WorldWideScience

Sample records for transporter slc6a18 xt2

  1. Variants in SLC18A3, vesicular acetylcholine transporter, cause congenital myasthenic syndrome

    NARCIS (Netherlands)

    O'Grady, Gina L.; Verschuuren, Corien; Yuen, Michaela; Webster, Richard; Menezes, Manoj; Fock, Johanna M.; Pride, Natalie; Best, Heather A.; Damm, Tatiana Benavides; Turner, Christian; Lek, Monkol; Engel, Andrew G.; North, Kathryn N.; Clarke, Nigel F.; MacArthur, Daniel G.; Kamsteeg, Erik-Jan; Cooper, Sandra T.

    2016-01-01

    Objective: To describe the clinical and genetic characteristics of presynaptic congenital myasthenic syndrome secondary to biallelic variants in SLC18A3. Methods: Individuals from 2 families were identified with biallelic variants in SLC18A3, the gene encoding the vesicular acetylcholine transporter

  2. SLC37A1 and SLC37A2 are phosphate-linked, glucose-6-phosphate antiporters.

    Directory of Open Access Journals (Sweden)

    Chi-Jiunn Pan

    Full Text Available Blood glucose homeostasis between meals depends upon production of glucose within the endoplasmic reticulum (ER of the liver and kidney by hydrolysis of glucose-6-phosphate (G6P into glucose and phosphate (P(i. This reaction depends on coupling the G6P transporter (G6PT with glucose-6-phosphatase-α (G6Pase-α. Only one G6PT, also known as SLC37A4, has been characterized, and it acts as a P(i-linked G6P antiporter. The other three SLC37 family members, predicted to be sugar-phosphate:P(i exchangers, have not been characterized functionally. Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to couple with G6Pase-α. G6PT- and mock-proteoliposomes are used as positive and negative controls, respectively. We show that SLC37A1 and SLC37A2 are ER-associated, P(i-linked antiporters, that can transport G6P. Unlike G6PT, neither is sensitive to chlorogenic acid, a competitive inhibitor of physiological ER G6P transport, and neither couples to G6Pase-α. We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. However, only G6PT/SLC37A4 matches the characteristics of the physiological ER G6P transporter, suggesting the other SLC37 proteins have roles independent of blood glucose homeostasis.

  3. Upregulation of the Creatine Transporter Slc6A8 by Klotho

    Directory of Open Access Journals (Sweden)

    Ahmad Almilaji

    2014-11-01

    Full Text Available Background/Aims: The transmembrane Klotho protein contributes to inhibition of 1,25(OH2D3 formation. The extracellular domain of Klotho protein could function as an enzyme with e.g. β-glucuronidase activity, be cleaved off and be released into blood and cerebrospinal fluid. Klotho regulates several cellular transporters. Klotho protein deficiency accelerates the appearance of age related disorders including neurodegeneration and muscle wasting and eventually leads to premature death. The main site of Klotho protein expression is the kidney. Klotho protein is also appreciably expressed in other tissues including chorioid plexus. The present study explored the effect of Klotho protein on the creatine transporter CreaT (Slc6A8, which participates in the maintenance of neuronal function and survival. Methods: To this end cRNA encoding Slc6A8 was injected into Xenopus oocytes with and without additional injection of cRNA encoding Klotho protein. Creatine transporter CreaT (Slc6A8 activity was estimated from creatine induced current determined by two-electrode voltage-clamp. Results: Coexpression of Klotho protein significantly increased creatine-induced current in Slc6A8 expressing Xenopus oocytes. Coexpression of Klotho protein delayed the decline of creatine induced current following inhibition of carrier insertion into the cell membrane by brefeldin A (5 µM. The increase of creatine induced current by coexpression of Klotho protein in Slc6A8 expressing Xenopus oocytes was reversed by β-glucuronidase inhibitor (DSAL. Similarly, treatment of Slc6A8 expressing Xenopus oocytes with recombinant human alpha Klotho protein significantly increased creatine induced current. Conclusion: Klotho protein up-regulates the activity of creatine transporter CreaT (Slc6A8 by stabilizing the carrier protein in the cell membrane, an effect requiring β-glucuronidase activity of Klotho protein.

  4. Neurotransmitter Transporter-Like: a male germline-specific SLC6 transporter required for Drosophila spermiogenesis.

    Directory of Open Access Journals (Sweden)

    Nabanita Chatterjee

    2011-01-01

    Full Text Available The SLC6 class of membrane transporters, known primarily as neurotransmitter transporters, is increasingly appreciated for its roles in nutritional uptake of amino acids and other developmentally specific functions. A Drosophila SLC6 gene, Neurotransmitter transporter-like (Ntl, is expressed only in the male germline. Mobilization of a transposon inserted near the 3' end of the Ntl coding region yields male-sterile mutants defining a single complementation group. Germline transformation with Ntl cDNAs under control of male germline-specific control elements restores Ntl/Ntl homozygotes to normal fertility, indicating that Ntl is required only in the germ cells. In mutant males, sperm morphogenesis appears normal, with elongated, individualized and coiled spermiogenic cysts accumulating at the base of the testes. However, no sperm are transferred to the seminal vesicle. The level of polyglycylation of Ntl mutant sperm tubulin appears to be significantly lower than that of wild type controls. Glycine transporters are the most closely related SLC6 transporters to Ntl, suggesting that Ntl functions as a glycine transporter in developing sperm, where augmentation of the cytosolic pool of glycine may be required for the polyglycylation of the massive amounts of tubulin in the fly's giant sperm. The male-sterile phenotype of Ntl mutants may provide a powerful genetic system for studying the function of an SLC6 transporter family in a model organism.

  5. SLC6 Neurotransmitter Transporters: Structure, Function, and Regulation

    DEFF Research Database (Denmark)

    Kristensen, Anders S; Andersen, Jacob; Jørgensen, Trine N

    2011-01-01

    The neurotransmitter transporters (NTTs) belonging to the solute carrier 6 (SLC6) gene family (also referred to as the neurotransmitter-sodium-symporter family or Na(+)/Cl(-)-dependent transporters) comprise a group of nine sodium- and chloride-dependent plasma membrane transporters...... for the monoamine neurotransmitters serotonin (5-hydroxytryptamine), dopamine, and norepinephrine, and the amino acid neurotransmitters GABA and glycine. The SLC6 NTTs are widely expressed in the mammalian brain and play an essential role in regulating neurotransmitter signaling and homeostasis by mediating uptake...... of released neurotransmitters from the extracellular space into neurons and glial cells. The transporters are targets for a wide range of therapeutic drugs used in treatment of psychiatric diseases, including major depression, anxiety disorders, attention deficit hyperactivity disorder and epilepsy...

  6. Reduced Slc6a15 in Nucleus Accumbens D2-Neurons Underlies Stress Susceptibility.

    Science.gov (United States)

    Chandra, Ramesh; Francis, T Chase; Nam, Hyungwoo; Riggs, Lace M; Engeln, Michel; Rudzinskas, Sarah; Konkalmatt, Prasad; Russo, Scott J; Turecki, Gustavo; Iniguez, Sergio D; Lobo, Mary Kay

    2017-07-05

    Previous research demonstrates that Slc6a15, a neutral amino acid transporter, is associated with depression susceptibility. However, no study examined Slc6a15 in the ventral striatum [nucleus accumbens (NAc)] in depression. Given our previous characterization of Slc6a15 as a striatal dopamine receptor 2 (D2)-neuron-enriched gene, we examined the role of Slc6a15 in NAc D2-neurons in mediating susceptibility to stress in male mice. First, we showed that Slc6a15 mRNA was reduced in NAc of mice susceptible to chronic social defeat stress (CSDS), a paradigm that produces behavioral and molecular adaptations that resemble clinical depression. Consistent with our preclinical data, we observed Slc6a15 mRNA reduction in NAc of individuals with major depressive disorder (MDD). The Slc6a15 reduction in NAc occurred selectively in D2-neurons. Next, we used Cre-inducible viruses combined with D2-Cre mice to reduce or overexpress Slc6a15 in NAc D2-neurons. Slc6a15 reduction in D2-neurons caused enhanced susceptibility to a subthreshold social defeat stress (SSDS) as observed by reduced social interaction, while a reduction in social interaction following CSDS was not observed when Slc6a15 expression in D2-neurons was restored. Finally, since both D2-medium spiny neurons (MSNs) and D2-expressing choline acetyltransferase (ChAT) interneurons express Slc6a15, we examined Slc6a15 protein in these interneurons after CSDS. Slc6a15 protein was unaltered in ChAT interneurons. Consistent with this, reducing Slc5a15 selectively in NAc D2-MSNs, using A2A-Cre mice that express Cre selectively in D2-MSNs, caused enhanced susceptibility to SSDS. Collectively, our data demonstrate that reduced Slc6a15 in NAc occurs in MDD individuals and that Slc6a15 reduction in NAc D2-neurons underlies stress susceptibility. SIGNIFICANCE STATEMENT Our study demonstrates a role for reduced Slc6a15, a neutral amino acid transporter, in nucleus accumbens (NAc) in depression and stress susceptibility. The

  7. Association between norepinephrine transporter gene (SLC6A2) polymorphisms and suicide in patients with major depressive disorder.

    Science.gov (United States)

    Kim, Yong-Ku; Hwang, Jung-A; Lee, Heon-Jeong; Yoon, Ho-Kyoung; Ko, Young-Hoon; Lee, Bun-Hee; Jung, Han-Yong; Hahn, Sang-Woo; Na, Kyoung-Sae

    2014-04-01

    Although several studies have investigated possible associations between norepinephrine neurotransmitter transporter gene (SLC6A2) polymorphisms and depression, few studies have examined associations between SLC6A2 polymorphisms and suicide. Three single-nucleotide polymorphisms (rs2242446, rs28386840, and rs5569) were measured in 550 patients: 201 with major depressive disorder (MDD) and suicide attempt/s, 160 with MDD without suicide attempts, and 189 healthy controls. Analysis of single-nucleotide polymorphisms (SNPs) and haplotype was conducted for the three groups. Subsequently, multivariate logistic regression analysis adjusting for age and gender was conducted to identify independent influences of each SNP. A possible association between suicide lethality and SLC6A2 polymorphisms was also investigated. In the genotype and allele frequency analysis, there were significant differences in rs28386840 between suicidal MDD patients and healthy controls. In the haplotype analysis, TAA (rs2242446-rs28386840-rs5569, from left to right) was associated with suicide attempts in MDD, although the significance (p=0.043) disappeared after Bonferroni correction. There were no relationships between lethality scores and SLC6A2 polymorphisms in suicidal MDD. Modest sample size and a single type of neurotransmitter analyzed (norepinephrine) are the primary limitations. Our results suggest that SLC6A2 polymorphisms were associated with suicide risk in patients with MDD. Future studies are warranted to elucidate possible mechanisms by which SLC6A2 polymorphisms influence suicide risk. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. SLC2A9 is a high-capacity urate transporter in humans.

    Directory of Open Access Journals (Sweden)

    Mark J Caulfield

    2008-10-01

    Full Text Available Serum uric acid levels in humans are influenced by diet, cellular breakdown, and renal elimination, and correlate with blood pressure, metabolic syndrome, diabetes, gout, and cardiovascular disease. Recent genome-wide association scans have found common genetic variants of SLC2A9 to be associated with increased serum urate level and gout. The SLC2A9 gene encodes a facilitative glucose transporter, and it has two splice variants that are highly expressed in the proximal nephron, a key site for urate handling in the kidney. We investigated whether SLC2A9 is a functional urate transporter that contributes to the longstanding association between urate and blood pressure in man.We expressed both SLC2A9 splice variants in Xenopus laevis oocytes and found both isoforms mediate rapid urate fluxes at concentration ranges similar to physiological serum levels (200-500 microM. Because SLC2A9 is a known facilitative glucose transporter, we also tested whether glucose or fructose influenced urate transport. We found that urate is transported by SLC2A9 at rates 45- to 60-fold faster than glucose, and demonstrated that SLC2A9-mediated urate transport is facilitated by glucose and, to a lesser extent, fructose. In addition, transport is inhibited by the uricosuric benzbromarone in a dose-dependent manner (Ki = 27 microM. Furthermore, we found urate uptake was at least 2-fold greater in human embryonic kidney (HEK cells overexpressing SLC2A9 splice variants than nontransfected kidney cells. To confirm that our findings were due to SLC2A9, and not another urate transporter, we showed that urate transport was diminished by SLC2A9-targeted siRNA in a second mammalian cell line. In a cohort of men we showed that genetic variants of SLC2A9 are associated with reduced urinary urate clearance, which fits with common variation at SLC2A9 leading to increased serum urate. We found no evidence of association with hypertension (odds ratio 0.98, 95% confidence interval [CI

  9. The orphan transporter v7-3 (slc6a15) is a Na+-dependent neutral amino acid transporter (B0AT2)

    DEFF Research Database (Denmark)

    Bröer, Angelika; Tietze, Nadine; Kowalczuk, Sonja

    2006-01-01

    . The transporter is functionally and sequence related to B(0)AT1 (slc6a19) and was hence named B(0)AT2. Leucine, isoleucine, valine, proline and methionine were recognized by the transporter, with values of K(0.5) (half-saturation constant) ranging from 40 to 200 microM. Alanine, glutamine and phenylalanine were...

  10. A haplotype of the norepinephrine transporter gene (SLC6A2) is associated with visual memory in attention-deficit/hyperactivity disorder.

    Science.gov (United States)

    Shang, Chi-Yung; Chiang, Huey-Ling; Gau, Susan Shur-Fen

    2015-04-03

    Attention-deficit/hyperactivity disorder (ADHD) is a common heritable childhood-onset psychiatric disorder with impaired visual memory. Based on the evidence from treatment effect of atomoxetine, which interacts directly with the norepinephrine transporter, on visual memory in children with ADHD, this study examined the linkage disequilibrium structure of the norepinephrine transporter gene (SLC6A2) and the association between SLC6A2 and ADHD and visual memory, a promising endophenotype for ADHD. This family-based association sample consisted of 382 probands with DSM-IV ADHD and their family members (n=1298 in total) of Han Chinese in Taiwan. Visual memory was assessed by the Pattern Recognition Memory (PRM) and Spatial Recognition Memory (SRM) tasks of the Cambridge Neuropsychological Test Automated Battery (CANTAB). We screened 21 polymorphisms across SLC6A2 and used the Family-Based Association Test (FBAT) to test the associations of SLC6A2 polymorphisms with ADHD and the PRM and SRM measures. In haplotype analyses, a haplotype rs36011 (T)/rs1566652 (G) was significantly associated with ADHD (minimal p=0.045) after adjustment for multiple testing. In quantitative analyses, this TG haplotype also demonstrated significant associations with visual memory measures, including mean latency of correct responses in PRM (minimal p=0.019), total correct responses in PRM (minimal p=0.018), and total correct responses in SRM (minimal p=0.015). Our novel finding of the haplotype rs36011 (T)/rs1566652 (G) as a novel genetic marker involved in both ADHD disease susceptibility and visual memory suggests that allelic variations in SLC6A2 could provide insight into the pathways leading from genotype to phenotype of ADHD. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures

    DEFF Research Database (Denmark)

    Carvill, Gemma L; McMahon, Jacinta M; Schneider, Amy

    2015-01-01

    GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutatio...

  12. Epigenetic adaptation of the placental serotonin transporter gene (SLC6A4 to gestational diabetes mellitus.

    Directory of Open Access Journals (Sweden)

    Sofia Blazevic

    Full Text Available We tested the hypothesis that gestational diabetes mellitus (GDM alters the DNA methylation pattern of the fetal serotonin transporter gene (SLC6A4, and examined the functional relevance of DNA methylation for regulation of the SLC6A4 expression in the human placenta. The study included 50 mother-infant pairs. Eighteen mothers were diagnosed with GDM and 32 had normal glucose tolerance (NGT. All neonates were of normal birth weight and born at term by planned Cesarean section. DNA and RNA were isolated from samples of tissue collected from the fetal side of the placenta immediately after delivery. DNA methylation was quantified at 7 CpG sites within the SLC6A4 distal promoter region using PCR amplification of bisulfite treated DNA and subsequent DNA sequencing. SLC6A4 mRNA levels were measured by reverse transcription-quantitative PCR (RT-qPCR. Functional SLC6A4 polymorphisms (5HTTLPR, STin2, rs25531 were genotyped using standard PCR-based procedures. Average DNA methylation across the 7 analyzed loci was decreased in the GDM as compared to the NGT group (by 27.1%, p = 0.037 and negatively correlated, before and after adjustment for potential confounder/s, with maternal plasma glucose levels at the 24th to 28th week of gestation (p0.05. The results suggest that DNA methylation of the fetal SLC6A4 gene is sensitive to the maternal metabolic state in pregnancy. They also indicate a predominant role of epigenetic over genetic mechanisms in the regulation of SLC6A4 expression in the human placenta. Longitudinal studies in larger cohorts are needed to verify these results and determine to which degree placental SLC6A4 changes may contribute to long-term outcomes of infants exposed to GDM.

  13. Synthesis and preclinical characterization of 1-(6'-deoxy-6'-[18F]fluoro-β-d-allofuranosyl)-2-nitroimidazole (β-6'-[18F]FAZAL) as a positron emission tomography radiotracer to assess tumor hypoxia.

    Science.gov (United States)

    Wanek, Thomas; Kreis, Katharina; Križková, Petra; Schweifer, Anna; Denk, Christoph; Stanek, Johann; Mairinger, Severin; Filip, Thomas; Sauberer, Michael; Edelhofer, Patricia; Traxl, Alexander; Muchitsch, Viktoria E; Mereiter, Kurt; Hammerschmidt, Friedrich; Cass, Carol E; Damaraju, Vijaya L; Langer, Oliver; Kuntner, Claudia

    2016-11-01

    Positron emission tomography (PET) using fluorine-18 ( 18 F)-labeled 2-nitroimidazole radiotracers has proven useful for assessment of tumor oxygenation. However, the passive diffusion-driven cellular uptake of currently available radiotracers results in slow kinetics and low tumor-to-background ratios. With the aim to develop a compound that is actively transported into cells, 1-(6'-deoxy-6'-[ 18 F]fluoro-β-d-allofuranosyl)-2-nitroimidazole (β-[ 18 F]1), a putative nucleoside transporter substrate, was synthetized by nucleophilic [ 18 F]fluoride substitution of an acetyl protected labeling precursor with a tosylate leaving group (β-6) in a final radiochemical yield of 12±8% (n=10, based on [ 18 F]fluoride starting activity) in a total synthesis time of 60min with a specific activity at end of synthesis of 218±58GBq/μmol (n=10). Both radiolabeling precursor β-6 and unlabeled reference compound β-1 were prepared in multistep syntheses starting from 1,2:5,6-di-O-isopropylidene-α-d-allofuranose. In vitro experiments demonstrated an interaction of β-1 with SLC29A1 and SLC28A1/2/3 nucleoside transporter as well as hypoxia specific retention of β-[ 18 F]1 in tumor cell lines. In biodistribution studies in healthy mice β-[ 18 F]1 showed homogenous tissue distribution and excellent metabolic stability, which was unaffected by tissue oxygenation. PET studies in tumor bearing mice showed tumor-to-muscle ratios of 2.13±0.22 (n=4) at 2h after administration of β-[ 18 F]1. In ex vivo autoradiography experiments β-[ 18 F]1 distribution closely matched staining with the hypoxia marker pimonidazole. In conclusion, β-[ 18 F]1 shows potential as PET hypoxia radiotracer which merits further investigation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. The dopamine transporter protein gene (SLC6A3): Primary linage mapping and linkage studies in Tourette syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Gelernter, J.; Kruger, S.D.; Pakstis, A.J. [Yale Univ., New Haven, CT (United States)]|[West Haven Veterans Affairs Medical Center, CT (United States)] [and others

    1995-12-10

    The dopamine transporter, the molecule responsible for presynaptic reuptake of dopamine and a major site of action of psychostimulant drugs, including cocaine, is encoded by locus SLC6A3 (alias DAT1). The protein`s actions and DAT`s specific localization to dopaminergic neurons make it a candidate gene for several psychiatric illnesses. SLC6A3 has been mapped to distal chromosome 5p, using physical methods. Genetic linkage methods were used to place SLC6A3 in the genetic linkage map. Four extended pedigrees (one of which overlaps with CEPH) were typed. Linkage with Tourette syndrome (TS) was also examined. SLC6A3 showed close linkage with several markers previously mapped to distal chromosome 5p, including D5S11 (Z{sub max} = 16.0, {theta}{sub M} = {theta}{sub F} = 0.03, results from four families) and D5S678 (Z{sub max} = 7.84, {theta}{sub M} = {theta}{sub F} = 0, results from two families). Observed crossovers established that SLC6A3 is a distal marker close to D5S10 and D5S678, but these three distal markers could not be ordered. Linkage between TS and SLC6A3 could be excluded independently in two branches of a large kindred segregating TS; the lod score in a third family was also negative, but not significant. Cumulative results show a lod score of -6.2 at {theta} = 0 and of -3.9 at {theta} = 0.05 (dominant model, narrow disease definition). SLC6A3 thus maps to distal chromosome 5p by linkage analysis, in agreement with previous physical mapping data. A mutation at SLC6A3 is not causative for TS in the two large families that generated significant negative lod scores (if the parameters of our analyses were correct) and is unlikely to be causative in the family that generated a negative lod score that did not reach significance. These results do not exclude a role for the dopamine transporter in influencing risk for TS in combination with other loci. 23 refs., 1 fig., 2 tabs.

  15. Riboflavin uptake transporter Slc52a2 (RFVT2) is upregulated in the mouse mammary gland during lactation.

    Science.gov (United States)

    Wu, Alex Man Lai; Dedina, Liana; Dalvi, Pooja; Yang, Mingdong; Leon-Cheon, John; Earl, Brian; Harper, Patricia A; Ito, Shinya

    2016-04-01

    While it is well recognized that riboflavin accumulates in breast milk as an essential vitamin for neonates, transport mechanisms for its milk excretion are not well characterized. The multidrug efflux transporter ABCG2 in the apical membrane of milk-producing mammary epithelial cells (MECs) is involved with riboflavin excretion. However, it is not clear whether MECs possess other riboflavin transport systems, which may facilitate its basolateral uptake into MECs. We report here that transcripts encoding the second (SLC52A2) and third (SLC52A3) member of the recently discovered family of SLC52A riboflavin uptake transporters are expressed in milk fat globules from human breast milk. Furthermore, Slc52a2 and Slc52a3 mRNA are upregulated in the mouse mammary gland during lactation. Importantly, the induction ofSlc52a2, which was the major Slc52a riboflavin transporter in the lactating mammary gland, was also observed at the protein level. Subcellular localization studies showed that green fluorescent protein-tagged mouse SLC52A2 mainly localized to the cell membrane, with no preferential distribution to the apical or basolateral membrane in polarized kidney MDCK cells. These results strongly implicate a potential role for SLC52A2 in riboflavin uptake by milk-producing MECs, a critical step in the transfer of riboflavin into breast milk. Copyright © 2016 the American Physiological Society.

  16. Association study of serotonin transporter SLC6A4 gene with Chinese Han irritable bowel syndrome.

    Directory of Open Access Journals (Sweden)

    Jing Yuan

    Full Text Available OBJECTIVE: Irritable bowel syndrome (IBS is a common clinical gastrointestinal dysfunction disorders. 5-sertonon (5-hydroxytryptamine, 5-HT is a very important neurotransmitter, which is involved in gastrointestinal motion and sensation. Solute carrier family 6 member 4 (SLC6A4 gene encode serotonin transporter (SERT which function is to rapidly reuptake the most of 5-HT. Therefore, it is needed to explore the association between SLC6A4 gene polymorphisms and IBS. METHODS: 119 patients and 238 healthy controls were administrated to detect the SLC6A4 gene polymorphisms including 5-HT-transporter-gene-linked polymorphic region (5-HTTLPR, variable number of tandem repeats (VNTRs and three selected tag Single Nucleotide Polymorphisms (SNPs rs1042173, rs3794808, rs2020936 by using polymerase chain reaction (PCR and TaqMan® SNP Genotyping. RESULTS: There were significant difference for 5-HTTLPR between IBS and control groups (X2 = 106.168, P<0.0001. In control group, genotypes were mainly L/L (58.4%, however, the genotypes in IBS were S/S (37.8%. The significant difference was shown in D-IBS subjects when compared to the controls (X(2 = 50.850, P<0.0001 for 5-HTTLPR. For STin2 VNTR, rs1042173, rs3794808, and rs2020936 polymorphisms, there were no any significant differences between IBS and control groups. There were no statistical significantly haplotypes for 5-HTTLPR, VNTRs and the three SNPs between IBS and controls. CONCLUSION: The S allele in 5-HTTLPR was a susceptible allele with Chinese Han IBS, but other associations of VNTRs, three selected Tag SNPs and positive haplotype with IBS were not found. It is indicated that much research are needed to study the relationship between other polymorphisms in SLC6A4 gene and IBS.

  17. Impact of genetic polymorphisms of SLC2A2, SLC2A5, and KHK on metabolic phenotypes in hypertensive individuals.

    Directory of Open Access Journals (Sweden)

    MyPhuong T Le

    Full Text Available In the past few decades, consumption of added sugars has increased dramatically. Studies have linked high sugar intake with increased risk for a number of diseases. Importantly, fructose, a component of sugar, has been linked with the development of features of metabolic syndrome. This study determined if single nucleotide polymorphisms in genes involved in fructose transport (solute carrier family 2 facilitated glucose transporter, member 2 (SLC2A2 and solute carrier family 2 facilitated glucose/fructose transporter, member 5 (SLC2A5 and metabolism (ketohexokinase (KHK affect inter-individual variability in metabolic phenotypes, such as increased serum uric acid levels.The influence of SLC2A2, SLC2A5, and KHK SNPs on metabolic phenotypes was tested in 237 European Americans and 167 African Americans from the Pharmacogenomic Evaluation and Antihypertensive Responses (PEAR study. Using baseline untreated fasting data, associations were considered significant if p≤0.005. These SNPs were then evaluated for potential replication (p≤0.05 using data from the Genetic Epidemiology of Responses to Antihypertensives (GERA studies.SLC2A5 rs5438 was associated with an increase in serum uric acid in European American males. However, we were unable to replicate the association in GERA. The minor allele of SLC2A2 rs8192675 showed an association with lower high-density lipoproteins in European Americans (A/A: 51.0 mg/dL, A/G: 47.0 mg/dL, G/G: 41.5 mg/dL, p = 0.0034 in PEAR. The association between rs8192675 and lower high-density lipoproteins was replicated in the combined European American GERA study samples (A/A: 47.6 mg/dL, A/G: 48.6 mg/dL, G/G: 41.9 mg/dL, p = 0.0315.The association between SLC2A2 rs8192675 and high-density lipoproteins suggests the polymorphism may play a role in influencing high-density lipoproteins and thus metabolic risk of cardiovascular disease.

  18. Major involvement of Na(+) -dependent multivitamin transporter (SLC5A6/SMVT) in uptake of biotin and pantothenic acid by human brain capillary endothelial cells.

    Science.gov (United States)

    Uchida, Yasuo; Ito, Katsuaki; Ohtsuki, Sumio; Kubo, Yoshiyuki; Suzuki, Takashi; Terasaki, Tetsuya

    2015-07-01

    The purpose of this study was to clarify the expression of Na(+) -dependent multivitamin transporter (SLC5A6/SMVT) and its contribution to the supply of biotin and pantothenic acid to the human brain via the blood-brain barrier. DNA microarray and immunohistochemical analyses confirmed that SLC5A6 is expressed in microvessels of human brain. The absolute expression levels of SLC5A6 protein in isolated human and monkey brain microvessels were 1.19 and 0.597 fmol/μg protein, respectively, as determined by a quantitative targeted absolute proteomics technique. Using an antibody-free method established by Kubo et al. (2015), we found that SLC5A6 was preferentially localized at the luminal membrane of brain capillary endothelium. Knock-down analysis using SLC5A6 siRNA showed that SLC5A6 accounts for 88.7% and 98.6% of total [(3) H]biotin and [(3) H]pantothenic acid uptakes, respectively, by human cerebral microvascular endothelial cell line hCMEC/D3. SLC5A6-mediated transport in hCMEC/D3 was markedly inhibited not only by biotin and pantothenic acid, but also by prostaglandin E2, lipoic acid, docosahexaenoic acid, indomethacin, ketoprofen, diclofenac, ibuprofen, phenylbutazone, and flurbiprofen. This study is the first to confirm expression of SLC5A6 in human brain microvessels and to provide evidence that SLC5A6 is a major contributor to luminal uptake of biotin and pantothenic acid at the human blood-brain barrier. In humans, it was unclear (not concluded) about what transport system at the blood-brain barrier (BBB) is responsible for the brain uptakes of two vitamins, biotin and pantothenic acid, which are necessary for brain proper function. This study clarified for the first time that the solute carrier 5A6/Na(+) -dependent multivitamin transporter SLC5A6/SMVT is responsible for the supplies of biotin and pantothenic acid into brain across the BBB in humans. DHA, docosahexaenoic acid; NSAID, non-steroidal anti-inflammatory drug; PGE2, prostaglandin E2. © 2015

  19. Characterization of SLC transporters in human skin

    Directory of Open Access Journals (Sweden)

    Marion Alriquet

    2015-03-01

    Full Text Available Most identified drug transporters belong to the ATP-binding Cassette (ABC and Solute Carrier (SLC families. Recent research indicates that some of these transporters play an important role in the absorption, distribution and excretion of drugs, and are involved in clinically relevant drug-drug interactions for systemic drugs. However, very little is known about the role of drug transporters in human skin in the disposition of topically applied drugs and their involvement in drug-drug interactions. The aim of this work was to compare the expression in human skin (vs human hepatocytes and kidney of SLC transporters included in the EMA guidance as the most likely clinical sources of drug interactions. The expression of SLC transporters in human tissues was analyzed by quantitative RT-PCR. Modulation of SLC47A1 and SLC47A2 (MATE1 and MATE2 expression was analyzed after treatment of human skin in organ-culture with rifampicin and UV irradiation. The expression of SLCO2B1 (OATPB, SLCO3A1 (OATPD, SLCO4A1 (OATPE, SLC47A1 and SLC47A2 (MATE1 and MATE2 was detected in human skin, OATPE and MATE1 being the most expressed. OATPE is about 70 times more expressed in human skin than in human hepatocytes. Moreover, the expression of SLC47A1 and SLC47A2 was down-regulated after treatment with rifampicin or after exposure to UV light. The present findings demonstrate that SLCO4A1 (OATPE and SLC47A1 (MATE1 are highly expressed in human skin and suggest the involvement of SLC transporters in the disposition of topically applied drugs.

  20. Action Potential Shortening and Impairment of Cardiac Function by Ablation of Slc26a6.

    Science.gov (United States)

    Sirish, Padmini; Ledford, Hannah A; Timofeyev, Valeriy; Thai, Phung N; Ren, Lu; Kim, Hyo Jeong; Park, Seojin; Lee, Jeong Han; Dai, Gu; Moshref, Maryam; Sihn, Choong-Ryoul; Chen, Wei Chun; Timofeyeva, Maria Valeryevna; Jian, Zhong; Shimkunas, Rafael; Izu, Leighton T; Chiamvimonvat, Nipavan; Chen-Izu, Ye; Yamoah, Ebenezer N; Zhang, Xiao-Dong

    2017-10-01

    Intracellular pH (pH i ) is critical to cardiac excitation and contraction; uncompensated changes in pH i impair cardiac function and trigger arrhythmia. Several ion transporters participate in cardiac pH i regulation. Our previous studies identified several isoforms of a solute carrier Slc26a6 to be highly expressed in cardiomyocytes. We show that Slc26a6 mediates electrogenic Cl - /HCO 3 - exchange activities in cardiomyocytes, suggesting the potential role of Slc26a6 in regulation of not only pH i , but also cardiac excitability. To test the mechanistic role of Slc26a6 in the heart, we took advantage of Slc26a6 knockout ( Slc26a6 -/ - ) mice using both in vivo and in vitro analyses. Consistent with our prediction of its electrogenic activities, ablation of Slc26a6 results in action potential shortening. There are reduced Ca 2+ transient and sarcoplasmic reticulum Ca 2+ load, together with decreased sarcomere shortening in Slc26a6 -/ - cardiomyocytes. These abnormalities translate into reduced fractional shortening and cardiac contractility at the in vivo level. Additionally, pH i is elevated in Slc26a6 -/ - cardiomyocytes with slower recovery kinetics from intracellular alkalization, consistent with the Cl - /HCO 3 - exchange activities of Slc26a6. Moreover, Slc26a6 -/ - mice show evidence of sinus bradycardia and fragmented QRS complex, supporting the critical role of Slc26a6 in cardiac conduction system. Our study provides mechanistic insights into Slc26a6, a unique cardiac electrogenic Cl - /HCO 3 - transporter in ventricular myocytes, linking the critical roles of Slc26a6 in regulation of pH i , excitability, and contractility. pH i is a critical regulator of other membrane and contractile proteins. Future studies are needed to investigate possible changes in these proteins in Slc26a6 -/ - mice. © 2017 American Heart Association, Inc.

  1. Deletions at SLC18A1 increased the risk of CRC and lower SLC18A1 expression associated with poor CRC outcome.

    Science.gov (United States)

    Zhang, Dandan; Li, Zhenli; Xu, Xiaohong; Zhou, Dan; Tang, Shunli; Yin, Xiaoyang; Xu, Fangying; Li, Hui; Zhou, Yuan; Zhu, Tao; Deng, Hong; Zhang, Shuai; Huang, Qiong; Wang, Jing; Yin, Wei; Zhu, Yimin; Lai, Maode

    2017-10-26

    Copy number variations (CNVs) contribute to the development of colorectal cancer (CRC). We conducted a two-stage association study to identify CNV risk loci for CRC. We performed a gene-based rare CNV study on 694 sporadic CRC and 1641 controls using Illumina Human-OmniExpress-12v1.0 BeadChips, and further replicated in 934 CRC cases and 2680 controls for risk CNVs by using TaqMan Copy Number Assay. Tumor buddings, cancer cells in the center of primary tumor and normal intestinal epithelial cells were captured using laser capture microdissection (LCM) and were assayed using AffymetrixGeneChip® Human Genome U133 Plus 2.0 Array. In addition, The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus data were assessed for the effects of risk CNVs. We found that germline deletions affecting the last six exons of SLC18A1 significantly associated with CRC with a combined P value of 6.4 × 10-5 by a two-stage analysis. Both in TCGA CRC RNA seq dataset and GDS4382, SLC18A1 was significantly down regulated in CRC tissues than in paired normal tissues (N = 32 and 17 pairs, P = 0.004 and 0.009, respectively). In LCM samples, similar observations were obtained that the expression levels of SLC18A1 in the tumor buddings, cancer cells in the center of primary tumor, and stroma of both tumor budding and cancer cells were lower than normal intestinal epithelial and stromal cells (fold change = 0.17-0.62, 0.12-0.57 and 0.37-0.68, respectively). In summary, the germline deletions at SLC18A1 contributed to the development of CRC. The role of SLC18A1 required further exploration. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  2. Expression and Its Clinical Significance of SLC22A18 in Non-small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Ming LEI

    2012-01-01

    Full Text Available Background and objective It has been proven that multidrug resistance (MDR is the main cause of chemotherapy failure in lung cancer. Research on emergence mechanisms of MDR has great clinical significance in improving the curative efficiency of lung cancer chemotherapy. Proteins encoded by the SLC22A18 gene, which is similar to the transmembrane transporter, may influence the sensitivity of chemotherapeutics as well as the metabolism and growth of cells. In addition, these proteins probably have some effect on the development of lung cancer MDR. The aim of the present study is to investigate the expression of SLC22A18 protein in non-small cell lung cancer (NSCLC as well as in corresponding normal lung tissue. Furthermore, the relationship between SLC22A18 expression and pathological grade and TNM stage is analyzed. Methods The expression of SLC22A18 was detected by EnVinsion in 96 cases with NSCLC and in corresponding normal lung tissue. Statistical analysis was performed using SPSS 17.0 statistical software. Results SLC22A18 was mainly located in cell membrane and cytoplasm. The expression level of SLC22A18 in NSCLC was significantly higher than that in normal tissue (P<0.01. The positive rates in squamous cell lung cancer and lung adenocarcinoma were 68% and 78.2%, respectively (P<0.05. Moreover, the higher expression of SLC22A18 was associated with lower histological grade and later TNM stage (P<0.05. Conclusion SLC22A18 protein is overexpressed in NSCLC, and its expression is correlated with pathological grade and TNM stage. These findings provide the experimental basis for investigating the role of tumor and chemoresistance.

  3. Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures

    Science.gov (United States)

    Carvill, Gemma L.; McMahon, Jacinta M.; Schneider, Amy; Zemel, Matthew; Myers, Candace T.; Saykally, Julia; Nguyen, John; Robbiano, Angela; Zara, Federico; Specchio, Nicola; Mecarelli, Oriano; Smith, Robert L.; Leventer, Richard J.; Møller, Rikke S.; Nikanorova, Marina; Dimova, Petia; Jordanova, Albena; Petrou, Steven; Helbig, Ingo; Striano, Pasquale; Weckhuysen, Sarah; Berkovic, Samuel F.; Scheffer, Ingrid E.; Mefford, Heather C.

    2015-01-01

    GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutations in seven individuals, all of whom have epilepsy with myoclonic-atonic seizures (MAE). We describe two truncations and four missense alterations, all of which most likely lead to loss of function of GAT-1 and thus reduced GABA re-uptake from the synapse. These individuals share many of the electrophysiological properties of Gat1-deficient mice, including spontaneous spike-wave discharges. Overall, pathogenic mutations occurred in 6/160 individuals with MAE, accounting for ∼4% of unsolved MAE cases. PMID:25865495

  4. Fructose Synthesis and Transport at the Uterine-Placental Interface of Pigs: Cell-Specific Localization of SLC2A5, SLC2A8, and Components of the Polyol Pathway.

    Science.gov (United States)

    Steinhauser, Chelsie B; Landers, McKinsey; Myatt, Louise; Burghardt, Robert C; Vallet, Jeffrey L; Bazer, Fuller W; Johnson, Greg A

    2016-11-01

    The fetal fluids and uterine flushings of pigs contain higher concentrations of fructose than glucose, but fructose is not detected in maternal blood. Fructose can be synthesized from glucose via enzymes of the polyol pathway, aldose reductase (AKR1B1) and sorbitol dehydrogenase (SORD), transported across cell membranes by solute carriers SLC2A5 and SLC2A8, and converted to fructose-1-phosphate by ketohexokinase (KHK). SLC2A8, SLC2A5, AKR1B1, SORD, and KHK mRNAs and proteins were analyzed using quantitative PCR and immunohistochemistry or in situ hybridization in endometria and placentae of cyclic and pregnant gilts, cyclic gilts injected with estrogen, and ovariectomized gilts injected with progesterone. Progesterone up-regulated SLC2A8 protein in uterine luminal (LE) and glandular epithelia during the peri-implantation period, and expression became exclusively placental, chorion and blood vessels, after Day 30. P4 up-regulated SLC2A5 mRNA in uterine LE and glandular epithelia after implantation, and the chorion expressed SLC2A5 between Days 30 and 85. AKR1B1 and SORD proteins localized to uterine LE during the peri-implantation period, but expression switched to chorion by Day 20 and was maintained through Day 85. Uterine expression of AKR1B1 mRNA was down-regulated by estrogen. KHK protein localized to trophectoderm/chorion throughout gestation. These results provide evidence that components for the conversion of glucose to fructose and for fructose transport are present at the uterine-placental interface of pigs. The shift in expression from LE to chorion during pregnancy suggests free-floating conceptuses are supported by fructose synthesized by the uterus, but after implantation, the chorion becomes self-sufficient for fructose synthesis and transport. © 2016 by the Society for the Study of Reproduction, Inc.

  5. Impaired riboflavin transport due to missense mutations in SLC52A2 causes Brown-Vialetto-Van Laere syndrome.

    Science.gov (United States)

    Haack, Tobias B; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M; Meitinger, Thomas; Yonezawa, Atsushi; Prokisch, Holger

    2012-11-01

    Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin transporter 3 (hRFT3), another member of the riboflavin transporter family, is also associated with BVVLS. Overexpression studies confirmed that the gene products of both mutant alleles have reduced riboflavin transport activities. While mutations in SLC52A3 cause decreased plasma riboflavin levels, concordant with a role of SLC52A3 in riboflavin uptake from food, the SLC52A2-mutant individual had normal plasma riboflavin concentrations, a finding in line with a postulated function of SLC52A2 in riboflavin uptake from blood into target cells. Our results contribute to the understanding of human riboflavin metabolism and underscore its role in the pathogenesis of BVVLS, thereby providing a rational basis for a high-dose riboflavin treatment.

  6. Transcript levels of members of the SLC2 and SLC5 families of glucose transport proteins in eel swimbladder tissue: the influence of silvering and the influence of a nematode infection.

    Science.gov (United States)

    Schneebauer, Gabriel; Mauracher, David; Fiechtner, Birgit; Pelster, Bernd

    2018-04-01

    The rate of glucose metabolism has been shown to be correlated to glucose uptake in swimbladder gas gland cells. Therefore, it is assumed that in the European eel silvering, i.e., the preparation of the eel for the spawning migration to the Sargasso Sea, coincides with an enhanced capacity for glucose uptake. To test this hypothesis expression of all known glucose transport proteins has been assessed at the transcript level in yellow and in silver eels, and we also included Anguillicola crassus infected swimbladders. Glucose uptake by rete mirabile endothelial cells could be crucial for the countercurrent exchange capacity of the rete. Therefore, this tissue was also included in our analysis. The results revealed expression of ten different members of the slc2 family of glucose transporters, of four slc5 family members, and of kiaa1919 in gas gland tissue. Glucose transporters of the slc2 family were expressed at very high level, and slc2a1b made up about 80% of all slc2 family members, irrespective of the developmental state or the infection status of the eel. Overall, the slc5 family contributed to only about 8% of all detected glucose transport transcripts in gas gland tissue, and the slc2 family to more than 85%. In rete capillaries, the contribution of sodium-dependent glucose transporters was significantly higher, leaving only 66% for the slc2 family of glucose transporters. Neither silvering nor the infection status had a significant effect on the expression of glucose transporters in swimbladder gas gland tissue, suggesting that glucose metabolism of eel gas gland cells may not be related to transcriptional changes of glucose transport proteins.

  7. The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters*

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

  8. Regulators of Slc4 bicarbonate transporter activity

    Directory of Open Access Journals (Sweden)

    Ian M. Thornell

    2015-06-01

    Full Text Available The Slc4 family of transporters is comprised of anion exchangers (AE1-4, Na-coupled bicarbonate transporters (NCBTs including electrogenic Na/bicarbonate cotransporters (NBCe1 and NBCe2, electroneutral Na/bicarbonate cotransporters (NBCn1 and NBCn2, and the electroneutral Na-driven Cl-bicarbonate exchanger (NDCBE, as well as a borate transporter (BTR1. These transporters regulate intracellular pH (pHi and contribute to steady-state pHi, but are also involved in other physiological processes including CO2 carriage by red blood cells and solute secretion/reabsorption across epithelia. Acid-base transporters function as either acid extruders or acid loaders, with the Slc4 proteins moving HCO3– either into or out of cells. According to results from both molecular and functional studies, multiple Slc4 proteins and/or associated splice variants with similar expected effects on pHi are often found in the same tissue or cell. Such apparent redundancy is likely to be physiologically important. In addition to regulating pHi, a HCO3– transporter contributes to a cell’s ability to fine tune the intracellular regulation of the cotransported/exchanged ion(s (e.g., Na+ or Cl–. In addition, functionally similar transporters or splice variants with different regulatory profiles will optimize pH physiology and solute transport under various conditions or within subcellular domains. Such optimization will depend on activated signaling pathways and transporter expression profiles. In this review, we will summarize and discuss both classical and more recently identified regulators of the Slc4 proteins. Some of these regulators include traditional second messengers, lipids, binding proteins, autoregulatory domains, and less conventional regulators. The material presented will provide insight into the diversity and physiological significance of multiple members within the Slc4 gene family.

  9. Metformin Is a Substrate and Inhibitor of the Human Thiamine Transporter, THTR-2 (SLC19A3).

    Science.gov (United States)

    Liang, Xiaomin; Chien, Huan-Chieh; Yee, Sook Wah; Giacomini, Marilyn M; Chen, Eugene C; Piao, Meiling; Hao, Jia; Twelves, Jolyn; Lepist, Eve-Irene; Ray, Adrian S; Giacomini, Kathleen M

    2015-12-07

    The biguanide metformin is widely used as first-line therapy for the treatment of type 2 diabetes. Predominately a cation at physiological pH's, metformin is transported by membrane transporters, which play major roles in its absorption and disposition. Recently, our laboratory demonstrated that organic cation transporter 1, OCT1, the major hepatic uptake transporter for metformin, was also the primary hepatic uptake transporter for thiamine, vitamin B1. In this study, we tested the reverse, i.e., that metformin is a substrate of thiamine transporters (THTR-1, SLC19A2, and THTR-2, SLC19A3). Our study demonstrated that human THTR-2 (hTHTR-2), SLC19A3, which is highly expressed in the small intestine, but not hTHTR-1, transports metformin (Km = 1.15 ± 0.2 mM) and other cationic compounds (MPP(+) and famotidine). The uptake mechanism for hTHTR-2 was pH and electrochemical gradient sensitive. Furthermore, metformin as well as other drugs including phenformin, chloroquine, verapamil, famotidine, and amprolium inhibited hTHTR-2 mediated uptake of both thiamine and metformin. Species differences in the substrate specificity of THTR-2 between human and mouse orthologues were observed. Taken together, our data suggest that hTHTR-2 may play a role in the intestinal absorption and tissue distribution of metformin and other organic cations and that the transporter may be a target for drug-drug and drug-nutrient interactions.

  10. Association between a genetic variant in the serotonin transporter gene (SLC6A4 and suicidal behavior in patients with schizophrenia

    Directory of Open Access Journals (Sweden)

    Lindholm Carlström Eva

    2012-05-01

    Full Text Available Abstract Background The serotonin (5-hydroxytryptamin; 5-HT system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT is associated with schizophrenia and suicidal behavior. In this study, we wanted to elucidate whether SLC6A4 variations is involved in attempted suicide among patients with schizophrenia in a Scandinavian case–control sample. Methods Patients diagnosed with schizophrenia from three Scandinavian samples were assessed for presence or absence of suicide attempts, based on record reviews and interview data. Seven SLC6A4 single nucleotide polymorphisms (SNPs were genotyped in 837 schizophrenia patients and 1,473 control individuals. Association analyses and statistical evaluations were performed with the program UNPHASED (version 3.0.9. Results We observed an allele association between the SNP rs16965628, located in intron one of SLC6A4, and attempted suicide (adjusted p-value 0.01, among patients with schizophrenia. No association was found to a diagnosis of schizophrenia, when patients were compared to healthy control individuals. Conclusion The gene SLC6A4 appears to be involved in suicidal ideation among patients with schizophrenia. Independent replication is needed before more firm conclusions can be drawn.

  11. Drug Clearance from Cerebrospinal Fluid Mediated by Organic Anion Transporters 1 (Slc22a6) and 3 (Slc22a8) at Arachnoid Membrane of Rats.

    Science.gov (United States)

    Zhang, Zhengyu; Tachikawa, Masanori; Uchida, Yasuo; Terasaki, Tetsuya

    2018-03-05

    Although arachnoid mater epithelial cells form the blood-arachnoid barrier (BAB), acting as a blood-CSF interface, it has been generally considered that the BAB is impermeable to water-soluble substances and plays a largely passive role. Here, we aimed to clarify the function of transporters at the BAB in regulating CSF clearance of water-soluble organic anion drugs based on quantitative targeted absolute proteomics (QTAP) and in vivo analyses. Protein expression levels of 61 molecules, including 19 ATP-binding-cassette (ABC) transporters and 32 solute-carrier (SLC) transporters, were measured in plasma membrane fraction of rat leptomeninges using QTAP. Thirty-three proteins were detected; others were under the quantification limits. Expression levels of multidrug resistance protein 1 (Mdr1a/P-gp/Abcb1a) and breast cancer resistance protein (Bcrp/Abcg2) were 16.6 and 3.27 fmol/μg protein (51.9- and 9.82-fold greater than in choroid plexus, respectively). Among those organic anion transporters detected only at leptomeninges, not choroid plexus, organic anion transporter 1 (oat1/Slc22a6) showed the greatest expression (2.73 fmol/μg protein). On the other hand, the protein expression level of oat3 at leptomeninges was 6.65 fmol/μg protein, and the difference from choroid plexus was within two-fold. To investigate oat1's role, we injected para-aminohippuric acid (PAH) with or without oat1 inhibitors into cisterna magna (to minimize the contribution of choroid plexus function) of rats. A bulk flow marker, FITC-inulin, was not taken up from CSF up to 15 min, whereas uptake clearance of PAH was 26.5 μL/min. PAH uptake was completely blocked by 3 mM cephalothin (inhibits both oat1 and oat3), while 17% of PAH uptake was inhibited by 0.2 mM cephalothin (selectively inhibits oat3). These results indicate that oat1 and oat3 at the BAB provide a distinct clearance pathway of organic anion drugs from CSF independently of choroid plexus.

