10-mL aliquot sample and 150 μL of a 15% Triton X-114 solution, the enrichment factor for the analyte is 103, which results in a detection limit of 0.02 μg L-1 vanadium. The separation of V(V) and V(IV) using an ion-exchanger allows speciation of the element at low concentrations. Data for seven reference water samples with certified vanadium contents confirm the reliability of the procedure. Several beer samples are also analyzed, those supplied as canned drinks showing low levels of tetravalent vanadium.

  3. Effect of surfactants on the spectrofluorimetric properties of zearalenone

    International Nuclear Information System (INIS)

    Appell, Michael; Bosma, Wayne B.

    2011-01-01

    The chemiluminescent properties of the estrogenic mycotoxin zearalenone in the presence of aqueous micellar media were investigated using steady state fluorescence techniques. Micelles of surfactants sodium dodecyl sulfate (SDS), hexadecyltrimethylammonium bromide (CTAB), and non-ionic Triton X-100 enhanced the fluorescence intensity of zearalenone in aqueous solutions. The binding constants have been determined and indicate zearalenone has the highest affinity for Triton X-100, followed by CTAB, and then by SDS. The encapsulation of zearalenone by the micelles studied is spontaneous and exothermic. The selective microenvironments provided by organized micellar systems offer an attractive medium to modulate fluorescence detection of zearalenone. - Highlights: → Surfactants can selectively modulate the fluorescence detection of zearalenone. → Binding studies provide information on the zearalenone-surfactant interactions. → Fluorescence intensity of zearalenone is related to the micelle microenvironment.

  4. Effects of different additives on bimetallic Au-Pt nanoparticles electrodeposited onto indium tin oxide electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Ballarin, Barbara, E-mail: ballarin@ms.fci.unibo.i [Dipartimento di Chimica Fisica ed Inorganica, Universita di Bologna, V.le Risorgimento, 4, 40136-Bologna (Italy)] [INSTM, UdR Bologna (Italy); Gazzano, Massimo [ISOF-CNR, V. Selmi, 40126-Bologna (Italy); Tonelli, Domenica [Dipartimento di Chimica Fisica ed Inorganica, Universita di Bologna, V.le Risorgimento, 4, 40136-Bologna (Italy)] [INSTM, UdR Bologna (Italy)

    2010-09-01

    Bimetallic Au-Pt nanoparticles (Au-Pt{sub NPs}) have been synthesized using an electrochemical reduction approach. The effects of the addition of different additives in the electrodeposition bath namely KI, 1-nonanesulfonic acid sodium salt and Triton X-100 have been investigated. The structural characterization of the bimetallic nanoparticles has been carried out using scanning electron microscopy (SEM), energy-dispersive X-ray spectroscopy (EDS), UV-vis spectroscopy, X-ray diffraction (XRD) and cyclic voltammetry (CV). The Au-Pt{sub NPs} prepared in the presence of KI and Triton X-100 characterized by a relatively narrow size distribution as well as a higher particle density and surface coverage whereas no changes in the morphology were observed. These results suggest a dependence of the size and distribution of the bimetallic nanoparticles from the type and concentration of the additives employed.

  5. CONSTRUCTION SENSITIVITY IN PINGYAO TONE SANDHI

    Directory of Open Access Journals (Sweden)

    Hui-shan Lin

    2012-06-01

    Full Text Available This paper investigates tone sandhi phenomena in Pingyao, a Jin dialect spoken in Shanxi province in China. Pingyao tone sandhi is special in that tone sandhi in bi-syllabic strings is construction sensitive, but tone sandhi in tri-syllabic strings is not fully conditioned by construction types. Based on Optimality Theory (OT, this paper proposes analyses for bi-tonal and tri-tonal sandhi in Pingyao. We show that while bi-tonal sandhi can be accounted for by assuming that there are different grammars associated with different construction types, the lack of construction sensitivity in certain tri-syllabic strings suggests that the association between construction types and phonological grammars can be sacrificed to comply with a higher demand. In Pingyao, the higher demand is to avoid having a tri-tonal string with marked tone sandhi domain from being associated with conflicting grammars.