  12. The renal urate transporter SLC17A1 locus: confirmation of association with gout.

    Science.gov (United States)

    Hollis-Moffatt, Jade E; Phipps-Green, Amanda J; Chapman, Brett; Jones, Gregory T; van Rij, Andre; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B; Montgomery, Grant W; Stamp, Lisa K; Dalbeth, Nicola; Merriman, Tony R

    2012-04-27

    Two major gout-causing genes have been identified, the urate transport genes SLC2A9 and ABCG2. Variation within the SLC17A1 locus, which encodes sodium-dependent phosphate transporter 1, a renal transporter of uric acid, has also been associated with serum urate concentration. However, evidence for association with gout is equivocal. We investigated the association of the SLC17A1 locus with gout in New Zealand sample sets. Five variants (rs1165196, rs1183201, rs9358890, rs3799344, rs12664474) were genotyped across a New Zealand sample set totaling 971 cases and 1,742 controls. Cases were ascertained according to American Rheumatism Association criteria. Two population groups were studied: Caucasian and Polynesian. At rs1183201 (SLC17A1), evidence for association with gout was observed in both the Caucasian (odds ratio (OR) = 0.67, P = 3.0 × 10-6) and Polynesian (OR = 0.74, P = 3.0 × 10-3) groups. Meta-analysis confirmed association of rs1183201 with gout at a genome-wide level of significance (OR = 0.70, P = 3.0 × 10-8). Haplotype analysis suggested the presence of a common protective haplotype. We confirm the SLC17A1 locus as the third associated with gout at a genome-wide level of significance.

  13. The human SLC25A33 and SLC25A36 genes of solute carrier family 25 encode two mitochondrial pyrimidine nucleotide transporters.

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-11-28

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Amino acid derivatives are substrates or non-transported inhibitors of the amino acid transporter PAT2 (slc36a2).

    Science.gov (United States)

    Edwards, Noel; Anderson, Catriona M H; Gatfield, Kelly M; Jevons, Mark P; Ganapathy, Vadivel; Thwaites, David T

    2011-01-01

    The H(+)-coupled amino acid transporter PAT2 (SLC36A2) transports the amino acids proline, glycine, alanine and hydroxyproline. A physiological role played by PAT2 in amino acid reabsorption in the renal proximal tubule is demonstrated by mutations in SLC36A2 that lead to an iminoglycinuric phenotype (imino acid and glycine uria) in humans. A number of proline, GABA and tryptophan derivatives were examined to determine if they function either as transported substrates or non-transported inhibitors of PAT2. The compounds were investigated following heterologous expression of rat PAT2 in Xenopus laevis oocytes. PAT2 function was characterised by: radiotracer uptake and competition (cis-inhibition) studies; radiotracer efflux and trans-stimulation; and measurement of substrate-induced positive inward current by two-electrode voltage-clamp. In general, the proline derivatives appeared to be transported substrates and the relative ability to induce current flow was closely related to the inhibitory effects on PAT2-mediated l-[(3)H]proline uptake. In contrast, certain heterocyclic GABA derivatives (e.g. l-pipecolic acid) were translocated only slowly. Finally, the tryptophan derivatives inhibited PAT2 function but did not undergo transport. l-Proline uptake was inhibited by 5-hydroxy-l-tryptophan (IC(50) 1.6±0.4mM), α-methyl-d,l-tryptophan (3.5±1.5mM), l-tryptophan, 1-methyl-l-tryptophan and indole-3-propionic acid. Although neither 5-hydroxy-l-tryptophan nor α-methyl-d,l-tryptophan were able to elicit inward current in PAT2-expressing oocytes both reduced the current evoked by l-proline. 5-Hydroxy-l-tryptophan and α-methyl-d,l-tryptophan were unable to trans-stimulate l-proline efflux from PAT2-expressing oocytes, confirming that the two compounds act as non-transported blockers of PAT2. These two tryptophan derivatives should prove valuable experimental tools in future investigations of the physiological roles of PAT2. Copyright © 2010 Elsevier B.V. All rights

  15. Additive composite ABCG2, SLC2A9 and SLC22A12 scores of high-risk alleles with alcohol use modulate gout risk.

    Science.gov (United States)

    Tu, Hung-Pin; Chung, Chia-Min; Min-Shan Ko, Albert; Lee, Su-Shin; Lai, Han-Ming; Lee, Chien-Hung; Huang, Chung-Ming; Liu, Chiu-Shong; Ko, Ying-Chin

    2016-09-01

    The aim of the present study was to evaluate the contribution of urate transporter genes and alcohol use to the risk of gout/tophi. Eight variants of ABCG2, SLC2A9, SLC22A12, SLC22A11 and SLC17A3 were genotyped in male individuals in a case-control study with 157 gout (33% tophi), 106 asymptomatic hyperuricaemia and 295 control subjects from Taiwan. The multilocus profiles of the genetic risk scores for urate gene variants were used to evaluate the risk of asymptomatic hyperuricaemia, gout and tophi. ABCG2 Q141K (T), SLC2A9 rs1014290 (A) and SLC22A12 rs475688 (C) under an additive model and alcohol use independently predicted the risk of gout (respective odds ratio for each factor=2.48, 2.03, 1.95 and 2.48). The additive composite Q141K, rs1014290 and rs475688 scores of high-risk alleles were associated with gout risk (Pgout and tophi risk (P for interaction=0.0452, 0.0033). The synergistic effect of genetic urate score 5-6 and alcohol use indicates that these combined factors correlate with gout and tophi occurrence.

  16. SLC6A1 Mutation and Ketogenic Diet in Epilepsy With Myoclonic-Atonic Seizures.

    Science.gov (United States)

    Palmer, Samantha; Towne, Meghan C; Pearl, Phillip L; Pelletier, Renee C; Genetti, Casie A; Shi, Jiahai; Beggs, Alan H; Agrawal, Pankaj B; Brownstein, Catherine A

    2016-11-01

    Epilepsy with myoclonic-atonic seizures, also known as myoclonic-astatic epilepsy or Doose syndrome, has been recently linked to variants in the SLC6A1 gene. Epilepsy with myoclonic-atonic seizures is often refractory to antiepileptic drugs, and the ketogenic diet is known for treating medically intractable seizures, although the mechanism of action is largely unknown. We report a novel SLC6A1 variant in a patient with epilepsy with myoclonic-atonic seizures, analyze its effects, and suggest a mechanism of action for the ketogenic diet. We describe a ten-year-old girl with epilepsy with myoclonic-atonic seizures and a de novo SLC6A1 mutation who responded well to the ketogenic diet. She carried a c.491G>A mutation predicted to cause p.Cys164Tyr amino acid change, which was identified using whole exome sequencing and confirmed by Sanger sequencing. High-resolution structural modeling was used to analyze the likely effects of the mutation. The SLC6A1 gene encodes a transporter that removes gamma-aminobutyric acid from the synaptic cleft. Mutations in SLC6A1 are known to disrupt the gamma-aminobutyric acid transporter protein 1, affecting gamma-aminobutyric acid levels and causing seizures. The p.Cys164Tyr variant found in our study has not been previously reported, expanding on the variants linked to epilepsy with myoclonic-atonic seizures. A 10-year-old girl with a novel SLC6A1 mutation and epilepsy with myoclonic-atonic seizures had an excellent clinical response to the ketogenic diet. An effect of the diet on gamma-aminobutyric acid reuptake mediated by gamma-aminobutyric acid transporter protein 1 is suggested. A personalized approach to epilepsy with myoclonic-atonic seizures patients carrying SLC6A1 mutation and a relationship between epilepsy with myoclonic-atonic seizures due to SLC6A1 mutations, GABAergic drugs, and the ketogenic diet warrants further exploration. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Intramolecular cross-linking in a bacterial homolog of mammalian SLC6 neurotransmitter transporters suggests an evolutionary conserved role of transmembrane segments 7 and 8

    DEFF Research Database (Denmark)

    Kniazeff, Julie; Loland, Claus Juul; Goldberg, Naomi

    2005-01-01

    The extracellular concentration of the neurotransmitters dopamine, serotonin, norepinephrine, GABA and glycine is tightly controlled by plasma membrane transporters belonging to the SLC6 gene family. A very large number of putative transport proteins with a remarkable homology to the SLC6...... proximity between TM 7 and 8 in the tertiary structure of TnaT as previously suggested for the mammalian counterparts. Furthermore, the inhibition of uptake upon cross-linking the two cysteines provides indirect support for a conserved conformational role of these transmembrane domains in the transport...

  18. Genetic analysis of the GLUT10 glucose transporter (SLC2A10 polymorphisms in Caucasian American type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Mychaleckyj Josyf C

    2005-12-01

    Full Text Available Abstract Background GLUT10 (gene symbol SLC2A10 is a facilitative glucose transporter within the type 2 diabetes (T2DM-linked region on chromosome 20q12-13.1. Therefore, we evaluated GLUT10 as a positional candidate gene for T2DM in Caucasian Americans. Methods Twenty SNPs including 4 coding, 10 intronic and 6 5' and 3' to the coding sequence were genotyped across a 100 kb region containing the SLC2A10 gene in DNAs from 300 T2DM cases and 310 controls using the Sequenom MassArray Genotyping System. Allelic association was evaluated, and linkage disequilibrium (LD and haplotype structure of SLC2A10 were also determined to assess whether any specific haplotypes were associated with T2DM. Results Of these variants, fifteen had heterozygosities greater than 0.80 and were analyzed further for association with T2DM. No evidence of significant association was observed for any variant with T2DM (all P ≥ 0.05, including Ala206Thr (rs2235491 which was previously reported to be associated with fasting insulin. Linkage disequilibrium analysis suggests that the SLC2A10 gene is contained in a single haplotype block of 14 kb. Haplotype association analysis with T2DM did not reveal any significant differences between haplotype frequencies in T2DM cases and controls. Conclusion From our findings, we can conclude that sequence variants in or near GLUT10 are unlikely to contribute significantly to T2DM in Caucasian Americans.

  19. Molecular Properties of Drugs Interacting with SLC22 Transporters OAT1, OAT3, OCT1, and OCT2: A Machine-Learning Approach.

    Science.gov (United States)

    Liu, Henry C; Goldenberg, Anne; Chen, Yuchen; Lun, Christina; Wu, Wei; Bush, Kevin T; Balac, Natasha; Rodriguez, Paul; Abagyan, Ruben; Nigam, Sanjay K

    2016-10-01

    Statistical analysis was performed on physicochemical descriptors of ∼250 drugs known to interact with one or more SLC22 "drug" transporters (i.e., SLC22A6 or OAT1, SLC22A8 or OAT3, SLC22A1 or OCT1, and SLC22A2 or OCT2), followed by application of machine-learning methods and wet laboratory testing of novel predictions. In addition to molecular charge, organic anion transporters (OATs) were found to prefer interacting with planar structures, whereas organic cation transporters (OCTs) interact with more three-dimensional structures (i.e., greater SP3 character). Moreover, compared with OAT1 ligands, OAT3 ligands possess more acyclic tetravalent bonds and have a more zwitterionic/cationic character. In contrast, OCT1 and OCT2 ligands were not clearly distinquishable form one another by the methods employed. Multiple pharmacophore models were generated on the basis of the drugs and, consistent with the machine-learning analyses, one unique pharmacophore created from ligands of OAT3 possessed cationic properties similar to OCT ligands; this was confirmed by quantitative atomic property field analysis. Virtual screening with this pharmacophore, followed by transport assays, identified several cationic drugs that selectively interact with OAT3 but not OAT1. Although the present analysis may be somewhat limited by the need to rely largely on inhibition data for modeling, wet laboratory/in vitro transport studies, as well as analysis of drug/metabolite handling in Oat and Oct knockout animals, support the general validity of the approach-which can also be applied to other SLC and ATP binding cassette drug transporters. This may make it possible to predict the molecular properties of a drug or metabolite necessary for interaction with the transporter(s), thereby enabling better prediction of drug-drug interactions and drug-metabolite interactions. Furthermore, understanding the overlapping specificities of OATs and OCTs in the context of dynamic transporter tissue

  20. Neurosteroid Transport in the Brain: Role of ABC and SLC Transporters

    Directory of Open Access Journals (Sweden)

    Markus Grube

    2018-04-01

    Full Text Available Neurosteroids, comprising pregnane, androstane, and sulfated steroids can alter neuronal excitability through interaction with ligand-gated ion channels and other receptors and have therefore a therapeutic potential in several brain disorders. They can be formed in brain cells or are synthesized by an endocrine gland and reach the brain by penetrating the blood–brain barrier (BBB. Especially sulfated steroids such as pregnenolone sulfate (PregS and dehydroepiandrosterone sulfate (DHEAS depend on transporter proteins to cross membranes. In this review, we discuss the involvement of ATP-binding cassette (ABC- and solute carrier (SLC-type membrane proteins in the transport of these compounds at the BBB and in the choroid plexus (CP, but also in the secretion from neurons and glial cells. Among the ABC transporters, especially BCRP (ABCG2 and several MRP/ABCC subfamily members (MRP1, MRP4, MRP8 are expressed in the brain and known to efflux conjugated steroids. Furthermore, several SLC transporters have been shown to mediate cellular uptake of steroid sulfates. These include members of the OATP/SLCO subfamily, namely OATP1A2 and OATP2B1, as well as OAT3 (SLC22A3, which have been reported to be expressed at the BBB, in the CP and in part in neurons. Furthermore, a role of the organic solute transporter OSTα-OSTβ (SLC51A/B in brain DHEAS/PregS homeostasis has been proposed. This transporter was reported to be localized especially in steroidogenic cells of the cerebellum and hippocampus. To date, the impact of transporters on neurosteroid homeostasis is still poorly understood. Further insights are desirable also with regard to the therapeutic potential of these compounds.

  1. Diversity in the glucose transporter-4 gene (SLC2A4 in humans reflects the action of natural selection along the old-world primates evolution.

    Directory of Open Access Journals (Sweden)

    Eduardo Tarazona-Santos

    Full Text Available BACKGROUND: Glucose is an important source of energy for living organisms. In vertebrates it is ingested with the diet and transported into the cells by conserved mechanisms and molecules, such as the trans-membrane Glucose Transporters (GLUTs. Members of this family have tissue specific expression, biochemical properties and physiologic functions that together regulate glucose levels and distribution. GLUT4 -coded by SLC2A4 (17p13 is an insulin-sensitive transporter with a critical role in glucose homeostasis and diabetes pathogenesis, preferentially expressed in the adipose tissue, heart muscle and skeletal muscle. We tested the hypothesis that natural selection acted on SLC2A4. METHODOLOGY/PRINCIPAL FINDINGS: We re-sequenced SLC2A4 and genotyped 104 SNPs along a approximately 1 Mb region flanking this gene in 102 ethnically diverse individuals. Across the studied populations (African, European, Asian and Latin-American, all the eight common SNPs are concentrated in the N-terminal region upstream of exon 7 ( approximately 3700 bp, while the C-terminal region downstream of intron 6 ( approximately 2600 bp harbors only 6 singletons, a pattern that is not compatible with neutrality for this part of the gene. Tests of neutrality based on comparative genomics suggest that: (1 episodes of natural selection (likely a selective sweep predating the coalescent of human lineages, within the last 25 million years, account for the observed reduced diversity downstream of intron 6 and, (2 the target of natural selection may not be in the SLC2A4 coding sequence. CONCLUSIONS: We propose that the contrast in the pattern of genetic variation between the N-terminal and C-terminal regions are signatures of the action of natural selection and thus follow-up studies should investigate the functional importance of different regions of the SLC2A4 gene.

  2. Interaction of GABA-mimetics with the taurine transporter (TauT, Slc6a6) in hyperosmotic treated caco-2, LLC-PK1 and rat renal SKPT cells

    DEFF Research Database (Denmark)

    Rasmussen, Rune Nørgaard; Lagunas, Candela; Plum, Jakob Munk

    2016-01-01

    The aim of the present study was to investigate if basic GABA-mimetics interact with the taurine transporter (TauT, Slc6a6), and to find a suitable cell based model that is robust towards extracellular changes in osmolality during uptake studies. Taurine uptake was measured in human Caco-2 cells....... Uptake of the GABA-mimetics gaboxadol and vigabatrin was investigated in SKPT cells, and quantified by liquid scintillation or HPLC-MS/MS analysis, respectively. The uptake rate of [(3)H]-taurine was Na(+) and Cl(-) and concentration dependent with taurine with an apparent Vmax of 6.3±1.6pmolcm(-2)min(-1......) and a Km of 24.9±15.0μM. β-alanine, nipecotic acid, gaboxadol, GABA, vigabatrin, δ-ALA and guvacine inhibited the taurine uptake rate in a concentration dependent manner. The order of affinity for TauT was β-alanine>GABA>nipecotic acid>guvacine>δ-ALA>vigabatrin>gaboxadol with IC50-values of 0.04, 1.07, 2...

  3. Association between a genetic variant in the serotonin transporter gene (SLC6A4) and suicidal behavior in patients with schizophrenia

    DEFF Research Database (Denmark)

    Lindholm Carlstrom, Eva; Saetre, Peter; Rosengren, Anders

    2012-01-01

    ABSTRACT: BACKGROUND: The serotonin (5-hydroxytryptamin; 5-HT) system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT) is associated with schizophrenia and suicidal behavior. ...

  4. Na(+) dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies

    DEFF Research Database (Denmark)

    Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D

    2013-01-01

    The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells....... Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular p...

  5. Study of the serotonin transporter (SLC6A4 and BDNF genes in French patients with non syndromic mental deficiency

    Directory of Open Access Journals (Sweden)

    Mignon Laurence

    2010-02-01

    Full Text Available Abstract Background Mental deficiency has been linked to abnormalities in cortical neuronal network connectivity and plasticity. These mechanisms are in part under the control of two interacting signalling pathways, the serotonergic and the brain-derived neurotrophic (BDNF pathways. The aim of the current paper is to determine whether particular alleles or genotypes of two crucial genes of these systems, the serotonin transporter gene (SLC6A4 and the brain-derived neurotrophic factor gene (BDNF, are associated with mental deficiency (MD. Methods We analyzed four functional polymorphisms (rs25531, 5-HTTLPR, VNTR, rs3813034 of the SLC6A4 gene and one functional polymorphism (Val66 Met of the BDNF gene in 98 patients with non-syndromic mental deficiency (NS-MD and in an ethnically matched control population of 251 individuals. Results We found no significant differences in allele and genotype frequencies in the five polymorphisms studied in the SLC6A4 and BDNF genes of NS-MD patients versus control patients. While the comparison of the patterns of linkage disequilibrium (D' in the control and NS-MD populations revealed a degree of variability it did not, however, reach significance. No significant differences in frequencies of haplotypes and genotypes for VNTR/rs3813034 and rs25531/5-HTTLPR were observed. Conclusion Altogether, results from the present study do not support a role for any of the five functional polymorphisms of SLC6A4 and BDNF genes in the aetiology of NS-RM. Moreover, they suggest no epistatic interaction in NS-MD between polymorphisms in BDNF and SLC6A4. However, we suggest that further studies on these two pathways in NS-MD remain necessary.

  6. Activation of lysosomal P2X4 by ATP transported into lysosomes via VNUT/SLC17A9 using V‐ATPase generated voltage gradient as the driving force

    Science.gov (United States)

    Zhong, Xi Zoë; Cao, Qi; Sun, Xue

    2016-01-01

    Key points SLC17A9 proteins function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation.P2X4 receptors act as lysosomal ion channels activated by luminal ATP.SLC17A9‐mediated ATP transport across the lysosomal membrane is suppressed by Bafilomycin A1, the V‐ATPase inhibitor.SLC17A9 mainly uses voltage gradient but not pH gradient generated by the V‐ATPase as the driving force to transport ATP into the lysosome to activate P2X4. Abstract The lysosome contains abundant ATP which plays important roles in lysosome functions and in cell signalling. Recently, solute carrier family 17 member 9 (SLC17A9, also known as VNUT for vesicular nucleotide transporter) proteins were suggested to function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation, and P2X4 receptors were suggested to be lysosomal ion channels that are activated by luminal ATP. However, the molecular mechanism of SLC17A9 transporting ATP and the regulatory mechanism of lysosomal P2X4 are largely unknown. In this study, we report that SLC17A9‐mediated ATP transport across lysosomal membranes is suppressed by Bafilomycin A1, the V‐ATPase inhibitor. By measuring P2X4 activity, which is indicative of ATP transport across lysosomal membranes, we further demonstrated that SLC17A9 mainly uses voltage gradient but not pH gradient as the driving force to transport ATP into lysosomes. This study provides a molecular mechanism for lysosomal ATP transport mediated by SLC17A9. It also suggests a regulatory mechanism of lysosomal P2X4 by SLC17A9. PMID:27477609

  7. Plasma Membrane Na+-Coupled Citrate Transporter (SLC13A5 and Neonatal Epileptic Encephalopathy

    Directory of Open Access Journals (Sweden)

    Yangzom D. Bhutia

    2017-02-01

    Full Text Available SLC13A5 is a Na+-coupled transporter for citrate that is expressed in the plasma membrane of specific cell types in the liver, testis, and brain. It is an electrogenic transporter with a Na+:citrate3− stoichiometry of 4:1. In humans, the Michaelis constant for SLC13A5 to transport citrate is ~600 μM, which is physiologically relevant given that the normal concentration of citrate in plasma is in the range of 150–200 μM. Li+ stimulates the transport function of human SLC13A5 at concentrations that are in the therapeutic range in patients on lithium therapy. Human SLC13A5 differs from rodent Slc13a5 in two important aspects: the affinity of the human transporter for citrate is ~30-fold less than that of the rodent transporter, thus making human SLC13A5 a low-affinity/high-capacity transporter and the rodent Slc13a5 a high-affinity/low-capacity transporter. In the liver, SLC13A5 is expressed exclusively in the sinusoidal membrane of the hepatocytes, where it plays a role in the uptake of circulating citrate from the sinusoidal blood for metabolic use. In the testis, the transporter is expressed only in spermatozoa, which is also only in the mid piece where mitochondria are located; the likely function of the transporter in spermatozoa is to mediate the uptake of citrate present at high levels in the seminal fluid for subsequent metabolism in the sperm mitochondria to generate biological energy, thereby supporting sperm motility. In the brain, the transporter is expressed mostly in neurons. As astrocytes secrete citrate into extracellular medium, the potential function of SLC13A5 in neurons is to mediate the uptake of circulating citrate and astrocyte-released citrate for subsequent metabolism. Slc13a5-knockout mice have been generated; these mice do not have any overt phenotype but are resistant to experimentally induced metabolic syndrome. Recently however, loss-of-function mutations in human SLC13A5 have been found to cause severe epilepsy

  8. Loss-of-function mutations in SLC30A8 protect against type 2 diabetes.

    Science.gov (United States)

    Flannick, Jason; Thorleifsson, Gudmar; Beer, Nicola L; Jacobs, Suzanne B R; Grarup, Niels; Burtt, Noël P; Mahajan, Anubha; Fuchsberger, Christian; Atzmon, Gil; Benediktsson, Rafn; Blangero, John; Bowden, Don W; Brandslund, Ivan; Brosnan, Julia; Burslem, Frank; Chambers, John; Cho, Yoon Shin; Christensen, Cramer; Douglas, Desirée A; Duggirala, Ravindranath; Dymek, Zachary; Farjoun, Yossi; Fennell, Timothy; Fontanillas, Pierre; Forsén, Tom; Gabriel, Stacey; Glaser, Benjamin; Gudbjartsson, Daniel F; Hanis, Craig; Hansen, Torben; Hreidarsson, Astradur B; Hveem, Kristian; Ingelsson, Erik; Isomaa, Bo; Johansson, Stefan; Jørgensen, Torben; Jørgensen, Marit Eika; Kathiresan, Sekar; Kong, Augustine; Kooner, Jaspal; Kravic, Jasmina; Laakso, Markku; Lee, Jong-Young; Lind, Lars; Lindgren, Cecilia M; Linneberg, Allan; Masson, Gisli; Meitinger, Thomas; Mohlke, Karen L; Molven, Anders; Morris, Andrew P; Potluri, Shobha; Rauramaa, Rainer; Ribel-Madsen, Rasmus; Richard, Ann-Marie; Rolph, Tim; Salomaa, Veikko; Segrè, Ayellet V; Skärstrand, Hanna; Steinthorsdottir, Valgerdur; Stringham, Heather M; Sulem, Patrick; Tai, E Shyong; Teo, Yik Ying; Teslovich, Tanya; Thorsteinsdottir, Unnur; Trimmer, Jeff K; Tuomi, Tiinamaija; Tuomilehto, Jaakko; Vaziri-Sani, Fariba; Voight, Benjamin F; Wilson, James G; Boehnke, Michael; McCarthy, Mark I; Njølstad, Pål R; Pedersen, Oluf; Groop, Leif; Cox, David R; Stefansson, Kari; Altshuler, David

    2014-04-01

    Loss-of-function mutations protective against human disease provide in vivo validation of therapeutic targets, but none have yet been described for type 2 diabetes (T2D). Through sequencing or genotyping of ~150,000 individuals across 5 ancestry groups, we identified 12 rare protein-truncating variants in SLC30A8, which encodes an islet zinc transporter (ZnT8) and harbors a common variant (p.Trp325Arg) associated with T2D risk and glucose and proinsulin levels. Collectively, carriers of protein-truncating variants had 65% reduced T2D risk (P = 1.7 × 10(-6)), and non-diabetic Icelandic carriers of a frameshift variant (p.Lys34Serfs*50) demonstrated reduced glucose levels (-0.17 s.d., P = 4.6 × 10(-4)). The two most common protein-truncating variants (p.Arg138* and p.Lys34Serfs*50) individually associate with T2D protection and encode unstable ZnT8 proteins. Previous functional study of SLC30A8 suggested that reduced zinc transport increases T2D risk, and phenotypic heterogeneity was observed in mouse Slc30a8 knockouts. In contrast, loss-of-function mutations in humans provide strong evidence that SLC30A8 haploinsufficiency protects against T2D, suggesting ZnT8 inhibition as a therapeutic strategy in T2D prevention.

  9. Effect of SLC34A2 gene mutation on extracellular phosphorus transport in PAM alveolar epithelial cells.

    Science.gov (United States)

    Ma, Tiangang; Qu, Danhua; Yan, Bingdi; Zhang, Qinghua; Ren, Jin; Hu, Yanbing

    2018-01-01

    A mutation in the IIb sodium phosphate transporter SLC34A2 gene has recently been described in pulmonary alveolar microlithiasis (PAM) patients. Experiments in this study were aimed at confirming the role of the gene product in PAM by comparing phosphorylated products in extracellular fluid of alveolar epithelial cells overexpressing the SLC34A2 gene or its mutated version. Eukaryotic expression vectors were constructed and transfected into A549 human alveolar epithelial cells. There were three groups of cells including those transfected with empty vector plasmid pcDNA3.1(+) (plasmid control group), those transfected with normal SLC34A2 gene expressed from pcDNA3.1 (normal control group), and those transfected with a version of the PAM SLC34A2 gene linked to the pcDNA3.1(+) (PAM group). Transfection efficiencies were detected by reverse transcription-polymerase chain reaction (RT-PCR). At 48 h after transfection, the concentration of inorganic phosphorus in the culture medium was detected using an automatic biochemical analyzer. Our results showed the concentration of inorganic phosphorus in the supernatant of the normal control group was significantly lower than that in the plasmid control and PAM groups (PPAM group was significantly lower than that in the plasmid control group (PPAM patients, given that the function of the phosphate transporter seems to be affected and it is conceivable that it would lead to extracellular fluid alterations in vivo .

  10. Impaired riboflavin transport due to missense mutations in SLC52A2 causes Brown-Vialetto-Van Laere syndrome

    OpenAIRE

    Haack, Tobias B.; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A.; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M.; Meitinger, Thomas; Yonezawa, Atsushi

    2012-01-01

    Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin tran...

  11. Sequence variation and linkage disequilibrium in the GABA transporter-1 gene (SLC6A1 in five populations: implications for pharmacogenetic research

    Directory of Open Access Journals (Sweden)

    Sughondhabirom Atapol

    2007-10-01

    Full Text Available Abstract Background GABA transporter-1 (GAT-1; genetic locus SLC6A1 is emerging as a novel target for treatment of neuropsychiatric disorders. To understand how population differences might influence strategies for pharmacogenetic studies, we identified patterns of genetic variation and linkage disequilibrium (LD in SLC6A1 in five populations representing three continental groups. Results We resequenced 12.4 kb of SLC6A1, including the promoters, exons and flanking intronic regions in African-American, Thai, Hmong, Finnish, and European-American subjects (total n = 40. LD in SLC6A1 was examined by genotyping 16 SNPs in larger samples. Sixty-three variants were identified through resequencing. Common population-specific variants were found in African-Americans, including a novel 21-bp promoter region variable number tandem repeat (VNTR, but no such variants were found in any of the other populations studied. Low levels of LD and the absence of major LD blocks were characteristic of all five populations. African-Americans had the highest genetic diversity. European-Americans and Finns did not differ in genetic diversity or LD patterns. Although the Hmong had the highest level of LD, our results suggest that a strategy based on the use of tag SNPs would not translate to a major improvement in genotyping efficiency. Conclusion Owing to the low level of LD and presence of recombination hotspots, SLC6A1 may be an example of a problematic gene for association and haplotype tagging-based genetic studies. The 21-bp promoter region VNTR polymorphism is a putatively functional candidate allele for studies focusing on variation in GAT-1 function in the African-American population.

  12. Comprehensive phenotype/genotype analyses of the norepinephrine transporter gene (SLC6A2 in ADHD: relation to maternal smoking during pregnancy.

    Directory of Open Access Journals (Sweden)

    Geeta A Thakur

    Full Text Available Despite strong pharmacological evidence implicating the norepinephrine transporter in ADHD, genetic studies have yielded largely insignificant results. We tested the association between 30 tag SNPs within the SLC6A2 gene and ADHD, with stratification based on maternal smoking during pregnancy, an environmental factor strongly associated with ADHD.Children (6-12 years old diagnosed with ADHD according to DSM-IV criteria were comprehensively evaluated with regard to several behavioral and cognitive dimensions of ADHD as well as response to a fixed dose of methylphenidate (MPH using a double-blind placebo controlled crossover trial. Family-based association tests (FBAT, including categorical and quantitative trait analyses, were conducted in 377 nuclear families.A highly significant association was observed with rs36021 (and linked SNPs in the group where mothers smoked during pregnancy. Association was noted with categorical DSM-IV ADHD diagnosis (Z=3.74, P=0.0002, behavioral assessments by parents (CBCL, P=0.00008, as well as restless-impulsive subscale scores on Conners'-teachers (P=0.006 and parents (P=0.006. In this subgroup, significant association was also observed with cognitive deficits, more specifically sustained attention, spatial working memory, planning, and response inhibition. The risk allele was associated with significant improvement of behavior as measured by research staff (Z=3.28, P=0.001, parents (Z=2.62, P=0.009, as well as evaluation in the simulated academic environment (Z=3.58, P=0.0003.By using maternal smoking during pregnancy to index a putatively more homogeneous group of ADHD, highly significant associations were observed between tag SNPs within SLC6A2 and ADHD diagnosis, behavioral and cognitive measures relevant to ADHD and response to MPH. This comprehensive phenotype/genotype analysis may help to further understand this complex disorder and improve its treatment. Clinical trial registration information - Clinical

  13. SLC52A2 [p.P141T] and SLC52A3 [p.N21S] causing Brown-Vialetto-Van Laere Syndrome in an Indian patient: First genetically proven case with mutations in two riboflavin transporters.

    Science.gov (United States)

    Udhayabanu, Tamilarasan; Subramanian, Veedamali S; Teafatiller, Trevor; Gowda, Vykuntaraju K; Raghavan, Varun S; Varalakshmi, Perumal; Said, Hamid M; Ashokkumar, Balasubramaniem

    2016-11-01

    Brown-Vialetto-Van Laere Syndrome (BVVLS), a rare neurological disorder characterized by bulbar palsies and sensorineural deafness, is mainly associated with defective riboflavin transporters encoded by the SLC52A2 and SLC52A3 genes. Here we present a 16-year-old BVVLS patient belonging to a five generation consanguineous family from Indian ethnicity with two homozygous missense mutations viz., c.421C>A [p.P141T] in SLC52A2 and c.62A>G [p.N21S] in SLC52A3. Functional characterization based on 3 H-riboflavin uptake assay and live-cell confocal imaging revealed that the effect of mutation c.421C>A [p.P141T] identified in SLC52A2 had a slight reduction in riboflavin uptake; on the other hand, the c.62A>G [p.N21S] identified in SLC52A3 showed a drastic reduction in riboflavin uptake, which appeared to be due to impaired trafficking and membrane targeting of the hRFVT-3 protein. This is the first report presenting mutations in both riboflavin transporters hRFVT-2 and hRFVT-3 in the same BVVLS patient. Also, c.62A>G [p.N21S] in SLC52A3 appears to contribute more to the disease phenotype in this patient than c.421C>A [p.P141T] in SLC52A2. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Differential expression of the Slc4 bicarbonate transporter family in murine corneal endothelium and cell culture.

    Science.gov (United States)

    Shei, William; Liu, Jun; Htoon, Hla M; Aung, Tin; Vithana, Eranga N

    2013-01-01

    To characterize the relative expression levels of all the solute carrier 4 (Slc4) transporter family members (Slc4a1-Slc4a11) in murine corneal endothelium using real-time quantitative (qPCR), to identify further important members besides Slc4a11 and Slc4a4, and to explore how close to the baseline levels the gene expressions remain after cells have been subjected to expansion and culture. Descemet's membrane-endothelial layers of 8-10-week-old C57BL6 mice were stripped from corneas and used for both primary cell culture and direct RNA extraction. Total RNA (from uncultured cells as well as cultured cells at passages 2 and 7) was reverse transcribed, and the cDNA was used for real time qPCR using specific primers for all the Slc4 family members. The geNorm method was applied to determine the most stable housekeeping genes and normalization factor, which was calculated from multiple housekeeping genes for more accurate and robust quantification. qPCR analyses revealed that all Slc4 bicarbonate transporter family members were expressed in mouse corneal endothelium. Slc4a11 showed the highest expression, which was approximately three times higher than that of Slc4a4 (3.4±0.3; p=0.004). All Slc4 genes were also expressed in cultured cells, and interestingly, the expression of Slc4a11 in cultured cells was significantly reduced by approximately 20-fold (0.05±0.001; p=0.000001) in early passage and by approximately sevenfold (0.14±0.002; p=0.000002) in late passage cells. Given the known involvement of SLC4A4 and SLC4A11 in corneal dystrophies, we speculate that the other two highly expressed genes in the uncultured corneal endothelium, SLC4A2 and SLC4A7, are worthy of being considered as potential candidate genes for corneal endothelial diseases. Moreover, as cell culture can affect expression levels of Slc4 genes, caution and careful design of experiments are necessary when undertaking studies of Slc4-mediated ion transport in cultured cells.

  15. The cyanobacterial bicarbonate transporter BicA: its physiological role and the implications of structural similarities with human SLC26 transporters.

    Science.gov (United States)

    Price, G Dean; Howitt, Susan M

    2011-04-01

    The cyanobacterial Na+-dependent HCO3- transporter BicA is a member of the ubiquitous and important SulP/SLC26 family of anion transporters found in eukaryotes and prokaryotes. BicA is an important component of the cyanobacterial CO2 concentrating mechanism, an adaptation that contributes to cyanobacteria being able to achieve an estimated 25% of global primary productivity, largely in the oceans. The human SLC26 members are involved in a range of key cellular functions involving a diverse range of anion transport activities including Cl-/HCO3-, I-/HCO3-, and SO42-/HCO3- exchange; mutations in SLC26 members are known to be associated with debilitating diseases such as Pendred syndrome, chondrodysplasias, and congenital chloride diarrhoea. We have recently experimentally determined the membrane topology of BicA using the phoA-lacZ reporter system and here consider some of the extrapolated implications for topology of the human SLC26 family and the Sultr plant sulphate transporters.

  16. The mammalian phosphate carrier SLC25A3 is a mitochondrial copper transporter required for cytochrome c oxidase biogenesis.

    Science.gov (United States)

    Boulet, Aren; Vest, Katherine E; Maynard, Margaret K; Gammon, Micah G; Russell, Antoinette C; Mathews, Alexander T; Cole, Shelbie E; Zhu, Xinyu; Phillips, Casey B; Kwong, Jennifer Q; Dodani, Sheel C; Leary, Scot C; Cobine, Paul A

    2018-02-09

    Copper is required for the activity of cytochrome c oxidase (COX), the terminal electron-accepting complex of the mitochondrial respiratory chain. The likely source of copper used for COX biogenesis is a labile pool found in the mitochondrial matrix. In mammals, the proteins that transport copper across the inner mitochondrial membrane remain unknown. We previously reported that the mitochondrial carrier family protein Pic2 in budding yeast is a copper importer. The closest Pic2 ortholog in mammalian cells is the mitochondrial phosphate carrier SLC25A3. Here, to investigate whether SLC25A3 also transports copper, we manipulated its expression in several murine and human cell lines. SLC25A3 knockdown or deletion consistently resulted in an isolated COX deficiency in these cells, and copper addition to the culture medium suppressed these biochemical defects. Consistent with a conserved role for SLC25A3 in copper transport, its heterologous expression in yeast complemented copper-specific defects observed upon deletion of PIC2 Additionally, assays in Lactococcus lactis and in reconstituted liposomes directly demonstrated that SLC25A3 functions as a copper transporter. Taken together, these data indicate that SLC25A3 can transport copper both in vitro and in vivo . © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Treatment of intractable epilepsy in a female with SLC6A8 deficiency

    NARCIS (Netherlands)

    Mercimek-Mahmutoglu, S.; Connolly, M.B.; Poskitt, K.J.; Horvath, G.A.; Lowry, N.; Salomons, G.S.; Casey, B.; Sinclair, G.; Davis, C.; Jakobs, C.; Stockler-Ipsiroglu, S.

    2010-01-01

    A female heterozygous for a novel, disease causing, missense mutation in the X-linked cerebral creatine transporter (SLC6A8) gene (c.1067G > T, p.Gly356Val) presented with intractable epilepsy, mild intellectual disability and moderately reduced cerebral creatine levels. Treatment with creatine

  18. The emerging physiological roles of the SLC14A family of urea transporters

    Science.gov (United States)

    Stewart, Gavin

    2011-01-01

    In mammals, urea is the main nitrogenous breakdown product of protein catabolism and is produced in the liver. In certain tissues, the movement of urea across cell membranes is specifically mediated by a group of proteins known as the SLC14A family of facilitative urea transporters. These proteins are derived from two distinct genes, UT-A (SLC14A2) and UT-B (SLC14A1). Facilitative urea transporters play an important role in two major physiological processes – urinary concentration and urea nitrogen salvaging. Although UT-A and UT-B transporters both have a similar basic structure and mediate the transport of urea in a facilitative manner, there are a number of significant differences between them. UT-A transporters are mainly found in the kidney, are highly specific for urea, have relatively lower transport rates and are highly regulated at both gene expression and cellular localization levels. In contrast, UT-B transporters are more widespread in their tissue location, transport both urea and water, have a relatively high transport rate, are inhibited by mercurial compounds and currently appear to be less acutely regulated. This review details the fundamental research that has so far been performed to investigate the function and physiological significance of these two types of urea transporters. PMID:21449978

  19. Deletion of Slc26a1 and Slc26a7 Delays Enamel Mineralization in Mice

    Directory of Open Access Journals (Sweden)

    Kaifeng Yin

    2017-05-01

    Full Text Available Amelogenesis features two major developmental stages—secretory and maturation. During maturation stage, hydroxyapatite deposition and matrix turnover require delicate pH regulatory mechanisms mediated by multiple ion transporters. Several members of the Slc26 gene family (Slc26a1, Slc26a3, Slc26a4, Slc26a6, and Slc26a7, which exhibit bicarbonate transport activities, have been suggested by previous studies to be involved in maturation-stage amelogenesis, especially the key process of pH regulation. However, details regarding the functional role of these genes in enamel formation are yet to be clarified, as none of the separate mutant animal lines demonstrates any discernible enamel defects. Continuing with our previous investigation of Slc26a1−/− and Slc26a7−/− animal models, we generated a double-mutant animal line with the absence of both Slc26a1 and Slc26a7. We showed in the present study that the double-mutant enamel density was significantly lower in the regions that represent late maturation-, maturation- and secretory-stage enamel development in wild-type mandibular incisors. However, the “maturation” and “secretory” enamel microstructures in double-mutant animals resembled those observed in wild-type secretory and/or pre-secretory stages. Elemental composition analysis revealed a lack of mineral deposition and an accumulation of carbon and chloride in double-mutant enamel. Deletion of Slc26a1 and Slc26a7 did not affect the stage-specific morphology of the enamel organ. Finally, compensatory expression of pH regulator genes and ion transporters was detected in maturation-stage enamel organs of double-mutant animals when compared to wild-type. Combined with the findings from our previous study, these data indicate the involvement of SLC26A1and SLC26A7 as key ion transporters in the pH regulatory network during enamel maturation.

  20. Interaction of GABA-mimetics with the taurine transporter (TauT, Slc6a6) in hyperosmotic treated Caco-2, LLC-PK1 and rat renal SKPT cells.

    Science.gov (United States)

    Rasmussen, Rune Nørgaard; Lagunas, Candela; Plum, Jakob; Holm, René; Nielsen, Carsten Uhd

    2016-01-20

    The aim of the present study was to investigate if basic GABA-mimetics interact with the taurine transporter (TauT, Slc6a6), and to find a suitable cell based model that is robust towards extracellular changes in osmolality during uptake studies. Taurine uptake was measured in human Caco-2 cells, porcine LLC-PK1 cells, and rat SKPT cells using radiolabelled taurine. Hyperosmotic conditions were obtained by incubation with raffinose (final osmolality of 500mOsm) for 24h prior to the uptake experiments. Expression of the taurine transporter, TauT, was investigated at the mRNA level by real-time PCR. Uptake of the GABA-mimetics gaboxadol and vigabatrin was investigated in SKPT cells, and quantified by liquid scintillation or HPLC-MS/MS analysis, respectively. The uptake rate of [(3)H]-taurine was Na(+) and Cl(-) and concentration dependent with taurine with an apparent Vmax of 6.3±1.6pmolcm(-2)min(-1) and a Km of 24.9±15.0μM. β-alanine, nipecotic acid, gaboxadol, GABA, vigabatrin, δ-ALA and guvacine inhibited the taurine uptake rate in a concentration dependent manner. The order of affinity for TauT was β-alanine>GABA>nipecotic acid>guvacine>δ-ALA>vigabatrin>gaboxadol with IC50-values of 0.04, 1.07, 2.02, 4.19, 4.94, 31.4 and 39.9mM, respectively. In conclusion, GABA mimetics inhibited taurine uptake in hyperosmotic rat renal SKPT cells. SKPT cells, which seem to be a useful model for investigating taurine transport in the short-term presence of high concentrations of osmolytes. Furthermore, analogues of β-alanine appear to have higher affinities for TauT than GABA-analogues. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction

    Directory of Open Access Journals (Sweden)

    Yun-Fang Jia

    2017-07-01

    Full Text Available While downregulation of excitatory amino acid transporter 2 (EAAT2, the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD, the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR and thymine–adenine (TA cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150 with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32. In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009 and binge eating (p = 0.0002 remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156 in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.

  2. Sodium-coupled neutral amino acid (System N/A) transporters of the SLC38 gene family.

    Science.gov (United States)

    Mackenzie, Bryan; Erickson, Jeffrey D

    2004-02-01

    The sodium-coupled neutral amino acid transporters (SNAT) of the SLC38 gene family resemble the classically-described System A and System N transport activities in terms of their functional properties and patterns of regulation. Transport of small, aliphatic amino acids by System A subtypes (SNAT1, SNAT2, and SNAT4) is rheogenic and pH sensitive. The System N subtypes SNAT3 and SNAT5 also countertransport H(+), which may be key to their operation in reverse, and have narrower substrate profiles than do the System A subtypes. Glutamine emerges as a favored substrate throughout the family, except for SNAT4. The SLC38 transporters undoubtedly play many physiological roles including the transfer of glutamine from astrocyte to neuron in the CNS, ammonia detoxification and gluconeogenesis in the liver, and the renal response to acidosis. Probing their regulation has revealed additional roles, and recent work has considered SLC38 transporters as therapeutic targets in neoplasia.

  3. The solute carrier 6 family of transporters

    DEFF Research Database (Denmark)

    Bröer, Stefan; Gether, Ulrik

    2012-01-01

    of these transporters is associated with a variety of diseases. Pharmacological inhibition of the neurotransmitter transporters in this family is an important strategy in the management of neurological and psychiatric disorders. This review provides an overview of the biochemical and pharmacological properties......The solute carrier 6 (SLC6) family of the human genome comprises transporters for neurotransmitters, amino acids, osmolytes and energy metabolites. Members of this family play critical roles in neurotransmission, cellular and whole body homeostasis. Malfunction or altered expression...... of the SLC6 family transporters....

  4. Deletion of the γ-Aminobutyric Acid Transporter 2 (GAT2 and SLC6A13) Gene in Mice Leads to Changes in Liver and Brain Taurine Contents*

    Science.gov (United States)

    Zhou, Yun; Holmseth, Silvia; Guo, Caiying; Hassel, Bjørnar; Höfner, Georg; Huitfeldt, Henrik S.; Wanner, Klaus T.; Danbolt, Niels C.

    2012-01-01

    The GABA transporters (GAT1, GAT2, GAT3, and BGT1) have mostly been discussed in relation to their potential roles in controlling the action of transmitter GABA in the nervous system. We have generated the first mice lacking the GAT2 (slc6a13) gene. Deletion of GAT2 (both mRNA and protein) neither affected growth, fertility, nor life span under nonchallenging rearing conditions. Immunocytochemistry showed that the GAT2 protein was predominantly expressed in the plasma membranes of periportal hepatocytes and in the basolateral membranes of proximal tubules in the renal cortex. This was validated by processing tissue from wild-type and knockout mice in parallel. Deletion of GAT2 reduced liver taurine levels by 50%, without affecting the expression of the taurine transporter TAUT. These results suggest an important role for GAT2 in taurine uptake from portal blood into liver. In support of this notion, GAT2-transfected HEK293 cells transported [3H]taurine. Furthermore, most of the uptake of [3H]GABA by cultured rat hepatocytes was due to GAT2, and this uptake was inhibited by taurine. GAT2 was not detected in brain parenchyma proper, excluding a role in GABA inactivation. It was, however, expressed in the leptomeninges and in a subpopulation of brain blood vessels. Deletion of GAT2 increased brain taurine levels by 20%, suggesting a taurine-exporting role for GAT2 in the brain. PMID:22896705

  5. Association of a serotonin transporter gene (SLC6A4) 5-HTTLPR polymorphism with body mass index categories but not type 2 diabetes mellitus in Mexicans

    Science.gov (United States)

    Peralta-Leal, Valeria; Leal-Ugarte, Evelia; Meza-Espinoza, Juan P.; Dávalos-Rodríguez, Ingrid P.; Bocanegra-Alonso, Anabel; Acosta-González, Rosa I.; Gonzales, Enrique; Nair, Saraswathy; Durán-González, Jorge

    2012-01-01

    The serotonergic system has been hypothesized to contribute to the biological susceptibility to type 2 diabetes mellitus (T2DM) and body-mass index (BMI) categories. We investigate a possible association of 5-HTTLPR polymorphism (L and S alleles) in the promoter region of the serotonin transporter gene (SLC6A4) with the development of T2DM and/or higher BMI by analyzing a sample of 138 individuals diagnosed with T2DM and 172 unrelated controls from the Mexican general population. In the total sample genotypes were distributed according to Hardy-Weinberg equilibrium, and S allele frequency was 0.58. There was no statistical association between 5-HTTLPR polymorphism and the development of T2DM in this Mexican population sample (p = 0.12). Nevertheless, logistic regression analysis of the L allele and increased BMI disclosed an association, after adjusting for age, sex and T2DM (p = 0.02, OR 1.74, 95% CI: 1.079–2.808). PMID:23055796

  6. Inhibition of intestinal bile acid transporter Slc10a2 improves triglyceride metabolism and normalizes elevated plasma glucose levels in mice.

    Directory of Open Access Journals (Sweden)

    Thomas Lundåsen

    Full Text Available Interruption of the enterohepatic circulation of bile acids increases cholesterol catabolism, thereby stimulating hepatic cholesterol synthesis from acetate. We hypothesized that such treatment should lower the hepatic acetate pool which may alter triglyceride and glucose metabolism. We explored this using mice deficient of the ileal sodium-dependent BA transporter (Slc10a2 and ob/ob mice treated with a specific inhibitor of Slc10a2. Plasma TG levels were reduced in Slc10a2-deficient mice, and when challenged with a sucrose-rich diet, they displayed a reduced response in hepatic TG production as observed from the mRNA levels of several key enzymes in fatty acid synthesis. This effect was paralleled by a diminished induction of mature sterol regulatory element-binding protein 1c (Srebp1c. Unexpectedly, the SR-diet induced intestinal fibroblast growth factor (FGF 15 mRNA and normalized bile acid synthesis in Slc10a2-/- mice. Pharmacologic inhibition of Slc10a2 in diabetic ob/ob mice reduced serum glucose, insulin and TGs, as well as hepatic mRNA levels of Srebp1c and its target genes. These responses are contrary to those reported following treatment of mice with a bile acid binding resin. Moreover, when key metabolic signal transduction pathways in the liver were investigated, those of Mek1/2-Erk1/2 and Akt were blunted after treatment of ob/ob mice with the Slc10a2 inhibitor. It is concluded that abrogation of Slc10a2 reduces hepatic Srebp1c activity and serum TGs, and in the diabetic ob/ob model it also reduces glucose and insulin levels. Hence, targeting of Slc10a2 may be a promising strategy to treat hypertriglyceridemia and diabetes.

  7. Serotonin Transporter Gene ("SLC6A4") Methylation Associates with Neonatal Intensive Care Unit Stay and 3-month-old Temperament in Preterm Infants

    Science.gov (United States)

    Montirosso, Rosario; Provenzi, Livio; Fumagalli, Monica; Sirgiovanni, Ida; Giorda, Roberto; Pozzoli, Uberto; Beri, Silvana; Menozzi, Giorgia; Tronick, Ed; Morandi, Francesco; Mosca, Fabio; Borgatti, Renato

    2016-01-01

    Preterm birth and Neonatal Intensive Care Unit (NICU) stay are early adverse stressful experiences, which may result in an altered temperamental profile. The serotonin transporter gene ("SLC6A4"), which has been linked to infant temperament, is susceptible to epigenetic regulation associated with early stressful experience. This study…

  8. ρ0 Cells Feature De-Ubiquitination of SLC Transporters and Increased Levels and Fluxes of Amino Acids

    Directory of Open Access Journals (Sweden)

    André Bordinassi Medina

    2017-04-01

    Full Text Available Solute carrier (SLC transporters are a diverse group of membrane transporter proteins that regulate the cellular flux and distribution of endogenous and xenobiotic compounds. Post-translational modifications (PTMs, such as ubiquitination, have recently emerged as one of the major regulatory mechanisms in protein function and localization. Previously, we showed that SLC amino acid transporters were on average 6-fold de-ubiquitinated and increased amino acid levels were detected in ρ0 cells (lacking mitochondrial DNA, mtDNA compared to parental cells. Here, we elucidated the altered functionality of SLC transporters and their dynamic ubiquitination status by measuring the uptake of several isotopically labeled amino acids in both human osteosarcoma 143B.TK- and ρ0 cells. Our pulse chase analysis indicated that de-ubiquitinated amino acid transporters in ρ0 cells were accompanied by an increased transport rate, which leads to higher levels of amino acids in the cell. Finding SLC transport enhancers is an aim of the pharmaceutical industry in order to compensate for loss of function mutations in these genes. Thus, the ubiquitination status of SLC transporters could be an indicator for their functionality, but evidence for a direct connection between de-ubiquitination and transporter activity has to be further elucidated.

  9. Effects of dopamine D2 receptor (DRD2) and transporter (SLC6A3) polymorphisms on smoking cue-induced cigarette craving among African-American smokers.

    Science.gov (United States)

    Erblich, J; Lerman, C; Self, D W; Diaz, G A; Bovbjerg, D H

    2005-04-01

    Cue-induced craving for addictive substances has long been known to contribute to the problem of persistent addiction in humans. Research in animals over the past decade has solidly established the central role of dopamine in cue-induced craving for addictive substances, including nicotine. Analogous studies in humans, however, are lacking, especially among African-American smokers, who have lower quit rates than Caucasian smokers. Based on the animal literature, the study's objective was to test the hypothesis that smokers carrying specific variants in dopamine-related genes previously associated with risk for addictive behaviors would exhibit heightened levels of cigarette craving following laboratory exposure to cues. To this end, cigarette craving was induced in healthy African-American smokers (n=88) through laboratory exposure to smoking cues. Smokers carrying either the DRD2 (D2 dopamine receptor gene) TaqI A1 RFLP or the SLC6A3 (dopamine transporter gene) 9-repeat VNTR polymorphisms had stronger cue-induced cravings than noncarriers (Ps cue-induced craving in humans, and suggest a possible genetic risk factor for persistent smoking behavior in African-American smokers.

  10. The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

    Directory of Open Access Journals (Sweden)

    Anna Rita Cappello

    2018-04-01

    Full Text Available The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P antiporters, catalyzing both homologous (Pi/Pi and heterologous (G6P/Pi exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT, transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib, an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

  11. The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

    Science.gov (United States)

    Cappello, Anna Rita; Curcio, Rosita; Lappano, Rosamaria; Maggiolini, Marcello; Dolce, Vincenza

    2018-04-01

    The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER) membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi) antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P) antiporters, catalyzing both homologous (Pi/Pi) and heterologous (G6P/Pi) exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT), transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α) or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib), an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

  12. Genome-wide association analysis identifies a mutation in the thiamine transporter 2 (SLC19A3 gene associated with Alaskan Husky encephalopathy.

    Directory of Open Access Journals (Sweden)

    Karen M Vernau

    Full Text Available Alaskan Husky Encephalopathy (AHE has been previously proposed as a mitochondrial encephalopathy based on neuropathological similarities with human Leigh Syndrome (LS. We studied 11 Alaskan Husky dogs with AHE, but found no abnormalities in respiratory chain enzyme activities in muscle and liver, or mutations in mitochondrial or nuclear genes that cause LS in people. A genome wide association study was performed using eight of the affected dogs and 20 related but unaffected control AHs using the Illumina canine HD array. SLC19A3 was identified as a positional candidate gene. This gene controls the uptake of thiamine in the CNS via expression of the thiamine transporter protein THTR2. Dogs have two copies of this gene located within the candidate interval (SLC19A3.2 - 43.36-43.38 Mb and SLC19A3.1 - 43.411-43.419 Mb on chromosome 25. Expression analysis in a normal dog revealed that one of the paralogs, SLC19A3.1, was expressed in the brain and spinal cord while the other was not. Subsequent exon sequencing of SLC19A3.1 revealed a 4bp insertion and SNP in the second exon that is predicted to result in a functional protein truncation of 279 amino acids (c.624 insTTGC, c.625 C>A. All dogs with AHE were homozygous for this mutation, 15/41 healthy AH control dogs were heterozygous carriers while 26/41 normal healthy AH dogs were wild type. Furthermore, this mutation was not detected in another 187 dogs of different breeds. These results suggest that this mutation in SLC19A3.1, encoding a thiamine transporter protein, plays a critical role in the pathogenesis of AHE.

  13. Lack of Association between a 3'UTR VNTR Polymorphism of Dopamine Transporter Gene (SLC6A3) and ADHD in a Brazilian Sample of Adult Patients

    Science.gov (United States)

    Aperecida da Silva, Maria; Cordeiro, Quirino; Louza, Mario; Vallada, Homero

    2011-01-01

    Objective: To investigate a possible association between a 3'UTR VNTR polymorphism of the dopamine transporter gene (SLC6A3) and ADHD in a Brazilian sample of adult patients. Method: Study Case-control with 102 ADHD adult outpatients ("DSM-IV" criteria) and 479 healthy controls. The primers' sequence used were: 3'UTR-Forward: 5' TGT GGT…

  14. Genetic variation of the GLUT10 glucose transporter (SLC2A10) and relationships to type 2 diabetes and intermediary traits

    DEFF Research Database (Denmark)

    Andersen, Gitte; Rose, Christian Schack; Hamid, Yasmin Hassan

    2003-01-01

    The SLC2A10 gene encodes the GLUT10 facilitative glucose transporter, which is expressed in high amounts in liver and pancreas. The gene is mapped to chromosome 20q12-q13.1, a region that has been shown to be linked to type 2 diabetes. The gene was examined in 61 Danish type 2 diabetic patients......, and a total of six variants (-27C-->T, Ala206Thr, Ala272Ala, IVS2 + 10G-->A, IVS4 + 18T-->G, and IVS4 + 26G-->A) were identified and investigated in an association study, which included 503 type 2 diabetic patients and 510 glucose-tolerant control subjects. None of the variants were associated with type 2...... substantially to the pathogenesis of type 2 diabetes in the examined study population. However, the codon 206 polymorphism may be related to the interindividual variation in fasting and oral glucose-induced serum insulin levels....

  15. Association between the SLC6A3 A1343G polymorphism and schizophrenia Associação entre o polimorfismo A1343G do SLC6A3 e esquizofrenia

    Directory of Open Access Journals (Sweden)

    Quirino Cordeiro

    2010-10-01

    Full Text Available Epidemiological studies have demonstrated that the genetic component is an important risk factor for the development of schizophrenia. The genes that codify the different compounds of the dopaminergic system have created interest for molecular investigations in patients with schizophrenia because the antipsychotic drugs, especially those of first generation, act on this cerebral system. Thus the aim of the present study was to investigate the possible association between a new single nucleotide polymorphism (rs6347 located in exon 9 of the protein transporter (SLC6A3 and schizophrenia. The distribution of the alleles and genotypes of the studied polymorphism was investigated in a sample of 235 patients and 834 controls matched by gender and age. There were statistical differences in the allelic (χ2=5.97, 1d.f. , p=0.01, OR=1.33-1.05Estudos epidemiológicos têm demonstrado que o componente genético é um importante fator de risco para a esquizofrenia. Os genes que codificam os diferentes componentes do sistema dopaminérgico passaram a despertar interesse para estudos moleculares em pacientes com esquizofrenia, pois os antipsicóticos, em especial os de primeira geração, exercem sua ação nesse sistema. Assim, o objetivo do presente estudo foi investigar a associação entre um novo polimorfismo de nucleotídeo único (rs6347 localizado no exon 9 do gene do transportador de dopamina (SLC6A3 e esquizofrenia. Um total de 235 pacientes e 834 controles pareados para sexo e idade foi selecionado para a investigação da distribuição dos alelos e genótipos do polimorfismo investigado entre os grupos de pacientes e controles. Houve diferenças estatisticamente significantes nas distribuições alélicas (χ2=5,97, 1d.f. , p=0,01, OR=1,33-1,052=6,56, 2d.f. , p=0,03 entre pacientes e controles. Assim, o polimorfismo SLC6A3 A1343G mostrou associação com esquizofrenia na amostra estudada.

  16. Inhibitors of GLUT/SLC2A Enhance the Action of BCNU and Temozolomide against High-Grade Gliomas

    Directory of Open Access Journals (Sweden)

    Alberto Azzalin

    2017-04-01

    Full Text Available Glucose transport across glioblastoma membranes plays a crucial role in maintaining the enhanced glycolysis typical of high-grade gliomas and glioblastoma. We tested the ability of two inhibitors of the glucose transporters GLUT/SLC2A superfamily, indinavir (IDV and ritonavir (RTV, and of one inhibitor of the Na/glucose antiporter type 2 (SGLT2/SLC5A2 superfamily, phlorizin (PHZ, in decreasing glucose consumption and cell proliferation of human and murine glioblastoma cells. We found in vitro that RTV, active on at least three different GLUT/SLC2A transporters, was more effective than IDV, a specific inhibitor of GLUT4/SLC2A4, both in decreasing glucose consumption and lactate production and in inhibiting growth of U87MG and Hu197 human glioblastoma cell lines and primary cultures of human glioblastoma. PHZ was inactive on the same cells. Similar results were obtained when cells were grown in adherence or as 3D multicellular tumor spheroids. RTV treatment but not IDV treatment induced AMP-activated protein kinase (AMPKα phosphorylation that paralleled the decrease in glycolytic activity and cell growth. IDV, but not RTV, induced an increase in GLUT1/SLC2A1 whose activity could compensate for the inhibition of GLUT4/SLC2A4 by IDV. RTV and IDV pass poorly the blood brain barrier and are unlikely to reach sufficient liquoral concentrations in vivo to inhibit glioblastoma growth as single agents. Isobologram analysis of the association of RTV or IDV and 1,3-bis(2-chloroethyl-1-nitrosourea (BCNU or 4-methyl-5-oxo-2,3,4,6,8-pentazabicyclo[4.3.0]nona-2,7,9-triene-9-carboxamide (TMZ indicated synergy only with RTV on inhibition of glioblastoma cells. Finally, we tested in vivo the combination of RTV and BCNU on established GL261 tumors. This drug combination increased the overall survival and allowed a five-fold reduction in the dose of BCNU.

  17. Impaired nutrient signaling and body weight control in a Na+ neutral amino acid cotransporter (Slc6a19)-deficient mouse.

    Science.gov (United States)

    Bröer, Angelika; Juelich, Torsten; Vanslambrouck, Jessica M; Tietze, Nadine; Solomon, Peter S; Holst, Jeff; Bailey, Charles G; Rasko, John E J; Bröer, Stefan

    2011-07-29

    Amino acid uptake in the intestine and kidney is mediated by a variety of amino acid transporters. To understand the role of epithelial neutral amino acid uptake in whole body homeostasis, we analyzed mice lacking the apical broad-spectrum neutral (0) amino acid transporter B(0)AT1 (Slc6a19). A general neutral aminoaciduria was observed similar to human Hartnup disorder which is caused by mutations in SLC6A19. Na(+)-dependent uptake of neutral amino acids into the intestine and renal brush-border membrane vesicles was abolished. No compensatory increase of peptide transport or other neutral amino acid transporters was detected. Mice lacking B(0)AT1 showed a reduced body weight. When adapted to a standard 20% protein diet, B(0)AT1-deficient mice lost body weight rapidly on diets containing 6 or 40% protein. Secretion of insulin in response to food ingestion after fasting was blunted. In the intestine, amino acid signaling to the mammalian target of rapamycin (mTOR) pathway was reduced, whereas the GCN2/ATF4 stress response pathway was activated, indicating amino acid deprivation in epithelial cells. The results demonstrate that epithelial amino acid uptake is essential for optimal growth and body weight regulation.

  18. Urine screening for patients with developmental disabilities detected a patient with creatine transporter deficiency due to a novel missense mutation in SLC6A8.

    Science.gov (United States)

    Kato, Hidekazu; Miyake, Fuyu; Shimbo, Hiroko; Ohya, Makoto; Sugawara, Hidenori; Aida, Noriko; Anzai, Rie; Takagi, Mariko; Okuda, Mitsuko; Takano, Kyoko; Wada, Takahito; Iai, Mizue; Yamashita, Sumimasa; Osaka, Hitoshi

    2014-08-01

    Creatine transporter deficiency (CTD) is an example of X-linked intellectual disability syndromes, caused by mutations in SLC6A8 on Xq28. Although this is the second most frequent genetic cause of intellectual disabilities in Europe or America after Fragile X syndrome, information on the morbidity of this disease is limited in Japan. Using the HPLC screening method we have established recently, we examined samples of urine of 105 patients (73 males and 32 females) with developmental disabilities at our medical center. And we have found a family with three ID boys with a novel missense mutation in SLC6A8. This is the second report of a Japanese family case of CTD. A systematic diagnostic system of this syndrome should be established in Japan to enable us to estimate its frequency and treatment. Copyright © 2013 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  19. The role of SLC2A1 in early onset and childhood absence epilepsies

    DEFF Research Database (Denmark)

    Muhle, Hiltrud; Helbig, Ingo; Frøslev, Tobias Guldberg

    2013-01-01

    Early Onset Absence Epilepsy constitutes an Idiopathic Generalized Epilepsy with absences starting before the age of four years. Mutations in SLC2A1, encoding the glucose transporter, account for approximately 10% of EOAE cases. The role of SLC2A1 mutations in absence epilepsies with a later onset...

  20. The Human Gene SLC25A29, of Solute Carrier Family 25, Encodes a Mitochondrial Transporter of Basic Amino Acids*

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292

  1. The human gene SLC25A29, of solute carrier family 25, encodes a mitochondrial transporter of basic amino acids.

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-05-09

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.

  2. Na+-taurocholate cotransporting polypeptide (NTCP/SLC10A1) ortholog in the marine skate Leucoraja erinacea is not a physiological bile salt transporter.

    Science.gov (United States)

    Yu, Dongke; Zhang, Han; Lionarons, Daniel A; Boyer, James L; Cai, Shi-Ying

    2017-04-01

    The Na + -dependent taurocholate cotransporting polypeptide (NTCP/SLC10A1) is a hepatocyte-specific solute carrier, which plays an important role in maintaining bile salt homeostasis in mammals. The absence of a hepatic Na + -dependent bile salt transport system in marine skate and rainbow trout raises a question regarding the function of the Slc10a1 gene in these species. Here, we have characterized the Slc10a1 gene in the marine skate, Leucoraja erinacea The transcript of skate Slc10a1 (skSlc10a1) encodes 319 amino acids and shares 46% identity to human NTCP (hNTCP) with similar topology to mammalian NTCP. SkSlc10a1 mRNA was mostly confined to the brain and testes with minimal expression in the liver. An FXR-bile salt reporter assay indicated that skSlc10a1 transported taurocholic acid (TCA) and scymnol sulfate, but not as effectively as hNTCP. An [ 3 H]TCA uptake assay revealed that skSlc10a1 functioned as a Na + -dependent transporter, but with low affinity for TCA ( K m = 92.4 µM) and scymnol sulfate ( K i = 31 µM), compared with hNTCP (TCA, K m = 5.4 µM; Scymnol sulfate, K i = 3.5 µM). In contrast, the bile salt concentration in skate plasma was 2 µM, similar to levels seen in mammals. Interestingly, skSlc10a1 demonstrated transport activity for the neurosteroids dehydroepiandrosterone sulfate and estrone-3-sulfate at physiological concentration, similar to hNTCP. Together, our findings indicate that skSlc10a1 is not a physiological bile salt transporter, providing a molecular explanation for the absence of a hepatic Na + -dependent bile salt uptake system in skate. We speculate that Slc10a1 is a neurosteroid transporter in skate that gained its substrate specificity for bile salts later in vertebrate evolution. Copyright © 2017 the American Physiological Society.

  3. Homozygous SLC6A17 Mutations Cause Autosomal-Recessive Intellectual Disability with Progressive Tremor, Speech Impairment, and Behavioral Problems

    OpenAIRE

    Iqbal, Zafar; Willemsen, Marjolein H.; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M.; Vulto-van Silfhout, Anneke T.; Vissers, Lisenka E.L.M.; de Brouwer, Arjan P.M.; Marouillat, Sylviane; Wienker, Thomas F.; Ropers, Hans Hilger; Kahrizi, Kimia

    2015-01-01

    We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neu...

  4. Separation study of Mg+2 from seawater and RO brine through a facilitated bulk liquid membrane transport using 18-Crown-6

    Directory of Open Access Journals (Sweden)

    Mir Mahdi Zahedi

    2017-12-01

    Full Text Available A facilitated bulk liquid membrane transport approach is studied for Mg(II extraction from seawater and reversed osmosis brine simulated media using 18-Crown-6 and dibenzo (DB-18-Crown-6. The work is based on investigating the experimental parameters affecting the transport efficiency, such as pH of feed and receiving phase, type of membrane solvent, temperature, type and concentration of the carrier, and stripping solution conditions. The transported amount of magnesium ions from feed phase (Mg(II = 0.059 M, NaCl = 0.01 M, pH = 3.3 across a chloroform membrane (18C6 = 0.001 M into the receiving phase (SCN− 0.1 M pH 3 was found to be %97 (±0.7 after 2.5 hr. The selectivity of the method was evaluated by performing competitive transport experiments on the mixtures containing Ca2+, Na+, K+, and Mg2+ ions.

  5. SLC25 Family Member Genetic Interactions Identify a Role for HEM25 in Yeast Electron Transport Chain Stability.

    Science.gov (United States)

    Dufay, J Noelia; Fernández-Murray, J Pedro; McMaster, Christopher R

    2017-06-07

    The SLC25 family member SLC25A38 (Hem25 in yeast) was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25 Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1 Δ hem25 Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components. Copyright © 2017 Dufay et al.

  6. SLC25 Family Member Genetic Interactions Identify a Role for HEM25 in Yeast Electron Transport Chain Stability

    Directory of Open Access Journals (Sweden)

    J. Noelia Dufay

    2017-06-01

    Full Text Available The SLC25 family member SLC25A38 (Hem25 in yeast was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25. Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1Δ hem25Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components.

  7. Investigation of SLC6A4 gene expression in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Elif Funda Şener

    2015-06-01

    Full Text Available Objective: Autism is defined as a complex neurodevelopmental disorder. Genetics plays a major role in the etiology of autism spectrum disorders (ASD. The role of the serotonin in the development of autism has been widely investigated. SLC6A4 gene (SERT or 5-HT has an important role reuptaking of serotonin. Because of this, our study examined the expression level of SLC6A4 gene in autism patients. Methods: Thirty-four patients (26 male, 8 female who diagnosed as autism firstly according to DSM-V criteria in the Department of child psychiatry, Erciyes University Medical Faculty and healthy 23 controls (16 male, 7 female were enrolled in this study. Total RNA was isolated from peripheral blood samples using TRIzol. Quantitative Real-time PCR (qRT-PCR was performed to detect SLC6A4 gene expression. Results: SLC6A4 gene expression was found statistically significant and low in autism group compared with controls (p=0,027. Conclusion: The low gene expression in the patient group implied that there is an abnormality of serotonin reuptake. According to our results, we suggest that much more studies may be planned with the expression and methylation profile of this gene combined with gene polymorphisms especially affecting the expression in larger sample sizes. J Clin Exp Invest 2015; 6 (2: 165-169

  8. Epigenetic regulation of the glucose transporter gene Slc2a1 by β-hydroxybutyrate underlies preferential glucose supply to the brain of fasted mice.

    Science.gov (United States)

    Tanegashima, Kosuke; Sato-Miyata, Yukiko; Funakoshi, Masabumi; Nishito, Yasumasa; Aigaki, Toshiro; Hara, Takahiko

    2017-01-01

    We carried out liquid chromatography-tandem mass spectrometry analysis of metabolites in mice. Those metabolome data showed that hepatic glucose content is reduced, but that brain glucose content is unaffected, during fasting, consistent with the priority given to brain glucose consumption during fasting. The molecular mechanisms for this preferential glucose supply to the brain are not fully understood. We also showed that the fasting-induced production of the ketone body β-hydroxybutyrate (β-OHB) enhances expression of the glucose transporter gene Slc2a1 (Glut1) via histone modification. Upon β-OHB treatment, Slc2a1 expression was up-regulated, with a concomitant increase in H3K9 acetylation at the critical cis-regulatory region of the Slc2a1 gene in brain microvascular endothelial cells and NB2a neuronal cells, shown by quantitative PCR analysis and chromatin immunoprecipitation assay. CRISPR/Cas9-mediated disruption of the Hdac2 gene increased Slc2a1 expression, suggesting that it is one of the responsible histone deacetylases (HDACs). These results confirm that β-OHB is a HDAC inhibitor and show that β-OHB plays an important role in fasting-induced epigenetic activation of a glucose transporter gene in the brain. © 2016 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  9. A single base deletion in the SLC45A2 gene in a Bullmastiff with oculocutaneous albinism.

    Science.gov (United States)

    Caduff, M; Bauer, A; Jagannathan, V; Leeb, T

    2017-10-01

    Oculocutaneous albinism type 4 (OCA4) in humans and similar phenotypes in many animal species are caused by variants in the SLC45A2 gene, encoding a putative sugar transporter. In dog, two independent SLC45A2 variants are known that cause oculocutaneous albinism in Doberman Pinschers and several small dog breeds respectively. For the present study, we investigated a Bullmastiff with oculocutaneous albinism. The affected dog was highly inbred and resulted from the mating of a sire to its own grandmother. We obtained whole genome sequence data from the affected dog and searched specifically for variants in candidate genes known to cause albinism. We detected a single base deletion in exon 6 of the SLC45A2 gene (NM_001037947.1:c.1287delC) that has not been reported thus far. This deletion is predicted to result in an early premature stop codon. It was confirmed by Sanger sequencing and perfectly co-segregated with the phenotype in the available family members. We genotyped 174 unrelated dogs from diverse breeds, all of which were homozygous wildtype. We therefore suggest that SLC45A2:c.1287delC causes the observed oculocutaneous albinism in the affected Bullmastiff. © 2017 Stichting International Foundation for Animal Genetics.

  10. Association of serotonin transporter (SLC6A4 & receptor (5HTR1A, 5HTR2A polymorphisms with response to treatment with escitalopram in patients with major depressive disorder : A preliminary study

    Directory of Open Access Journals (Sweden)

    Aniruddha Basu

    2015-01-01

    Full Text Available Background & objectives: Genetic factors have potential of predicting response to antidepressants in patients with major depressive disorder (MDD. In this study, an attempt was made to find an association between response to escitalopram in patients with MDD, and serotonin transporter (SLC6A4 and receptor (5HTR1A, 5HTR2A polymorphisms. Methods: Fifty five patients diagnosed as suffering from MDD, were selected for the study. The patients were treated with escitalopram over a period of 6-8 wk. Severity of depression, response to treatment and side effects were assessed using standardised instruments. Genetic variations from HTR1A (rs6295, HTR2A (rs6311 and rs6313 and SLC6A4 (44 base-pair insertion/deletion at 5-HTTLPR were genotyped. The genetic data of the responders and non-responders were compared to assess the role of genetic variants in therapeutic outcome. Results: Thirty six (65.5% patients responded to treatment, and 19 (34.5% had complete remission. No association was observed for genotype and allelic frequencies of single nucleotide polymorphisms (SNPs among remitter/non-remitter and responder/non-responder groups, and six most common side-effects, except memory loss which was significantly associated with rs6311 ( p0 =0.03. Interpretation & conclusions: No significant association was found between the SNPs analysed and response to escitalopram in patients with MDD though a significant association was seen between the side effect of memory loss and rs6311. Studies with larger sample are required to find out genetic basis of antidepressant response in Indian patients.

  11. Complex analysis of urate transporters SLC2A9, SLC22A12 and functional characterization of non-synonymous allelic variants of GLUT9 in the Czech population: no evidence of effect on hyperuricemia and gout.

    Science.gov (United States)

    Hurba, Olha; Mancikova, Andrea; Krylov, Vladimir; Pavlikova, Marketa; Pavelka, Karel; Stibůrková, Blanka

    2014-01-01

    Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects). We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2) and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. We identified a total of 52 sequence variants (12 unpublished). Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.

  12. Function and expression of the proton-coupled amino acid transporter Slc36a1 along the rat gastrointestinal tract

    DEFF Research Database (Denmark)

    Broberg, M. L.; Holm, Rasmus Koldborg; Tønsberg, H

    2012-01-01

    BACKGROUND AND PURPOSE: Intestinal absorption via membrane transporters may determine the pharmacokinetics of drug compounds. The hypothesis is that oral absorption of gaboxadol (4, 5, 6, 7-tetrahydroisoxazolo [5,4-c] pyridine-3-ol) in rats occurs via the proton-coupled amino acid transporter, r....... The intestinal expression of rSlc36a1 mRNA was measured by quantitative real-time PCR (q-RT-PCR). Furthermore, the hPAT1-/rPAT1-mediated transport of gaboxadol or L-proline was studied in hPAT1-expressing X. laevis oocytes, Caco-2 cell monolayers and excised segments of the rat intestine. KEY RESULTS......). The in vitro carrier-mediated uptake rate of L-proline in the excised intestinal segments was highest in the mid jejunum and low in the colon. The in vitro uptake and the in vivo absorption correlated with the expression of rSlc36a1 mRNA along the rat intestine. CONCLUSIONS AND IMPLICATIONS: The results...

  13. Slc3a2 Mediates Branched-Chain Amino-Acid-Dependent Maintenance of Regulatory T Cells

    Directory of Open Access Journals (Sweden)

    Kayo Ikeda

    2017-11-01

    Full Text Available Summary: Foxp3+ regulatory T (Treg cells, which suppress immune responses, are highly proliferative in vivo. However, it remains unclear how the active replication of Treg cells is maintained in vivo. Here, we show that branched-chain amino acids (BCAAs, including isoleucine, are required for maintenance of the proliferative state of Treg cells via the amino acid transporter Slc3a2-dependent metabolic reprogramming. Mice fed BCAA-reduced diets showed decreased numbers of Foxp3+ Treg cells with defective in vivo proliferative capacity. Mice lacking Slc3a2 specifically in Foxp3+ Treg cells showed impaired in vivo replication and decreased numbers of Treg cells. Slc3a2-deficient Treg cells showed impaired isoleucine-induced activation of the mTORC1 pathway and an altered metabolic state. Slc3a2 mutant mice did not show an isoleucine-induced increase of Treg cells in vivo and exhibited multi-organ inflammation. Taken together, these findings demonstrate that BCAA controls Treg cell maintenance via Slc3a2-dependent metabolic regulation. : Treg cells regulate excess immune responses and are highly proliferative in vivo. Ikeda et al. find that branched-chain amino acids (BCAAs are essentially required to maintain expansion and the suppressive capacity of Treg cells via Slc3a2 and mTORC1. Keywords: Treg cells, amino acids, immunometabolism, immune regulation, transporter

  14. Genetic moderation of cocaine subjective effects by variation in the TPH1, TPH2, and SLC6A4 serotonin genes.

    Science.gov (United States)

    Patriquin, Michelle A; Hamon, Sara C; Harding, Mark J; Nielsen, Ellen M; Newton, Thomas F; De La Garza, Richard; Nielsen, David A

    2017-10-01

    This study investigated variants of tryptophan hydroxylase (TPH)1, TPH2, and SLC6A4 in the moderation of the subjective effects of cocaine. Non-treatment-seeking cocaine-dependent individuals (N=66) were intravenously administered saline and cocaine (40 mg) in a randomized order. Participants self-reported subjective effects of cocaine using a visual analog scale starting before administration of saline or cocaine (-15 min) to up to 20 min after infusion. Self-report ratings on the visual analog scale ranged from 0 (no effect) to 100 (greatest effect). Participants were genotyped for the TPH1 rs1799913, TPH2 rs4290270, and SLC6A4 5-HTTLPR variants. Repeated-measures analysis of covariance was used to examine changes in subjective effect scores over time while controlling for population structure. Participants carrying the TPH1 rs1799913 A allele reported greater subjective response to cocaine for 'stimulated' and 'access' relative to the CC genotype group. Those carrying the TPH2 rs4290270 A allele reported higher 'good effect' and lower 'depressed' effect relative to the TT genotype group. Those carrying the SLC6A4 5-HTTLPR S' allele reported greater 'desire' and 'access' compared with the L'L' genotype group. These findings indicate that TPH1, TPH2, and SLC6A4 variants moderate the subjective effects of cocaine in non-treatment-seeking cocaine-dependent participants.

  15. Organic cation transporter 2 (SLC22A2), a low-affinity and high-capacity choline transporter, is preferentially enriched on synaptic vesicles in cholinergic neurons.

    Science.gov (United States)

    Nakata, T; Matsui, T; Kobayashi, K; Kobayashi, Y; Anzai, N

    2013-11-12

    Organic cation transporters (OCTs) are expressed mainly in the kidney and liver. OCTs transport intrinsic organic cations, including monoamine, dopamine, serotonine and choline, across the plasma membrane. Here, we demonstrate that OCT2 (SLC22A2) is expressed in cholinergic neurons, motoneurons in the anterior horn of the spinal cord, and is implicated in acetylcholine (Ach) recycling in presynaptic terminals. Application of rabbit anti-peptide antibody revealed that OCT2 was expressed in the anterior horn of the spinal cord. Double immunostaining of muscle sections with anti-OCT2 and alpha-bungarotoxin (BTX) revealed that OCT2 was localized in the neuromuscular junctions (NMJs). Immunoelectron microscopy revealed that OCT2 was localized both in synaptic vesicles (SVs) in presynaptic terminals around the motoneurons (C-terminals) and in SVs in nerve terminals in NMJs. The similarity in the distribution of OCT2 in cholinergic neurons and that of vesicular acetyl choline transporter (VAchT), and the fact that OCT2 can transport choline suggest that OCT2 could work as a low-affinity and high-capacity choline transporter at presynaptic terminals in cholinergic neurons in a firing-dependent manner. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.

  16. [Polymorphism in the Serotonin Transporter Gene (SLC6A4) and Emotional Bipolar Disorder in Two Regional Mental Health Centers from the Eje Cafetero (Colombia)].

    Science.gov (United States)

    Ramos, Lucero Rengifo; Arias, Duverney Gaviria; Salazar, Liliana Salazar; Vélez, Juan Pablo; Pardo, Stella Lozano

    2012-03-01

    The indel polymorphisms in the promoting region and the 2(nd) intron polymorphisms in the serotonin transporter gene (SLC6A4) have been associated to bipolar disorder 1 (BD1) in several population studies. The objective was to analyze the genotypic and allelic frequencies in both gene regions in a study of cases and controls with individuals from Risaralda and Quindío (Colombia) so as to establish possible associations to BD1, and compare results with previous and similar studies. 133 patients and 120 controls were studied. L and S indel polymorphisms in the promoting region were analyzed by PCR, together with VNTR STin2.10 and STin 2.12 VNTRs polymorphisms in the 2(nd) intron of the SL-C6A4 gene Genotypic and allelic frequencies for the S and L polymorphisms were similar both in cases and controls. However, the LL genotype was significantly increased both in BD1 population (OR=1.89; CI95%=1.1-3.68), and when discriminated by gender. This particular genotype in general population is OR=2.22; IC95%=1.04-5.66 for women, and OR=1.62; IC 95%=0.71-4.39 for men. No significant genotypic and allelic differences were found for VNTR STin2.10 and STin 2.12. polymorphisms. No association was found between polymorphisms of 5-HTTLPR polymorphisms and the 2(nd) intron of the serotonin transporting gene in general patients with BD1, nor when compared by gender. Our results are similar to those reported for Caucasian populations and differ from those of Asian and Brazilian populations. Copyright © 2012 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  17. Homozygous SLC6A17 Mutations Cause Autosomal-Recessive Intellectual Disability with Progressive Tremor, Speech Impairment, and Behavioral Problems

    Science.gov (United States)

    Iqbal, Zafar; Willemsen, Marjolein H.; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M.; Vulto-van Silfhout, Anneke T.; Vissers, Lisenka E.L.M.; de Brouwer, Arjan P.M.; Marouillat, Sylviane; Wienker, Thomas F.; Ropers, Hans Hilger; Kahrizi, Kimia; Nadif Kasri, Nael; Najmabadi, Hossein; Laumonnier, Frédéric; Kleefstra, Tjitske; van Bokhoven, Hans

    2015-01-01

    We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neutral amino acids and glutamate, and plays an important role in the regulation of glutamatergic synapses. Prediction programs and 3D modeling suggest that the identified mutations are deleterious to protein function. To directly test the functional consequences, we investigated the neuronal subcellular localization of overexpressed wild-type and mutant variants in mouse primary hippocampal neuronal cells. Wild-type protein was present in soma, axons, dendrites, and dendritic spines. p.Pro633Arg altered SLC6A17 was found in soma and proximal dendrites but did not reach spines. p.Gly162Arg altered SLC6A17 showed a normal subcellular distribution but was associated with an abnormal neuronal morphology mainly characterized by the loss of dendritic spines. In summary, our genetic findings implicate homozygous SLC6A17 mutations in autosomal-recessive intellectual disability, and their pathogenic role is strengthened by genetic evidence and in silico and in vitro functional analyses. PMID:25704603

  18. Complex analysis of urate transporters SLC2A9, SLC22A12 and functional characterization of non-synonymous allelic variants of GLUT9 in the Czech population: no evidence of effect on hyperuricemia and gout.

    Directory of Open Access Journals (Sweden)

    Olha Hurba

    Full Text Available OBJECTIVE: Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. METHODS: The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects. We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2 and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. RESULTS: We identified a total of 52 sequence variants (12 unpublished. Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. CONCLUSION: Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.

  19. Language disorder with mild intellectual disability in a child affected by a novel mutation of SLC6A8 gene.

    Science.gov (United States)

    Battini, R; Chilosi, A M; Casarano, M; Moro, F; Comparini, A; Alessandrì, M G; Leuzzi, V; Tosetti, M; Cioni, G

    2011-02-01

    We describe the clinical and molecular features of a child harboring a novel mutation in SLC6A8 gene in association with a milder phenotype than other creatine transporter (CT1) deficient patients (OMIM 300352) [1-7]. The mutation c.757 G>C p.G253R in exon 4 of SLC6A8 was hemizygous in the child, aged 6 years and 6 months, who showed mild intellectual disability with severe speech and language delay. His carrier mother had borderline intellectual functioning. Although the neurochemical and biochemical parameters were fully consistent with those reported in the literature for subjects with CT1 deficit, in our patient within a general cognitive disability, a discrepancy between nonverbal and verbal skills was observed, confirming the peculiar vulnerability of language development under brain Cr depletion. Copyright © 2010 Elsevier Inc. All rights reserved.

  20. Homozygous SLC6A17 mutations cause autosomal-recessive intellectual disability with progressive tremor, speech impairment, and behavioral problems.

    Science.gov (United States)

    Iqbal, Zafar; Willemsen, Marjolein H; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; de Brouwer, Arjan P M; Marouillat, Sylviane; Wienker, Thomas F; Ropers, Hans Hilger; Kahrizi, Kimia; Nadif Kasri, Nael; Najmabadi, Hossein; Laumonnier, Frédéric; Kleefstra, Tjitske; van Bokhoven, Hans

    2015-03-05

    We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neutral amino acids and glutamate, and plays an important role in the regulation of glutamatergic synapses. Prediction programs and 3D modeling suggest that the identified mutations are deleterious to protein function. To directly test the functional consequences, we investigated the neuronal subcellular localization of overexpressed wild-type and mutant variants in mouse primary hippocampal neuronal cells. Wild-type protein was present in soma, axons, dendrites, and dendritic spines. p.Pro633Arg altered SLC6A17 was found in soma and proximal dendrites but did not reach spines. p.Gly162Arg altered SLC6A17 showed a normal subcellular distribution but was associated with an abnormal neuronal morphology mainly characterized by the loss of dendritic spines. In summary, our genetic findings implicate homozygous SLC6A17 mutations in autosomal-recessive intellectual disability, and their pathogenic role is strengthened by genetic evidence and in silico and in vitro functional analyses. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  1. The histidine transporter SLC15A4 coordinates mTOR-dependent inflammatory responses and pathogenic antibody production.

    Science.gov (United States)

    Kobayashi, Toshihiko; Shimabukuro-Demoto, Shiho; Yoshida-Sugitani, Reiko; Furuyama-Tanaka, Kaori; Karyu, Hitomi; Sugiura, Yuki; Shimizu, Yukiko; Hosaka, Toshiaki; Goto, Motohito; Kato, Norihiro; Okamura, Tadashi; Suematsu, Makoto; Yokoyama, Shigeyuki; Toyama-Sorimachi, Noriko

    2014-09-18

    SLC15A4 is a lysosome-resident, proton-coupled amino-acid transporter that moves histidine and oligopeptides from inside the lysosome to the cytosol of eukaryotic cells. SLC15A4 is required for Toll-like receptor 7 (TLR7)- and TLR9-mediated type I interferon (IFN-I) productions in plasmacytoid dendritic cells (pDCs) and is involved in the pathogenesis of certain diseases including lupus-like autoimmunity. How SLC15A4 contributes to diseases is largely unknown. Here we have shown that B cell SLC15A4 was crucial for TLR7-triggered IFN-I and autoantibody productions in a mouse lupus model. SLC15A4 loss disturbed the endolysosomal pH regulation and probably the v-ATPase integrity, and these changes were associated with disruption of the mTOR pathway, leading to failure of the IFN regulatory factor 7 (IRF7)-IFN-I regulatory circuit. Importantly, SLC15A4's transporter activity was necessary for the TLR-triggered cytokine production. Our findings revealed that SLC15A4-mediated optimization of the endolysosomal state is integral to a TLR7-triggered, mTOR-dependent IRF7-IFN-I circuit that leads to autoantibody production. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Importance of uncharged polar residues and proline in the proximal two-thirds (Pro107–Ser128 of the highly conserved region of mouse ileal Na+-dependent bile acid transporter, Slc10a2, in transport activity and cellular expression

    Directory of Open Access Journals (Sweden)

    Saeki Tohru

    2013-02-01

    Full Text Available Abstract Background SLC10A2-mediated reabsorption of bile acids at the distal end of the ileum is the first step in enterohepatic circulation. Because bile acids act not only as detergents but also as signaling molecules in lipid metabolism and energy production, SLC10A2 is important as the key transporter for understanding the in vivo kinetics of bile acids. SLC10A family members and the homologous genes of various species share a highly conserved region corresponding to Gly104–Pro142 of SLC10A2. The functional importance of this region has not been fully elucidated. Results To elucidate the functional importance of this region, we previously performed mutational analysis of the uncharged polar residues and proline in the distal one-third (Thr130–Pro142 of the highly conserved region in mouse Slc10a2. In this study, proline and uncharged polar residues in the remaining two-thirds of this region in mouse Slc10a2 were subjected to mutational analysis, and taurocholic acid uptake and cell surface localization were examined. Cell surface localization of Slc10a2 is necessary for bile acid absorption. Mutants in which Asp or Leu were substituted for Pro107 (P107N or P107L were abundantly expressed, but their cell surface localization was impaired. The S126A mutant was completely impaired in cellular expression. The T110A and S128A mutants exhibited remarkably enhanced membrane expression. The S112A mutant was properly expressed at the cell surface but transport activity was completely lost. Replacement of Tyr117 with various amino acids resulted in reduced transport activity. The degree of reduction roughly depended on the van der Waals volume of the side chains. Conclusions The functional importance of proline and uncharged polar residues in the highly conserved region of mouse Slc10a2 was determined. This information will contribute to the design of bile acid-conjugated prodrugs for efficient drug delivery or SLC10A2 inhibitors for

  3. The Role of Na:K:2Cl Cotransporter 1 (NKCC1/SLC12A2) in Dental Epithelium during Enamel Formation in Mice

    Science.gov (United States)

    Jalali, Rozita; Lodder, Johannes C.; Zandieh-Doulabi, Behrouz; Micha, Dimitra; Melvin, James E.; Catalan, Marcelo A.; Mansvelder, Huibert D.; DenBesten, Pamela; Bronckers, Antonius

    2017-01-01

    Na+:K+:2Cl− cotransporters (NKCCs) belong to the SLC12A family of cation-coupled Cl− transporters. We investigated whether enamel-producing mouse ameloblasts express NKCCs. Transcripts for Nkcc1 were identified in the mouse dental epithelium by RT-qPCR and NKCC1 protein was immunolocalized in outer enamel epithelium and in the papillary layer but not the ameloblast layer. In incisors of Nkcc1-null mice late maturation ameloblasts were disorganized, shorter and the mineral density of the enamel was reduced by 10% compared to wild-type controls. Protein levels of gap junction protein connexin 43, Na+-dependent bicarbonate cotransporter e1 (NBCe1), and the Cl−-dependent bicarbonate exchangers SLC26A3 and SLC26A6 were upregulated in Nkcc1-null enamel organs while the level of NCKX4/SLC24A4, the major K+, Na+ dependent Ca2+ transporter in maturation ameloblasts, was slightly downregulated. Whole-cell voltage clamp studies on rat ameloblast-like HAT-7 cells indicated that bumetanide increased ion-channel activity conducting outward currents. Bumetanide also reduced cell volume of HAT-7 cells. We concluded that non-ameloblast dental epithelium expresses NKCC1 to regulate cell volume in enamel organ and provide ameloblasts with Na+, K+ and Cl− ions required for the transport of mineral- and bicarbonate-ions into enamel. Absence of functional Nkcc1 likely is compensated by other types of ion channels and ion transporters. The increased amount of Cx43 in enamel organ cells in Nkcc1-null mice suggests that these cells display a higher number of gap junctions to increase intercellular communication. PMID:29209227

  4. Role of the urate transporter SLC2A9 gene in susceptibility to gout in New Zealand Māori, Pacific Island, and Caucasian case-control sample sets.

    Science.gov (United States)

    Hollis-Moffatt, Jade E; Xu, Xin; Dalbeth, Nicola; Merriman, Marilyn E; Topless, Ruth; Waddell, Chloe; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B B; Stamp, Lisa K; Merriman, Tony R

    2009-11-01

    To examine the role of genetic variation in the renal urate transporter SLC2A9 in gout in New Zealand sample sets of Māori, Pacific Island, and Caucasian ancestry and to determine if the Māori and Pacific Island samples could be useful for fine-mapping. Patients (n= 56 Māori, 69 Pacific Island, and 131 Caucasian) were recruited from rheumatology outpatient clinics and satisfied the American College of Rheumatology criteria for gout. The control samples comprised 125 Māori subjects, 41 Pacific Island subjects, and 568 Caucasian subjects without arthritis. SLC2A9 single-nucleotide polymorphisms rs16890979 (V253I), rs5028843, rs11942223, and rs12510549 were genotyped (possible etiologic variants in Caucasians). Association of the major allele of rs16890979, rs11942223, and rs5028843 with gout was observed in all sample sets (P = 3.7 x 10(-7), 1.6 x 10(-6), and 7.6 x 10(-5) for rs11942223 in the Māori, Pacific Island, and Caucasian samples, respectively). One 4-marker haplotype (1/1/2/1; more prevalent in the Māori and Pacific Island control samples) was not observed in a single gout case. Our data confirm a role of SLC2A9 in gout susceptibility in a New Zealand Caucasian sample set, with the effect on risk (odds ratio >2.0) greater than previous estimates. We also demonstrate association of SLC2A9 with gout in samples of Māori and Pacific Island ancestry and a consistent pattern of haplotype association. The presence of both alleles of rs16890979 on susceptibility and protective haplotypes in the Māori and Pacific Island sample is evidence against a role for this nonsynonymous variant as the sole etiologic agent. More extensive linkage disequilibrium in Māori and Pacific Island samples suggests that Caucasian samples may be more useful for fine-mapping.

  5. A 40-bp VNTR polymorphism in the 3'-untranslated region of DAT1/SLC6A3 is associated with ADHD but not with alcoholism.

    Science.gov (United States)

    Šerý, Omar; Paclt, Ivo; Drtílková, Ivana; Theiner, Pavel; Kopečková, Marta; Zvolský, Petr; Balcar, Vladimir J

    2015-06-11

    ADHD and alcoholism are psychiatric diseases with pathophysiology related to dopamine system. DAT1 belongs to the SLC6 family of transporters and is involved in the regulation of extracellular dopamine levels. A 40 bp variable number tandem repeat (VNTR) polymorphism in the 3'-untranslated region of DAT1/SLC6A3 gene was previously reported to be associated with various phenotypes involving disturbed regulation of dopaminergic neurotransmission. A total of 1312 subjects were included and genotyped for 40 bp VNTR polymorphism of DAT1/SLC6A3 gene in this study (441 alcoholics, 400 non-alcoholic controls, 218 ADHD children and 253 non ADHD children). Using miRBase software, we have performed a computer analysis of VNTR part of DAT1 gene for presence of miRNA binding sites. We have found significant relationships between ADHD and the 40 bp VNTR polymorphisms of DAT1/SLC6A3 gene (P VNTR polymorphism of DAT1/SLC6A3 gene has been detected. We have found an association between 40 bp VNTR polymorphism of DAT1/SLC6A3 gene and ADHD in the Czech population; in a broad agreement with studies in other population samples. Furthermore, we detected rare genotypes 8/10, 7/10 and 10/11 present in ADHD boys only and identified miRNAs that should be looked at as potential novel targets in the research on ADHD.

  6. Prenatal serotonin reuptake inhibitor (SRI antidepressant exposure and serotonin transporter promoter genotype (SLC6A4 influence executive functions at 6 years of age

    Directory of Open Access Journals (Sweden)

    Whitney eWeikum

    2013-10-01

    Full Text Available Prenatal exposure to serotonin reuptake inhibitor (SRI antidepressants and maternal depression may affect prefrontal cognitive skills (executive functions; EFs including self-control, working memory and cognitive flexibility. We examined long-term effects of prenatal SRI exposure on EFs to determine whether effects are moderated by maternal mood and/or genetic variations in SLC6A4 (a gene that codes for the serotonin transporter [5-HTT] central to the regulation of synaptic serotonin levels and behavior. Children who were exposed to SRIs prenatally (SRI-exposed N=26 and non-exposed (N=38 were studied at age 6 years (M=6.3 SD=0.5 using the Hearts & Flowers task (H&F to assess EFs. Maternal mood was measured during pregnancy (3rd trimester and when the child was age 6 years (Hamilton Depression Scale. Parent reports of child behavior were also obtained (MacArthur Health & Behavior Questionnaire. Parents of prenatally SRI-exposed children reported fewer child externalizing and inattentive (ADHD behaviors. Generalized estimate equation modeling showed a significant 3-way interaction between prenatal SRI exposure, SLC6A4 variant, and maternal mood at the 6-year time-point on H&F accuracy. For prenatally SRI-exposed children, regardless of maternal mood, the H&F accuracy of children with reduced 5HTT expression (a short [S] allele remained stable. Even with increasing maternal depressive symptoms (though all below clinical threshold, EFs of children with at least one short allele were comparable to children with the same genotype whose mothers reported few if any depressive symptoms – in this sense they showed resilience. Children with two long (L alleles were more sensitive to context. When their mothers had few depressive symptoms, LL children showed extremely good EF performance – better than any other group. When their mothers reported more depressive symptoms, LL children’s EF performance was worse than that of any other group.