  6. Exploring incomplete fusion fraction in 6,7Li induced nuclear reactions

    Directory of Open Access Journals (Sweden)

    Parkar V. V.

    2017-01-01

    Full Text Available We have included breakup effects explicitly to simultaneously calculate the measured cross-sections of the complete fusion, incomplete fusion, and total fusion for 6,7Li projectiles on various targets using the Continuum Discretized Coupled Channels method. The breakup absorption cross-sections obtained with different choices of short range imaginary potentials are utilized to evaluate the individual α-capture and d/t-capture cross-sections and compare with the measured data. It is interesting to note, while in case of 7Li projectile the cross-sections for triton-ICF/triton-capture is far more dominant than α-ICF/α-capture at all energies, similar behavior is not observed in case of 6Li projectile for the deuteron-ICF/deuteron-capture and α-ICF/α-capture. Both these observations are also corroborated by the experimental data for all the systems studied.

  7. Effect of 60Co γ-ray irradiation on cytoskeleton of human peripheral blood monocytes with whole mount cell electron microscopy in vitro

    International Nuclear Information System (INIS)

    Chen Xiaomei; Guo Yuhua; Yin Zhiwei

    1992-01-01

    Whole mount cell electron microscopy was used in combination with selective extraction to prepare cytoskeletal framework. Cytoskeleton prepared by Triton X-100 treatment of human peripheral blood monocytes appeared on electron microscopy as a highly organized and interconnected three-dimensional matrix of different fibrous elements. By three-dimensional visualization of Triton X-100 resistant cytoskeletons it was demonstrated that different doses of 60 Co γ-rays caused distinctive and reproducible alterations of the cytoskeleton of intact human peripheral blood monocytes in vitro. The alterations were similar to those caused by cytochalasin B and by colchicine. From these observations and other workers'studies, it is presumed that 60 Co γ-ray irradiation may inhibit cytoplasmic microtubule and microfilament assembling

  8. Enhancing enzymatic hydrolysis of coconut husk through Pseudomonas aeruginosa AP 029/GLVIIA rhamnolipid preparation.

    Science.gov (United States)

    de Araújo, Cynthia Kérzia Costa; de Oliveira Campos, Alan; de Araújo Padilha, Carlos Eduardo; de Sousa Júnior, Francisco Canindé; do Nascimento, Ruthinéia Jéssica Alves; de Macedo, Gorete Ribeiro; Dos Santos, Everaldo Silvino

    2017-08-01

    This work investigated the influence of chemical (Triton X-100) and biological surfactant preparation (rhamnolipids) in coconut husk hydrolysis that was subjected to pretreatment with acid-alkali or alkaline hydrogen peroxide. The natural and pretreated biomass was characterized using the National Renewable Energy Laboratory protocol analysis as well as X-ray diffraction and scanning electron microscopy. The results demonstrated that in terms of the total reducing sugars, there was no significant difference between the hydrolysis using Triton X-100 and rhamnolipids, regardless of the pretreatment. A cellulosic conversion value as high as 33.0% was obtained in experiments with rhamnolipids. The coconut husk was observed to be a potential biomass that could produce second generation ethanol, and the rhamnolipid preparation can be used to support for the enzymatic hydrolysis, enhancing the advantage of cellulose conversion into glucose over chemical surfactants because it is an environmentally friendly approach. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Spectroscopic Behavior of Some A3B Type Tetrapyrrolic Complexes in Several Organic Solvents and Micellar Media

    Directory of Open Access Journals (Sweden)

    Radu Socoteanu

    2011-08-01

    Full Text Available The paper presents spectral studies of some unsymmetrical A3B tetrapyrrolic, porphyrin-type complexes with Cu(II and Zn(II in different solvents and micellar media aimed at estimating their properties in connection with the living cell. The results indicate that the position of the absorption and emission peaks is mostly influenced by the central metal ion and less by the environmental polarity or the peripheric substituents of the porphyrinic core. The comparison between the overall absorption and emission spectra of the compounds in methanol or cyclohexane vs. direct and reverse Triton X micellar systems, respectively, suggests for all compounds the localization at the interface between the polyethylene oxide chains and the tert-octyl-phenyl etheric residue of the Triton X-100 molecules. These findings could be important when testing the compounds embedded in liposomes or other delivery systems to the targeted cell.