  7. Characterization of Organic Anion Transporter 2 (SLC22A7): A Highly Efficient Transporter for Creatinine and Species-Dependent Renal Tubular Expression.

    Science.gov (United States)

    Shen, Hong; Liu, Tongtong; Morse, Bridget L; Zhao, Yue; Zhang, Yueping; Qiu, Xi; Chen, Cliff; Lewin, Anne C; Wang, Xi-Tao; Liu, Guowen; Christopher, Lisa J; Marathe, Punit; Lai, Yurong

    2015-07-01

    The contribution of organic anion transporter OAT2 (SLC22A7) to the renal tubular secretion of creatinine and its exact localization in the kidney are reportedly controversial. In the present investigation, the transport of creatinine was assessed in human embryonic kidney (HEK) cells that stably expressed human OAT2 (OAT2-HEK) and isolated human renal proximal tubule cells (HRPTCs). The tubular localization of OAT2 in human, monkey, and rat kidney was characterized. The overexpression of OAT2 significantly enhanced the uptake of creatinine in OAT2-HEK cells. Under physiologic conditions (creatinine concentrations of 41.2 and 123.5 µM), the initial rate of OAT2-mediated creatinine transport was approximately 11-, 80-, and 80-fold higher than OCT2, multidrug and toxin extrusion protein (MATE)1, and MATE2K, respectively, resulting in approximately 37-, 1850-, and 80-fold increase of the intrinsic transport clearance when normalized to the transporter protein concentrations. Creatinine intracellular uptake and transcellular transport in HRPTCs were decreased in the presence of 50 µM bromosulfophthalein and 100 µM indomethacin, which inhibited OAT2 more potently than other known creatinine transporters, OCT2 and multidrug and toxin extrusion proteins MATE1 and MATE2K (IC50: 1.3 µM vs. > 100 µM and 2.1 µM vs. > 200 µM for bromosulfophthalein and indomethacin, respectively) Immunohistochemistry analysis showed that OAT2 protein was localized to both basolateral and apical membranes of human and cynomolgus monkey renal proximal tubules, but appeared only on the apical membrane of rat proximal tubules. Collectively, the findings revealed the important role of OAT2 in renal secretion and possible reabsorption of creatinine and suggested a molecular basis for potential species difference in the transporter handling of creatinine. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.

  8. Lack of association between VNTR polymorphism of dopamine transporter gene (SLC6A3 and schizophrenia in a Brazilian sample Ausência de associação entre o polimorfismo VNTR do gene do transportador de dopamina (SLC6A3 e esquizofrenia em uma população brasileira

    Directory of Open Access Journals (Sweden)

    Quirino Cordeiro

    2004-12-01

    Full Text Available A role of dopaminergic dysfunction has been postulated in the aetiology of schizophrenia. We hypothesized that variations in the dopamine transporter gene (SLC6A3 may be associated with schizophrenia. We conducted case-control and family based analysis on the polymorphic SLC6A3 variable number tandem repeat (VNTR in a sample of 220 schizophrenic patients, 226 gender and ethnic matched controls, and 49 additional case-parent trios. No differences were found in allelic or genotypic distributions between cases and controls and no significant transmission distortions from heterozygous parents to schizophrenic offspring were detected. Thus, our results do not support an association of the SLC6A3 VNTR with schizophrenia in our sample.Genes do sistema dopaminérgico são de escolha para a pesquisa de susceptibilidade para a esquizofrenia. Desse modo, possível contribuição do polimorfismo do gene do transportador de dopamina (SLC6A3 no aumento da vulnerabilidade para a esquizofrenia foi investigada no presente estudo. Analisou-se a distribuição do sítio polimórfico do gene do transportador de dopamina (VNTR em uma população de 220 pacientes com esquizofrenia (critério diagnóstico: DSM-IV e comparou-se com a distribuição em uma população controle de 226 indivíduos pareados para sexo e etnia. Nenhuma diferença foi observada na distribuição dos alelos entre casos e controles. O mesmo polimorfismo também foi investigado em uma segunda amostra composta por 49 trios (pais e probando. O resultado também foi negativo. Tais dados não dão suporte para a participação do polimorfismo do gene do transportador de dopamina no aumento de susceptibilidade para esquizofrenia na amostra estudada.

  9. SLC39A8 Deficiency: A Disorder of Manganese Transport and Glycosylation.

    Science.gov (United States)

    Park, Julien H; Hogrebe, Max; Grüneberg, Marianne; DuChesne, Ingrid; von der Heiden, Ava L; Reunert, Janine; Schlingmann, Karl P; Boycott, Kym M; Beaulieu, Chandree L; Mhanni, Aziz A; Innes, A Micheil; Hörtnagel, Konstanze; Biskup, Saskia; Gleixner, Eva M; Kurlemann, Gerhard; Fiedler, Barbara; Omran, Heymut; Rutsch, Frank; Wada, Yoshinao; Tsiakas, Konstantinos; Santer, René; Nebert, Daniel W; Rust, Stephan; Marquardt, Thorsten

    2015-12-03

    SLC39A8 is a membrane transporter responsible for manganese uptake into the cell. Via whole-exome sequencing, we studied a child that presented with cranial asymmetry, severe infantile spasms with hypsarrhythmia, and dysproportionate dwarfism. Analysis of transferrin glycosylation revealed severe dysglycosylation corresponding to a type II congenital disorder of glycosylation (CDG) and the blood manganese levels were below the detection limit. The variants c.112G>C (p.Gly38Arg) and c.1019T>A (p.Ile340Asn) were identified in SLC39A8. A second individual with the variants c.97G>A (p.Val33Met) and c.1004G>C (p.Ser335Thr) on the paternal allele and c.610G>T (p.Gly204Cys) on the maternal allele was identified among a group of unresolved case subjects with CDG. These data demonstrate that variants in SLC39A8 impair the function of manganese-dependent enzymes, most notably β-1,4-galactosyltransferase, a Golgi enzyme essential for biosynthesis of the carbohydrate part of glycoproteins. Impaired galactosylation leads to a severe disorder with deformed skull, severe seizures, short limbs, profound psychomotor retardation, and hearing loss. Oral galactose supplementation is a treatment option and results in complete normalization of glycosylation. SLC39A8 deficiency links a trace element deficiency with inherited glycosylation disorders. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  10. Structure of Bor1 supports an elevator transport mechanism for SLC4 anion exchangers.

    Science.gov (United States)

    Thurtle-Schmidt, Bryan H; Stroud, Robert M

    2016-09-20

    Boron is essential for plant growth because of its incorporation into plant cell walls; however, in excess it is toxic to plants. Boron transport and homeostasis in plants is regulated in part by the borate efflux transporter Bor1, a member of the solute carrier (SLC) 4 transporter family with homology to the human bicarbonate transporter Band 3. Here, we present the 4.1-Å resolution crystal structure of Arabidopsis thaliana Bor1. The structure displays a dimeric architecture in which dimerization is mediated by centralized Gate domains. Comparisons with a structure of Band 3 in an outward-open state reveal that the Core domains of Bor1 have rotated inwards to achieve an occluded state. Further structural comparisons with UapA, a xanthine transporter from the nucleobase-ascorbate transporter family, show that the downward pivoting of the Core domains relative to the Gate domains may access an inward-open state. These results suggest that the SLC4, SLC26, and nucleobase-ascorbate transporter families all share an elevator transport mechanism in which alternating access is provided by Core domains that carry substrates across a membrane.

  11. Polymorphism Study on SLC30A8 and Its Association with Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    M. Vignesh

    2016-11-01

    Full Text Available Type 2 diabetes mellitus (T2DM is one of the threatening disorders in the world. It affects people of all ages. Type 2 diabetes mellitus is a condition in which the glucose level in the blood is elevated due to improper function of the secretion of insulin from beta cells of the pancreas. It is a multifactorial disease because it is caused by both environmental and hereditary factors. One of the genes which play an important role in type 2 diabetes mellitus is SLC30A8 which encodes for zinc transporter ZnT8. The common polymorphic site for SLC30A8 is rs13266634. This single-nucleotide polymorphism leads to type 2 diabetes mellitus by replacing the arginine residue with tryptophan residue. This review mainly focuses on the polymorphic studies in the gene SLC30A8 and its association with type 2 diabetes mellitus.

  12. [The association of polymorphisms in SLC18A1, TPH1 and RELN genes with risk of paranoid schizophrenia].

    Science.gov (United States)

    Galaktionova, D Iu; Gareeva, A E; Khusnutdinova, E K; Nasedkina, T V

    2014-01-01

    We have developed a biochip for the analysis of polymorphisms in candidate genes for schizophrenia: DISC1, RELN, ZNF804A, PLXNA2, COMT, SLC18A41, CACNA1C, ANK3, TPH1, PLAA and SNAP-25. Using biochip the allele and genotype frequencies in 198 patients with schizophrenia and 192 healthy individuals have been obtained. For SLC18A1 polymorphism rs2270641 A>C, the frequencies of A allele (p = 0.007) and AA genotype (p = 0.002) were lower in patients compared with healthy individuals. A significant association was found between AA genotype (p = 0.036) of the TPH1 polymorphism rs1800532 C>A and schizophrenia. The C allele (p = 0.039) of the RELNpolymorphism rs7341475 C>T were lower in patients with schizophrenia compared with healthy individuals in a tatar population. Genotype AA of the TPH1 polymorphism rs1800532 C>A were more frequent in patients with schizophrenia compared with healthy individuals. Ithas been shown that the C allele (p = 0.0001) and GC (p = = 0.0001) genotype of the PLXNA2 polymorphism rs1327175 G>C are associated with the family history in patients with paranoid schizophrenia. The obtained data suggest that SLC18A1, TPH1 and RELN gene polymorphisms are associated with the risk of paranoid schizophrenia.

  13. Defective enamel and bone development in sodium-dependent citrate transporter (NaCT Slc13a5 deficient mice.

    Directory of Open Access Journals (Sweden)

    Armando R Irizarry

    Full Text Available There has been growing recognition of the essential roles of citrate in biomechanical properties of mineralized tissues, including teeth and bone. However, the sources of citrate in these tissues have not been well defined, and the contribution of citrate to the regulation of odontogenesis and osteogenesis has not been examined. Here, tooth and bone phenotypes were examined in sodium-dependent citrate transporter (NaCT Slc13a5 deficient C57BL/6 mice at 13 and 32 weeks of age. Slc13a5 deficiency led to defective tooth development, characterized by absence of mature enamel, formation of aberrant enamel matrix, and dysplasia and hyperplasia of the enamel organ epithelium that progressed with age. These abnormalities were associated with fragile teeth with a possible predisposition to tooth abscesses. The lack of mature enamel was consistent with amelogenesis imperfecta. Furthermore, Slc13a5 deficiency led to decreased bone mineral density and impaired bone formation in 13-week-old mice but not in older mice. The findings revealed the potentially important role of citrate and Slc13a5 in the development and function of teeth and bone.

  14. Recent SLC developments

    International Nuclear Information System (INIS)

    Ross, M.

    1993-04-01

    The SLAC Linear Collider (SLC) is the forerunner of a new generation of high energy accelerators. As such, it incorporates many novel features that must be fully exploited to achieve optimum performance. In this paper we present an overview of the frontiers of collider performance at SLC. Recent developments have centered on polarization, intensity and emittance preservation issues. A polarized source and spin transport system were successfully commissioned in 1992 and operated with high reliability. Practical intensity limits associated with rapid growth ( S ) bunch length instabilities have been observed in the damping rings. Ring RF voltage manipulations are used to suppress the instabilities. Emittance preservation technique development has focused on controlling system-wide instabilities and improving feedback and tuning procedures. Control of instabilities of all time scales, pulse to pulse, fast and slow, is one of the most challenging aspects of the collider. The challenge is met with (1) very high level of control and automation required for general tuning and optimization, (2) real-time transport line optical correction and monitoring, (3) coupled, high level, trajectory and energy feedback, (4) high order multipole optical correction and monitoring, (5) feedback-based linac beam emittance preservation, and (6) interaction region luminosity optimization. The common thread beneath all of these is the SLC control system which must provide a level of control, diagnosis and feedback not required for simpler machines

  15. SLC5A8 gene, a transporter of butyrate: a gut flora metabolite, is frequently methylated in African American colon adenomas.

    Directory of Open Access Journals (Sweden)

    Hassan Brim

    Full Text Available Colon cancer is one of the leading causes of cancer related deaths. Its impact on African Americans (AAs is higher than in the general population both in the incidence and mortality from the disease. Colon cancer aggressiveness in AAs as well as non-frequent check-ups and follow up in this population have been proposed as ways to explain the observed discrepancies. These facts made the detection of early carcinogenesis markers in this population a priority.Here, we analyzed 50 colon adenomas from AA patients for both microsatellite instability (MSI and the methylation status of SLC5A8 gene. This gene's product is involved in the transport of butyrate that has anti-proliferative properties through its effects on histone acetylation and gene expression. A proteomic analysis to check the expressed histones in adenoma and normal tissues was also performed.The analyzed samples displayed 82% (n = 41 methylation level of SLC5A8 gene in adenomas. The MSI-H (high adenoma were about 18% (n = 9 while the rest were mostly MSS (microsatellite stable with few MSI-L (Low. No association was found between SLC5A8 methylation and the MSI status. Also, there was no association between SLC5A8 methylation and the sex and age of the patients. However, there were more right sided adenomas with SLC5A8 methylation than the left sided ones. The proteomic analysis revealed distinct histone expression profiles between normal and adenoma tissues.SLC5A8 is highly methylated in AA colon adenomas which points to its potential use as a marker for early detection. The MSI rate is similar to that found in colon cancer tumors in AAs. These findings suggest that both processes stem from the same epigenetic and genetic events occurring at an early stage in colon carcinogenesis in AAs.

  16. The cataract and glucosuria associated monocarboxylate transporter MCT12 is a new creatine transporter

    Science.gov (United States)

    Abplanalp, Jeannette; Laczko, Endre; Philp, Nancy J.; Neidhardt, John; Zuercher, Jurian; Braun, Philipp; Schorderet, Daniel F.; Munier, Francis L.; Verrey, François; Berger, Wolfgang; Camargo, Simone M.R.; Kloeckener-Gruissem, Barbara

    2013-01-01

    Creatine transport has been assigned to creatine transporter 1 (CRT1), encoded by mental retardation associated SLC6A8. Here, we identified a second creatine transporter (CRT2) known as monocarboxylate transporter 12 (MCT12), encoded by the cataract and glucosuria associated gene SLC16A12. A non-synonymous alteration in MCT12 (p.G407S) found in a patient with age-related cataract (ARC) leads to a significant reduction of creatine transport. Furthermore, Slc16a12 knockout (KO) rats have elevated creatine levels in urine. Transport activity and expression characteristics of the two creatine transporters are distinct. CRT2 (MCT12)-mediated uptake of creatine was not sensitive to sodium and chloride ions or creatine biosynthesis precursors, breakdown product creatinine or creatine phosphate. Increasing pH correlated with increased creatine uptake. Michaelis–Menten kinetics yielded a Vmax of 838.8 pmol/h/oocyte and a Km of 567.4 µm. Relative expression in various human tissues supports the distinct mutation-associated phenotypes of the two transporters. SLC6A8 was predominantly found in brain, heart and muscle, while SLC16A12 was more abundant in kidney and retina. In the lens, the two transcripts were found at comparable levels. We discuss the distinct, but possibly synergistic functions of the two creatine transporters. Our findings infer potential preventive power of creatine supplementation against the most prominent age-related vision impaired condition. PMID:23578822

  17. AVPR1a and SLC6A4 Gene Polymorphisms Are Associated with Creative Dance Performance.

    Directory of Open Access Journals (Sweden)

    2005-09-01

    Full Text Available Dancing, which is integrally related to music, likely has its origins close to the birth of Homo sapiens, and throughout our history, dancing has been universally practiced in all societies. We hypothesized that there are differences among individuals in aptitude, propensity, and need for dancing that may partially be based on differences in common genetic polymorphisms. Identifying such differences may lead to an understanding of the neurobiological basis of one of mankind's most universal and appealing behavioral traits-dancing. In the current study, 85 current performing dancers and their parents were genotyped for the serotonin transporter (SLC6A4: promoter region HTTLPR and intron 2 VNTR and the arginine vasopressin receptor 1a (AVPR1a: promoter microsatellites RS1 and RS3. We also genotyped 91 competitive athletes and a group of nondancers/nonathletes (n = 872 subjects from 414 families. Dancers scored higher on the Tellegen Absorption Scale, a questionnaire that correlates positively with spirituality and altered states of consciousness, as well as the Reward Dependence factor in Cloninger's Tridimensional Personality Questionnaire, a measure of need for social contact and openness to communication. Highly significant differences in AVPR1a haplotype frequencies (RS1 and RS3, especially when conditional on both SLC6A4 polymorphisms (HTTLPR and VNTR, were observed between dancers and athletes using the UNPHASED program package (Cocaphase: likelihood ratio test [LRS] = 89.23, p = 0.000044. Similar results were obtained when dancers were compared to nondancers/nonathletes (Cocaphase: LRS = 92.76, p = 0.000024. These results were confirmed using a robust family-based test (Tdtphase: LRS = 46.64, p = 0.010. Association was also observed between Tellegen Absorption Scale scores and AVPR1a (Qtdtphase: global chi-square = 26.53, p = 0.047, SLC6A4 haplotypes (Qtdtphase: chi-square = 2.363, p = 0.018, and AVPR1a conditional on SCL6A4 (Tdtphase: LRS

  18. AVPR1a and SLC6A4 gene polymorphisms are associated with creative dance performance.

    Directory of Open Access Journals (Sweden)

    Rachel Bachner-Melman

    2005-09-01

    Full Text Available Dancing, which is integrally related to music, likely has its origins close to the birth of Homo sapiens, and throughout our history, dancing has been universally practiced in all societies. We hypothesized that there are differences among individuals in aptitude, propensity, and need for dancing that may partially be based on differences in common genetic polymorphisms. Identifying such differences may lead to an understanding of the neurobiological basis of one of mankind's most universal and appealing behavioral traits--dancing. In the current study, 85 current performing dancers and their parents were genotyped for the serotonin transporter (SLC6A4: promoter region HTTLPR and intron 2 VNTR and the arginine vasopressin receptor 1a (AVPR1a: promoter microsatellites RS1 and RS3. We also genotyped 91 competitive athletes and a group of nondancers/nonathletes (n = 872 subjects from 414 families. Dancers scored higher on the Tellegen Absorption Scale, a questionnaire that correlates positively with spirituality and altered states of consciousness, as well as the Reward Dependence factor in Cloninger's Tridimensional Personality Questionnaire, a measure of need for social contact and openness to communication. Highly significant differences in AVPR1a haplotype frequencies (RS1 and RS3, especially when conditional on both SLC6A4 polymorphisms (HTTLPR and VNTR, were observed between dancers and athletes using the UNPHASED program package (Cocaphase: likelihood ratio test [LRS] = 89.23, p = 0.000044. Similar results were obtained when dancers were compared to nondancers/nonathletes (Cocaphase: LRS = 92.76, p = 0.000024. These results were confirmed using a robust family-based test (Tdtphase: LRS = 46.64, p = 0.010. Association was also observed between Tellegen Absorption Scale scores and AVPR1a (Qtdtphase: global chi-square = 26.53, p = 0.047, SLC6A4 haplotypes (Qtdtphase: chi-square = 2.363, p = 0.018, and AVPR1a conditional on SCL6A4 (Tdtphase: LRS

  19. Expression of solute carrier 7A4 (SLC7A4) in the plasma membrane is not sufficient to mediate amino acid transport activity.

    OpenAIRE

    Wolf, Sabine; Janzen, Annette; Vékony, Nicole; Martiné, Ursula; Strand, Dennis; Closs, Ellen I

    2002-01-01

    Member 4 of human solute carrier family 7 (SLC7A4) exhibits significant sequence homology with the SLC7 subfamily of human cationic amino acid transporters (hCATs) [Sperandeo, Borsani, Incerti, Zollo, Rossi, Zuffardi, Castaldo, Taglialatela, Andria and Sebastio (1998) Genomics 49, 230-236]. It is therefore often referred to as hCAT-4 even though no convincing transport activity has been shown for this protein. We expressed SLC7A4 in Xenopus laevis oocytes, but could not detect any transport a...

  20. The Creatine Transporter Gene Paralogous at 16p11.2 Is Expressed in Human Brain

    Directory of Open Access Journals (Sweden)

    Nadia Bayou

    2008-01-01

    We report on the clinical, cytogenetic, and molecular findings in a boy with autism carrying a de novo translocation t(7;16(p22.1;p11.2. The chromosome 16 breakpoint disrupts the paralogous SLC6A8 gene also called SLC6A10 or CT2. Predicted translation of exons and RT-PCR analysis reveal specific expression of the creatine transporter paralogous in testis and brain. Several studies reported on the role of X-linked creatine transporter mutations in individuals with mental retardation, with or without autism. The existence of disruption in SLC6A8 paralogous gene associated with idiopathic autism suggests that this gene may be involved in the autistic phenotype in our patient.

  1. Physiology of SLC12 transporters: lessons from inherited human genetic mutations and genetically engineered mouse knockouts.

    Science.gov (United States)

    Gagnon, Kenneth B; Delpire, Eric

    2013-04-15

    Among the over 300 members of the solute carrier (SLC) group of integral plasma membrane transport proteins are the nine electroneutral cation-chloride cotransporters belonging to the SLC12 gene family. Seven of these transporters have been functionally described as coupling the electrically silent movement of chloride with sodium and/or potassium. Although in silico analysis has identified two additional SLC12 family members, no physiological role has been ascribed to the proteins encoded by either the SLC12A8 or the SLC12A9 genes. Evolutionary conservation of this gene family from protists to humans confirms their importance. A wealth of physiological, immunohistochemical, and biochemical studies have revealed a great deal of information regarding the importance of this gene family to human health and disease. The sequencing of the human genome has provided investigators with the capability to link several human diseases with mutations in the genes encoding these plasma membrane proteins. The availability of bacterial artificial chromosomes, recombination engineering techniques, and the mouse genome sequence has simplified the creation of targeting constructs to manipulate the expression/function of these cation-chloride cotransporters in the mouse in an attempt to recapitulate some of these human pathologies. This review will summarize the three human disorders that have been linked to the mutation/dysfunction of the Na-Cl, Na-K-2Cl, and K-Cl cotransporters (i.e., Bartter's, Gitleman's, and Andermann's syndromes), examine some additional pathologies arising from genetically modified mouse models of these cotransporters including deafness, blood pressure, hyperexcitability, and epithelial transport deficit phenotypes.

  2. Estimated carrier frequency of creatine transporter deficiency in females in the general population using functional characterization of novel missense variants in the SLC6A8 gene.

    Science.gov (United States)

    DesRoches, Caro-Lyne; Patel, Jaina; Wang, Peixiang; Minassian, Berge; Salomons, Gajja S; Marshall, Christian R; Mercimek-Mahmutoglu, Saadet

    2015-07-10

    Creatine transporter deficiency (CRTR-D) is an X-linked inherited disorder of creatine transport. All males and about 50% of females have intellectual disability or cognitive dysfunction. Creatine deficiency on brain proton magnetic resonance spectroscopy and elevated urinary creatine to creatinine ratio are important biomarkers. Mutations in the SLC6A8 gene occur de novo in 30% of males. Despite reports of high prevalence of CRTR-D in males with intellectual disability, there are no true prevalence studies in the general population. To determine carrier frequency of CRTR-D in the general population we studied the variants in the SLC6A8 gene reported in the Exome Variant Server database and performed functional characterization of missense variants. We also analyzed synonymous and intronic variants for their predicted pathogenicity using in silico analysis tools. Nine missense variants were functionally analyzed using transient transfection by site-directed mutagenesis with In-Fusion HD Cloning in HeLa cells. Creatine uptake was measured by liquid chromatography tandem mass spectrometry for creatine measurement. The c.1654G>T (p.Val552Leu) variant showed low residual creatine uptake activity of 35% of wild type transfected HeLa cells and was classified as pathogenic. Three variants (c.808G>A; p.Val270Met, c.942C>G; p.Phe314Leu and c.952G>A; p.Ala318Thr) were predicted to be pathogenic based on in silico analysis, but proved to be non-pathogenic by our functional analysis. The estimated carrier frequency of CRTR-D was 0.024% in females in the general population. We recommend functional studies for all novel missense variants by transient transfection followed by creatine uptake measurement by liquid chromatography tandem mass spectrometry as fast and cost effective method for the functional analysis of missense variants in the SLC6A8 gene. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.

  3. Contribution of SLC30A8 variants to the risk of type 2 diabetes in a multi-ethnic population: a case control study

    OpenAIRE

    Salem, Sameer D; Saif-Ali, Riyadh; Ismail, Ikram S; Al-Hamodi, Zaid; Muniandy, Sekaran

    2014-01-01

    Background Several studies have shown the association of solute carrier family 30 (zinc transporter) member 8 (SLC30A8) rs13266634 with type 2 diabetes (T2D). However, the association of alternative variants and haplotypes of SLC30A8 with T2D have not been studied in different populations. The aim of this study is to assess the association of the alternative SLC30A8 variants, rs7002176 and rs1995222 as well as the most common variant, rs13266634 and haplotypes with glutamic acid decarboxylase...

  4. Lack of SLC2A1 (glucose transporter 1) mutations in 30 Italian patients with alternating hemiplegia of childhood.

    Science.gov (United States)

    De Grandis, Elisa; Stagnaro, Michela; Biancheri, Roberta; Giannotta, Melania; Gobbi, Giuseppe; Traverso, Monica; Veneselli, Edvige; Zara, Federico

    2013-07-01

    Alternating hemiplegia of childhood is a rare, predominantly sporadic disorder. Diagnosis is clinical, and little is known about genetics. Glucose transporter 1 deficiency syndrome shares with alternating hemiplegia of childhood paroxysmal and nonparoxysmal symptoms. The aim of the study was to investigate glucose transporter 1 mutations in 30 Italian patients. Genetic material was analyzed by DNA amplification and glucose transporter 1 region sequencing. Mutational analysis findings of the SLC2A1 gene were negative in all patients. The pattern of movement disorders was reviewed. Interictal dystonia and multiple paroxysmal events were typical of alternating hemiplegia of childhood. In conclusion, alternating hemiplegia of childhood is a heterogeneous clinical condition, and although glucose transporter 1 deficiency can represent an undiagnosed cause of this disorder, mutational analysis is not routinely recommended. Alternatively, a careful clinical analysis and the 3-O-methyl-D-glucose uptake test can allow prompt identification of a subgroup of patients with alternating hemiplegia of childhood treatable with a ketogenic diet.

  5. Human Sodium Phosphate Transporter 4 (hNPT4/SLC17A3) as a Common Renal Secretory Pathway for Drugs and Urate*

    Science.gov (United States)

    Jutabha, Promsuk; Anzai, Naohiko; Kitamura, Kenichiro; Taniguchi, Atsuo; Kaneko, Shuji; Yan, Kunimasa; Yamada, Hideomi; Shimada, Hidetaka; Kimura, Toru; Katada, Tomohisa; Fukutomi, Toshiyuki; Tomita, Kimio; Urano, Wako; Yamanaka, Hisashi; Seki, George; Fujita, Toshiro; Moriyama, Yoshinori; Yamada, Akira; Uchida, Shunya; Wempe, Michael F.; Endou, Hitoshi; Sakurai, Hiroyuki

    2010-01-01

    The evolutionary loss of hepatic urate oxidase (uricase) has resulted in humans with elevated serum uric acid (urate). Uricase loss may have been beneficial to early primate survival. However, an elevated serum urate has predisposed man to hyperuricemia, a metabolic disturbance leading to gout, hypertension, and various cardiovascular diseases. Human serum urate levels are largely determined by urate reabsorption and secretion in the kidney. Renal urate reabsorption is controlled via two proximal tubular urate transporters: apical URAT1 (SLC22A12) and basolateral URATv1/GLUT9 (SLC2A9). In contrast, the molecular mechanism(s) for renal urate secretion remain unknown. In this report, we demonstrate that an orphan transporter hNPT4 (human sodium phosphate transporter 4; SLC17A3) was a multispecific organic anion efflux transporter expressed in the kidneys and liver. hNPT4 was localized at the apical side of renal tubules and functioned as a voltage-driven urate transporter. Furthermore, loop diuretics, such as furosemide and bumetanide, substantially interacted with hNPT4. Thus, this protein is likely to act as a common secretion route for both drugs and may play an important role in diuretics-induced hyperuricemia. The in vivo role of hNPT4 was suggested by two hyperuricemia patients with missense mutations in SLC17A3. These mutated versions of hNPT4 exhibited reduced urate efflux when they were expressed in Xenopus oocytes. Our findings will complete a model of urate secretion in the renal tubular cell, where intracellular urate taken up via OAT1 and/or OAT3 from the blood exits from the cell into the lumen via hNPT4. PMID:20810651

  6. Lack of Association between SLC30A8 Variants and Type 2 Diabetes in Mexican American Families

    Directory of Open Access Journals (Sweden)

    Hemant Kulkarni

    2016-01-01

    Full Text Available SLC30A8 encodes zinc transporter 8 which is involved in packaging and release of insulin. Evidence for the association of SLC30A8 variants with type 2 diabetes (T2D is inconclusive. We interrogated single nucleotide polymorphisms (SNPs around SLC30A8 for association with T2D in high-risk, pedigreed individuals from extended Mexican American families. This study of 118 SNPs within 50 kb of the SLC30A8 locus tested the association with eight T2D-related traits at four levels: (i each SNP using measured genotype approach (MGA; (ii interaction of SNPs with age and sex; (iii combinations of SNPs using Bayesian Quantitative Trait Nucleotide (BQTN analyses; and (iv entire gene locus using the gene burden test. Only one SNP (rs7817754 was significantly associated with incident T2D but a summary statistic based on all T2D-related traits identified 11 novel SNPs. Three SNPs and one SNP were weakly but interactively associated with age and sex, respectively. BQTN analyses could not demonstrate any informative combination of SNPs over MGA. Lastly, gene burden test results showed that at best the SLC30A8 locus could account for only 1-2% of the variability in T2D-related traits. Our results indicate a lack of association of the SLC30A8 SNPs with T2D in Mexican American families.

  7. Documentation for the “XT3D” option in the Node Property Flow (NPF) Package of MODFLOW 6

    Science.gov (United States)

    Provost, Alden M.; Langevin, Christian D.; Hughes, Joseph D.

    2017-08-10

    This report describes the “XT3D” option in the Node Property Flow (NPF) Package of MODFLOW 6. The XT3D option extends the capabilities of MODFLOW by enabling simulation of fully three-dimensional anisotropy on regular or irregular grids in a way that properly takes into account the full, three-dimensional conductivity tensor. It can also improve the accuracy of groundwater-flow simulations in cases in which the model grid violates certain geometric requirements. Three example problems demonstrate the use of the XT3D option to simulate groundwater flow on irregular grids and through three-dimensional porous media with anisotropic hydraulic conductivity.Conceptually, the XT3D method of estimating flow between two MODFLOW 6 model cells can be viewed in terms of three main mathematical steps: construction of head-gradient estimates by interpolation; construction of fluid-flux estimates by application of the full, three-dimensional form of Darcy’s Law, in which the conductivity tensor can be heterogeneous and anisotropic; and construction of the flow expression by enforcement of continuity of flow across the cell interface. The resulting XT3D flow expression, which relates the flow across the cell interface to the values of heads computed at neighboring nodes, is the sum of terms in which conductance-like coefficients multiply head differences, as in the conductance-based flow expression the NPF Package uses by default. However, the XT3D flow expression contains terms that involve “neighbors of neighbors” of the two cells for which the flow is being calculated. These additional terms have no analog in the conductance-based formulation. When assembled into matrix form, the XT3D formulation results in a larger stencil than the conductance-based formulation; that is, each row of the coefficient matrix generally contains more nonzero elements. The “RHS” suboption can be used to avoid expanding the stencil by placing the additional terms on the right-hand side

  8. Hypotonic activation of the myo-inositol transporter SLC5A3 in HEK293 cells probed by cell volumetry, confocal and super-resolution microscopy.

    Directory of Open Access Journals (Sweden)

    Joseph Andronic

    Full Text Available Swelling-activated pathways for myo-inositol, one of the most abundant organic osmolytes in mammalian cells, have not yet been identified. The present study explores the SLC5A3 protein as a possible transporter of myo-inositol in hyponically swollen HEK293 cells. To address this issue, we examined the relationship between the hypotonicity-induced changes in plasma membrane permeability to myo-inositol P ino [m/s] and expression/localization of SLC5A3. P ino values were determined by cell volumetry over a wide tonicity range (100-275 mOsm in myo-inositol-substituted solutions. While being negligible under mild hypotonicity (200-275 mOsm, P ino grew rapidly at osmolalities below 200 mOsm to reach a maximum of ∼ 3 nm/s at 100-125 mOsm, as indicated by fast cell swelling due to myo-inositol influx. The increase in P ino resulted most likely from the hypotonicity-mediated incorporation of cytosolic SLC5A3 into the plasma membrane, as revealed by confocal fluorescence microscopy of cells expressing EGFP-tagged SLC5A3 and super-resolution imaging of immunostained SLC5A3 by direct stochastic optical reconstruction microscopy (dSTORM. dSTORM in hypotonic cells revealed a surface density of membrane-associated SLC5A3 proteins of 200-2000 localizations/μm2. Assuming SLC5A3 to be the major path for myo-inositol, a turnover rate of 80-800 myo-inositol molecules per second for a single transporter protein was estimated from combined volumetric and dSTORM data. Hypotonic stress also caused a significant upregulation of SLC5A3 gene expression as detected by semiquantitative RT-PCR and Western blot analysis. In summary, our data provide first evidence for swelling-mediated activation of SLC5A3 thus suggesting a functional role of this transporter in hypotonic volume regulation of mammalian cells.

  9. Genome-wide association analysis confirms and extends the association of SLC2A9 with serum uric acid levels to Mexican Americans

    Directory of Open Access Journals (Sweden)

    Venkata Saroja eVoruganti

    2013-12-01

    Full Text Available Increased serum uric acid (SUA is a risk factor for gout and renal and cardiovascular disease. The purpose of this study was to identify genetic factors that affect the variation in SUA in 632 Mexican Americans participants of the San Antonio Family Heart Study (SAFHS. A genome-wide association analysis was performed using the Illumina Human Hap 550K single nucleotide polymorphism (SNP microarray. We used a linear regression-based association test under an additive model of allelic effect, while accounting for non-independence among family members via a kinship variance component. All analyses were performed in the software package SOLAR. SNPs rs6832439, rs13131257 and rs737267 in solute carrier protein 2 family, member 9 (SLC2A9 were associated with SUA at genome-wide significance (p <1.3×10-7. The minor alleles of these SNPs had frequencies of 36.2%, 36.2%, and 38.2 %, respectively, and were associated with decreasing SUA levels. All of these SNPs were located in introns 3-7 of SLC2A9, the location of the previously reported associations in European populations. When analyzed for association with cardiovascular-renal disease risk factors, conditional on SLC2A9 SNPs strongly associated with SUA, significant associations were found for SLC2A9 SNPs with BMI, body weight and waist circumference (p < 1.4 x 10-3 and suggestive associations with albumin-creatinine ratio and total antioxidant status. The SLC2A9 gene encodes an urate transporter that has considerable influence on variation in SUA. In addition to the primary association locus, suggestive evidence (p<1.9×10-6 for joint linkage/association was found at a previously-reported urate quantitative trait locus (Logarithm of odds score = 3.6 on 3p26.3. In summary, our GWAS extends and confirms the association of SLC2A9 with SUA for the first time in a Mexican American cohort and also shows for the first time its association with cardiovascular-renal disease risk factors.

  10. Neutronic design of the XT-ADS core

    International Nuclear Information System (INIS)

    Van den Eynde, G.

    2007-01-01

    The EUROTRANS project is an integrated project in the 6th European Framework Program in the context of Partitioning and Transmutation. The objective of this project is the step-wise approach to a European Transmutation Demonstration. This project aims to deliver an advanced design of a small-scale Accelerator Driven System (ADS), XT-ADS, as well as the conceptual design of a European Facility for Industrial Transmutation (EFIT). The partners of this project accepted to use the MYRRHA Draft-2 design file as a starting basis for the design of the short-term XT-ADS demonstration machine. Instead of starting from a blank page, this allowed optimising an existing design towards the needs of XT-ADS, and this within the accepted limits of the safety requirements. Many options have been revisited and the framework is now set up. The main two objectives of the XT-ADS machine are the following: to demonstrate the feasibility of the ADS concept and to perform as a multi-purpose irradiation facility. Special attention is paid to the possibility of testing fuel dedicated to transmutation of minor actinides and long-life fission products. During the demonstration phase, the core will be loaded with MOX fuel in a clean core configuration. Since the XT-ADS must be a representative prototype, it has to operate at a reasonable power, a minimum of 50 MWth was set in the objectives. After this phase, the core will house In-Pile-Sections of different types for irradiating material samples, new types of fuel pins. We aim to be able to provide irradiation conditions that are close to EFIT conditions so XT-ADS can be used as a test-bed for EFIT parts

  11. Treatable childhood neuronopathy caused by mutations in riboflavin transporter RFVT2

    Science.gov (United States)

    Foley, A. Reghan; Menezes, Manoj P.; Pandraud, Amelie; Gonzalez, Michael A.; Al-Odaib, Ahmad; Abrams, Alexander J.; Sugano, Kumiko; Yonezawa, Atsushi; Manzur, Adnan Y.; Burns, Joshua; Hughes, Imelda; McCullagh, B. Gary; Jungbluth, Heinz; Lim, Ming J.; Lin, Jean-Pierre; Megarbane, Andre; Urtizberea, J. Andoni; Shah, Ayaz H.; Antony, Jayne; Webster, Richard; Broomfield, Alexander; Ng, Joanne; Mathew, Ann A.; O’Byrne, James J.; Forman, Eva; Scoto, Mariacristina; Prasad, Manish; O’Brien, Katherine; Olpin, Simon; Oppenheim, Marcus; Hargreaves, Iain; Land, John M.; Wang, Min X.; Carpenter, Kevin; Horvath, Rita; Straub, Volker; Lek, Monkol; Gold, Wendy; Farrell, Michael O.; Brandner, Sebastian; Phadke, Rahul; Matsubara, Kazuo; McGarvey, Michael L.; Scherer, Steven S.; Baxter, Peter S.; King, Mary D.; Clayton, Peter; Rahman, Shamima; Reilly, Mary M.; Ouvrier, Robert A.; Christodoulou, John; Züchner, Stephan; Muntoni, Francesco

    2014-01-01

    Childhood onset motor neuron diseases or neuronopathies are a clinically heterogeneous group of disorders. A particularly severe subgroup first described in 1894, and subsequently called Brown-Vialetto-Van Laere syndrome, is characterized by progressive pontobulbar palsy, sensorineural hearing loss and respiratory insufficiency. There has been no treatment for this progressive neurodegenerative disorder, which leads to respiratory failure and usually death during childhood. We recently reported the identification of SLC52A2, encoding riboflavin transporter RFVT2, as a new causative gene for Brown-Vialetto-Van Laere syndrome. We used both exome and Sanger sequencing to identify SLC52A2 mutations in patients presenting with cranial neuropathies and sensorimotor neuropathy with or without respiratory insufficiency. We undertook clinical, neurophysiological and biochemical characterization of patients with mutations in SLC52A2, functionally analysed the most prevalent mutations and initiated a regimen of high-dose oral riboflavin. We identified 18 patients from 13 families with compound heterozygous or homozygous mutations in SLC52A2. Affected individuals share a core phenotype of rapidly progressive axonal sensorimotor neuropathy (manifesting with sensory ataxia, severe weakness of the upper limbs and axial muscles with distinctly preserved strength of the lower limbs), hearing loss, optic atrophy and respiratory insufficiency. We demonstrate that SLC52A2 mutations cause reduced riboflavin uptake and reduced riboflavin transporter protein expression, and we report the response to high-dose oral riboflavin therapy in patients with SLC52A2 mutations, including significant and sustained clinical and biochemical improvements in two patients and preliminary clinical response data in 13 patients with associated biochemical improvements in 10 patients. The clinical and biochemical responses of this SLC52A2-specific cohort suggest that riboflavin supplementation can

  12. SLC30A9 mutation affecting intracellular zinc homeostasis causes a novel cerebro-renal syndrome.

    Science.gov (United States)

    Perez, Yonatan; Shorer, Zamir; Liani-Leibson, Keren; Chabosseau, Pauline; Kadir, Rotem; Volodarsky, Michael; Halperin, Daniel; Barber-Zucker, Shiran; Shalev, Hanna; Schreiber, Ruth; Gradstein, Libe; Gurevich, Evgenia; Zarivach, Raz; Rutter, Guy A; Landau, Daniel; Birk, Ohad S

    2017-04-01

    A novel autosomal recessive cerebro-renal syndrome was identified in consanguineous Bedouin kindred: neurological deterioration was evident as of early age, progressing into severe intellectual disability, profound ataxia, camptocormia and oculomotor apraxia. Brain MRI was normal. Four of the six affected individuals also had early-onset nephropathy with features of tubulo-interstitial nephritis, hypertension and tendency for hyperkalemia, though none had rapid deterioration of renal function. Genome wide linkage analysis identified an ∼18 Mb disease-associated locus on chromosome 4 (maximal logarithm of odds score 4.4 at D4S2971; θ = 0). Whole exome sequencing identified a single mutation in SLC30A9 within this locus, segregating as expected within the kindred and not found in a homozygous state in 300 Bedouin controls. We showed that SLC30A9 (solute carrier family 30 member 9; also known as ZnT-9) is ubiquitously expressed with high levels in cerebellum, skeletal muscle, thymus and kidney. Confocal analysis of SH-SY5Y cells overexpressing SLC30A9 fused to enhanced green fluorescent protein demonstrated vesicular cytosolic localization associated with the endoplasmic reticulum, not co-localizing with endosomal or Golgi markers. SLC30A9 encodes a putative zinc transporter (by similarity) previously associated with Wnt signalling. However, using dual-luciferase reporter assay in SH-SY5Y cells we showed that Wnt signalling was not affected by the mutation. Based on protein modelling, the identified mutation is expected to affect SLC30A9's highly conserved cation efflux domain, putatively disrupting its transmembrane helix structure. Cytosolic Zn2+ measurements in HEK293 cells overexpressing wild-type and mutant SLC30A9 showed lower zinc concentration within mutant rather than wild-type SLC30A9 cells. This suggests that SLC30A9 has zinc transport properties affecting intracellular zinc homeostasis, and that the molecular mechanism of the disease is through

  13. Bromine-rich Zinc Bromides: Zn6Br12(18-crown-6)2×(Br2)5, Zn4Br8(18-crown-6)2×(Br2)3, and Zn6Br12(18-crown-6)2×(Br2)2.

    Science.gov (United States)

    Hausmann, David; Feldmann, Claus

    2016-06-20

    The bromine-rich zinc bromides Zn6Br12(18-crown-6)2×(Br2)5 (1), Zn4Br8(18-crown-6)2×(Br2)3 (2), and Zn6Br12(18-crown-6)2×(Br2)2 (3) are prepared by reaction of ZnBr2, 18-crown-6, and elemental bromine in the ionic liquid [MeBu3N][N(Tf)2] (N(Tf)2 = bis(trifluoromethylsulfonyl)amide). Zn6Br12(18-crown-6)2×(Br2)5 (1) is formed instantaneously by the reaction. Even at room temperature, compound 1 releases bromine, which was confirmed by thermogravimetry (TG) and mass spectrometry (MS). The release of Br2 can also be directly followed by the color and density of the title compounds. With controlled conditions (2 weeks, 25 °C, absence of excess Br2) Zn6Br12(18-crown-6)2×(Br2)5 (1) slowly releases bromine with conconcurrent generation of Zn4Br8(18-crown-6)2×(Br2)3 (2) (in ionic liquid) and Zn6Br12(18-crown-6)2×(Br2)2 (3) (in inert oil). All bromine-rich zinc bromides contain voluminous uncharged (e.g., Zn3Br6(18-crown-6), Zn2Br4(18-crown-6)) or ionic (e.g., [Zn2Br3(18-crown-6)](+), [(Zn2Br6)×(Br2)2](2-)) building units with dibromine molecules between the Zn oligomers and partially interconnecting the Zn-containing building units. Due to the structural similarity, the bromine release is possible via crystal-to-crystal transformation with retention of the crystal shape.

  14. Dicty_cDB: SLC418 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4

  15. Risk and protective genetic variants in suicidal behaviour: association with SLC1A2, SLC1A3, 5-HTR1B &NTRK2 polymorphisms.

    LENUS (Irish Health Repository)

    Murphy, Therese M

    2012-02-01

    BACKGROUND: Suicidal behaviour is known to aggregate in families. Patients with psychiatric disorders are at higher risk for suicide attempts (SA), however protective and risk genetic variants for suicide appear to be independent of underlying psychiatric disorders. Here we investigate genetic variants in genes important for neurobiological pathways linked to suicidal behaviour and\\/or associated endophenotypes, for association with SA among patients with co-existing psychiatric illness. Selected gene-gene and gene-environment interactions were also tested. METHODS: DNA was obtained from bloods of 159 patients (76 suicide attempters and 83 non-attempters), who were profiled for DSM-IV Axis I psychiatric diagnosis. Twenty-eight single nucleotide polymorphisms (SNPs) from 18 candidate genes (COMT, 5-HT2A, 5-HT1A, 5-HTR1B, TPH1, MAO-A, TPH2, DBH, CNR1, BDNF, ABCG1, GABRA5, GABRG2, GABRB2, SLC1A2, SLC1A3, NTRK2, CRHR1) were genotyped. Genotyping was performed by KBioscience. Tests of association between genetic variants and SA were conducted using Chi squared and Armitage Trend tests. Binary logistical regression analyses were performed to evaluate the contribution of individual genetic variants to the prediction of SA, and to examine SNPs for potential gene-gene and gene-environment interactions. RESULTS: Our analysis identified 4 SNPs (rs4755404, rs2269272, rs6296 and rs1659400), which showed evidence of association with SA compared to a non-attempter control group. We provide evidence of a 3-locus gene-gene interaction, and a putative gene-environment interaction, whereby genetic variation at the NTRK2 locus may moderate the risk associated with history of childhood abuse. CONCLUSION: Preliminary findings suggest that allelic variability in SLC1A2\\/3, 5-HTR1B and NTRK2 may be relevant to the underlying diathesis for suicidal acts.

  16. Distribution and expression of SLC45A2 in the skin of sheep with different coat colors.

    Science.gov (United States)

    Wang, Haidong; Xue, Linli; Li, Yanan; Zhao, Bingling; Chen, Tianzhi; Liu, Ying; Chang, Lucheng; Wang, Juan

    2016-01-01

    To investigate whether the membrane-associated transporter protein SLC45A2 is differentially expressed in the skin of sheep with different coat colors and to determine its correlation with coat color establishment in sheep. The expression of SLC45A2 in sheep skin samples with different coat colors was qualitatively and quantitatively analyzed by PCR amplification, RT-PCR, immunohistochemical staining and Western blotting. A 193-bp SLC45A2 CDS sequence was successfully amplified from sheep skin samples with diverse coat colors. RT-PCR analysis revealed that SLC45A2 mRNA was expressed in all sheep skin samples tested, with relative expression levels of 512.74 ± 121.51 in black skin, 143.38 ± 119.31 and 1.36 ± 0.09 in black dots and white dots of piebald skin, respectively, and 1.02 ± 0.23 in white skin (p coat colors. These patterns were quantified by optical density (OD) analysis, which yielded relative expression levels of 0.23 ± 0.11 in black skin, 0.19 ± 0.09 and 0.10 ± 0.03 in black dots and white dots of piebald skin, respectively, and 0.08 ± 0.01 in white skin (p coat colors, though at significantly different levels. SLC45A2 may participate in the establishment of coat color by regulating the synthesis and trafficking of melanin.

  17. Determination of Unbound Partition Coefficient and in Vitro-in Vivo Extrapolation for SLC13A Transporter-Mediated Uptake.