  10. Autodegradation of 125I-labeled human epidermal cell surface proteins

    International Nuclear Information System (INIS)

    Hashimoto, K.; Singer, K.H.; Lazarus, G.S.

    1982-01-01

    Triton X-100 extracts of cultured human epidermal cells exhibited proteolytic activity as measured by the hydrolysis of [ 3 H]-casein at neutral pH. The majority of endogenous proteolytic activity was inhibited by parahydroxy mercuribenzoate and by mersalyl acid, indicating the enzyme(s) was a thiol class proteinase(s). Crude Triton X-100 extracts were prepared from epidermal cells following labeling of proteins with 125 I. Autodegradation of labeled proteins at 37 degrees C was detected as early as 1 hr and reached a plateau level by 4 hr. Degradation was inhibited by thiol class proteinase inhibitors. Among the detergent-solubilized radiolabeled proteins a polypeptide chain of Mr 155,000 was particularly sensitive to degradation by endogenous thiol proteinase(s)

  11. Characterization of the gamma-aminobutyric acid receptor system in human brain gliomas

    International Nuclear Information System (INIS)

    Frattola, L.; Ferrarese, C.; Canal, N.; Gaini, S.M.; Galluso, R.; Piolti, R.; Trabucchi, M.

    1985-01-01

    The properties of [ 3 H]-gamma-aminobutyric acid [( 3 H]GABA) binding were studied in biopsied specimens from normal human brain and from 18 cases of human brain gliomas, made up of 6 astrocytomas, 6 glioblastomas, 3 oligodendrogliomas, and 3 medulloblastomas. In fresh membranes obtained from normal gray and white matter one population of Na+-dependent GABA receptors was observed, while in the frozen Triton X-100-treated membranes two distinct populations of Na+-independent binding sites were detected. Specific GABA binding sites in brain gliomas were shown only in frozen Triton X-100-treated membranes. As in normal tissue, these receptors are Na+-independent and bind [ 3 H]GABA with two distinct affinity components. The biochemical profiles of [ 3 H]GABA binding to membranes obtained from different tumors of glial origin are quite similar and cannot be related to the degree of malignancy of the neoplasia

  12. Bubble-size distributions produced by wall injection of air into flowing freshwater, saltwater and surfactant solutions

    Science.gov (United States)

    Winkel, Eric S.; Ceccio, Steven L.; Dowling, David R.; Perlin, Marc

    2004-12-01

    As air is injected into a flowing liquid, the resultant bubble characteristics depend on the properties of the injector, near-wall flow, and flowing liquid. Previous research has shown that near-wall bubbles can significantly reduce skin-friction drag. Air was injected into the turbulent boundary layer on a test section wall of a water tunnel containing various concentrations of salt and surfactant (Triton-X-100, Union Carbide). Photographic records show that the mean bubble diameter decreased monotonically with increasing salt and surfactant concentrations. Here, 33 ppt saltwater bubbles had one quarter, and 20 ppm Triton-X-100 bubbles had one half of the mean diameter of freshwater bubbles.

  13. Complementary experimental-simulational study of surfactant micellar phase in the extraction process of metallic ions: Effects of temperature and salt concentration

    Science.gov (United States)

    Soto-Ángeles, Alan Gustavo; Rodríguez-Hidalgo, María del Rosario; Soto-Figueroa, César; Vicente, Luis

    2018-02-01

    The thermoresponsive micellar phase behaviour that exhibits the Triton-X-100 micelles by temperature effect and addition of salt in the extraction process of metallic ions was explored from mesoscopic and experimental points. In the theoretical study, we analyse the formation of Triton-X-100 micelles, load and stabilization of dithizone molecules and metallic ions extraction inside the micellar core at room temperature; finally, a thermal analysis is presented. In the experimental study, the spectrophotometric outcomes confirm the solubility of the copper-dithizone complex in the micellar core, as well as the extraction of metallic ions of aqueous environment via a cloud-point at 332.2 K. The micellar solutions with salt present a low absorbance value compared with the micellar solutions without salt. The decrease in the absorbance value is attributed to a change in the size of hydrophobic region of colloidal micelles. All transitory stages of extraction process are discussed and analysed in this document.