    Science.gov (United States)

    Riccardi, Keith; Li, Zhenhong; Brown, Janice A; Gorgoglione, Matthew F; Niosi, Mark; Gosset, James; Huard, Kim; Erion, Derek M; Di, Li

    2016-10-01

    Unbound partition coefficient (Kpuu) is important to an understanding of the asymmetric free drug distribution of a compound between cells and medium in vitro, as well as between tissue and plasma in vivo, especially for transporter-mediated processes. Kpuu was determined for a set of compounds from the SLC13A family that are inhibitors and substrates of transporters in hepatocytes and transporter-transfected cell lines. Enantioselectivity was observed, with (R)-enantiomers achieving much higher Kpuu (>4) than the (S)-enantiomers (<1) in human hepatocytes and SLC13A5-transfected human embryonic 293 cells. The intracellular free drug concentration correlated directly with in vitro pharmacological activity rather than the nominal concentration in the assay because of the high Kpuu mediated by SLC13A5 transporter uptake. Delivery of the diacid PF-06649298 directly or via hydrolysis of the ethyl ester prodrug PF-06757303 resulted in quite different Kpuu values in human hepatocytes (Kpuu of 3 for diacid versus 59 for prodrug), which was successfully modeled on the basis of passive diffusion, active uptake, and conversion rate from ester to diacid using a compartmental model. Kpuu values changed with drug concentrations; lower values were observed at higher concentrations possibly owing to a saturation of transporters. Michaelis-Menten constant (Km) of SLC13A5 was estimated to be 24 μM for PF-06649298 in human hepatocytes. In vitro Kpuu obtained from rat suspension hepatocytes supplemented with 4% fatty acid free bovine serum albumin showed good correlation with in vivo Kpuu of liver-to-plasma, illustrating the potential of this approach to predict in vivo Kpuu from in vitro systems. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.

  18. Correction of the first order beam transport of the SLC Arcs

    International Nuclear Information System (INIS)

    Walker, N.; Barklow, T.; Emma, P.; Krejcik, P.

    1991-05-01

    Correction of the first order transport of the SLC Arcs has been made possible by a technique which allows the full 4x4 transport matrix across any section of Arc to be experimentally determined. By the introduction of small closed bumps into each achromat, it is possible to substantially correct first order optical errors, and notably the cross plane coupling at the exit of the Arcs. 4 refs., 3 figs

  19. Association of polymorphisms in 5-HTT (SLC6A4) and MAOA genes with measures of obesity in young adults of Portuguese origin.

    Science.gov (United States)

    Dias, Helena; Muc, Magdalena; Padez, Cristina; Manco, Licínio

    2016-01-01

    To investigate the association of polymorphisms in SLC6A4 and MAOA genes with overweight (including obesity). Young adults (n = 535) of Portuguese origin were genotyped for the SLC6A4 polymorphisms 5-HTTLPR and STin2 and a MAOA VNTR. BMI and body fat percentage were measured and a questionnaire was used to assess individual's sport practicing habits. In whole study sample, haplotype-based analysis revealed significant association with overweight/obesity for the individual 5-HTTLPR/Stin2 haplotype L10 (p = 0.04). In men, the MAOA 3R genotype was nominally associated with body fat (p = 0.04). In inactive individuals, overweight/obesity was found significantly associated with 5-HTTLPR L-allele (p = 0.01) and nominally associated with STin2 10-allele (p = 0.03). A significant association was also found testing for all haplotype effects (χ(2 )= 8.7; p = 0.03). We found some evidences for the association of SLC6A4 and MAOA genes with measures of obesity. Our results suggest physical inactivity accentuates the influence of SLC6A4 polymorphisms on obesity risk.

  20. The zinc transporter SLC39A13/ZIP13 is required for connective tissue development; its involvement in BMP/TGF-beta signaling pathways.

    Directory of Open Access Journals (Sweden)

    Toshiyuki Fukada

    Full Text Available BACKGROUND: Zinc (Zn is an essential trace element and it is abundant in connective tissues, however biological roles of Zn and its transporters in those tissues and cells remain unknown. METHODOLOGY/PRINCIPAL FINDINGS: Here we report that mice deficient in Zn transporter Slc39a13/Zip13 show changes in bone, teeth and connective tissue reminiscent of the clinical spectrum of human Ehlers-Danlos syndrome (EDS. The Slc39a13 knockout (Slc39a13-KO mice show defects in the maturation of osteoblasts, chondrocytes, odontoblasts, and fibroblasts. In the corresponding tissues and cells, impairment in bone morphogenic protein (BMP and TGF-beta signaling were observed. Homozygosity for a SLC39A13 loss of function mutation was detected in sibs affected by a unique variant of EDS that recapitulates the phenotype observed in Slc39a13-KO mice. CONCLUSIONS/SIGNIFICANCE: Hence, our results reveal a crucial role of SLC39A13/ZIP13 in connective tissue development at least in part due to its involvement in the BMP/TGF-beta signaling pathways. The Slc39a13-KO mouse represents a novel animal model linking zinc metabolism, BMP/TGF-beta signaling and connective tissue dysfunction.

  1. SLC3A1 and SLC7A9 mutations in autosomal recessive or dominant canine cystinuria: a new classification system.

    Science.gov (United States)

    Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U

    2013-01-01

    Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.

  2. Identification of two novel mutations in the SLC45A2 gene in a Hungarian pedigree affected by unusual OCA type 4.

    Science.gov (United States)

    Tóth, Lola; Fábos, Beáta; Farkas, Katalin; Sulák, Adrienn; Tripolszki, Kornélia; Széll, Márta; Nagy, Nikoletta

    2017-03-15

    Oculocutaneous albinism (OCA) is a clinically and genetically heterogenic group of pigmentation abnormalities. OCA type IV (OCA4, OMIM 606574) develops due to homozygous or compound heterozygous mutations in the solute carrier family 45, member 2 (SLC45A2) gene. This gene encodes a membrane-associated transport protein, which regulates tyrosinase activity and, thus, melanin content by changing melanosomal pH and disrupting the incorporation of copper into tyrosinase. Here we report two Hungarian siblings affected by an unusual OCA4 phenotype. After genomic DNA was isolated from peripheral blood of the patients, the coding regions of the SLC45A2 gene were sequenced. In silico tools were applied to identify the functional impact of the newly detected mutations. Direct sequencing of the SLC45A2 gene revealed two novel, heterozygous mutations, one missense (c.1226G > A, p.Gly409Asp) and one nonsense (c.1459C > T, p.Gln437*), which were present in both patients, suggesting the mutations were compound heterozygous. In silico tools suggest that these variations are disease causing mutations. The newly identified mutations may affect the transmembrane domains of the protein, and could impair transport function, resulting in decreases in both melanosomal pH and tyrosinase activity. Our study provides expands on the mutation spectrum of the SLC45A2 gene and the genetic background of OCA4.

  3. Dicty_cDB: SLC466 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid

  4. SLC and SLD: Experimental experience with a linear collider

    International Nuclear Information System (INIS)

    Breidenbach, M.

    1993-08-01

    The SLAC Linear Collider (SLC) is the prototype e + e - linear collider. This talk will consist of an introduction to SLC, a description of the strategy for luminosity, a description of the systems for the transport and measurement of the polarized electrons, and a description of the present performance of the SLC and planned upgrades. The detector, SLD, and the status of the polarization asymmetry measurement A LR will be described

  5. Characteristics of Mammalian Rh Glycoproteins (SLC42 transporters) and Their Role in Acid-Base Transport

    Science.gov (United States)

    Nakhoul, Nazih L.; Hamm, L. Lee

    2012-01-01

    The mammalian Rh glycoproteins belong to the solute transporter family SLC42 and include RhAG, present in red blood cells, and two non-erythroid members RhBG and RhCG that are expressed in various tissues, including kidney, liver, skin and the GI tract. The Rh proteins in the red blood cell form an “Rh complex” made up of one D-subunit, one CE-subunit and two RhAG subunits. The Rh complex has a well-known antigenic effect but also contributes to the stability of the red cell membrane. RhBG and RhCG are related to the NH4+ transporters of the yeast and bacteria but their exact function is yet to be determined. This review describes the expression and molecular properties of these membrane proteins and their potential role as NH3/NH4+ and CO2 transporters. The likelihood that these proteins transport gases such as CO2 or NH3 is novel and significant. The review also describes the physiological importance of these proteins and their relevance to human disease. PMID:23506896

  6. Effects of Sodium and Amino Acid Substrate Availability upon the Expression and Stability of the SNAT2 (SLC38A2 Amino Acid Transporter

    Directory of Open Access Journals (Sweden)

    Thorsten M. Hoffmann

    2018-02-01

    Full Text Available The SNAT2 (SLC38A2 System A amino acid transporter mediates Na+-coupled cellular uptake of small neutral α-amino acids (AAs and is extensively regulated in response to humoral and nutritional cues. Understanding the basis of such regulation is important given that AA uptake via SNAT2 has been linked to activation of mTORC1; a major controller of many important cellular processes including, for example, mRNA translation, lipid synthesis, and autophagy and whose dysregulation has been implicated in the development of cancer and conditions such as obesity and type 2 diabetes. Extracellular AA withdrawal induces an adaptive upregulation of SNAT2 gene transcription and SNAT2 protein stability but, as yet, the sensing mechanism(s that initiate this response remain poorly understood although interactions between SNAT2 and its substrates may play a vital role. Herein, we have explored how changes in substrate (AA and Na+ availability impact upon the adaptive regulation of SNAT2 in HeLa cells. We show that while AA deprivation induces SNAT2 gene expression, this induction was not apparent if extracellular Na+ was removed during the AA withdrawal period. Furthermore, we show that the increase in SNAT2 protein stability associated with AA withdrawal is selectively repressed by provision of SNAT2 AA substrates (N-methylaminoisobutyric acid and glutamine, but not non-substrates. This stabilization and substrate-induced repression were critically dependent upon the cytoplasmic N-terminal tail of SNAT2 (containing lysyl residues which are putative targets of the ubiquitin-proteasome system, because “grafting” this tail onto SNAT5, a related SLC38 family member that does not exhibit adaptive regulation, confers substrate-induced changes in stability of the SNAT2-5 chimeric transporter. In contrast, expression of SNAT2 in which the N-terminal lysyl residues were mutated to alanine rendered the transporter stable and insensitive to substrate-induced changes

  7. The role of SLC2A1 mutations in myoclonic astatic epilepsy and absence epilepsy, and the estimated frequency of GLUT1 deficiency syndrome

    DEFF Research Database (Denmark)

    Larsen, Jan; Johannesen, Katrine Marie; Ek, Jakob

    2015-01-01

    The first mutations identified in SLC2A1, encoding the glucose transporter type 1 (GLUT1) protein of the blood-brain barrier, were associated with severe epileptic encephalopathy. Recently, dominant SLC2A1 mutations were found in rare autosomal dominant families with various forms of epilepsy inc...

  8. Partial deletion of the sulfate transporter SLC13A1 is associated with an osteochondrodysplasia in the Miniature Poodle breed.

    Directory of Open Access Journals (Sweden)

    Mark W Neff

    Full Text Available A crippling dwarfism was first described in the Miniature Poodle in Great Britain in 1956. Here, we resolve the genetic basis of this recessively inherited disorder. A case-control analysis (8:8 of genotype data from 173 k SNPs revealed a single associated locus on CFA14 (P(raw <10(-8. All affected dogs were homozygous for an ancestral haplotype consistent with a founder effect and an identical-by-descent mutation. Systematic failure of nine, nearly contiguous SNPs, was observed solely in affected dogs, suggesting a deletion was the causal mutation. A 130-kb deletion was confirmed both by fluorescence in situ hybridization (FISH analysis and by cloning the physical breakpoints. The mutation was perfectly associated in all cases and obligate heterozygotes. The deletion ablated all but the first exon of SLC13A1, a sodium/sulfate symporter responsible for regulating serum levels of inorganic sulfate. Our results corroborate earlier findings from an Slc13a1 mouse knockout, which resulted in hyposulfatemia and syndromic defects. Interestingly, the metabolic disorder in Miniature Poodles appears to share more clinical signs with a spectrum of human disorders caused by SLC26A2 than with the mouse Slc13a1 model. SLC26A2 is the primary sodium-independent sulfate transporter in cartilage and bone and is important for the sulfation of proteoglycans such as aggregan. We propose that disruption of SLC13A1 in the dog similarly causes undersulfation of proteoglycans in the extracellular matrix (ECM, which impacts the conversion of cartilage to bone. A co-dominant DNA test of the deletion was developed to enable breeders to avoid producing affected dogs and to selectively eliminate the mutation from the gene pool.

  9. Loss of function of Slc20a2 associated with familial idiopathic Basal Ganglia calcification in humans causes brain calcifications in mice

    DEFF Research Database (Denmark)

    Jensen, N.; Schroder, H. D.; Hejbol, E. K.

    2013-01-01

    Familial idiopathic basal ganglia calcification (FIBGC) is a neurodegenerative disorder with neuropsychiatric and motor symptoms. Deleterious mutations in SLC20A2, encoding the type III sodium-dependent phosphate transporter 2 (PiT2), were recently linked to FIBGC in almost 50% of the families...... reported worldwide. Here, we show that knockout of Slc20a2 in mice causes calcifications in the thalamus, basal ganglia, and cortex, demonstrating that reduced PiT2 expression alone can cause brain calcifications....

  10. Genetic polymorphisms and haplotypes of the organic cation transporter 1 gene (SLC22A1 in the Xhosa population of South Africa

    Directory of Open Access Journals (Sweden)

    Clifford Jacobs

    2014-06-01

    Full Text Available Human organic cation transporter 1 is primarily expressed in hepatocytes and mediates the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for human organic cation transporter 1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response to clinical drugs, which are substrates for this transporter. The genotypic and allelic distributions of 19 nonsynonymous and one intronic SLC22A1 single nucleotide polymorphisms were determined in 148 healthy Xhosa participants from South Africa, using a SNAPshot® multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F (rs34447885, P341L (rs2282143, V519F (rs78899680, and the intronic variant rs622342 were 1.7%, 8.4%, 3.0%, and 21.6%, respectively. None of the participants carried the variant allele for R61C (rs12208357, C88R (rs55918055, S189L (rs34104736, G220V (rs36103319, P283L (rs4646277, R287G (rs4646278, G401S (rs34130495, M440I (rs35956182, or G465R (rs34059508. In addition, no variant alleles were observed for A306T (COSM164365, A413V (rs144322387, M420V (rs142448543, I421F (rs139512541, C436F (rs139512541, V501E (rs143175763, or I542V (rs137928512 in the population. Eight haplotypes were inferred from the genotypic data. This study reports important genetic data that could be useful for future pharmacogenetic studies of drug transporters in the indigenous Sub-Saharan African populations.

  11. A performance evaluation of the IBM 370/XT personal computer

    Science.gov (United States)

    Dominick, Wayne D. (Editor); Triantafyllopoulos, Spiros

    1984-01-01

    An evaluation of the IBM 370/XT personal computer is given. This evaluation focuses primarily on the use of the 370/XT for scientific and technical applications and applications development. A measurement of the capabilities of the 370/XT was performed by means of test programs which are presented. Also included is a review of facilities provided by the operating system (VM/PC), along with comments on the IBM 370/XT hardware configuration.

  12. Prenatal exposure to maternal depressed mood and the MTHFR C677T variant affect SLC6A4 methylation in infants at birth.

    Directory of Open Access Journals (Sweden)

    Angela M Devlin

    2010-08-01

    Full Text Available Prenatal and early postnatal exposure to maternal depression may "program" childhood behavior via epigenetic processes such as DNA methylation. Methylenetetrahydro-folate reductase (MTHFR is an important enzyme in the generation of methyl groups for DNA methylation. The common MTHFR C677T variant is associated with depression in men and non-pregnant women, and with global changes in DNA methylation. This study investigated the effect of maternal MTHFR C677T genotype on antenatal maternal mood, and their impact on the gene-specific methylation in pregnant women and their newborn infants. The methylation status of SLC6A4, which encodes the transmembrane serotonin transporter, and BDNF, which encodes brain derived neurotrophic factor, were assessed because of their potential role in behaviour.Depressed mood was assessed by the Edinburgh Postnatal Depression Scale (EPDS and the Hamilton Rating Scale for Depression (HAM-D in women (n = 82, all taking folate during the 2(nd and 3(rd trimesters of pregnancy. The methylation status of SLC6A4 and BDNF were assessed in 3rd trimester maternal peripheral leukocytes and in umbilical cord leukocytes collected from their infants at birth. Women with the MTHFR 677TT genotype had greater 2(nd trimester depressed mood (p<0.05. Increased 2(nd trimester maternal depressed mood (EPDS scores was associated with decreased maternal and infant SLC6A4 promoter methylation (p<0.05, but had no effect on BDNF promoter methylation.These findings show that the MTHFR C677T variant is associated with greater depressed mood during pregnancy. We further showed that prenatal exposure to maternal depressed mood affects gene-specific DNA methylation patterns. These findings support the concept that alterations in epigenetic processes may contribute to developmental programming of behaviour by maternal depression.

  13. Alternative transcription of sodium/bicarbonate transporter SLC4A7 gene enhanced by single nucleotide polymorphisms.

    Science.gov (United States)

    Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong

    2017-03-01

    Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.

  14. Cystinuria Associated with Different SLC7A9 Gene Variants in the Cat.

    Directory of Open Access Journals (Sweden)

    Keijiro Mizukami

    Full Text Available Cystinuria is a classical inborn error of metabolism characterized by a selective proximal renal tubular defect affecting cystine, ornithine, lysine, and arginine (COLA reabsorption, which can lead to uroliths and urinary obstruction. In humans, dogs and mice, cystinuria is caused by variants in one of two genes, SLC3A1 and SLC7A9, which encode the rBAT and bo,+AT subunits of the bo,+ basic amino acid transporter system, respectively. In this study, exons and flanking regions of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA of cats (Felis catus with COLAuria and cystine calculi. Relative to the Felis catus-6.2 reference genome sequence, DNA sequences from these affected cats revealed 3 unique homozygous SLC7A9 missense variants: one in exon 5 (p.Asp236Asn from a non-purpose-bred medium-haired cat, one in exon 7 (p.Val294Glu in a Maine Coon and a Sphinx cat, and one in exon 10 (p.Thr392Met from a non-purpose-bred long-haired cat. A genotyping assay subsequently identified another cystinuric domestic medium-haired cat that was homozygous for the variant originally identified in the purebred cats. These missense variants result in deleterious amino acid substitutions of highly conserved residues in the bo,+AT protein. A limited population survey supported that the variants found were likely causative. The remaining 2 sequenced domestic short-haired cats had a heterozygous variant at a splice donor site in intron 10 and a homozygous single nucleotide variant at a branchpoint in intron 11 of SLC7A9, respectively. This study identifies the first SLC7A9 variants causing feline cystinuria and reveals that, as in humans and dogs, this disease is genetically heterogeneous in cats.

  15. Multicenter cohort association study of SLC2A1 single nucleotide polymorphisms and age-related macular degeneration

    Science.gov (United States)

    Baas, Dominique C.; Ho, Lintje; Tanck, Michael W.T.; Fritsche, Lars G.; Merriam, Joanna E.; van het Slot, Ruben; Koeleman, Bobby P.C.; Gorgels, Theo G.M.F.; van Duijn, Cornelia M.; Uitterlinden, André G.; de Jong, Paulus T.V.M.; Hofman, Albert; ten Brink, Jacoline B.; Vingerling, Johannes R.; Klaver, Caroline C.W.; Dean, Michael; Weber, Bernhard H. F.; Allikmets, Rando; Hageman, Gregory S.

    2012-01-01

    Purpose Age-related macular degeneration (AMD) is a major cause of blindness in older adults and has a genetically complex background. This study examines the potential association between single nucleotide polymorphisms (SNPs) in the glucose transporter 1 (SLC2A1) gene and AMD. SLC2A1 regulates the bioavailability of glucose in the retinal pigment epithelium (RPE), which might influence oxidative stress–mediated AMD pathology. Methods Twenty-two SNPs spanning the SLC2A1 gene were genotyped in 375 cases and 199 controls from an initial discovery cohort (the Amsterdam-Rotterdam-Netherlands study). Replication testing was performed in The Rotterdam Study (the Netherlands) and study populations from Würzburg (Germany), the Age Related Eye Disease Study (AREDS; United States), Columbia University (United States), and Iowa University (United States). Subsequently, a meta-analysis of SNP association was performed. Results In the discovery cohort, significant genotypic association between three SNPs (rs3754219, rs4660687, and rs841853) and AMD was found. Replication in five large independent (Caucasian) cohorts (4,860 cases and 4,004 controls) did not yield consistent association results. The genotype frequencies for these SNPs were significantly different for the controls and/or cases among the six individual populations. Meta-analysis revealed significant heterogeneity of effect between the studies. Conclusions No overall association between SLC2A1 SNPs and AMD was demonstrated. Since the genotype frequencies for the three SLC2A1 SNPs were significantly different for the controls and/or cases between the six cohorts, this study corroborates previous evidence that population dependent genetic risk heterogeneity in AMD exists. PMID:22509097

  16. Dicty_cDB: SLC436 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4

  17. Transport via SLC5A8 with Subsequent Inhibition of Histone Deacetylases HDAC1 and HDAC3 Underlies the Antitumor Activity of 3-Bromopyruvate

    Science.gov (United States)

    Thangaraju, Muthusamy; Karunakaran, Senthil K.; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D.; Ganapathy, Vadivel

    2009-01-01

    Background 3-Bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of ATP production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The present studies have uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. Methods Transport of 3-bromopyruvate via SLC5A8, a tumor suppressor and a Na+-coupled electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by FACS analysis and colony formation assay. Acetylation status of histone H4 was evaluated by Western blot. Results 3-Bromopyruvate is a transportable substrate for SLC5A8, with the transport process being Na+-coupled and electrogenic. MCF7 cells do not express SLC5A8 and are not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells undergo apoptosis in the presence of 3-bromopyruvate. This cell death is associated with inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identify HDAC1 and HDAC3 as the targets for 3-bromopyruvate. Conclusions 3-Bromopyruvate is transported into cells actively via the tumor suppressor SLC5A8 and the process is energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells leads to apoptosis, and the mechanism involves inhibition of HDAC1/HDAC3. PMID:19637353

  18. Transport by SLC5A8 with subsequent inhibition of histone deacetylase 1 (HDAC1) and HDAC3 underlies the antitumor activity of 3-bromopyruvate.

    Science.gov (United States)

    Thangaraju, Muthusamy; Karunakaran, Senthil K; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D; Ganapathy, Vadivel

    2009-10-15

    3-bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of adenosine triphosphate production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The current studies uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. The transport of 3-bromopyruvate by sodium-coupled monocarboxylate transporter SMCT1 (SLC5A8), a tumor suppressor and a sodium (Na+)-coupled, electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by fluorescence-activated cell-sorting analysis and colony-formation assay. The acetylation status of histone H4 was evaluated by Western blot analysis. 3-Bromopyruvate is a transportable substrate for SLC5A8, and that transport process is Na+-coupled and electrogenic. MCF7 cells did not express SLC5A8 and were not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells underwent apoptosis in the presence of 3-bromopyruvate. This cell death was associated with the inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identified HDAC1 and HDAC3 as the targets for 3-bromopyruvate. 3-Bromopyruvate was transported into cells actively through the tumor suppressor SLC5A8, and the process was energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells led to apoptosis, and the mechanism involved the inhibition of HDAC1/HDAC3. Copyright (c) 2009 American Cancer Society.

  19. No Association of BDNF, COMT, MAOA, SLC6A3, and SLC6A4 Genes and Depressive Symptoms in a Sample of Healthy Colombian Subjects.

    Science.gov (United States)

    González-Giraldo, Yeimy; Camargo, Andrés; López-León, Sandra; Forero, Diego A

    2015-01-01

    Background. Major depressive disorder (MDD) is the second cause of years lived with disability around the world. A large number of studies have been carried out to identify genetic risk factors for MDD and related endophenotypes, mainly in populations of European and Asian descent, with conflicting results. The main aim of the current study was to analyze the possible association of five candidate genes and depressive symptoms in a Colombian sample of healthy subjects. Methods and Materials. The Spanish adaptation of the Hospital Anxiety and Depression Scale (HADS) was applied to one hundred eighty-eight healthy Colombian subjects. Five functional polymorphisms were genotyped using PCR-based assays: BDNF-Val66Met (rs6265), COMT-Val158Met (rs4680), SLC6A4-HTTLPR (rs4795541), MAOA-uVNTR, and SLC6A3-VNTR (rs28363170). Result. We did not find significant associations with scores of depressive symptoms, derived from the HADS, for any of the five candidate genes (nominal p values >0.05). In addition, we did not find evidence of significant gene-gene interactions. Conclusion. This work is one of the first studies of candidate genes for depressive symptoms in a Latin American sample. Study of additional genetic and epigenetic variants, taking into account other pathophysiological theories, will help to identify novel candidates for MDD in populations around the world.

  20. Missense mutation in exon 2 of SLC36A1 responsible for champagne dilution in horses.

    Directory of Open Access Journals (Sweden)

    Deborah Cook

    2008-09-01

    Full Text Available Champagne coat color in horses is controlled by a single, autosomal-dominant gene (CH. The phenotype produced by this gene is valued by many horse breeders, but can be difficult to distinguish from the effect produced by the Cream coat color dilution gene (CR. Three sires and their families segregating for CH were tested by genome scanning with microsatellite markers. The CH gene was mapped within a 6 cM region on horse chromosome 14 (LOD = 11.74 for theta = 0.00. Four candidate genes were identified within the region, namely SPARC [Secreted protein, acidic, cysteine-rich (osteonectin], SLC36A1 (Solute Carrier 36 family A1, SLC36A2 (Solute Carrier 36 family A2, and SLC36A3 (Solute Carrier 36 family A3. SLC36A3 was not expressed in skin tissue and therefore not considered further. The other three genes were sequenced in homozygotes for CH and homozygotes for the absence of the dilution allele (ch. SLC36A1 had a nucleotide substitution in exon 2 for horses with the champagne phenotype, which resulted in a transition from a threonine amino acid to an arginine amino acid (T63R. The association of the single nucleotide polymorphism (SNP with the champagne dilution phenotype was complete, as determined by the presence of the nucleotide variant among all 85 horses with the champagne dilution phenotype and its absence among all 97 horses without the champagne phenotype. This is the first description of a phenotype associated with the SLC36A1 gene.

  1. Slc5a8, a Na+-coupled high-affinity transporter for short-chain fatty acids, is a conditional tumour suppressor in colon that protects against colitis and colon cancer under low-fibre dietary conditions.

    Science.gov (United States)

    Gurav, Ashish; Sivaprakasam, Sathish; Bhutia, Yangzom D; Boettger, Thomas; Singh, Nagendra; Ganapathy, Vadivel

    2015-07-15

    Mammalian colon harbours trillions of bacteria under physiological conditions; this symbiosis is made possible because of a tolerized response from the mucosal immune system. The mechanisms underlying this tolerogenic phenomenon remain poorly understood. In the present study we show that Slc5a8 (solute carrier gene family 5a, member 8), a Na(+)-coupled high-affinity transporter in colon for the bacterial fermentation product butyrate, plays a critical role in this process. Among various immune cells in colon, dendritic cells (DCs) are unique not only in their accessibility to luminal contents but also in their ability to induce tolerogenic phenotype in T-cells. We found that DCs exposed to butyrate express the immunosuppressive enzymes indoleamine 2,3-dioxygenase 1 (IDO1) and aldehyde dehydrogenase 1A2 (Aldh1A2), promote conversion of naive T-cells into immunosuppressive forkhead box P3(+) (FoxP3(+)) Tregs (regulatory T-cells) and suppress conversion of naive T-cells into pro-inflammatory interferon (IFN)-γ-producing cells. Slc5a8-null DCs do not induce IDO1 and Aldh1A2 and do not generate Tregs or suppress IFN-γ-producing T-cells in response to butyrate. We also provide in vivo evidence for an obligatory role for Slc5a8 in suppression of IFN-γ-producing T-cells. Furthermore, Slc5a8 protects against colitis and colon cancer under conditions of low-fibre intake but not when dietary fibre intake is optimal. This agrees with the high-affinity nature of the transporter to mediate butyrate entry into cells. We conclude that Slc5a8 is an obligatory link between dietary fibre and mucosal immune system via the bacterial metabolite butyrate and that this transporter is a conditional tumour suppressor in colon linked to dietary fibre content. © 2015 Authors; published by Portland Press Limited.

  2. Molecular Determinants for Substrate Interactions with the Glycine Transporter GlyT2.

    Science.gov (United States)

    Carland, Jane E; Thomas, Michael; Mostyn, Shannon N; Subramanian, Nandhitha; O'Mara, Megan L; Ryan, Renae M; Vandenberg, Robert J

    2018-03-21

    Transporters in the SLC6 family play key roles in regulating neurotransmission and are the targets for a wide range of therapeutics. Important insights into the transport mechanisms and the specificity of drug interactions of SLC6 transporters have been obtained from the crystal structures of a bacterial homologue of the family, LeuT Aa , and more recently the Drosophila dopamine transporter and the human serotonin transporter. However, there is disputed evidence that the bacterial leucine transporter, LeuT Aa , contains two substrate binding sites that work cooperatively in the mechanism of transport, with the binding of a second substrate being required for the release of the substrate from the primary site. An alternate proposal is that there may be low affinity binding sites that serve to direct the flow of substrates to the primary site. We have used a combination of molecular dynamics simulations of substrate interactions with a homology model of GlyT2, together with radiolabeled amino acid uptake assays and electrophysiological analysis of wild-type and mutant transporters, to provide evidence that substrate selectivity of GlyT2 is determined entirely by the primary substrate binding site and, furthermore, if a secondary site exists then it is a low affinity nonselective amino acid binding site.

  3. neXtA5: accelerating annotation of articles via automated approaches in neXtProt.

    Science.gov (United States)

    Mottin, Luc; Gobeill, Julien; Pasche, Emilie; Michel, Pierre-André; Cusin, Isabelle; Gaudet, Pascale; Ruch, Patrick

    2016-01-01

    The rapid increase in the number of published articles poses a challenge for curated databases to remain up-to-date. To help the scientific community and database curators deal with this issue, we have developed an application, neXtA5, which prioritizes the literature for specific curation requirements. Our system, neXtA5, is a curation service composed of three main elements. The first component is a named-entity recognition module, which annotates MEDLINE over some predefined axes. This report focuses on three axes: Diseases, the Molecular Function and Biological Process sub-ontologies of the Gene Ontology (GO). The automatic annotations are then stored in a local database, BioMed, for each annotation axis. Additional entities such as species and chemical compounds are also identified. The second component is an existing search engine, which retrieves the most relevant MEDLINE records for any given query. The third component uses the content of BioMed to generate an axis-specific ranking, which takes into account the density of named-entities as stored in the Biomed database. The two ranked lists are ultimately merged using a linear combination, which has been specifically tuned to support the annotation of each axis. The fine-tuning of the coefficients is formally reported for each axis-driven search. Compared with PubMed, which is the system used by most curators, the improvement is the following: +231% for Diseases, +236% for Molecular Functions and +3153% for Biological Process when measuring the precision of the top-returned PMID (P0 or mean reciprocal rank). The current search methods significantly improve the search effectiveness of curators for three important curation axes. Further experiments are being performed to extend the curation types, in particular protein-protein interactions, which require specific relationship extraction capabilities. In parallel, user-friendly interfaces powered with a set of JSON web services are currently being

  4. Evidencia de asociación entre el gen SLC6A4 y efectos epistáticos con variantes en HTR2A en la etiología del autismo en la población antioqueña

    Directory of Open Access Journals (Sweden)

    Ana Victoria Valencia

    2012-12-01

    Full Text Available Introducción. El espectro autista constituye un grupo de trastornos graves del neurodesarrollo, conun fuerte componente genético. Se ha sugerido un papel importante del sistema serotoninérgico en el desarrollo de este grupo de trastornos, con base en los estudios de respuesta a medicamentos y la hiperserotoninemia, característica común en el autismo. Se han implicado múltiples moléculas en el metabolismo y la neurotransmisión de la serotonina; sin embargo, los resultados de los estudios hantenido poca congruencia entre diferentes poblaciones. Objetivos. Evaluar la relación entre el autismo y el polimorfismo de nucleótido simple (SingleNucleotide Polymorphism, SNP en los genes SLC6A4, HTR2A e ITGB3, en una muestra de la población antioqueña. Materiales y métodos. Se genotipificaron 42 núcleos familiares con autismo para 10 variantes enlos genes SLC6A4, ITGB3 y HTR2A. Se evaluó la asociación utilizando la prueba de desequilibrio enla transmisión. Se exploró el impacto de la interacción entre estos genes y el autismo, utilizando la reducción multidimensional. Resultados. Se encontró asociación de las variantes rs4583306 (OR=2,6, p=0,004 y rs2066713(OR=2,2 p=0,03, en el gen SLC6A4, y asociación de combinaciones genotípicas entre los genes SLC6A4 y HTR2A y el riesgo de autismo (p=0,0001. Conclusiones. Se encontró asociación significativa con variantes en el gen transportador de serotoninacon el autismo, al igual que interacción entre variantes en los genes HTR2A con SLC6A4. Estos resultados concuerdan con los de estudios previos en otras poblaciones y son pruebas a favor delpapel del sistema serotoninérgico en la etiología del espectro autista.   doi: http://dx.doi.org/10.7705/biomedica.v32i4.593

  5. Brain calcification process and phenotypes according to age and sex: Lessons from SLC20A2, PDGFB, and PDGFRB mutation carriers.

    Science.gov (United States)

    Nicolas, Gaël; Charbonnier, Camille; de Lemos, Roberta Rodrigues; Richard, Anne-Claire; Guillin, Olivier; Wallon, David; Legati, Andrea; Geschwind, Daniel; Coppola, Giovanni; Frebourg, Thierry; Campion, Dominique; de Oliveira, João Ricardo Mendes; Hannequin, Didier

    2015-10-01

    Primary Familial Brain Calcification (PFBC) is a dominantly inherited cerebral microvascular calcifying disorder with diverse neuropsychiatric expression. Three causative genes have been identified: SLC20A2, PDGFRB and, recently, PDGFB, whose associated phenotype has not yet been extensively studied. We included in the largest published case series of genetically confirmed PFBC, 19 PDGFB (including three new mutations), 24 SLC20A2 (including 4 new mutations), and 14 PDGFRB mutation carriers, from two countries (France and Brazil). We studied clinical features and applied our visual rating scale on all 49 available CT scans. Among the symptomatic mutation carriers (33/57, 58%), the three most frequently observed categories of clinical features were psychiatric signs (72.7%, 76.5%, and 80% for PDGFB, SLC20A2, and PDGFRB, respectively), movement disorders (45.5%, 76.5%, and 40%), and cognitive impairment (54.6%, 64.7%, and 40%). The median age of clinical onset was 31 years, 25% had an early onset (before 18) and 25% a later onset (after 53). Patients with an early clinical onset exhibited mostly isolated psychiatric or cognitive signs, while patients with a later onset exhibited mostly movement disorders, especially in association with other clinical features. CT scans rating allowed identifying four patterns of calcification. The total calcification score was best predicted by the combined effects of gene (SLC20A2 > PDGFB > PDGFRB mutations), sex (male), and (increasing) age, defining three risk classes, which correlated with the four patterns of calcification. These calcification patterns could reflect the natural history of the calcifying process, with distinct risk classes characterized by different age at onset or rate of progression. © 2015 Wiley Periodicals, Inc.

  6. Pharmacotherapy in pregnancy; effect of ABC and SLC transporters on drug transport across the placenta and fetal drug exposure.

    Science.gov (United States)

    Staud, Frantisek; Cerveny, Lukas; Ceckova, Martina

    2012-11-01

    Pharmacotherapy during pregnancy is often inevitable for medical treatment of the mother, the fetus or both. The knowledge of drug transport across placenta is, therefore, an important topic to bear in mind when deciding treatment in pregnant women. Several drug transporters of the ABC and SLC families have been discovered in the placenta, such as P-glycoprotein, breast cancer resistance protein, or organic anion/cation transporters. It is thus evident that the passage of drugs across the placenta can no longer be predicted simply on the basis of their physical-chemical properties. Functional expression of placental drug transporters in the trophoblast and the possibility of drug-drug interactions must be considered to optimize pharmacotherapy during pregnancy. In this review we summarize current knowledge on the expression and function of ABC and SLC transporters in the trophoblast. Furthermore, we put this data into context with medical conditions that require maternal and/or fetal treatment during pregnancy, such as gestational diabetes, HIV infection, fetal arrhythmias and epilepsy. Proper understanding of the role of placental transporters should be of great interest not only to clinicians but also to pharmaceutical industry for future drug design and development to control the degree of fetal exposure.

  7. Status of the SLC

    International Nuclear Information System (INIS)

    Moffeit, K.C.

    1987-01-01

    The status and research possibilities of the Stanford Linear Collider (SLC) are reviewed. The physics program concentrates on production of Z 0 's and their decay. The SLC systems include a new injector and booster, two damping rings to provide the small beam emittance, a new positron source, the existing LINAC structure upgraded for higher energy and better beam control, beam transport arcs, a final focus section, and experimental halls are detectors. Energy spectrometers with an accuracy of ± 50 MeV/c 2 for pulse-to-pulse center of mass energy measurement are to be installed. Longitudinal polarized electrons are expected, and will allow more precise tests of the standard model

  8. Disruption of Slc52a3 gene causes neonatal lethality with riboflavin deficiency in mice

    OpenAIRE

    Yoshimatsu, Hiroki; Yonezawa, Atsushi; Yamanishi, Kaori; Yao, Yoshiaki; Sugano, Kumiko; Nakagawa, Shunsaku; Imai, Satoshi; Omura, Tomohiro; Nakagawa, Takayuki; Yano, Ikuko; Masuda, Satohiro; Inui, Ken-ichi; Matsubara, Kazuo

    2016-01-01

    Homeostasis of riboflavin should be maintained by transporters. Previous in vitro studies have elucidated basic information about riboflavin transporter RFVT3 encoded by SLC52A3 gene. However, the contribution of RFVT3 to the maintenance of riboflavin homeostasis and the significance in vivo remain unclear. Here, we investigated the physiological role of RFVT3 using Slc52a3 knockout (Slc52a3−/−) mice. Most Slc52a3−/− mice died with hyperlipidemia and hypoglycemia within 48 hr after birth. The...

  9. Sodium bicarbonate cotransporter NBCe2 gene variants increase sodium and bicarbonate transport in human renal proximal tubule cells.

    Science.gov (United States)

    Gildea, John J; Xu, Peng; Kemp, Brandon A; Carlson, Julia M; Tran, Hanh T; Bigler Wang, Dora; Langouët-Astrié, Christophe J; McGrath, Helen E; Carey, Robert M; Jose, Pedro A; Felder, Robin A

    2018-01-01

    Salt sensitivity of blood pressure affects >30% of the hypertensive and >15% of the normotensive population. Variants of the electrogenic sodium bicarbonate cotransporter NBCe2 gene, SLC4A5, are associated with increased blood pressure in several ethnic groups. SLC4A5 variants are also highly associated with salt sensitivity, independent of hypertension. However, little is known about how NBCe2 contributes to salt sensitivity, although NBCe2 regulates renal tubular sodium bicarbonate transport. We hypothesized that SLC4A5 rs10177833 and rs7571842 increase NBCe2 expression and human renal proximal tubule cell (hRPTC) sodium transport and may be a cause of salt sensitivity of blood pressure. To characterize the hRPTC ion transport of wild-type (WT) and homozygous variants (HV) of SLC4A5. The expressions of NBCe2 mRNA and protein were not different between hRPTCs carrying WT or HV SLC4A5 before or after dopaminergic or angiotensin (II and III) stimulation. However, luminal to basolateral sodium transport, NHE3 protein, and Cl-/HCO3- exchanger activity in hRPTCs were higher in HV than WT SLC4A5. Increasing intracellular sodium enhanced the apical location of NBCe2 in HV hRPTCs (4.24±0.35% to 11.06±1.72% (P<0.05, N = 3, 2-way ANOVA, Holm-Sidak test)) as determined by Total Internal Reflection Fluorescence Microscopy (TIRFM). In hRPTCs isolated from kidney tissue, increasing intracellular sodium enhanced bicarbonate-dependent pH recovery rate and increased NBCe2 mRNA and protein expressions to a greater extent in HV than WT SLC4A5 (+38.00±6.23% vs HV normal salt (P<0.01, N = 4, 2-way ANOVA, Holm-Sidak test)). In hRPTCs isolated from freshly voided urine, bicarbonate-dependent pH recovery was also faster in those from salt-sensitive and carriers of HV SLC4A5 than from salt-resistant and carriers of WT SLC4A5. The faster NBCe2-specific bicarbonate-dependent pH recovery rate in HV SCL4A5 was normalized by SLC4A5- but not SLC4A4-shRNA. The binding of purified hepatocyte

  10. Association analysis between a VNTR intron 8 polymorphism of the dopamine transporter gene (SLC6A3 and obsessive- compulsive disorder in a Brazilian sample Análise de associação entre um polimorfismo VNTR no intron 8 do gene do transportador de dopamina (SLC6A3 e transtorno obsessivo-compulsivo em uma amostra brasileira

    Directory of Open Access Journals (Sweden)

    Karen Miguita

    2007-12-01

    Full Text Available Family, twin and segregation analysis have provided evidences that genetic factors are implicated in the susceptibility for obsessive-compulsive disorder (OCD. Several lines of research suggest that the dopaminergic system may be involved in the pathophysiology of OCD. Thus, the aim of the present study was to investigate a possible association between a polymorphism located in intron 8 of the dopamine transporter gene (SLC6A3 and OCD in a Brazilian sample composed by 208 patients and 865 healthy controls. No statistically differences were observed in allelic and genotype distributions between cases and controls. No association was also observed when the sample was divided according to specific phenotypic features such as gender, presence of tic disorders co-morbidity and age at onset of obsessive-compulsive symptoms (OCS. Our results suggest that the intron 8 VNTR of the SLC6A3 investigated in this study is not related to the susceptibility for OCD in our Brazilian sample.Estudos de família, gêmeos e de segregação têm demonstrado que fatores genéticos estão envolvidos na susceptibilidade para o desenvolvimento do transtorno obsessivo-compulsivo (TOC. Várias linhas de pesquisa sugerem que o sistema dopaminérgico possa estar envolvido na fisiopatologia do TOC. Assim, o objetivo do presente estudo foi investigar uma possível associação entre o polimorfismo localizado no intron 8 do gene do transportador da dopamina (SLC6A3 e o TOC em uma amostra brasileira composta por 208 pacientes e 865 controles sadios. Nenhuma diferença estatisticamente significante foi observada nas distribuições alélicas e genotípicas entre os grupos de pacientes e controles. Nenhuma associação também foi observada quando as amostras foram divididas de acordo com características fenotípicas específicas, tais como gênero, presença de co-morbidade com tiques e idade de início dos sintomas obsessivo-compulsivo (SOC. Nossos resultados sugerem que o VNTR

  11. Inorganic phosphorus (Pi) in CSF is a biomarker for SLC20A2-associated idiopathic basal ganglia calcification (IBGC1).

    Science.gov (United States)

    Hozumi, Isao; Kurita, Hisaka; Ozawa, Kazuhiro; Furuta, Nobuyuki; Inden, Masatoshi; Sekine, Shin-Ichiro; Yamada, Megumi; Hayashi, Yuichi; Kimura, Akio; Inuzuka, Takashi; Seishima, Mitsuru

    2018-05-15

    Idiopathic basal ganglia calcification (IBGC), also called Fahr's disease or recently primary familial brain calcification (PFBC), is characterized by abnormal deposits of minerals including calcium mainly and phosphate in the brain. Mutations in SLC20A2 (IBGC1 (merged with former IBGC2 and IBGC3)), which encodes PiT-2, a phosphate transporter, is the major cause of IBGC. Recently, Slc20a2-KO mice have been showed to have elevated levels of inorganic phosphorus (Pi) in cerebrospinal fluid (CSF); however, CSF Pi levels in patients with IBGC have not been fully examined. We investigated the cases of 29 patients with IBGC including six patients with SLC20A2 mutation and three patients with PDGFB mutation, and 13 controls. The levels of sodium (Na), potassium (K), chloride (Cl), calcium (Ca), and Pi in sera and CSF were determined by potentiometry and colorimetry. Moreover, clinical manifestations were investigated in the IBGC patients with high Pi levels in CSF. The study revealed that the average level of Pi in the CSF of the total group of patients with IBGC is significantly higher than that of the control group, and the levels of Pi in CSF of the IBGC patients with SLC20A2 mutations are significantly higher than those of the IBGC patients with PDGFB mutations, the other IBGC patients and controls. Results of this study suggest that the levels of CSF Pi will be a good biomarker for IBGC1. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Treatment of Creatine Transporter (SLC6A8) Deficiency With Oral S-Adenosyl Methionine as Adjunct to L-arginine, Glycine, and Creatine Supplements.

    Science.gov (United States)

    Jaggumantri, Sravan; Dunbar, Mary; Edgar, Vanessa; Mignone, Cristina; Newlove, Theresa; Elango, Rajavel; Collet, Jean Paul; Sargent, Michael; Stockler-Ipsiroglu, Sylvia; van Karnebeek, Clara D M

    2015-10-01

    Creatine transporter (SLC6A8) deficiency is an X-linked inborn error of metabolism characterized by cerebral creatine deficiency, behavioral problems, seizures, hypotonia, and intellectual developmental disability. A third of patients are amenable to treatment with high-dose oral creatine, glycine, and L-arginine supplementation. Given the limited treatment response, we initiated an open-label observational study to evaluate the effect of adjunct S-adenosyl methionine to further enhance intracerebral creatine synthesis. Significant and reproducible issues with sleep and behavior were noted in both male patients on a dose of 50/mg/kg. One of the two patients stopped S-adenosyl methionine and did not come for any follow-up. A safe and tolerable dose (17 mg/kg/day) was identified in the other patient. On magnetic resonance spectroscopy, this 8-year-old male did not show an increase in intracerebral creatine. However, significant improvement in speech/language skills, muscle mass were observed as well as in personal outcomes as defined by the family in activities related to communication and decision making. Further research is needed to assess the potential of S-adenosyl methionine as an adjunctive therapy for creatine transporter deficiency patients and to define the optimal dose. Our study also illustrates the importance of pathophysiology-based treatment, individualized outcome assessment, and patient/family participation in rare diseases research. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Nuclear data sensitivity/uncertainty analysis for XT-ADS

    International Nuclear Information System (INIS)

    Sugawara, Takanori; Sarotto, Massimo; Stankovskiy, Alexey; Van den Eynde, Gert

    2011-01-01

    Highlights: → The sensitivity and uncertainty analyses were performed to comprehend the reliability of the XT-ADS neutronic design. → The uncertainties deduced from the covariance data for the XT-ADS criticality were 0.94%, 1.9% and 1.1% by the SCALE 44-group, TENDL-2009 and JENDL-3.3 data, respectively. → When the target accuracy of 0.3%Δk for the criticality was considered, the uncertainties did not satisfy it. → To achieve this accuracy, the uncertainties should be improved by experiments under an adequate condition. - Abstract: The XT-ADS, an accelerator-driven system for an experimental demonstration, has been investigated in the framework of IP EUROTRANS FP6 project. In this study, the sensitivity and uncertainty analyses were performed to comprehend the reliability of the XT-ADS neutronic design. For the sensitivity analysis, it was found that the sensitivity coefficients were significantly different by changing the geometry models and calculation codes. For the uncertainty analysis, it was confirmed that the uncertainties deduced from the covariance data varied significantly by changing them. The uncertainties deduced from the covariance data for the XT-ADS criticality were 0.94%, 1.9% and 1.1% by the SCALE 44-group, TENDL-2009 and JENDL-3.3 data, respectively. When the target accuracy of 0.3%Δk for the criticality was considered, the uncertainties did not satisfy it. To achieve this accuracy, the uncertainties should be improved by experiments under an adequate condition.

  14. Quantifying the relative contributions of different solute carriers to aggregate substrate transport

    Science.gov (United States)

    Taslimifar, Mehdi; Oparija, Lalita; Verrey, Francois; Kurtcuoglu, Vartan; Olgac, Ufuk; Makrides, Victoria

    2017-01-01

    Determining the contributions of different transporter species to overall cellular transport is fundamental for understanding the physiological regulation of solutes. We calculated the relative activities of Solute Carrier (SLC) transporters using the Michaelis-Menten equation and global fitting to estimate the normalized maximum transport rate for each transporter (Vmax). Data input were the normalized measured uptake of the essential neutral amino acid (AA) L-leucine (Leu) from concentration-dependence assays performed using Xenopus laevis oocytes. Our methodology was verified by calculating Leu and L-phenylalanine (Phe) data in the presence of competitive substrates and/or inhibitors. Among 9 potentially expressed endogenous X. laevis oocyte Leu transporter species, activities of only the uniporters SLC43A2/LAT4 (and/or SLC43A1/LAT3) and the sodium symporter SLC6A19/B0AT1 were required to account for total uptake. Furthermore, Leu and Phe uptake by heterologously expressed human SLC6A14/ATB0,+ and SLC43A2/LAT4 was accurately calculated. This versatile systems biology approach is useful for analyses where the kinetics of each active protein species can be represented by the Hill equation. Furthermore, its applicable even in the absence of protein expression data. It could potentially be applied, for example, to quantify drug transporter activities in target cells to improve specificity. PMID:28091567

  15. SLC2A3 single-nucleotide polymorphism and duplication influence cognitive processing and population-specific risk for attention-deficit/hyperactivity disorder.