  14. Effects of Functionalized Graphene Nanoplatelets on the Morphology and Properties of Phenolic Resins

    Directory of Open Access Journals (Sweden)

    Jing Dai

    2016-01-01

    Full Text Available Graphene nanoplatelets (Gnps were covalently functionalized by 3-aminopropyltriethoxysilane (KH550 and noncovalently functionalized by Triton X-100, respectively. The morphology and structure of KH550 modified graphene (K-Gnp and Triton X-100 modified graphene (T-Gnp were characterized by Fourier transform infrared spectroscopy, scanning electron micrograph, and Raman spectrometer. The influences of K-Gnp and T-Gnp on thermal conductivity, fracture toughness, and thermal stability of the boron phenolic resin (BPR were investigated. Both covalently functionalized K-Gnp and noncovalently functionalized T-Gnp not only improve the dispersion of Gnp in the polymer matrix but also increase interfacial bonding strength between the BPR matrix and Gnp, thus leading to the enhanced mechanical property and thermal stability of nanocomposites. Besides this, mechanical property and thermal stability of the BPR containing K-Gnp are superior to those of BPR containing T-Gnp.

  15. Exploring incomplete fusion fraction in 6,7Li induced nuclear reactions

    Science.gov (United States)

    Parkar, V. V.; Jha, V.; Kailas, S.

    2017-11-01

    We have included breakup effects explicitly to simultaneously calculate the measured cross-sections of the complete fusion, incomplete fusion, and total fusion for 6,7Li projectiles on various targets using the Continuum Discretized Coupled Channels method. The breakup absorption cross-sections obtained with different choices of short range imaginary potentials are utilized to evaluate the individual α-capture and d/t-capture cross-sections and compare with the measured data. It is interesting to note, while in case of 7Li projectile the cross-sections for triton-ICF/triton-capture is far more dominant than α-ICF/α-capture at all energies, similar behavior is not observed in case of 6Li projectile for the deuteron-ICF/deuteron-capture and α-ICF/α-capture. Both these observations are also corroborated by the experimental data for all the systems studied.

  16. [Removal of oral Prevotella intermedia Endotoxin by octyl phenyl polyoxyethylene ether extraction method].

    Science.gov (United States)

    Wang, Ai-wu; Liu, Yan; Hu, Kong-xin; Cheng, Qian

    2012-12-01

    To investigate an effective purification method for removing endotoxin from Prevotella intermedia. The main protein ingredients of bacteria prepared from ammonium sulfate precipitation were further treated with octyl phenyl polyoxyethylene ether (Triton X-114), and then processed at 4°C, 37°C and 25°C. The obtained aqueous phase after at least two more cycle repeated operations was assayed for endotoxin by Western blotting, LAL-clotting method, in vitro cell stimulation and in vivo animal experiments. Western blotting and LAL-clotting method demonstrated that the reduction in endotoxin level was greater than 99.99% and recovery of the proteins after endotoxin removal was greater than 90% with Triton X-114 treatment for 3 cycles. The cytokines expression level was lower in both in vitro cell stimulation and in vivo animal experiments than in untreated group (P Prevotella intermedia.

  17. Photoproduction of hydrogen by membranes of green photosynthetic bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Bernstein, J D; Olson, J M

    1980-01-01

    Photoproduction of H/sub 2/ from ascorbate by unit-membrane vesicles from Chlorobium limicola f. thiosulfatophilum was achieved with a system containing gramicidin D, tetramethyl-p-phenylenediamine, methyl viologen, dithioerythritol, Clostridium hydrogenase, and an oxygen-scavenging mixture of glucose, glucose oxidase, ethanol, and catalase. Maximum quantum yield was less than one percent. Half maximum rate of H/sub 2/ production occurred at a white-light intensity of approximately 0.15 cm/sup -2/. The reaction was inhibited completely by 0.3% sodium dodecylbenzene sulfonate, 1% Triton X-100, or preheating the vesicles at 100/sup 0/C for 5 minutes. Low concentrations (0.01 and 0.05%) of Triton X-100 about doubled the reaction rate.

  18. Surfactant-enhanced remediation of a trichloroethene-contaminated aquifer. 2. Transport of TCE

    Science.gov (United States)

    Sahoo, D.; Smith, J.A.; Imbrigiotta, T.E.; Mclellan, H.M.

    1998-01-01

    Field studies were conducted under an induced gradient in a trichloroethene (TCE)-contaminated aquifer at Picatinny Arsenal, NJ, to study (a) the rate-limited desorption of TCE from aquifer sediments to water and (b) the effect of a surfactant (Triton X-100) on the desorption and transport of TCE. Clean water was injected into the contaminated aquifer for 206 day. Triton X-100 was added for a 36-day period (days 36-71 from the start of clean water injection). The effect of Triton X-100 on the desorption and transport of TCE in the field was examined by observing the concentrations of these two solutes in four monitoring wells 3-9 m from the injection wells. These data show a small but discernible increase in the TCE concentration in two of the wells corresponding approximately to the time when surfactant reaches the wells; in the other two monitoring wells, the increase in TCE concentration is negligible. A solute transport model that assumes local sorption equilibrium and used a laboratory-derived distribution coefficient could not adequately describe TCE desorption and transport observed in the aquifer. Two model formulations that accounted for rate-limited sorption - two-site and multisite models - fit the data well. TCE concentrations after surfactant injection were underpredicted by the models unless mass transfer rate was increased to account for the effect of surfactant on the rate of TCE desorption. The concentration data from the two wells and the model analysis suggest that the rate of TCE desorption is increased (by approximately 30%) as a result of Triton X-100 injection.Field studies were conducted under an induced gradient in a trichloroethene (TCE)-contaminated aquifer at Picatinny Arsenal, NJ, to study (a) the rate-limited desorption of TCE from aquifer sediments to water and (b) the effect of a surfactant (Triton X-100) on the desorption and transport of TCE. Clean water was injected into the contaminated aquifer for 206 day. Triton X-100 was added

  19. Carbonate platform growth and demise offshore Central Vietnam

    DEFF Research Database (Denmark)

    Fyhn, Michael B.W.; Boldreel, Lars Ole; Nielsen, Lars H.

    2013-01-01

    Miocene carbonate platforms cover a large part of the Central Vietnamese South China Sea margin. Early carbonate deposition took place on two regional platforms separated by a narrow depression developed along the trace of the East Vietnam Boundary Fault Zone. West of the East Vietnam Boundary...... Fault Zone, the Tuy Hoa Carbonate Platform fringes the continental margin between Da Nang and Nha Trang. Here, platform growth initiated during the Early Miocene and continued until Middle Miocene time when regional uplift led to subaerial exposure, termination of platform growth and karstification....... East of the fault zone, the Triton Carbonate Platform was also initiated during the Early Miocene. Carbonate growth thrived during Early and part of Middle Miocene time and a thick, clean Lower and Middle Miocene carbonate succession cover the Triton Horst and the Qui Nhon Ridge. During the Middle...

  20. A pre-validation trial - testing genotoxicity of several chemicals using standard, medium- and high-throughput comet formats.

    Directory of Open Access Journals (Sweden)

    Kristine Bjerve Gutzkow

    2015-06-01

    Results obtained with the three systems (standard, medium- and high-throughput were essentially the same. The 96-minigel format was analysed with the fully automated scoring system IMSTAR and comparable results were achieved with the semi-automated scoring system from Perceptives. The known genotoxic chemicals MNU, B(aP, 4-NQO and cyclophosphamide showed little consistent sign of genotoxicity at concentrations causing limited cytotoxicity. D-mannitol and Triton X-100 were, as expected, non-genotoxic (though Triton X-100, at high concentrations, caused DNA breaks as an apparent secondary effect of cytotoxicity. Etoposide and bleomycin gave significant increase in DNA strand break at borderline cytotoxic concentrations. The limitation of the assay to detect damaged bases by known genotoxins may be overcome by incorporating a DNA repair enzyme, such as formamidopyrimidine-DNA-glycosylase (FPG, to convert damaged bases into breaks as shown by Azqueta A et al., Mutagenesis vol. 28 no. 3 pp. 271–277, 2013 .