    Science.gov (United States)

    Merker, Sören; Reif, Andreas; Ziegler, Georg C; Weber, Heike; Mayer, Ute; Ehlis, Ann-Christine; Conzelmann, Annette; Johansson, Stefan; Müller-Reible, Clemens; Nanda, Indrajit; Haaf, Thomas; Ullmann, Reinhard; Romanos, Marcel; Fallgatter, Andreas J; Pauli, Paul; Strekalova, Tatyana; Jansch, Charline; Vasquez, Alejandro Arias; Haavik, Jan; Ribasés, Marta; Ramos-Quiroga, Josep Antoni; Buitelaar, Jan K; Franke, Barbara; Lesch, Klaus-Peter

    2017-07-01

    Attention-deficit/hyperactivity disorder (ADHD) is a common, highly heritable neurodevelopmental disorder with profound cognitive, behavioral, and psychosocial impairments with persistence across the life cycle. Our initial genome-wide screening approach for copy number variants (CNVs) in ADHD implicated a duplication of SLC2A3, encoding glucose transporter-3 (GLUT3). GLUT3 plays a critical role in cerebral glucose metabolism, providing energy for the activity of neurons, which, in turn, moderates the excitatory-inhibitory balance impacting both brain development and activity-dependent neural plasticity. We therefore aimed to provide additional genetic and functional evidence for GLUT3 dysfunction in ADHD. Case-control association analyses of SLC2A3 single-nucleotide polymorphisms (SNPs) and CNVs were conducted in several European cohorts of patients with childhood and adult ADHD (SNP, n = 1,886 vs. 1,988; CNV, n = 1,692 vs. 1,721). These studies were complemented by SLC2A3 expression analyses in peripheral cells, functional EEG recordings during neurocognitive tasks, and ratings of food energy content. Meta-analysis of all cohorts detected an association of SNP rs12842 with ADHD. While CNV analysis detected a population-specific enrichment of SLC2A3 duplications only in German ADHD patients, the CNV + rs12842 haplotype influenced ADHD risk in both the German and Spanish cohorts. Duplication carriers displayed elevated SLC2A3 mRNA expression in peripheral blood cells and altered event-related potentials reflecting deficits in working memory and cognitive response control, both endophenotypic traits of ADHD, and an underestimation of energy units of high-caloric food. Taken together, our results indicate that both common and rare SLC2A3 variation impacting regulation of neuronal glucose utilization and energy homeostasis may result in neurocognitive deficits known to contribute to ADHD risk. © 2017 Association for Child and Adolescent Mental Health.

  16. Adapting the MYRRHA concept to meet the XT-ADS objectives

    International Nuclear Information System (INIS)

    De Bruyn, D.

    2007-01-01

    The EUROTRANS project is an integrated project in the Sixth European Framework Program in the context of Partitioning and Transmutation. The objective of this project is the step-wise approach to a European Transmutation Demonstration. This project aims to deliver an advanced design of a small-scale Accelerator Driven System (ADS), XT-ADS, as well as the conceptual design of a European Facility for Industrial Transmutation, EFIT. The partners of this project accepted to use the MYRRHA Draft-2 design file as a starting basis for the design of the short-term XT-ADS demonstration machine. Instead of starting from a blank page, this allowed optimising an existing design towards the needs of XT-ADS, and within the limits of safety requirements. Many options have been revisited and the framework is now set up. While our MYRRHA Draft-2 design file was still a conceptual design, our intention is to get at the end of the EUROTRANS project (March 2009) an advanced design of the XT-ADS machine, albeit a first advanced design. Moreover, industrial partners (Ansaldo Nucleare, Areva) will contribute to this XT-ADS design

  17. Global transcriptome profiling identifies KLF15 and SLC25A10 as modifiers of adipocytes insulin sensitivity in obese women.

    Directory of Open Access Journals (Sweden)

    Agné Kulyté

    Full Text Available Although the mechanisms linking obesity to insulin resistance (IR and type 2 diabetes (T2D are not entirely understood, it is likely that alterations of adipose tissue function are involved. The aim of this study was to identify new genes controlling insulin sensitivity in adipocytes from obese women with either insulin resistant (OIR or sensitive (OIS adipocytes. Insulin sensitivity was first determined by measuring lipogenesis in isolated adipocytes from abdominal subcutaneous white adipose tissue (WAT in a large observational study. Lipogenesis was measured under conditions where glucose transport was the rate limiting step and reflects in vivo insulin sensitivity. We then performed microarray-based transcriptome profiling on subcutaneous WAT specimen from a subgroup of 9 lean, 21 OIS and 18 obese OIR women. We could identify 432 genes that were differentially expressed between the OIR and OIS group (FDR ≤5%. These genes are enriched in pathways related to glucose and amino acid metabolism, cellular respiration, and insulin signaling, and include genes such as SLC2A4, AKT2, as well as genes coding for enzymes in the mitochondria respiratory chain. Two IR-associated genes, KLF15 encoding a transcription factor and SLC25A10 encoding a dicarboxylate carrier, were selected for functional evaluation in adipocytes differentiated in vitro. Knockdown of KLF15 and SLC25A10 using siRNA inhibited insulin-stimulated lipogenesis in adipocytes. Transcriptome profiling of siRNA-treated cells suggested that KLF15 might control insulin sensitivity by influencing expression of PPARG, PXMP2, AQP7, LPL and genes in the mitochondrial respiratory chain. Knockdown of SLC25A10 had only modest impact on the transcriptome, suggesting that it might directly influence insulin sensitivity in adipocytes independently of transcription due to its important role in fatty acid synthesis. In summary, this study identifies novel genes associated with insulin sensitivity in

  18. Developmental expression of SLC26A4 (Pendrin) during amelogenesis in developing rodent teeth

    Science.gov (United States)

    Bronckers, Antonius LJJ; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M.; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela

    2012-01-01

    Ameloblasts need to regulate pH during formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as pH regulator. SLC26A4 does not appear critical for ameloblast functioning and is likely compensated by other pH regulators. PMID:22243245

  19. Triiodothyronine Acutely Stimulates Glucose Transport into L6 Muscle Cells Without Increasing Surface GLUT4, GLUT1, or GLUT3

    Science.gov (United States)

    Teixeira, Silvania Silva; Tamrakar, Akhilesh K.; Goulart-Silva, Francemilson; Serrano-Nascimento, Caroline; Klip, Amira

    2012-01-01

    Background Thyroid hormones (THs) act genomically to stimulate glucose transport by elevating glucose transporter (Slc2a) expression and glucose utilization by cells. However, nongenomic effects of THs are now emerging. Here, we assess how triiodothyronine (T3) acutely affects glucose transport and the content of GLUT4, GLUT1, and GLUT3 at the surface of muscle cells, and possible interactions between T3 and insulin action. Methods Differentiated L6 myotubes transfected with myc-tagged Slc2a4 (L6-GLUT4myc) or Slc2a1 (L6-GLUT1myc) and wild-type L6 myotubes were studied in the following conditions: control, hypothyroid (Tx), Tx plus T3, Tx plus insulin, and Tx plus insulin and T3. Results Glucose uptake and GLUT4 content at the cell surface decreased in the Tx group relative to controls. T3 treatment for 30 minutes increased glucose transport into L6-GLUT4myc cells without altering surface GLUT4 content, which increased only thereafter. The total amount of GLUT4 protein remained unchanged among the groups studied. The surface GLUT1 content of L6-GLUT1myc cells also remained unaltered after T3 treatment; however, in these cells glucose transport was not stimulated by T3. In wild-type L6 cells, although T3 treatment increased the total amount of GLUT3, it did not change the surface GLUT3 content. Moreover, within 30 minutes, T3 stimulation of glucose uptake was additive to that of insulin in L6-GLUT4myc cells. As expected, insulin elevated surface GLUT4 content and glucose uptake. However, interestingly, surface GLUT4 content remained unchanged or even dropped with T3 plus insulin. Conclusions These data reveal that T3 rapidly increases glucose uptake in L6-GLUT4myc cells, which, at least for 30 minutes, did not depend on an increment in GLUT4 at the cell surface yet potentiates insulin action. We propose that this rapid T3 effect involves activation of GLUT4 transporters at the cell surface, but cannot discount the involvement of an unknown GLUT. PMID:22663547

  20. Development of imatinib and dasatinib resistance: dynamics of expression of drug transporters ABCB1, ABCC1, ABCG2, MVP, and SLC22A1.

    Science.gov (United States)

    Gromicho, Marta; Dinis, Joana; Magalhães, Marta; Fernandes, Alexandra R; Tavares, Purificação; Laires, António; Rueff, José; Rodrigues, António Sebastião

    2011-10-01

    About 20% of patients with chronic myeloid leukemia (CML) do not respond to treatment with imatinib either initially or because of acquired resistance. To study the development of CML drug resistance, an in vitro experimental system comprising cell lines with different resistance levels was established by exposing K562 cells to increasing concentrations of imatinib and dasatinib anticancer agents. The mRNA levels of BCR- ABL1 and of genes involved in drug transport or redistribution (ABCB1, ABCC1, ABCC3, ABCG2, MVP, and SLC22A1) were measured and the ABL1 kinase domain sequenced. Results excluded BCR- ABL1 overexpression and mutations as relevant resistance mechanisms. Most studied transporters were overexpressed in the majority of resistant cell lines. Their expression pattern was dynamic: varying with resistance level and chronic drug exposure. Studied efflux transporters may have an important role at the initial stages of resistance, but after prolonged exposure and for higher doses of drugs other mechanisms might take place.

  1. MYRRHA/XT-ADS primary system design and experimental devices

    International Nuclear Information System (INIS)

    Maes, D.

    2009-01-01

    The EUROTRANS project is an integrated project in the Sixth European Framework Program in the context of Partitioning and Transmutation. The objective of this project is to work towards an ETD (European Transmutation Demonstration) in a step-wise manner. The first step is to carry out an advanced design of a small-scale XT-ADS (eXperimental Transmutation in an Accelerator Driven System) for realisation in a short-term (about 10 years) as well as to accomplish a generic conceptual design of EFIT (European Facility for Industrial Transmutation) for realisation in the long-term. The MYRRHA-2005 design served as a starting basis for the XT-ADS. Many options have been revisited and the framework is now set up. While the MYRRHA-2005 design was still a conceptual design, the intention is to get at the end of the EUROTRANS project (March 2009) an advanced design of the XT-ADS, albeit a first advanced design. While the design work performed during the first years of the project (2005-2006) was mainly devoted to optimise and enhance the primary and secondary system configuration according to the suggestions and contributions of our industrial partners (Ansaldo Nucleare, Areva, Suez-Tractebel) within the DM1 (Domain 1 D ESIGN ) , the last year work objectives mainly consisted of (1) the release of the Remote Handling Design Catalogue for XT-ADS and (2) the formulation of the specification of the experimental devices according to the XT-ADS objectives and adapted to the actual XT-ADS core and core support structure design; (3) the detailed calculations of the main XT-ADS primary and secondary system components

  2. Determining mutations in G6PC and SLC37A4 genes in a sample of Brazilian patients with glycogen storage disease types Ia and Ib

    Directory of Open Access Journals (Sweden)

    Marcelo Paschoalete Carlin

    2013-01-01

    Full Text Available Glycogen storage disease (GSD comprises a group of autosomal recessive disorders characterized by deficiency of the enzymes that regulate the synthesis or degradation of glycogen. Types Ia and Ib are the most prevalent; while the former is caused by deficiency of glucose-6-phosphatase (G6Pase, the latter is associated with impaired glucose-6-phosphate transporter, where the catalytic unit of G6Pase is located. Over 85 mutations have been reported since the cloning of G6PC and SLC37A4 genes. In this study, twelve unrelated patients with clinical symptoms suggestive of GSDIa and Ib were investigated by using genetic sequencing of G6PC and SLC37A4 genes, being three confirmed as having GSD Ia, and two with GSD Ib. In seven of these patients no mutations were detected in any of the genes. Five changes were detected in G6PC, including three known point mutations (p.G68R, p.R83C and p.Q347X and two neutral mutations (c.432G > A and c.1176T > C. Four changes were found in SLC37A4: a known point mutation (p.G149E, a novel frameshift insertion (c.1338_1339insT, and two neutral mutations (c.1287G > A and c.1076-28C > T. The frequency of mutations in our population was similar to that observed in the literature, in which the mutation p.R83C is also the most frequent one. Analysis of both genes should be considered in the investigation of this condition. An alternative explanation to the negative results in this molecular study is the possibility of a misdiagnosis. Even with a careful evaluation based on laboratory and clinical findings, overlap with other types of GSD is possible, and further molecular studies should be indicated.

  3. SLC2A9 and ZNF518B polymorphisms correlate with gout-related metabolic indices in Chinese Tibetan populations.

    Science.gov (United States)

    Zhang, X Y; Geng, T T; Liu, L J; Yuan, D Y; Feng, T; Kang, L L; Jin, T B; Chen, C

    2015-08-19

    Current evidence suggests that heredity and metabolic syndrome contribute to gout progression. SLC2A9 and ZNF518B may play a role in gout progression in different populations, but no studies have focused on the Tibetan Chinese population. In this study, we determined whether variations in these 2 genes were correlated with gout-related indices in Chinese-Tibetan gout patients. We detected 6 single nucleotide polymorphisms in SLC2A9 and ZNF518B in 319 Chinese Tibetan gout patients. One-way analysis of variance was used to evaluate the polymorphisms' effects on gout based on mean serum levels of metabolism indicators. Polymorphisms in SLC2A9 and ZNF518B affected multiple risk factors related to gout development. Significant differences in serum triglyceride levels and high-density lipoprotein-cholesterol level were detected between different genotypic groups with SLC2A9 polymorphisms rs13129697 (P = 0.022), rs4447863 (P = 0.018), and rs1014290 (P = 0.045). Similarly in ZNF518B, rs3217 (P = 0.016) and rs10016022 (P = 0.046) were associated with high creatinine and glucose levels, respectively. This study is the first to investigate and identify positive correlations between SLC2A9 and ZNF518B gene polymorphisms and metabolic indices in Tibetan gout patients. We found significant evidence indicating that genetic polymorphisms affect gout-related factors in Chinese Tibetan populations.

  4. Production and Purification of a Novel Xanthan Lyase from a Xanthan-Degrading Microbacterium sp. Strain XT11

    Directory of Open Access Journals (Sweden)

    Fan Yang

    2014-01-01

    Full Text Available A xanthan lyase was produced and purified from the culture supernatant of an excellent xanthan-modifying strain Microbacterium sp. XT11. Xanthan lyase was induced by xanthan but was inhibited by its structural monomer glucose. Its production by strain XT11 is much higher than that by all other reported strains. The purified xanthan lyase has a molecular mass of 110 kDa and a specific activity of 28.2 U/mg that was much higher than that of both Paenibacillus and Bacillus lyases. It was specific on the pyruvated mannosyl residue in the intact xanthan molecule, but about 50% lyase activity remained when xanthan was partially depyruvated. Xanthan lyase was optimally active at pH 6.0–6.5 and 40°C and alkali-tolerant at a high pH value of 11.0. The metal ions including K+, Ca2+, Na+, Mg2+, Mn2+, and Li+ strongly stimulated xanthan lyase activity but ions Zn2+ and Cu2+ were its inhibitor. Xanthan lyase should be a novel enzyme different from the other xanthan lyases ever reported.

  5. The rise and fall of novel renal magnesium transporters.

    Science.gov (United States)

    Schäffers, Olivier J M; Hoenderop, Joost G J; Bindels, René J M; de Baaij, Jeroen H F

    2018-06-01

    Body Mg 2+ balance is finely regulated in the distal convoluted tubule (DCT), where a tight interplay among transcellular reabsorption, mitochondrial exchange, and basolateral extrusion takes place. In the last decades, several research groups have aimed to identify the molecular players in these processes. A multitude of proteins have been proposed to function as Mg 2+ transporter in eukaryotes based on phylogenetic analysis, differential gene expression, and overexpression studies. However, functional evidence for many of these proteins is lacking. The aim of this review is, therefore, to critically reconsider all putative Mg 2+ transporters and put their presumed function in context of the renal handling of Mg 2+ . Sufficient experimental evidence exists to acknowledge transient receptor potential melastatin (TRPM) 6 and TRPM7, solute carrier family 41 (SLC41) A1 and SLC41A3, and mitochondrial RNA splicing 2 (MRS2) as Mg 2+ transporters. TRPM6/7 facilitate Mg 2+ influx, SLC41A1 mediates Mg 2+ extrusion, and MRS2 and SLC41A3 are implicated in mitochondrial Mg 2+ homeostasis. These proteins are highly expressed in the DCT. The function of cyclin M (CNNM) proteins is still under debate. For the other proposed Mg 2+ transporters including Mg 2+ transporter subtype 1 (MagT1), nonimprinted in Prader-Willi/Angelman syndrome (NIPA), membrane Mg 2+ transport (MMgT), Huntingtin-interacting protein 14 (HIP14), and ATP13A4, functional evidence is limited, or functions alternative to Mg 2+ transport have been suggested. Additional characterization of their Mg 2+ transport proficiency should be provided before further claims about their role as Mg 2+ transporter can be made.

  6. Common Genetic Variation and Haplotypes of the Anion Exchanger SLC4A2 in Primary Biliary Cirrhosis

    Science.gov (United States)

    Juran, Brian D.; Atkinson, Elizabeth J.; Larson, Joseph J.; Schlicht, Erik M.; Lazaridis, Konstantinos N.

    2010-01-01

    Objectives Deficiencies of the anion exchanger SLC4A2 are thought to play a pathogenic role in primary biliary cirrhosis (PBC), evidenced by decreased expression and activity in PBC patients and development of disease features in SLC4A2 knockout mice. We hypothesized that genetic variation in SLC4A2 might influence this pathogenic contribution. Thus, we aimed to perform a comprehensive assessment of SLC4A2 genetic variation in PBC using a linkage disequilibrium (LD)-based haplotype-tagging approach. Methods Twelve single nucleotide polymorphisms (SNPs) across SLC4A2 were genotyped in 409 PBC patients and 300 controls and evaluated for association with disease, as well as with prior orthotopic liver transplant and antimitochondrial antibody (AMA) status among the PBC patients, both individually and as inferred haplotypes, using logistic regression. Results All SNPs were in Hardy–Weinberg equilibrium. No associations with disease or liver transplantation were detected, but two variants, rs2303929 and rs3793336, were associated with negativity for antimitochondrial antibodies among the PBC patients. Conclusions The common genetic variation of SLC4A2 does not directly affect the risk of PBC or its clinical outcome. Whether the deficiency of SLC4A2 expression and activity observed earlier in PBC patients is an acquired epiphenomenon of underlying disease or is because of heritable factors in unappreciated regulatory regions remains uncertain. Of note, two SLC4A2 variants appear to influence AMA status among PBC patients. The mechanisms behind this finding are unclear. PMID:19491853

  7. Screening of SLC26A4, FOXI1, KCNJ10, and GJB2 in bilateral deafness patients with inner ear malformation.

    Science.gov (United States)

    Chen, Kaitian; Wang, Xianren; Sun, Liang; Jiang, Hongyan

    2012-06-01

    Bilateral nonsyndromic sensorineural hearing loss associated with inner ear malformation is closely related to genetics. SLC26A4 is considered to be the major involved gene. Recently, FOXI1 and KCNJ10 mutations have been linked to enlarged vestibular aqueducts and GJB2 mutations linked to temporal bone malformation. The authors aimed to investigate the mutation spectrums of these genes in Chinese patients with bilateral hearing impairment associated with inner ear malformation. Cross-sectional study. Affiliated hospital of the university. The authors analyzed the GJB2, SLC26A4, FOXI1, and KCNJ10 gene sequences in 43 patients presenting with bilateral hearing impairment associated with inner ear malformation using pyrosequencing and direct DNA sequencing. In total, 74.4% (32/43) of patients carried at least 1 of 14 pathogenic SLC26A4 mutations, including 6 novel mutations and 4 polymorphisms. Patients with enlarged vestibular aqueducts had a higher rate of SLC26A4 mutation than Mondini dysplasia patients. No FOXI1 or KCNJ10 potential pathogenic mutation was present, and GJB2 biallelic pathogenic mutations were uncommon (2.3%; 1/43). No significant correlation was observed between the genotype and phenotype of SLC26A4 mutations. SLC26A4 accounts for 74.4% of inner ear malformations in our cohort, whereas FOXI1, KCNJ10, and GJB2 mutations are not common. Other possible genes or external factors may contribute to this multibranch abnormality.

  8. Insulin-increased L-arginine transport requires A(2A adenosine receptors activation in human umbilical vein endothelium.

    Directory of Open Access Journals (Sweden)

    Enrique Guzmán-Gutiérrez

    Full Text Available Adenosine causes vasodilation of human placenta vasculature by increasing the transport of arginine via cationic amino acid transporters 1 (hCAT-1. This process involves the activation of A(2A adenosine receptors (A(2AAR in human umbilical vein endothelial cells (HUVECs. Insulin increases hCAT-1 activity and expression in HUVECs, and A(2AAR stimulation increases insulin sensitivity in subjects with insulin resistance. However, whether A(2AAR plays a role in insulin-mediated increase in L-arginine transport in HUVECs is unknown. To determine this, we first assayed the kinetics of saturable L-arginine transport (1 minute, 37°C in the absence or presence of nitrobenzylthioinosine (NBTI, 10 µmol/L, adenosine transport inhibitor and/or adenosine receptors agonist/antagonists. We also determined hCAT-1 protein and mRNA expression levels (Western blots and quantitative PCR, and SLC7A1 (for hCAT-1 reporter promoter activity. Insulin and NBTI increased the extracellular adenosine concentration, the maximal velocity for L-arginine transport without altering the apparent K(m for L-arginine transport, hCAT-1 protein and mRNA expression levels, and SLC7A1 transcriptional activity. An A2AAR antagonist ZM-241385 blocked these effects. ZM241385 inhibited SLC7A1 reporter transcriptional activity to the same extent in cells transfected with pGL3-hCAT-1(-1606 or pGL3-hCAT-1(-650 constructs in the presence of NBTI + insulin. However, SLC7A1 reporter activity was increased by NBTI only in cells transfected with pGL3-hCAT-1(-1606, and the ZM-241385 sensitive fraction of the NBTI response was similar in the absence or in the presence of insulin. Thus, insulin modulation of hCAT-1 expression and activity requires functional A(2AAR in HUVECs, a mechanism that may be applicable to diseases associated with fetal insulin resistance, such as gestational diabetes.

  9. Evaluation of dopamine transporters and D2 receptors in hemiparkinsonian rat brains in vivo using consecutive PET scans of [18F]FPCIT and [18F]fallypride

    International Nuclear Information System (INIS)

    Choi, Jae Yong; Kim, Chul Hoon; Jeon, Tae Joo; Cho, Won Gil; Lee, Jin Suk; Lee, Soo Jin; Choi, Tae Hyun; Kim, Byoung Soo; Yi, Chi Hoon; Seo, Youngbeom; Yi, Dae Ik; Han, Sang Jin; Lee, Minkyung; Kim, Dong Goo; Lee, Jong Doo; An, Gwangil

    2012-01-01

    The aim of this study was to investigate dopaminergic function in unilaterally lesioned 6-OHDA rats by dual PET radioligands: [ 18 F]FPCIT (a dopamine transporter imaging radioligand) and [ 18 F]fallypride (a dopamine D2 receptors imaging radioligand). As a result, the brain uptake of [ 18 F]FPCIT was significantly reduced and that of [ 18 F]fallypride was increased in the ipsilateral striatum (lesion side) of the 6-OHDA rats. These findings implicated that dopamine transporter is down-regulated and dopamine D2 receptor is up-regulated in this hemiparkinsonian rat model. - Highlights: ► The dopaminergic integrity in unilateral 6-OHDA was evaluated by dual PET tracers. ► The brain uptake and BP ND of [ 18 F]FPCIT was greatly decreased. ► The brain uptake and BP ND [ 18 F]fallypride was slightly increased. ► DAT are down-regulated and D2R are up-regulated.

  10. Interactions between Serotonin Transporter Gene Haplotypes and Quality of Mothers' Parenting Predict the Development of Children's Noncompliance

    Science.gov (United States)

    Sulik, Michael J.; Eisenberg, Nancy; Lemery-Chalfant, Kathryn; Spinrad, Tracy L.; Silva, Kassondra M.; Eggum, Natalie D.; Betkowski, Jennifer A.; Kupfer, Anne; Smith, Cynthia L.; Gaertner, Bridget; Stover, Daryn A.; Verrelli, Brian C.

    2012-01-01

    The LPR and STin2 polymorphisms of the serotonin transporter gene (SLC6A4) were combined into haplotypes that, together with quality of maternal parenting, were used to predict initial levels and linear change in children's (N = 138) noncompliance and aggression from age 18-54 months. Quality of mothers' parenting behavior was observed when…

  11. Dicty_cDB: SLC419 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4

  12. Peripheral SLC6A4 DNA methylation is associated with in vivo measures of human brain serotonin synthesis and childhood physical aggression.

    Directory of Open Access Journals (Sweden)

    Dongsha Wang

    Full Text Available The main challenge in addressing the role of DNA methylation in human behaviour is the fact that the brain is inaccessible to epigenetic analysis in living humans. Using positron emission tomography (PET measures of brain serotonin (5-HT synthesis, we found in a longitudinal sample that adult males with high childhood-limited aggression (C-LHPA had lower in vivo 5-HT synthesis in the orbitofrontal cortex (OBFC. Here we hypothesized that 5-HT alterations associated with childhood aggression were linked to differential DNA methylation of critical genes in the 5-HT pathway and these changes were also detectable in peripheral white blood cells. Using pyrosequencing, we determined the state of DNA methylation of SLC6A4 promoter in T cells and monocytes isolated from blood of cohort members (N = 25 who underwent a PET scan, and we examined whether methylation status in the blood is associated with in vivo brain 5-HT synthesis. Higher levels of methylation were observed in both T cells and monocytes at specific CpG sites in the C-LHPA group. DNA methylation of SLC6A4 in monocytes appears to be associated more reliably with group membership than T cells. In both cell types the methylation state of these CpGs was associated with lower in vivo measures of brain 5-HT synthesis in the left and right lateral OBFC (N = 20 where lower 5-HT synthesis in C-LHPA group was observed. Furthermore, in vitro methylation of the SLC6A4 promoter in a luciferase reporter construct suppresses its transcriptional activity supporting a functional role of DNA methylation in SLC6A4 promoter regulation. These findings indicate that state of SLC6A4 promoter methylation is altered in peripheral white blood cells of individuals with physical aggression during childhood. This supports the relevance of peripheral DNA methylation for brain function and suggests that peripheral SLC6A4 DNA methylation could be a marker of central 5-HT function.

  13. Effects of fasting and refeeding on gene expression of slc15a1a, a gene encoding an oligopeptide transporter (PepT1), in the intestine of Mozambique tilapia.

    Science.gov (United States)

    Orozco, Zenith Gaye A; Soma, Satoshi; Kaneko, Toyoji; Watanabe, Soichi

    2017-01-01

    The tissue distribution of slc15a1a, a gene that encodes an oligopeptide transporter, PepT1, and its response to fasting and refeeding were investigated in the intestinal epithelium of Mozambique tilapia for a better understanding of its role on nutrient absorption. The slc15a1a was predominantly expressed in the absorptive epithelia of the anterior part of the intestine, suggesting that digested oligopeptides are primarily absorbed in the anterior intestine. The response of slc15a1a to fasting was evaluated at 1, 2, 4, 7 and 14days after the last feeding. Fasting revealed a biphasic effect, where short-term fasting significantly upregulated slc15a1a expression and long-term fasting resulted in downregulation. The expression level continued to decrease and fell below the pre-fasted level from day 4 to 14. Proximal (the hepatic loop, HL) and distal parts (the proximal major coil, PMC) of the anterior intestine showed different magnitudes of responses to fasting; slc15a1a expression in the PMC showed greater upregulation and downregulation than that in the HL. Refeeding significantly stimulated slc15a1a expression at day 3, although the expression did not exceed the pre-fasted level. Observed responses of slc15a1a to fasting and refeeding suggest that the expression level of this gene can serve as a sensitive indicator of the changes that may occur in altering nutritional conditions. These findings contribute to a better understanding of the role of PepT1 in nutrition and of the complex mechanisms underlying the absorption of oligopeptides and amino acids in the intestine, and may lead to development of possible means to manipulate the absorption processes for the improvement of growth and other metabolic and physiological conditions in fish. Copyright © 2016. Published by Elsevier Inc.

  14. SLC6A3 coding variant Ala559Val found in two autism probands alters dopamine transporter function and trafficking.

    Science.gov (United States)

    Bowton, E; Saunders, C; Reddy, I A; Campbell, N G; Hamilton, P J; Henry, L K; Coon, H; Sakrikar, D; Veenstra-VanderWeele, J M; Blakely, R D; Sutcliffe, J; Matthies, H J G; Erreger, K; Galli, A

    2014-10-14

    Emerging evidence associates dysfunction in the dopamine (DA) transporter (DAT) with the pathophysiology of autism spectrum disorder (ASD). The human DAT (hDAT; SLC6A3) rare variant with an Ala to Val substitution at amino acid 559 (hDAT A559V) was previously reported in individuals with bipolar disorder or attention-deficit hyperactivity disorder (ADHD). We have demonstrated that this variant is hyper-phosphorylated at the amino (N)-terminal serine (Ser) residues and promotes an anomalous DA efflux phenotype. Here, we report the novel identification of hDAT A559V in two unrelated ASD subjects and provide the first mechanistic description of its impaired trafficking phenotype. DAT surface expression is dynamically regulated by DAT substrates including the psychostimulant amphetamine (AMPH), which causes hDAT trafficking away from the plasma membrane. The integrity of DAT trafficking directly impacts DA transport capacity and therefore dopaminergic neurotransmission. Here, we show that hDAT A559V is resistant to AMPH-induced cell surface redistribution. This unique trafficking phenotype is conferred by altered protein kinase C β (PKCβ) activity. Cells expressing hDAT A559V exhibit constitutively elevated PKCβ activity, inhibition of which restores the AMPH-induced hDAT A559V membrane redistribution. Mechanistically, we link the inability of hDAT A559V to traffic in response to AMPH to the phosphorylation of the five most distal DAT N-terminal Ser. Mutation of these N-terminal Ser to Ala restores AMPH-induced trafficking. Furthermore, hDAT A559V has a diminished ability to transport AMPH, and therefore lacks AMPH-induced DA efflux. Pharmacological inhibition of PKCβ or Ser to Ala substitution in the hDAT A559V background restores AMPH-induced DA efflux while promoting intracellular AMPH accumulation. Although hDAT A559V is a rare variant, it has been found in multiple probands with neuropsychiatric disorders associated with imbalances in DA neurotransmission

  15. Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.

    Science.gov (United States)

    Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W

    2014-04-01

    Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.

  16. Conduction Abnormalities and Pacemaker Implantations After SAPIEN 3 Vs SAPIEN XT Prosthesis Aortic Valve Implantation.

    Science.gov (United States)

    Husser, Oliver; Kessler, Thorsten; Burgdorf, Christof; Templin, Christian; Pellegrini, Costanza; Schneider, Simon; Kasel, Albert Markus; Kastrati, Adnan; Schunkert, Heribert; Hengstenberg, Christian

    2016-02-01

    Transcatheter aortic valve implantation is increasingly used in patients with aortic stenosis. Post-procedural intraventricular conduction abnormalities and permanent pacemaker implantations remain a serious concern. Recently, the Edwards SAPIEN 3 prosthesis has replaced the SAPIEN XT. We sought to determine the incidences of new-onset intraventricular conduction abnormalities and permanent pacemaker implantations by comparing the 2 devices. We analyzed the last consecutive 103 patients undergoing transcatheter aortic valve implantation with SAPIEN XT before SAPIEN 3 was used in the next 105 patients. To analyze permanent pacemaker implantations and new-onset intraventricular conduction abnormalities, patients with these conditions at baseline were excluded. Electrocardiograms were recorded at baseline, after the procedure, and before discharge. SAPIEN 3 was associated with higher device success (100% vs 92%; P=.005) and less paravalvular leakage (0% vs 7%; Ppacemaker implantations was 12.6% (23 of 183) with no difference between the 2 groups (SAPIEN 3: 12.5% [12 of 96] vs SAPIEN XT: 12.6% [11 of 87]; P=.99). SAPIEN 3 was associated with a higher rate of new-onset intraventricular conduction abnormalities (49% vs 27%; P=.007) due to a higher rate of fascicular blocks (17% vs 5%; P=.021). There was no statistically significant difference in transient (29% [20 of 69] vs persistent 19% [12 of 64]; P=.168) left bundle branch blocks (28% [19 of 69] vs 17% [11 of 64]; P=.154) when SAPIEN 3 was compared with SAPIEN XT. We found a trend toward a higher rate of new-onset intraventricular conduction abnormalities with SAPIEN 3 compared with SAPIEN XT, although this did not result in a higher permanent pacemaker implantation rate. Copyright © 2015 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

  17. Dicty_cDB: SLC456 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -

  18. Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore.

    Science.gov (United States)

    Lean, Choo Bee; Lee, Edmund Jon Deoon

    2009-01-01

    MCT1(SLC16A1) is the first member of the monocarboxylate transporter (MCT) and its family is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study identifies genetic variations in SLC16A1 in the ethnic Chinese group of the Singaporean population (n=95). The promoter, coding region and exon-intron junctions of the SLC16A1 gene encoding the MCT1 transporter were screened for genetic variation in the study population by DNA sequencing. Seven genetic variations of SLC16A1, including 4 novel ones, were found: 2 in the promoter region, 2 in the coding exons (both nonsynonymous variations), 2 in the 3' untranslated region (3'UTR) and 1 in the intron. Of the two mutations detected in the promoter region, the -363-855T>C is a novel mutation. The 1282G>A (Val(428)Ile) is a novel SNP and was found as heterozygotic in 4 subjects. The 1470T>A (Asp(490)Glu) was found to be a common polymorphism in this study. Lastly, IVS3-17A>C in intron 3 and 2258 (755)A>G in 3'UTR are novel mutations found to be common polymorphisms in the local Chinese population. To our knowledge, this is the first report of a comprehensive analysis on the MCT1 gene in any population.

  19. Significance of downregulation of renal organic cation transporter (SLC47A1 in cisplatin-induced proximal tubular injury

    Directory of Open Access Journals (Sweden)

    Mizuno T

    2015-07-01

    Full Text Available Tomohiro Mizuno,1–3 Waichi Sato,2,3 Kazuhiro Ishikawa,4 Yuki Terao,1 Kazuo Takahashi,2 Yukihiro Noda,5 Yukio Yuzawa,2 Tadashi Nagamatsu1 1Department of Analytical Pharmacology, Meijo University Faculty of Pharmacy, Nagoya, 2Department of Nephrology, School of Medicine, Fujita Health University, Toyoake, 3Department of Nephrology, Nagoya University School of Medicine, Nagoya, 4Department of Neuropsychopharmacology and Hospital Pharmacy, Nagoya University Graduate School of Medicine, Nagoya, 5Division of Clinical Sciences and Neuropsychopharmacology, Meijo University Faculty of Pharmacy, Nagoya, Japan Background/aim: To elucidate the mechanism responsible for developing acute kidney injury in patients with diabetes mellitus, we also evaluated the issue of whether advanced glycation endproducts (AGEs influence the expressions of multi antimicrobial extrusion protein (MATE1/SLC47A1 in tubular cells. Materials and methods: To detect changing expression of MATE1/SLC47A1 in dose- and time-dependent manners, human proximal tubular epithelial cells were incubated with AGE-aggregated-human serum albumin. As a function assay for MATE1/SLC47A1, human proximal tubular epithelial cells were incubated with cisplatin or carboplatin. Results: On incubation with AGEs, the expressions of MATE1/SLC47A1 were decreased in tubular cells. In addition, the toxicities of cisplatin were increased in tubular cells that had been pretreated with AGEs. However, the toxicities of carboplatin were smaller than that of cisplatin in proximal tubular epithelial cells. Conclusion: The expression of the MATE1/SLC47A1 is decreased by AGEs, which increases the risk for proximal tubular injury. Keywords: advanced glycation endproducts, cisplatin, SLC47A1, diabetes mellitus, acute kidney injury

  20. Mutations in SLC20A2 are a major cause of familial idiopathic basal ganglia calcification

    Science.gov (United States)

    Hsu, Sandy Chan; Sears, Renee L.; Lemos, Roberta R.; Quintáns, Beatriz; Huang, Alden; Spiteri, Elizabeth; Nevarez, Lisette; Mamah, Catherine; Zatz, Mayana; Pierce, Kerrie D.; Fullerton, Janice M.; Adair, John C.; Berner, Jon E.; Bower, Matthew; Brodaty, Henry; Carmona, Olga; Dobricić, Valerija; Fogel, Brent L.; García-Estevez, Daniel; Goldman, Jill; Goudreau, John L.; Hopfer, Suellen; Janković, Milena; Jaumà, Serge; Jen, Joanna C.; Kirdlarp, Suppachok; Klepper, Joerg; Kostić, Vladimir; Lang, Anthony E.; Linglart, Agnès; Maisenbacher, Melissa K.; Manyam, Bala V.; Mazzoni, Pietro; Miedzybrodzka, Zofia; Mitarnun, Witoon; Mitchell, Philip B.; Mueller, Jennifer; Novaković, Ivana; Paucar, Martin; Paulson, Henry; Simpson, Sheila A.; Svenningsson, Per; Tuite, Paul; Vitek, Jerrold; Wetchaphanphesat, Suppachok; Williams, Charles; Yang, Michele; Schofield, Peter R.; de Oliveira, João R. M.; Sobrido, María-Jesús

    2014-01-01

    Familial idiopathic basal ganglia calcification (IBGC) or Fahr’s disease is a rare neurodegenerative disorder characterized by calcium deposits in the basal ganglia and other brain regions, which is associated with neuropsychiatric and motor symptoms. Familial IBGC is genetically heterogeneous and typically transmitted in an autosomal dominant fashion. We performed a mutational analysis of SLC20A2, the first gene found to cause IBGC, to assess its genetic contribution to familial IBGC. We recruited 218 subjects from 29 IBGC-affected families of varied ancestry and collected medical history, neurological exam, and head CT scans to characterize each patient’s disease status. We screened our patient cohort for mutations in SLC20A2. Twelve novel (nonsense, deletions, missense, and splice site) potentially pathogenic variants, one synonymous variant, and one previously reported mutation were identified in 13 families. Variants predicted to be deleterious cosegregated with disease in five families. Three families showed nonsegregation with clinical disease of such variants, but retrospective review of clinical and neuroimaging data strongly suggested previous misclassification. Overall, mutations in SLC20A2 account for as many as 41 % of our familial IBGC cases. Our screen in a large series expands the catalog of SLC20A2 mutations identified to date and demonstrates that mutations in SLC20A2 are a major cause of familial IBGC. Non-perfect segregation patterns of predicted deleterious variants highlight the challenges of phenotypic assessment in this condition with highly variable clinical presentation. PMID:23334463

  1. SLC injector simulation and tuning for high charge transport

    International Nuclear Information System (INIS)

    Yeremian, A.D.; Miller, R.H.; Clendenin, J.E.; Early, R.A.; Ross, M.C.; Turner, J.L.; Wang, J.W.

    1992-01-01

    We have simulated the SLC injector from the thermionic gun through the first accelerating section and used the resulting parameters to tune the injector for optimum performance and high charge transport. Simulations are conducted using PARMELA, a three-dimensional space-charge model. The magnetic field profile due to the existing magnetic optics is calculated using POISSON, while SUPERFISH is used to calculate the space harmonics of the various bunchers and the accelerator cavities. The initial beam conditions in the PARMELA code are derived from the EGUN model of the gun. The resulting injector parameters from the PARMELA simulation are used to prescribe experimental settings of the injector components. The experimental results are in agreement with the results of the integrated injector model. (Author) 5 figs., 7 refs

  2. Dicty_cDB: SLC486 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4

  3. MicroRNA-129-5p Regulates Glycolysis and Cell Proliferation by Targeting the Glucose Transporter SLC2A3 in Gastric Cancer Cells

    Directory of Open Access Journals (Sweden)

    Di Chen

    2018-05-01

    Full Text Available Tumor cells increase their glucose consumption through aerobic glycolysis to manufacture the necessary biomass required for proliferation, commonly known as the Warburg effect. Accumulating evidences suggest that microRNAs (miRNAs interact with their target genes and contribute to metabolic reprogramming in cancer cells. By integrating high-throughput screening data and the existing miRNA expression datasets, we explored the roles of candidate glycometabolism-regulating miRNAs in gastric cancer (GC. Subsequent investigation of the characterized miRNAs indicated that miR-129-5p inhibits glucose metabolism in GC cells. miRNA-129-5p directly targets the 3′-UTR of SLC2A3, thereby suppressing glucose consumption, lactate production, cellular ATP levels, and glucose uptake of GC cells. In addition, the PI3K-Akt and MAPK signaling pathways are involved in the effects of the miR-129-5p/SLC2A3 axis, regulating GC glucose metabolism and growth. These results reveal a novel role of the miR-129-5p/SLC2A3 axis in reprogramming the glycometabolism process in GC cells and indicate a potential therapeutic target for the treatment of this disease.

  4. Prostaglandin transporter (OATP2A1/SLCO2A1) contributes to local disposition of eicosapentaenoic acid-derived PGE3.

    Science.gov (United States)

    Gose, Tomoka; Nakanishi, Takeo; Kamo, Shunsuke; Shimada, Hiroaki; Otake, Katsumasa; Tamai, Ikumi

    2016-01-01

    Eicosapentaenoic acid (EPA)-derived prostaglandin E3 (PGE3) possesses an anti-inflammatory effect; however, information for transporters that regulate its peri-cellular concentration is limited. The present study, therefore, aimed to clarify transporters involved in local disposition of PGE3. PGE3 uptake was assessed in HEK293 cells transfected with OATP2A1/SLCO2A1, OATP1B1/SLCO1B1, OATP2B1/SLCO2B1, OAT1/SLC22A6, OCT1/SLC22A1 or OCT2/SLC22A2 genes, compared with HEK293 cells transfected with plasmid vector alone (Mock). PGE3 uptake by OATP2A1-expressing HEK293 cells (HEK/2A1) was the highest and followed by HEK/1B1, while no significantly higher uptake of PGE3 than Mock cells was detected by other transporters. Saturation kinetics in PGE3 uptake by HEK/2A1 estimated the Km as 7.202 ± 0.595 μM, which was 22 times higher than that of PGE2 (Km=0.331 ± 0.131 μM). Furthermore, tissue disposition of PGE3 was examined in wild-type (WT) and Slco2a1-deficient (Slco2a1(-/-)) mice after oral administration of EPA ethyl ester (EPA-E) when they underwent intraperitoneal injection of endotoxin (e.g., lipopolysaccharide). PGE3 concentration was significantly higher in the lung, and tended to increase in the colon, stomach, and kidney of Slco2a1(-/-), compared to WT mice. Ratio of PGE2 metabolite 15-keto PGE2 over PGE2 concentration was significantly lower in the lung and colon of Slco2a1(-/-) than that of WT mice, suggesting that PGE3 metabolism is downregulated in Slco2a1(-/-) mice. In conclusion, PGE3 was found to be a substrate of OATP2A1, and local disposition of PGE3 could be regulated by OATP2A1 at least in the lung. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Drosophila SLC5A11 Mediates Hunger by Regulating K(+) Channel Activity.

    Science.gov (United States)

    Park, Jin-Yong; Dus, Monica; Kim, Seonil; Abu, Farhan; Kanai, Makoto I; Rudy, Bernardo; Suh, Greg S B

    2016-08-08

    Hunger is a powerful drive that stimulates food intake. Yet, the mechanism that determines how the energy deficits that result in hunger are represented in the brain and promote feeding is not well understood. We previously described SLC5A11-a sodium/solute co-transporter-like-(or cupcake) in Drosophila melanogaster, which is required for the fly to select a nutritive sugar over a sweeter nonnutritive sugar after periods of food deprivation. SLC5A11 acts on approximately 12 pairs of ellipsoid body (EB) R4 neurons to trigger the selection of nutritive sugars, but the underlying mechanism is not understood. Here, we report that the excitability of SLC5A11-expressing EB R4 neurons increases dramatically during starvation and that this increase is abolished in the SLC5A11 mutation. Artificial activation of SLC5A11-expresssing neurons is sufficient to promote feeding and hunger-driven behaviors; silencing these neurons has the opposite effect. Notably, SLC5A11 transcript levels in the brain increase significantly when flies are starved and decrease shortly after starved flies are refed. Furthermore, expression of SLC5A11 is sufficient for promoting hunger-driven behaviors and enhancing the excitability of SLC5A11-expressing neurons. SLC5A11 inhibits the function of the Drosophila KCNQ potassium channel in a heterologous expression system. Accordingly, a knockdown of dKCNQ expression in SLC5A11-expressing neurons produces hunger-driven behaviors even in fed flies, mimicking the overexpression of SLC5A11. We propose that starvation increases SLC5A11 expression, which enhances the excitability of SLC5A11-expressing neurons by suppressing dKCNQ channels, thereby conferring the hunger state. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Mutations in SLC12A5 in epilepsy of infancy with migrating focal seizures

    Science.gov (United States)

    Stödberg, Tommy; McTague, Amy; Ruiz, Arnaud J.; Hirata, Hiromi; Zhen, Juan; Long, Philip; Farabella, Irene; Meyer, Esther; Kawahara, Atsuo; Vassallo, Grace; Stivaros, Stavros M.; Bjursell, Magnus K.; Stranneheim, Henrik; Tigerschiöld, Stephanie; Persson, Bengt; Bangash, Iftikhar; Das, Krishna; Hughes, Deborah; Lesko, Nicole; Lundeberg, Joakim; Scott, Rod C.; Poduri, Annapurna; Scheffer, Ingrid E.; Smith, Holly; Gissen, Paul; Schorge, Stephanie; Reith, Maarten E. A.; Topf, Maya; Kullmann, Dimitri M.; Harvey, Robert J.; Wedell, Anna; Kurian, Manju A.

    2015-01-01

    The potassium-chloride co-transporter KCC2, encoded by SLC12A5, plays a fundamental role in fast synaptic inhibition by maintaining a hyperpolarizing gradient for chloride ions. KCC2 dysfunction has been implicated in human epilepsy, but to date, no monogenic KCC2-related epilepsy disorders have been described. Here we show recessive loss-of-function SLC12A5 mutations in patients with a severe infantile-onset pharmacoresistant epilepsy syndrome, epilepsy of infancy with migrating focal seizures (EIMFS). Decreased KCC2 surface expression, reduced protein glycosylation and impaired chloride extrusion contribute to loss of KCC2 activity, thereby impairing normal synaptic inhibition and promoting neuronal excitability in this early-onset epileptic encephalopathy. PMID:26333769

  7. Inhibition of SLC1A5 sensitizes colorectal cancer to cetuximab.

    Science.gov (United States)

    Ma, Huanrong; Wu, Zhenzhen; Peng, Jianjun; Li, Yang; Huang, Hongxiang; Liao, Yi; Zhou, Minyu; Sun, Li; Huang, Na; Shi, Min; Bin, Jianping; Liao, Yulin; Rao, Jinjun; Wang, Lin; Liao, Wangjun

    2018-06-15

    Cetuximab resistance is a key barrier in treating metastatic colorectal cancer (mCRC). Targeting of metabolic resources import could resensitize drug-resistant cancer cells to anticancer treatments. Here we showed that the expression of the glutamine transporter solute carrier 1 family member 5 (SLC1A5) in clinical CRC samples of patients resisted to cetuximab was significantly higher than in those of patients responded to cetuximab. Inhibition of SLC1A5 by shRNA-mediated gene silencing or pharmacological inhibitor significantly suppressed the growth of CRC. Moreover, inhibition of SLC1A5 significantly enhanced the inhibitory efficacy of cetuximab on CRC proliferation both in vitro and in vivo. Mechanistically, SLC1A5 inhibition facilitated EGFR degradation through the ubiquitin-proteasome pathway, and decreased the expression of nuclear EGFR, both of which might have contribution to the improved response to cetuximab. This study provides the metabolic molecule SLC1A5 as a potential therapeutic target to increase the efficacy of cetuximab on CRC. © 2018 UICC.

  8. Decreased miR-106a inhibits glioma cell glucose uptake and proliferation by targeting SLC2A3 in GBM.

    Science.gov (United States)

    Dai, Dong-Wei; Lu, Qiong; Wang, Lai-Xing; Zhao, Wen-Yuan; Cao, Yi-Qun; Li, Ya-Nan; Han, Guo-Sheng; Liu, Jian-Min; Yue, Zhi-Jian

    2013-10-14

    MiR-106a is frequently down-regulated in various types of human cancer. However the underlying mechanism of miR-106a involved in glioma remains elusive. The association of miR-106a with glioma grade and patient survival was analyzed. The biological function and target of miR-106a were determined by bioinformatic analysis and cell experiments (Western blot, luciferase reporter, cell cycle, ntracellular ATP production and glucose uptake assay). Finally, rescue expression of its target SLC2A3 was used to test the role of SLC2A3 in miR-106a-mediated cell glycolysis and proliferation. Here we showed that miR-106a was a tumor suppressor miRNA was involved in GBM cell glucose uptake and proliferation. Decreased miR-106a in GBM tissues and conferred a poor survival of GBM patients. SLC2A3 was identified as a core target of miR-106a in GBM cells. Inhibition of SLC2A3 by miR-106a attenuated cell proliferation and inhibited glucose uptake. In addition, for each biological process we identified ontology-associated transcripts that significantly correlated with SLC2A3 expression. Finally, the expression of SLC2A3 largely abrogated miR-106a-mediated cell proliferation and glucose uptake in GBM cells. Taken together, miR-106a and SLC2A3 could be potential therapeutic approaches for GBM.

  9. SLC injector simulation and tuning for high charge transport

    International Nuclear Information System (INIS)

    Yeremian, A.D.; Miller, R.H.; Clendenin, J.E.; Early, R.A.; Ross, M.C.; Turner, J.L.; Wang, J.W.

    1992-08-01

    We have simulated the SLC injector from the thermionic gun through the first accelerating section and used the resulting parameters to tune the injector for optimum performance and high charge transport. Simulations are conducted using PARMELA, a three-dimensional ray-trace code with a two-dimensional space-charge model. The magnetic field profile due to the existing magnetic optics is calculated using POISSON, while SUPERFISH is used to calculate the space harmonics of the various bunchers and the accelerator cavities. The initial beam conditions in the PARMELA code are derived from the EGUN model of the gun. The resulting injector parameters from the PARMELA simulation are used to prescribe experimental settings of the injector components. The experimental results are in agreement with the results of the integrated injector model

  10. Solute Carrier Family 26 Member a2 (slc26a2 Regulates Otic Development and Hair Cell Survival in Zebrafish.

    Directory of Open Access Journals (Sweden)

    Fei Liu

    Full Text Available Hearing loss is one of the most prevalent human birth defects. Genetic factors contribute to the pathogenesis of deafness. It is estimated that one-third of deafness genes have already been identified. The current work is an attempt to find novel genes relevant to hearing loss using guilt-by-profiling and guilt-by-association bioinformatics analyses of approximately 80 known non-syndromic hereditary hearing loss (NSHL genes. Among the 300 newly identified candidate deafness genes, slc26a2 were selected for functional studies in zebrafish. The slc26a2 gene was knocked down using an antisense morpholino (MO, and significant defects were observed in otolith patterns, semicircular canal morphology, and lateral neuromast distributions in morphants. Loss-of-function defects are caused primarily by apoptosis, and morphants are insensitive to sound stimulation and imbalanced swimming behaviours. Morphant defects were found to be partially rescued by co-injection of human SLC26A2 mRNA. All the results suggest that bioinformatics is capable of predicting new deafness genes and this showed slc26a2 is to be a critical otic gene whose dysfunction may induce hearing impairment.

  11. Topology mapping to characterize cyanobacterial bicarbonate transporters: BicA (SulP/SLC26 family) and SbtA.

    Science.gov (United States)

    Price, G Dean; Howitt, Susan M

    2014-09-01

    This mini-review addresses advances in understanding the transmembrane topologies of two unrelated, single-subunit bicarbonate transporters from cyanobacteria, namely BicA and SbtA. BicA is a Na(+)-dependent bicarbonate transporter that belongs to the SulP/SLC26 family that is widespread in both eukaryotes and prokaryotes. Topology mapping of BicA via the phoA/lacZ fusion reporter method identified 12 transmembrane helices with an unresolved hydrophobic region just beyond helix 8. Re-interpreting this data in the light of a recent topology study on rat prestin leads to a consensus topology of 14 transmembrane domains with a 7+7 inverted repeat structure. SbtA is also a Na(+)-dependent bicarbonate transporter, but of considerably higher affinity (Km 2-5 μM versus >100 μM for BicA). Whilst SbtA is widespread in cyanobacteria and a few bacteria, it appears to be absent from eukaryotes. Topology mapping of SbtA via the phoA/lacZ fusion reporter method identified 10 transmembrane helices. The topology consists of a 5+5 inverted repeat, with the two repeats separated by a large intracellular loop. The unusual location of the N and C-termini outside the cell raises the possibility that SbtA forms a novel fold, not so far identified by structural and topological studies on transport proteins.

  12. SLC polarized beam source electron optics design

    International Nuclear Information System (INIS)

    Eppley, K.R.; Lavine, T.L.; Early, R.A.; Herrmannsfeldt, W.B.; Miller, R.H.; Schultz, D.C.; Spencer, C.M.; Yeremian, A.D.

    1991-05-01

    This paper describes the design of the beam-line from the polarized electron gun to the linac injector in the Stanford Linear Collider (SLC). The polarized electron source is a GaAs photocathode, requiring 10 -11 -Torr-range pressure for adequate quantum efficiency and longevity. The photocathode is illuminated by 3-nsec-long laser pulses. The quality of the optics for the 160-kV beam is crucial since electron-stimulated gas desorption from beam loss in excess of 0.1% of the 20-nC pulses may poison the photocathode. Our design for the transport line consists of a differential pumping region isolated by a pair of valves. Focusing is provided by a pair of Helmholtz coils and by several iron-encased solenoidal lenses. Our optics design is based on beam transport simulations using 2 1/2-D particle-in-cell codes to model the gun and to solve the fully-relativistic time-dependent equations of motion in three dimensions for electrons in the presence of azimuthally symmetric electromagnetic fields. 6 refs., 6 figs

  13. In silico analysis of consequences of non-synonymous SNPs of Slc11a2 gene in Indian bovines

    Directory of Open Access Journals (Sweden)

    Shreya M. Patel

    2015-09-01

    Full Text Available The aim of our study was to analyze the consequences of non-synonymous SNPs in Slc11a2 gene using bioinformatic tools. There is a current need of efficient bioinformatic tools for in-depth analysis of data generated by the next generation sequencing technologies. SNPs are known to play an imperative role in understanding the genetic basis of many genetic diseases. Slc11a2 is one of the major metal transporter families in mammals and plays a critical role in host defenses. In this study, we performed a comprehensive analysis of the impact of all non-synonymous SNPs in this gene using multiple tools like SIFT, PROVEAN, I-Mutant and PANTHER. Among the total 124 SNPs obtained from amplicon sequencing of Slc11a2 gene by Ion Torrent PGM involving 10 individuals of Gir cattle and Murrah buffalo each, we found 22 non-synonymous. Comparing the prediction of these 4 methods, 5 nsSNPs (G369R, Y374C, A377V, Q385H and N492S were identified as deleterious. In addition, while tested out for polar interactions with other amino acids in the protein, from above 5, Y374C, Q385H and N492S showed a change in interaction pattern and further confirmed by an increase in total energy after energy minimizations in case of mutant protein compared to the native.

  14. SLC4A11 Prevents Osmotic Imbalance Leading to Corneal Endothelial Dystrophy, Deafness, and Polyuria*

    Science.gov (United States)

    Gröger, Nicole; Fröhlich, Henning; Maier, Hannes; Olbrich, Andrea; Kostin, Sawa; Braun, Thomas; Boettger, Thomas

    2010-01-01

    Maintenance of ion concentration gradients is essential for the function of many organs, including the kidney, the cornea, and the inner ear. Ion concentrations and fluid content in the cornea are regulated by endothelial cells that separate the collagenous avascular corneal stroma from the anterior eye chamber. Failure to maintain correct ion concentrations leads to swelling and destruction of the cornea. In the inner ear, the stria vascularis is responsible for generating proper ion concentrations in the endolymph, which is essential for hearing. Mutations of SLC4A11 in humans lead to syndromes associated with corneal dystrophy and perceptive deafness. The molecular mechanisms underlying these symptoms are poorly understood, impeding therapeutic interventions. The ion transporter SLC4A11 mediates sodium-dependent transport of borate as well as flux of sodium and hydroxyl ions in vitro. Here, we show that SLC4A11 is expressed in the endothelial cells of the cornea where it prevents severe morphological changes of the cornea caused by increased sodium chloride concentrations in the stroma. In the inner ear, SLC4A11 is located in fibrocytes underlying the stria vascularis. Loss of SLC4A11 leads to morphological changes in the fibrocytes and deafness. We demonstrate that SLC4A11 is essential for the generation of the endocochlear potential but not for regulation of potassium concentrations in the endolymph. In the kidney, SLC4A11 is expressed in the thin descending limb of Henle loop. SLC4A11 is essential for urinary concentration, suggesting that SLC4A11 participates in the countercurrent multiplication that concentrates urine in the kidney medulla. PMID:20185830

  15. Analysis of metabolism of 6FDG: a PET glucose transport tracer

    Energy Technology Data Exchange (ETDEWEB)

    Muzic, Raymond F., E-mail: raymond.muzic@case.edu [Department of Radiology, Case Western Reserve University, Cleveland, OH 44106 (United States); Department of Biomedical Engineering, Case Western Reserve University, Cleveland, OH 44106 (United States); Chandramouli, Visvanathan [Department of Radiology, Case Western Reserve University, Cleveland, OH 44106 (United States); Huang, Hsuan-Ming [Department of Biomedical Engineering, Case Western Reserve University, Cleveland, OH 44106 (United States); Wu Chunying; Wang Yanming [Department of Radiology, Case Western Reserve University, Cleveland, OH 44106 (United States); Ismail-Beigi, Faramarz [Department of Medicine, Case Western Reserve University, Cleveland, OH 44106 (United States)

    2011-07-15

    Introduction: We are developing {sup 18}F-labeled 6-fluoro-6-deoxy-D-glucose ([{sup 18}F]6FDG) as a tracer of glucose transport. As part of this process it is important to characterize and quantify putative metabolites. In contrast to the ubiquitous positron emission tomography (PET) tracer {sup 18}F-labeled 2-fluoro-2-deoxy-D-glucose ([{sup 18}F]2FDG) which is phosphorylated and trapped intracellularly, the substitution of fluorine for a hydroxyl group at carbon-6 in [{sup 18}F]6FDG should prevent its phosphorylation. Consequently, [{sup 18}F]6FDG has the potential to trace the transport step of glucose metabolism without the confounding effects of phosphorylation and subsequent steps of metabolism. Herein the focus is to determine whether, and the degree to which, [{sup 18}F]6FDG remains unchanged following intravenous injection. Methods: Biodistribution studies were performed using 6FDG labeled with {sup 18}F or with the longer-lived radionuclides {sup 3}H and {sup 14}C. Tissues were harvested at 1, 6, and 24 h following intravenous administration and radioactivity was extracted from the tissues and analyzed using a combination of ion exchange columns, high-performance liquid chromatography, and chemical reactivity. Results: At the 1 h time-point, the vast majority of radioactivity in the liver, brain, heart, skeletal muscle, and blood was identified as 6FDG. At the 6-h and 24-h time points, there was evidence of a minor amount of radioactive material that appeared to be 6-fluoro-6-deoxy-D-sorbitol and possibly 6-fluoro-6-deoxy-D-gluconic acid. Conclusion: On the time scale typical of PET imaging studies radioactive metabolites of [{sup 18}F]6FDG are negligible.

  16. SLC-2000: A luminosity upgrade for the SLC

    International Nuclear Information System (INIS)

    Breidenbach, M.; Decker, F.-J.; Helm, R.; Napoly, O.; Phinney, N.; Raimondi, P.; Raubenheimer, T.O.; Siemann, R.; Zimmermann, F.; Hertzbach, S.

    1996-01-01

    We discuss a possible upgrade to the Stanford Linear Collider (SLC), whose objective is to increase the SLC luminosity by at least a factor 7, to an average Z production rate of more than 35,000 per week. The centerpiece of the upgrade is the installation of a new superconducting final doublet with a field gradient of 240 T/m, which will be placed at a distance of only 70 cm from the interaction point. In addition, several bending magnets in each final focus will be lengthened and two octupole correctors are added. A complementary upgrade of damping rings and bunch compressors will allow optimum use of the modified final focus and can deliver, or exceed, the targeted luminosity. The proposed upgrade will place the SLC physics program in a very competitive position, and will also enable it to pursue its pioneering role as the first and only linear collider. (author)

  17. Molecular Mechanisms of Urea Transport in Health and Disease

    Science.gov (United States)

    Klein, Janet D.; Blount, Mitsi A.; Sands, Jeff M.

    2012-01-01

    In the late 1980s, urea permeability measurements produced values that could not be explained by paracellular transport or lipid phase diffusion. The existence of urea transport proteins were thus proposed and less than a decade later, the first urea transporter was cloned. The SLC14A family of urea transporters has two major subgroups, designated SLC14A1 (or UT-B) and Slc14A2 (or UT-A). UT-B and UT-A gene products are glycoproteins located in various extra-renal tissues however, a majority of the resulting isoforms are found in the kidney. The UT-B (Slc14A1) urea transporter was originally isolated from erythrocytes and two isoforms have been reported. In kidney, UT-B is located primarily in the descending vasa recta. The UT-A (Slc14A2) urea transporter yields 6 distinct isoforms, of which 3 are found chiefly in the kidney medulla. UT-A1 and UT-A3 are found in the inner medullary collecting duct (IMCD), while UT-A2 is located in the thin descending limb. These transporters are crucial to the kidney’s ability to concentrate urine. The regulation of urea transporter activity in the IMCD involves acute modification through phosphorylation and subsequent movement to the plasma membrane. UT-A1 and UT-A3 accumulate in the plasma membrane in response to stimulation by vasopressin or hypertonicity. Long term regulation of the urea transporters in the IMCD involves altering protein abundance in response to changes in hydration status, low protein diets, or adrenal steroids. Urea transporters have been studied using animal models of disease including diabetes mellitus, lithium intoxication, hypertension, and nephrotoxic drug responses. Exciting new genetically engineered mouse models are being developed to study these transporters. PMID:23007461

  18. NBCe1 (SLC4A4) a potential pH regulator in enamel organ cells during enamel development in the mouse

    NARCIS (Netherlands)

    Jalali, R.; Guo, J.; Zandieh-Doulabi, B.; Bervoets, T.J.M.; Paine, M.L.; Boron, W.F.; Parker, M.D.; Bijvelds, M.J.C.; Medina, J.F.; DenBesten, P.K.; Bronckers, A.L.J.J.

    2014-01-01

    During the formation of dental enamel, maturation-stage ameloblasts express ion-transporting transmembrane proteins. The SLC4 family of ion-transporters regulates intra- and extracellular pH in eukaryotic cells by cotransporting HCO3 − with Na+. Mutation in SLC4A4 (coding for the sodium-bicarbonate

  19. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    Science.gov (United States)

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  20. Intronic deletions in the SLC34A3 gene: A cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria

    OpenAIRE

    Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.

    2013-01-01

    Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine cal...

  1. Transistor properties of exfoliated single crystals of 2 H -Mo (Se1-xT ex ) 2(0 ≤x ≤1 )

    Science.gov (United States)

    Uesugi, Eri; Miao, Xiao; Ota, Hiromi; Goto, Hidenori; Kubozono, Yoshihiro

    2017-06-01

    Field-effect transistors (FETs) were fabricated using exfoliated single crystals of Mo (Se1-xT ex) 2 with an x range of 0 to 1, and the transistor properties fully investigated at 295 K in four-terminal measurement mode. The chemical composition and crystal structure of exfoliated single crystals were identified by energy-dispersive x-ray spectroscopy (EDX), single-crystal x-ray diffraction, and Raman scattering, suggesting the 2 H - structure in all Mo (Se1-xT ex) 2 . The lattice constants of a and c increase monotonically with increasing x , indicating the substitution of Se by Te. When x 0.4 . In contrast, the polarity of a thick single-crystal Mo (Se1-xT ex) 2 FET did not change despite an increase in x . The change of polarity in a thin single-crystal FET was well explained by the variation of electronic structure. The absence of such change in the thick single-crystal FET can be reasonably interpreted based on the large bulk conduction due to naturally accumulated electrons. The μ value in the thin single-crystal FET showed a parabolic variation, with a minimum μ at around x =0.4 , which probably originates from the disorder of the single crystal caused by the partial replacement of Se by Te, i.e., a disorder that may be due to ionic size difference of Se and Te.

  2. Bicarbonate Transport During Enamel Maturation.

    Science.gov (United States)

    Yin, Kaifeng; Paine, Michael L

    2017-11-01

    Amelogenesis (tooth enamel formation) is a biomineralization process consisting primarily of two stages (secretory stage and maturation stage) with unique features. During the secretory stage, the inner epithelium of the enamel organ (i.e., the ameloblast cells) synthesizes and secretes enamel matrix proteins (EMPs) into the enamel space. The protein-rich enamel matrix forms a highly organized architecture in a pH-neutral microenvironment. As amelogenesis transitions to maturation stage, EMPs are degraded and internalized by ameloblasts through endosomal-lysosomal pathways. Enamel crystallite formation is initiated early in the secretory stage, however, during maturation stage the more rapid deposition of calcium and phosphate into the enamel space results in a rapid expansion of crystallite length and mineral volume. During maturation-stage amelogenesis, the pH value of enamel varies considerably from slightly above neutral to acidic. Extracellular acid-base balance during enamel maturation is tightly controlled by ameloblast-mediated regulatory networks, which include significant synthesis and movement of bicarbonate ions from both the enamel papillary layer cells and ameloblasts. In this review we summarize the carbonic anhydrases and the carbonate transporters/exchangers involved in pH regulation in maturation-stage amelogenesis. Proteins that have been shown to be instrumental in this process include CA2, CA6, CFTR, AE2, NBCe1, SLC26A1/SAT1, SLC26A3/DRA, SLC26A4/PDS, SLC26A6/PAT1, and SLC26A7/SUT2. In addition, we discuss the association of miRNA regulation with bicarbonate transport in tooth enamel formation.

  3. Dicty_cDB: SLC461 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu

  4. Sialin (SLC17A5) functions as a nitrate transporter in the plasma membrane

    Science.gov (United States)

    Qin, Lizheng; Liu, Xibao; Sun, Qifei; Fan, Zhipeng; Xia, Dengsheng; Ding, Gang; Ong, Hwei Ling; Adams, David; Gahl, William A.; Zheng, Changyu; Qi, Senrong; Jin, Luyuan; Zhang, Chunmei; Gu, Liankun; He, Junqi; Deng, Dajun; Ambudkar, Indu S.; Wang, Songlin

    2012-01-01

    In vivo recycling of nitrate (NO3−) and nitrite (NO2−) is an important alternative pathway for the generation of nitric oxide (NO) and maintenance of systemic nitrate–nitrite–NO balance. More than 25% of the circulating NO3− is actively removed and secreted by salivary glands. Oral commensal bacteria convert salivary NO3− to NO2−, which enters circulation and leads to NO generation. The transporters for NO3− in salivary glands have not yet been identified. Here we report that sialin (SLC17A5), mutations in which cause Salla disease and infantile sialic acid storage disorder (ISSD), functions as an electrogenic 2NO3−/H+ cotransporter in the plasma membrane of salivary gland acinar cells. We have identified an extracellular pH-dependent anion current that is carried by NO3− or sialic acid (SA), but not by Br−, and is accompanied by intracellular acidification. Both responses were reduced by knockdown of sialin expression and increased by the plasma membrane-targeted sialin mutant (L22A-L23A). Fibroblasts from patients with ISSD displayed reduced SA- and NO3−-induced currents compared with healthy controls. Furthermore, expression of disease-associated sialin mutants in fibroblasts and salivary gland cells suppressed the H+-dependent NO3− conductance. Importantly, adenovirus-dependent expression of the sialinH183R mutant in vivo in pig salivary glands decreased NO3− secretion in saliva after intake of a NO3−-rich diet. Taken together, these data demonstrate that sialin mediates nitrate influx into salivary gland and other cell types. We suggest that the 2NO3−/H+ transport function of sialin in salivary glands can contribute significantly to clearance of serum nitrate, as well as nitrate recycling and physiological nitrite-NO homeostasis. PMID:22778404

  5. Deletion of the betaine-GABA transporter (BGT1; slc6a12) gene does not affect seizure thresholds of adult mice

    DEFF Research Database (Denmark)

    Lehre, A C; Rowley, N M; Zhou, Y

    2011-01-01

    of the GAT1 by the clinically available anti-epileptic drug tiagabine has been an effective strategy for the treatment of some patients with partial seizures. Recently, the investigational drug EF1502, which inhibits both GAT1 and BGT1, was found to exert an anti-convulsant action synergistic...... to that of tiagabine, supposedly due to inhibition of BGT1. The present study addresses the role of BGT1 in seizure control and the effect of EF1502 by developing and exploring a new mouse line lacking exons 3-5 of the BGT1 (slc6a12) gene. The deletion of this sequence abolishes the expression of BGT1 mRNA. However......, homozygous BGT1-deficient mice have normal development and show seizure susceptibility indistinguishable from that in wild-type mice in a variety of seizure threshold models including: corneal kindling, the minimal clonic and minimal tonic extension seizure threshold tests, the 6Hz seizure threshold test...

  6. IP EUROTRANS: from MYRRHA towards XT-ADS

    International Nuclear Information System (INIS)

    Debruyn, D.

    2006-01-01

    The integrated project (IP) EUROTRANS (EUROpean Research Programme for the TRANSmutation of High-Level Nuclear Waste in an Accelerator Driven System) has been launched in the Euratom Sixth Framework Programme (FP6) and has officially started in April 2005 for a duration of four years. This project is the logical continuation of several activities worked out within the previous Framework Programme (FP5), namely the ADOPT network, the FUETRA, BASTRA and TESTRA clusters and the PDS-XADS project. The project is divided into five main sub-projects or domains (DMs). SCK-CEN coordinates the DM1 DESIGN described hereafter. The aim of DM2 ECATS is to provide validated experimental input from relevant coupling experiments of an accelerator, a spallation target and a sub-critical blanket, while the development and demonstration of the associated technologies is devoted to the remaining DMs, DM3 AFTRA (fuels), DM4 DEMETRA (heavy liquid metal technologies) and DM5 NUDATRA (nuclear data). The objective of the DM1 DESIGN of IP EUROTRANS is to proceed by a significant jump towards the demonstration of the industrial transmutation through the ADS route. The strategy of European Transmutation Demonstration (ETD) is carried out with two interconnected activities: (1) the first activity is to develop an advanced design file leading to a short-term (i.e. realisation within the next 10 years) experimental demonstration of the technical feasibility of Transmutation (at 50 to 100 MWth) in an Accelerator Driven System (XT-ADS). Liquid lead-bismuth eutectic (LBE) is used as primary coolant and material for the spallation target and the core is designed with standard MOX fuel; (2) the second activity is to carry out in parallel a reference conceptual design for a modular EFIT (European Facility for Industrial Transmutation) machine with a power of up to several 100 MWth, as a basis for a cost estimate and safety studies for an ADS-based transmutation system. For the EFIT, liquid lead is used

  7. SLC6A1 gene involvement in susceptibility to attention-deficit/hyperactivity disorder: A case-control study and gene-environment interaction.

    Science.gov (United States)

    Yuan, Fang-Fen; Gu, Xue; Huang, Xin; Zhong, Yan; Wu, Jing

    2017-07-03

    Attention-deficit/hyperactivity disorder (ADHD) is an early onset childhood neurodevelopmental disorder with an estimated heritability of approximately 76%. We conducted a case-control study to explore the role of the SLC6A1 gene in ADHD. The genotypes of eight variants were determined using Sequenom MassARRAY technology. The participants in the study were 302 children with ADHD and 411 controls. ADHD symptoms were assessed using the Conners Parent Symptom Questionnaire. In our study, rs2944366 was consistently shown to be associated with the ADHD risk in the dominant model (odds ratio [OR]=0.554, 95% confidence interval [CI]=0.404-0.760), and nominally associated with Hyperactive index score (P=0.027). In addition, rs1170695 has been found to be associated with the ADHD risk in the addictive model (OR=1.457, 95%CI=1.173-1.809), while rs9990174 was associated with the Hyperactive index score (P=0.010). Intriguingly, gene-environmental interactions analysis consistently revealed the potential interactions of rs1170695 with blood lead (P mul =0.044) to modify the ADHD risk. Expression quantitative trait loci analysis suggested that these positive single nucleotide polymorphisms (SNPs) may mediate SLC6A1 gene expression. Therefore, our results suggest that selected SLC6A1 gene variants may have a significant effect on the ADHD risk. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Organic solute carrier 22 (SLC22 family: Potential for interactions with food, herbal/dietary supplements, endogenous compounds, and drugs

    Directory of Open Access Journals (Sweden)

    Raymond E. Lai

    2018-04-01

    Full Text Available Many drugs, hormones, components of herbal medicines, environmental pesticides and toxins are Solute Carrier family 22 (SLC22 substrates. The last twenty years has seen great progress in determining SLC22 tissue expression profiles, membrane localization, energetics, substrate profiles and biopharmaceutical significance. However, much still remains to be answered in terms of SLC22 family member's roles in ‘normal’ physiology as compared to pathophysiological states, as well as in drug interactions that impact pharmacokinetics, efficacy and toxicity. This review begins with a brief synopsis of SLC22 family discovery, function and tissue expression. Subsequent sections provide examples establishing a role for SLC22 transporters in food-drug, herbal supplement-drug, endogenous substrate-drug and drug–drug interactions. Keywords: Hepatic transport, Nephrotoxicity, Organic anion transporter, Organic cation transporter, Renal transport

  9. Radiosynthesis of 6’-Deoxy-6’[18F]Fluorosucrose via Automated Synthesis and Its Utility to Study In Vivo Sucrose Transport in Maize (Zea mays) Leaves

    Science.gov (United States)

    Ying, Weijiang; Gaddam, Vikram; Harmata, Michael; Robertson, J. David; Swyers, Michael; Jurisson, Silvia S.

    2015-01-01

    Sugars produced from photosynthesis in leaves are transported through the phloem tissues within veins and delivered to non-photosynthetic organs, such as roots, stems, flowers, and seeds, to support their growth and/or storage of carbohydrates. However, because the phloem is located internally within the veins, it is difficult to access and to study the dynamics of sugar transport. Radioactive tracers have been extensively used to study vascular transport in plants and have provided great insights into transport dynamics. To better study sucrose partitioning in vivo, a novel radioactive analog of sucrose was synthesized through a completely chemical synthesis route by substituting fluorine-18 (half-life 110 min) at the 6’ position to generate 6’-deoxy-6’[18F]fluorosucrose (18FS). This radiotracer was then used to compare sucrose transport between wild-type maize plants and mutant plants lacking the Sucrose transporter1 (Sut1) gene, which has been shown to function in sucrose phloem loading. Our results demonstrate that 18FS is transported in vivo, with the wild-type plants showing a greater rate of transport down the leaf blade than the sut1 mutant plants. A similar transport pattern was also observed for universally labeled [U-14C]sucrose ([U-14C]suc). Our findings support the proposed sucrose phloem loading function of the Sut1 gene in maize, and additionally demonstrate that the 18FS analog is a valuable, new tool that offers imaging advantages over [U-14C]suc for studying phloem transport in plants. PMID:26024520

  10. Dicty_cDB: SLC489 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4

  11. Developmental expression of solute carrier family 26A member 4 (SLC26A4/pendrin) during amelogenesis in developing rodent teeth.

    Science.gov (United States)

    Bronckers, Antonius L J J; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela

    2011-12-01

    Ameloblasts need to regulate pH during the formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine, and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear, and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues, including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts, and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as a pH regulator. SLC26A4 does not appear to be critical for ameloblast function and is probably compensated by other pH regulators. © 2011 Eur J Oral Sci.

  12. Essential roles of aspartate aminotransferase 1 and vesicular glutamate transporters in β-cell glutamate signaling for incretin-induced insulin secretion.

    Directory of Open Access Journals (Sweden)

    Naoya Murao

    Full Text Available Incretins (GLP-1 and GIP potentiate insulin secretion through cAMP signaling in pancreatic β-cells in a glucose-dependent manner. We recently proposed a mechanistic model of incretin-induced insulin secretion (IIIS that requires two critical processes: 1 generation of cytosolic glutamate through the malate-aspartate (MA shuttle in glucose metabolism and 2 glutamate transport into insulin granules by cAMP signaling to promote insulin granule exocytosis. To directly prove the model, we have established and characterized CRISPR/Cas9-engineered clonal mouse β-cell lines deficient for the genes critical in these two processes: aspartate aminotransferase 1 (AST1, gene symbol Got1, a key enzyme in the MA shuttle, which generates cytosolic glutamate, and the vesicular glutamate transporters (VGLUT1, VGLUT2, and VGLUT3, gene symbol Slc17a7, Slc17a6, and Slc17a8, respectively, which participate in glutamate transport into secretory vesicles. Got1 knockout (KO β-cell lines were defective in cytosolic glutamate production from glucose and showed impaired IIIS. Unexpectedly, different from the previous finding that global Slc17a7 KO mice exhibited impaired IIIS from pancreatic islets, β-cell specific Slc17a7 KO mice showed no significant impairment in IIIS, as assessed by pancreas perfusion experiment. Single Slc17a7 KO β-cell lines also retained IIIS, probably due to compensatory upregulation of Slc17a6. Interestingly, triple KO of Slc17a7, Slc17a6, and Slc17a8 diminished IIIS, which was rescued by exogenously introduced wild-type Slc17a7 or Slc17a6 genes. The present study provides direct evidence for the essential roles of AST1 and VGLUTs in β-cell glutamate signaling for IIIS and also shows the usefulness of the CRISPR/Cas9 system for studying β-cells by simultaneous disruption of multiple genes.

  13. Comparison between the SAPIEN S3 and the SAPIEN XT transcatheter heart valves: A single-center experience.

    Science.gov (United States)

    Sawaya, Fadi J; Spaziano, Marco; Lefèvre, Thierry; Roy, Andrew; Garot, Phillippe; Hovasse, Thomas; Neylon, Antoinette; Benamer, Hakim; Romano, Mauro; Unterseeh, Thierry; Morice, Marie-Claude; Chevalier, Bernard

    2016-12-26

    To investigate the clinical outcomes of transcatheter aortic valve implantation (TAVI) with the SAPIEN 3 transcatheter heart valve (S3-THV) vs the SAPIEN XT valve (XT-THV). We retrospectively analyzed 507 patients that underwent TAVI with the XT-THV and 283 patients that received the S3-THV at our institution between March 2010 and December 2015. Thirty-day mortality (3.5% vs 8.7%; OR = 0.44, P = 0.21) and 1-year mortality (25.7% vs 20.1%, P = 0.55) were similar in the S3-THV and the XT-THV groups. The rates of both major vascular complication and paravalvular regurgitation (PVR) > 1 were almost 4 times lower in the S3-THV group than the XT-THV group (major vascular complication: 2.8% vs 9.9%, P 1: 2.4% vs 9.7%, P < 0.0001). However, the rate of new pacemaker implantation was almost twice as high in the S3-THV group (17.3% vs 9.8%, P = 0.03). In the S3 group, independent predictors of new permanent pacemaker were pre-procedural RBBB (OR = 4.9; P = 0.001), pre-procedural PR duration (OR = 1.14, P = 0.05) and device lack of coaxiality (OR = 1.13; P = 0.05) during deployment. The S3-THV is associated to lower rates of major vascular complications and PVR but higher rates of new pacemaker compared to the XT-THV. Sub-optimal visualization of the S3-THV in relation to the aortic valvular complex during deployment is a predictor of new permanent pacemaker.

  14. Meta-analysis of the association of the SLC6A3 3'-UTR VNTR with cognition.

    Science.gov (United States)

    Ettinger, Ulrich; Merten, Natascha; Kambeitz, Joseph

    2016-01-01

    The gene coding for the dopamine transporter (DAT), SLC6A3, contains a 40-base pair variable number of tandem repeats (VNTR) polymorphism (rs28363170) in its 3' untranslated region. This VNTR has been associated with attention deficit hyperactivity disorder (ADHD) and has been investigated in relation to cognition and brain function. Here, we report the results of a comprehensive meta-analysis with meta-regression examining the association of the VNTR with different domains of cognition in healthy adults. We extracted data from 28 independent studies and carried out meta-analyses for associations with working memory (k=10 samples, N=1193 subjects), inhibition (k=8 samples, N=829 subjects), executive functions including inhibition (k=10 samples, N=984 subjects), attention (k=6 samples, N=742 subjects) and declarative long-term memory (k=5 samples, N=251 subjects). None of the investigated dimensions showed significant associations with the VNTR (all p>0.26). Meta-regression including year of publication, gender, age, ethnicity and percentage of 10R-homozygotes similarly did not attain significance. We conclude that there is no evidence that rs28363170 may be a significant predictor of cognitive function in healthy adults. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Transport mechanism and regulatory properties of the human amino acid transporter ASCT2 (SLC1A5).

    Science.gov (United States)

    Scalise, Mariafrancesca; Pochini, Lorena; Panni, Simona; Pingitore, Piero; Hedfalk, Kristina; Indiveri, Cesare

    2014-11-01

    The kinetic mechanism of the transport catalyzed by the human glutamine/neutral amino acid transporter hASCT2 over-expressed in P. pastoris was determined in proteoliposomes by pseudo-bi-substrate kinetic analysis of the Na(+)-glutamineex/glutaminein transport reaction. A random simultaneous mechanism resulted from the experimental analysis. Purified functional hASCT2 was chemically cross-linked to a stable dimeric form. The oligomeric structure correlated well with the kinetic mechanism of transport. Half-saturation constants (Km) of the transporter for the other substrates Ala, Ser, Asn and Thr were measured both on the external and internal side. External Km were much lower than the internal ones confirming the asymmetry of the transporter. The electric nature of the transport reaction was determined imposing a negative inside membrane potential generated by K(+) gradients in the presence of valinomycin. The transport reaction resulted to be electrogenic and the electrogenicity originated from external Na(+). Internal Na(+) exerted a stimulatory effect on the transport activity which could be explained by a regulatory, not a counter-transport, effect. Native and deglycosylated hASCT2 extracted from HeLa showed the same transport features demonstrating that the glycosyl moiety has no role in transport function. Both in vitro and in vivo interactions of hASCT2 with the scaffold protein PDZK1 were revealed.

  16. Flat beams in the SLC

    International Nuclear Information System (INIS)

    Adolphsen, C.; Barklow, T.; Burke, D.; Decker, F.J.; Emma, P.; Hildreth, M.; Himel, T.; Krejcik, P.; Limberg, T.; Minty, M.

    1993-01-01

    The Stanford Linear Collider was designed to operate with round beams; horizontal and vertical emittance made equal in the damping rings. The main motivation was to facilitate the optical matching through beam lines with strong coupling elements like the solenoid spin rotator magnets and the SLC arcs. Tests in 1992 showed that open-quote flat close-quote beams with a vertical to horizontal emittance ratio of around 1/10 can be successfully delivered to the end of the linac. Techniques developed to measure and control the coupling of the SLC arcs allow These beams to be transported to the Interaction Point (IP). Before flat beams could be used for collisions with polarized electrons, a new method of rotating the electron spin orientation with vertical arc orbit bumps had to be developed. Early in the 1993 run, the SLC was switched to open-quote flat close-quote beam operation. Within a short time the peak luminosity of the previous running cycle was reached and then surpassed. The average daily luminosity is now a factor of about two higher than the best achieved last year. In the following the authors present an overview of the problems encountered and their solutions for different parts of the SLC

  17. Acetylene–ammonia–18-crown-6 (1/2/1

    Directory of Open Access Journals (Sweden)

    Tobias Grassl

    2012-10-01

    Full Text Available The title compound, C2H2·C12H24O6·2NH3, was formed by co-crystallization of 18-crown-6 and acetylene in liquid ammonia. The 18-crown-6 molecule has threefold rotoinversion symmetry. The acteylene molecule lies on the threefold axis and the whole molecule is generated by an inversion center. The two ammonia molecules are also located on the threefold axis and are related by inversion symmetry. In the crystal, the ammonia molecules are located below and above the crown ether plane and are connected by intermolecular N—H...O hydrogen bonds. The acetylene molecules are additionally linked by weak C—H...N interactions into chains that propagate in the direction of the crystallographic c axis. The 18-crown-6 molecule [occupancy ratio 0.830 (4:0.170 (4] is disordered and was refined using a split model.

  18. OCD candidate gene SLC1A1/EAAT3 impacts basal ganglia-mediated activity and stereotypic behavior.

    Science.gov (United States)

    Zike, Isaac D; Chohan, Muhammad O; Kopelman, Jared M; Krasnow, Emily N; Flicker, Daniel; Nautiyal, Katherine M; Bubser, Michael; Kellendonk, Christoph; Jones, Carrie K; Stanwood, Gregg; Tanaka, Kenji Fransis; Moore, Holly; Ahmari, Susanne E; Veenstra-VanderWeele, Jeremy

    2017-05-30

    Obsessive-compulsive disorder (OCD) is a chronic, disabling condition with inadequate treatment options that leave most patients with substantial residual symptoms. Structural, neurochemical, and behavioral findings point to a significant role for basal ganglia circuits and for the glutamate system in OCD. Genetic linkage and association studies in OCD point to SLC1A1 , which encodes the neuronal glutamate/aspartate/cysteine transporter excitatory amino acid transporter 3 (EAAT3)/excitatory amino acid transporter 1 (EAAC1). However, no previous studies have investigated EAAT3 in basal ganglia circuits or in relation to OCD-related behavior. Here, we report a model of Slc1a1 loss based on an excisable STOP cassette that yields successful ablation of EAAT3 expression and function. Using amphetamine as a probe, we found that EAAT3 loss prevents expected increases in ( i ) locomotor activity, ( ii ) stereotypy, and ( iii ) immediate early gene induction in the dorsal striatum following amphetamine administration. Further, Slc1a1 -STOP mice showed diminished grooming in an SKF-38393 challenge experiment, a pharmacologic model of OCD-like grooming behavior. This reduced grooming is accompanied by reduced dopamine D 1 receptor binding in the dorsal striatum of Slc1a1 -STOP mice. Slc1a1 -STOP mice also exhibit reduced extracellular dopamine concentrations in the dorsal striatum both at baseline and following amphetamine challenge. Viral-mediated restoration of Slc1a1 /EAAT3 expression in the midbrain but not in the striatum results in partial rescue of amphetamine-induced locomotion and stereotypy in Slc1a1 -STOP mice, consistent with an impact of EAAT3 loss on presynaptic dopaminergic function. Collectively, these findings indicate that the most consistently associated OCD candidate gene impacts basal ganglia-dependent repetitive behaviors.

  19. Dicty_cDB: SLC442 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4

  20. Cation-Coupled Bicarbonate Transporters

    OpenAIRE

    Aalkjaer, Christian; Boedtkjer, Ebbe; Choi, Inyeong; Lee, Soojung

    2014-01-01

    Cation-coupled HCO3− transport was initially identified in the mid-1970s when pioneering studies showed that acid extrusion from cells is stimulated by CO2/HCO3− and associated with Na+ and Cl− movement. The first Na+-coupled bicarbonate transporter (NCBT) was expression-cloned in the late 1990s. There are currently five mammalian NCBTs in the SLC4-family: the electrogenic Na,HCO3-cotransporters NBCe1 and NBCe2 (SLC4A4 and SLC4A5 gene products); the electroneutral Na,HCO3-cotransporter NBCn1 ...

  1. Dicty_cDB: SLC441 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2

  2. mTORC1 Activator SLC38A9 Is Required to Efflux Essential Amino Acids from Lysosomes and Use Protein as a Nutrient.

    Science.gov (United States)

    Wyant, Gregory A; Abu-Remaileh, Monther; Wolfson, Rachel L; Chen, Walter W; Freinkman, Elizaveta; Danai, Laura V; Vander Heiden, Matthew G; Sabatini, David M

    2017-10-19

    The mTORC1 kinase is a master growth regulator that senses many environmental cues, including amino acids. Activation of mTORC1 by arginine requires SLC38A9, a poorly understood lysosomal membrane protein with homology to amino acid transporters. Here, we validate that SLC38A9 is an arginine sensor for the mTORC1 pathway, and we uncover an unexpectedly central role for SLC38A9 in amino acid homeostasis. SLC38A9 mediates the transport, in an arginine-regulated fashion, of many essential amino acids out of lysosomes, including leucine, which mTORC1 senses through the cytosolic Sestrin proteins. SLC38A9 is necessary for leucine generated via lysosomal proteolysis to exit lysosomes and activate mTORC1. Pancreatic cancer cells, which use macropinocytosed protein as a nutrient source, require SLC38A9 to form tumors. Thus, through SLC38A9, arginine serves as a lysosomal messenger that couples mTORC1 activation to the release from lysosomes of the essential amino acids needed to drive cell growth. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Dicty_cDB: SLC470 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4

  4. Three-dimensional structure of β-cell-specific zinc transporter, ZnT-8, predicted from the type 2 diabetes-associated gene variant SLC30A8 R325W

    Directory of Open Access Journals (Sweden)

    Weijers Rob NM

    2010-06-01

    Full Text Available Abstract Background We examined the effects of the R325W mutation on the three-dimensional (3D structure of the β-cell-specific Zn2+ (zinc transporter ZnT-8. Methods A model of the C-terminal domain of the human ZnT-8 protein was generated by homology modeling based on the known crystal structure of the Escherichia coli (E. coli zinc transporter YiiP at 3.8 Å resolution. Results The homodimer ZnT-8 protein structure exists as a Y-shaped architecture with Arg325 located at the ultimate bottom of this motif at approximately 13.5 Å from the transmembrane domain juncture. The C-terminal domain sequences of the human ZnT-8 protein and the E. coli zinc transporter YiiP share 12.3% identical and 39.5% homologous residues resulting in an overall homology of 51.8%. Validation statistics of the homology model showed a reasonable quality of the model. The C-terminal domain exhibited an αββαβ fold with Arg325 as the penultimate N-terminal residue of the α2-helix. The side chains of both Arg325 and Trp325 point away from the interface with the other monomer, whereas the ε-NH3+ group of Arg325 is predicted to form an ionic interaction with the β-COO- group of Asp326 as well as Asp295. An amino acid alignment of the β22 C-terminal loop domain revealed a variety of neutral amino acids at position 325 of different ZnT-8 proteins. Conclusions Our validated homology models predict that both Arg325 and Trp325, amino acids with a helix-forming behavior, and penultimate N-terminal residues in the α2-helix of the C-terminal domain, are shielded by the planar surface of the three cytoplasmic β-strands and hence unable to affect the sensing capacity of the C-terminal domain. Moreover, the amino acid residue at position 325 is too far removed from the docking and transporter parts of ZnT-8 to affect their local protein conformations. These data indicate that the inherited R325W abnormality in SLC30A8 may be tolerated and results in adequate zinc transfer

  5. Desktop Video: Multi-Media on the NeXT Computer.

    Science.gov (United States)

    Stammen, Ronald M.; Richardson, Jolene

    A new course, Independent Study Research and Writing via Telecommunications, is being developed by the Division of Independent Study (DIS) of the North Dakota Department of Public Instruction to teach telepublishing skills utilizing the NeXT telecommunicating (interpersonal computing) techniques, i.e., NeXT Mail. This multimedia electronic-mail…

  6. Possible association of norepinephrine transporter -3081(A/T polymorphism with methylphenidate response in attention deficit hyperactivity disorder

    Directory of Open Access Journals (Sweden)

    Shin Min-Sup

    2010-10-01

    Full Text Available Abstract Background Attention-deficit/hyperactivity disorder (ADHD is a heritable disorder characterized by symptoms of inattention and/or hyperactivity/impulsivity. Methylphenidate (MPH has been shown to block the norepinephrine transporter (NET, and genetic investigations have demonstrated that the norepinephrine transporter gene (SLC6A2 is associated with ADHD. The aims of this study were to examine the association of the SLC6A2 -3081(A/T and G1287A polymorphisms with MPH response in ADHD. Methods This study enrolled 112 children and adolescents with ADHD. A response criterion was defined based on the Clinical Global Impression-Improvement (CGI-I score, and the ADHD Rating Scale-IV (ARS score was also assessed at baseline and 8 weeks after MPH treatment. Results We found that the subjects who had the T allele as one of the alleles (A/T or T/T genotypes at the -3081(A/T polymorphism showed a better response to MPH treatment than those with the A/A genotype as measured by the CGI-I. We also found a trend towards a difference in the change of the total ARS scores and hyperactivity/impulsivity subscores between subjects with and without the T allele. No significant association was found between the genotypes of the SLC6A2 G1287A polymorphism and response to ADHD treatment. Conclusion Our findings provide evidence for the involvement of the -3081(A/T polymorphism of SLC6A2 in the modulation of the effectiveness of MPH treatment in ADHD.

  7. A Combined Study of SLC6A15 Gene Polymorphism and the Resting-State Functional Magnetic Resonance Imaging in First-Episode Drug-Naive Major Depressive Disorder.

    Science.gov (United States)

    Wang, Lijuan; Liu, Zhifen; Cao, Xiaohua; Li, Jianying; Zhang, Aixia; Sun, Ning; Yang, Chunxia; Zhang, Kerang

    2017-09-01

    The SLC6A15 gene has been identified as a novel candidate gene for major depressive disorder (MDD). However, the mechanism underlying the effects of how the SLC6A15 gene affects functional brain activity of patients with MDD remains unknown. In the present study, we investigated the effect of the SLC6A15 gene polymorphism, rs1545843, on resting-state brain function in MDD with the imaging genomic technology and the regional homogeneity (ReHo) method. Sixty-seven MDD patients and 44 healthy controls underwent functional magnetic resonance imaging scans and genotyping. The differences in ReHo between genotypes were initially tested using the student's t test. We then performed a 2 × 2 (genotypes × disease status) analysis of variance to identify the main effects of genotypes, disease status, and their interactions in MDD. MDD patients with A+ genotypes showed decreased ReHo in the medial cingulum compared with MDD patients with the GG genotype. This was in contrast to normal controls with A+ genotypes who showed increased ReHo in the posterior cingulum and the frontal, temporal, and parietal lobes and decreased ReHo in the left corpus callosum, compared with controls with the GG genotypes. The main effect of disease was found in the frontal, parietal, and temporal lobes. The main effect of genotypes was found in the left corpus callosum and the frontal lobe. There was no interaction between rs1545843 genotypes and disease status. We found that the left corpus callosum ReHo was positively correlated with total scores of the Hamilton Depression Scale (HAMD) (p = 0.021), so as was the left inferior parietal gyrus ReHo with cognitive disorder (p = 0.02). In addition, the right middle temporal gyrus had a negative correlation with retardation (p = 0.049). We observed an association between the SLC6A15 rs1545843 and resting-state brain function of the corpus callosum, cingulum and the frontal, parietal, and temporal lobes in MDD patients, which may be

  8. The common SLC30A8 Arg325Trp variant is associated with reduced first-phase insulin release in 846 non-diabetic offspring of type 2 diabetes patients--the EUGENE2 study

    DEFF Research Database (Denmark)

    Boesgaard, T W; Zilinskaite, J; Vänttinen, M

    2008-01-01

    AIMS/HYPOTHESIS: A recent genome-wide association study identified the SLC30A8 rs13266634 polymorphism encoding an Arg325Trp polymorphism in the zinc transporter protein member 8 (ZnT-8) to be associated with type 2 diabetes. Here, we investigate whether the polymorphism is related to altered ins...

  9. Regulatory domain or CpG site variation in SLC12A5, encoding the chloride transporter KCC2, in human autism and schizophrenia

    Directory of Open Access Journals (Sweden)

    Nancy D Merner

    2015-10-01

    Full Text Available Many encoded gene products responsible for neurodevelopmental disorders (NDs like autism spectrum disorders (ASD, schizophrenia (SCZ, intellectual disability (ID, and idiopathic generalized epilepsy (IGE converge on networks controlling synaptic function. An increase in KCC2 (SLC12A5 Cl- transporter activity drives the developmental GABA excitatory-inhibitory sequence, but the role of KCC2 in human NDs is essentially unknown. Here, we report two rare, non-synonymous (NS, functionally-impairing variants in the KCC2 C-terminal regulatory domain (CTRD in human ASD (R952H and R1049C and SCZ (R952H previously linked with IGE and familial febrile seizures, and another novel NS KCC2 variant in ASD (R1048W with highly-predicted pathogenicity. Exome data from 2517 simplex families in the ASD Simon Simplex Collection revealed significantly more KCC2 CTRD variants in ASD cases than controls, and interestingly, these were more often synonymous and predicted to disrupt or introduce a CpG site. Furthermore, full gene analysis showed ASD cases are more likely to contain rare KCC2 variants affecting CpG sites than controls. These data suggest genetically-encoded dysregulation of KCC2-dependent GABA signaling may contribute to multiple human NDs.

  10. A partial gene deletion of SLC45A2 causes oculocutaneous albinism in Doberman pinscher dogs.

    Directory of Open Access Journals (Sweden)

    Paige A Winkler

    Full Text Available The first white Doberman pinscher (WDP dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1 produce a detailed description of the ocular phenotype of WDPs, (2 objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3 determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs; cutaneous tumors were noted in 12/20 WDP (5 years of age: 8/8 and 1/20 SDPs (p<0.00001. Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968-77,067,051. This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model.

  11. Functional Testing of SLC26A4 Variants—Clinical and Molecular Analysis of a Cohort with Enlarged Vestibular Aqueduct from Austria

    Science.gov (United States)

    Bernardinelli, Emanuele; Nofziger, Charity; Patsch, Wolfgang; Rasp, Gerd; Paulmichl, Markus; Dossena, Silvia

    2018-01-01

    The prevalence and spectrum of sequence alterations in the SLC26A4 gene, which codes for the anion exchanger pendrin, are population-specific and account for at least 50% of cases of non-syndromic hearing loss associated with an enlarged vestibular aqueduct. A cohort of nineteen patients from Austria with hearing loss and a radiological alteration of the vestibular aqueduct underwent Sanger sequencing of SLC26A4 and GJB2, coding for connexin 26. The pathogenicity of sequence alterations detected was assessed by determining ion transport and molecular features of the corresponding SLC26A4 protein variants. In this group, four uncharacterized sequence alterations within the SLC26A4 coding region were found. Three of these lead to protein variants with abnormal functional and molecular features, while one should be considered with no pathogenic potential. Pathogenic SLC26A4 sequence alterations were only found in 12% of patients. SLC26A4 sequence alterations commonly found in other Caucasian populations were not detected. This survey represents the first study on the prevalence and spectrum of SLC26A4 sequence alterations in an Austrian cohort and further suggests that genetic testing should always be integrated with functional characterization and determination of the molecular features of protein variants in order to unequivocally identify or exclude a causal link between genotype and phenotype. PMID:29320412

  12. Cotransporting Ion is a Trigger for Cellular Endocytosis of Transporter-Targeting Nanoparticles: A Case Study of High-Efficiency SLC22A5 (OCTN2)-Mediated Carnitine-Conjugated Nanoparticles for Oral Delivery of Therapeutic Drugs.

    Science.gov (United States)

    Kou, Longfa; Yao, Qing; Sun, Mengchi; Wu, Chunnuan; Wang, Jia; Luo, Qiuhua; Wang, Gang; Du, Yuqian; Fu, Qiang; Wang, Jian; He, Zhonggui; Ganapathy, Vadivel; Sun, Jin

    2017-09-01

    OCTN2 (SLC22A5) is a Na + -coupled absorption transporter for l-carnitine in small intestine. This study tests the potential of this transporter for oral delivery of therapeutic drugs encapsulated in l-carnitine-conjugated poly(lactic-co-glycolic acid) (PLGA) nanoparticles (LC-PLGA NPs) and discloses the molecular mechanism for cellular endocytosis of transporter-targeting nanoparticles. Conjugation of l-carnitine to a surface of PLGA-NPs enhances the cellular uptake and intestinal absorption of encapsulated drug. In both cases, the uptake process is dependent on cotransporting ion Na + . Computational OCTN2 docking analysis shows that the presence of Na + is important for the formation of the energetically stable intermediate complex of transporter-Na + -LC-PLGA NPs, which is also the first step in cellular endocytosis of nanoparticles. The transporter-mediated intestinal absorption of LC-PLGA NPs occurs via endocytosis/transcytosis rather than via the traditional transmembrane transport. The portal blood versus the lymphatic route is evaluated by the plasma appearance of the drug in the control and lymph duct-ligated rats. Absorption via the lymphatic system is the predominant route in the oral delivery of the NPs. In summary, LC-PLGA NPs can effectively target OCTN2 on the enterocytes for enhancing oral delivery of drugs and the critical role of cotransporting ions should be noticed in designing transporter-targeting nanoparticles. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Intronic deletions in the SLC34A3 gene: A cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria

    Science.gov (United States)

    Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.

    2013-01-01

    Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine calcium excretion with high serum calcium, low intact parathyroid hormone (PTH) levels, and elevated 1,25(OH)2D level. In addition, the patient had low to low-normal serum phosphorus with high urine phosphorus. The patient had normal stature; without rachitic or boney deformities or a history of fractures. Genetic analysis of SLC34A3 revealed the patient to be a compound heterozygote for a novel single base pair deletion in exon 12 (c.1304delG) and 30-base pair deletion in intron 6 (g.1440–1469del). The single-base pair mutation causes a frameshift, which results in premature stop codon. The intronic deletion is likely caused by misalignment of the 4-basepair homologous repeats and results in the truncation of an already small intron to 63 bp, which would impair proper RNA splicing of the intron. This is the fourth unique intronic deletion identified in patients with HHRH, suggesting the frequent occurrence of sequence misalignments in SLC34A3 and the importance of screening introns in patients with HHRH. PMID:24176905

  14. De Novo Mutations in SLC25A24 Cause a Craniosynostosis Syndrome with Hypertrichosis, Progeroid Appearance, and Mitochondrial Dysfunction.

    Science.gov (United States)

    Ehmke, Nadja; Graul-Neumann, Luitgard; Smorag, Lukasz; Koenig, Rainer; Segebrecht, Lara; Magoulas, Pilar; Scaglia, Fernando; Kilic, Esra; Hennig, Anna F; Adolphs, Nicolai; Saha, Namrata; Fauler, Beatrix; Kalscheuer, Vera M; Hennig, Friederike; Altmüller, Janine; Netzer, Christian; Thiele, Holger; Nürnberg, Peter; Yigit, Gökhan; Jäger, Marten; Hecht, Jochen; Krüger, Ulrike; Mielke, Thorsten; Krawitz, Peter M; Horn, Denise; Schuelke, Markus; Mundlos, Stefan; Bacino, Carlos A; Bonnen, Penelope E; Wollnik, Bernd; Fischer-Zirnsak, Björn; Kornak, Uwe

    2017-11-02

    Gorlin-Chaudhry-Moss syndrome (GCMS) is a dysmorphic syndrome characterized by coronal craniosynostosis and severe midface hypoplasia, body and facial hypertrichosis, microphthalmia, short stature, and short distal phalanges. Variable lipoatrophy and cutis laxa are the basis for a progeroid appearance. Using exome and genome sequencing, we identified the recurrent de novo mutations c.650G>A (p.Arg217His) and c.649C>T (p.Arg217Cys) in SLC25A24 in five unrelated girls diagnosed with GCMS. Two of the girls had pronounced neonatal progeroid features and were initially diagnosed with Wiedemann-Rautenstrauch syndrome. SLC25A24 encodes a mitochondrial inner membrane ATP-Mg/P i carrier. In fibroblasts from affected individuals, the mutated SLC25A24 showed normal stability. In contrast to control cells, the probands' cells showed mitochondrial swelling, which was exacerbated upon treatment with hydrogen peroxide (H 2 O 2 ). The same effect was observed after overexpression of the mutant cDNA. Under normal culture conditions, the mitochondrial membrane potential of the probands' fibroblasts was intact, whereas ATP content in the mitochondrial matrix was lower than that in control cells. However, upon H 2 O 2 exposure, the membrane potential was significantly elevated in cells harboring the mutated SLC25A24. No reduction of mitochondrial DNA copy number was observed. These findings demonstrate that mitochondrial dysfunction with increased sensitivity to oxidative stress is due to the SLC25A24 mutations. Our results suggest that the SLC25A24 mutations induce a gain of pathological function and link mitochondrial ATP-Mg/P i transport to the development of skeletal and connective tissue. Copyright © 2017 American Society of Human Genetics. All rights reserved.

  15. The effects and mechanisms of SLC34A2 on maintaining stem cell-like phenotypes in CD147+ breast cancer stem cells.

    Science.gov (United States)

    Lv, Yonggang; Wang, Ting; Fan, Jing; Zhang, Zhenzhen; Zhang, Juliang; Xu, Cheng; Li, Yongping; Zhao, Ge; He, Chenyang; Meng, Huimin; Yang, Hua; Wang, Zhen; Liu, Jiayun; Chen, Jianghao; Wang, Ling

    2017-04-01

    The cancer stem cell (CSC) hypothesis has gained significant recognition in describing tumorigenesis. Identification of the factors critical to development of breast cancer stem cells (BCSCs) may provide insight into the improvement of effective therapies against breast cancer. In this study, we aim to investigate the biological function of SLC34A2 in affecting the stem cell-like phenotypes in BCSCs and its underlying mechanisms. We demonstrated that CD147 + cells from breast cancer tissue samples and cell lines possessed BCSC-like features, including the ability of self-renewal in vitro, differentiation, and tumorigenic potential in vivo. Flow cytometry analysis showed the presence of a variable fraction of CD147 + cells in 9 of 10 tumor samples. Significantly, SLC34A2 expression in CD147 + BCSCs was enhanced compared with that in differentiated adherent progeny of CD147 + BCSCs and adherently cultured cell line cells. In breast cancer patient cohorts, SLC34A2 expression was found increased in 9 of 10 tumor samples. By using lentiviral-based approach, si-SLC34A2-transduced CD147 + BCSCs showed decreased ability of sphere formation, cell viability in vitro, and tumorigenicity in vivo, which suggested the essential role of SLC34A2 in CD147 + BCSCs. Furthermore, PI3K/AKT pathway and SOX2 were found necessary to maintain the stemness of CD147 + BCSCs by using LY294002 or lentiviral-si-SOX2. Finally, we indicated that SLC34A2 could regulate SOX2 to maintain the stem cell-like features in CD147 + BCSCs through PI3K/AKT pathway. Therefore, our report identifies a novel role of SLC34A2 in BCSCs' state regulation and establishes a rationale for targeting the SLC34A2/PI3K/AKT/SOX2 signaling pathway for breast cancer therapy.

  16. Tissue-specific amino acid transporter partners ACE2 and collectrin differentially interact with hartnup mutations

    DEFF Research Database (Denmark)

    Camargo, Simone M R; Singer, Dustin; Makrides, Victoria

    2008-01-01

    BACKGROUND & AIMS: Hartnup amino acid transporter B(0)AT1 (SLC6A19) is the major luminal sodium-dependent neutral amino acid transporter of small intestine and kidney proximal tubule. The expression of B(0)AT1 in kidney was recently shown to depend on its association with collectrin (Tmem27...

  17. Multifunction input-output board for the IBM AT/XT (Lab-Master)

    Energy Technology Data Exchange (ETDEWEB)

    Pilyar, A V

    1996-12-31

    Multifunction input-output board for the IBM PC AT/XT is described. It consists of a CMOS analog input multiplexer, programmable amplifier, a fast 12-bit ADC, four 10-bit DAC and two 8-bit digital input-output registers. Specifications of analog input and output are given. 6 refs.

  18. Immunohistochemical expression profiles of solute carrier transporters in alpha-fetoprotein-producing gastric cancer.

    Science.gov (United States)

    Shimakata, Takaaki; Kamoshida, Shingo; Kawamura, Jumpei; Ogane, Naoki; Kameda, Yoichi; Yanagita, Emmy; Itoh, Tomoo; Takeda, Risa; Naka, Ayano; Sakamaki, Kuniko; Hayashi, Yurie; Kuwao, Sadahito

    2016-11-01

    Alpha-fetoprotein (AFP)-producing gastric cancer (GC) is an aggressive tumour with high rates of liver metastasis and poor prognosis, and for which a validated chemotherapy regimen has not been established. Drug uptake by solute carrier (SLC) transporters is proposed as one of the mechanisms involved in sensitivity to chemotherapy. In this study, we aimed to develop important insights into effective chemotherapeutic regimens for AFP-producing GC. We evaluated immunohistochemically the expression levels of a panel of SLC transporters in 20 AFP-producing GCs and 130 conventional GCs. SLC transporters examined were human equilibrative nucleoside transporter 1 (hENT1), organic anion transporter 2 (OAT2), organic cation transporter (OCT) 2, OCT6 and organic anion-transporting polypeptide 1B3 (OATP1B3). The rates of high expression levels of hENT1 (hENT1 high ) and OAT2 (OAT2 high ) were statistically higher in AFP-producing GC, compared with conventional GC. When analysing hENT1 and OAT2 in combination, hENT1 high /OAT2 high was the most particular expression profile for AFP-producing GC, with a greater significance than hENT1 or OAT2 alone. However, no significant differences in OCT2, OCT6 or OATP1B3 levels were detected between AFP-producing and conventional GCs. However, immunoreactivity for hENT1, OAT2 and OCT6 tended to be increased in GC tissues compared with non-neoplastic epithelia. Because hENT1 and OAT2 are crucial for the uptake of gemcitabine and 5-fluorouracil, respectively, our results suggest that patients with AFP-producing GC could potentially benefit from gemcitabine/fluoropyrimidine combination chemotherapy. Increased expression of hENT1, OAT2 and OCT6 may also be associated with the progression of GC. © 2016 John Wiley & Sons Ltd.

  19. Dispersive effects of transverse displacements of SLC Arc magnets

    International Nuclear Information System (INIS)

    Murray, J.J.; Fieguth, T.; Kheifets, S.

    1986-01-01

    The SLC Arc magnets are subject to random displacements and field errors resulting in unpredictable transverse displacement of the central trajectory from that of the design. The chosen method of correcting this perturbed trajectory in the SLC Arcs utilizes mechanical movement of the combined function magnets which compose the Arc transport lines. Here we present the results of a recent investigation substantiating the earlier results which led to the adoption of this method

  20. Autosomal-Recessive Intellectual Disability with Cerebellar Atrophy Syndrome Caused by Mutation of the Manganese and Zinc Transporter Gene SLC39A8

    Science.gov (United States)

    Boycott, Kym M.; Beaulieu, Chandree L.; Kernohan, Kristin D.; Gebril, Ola H.; Mhanni, Aziz; Chudley, Albert E.; Redl, David; Qin, Wen; Hampson, Sarah; Küry, Sébastien; Tetreault, Martine; Puffenberger, Erik G.; Scott, James N.; Bezieau, Stéphane; Reis, André; Uebe, Steffen; Schumacher, Johannes; Hegele, Robert A.; McLeod, D. Ross; Gálvez-Peralta, Marina; Majewski, Jacek; Ramaekers, Vincent T.; Nebert, Daniel W.; Innes, A. Micheil; Parboosingh, Jillian S.; Abou Jamra, Rami

    2015-01-01

    Manganese (Mn) and zinc (Zn) are essential divalent cations used by cells as protein cofactors; various human studies and animal models have demonstrated the importance of Mn and Zn for development. Here we describe an autosomal-recessive disorder in six individuals from the Hutterite community and in an unrelated Egyptian sibpair; the disorder is characterized by intellectual disability, developmental delay, hypotonia, strabismus, cerebellar atrophy, and variable short stature. Exome sequencing in one affected Hutterite individual and the Egyptian family identified the same homozygous variant, c.112G>C (p.Gly38Arg), affecting a conserved residue of SLC39A8. The affected Hutterite and Egyptian individuals did not share an extended common haplotype, suggesting that the mutation arose independently. SLC39A8 is a member of the solute carrier gene family known to import Mn, Zn, and other divalent cations across the plasma membrane. Evaluation of these two metal ions in the affected individuals revealed variably low levels of Mn and Zn in blood and elevated levels in urine, indicating renal wasting. Our findings identify a human Mn and Zn transporter deficiency syndrome linked to SLC39A8, providing insight into the roles of Mn and Zn homeostasis in human health and development. PMID:26637978

  1. Glucose transporter-1 deficiency syndrome : the expanding clinical and genetic spectrum of a treatable disorder

    NARCIS (Netherlands)

    Leen, Wilhelmina G.; Klepper, Joerg; Verbeek, Marcel M.; Leferink, Maike; Hofste, Tom; van Engelen, Baziel G.; Wevers, Ron A.; Arthur, Todd; Bahi-Buisson, Nadia; Ballhausen, Diana; Bekhof, Jolita; van Bogaert, Patrick; Carrilho, Ines; Chabrol, Brigitte; Champion, Michael P.; Coldwell, James; Clayton, Peter; Donner, Elizabeth; Evangeliou, Athanasios; Ebinger, Friedrich; Farrell, Kevin; Forsyth, Rob J.; de Goede, Christian G. E. L.; Gross, Stephanie; Grunewald, Stephanie; Holthausen, Hans; Jayawant, Sandeep; Lachlan, Katherine; Laugel, Vincent; Leppig, Kathy; Lim, Ming J.; Mancini, Grazia; Della Marina, Adela; Martorell, Loreto; McMenamin, Joe; Meuwissen, Marije E. C.; Mundy, Helen; Nilsson, Nils O.; Panzer, Axel; Poll-The, Bwee T.; Rauscher, Christian; Rouselle, Christophe M. R.; Sandvig, Inger; Scheffner, Thomas; Sheridan, Eamonn; Simpson, Neil; Sykora, Parol; Tomlinson, Richard; Trounce, John; Webb, David; Weschke, Bernhard; Scheffer, Hans; Willemsen, Michel A.

    Glucose transporter-1 deficiency syndrome is caused by mutations in the SLC2A1 gene in the majority of patients and results in impaired glucose transport into the brain. From 2004-2008, 132 requests for mutational analysis of the SLC2A1 gene were studied by automated Sanger sequencing and multiplex

  2. Glucose transporter-1 deficiency syndrome: The expanding clinical and genetic spectrum of a treatable disorder

    NARCIS (Netherlands)

    W.G. Leen (Wilhelmina); J. Klepper (Joerg); M.M. Verbeek (Marcel); M. Leferink (Maike); T. Hofste (Tom); B.G.M. van Engelen (Baziel); R.A. Wevers (Ron); T. Arthur (Todd); N. Bahi-Buisson (Nadia); D. Ballhausen (Diana); J. Bekhof (Jolita); P. van Bogaert (Patrick); I. Carrilho (Inês); B. Chabrol (Brigitte); M.P. Champion (Michael); J. Coldwell (James); P. Clayton (Peter); E. Donner (Elizabeth); A. Evangeliou (Athanasios); F. Ebinger (Friedrich); K. Farrell (Kevin); R.J. Forsyth (Rob); C.G.E.L. de Goede (Christian); S. Gross (Stephanie); S. Grünewald (Sonja); H. Holthausen (Hans); S. Jayawant (Sandeep); K. Lachlan (Katherine); V. Laugel (Vincent); K. Leppig (Kathy); M.J. Lim (Ming); G.M.S. Mancini (Grazia); A.D. Marina; L. Martorell (Loreto); J. McMenamin (Joe); M.E.C. Meuwissen (Marije); H. Mundy (Helen); N.O. Nilsson (Nils); A. Panzer (Axel); B.T. Poll-The; C. Rauscher (Christian); C.M.R. Rouselle (Christophe); I. Sandvig (Inger); T. Scheffner (Thomas); E. Sheridan (Eamonn); N. Simpson (Neil); P. Sykora (Parol); R. Tomlinson (Richard); J. Trounce (John); D.W.M. Webb (David); B. Weschke (Bernhard); H. Scheffer (Hans); M.A. Willemsen (Michél)

    2010-01-01

    textabstractGlucose transporter-1 deficiency syndrome is caused by mutations in the SLC2A1 gene in the majority of patients and results in impaired glucose transport into the brain. From 2004-2008, 132 requests for mutational analysis of the SLC2A1 gene were studied by automated Sanger sequencing

  3. Glucose transporter-1 deficiency syndrome: the expanding clinical and genetic spectrum of a treatable disorder

    NARCIS (Netherlands)

    Leen, Wilhelmina G.; Klepper, Joerg; Verbeek, Marcel M.; Leferink, Maike; Hofste, Tom; van Engelen, Baziel G.; Wevers, Ron A.; Arthur, Todd; Bahi-Buisson, Nadia; Ballhausen, Diana; Bekhof, Jolita; van Bogaert, Patrick; Carrilho, Inês; Chabrol, Brigitte; Champion, Michael P.; Coldwell, James; Clayton, Peter; Donner, Elizabeth; Evangeliou, Athanasios; Ebinger, Friedrich; Farrell, Kevin; Forsyth, Rob J.; de Goede, Christian G. E. L.; Gross, Stephanie; Grunewald, Stephanie; Holthausen, Hans; Jayawant, Sandeep; Lachlan, Katherine; Laugel, Vincent; Leppig, Kathy; Lim, Ming J.; Mancini, Grazia; Marina, Adela Della; Martorell, Loreto; McMenamin, Joe; Meuwissen, Marije E. C.; Mundy, Helen; Nilsson, Nils O.; Panzer, Axel; Poll-The, Bwee T.; Rauscher, Christian; Rouselle, Christophe M. R.; Sandvig, Inger; Scheffner, Thomas; Sheridan, Eamonn; Simpson, Neil; Sykora, Parol; Tomlinson, Richard; Trounce, John; Webb, David; Weschke, Bernhard; Scheffer, Hans; Willemsen, Michél A.

    2010-01-01

    Glucose transporter-1 deficiency syndrome is caused by mutations in the SLC2A1 gene in the majority of patients and results in impaired glucose transport into the brain. From 2004-2008, 132 requests for mutational analysis of the SLC2A1 gene were studied by automated Sanger sequencing and multiplex

  4. Glucose transporter-1 deficiency syndrome: the expanding clinical and genetic spectrum of a treatable disorder.

    NARCIS (Netherlands)

    Leen, W.G.; Klepper, J.; Verbeek, M.M.; Leferink, M.; Hofste, T.; Engelen, B.G.M. van; Wevers, R.A.; Arthur, T.; Bahi-Buisson, N.; Ballhausen, D.; Bekhof, J.; Bogaert, P. van; Carrilho, I.; Chabrol, B.; Champion, M.P.; Coldwell, J.; Clayton, P.; Donner, E.; Evangeliou, A.; Ebinger, F.; Farrell, K.; Forsyth, R.J.; Goede, C.G. de; Gross, S.; Grunewald, S.; Holthausen, H.; Jayawant, S.; Lachlan, K.; Laugel, V.; Leppig, K.; Lim, M.J.; Mancini, G.; Marina, A.D.; Martorell, L.; McMenamin, J.; Meuwissen, M.E.; Mundy, H.; Nilsson, N.O.; Panzer, A.; Poll-The, B.T.; Rauscher, C.; Rouselle, C.M.; Sandvig, I.; Scheffner, T.; Sheridan, E.; Simpson, N.; Sykora, P.; Tomlinson, R.; Trounce, J.; Webb, D.; Weschke, B.; Scheffer, H.; Willemsen, M.A.A.P.

    2010-01-01

    Glucose transporter-1 deficiency syndrome is caused by mutations in the SLC2A1 gene in the majority of patients and results in impaired glucose transport into the brain. From 2004-2008, 132 requests for mutational analysis of the SLC2A1 gene were studied by automated Sanger sequencing and multiplex

  5. Maternal DRD2, SLC6A3, and OXTR genotypes as potential moderators of the relation between maternal history of care and maternal cortisol secretion in the context of mother-infant separation.

    Science.gov (United States)

    Ludmer, Jaclyn A; Jamieson, Brittany; Gonzalez, Andrea; Levitan, Robert; Kennedy, James; Villani, Vanessa; Masellis, Mario; Basile, Vincenzo S; Atkinson, Leslie

    2017-10-01

    A mother's cortisol secretion is importantly associated with her own mental health and her infant's cortisol secretion. This study investigated the influences of maternal history of care and maternal DRD2, SLC6A3, and OXTR genotypes on maternal cortisol in the context of infant stress. A community sample of 296 mother-infant dyads completed a maternal separation at infant age 17 months. Maternal salivary cortisol, buccal cells, and self-reported history of care were collected. Multilevel models revealed that history of care had a greater influence on maternal baseline cortisol (but not cortisol trajectory) for mothers with more plasticity alleles of SLC6A3 (10R) and OXTR (G), relative to mothers with fewer or no plasticity alleles. Findings indicate that a mother's history of care is related to her cortisol secretion in anticipation of infant stress, but that this relation depends on her genetic characteristics. Findings are discussed in relation to the maternal protective system and anticipatory cortisol secretion. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Further characterisation of the recently described SLC26A4 c.918+2T>C mutation and reporting of a novel variant predicted to be damaging.

    Science.gov (United States)

    Gonçalves, A C; Santos, R; O'Neill, A; Escada, P; Fialho, G; Caria, H

    2016-06-01

    Pendred syndrome (PS) is the second most common type of autosomal recessive syndromic hearing loss (HL). It is characterised by sensorineural HL and goiter with occasional hypothyroidism. These features are generally accompanied by malformations of the inner ear, as enlarged vestibular aqueduct (EVA). In about 50% of probands, mutations in the SLC26A4 gene are the cause of the disease. Here we report the case of a Portuguese female, aged 47, presenting with severe to profound HL and hypothyroidism. Her mother and sister, both deceased, had suffered from HL and goiter. By MRI and CT, an enlarged vestibular aqueduct and endolymphatic sac were observed. Molecular study of the patient included screening for GJB2 coding mutations and GJB6 common deletions followed by screening of all SLC26A4 exons, as well as intronic regions 8 and 14. Mutation c.918+2T>C was found for the first time in homozygosity in the intronic region 7 of the SLC26A4 gene. Whilst sequencing the control samples, a novel mutation c.821C>G was found in heterozygosity in the exon 7 of SLC26A4 gene and was predicted to be damaging. This study thus led to the finding of two novel SLC26A4 genotypes and provides new insight on the phenotypic features associated with PS. © Copyright by Società Italiana di Otorinolaringologia e Chirurgia Cervico-Facciale, Rome, Italy.

  7. SLC energy spectrum monitor using synchrotron radiation

    International Nuclear Information System (INIS)

    Seeman, J.; Brunk, W.; Early, R.; Ross, M.; Tillmann, E.; Walz, D.

    1986-04-01

    The SLAC Linac is being upgraded for the use in the SLAC Linear Collider (SLC). The improved Linac must accelerate electron and positron bunches from 1.2 GeV to 50 GeV while producing output energy spectra of about 0.2%. The energy spectra must be maintained during operation to provide for good beam transmission and to minimize chromatic effects in the SLC ARCs and Final Focus. the energy spectra of these beams are determined by the bunch length and intensity, the RF phase and waveform and the intra-bunch longitudinal wakefields. A non-destructive energy spectrum monitor has been designed using a vertical wiggler magnet located downstream of the horizontal beam splitter at the end of the SLC Linac. It produces synchrotron radiation which is viewed in an off-axis x-ray position sensitive detector. The expected resolution is 0.08%. The design considerations of this monitor are presented in this paper. A pair of these monitors is under construction with an installation date set for late summer 1986. 5 refs., 6 figs

  8. SLC1 and SLC4 encode partially redundant acyl-coenzyme A 1-acylglycerol-3-phosphate O-acyltransferases of budding yeast

    DEFF Research Database (Denmark)

    Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath

    2007-01-01

    Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...

  9. Associação entre polimorfismo SLC6A3 3’UTR VNTR e a resposta ao tratamento da dependência de nicotina

    Directory of Open Access Journals (Sweden)

    Guilherme Rubino de Azevedo Focchi

    2011-01-01

    Full Text Available Objetivo: Avaliar a associação entre a resposta ao tratamento da dependência de nicotina com bupropiona e a presença do polimorfismo SLC6A3 3’UTR VNTR, localizado no gene que codifica o transportador dopaminérgico. Método: Foram acompanhados no Ambulatório de Tabagismo do Instituto de Psiquiatria da Faculdade de Medicina da USP 100 pacientes do sexo masculino com diagnóstico de dependência de nicotina, sem outras patologias. Todos receberam bupropiona até 300 mg ao dia por 12 semanas, associada à terapia cognitivo-comportamental em grupo. A Escala de Fagerström foi aplicada no início e no final do tratamento, e avaliou-se a parada do uso de cigarros na última semana de tratamento e um mês após. Os pacientes tiveram 10 ml de sangue colhidos e genotipados para a existência do polimorfismo SLC6A3 3’UTR VNTR. Resultados: Não foi encontrada associação entre cessação do uso de cigarro e presença do polimorfismo. Conclusão: São necessários mais estudos para avaliar se a presença do polimorfismo SLC6A3 3’UTR VNTR estaria relacionada à melhor resposta ao tratamento da dependência de nicotina.

  10. Expression of hepatic transporters OATP-C and MRP2 in primary sclerosing cholangitis

    NARCIS (Netherlands)

    Oswald, M.; Kullak-Ublick, G. A.; Paumgartner, G.; Beuers, U.

    2001-01-01

    In chronic cholestatic liver diseases, biliary excretion of organic anions from blood into bile is impaired. The aim of this study was to identify the underlying mechanism. Expression of the basolateral organic anion transporting polypeptide OATP-C (SLC21A6) and the canalicular multidrug resistance

  11. Transportation Energy Data Book, Edition 18

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Stacy C.

    1998-09-01

    The Transportation Energy Data Book: Edition 18 is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with the Office of Transportation Technologies in the Department of Energy (DOE). Designed for use as a desk-top reference, the data book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. This edition of the Data Book has 11 chapters which focus on various aspects of the transportation industry. Chapter 1 focuses on petroleum; Chapter 2 - energy Chapter 3 - emissions; Chapter 4 - transportation and the economy; Chapter 5 - highway vehicles; Chapter 6 - Light vehicles; Chapter 7 - heavy vehicles; Chapter 8 - alternative fuel vehicles; Chapter 9 - fleet vehicles; Chapter 10 - household vehicles; and Chapter 11 - nonhighway modes. The sources used represent the latest available data.

  12. Congenital Chloride-Losing Diarrhea in a Mexican child with the novel homozygous SLC26A3 mutation G393W

    Directory of Open Access Journals (Sweden)

    Fabian R. Reimold

    2015-06-01

    Full Text Available Congenital chloride diarrhea is an autosomal recessive disease caused by mutations in the intestinal lumenal membrane Cl-/HCO3- exchanger, SLC26A3.We report here the novel SLC26A3 mutation G393W in a Mexican child, the first such report in a patient from Central America. SLC26A3 G393W expression in Xenopus oocytes exhibits a mild hypomorphic phenotype, with normal surface expression and moderately reduced anion transport function. However, expression of HA-SLC26A3 in HEK-293 cells reveals intracellular retention and greatly decreased steady-state levels of the mutant polypeptide, in contrast to peripheral membrane expression of the wildtype protein. Whereas wildtype HA-SLC26A3 is apically localized in polarized monolayers of filter-grown MDCK cells and Caco2 cells, mutant HA-SLC26A3 G393W exhibits decreased total polypeptide abundance, with reduced or absent surface expression and sparse punctate (or absent intracellular distribution. The WT protein is similarly localized in LLCPK1 cells, but the mutant fails to accumulate to detectable levels. We conclude that the chloride-losing diarrhea phenotype associated with homozygous expression of SLC26A3 G393W likely reflects lack of apical surface expression in enterocytes, secondary to combined abnormalities in polypeptide trafficking and stability. Future progress in development of general or target-specific folding chaperonins and correctors may hold promise for pharmacological rescue of this and similar genetic defects in membrane protein targeting.

  13. SLC45A2 mutation frequency in Oculocutaneous Albinism Italian patients doesn't differ from other European studies.

    Science.gov (United States)

    Mauri, Lucia; Barone, Luca; Al Oum, Muna; Del Longo, Alessandra; Piozzi, Elena; Manfredini, Emanuela; Stanzial, Franco; Benedicenti, Francesco; Penco, Silvana; Patrosso, Maria Cristina

    2014-01-01

    Oculocutaneous Albinism (OCA) is a heterogeneous group of inherited diseases involving hair, skin and eyes. To date, six forms are recognized on the effects of different melanogenesis genes. OCA4 is caused by mutations in SLC45A2 showing a heterogeneous phenotype ranging from white hair, blue irides and nystagmus to brown/black hair, brown irides and no nystagmus. The high clinic variety often leads to misdiagnosis. Our aim is to contribute to OCA4 diagnosis defining SLC45A2 genetic variants in Italian patients with OCA without any TYR, OCA2 and TYRP1 gene defects. After the clinical diagnosis of OCA, all patients received genetic counseling and genetic test. Automatic sequencing of TYR, OCA2, and TYRP1 genes was performed on DNA of 117 albino patients. Multiplex Ligation-dependent Probe Amplification (MLPA) was carried out on TYR and OCA2 genes to increase the mutation rate. SLC45A2 gene sequencing was then executed in the patients with a single mutation in one of the TYR, OCA2, TYRP1 genes and in the patients, which resulted negative at the screening of these genes. SLC45A2 gene analysis was performed in 41 patients and gene alterations were found in 5 patients. Four previously reported SLC45A2 mutations were found: p.G100S, p.W202C, p.A511E and c.986delC, and three novel variants were identified: p.M265L, p.H94D, and c.1156+1G>A. All the alterations have been detected in the group of patients without mutations in the other OCA genes. Three new variants were identified in OCA4 gene; the analysis allowed the classification of a patient previously misdiagnosed as OA1 because of skin and hair pigmentation presence. The molecular defects in SLC45A2 gene represent the 3.4% in this cohort of Italian patients, similar to other Caucasian populations; our data differ from those previously published by an Italian researcher group, obtained on a smaller cohort of patients. © 2013 Elsevier B.V. All rights reserved.

  14. MBL, P2X7, and SLC11A1 gene polymorphisms in patients with oropharyngeal tularemia.

    Science.gov (United States)

    Somuk, Battal Tahsin; Koc, Sema; Ates, Omer; Göktas, Göksel; Soyalic, Harun; Uysal, Ismail Onder; Gurbuzler, Levent; Sapmaz, Emrah; Sezer, Saime; Eyibilen, Ahmet

    2016-11-01

    A significant association was found of oropharyngeal tularemia with SLC11A1 allele polymorphism (INT4 G/C) and MBL2 C + 4T (P/Q). These results indicate C allele and Q allele might be a risk factor for the development of oropharyngeal tularemia. This study aimed to investigate the relationship of SLC11A1, MBL, and P2X 7 gene polymorphism with oropharyngeal tularemia. The study included totally 120 patients who were diagnosed with oropharyngeal tularemia. Frequencies of polymorphisms in the following genes were analyzed both in the patient and control groups in the study: SLC11A1 (5'(GT) n Allele 2/3, Int4 G/C, 3' UTR, D543N G/A), MBL (MBL2 C + 4T (P/Q), and P2X 7 (-762 C/T and 1513 A/C). Among all polymorphisms that were investigated in this study, SLC11A1 gene showed a significance in the distriburtion of polymorphism allelle frequency at the INT4 region. Frequency of C allele was 54 (28%) in patients with oropharyngeal tularemia, and 31 (13%) in the control group (p = 0.006 and OR = 1.96 (1.21-3.20)). An association was detected between MBL2 C + 4T (P/Q) gene polymorphism and oropharyngeal tularemia (p tularemia in this study (p > 0.05).

  15. Diaqua{6,6′-dimethoxy-2,2′-[ethane-1,2-diylbis(nitrilomethylidyne]diphenolato-κ2O,N,N′,O′}manganese(III perchlorate 18-crown-6 hemisolvate monohydrate

    Directory of Open Access Journals (Sweden)

    Ming-Ming Yu

    2009-02-01

    Full Text Available In the cation of the title compound, [Mn(C18H18N2O4(H2O2]ClO4·0.5C12H24O6·H2O, the MnIII ion is coordinated by two water O atoms, and two O atoms and two N atoms from the tetradentate 6,6′-dimethoxy-2,2′-[ethane-1,2-diylbis(nitrilomethylidyne]diphenolate ligand, completing a distorted octahedral geometry. One O atom of the 18-crown-6-ether is disordered over two positions with occupancies of 0.70 (2 and 0.30 (2.

  16. Anticipation in a family with primary familial brain calcification caused by an SLC20A2 variant.

    Science.gov (United States)

    Konno, Takuya; Blackburn, Patrick R; Rozen, Todd D; van Gerpen, Jay A; Ross, Owen A; Atwal, Paldeep S; Wszolek, Zbigniew K

    2018-04-11

    To describe a family with primary familial brain calcification (PFBC) due to SLC20A2 variant showing possible genetic anticipation. We conducted historical, genealogical, clinical, and radiologic studies of a family with PFBC. Clinical evaluations including neurological examination and head computed tomography (CT) scans of a proband and her father were performed. They provided additional information regarding other family members. To identify a causative gene variant, we performed whole-exome sequencing for the proband followed by segregation analysis in other affected members using direct sequencing. In this family, nine affected members were identified over four generations. The proband suffered from chronic daily headache including thunderclap headache. We identified an SLC20A2 (c.509delT, p.(Leu170*)) variant in three affected members over three generations. Interestingly, the age of onset became younger as the disease passed through successive generations, suggestive of genetic anticipation. For clinical purpose, it is important to consider thunderclap headache and genetic anticipation in PFBC caused by SLC20A2 variants. Further investigation is required to validate our observation. Copyright © 2018 Polish Neurological Society. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  17. Functional assessment of allelic variants in the SLC26A4 gene involved in Pendred syndrome and nonsyndromic EVA

    Science.gov (United States)

    Pera, Alejandra; Dossena, Silvia; Rodighiero, Simona; Gandía, Marta; Bottà, Guido; Meyer, Giuliano; Moreno, Felipe; Nofziger, Charity; Hernández-Chico, Concepción; Paulmichl, Markus

    2008-01-01

    Pendred syndrome is an autosomal recessive disorder characterized by sensorineural hearing loss, with malformations of the inner ear, ranging from enlarged vestibular aqueduct (EVA) to Mondini malformation, and deficient iodide organification in the thyroid gland. Nonsyndromic EVA (ns-EVA) is a separate type of sensorineural hearing loss showing normal thyroid function. Both Pendred syndrome and ns-EVA seem to be linked to the malfunction of pendrin (SLC26A4), a membrane transporter able to exchange anions between the cytosol and extracellular fluid. In the past, the pathogenicity of SLC26A4 missense mutations were assumed if the mutations fulfilled two criteria: low incidence of the mutation in the control population and substitution of evolutionary conserved amino acids. Here we show that these criteria are insufficient to make meaningful predictions about the effect of these SLC26A4 variants on the pendrin-induced ion transport. Furthermore, we functionally characterized 10 missense mutations within the SLC26A4 ORF, and consistently found that on the protein level, an addition or omission of a proline or a charged amino acid in the SLC26A4 sequence is detrimental to its function. These types of changes may be adequate for predicting SLC26A4 functionality in the absence of direct functional tests. PMID:19017801

  18. The JPEG XT suite of standards: status and future plans

    Science.gov (United States)

    Richter, Thomas; Bruylants, Tim; Schelkens, Peter; Ebrahimi, Touradj

    2015-09-01

    The JPEG standard has known an enormous market adoption. Daily, billions of pictures are created, stored and exchanged in this format. The JPEG committee acknowledges this success and spends continued efforts in maintaining and expanding the standard specifications. JPEG XT is a standardization effort targeting the extension of the JPEG features by enabling support for high dynamic range imaging, lossless and near-lossless coding, and alpha channel coding, while also guaranteeing backward and forward compatibility with the JPEG legacy format. This paper gives an overview of the current status of the JPEG XT standards suite. It discusses the JPEG legacy specification, and details how higher dynamic range support is facilitated both for integer and floating-point color representations. The paper shows how JPEG XT's support for lossless and near-lossless coding of low and high dynamic range images is achieved in combination with backward compatibility to JPEG legacy. In addition, the extensible boxed-based JPEG XT file format on which all following and future extensions of JPEG will be based is introduced. This paper also details how the lossy and lossless representations of alpha channels are supported to allow coding transparency information and arbitrarily shaped images. Finally, we conclude by giving prospects on upcoming JPEG standardization initiative JPEG Privacy & Security, and a number of other possible extensions in JPEG XT.

  19. Positive selection in the SLC11A1 gene in the family Equidae

    DEFF Research Database (Denmark)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan

    2016-01-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...

  20. S113R mutation in SLC33A1 leads to neurodegeneration and augmented BMP signaling in a mouse model

    Directory of Open Access Journals (Sweden)

    Pingting Liu

    2017-01-01

    Full Text Available The S113R mutation (c.339T>G (MIM #603690.0001 in SLC33A1 (MIM #603690, an ER membrane acetyl-CoA transporter, has been previously identified in individuals with hereditary spastic paraplegia type 42 (SPG42; MIM #612539. SLC33A1 has also been shown to inhibit the bone morphogenetic protein (BMP signaling pathway in zebrafish. To better understand the function of SLC33A1, we generated and characterized Slc33a1S113R knock-in mice. Homozygous Slc33a1S113R mutant mice were embryonic lethal, whereas heterozygous Slc33a1 mutant mice (Slc33a1wt/mut exhibited behavioral abnormalities and central neurodegeneration, which is consistent with hereditary spastic paraplegia (HSP phenotypes. Importantly, we found an upregulation of BMP signaling in the nervous system and mouse embryonic fibroblasts of Slc33a1wt/mut mice. Using a sciatic nerve crush injury model in vivo and dorsal root ganglion (DRG culture in vitro we showed that injury-induced axonal regeneration in Slc33a1wt/mut mice was accelerated and mediated by upregulated BMP signaling. Exogenous addition of BMP signaling antagonist, noggin, could efficiently alleviate the accelerated injury-induced axonal regrowth. These results indicate that SLC33A1 can negatively regulate BMP signaling in mice, further supporting the notion that upregulation of BMP signaling is a common mechanism of a subset of hereditary spastic paraplegias.

  1. Zinc-Associated Variant in SLC30A8 Gene Interacts With Gestational Weight Gain on Postpartum Glycemic Changes: A Longitudinal Study in Women With Prior Gestational Diabetes Mellitus.

    Science.gov (United States)

    Wang, Tiange; Liu, Huikun; Wang, Leishen; Huang, Tao; Li, Weiqin; Zheng, Yan; Heianza, Yoriko; Sun, Dianjianyi; Leng, Junhong; Zhang, Shuang; Li, Nan; Hu, Gang; Qi, Lu

    2016-12-01

    Zinc transporter 8 genetic variant SLC30A8 has been associated with postpartum risk of type 2 diabetes among women with gestational diabetes mellitus (GDM). Gestational weight gain is one of the strongest risk factors for postpartum hyperglycemia. We assessed the interaction between type 2 diabetes-associated SLC30A8 rs13266634 and gestational weight gain on 1-5 years of postpartum glycemic changes in 1,071 women with prior GDM in a longitudinal study. Compared with gestation of 26-30 weeks, postpartum levels of fasting glucose, oral glucose tolerance test 2-h glucose, and hemoglobin A 1c (HbA 1c ) increased across rs13266634 TT, CT, and CC genotypes in women with excessive gestational weight gain, whereas opposite genetic associations were found in women with inadequate or adequate gestational weight gain. Postpartum changes in fasting glucose per additional copy of the C allele were -0.18, -0.04, and 0.12 mmol/L in women with inadequate, adequate, and excessive gestational weight gain, respectively (P for interaction = 0.002). We also found similar interactions for changes in 2-h glucose and HbA 1c (P for interaction = 0.003 and 0.005, respectively). Our data indicate that gestational weight gain may modify SLC30A8 variant on long-term glycemic changes, highlighting the importance of gestational weight control in the prevention of postpartum hyperglycemia in women with GDM. © 2016 by the American Diabetes Association.

  2. Genetic variants of the human H+/dipeptide transporter PEPT2

    DEFF Research Database (Denmark)

    Pinsonneault, Julia; Nielsen, Carsten Uhd; Sadée, Wolfgang

    2004-01-01

    . We have conducted a haplotype analysis of 27 single nucleotide polymorphisms located in or near exons of the human gene encoding hPEPT2 (SLC15A2), using genotyping data from 247 genomic DNA samples from the Coriell collection. Our analysis reveals that hPEPT2 has a >6-kilobase sequence block......PEPT2 is a high-affinity H+/dipeptide transporter expressed in kidney, brain, lung, and mammary gland. The physiological role of PEPT2 in kidney is to reabsorb small peptides generated by luminal peptidases. PEPT2 is also a transporter for peptide-like drugs such as penicillins and cephalosporins...... with at least 10 abundant polymorphisms in almost complete linkage disequilibrium. As a result, only two main hPEPT2 variants exist (hPEPT2*1 and *2) with several phased amino acid substitutions, present in substantial frequencies in all ethnic groups tested. When expressed in Chinese hamster ovary cells, h...

  3. Active Hydrophilic Components of the Medicinal Herb Salvia miltiorrhiza (Danshen Potently Inhibit Organic Anion Transporters 1 (Slc22a6 and 3 (Slc22a8

    Directory of Open Access Journals (Sweden)

    Li Wang

    2012-01-01

    Full Text Available Many active components of herbal products are small organic anions, and organic anion transporters were previously demonstrated to be a potential site of drug-drug interactions. In this study, we assessed the inhibitory effects of six hydrophilic components of the herbal medicine Danshen, lithospermic acid, protocatechuic acid, rosmarinic acid, salvianolic acid A, salvianolic acid B, and tanshinol, on the function of the murine organic anion transporters, mOat1 and mOat3. All of Danshen components significantly inhibited mOat1- and mOat3-mediated substrate uptake (<0.001 with lithospermic acid (LSA, protocatechuic acid, rosmarinic acid (RMA, and salvianolic acid A (SAA producing virtually complete inhibition under test conditions. Kinetic analysis demonstrated that LSA, RMA, and SAA were competitive inhibitors. As such, values were estimated as 14.9±4.9 μM for LSA, 5.5±2.2 μM for RMA, and 4.9±2.2 μM for SAA on mOat1-mediated transport, and as 31.1±7.0 μM for LSA, 4.3±0.2 μM for RMA, and 21.3±7.7 μM for SAA on mOat3-mediated transport. These data suggest that herb-drug interactions may occur in vivo on the human orthologs of these transporters in situations of polypharmacy involving Danshen and clinical therapeutics known to be organic anion transporter substrates.

  4. Potential for food-drug interactions by dietary phenolic acids on human organic anion transporters 1 (SLC22A6), 3 (SLC22A8), and 4 (SLC22A11).

    Science.gov (United States)

    Wang, Li; Sweet, Douglas H

    2012-10-15

    Phenolic acids exert beneficial health effects such as anti-oxidant, anti-carcinogenic, and anti-inflammatory activities and show systemic exposure after consumption of common fruits, vegetables, and beverages. However, knowledge regarding which components convey therapeutic benefits and the mechanism(s) by which they cross cell membranes is extremely limited. Therefore, we determined the inhibitory effects of nine food-derived phenolic acids, p-coumaric acid, ferulic acid, gallic acid, gentisic acid, 4-hydroxybenzoic acid, protocatechuic acid, sinapinic acid, syringic acid, and vanillic acid, on human organic anion transporter 1 (hOAT1), hOAT3, and hOAT4. In the present study, inhibition of OAT-mediated transport of prototypical substrates (1 μM) by phenolic acids (100 μM) was examined in stably expressing cell lines. All compounds significantly inhibited hOAT3 transport, while just ferulic, gallic, protocatechuic, sinapinic, and vanillic acid significantly blocked hOAT1 activity. Only sinapinic acid inhibited hOAT4 (~35%). For compounds exhibiting inhibition > ~60%, known clinical plasma concentration levels and plasma protein binding in humans were examined to select compounds to evaluate further with dose-response curves (IC(50) values) and drug-drug interaction (DDI) index determinations. IC(50) values ranged from 1.24 to 18.08 μM for hOAT1 and from 7.35 to 87.36 μM for hOAT3. Maximum DDI indices for gallic and gentisic acid (≫0.1) indicated a very strong potential for DDIs on hOAT1 and/or hOAT3. This study indicates that gallic acid from foods or supplements, or gentisic acid from salicylate-based drug metabolism, may significantly alter the pharmacokinetics (efficacy and toxicity) of concomitant therapeutics that are hOAT1 and/or hOAT3 substrates. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. X-Linked Creatine Transporter Deficiency Presenting as a Mitochondrial Disorder

    NARCIS (Netherlands)

    Hathaway, S.C.; Friez, M.; Limbo, K.; Parker, C.; Salomons, G.S.; Vockley, J.; Wood, T.; Abdul-Rahman, O.A.

    2010-01-01

    X-linked creatine transporter defect is caused by mutations in SLC6A8 at Xq28, which encodes the sodium-dependent creatine transporter. Reduction in creatine uptake results in elevated urine creatine and CSF creatine deficiency, which can be detected on magnetic resonance spectroscopy. We report a

  6. Accuracy of the Garmin 920 XT HRM to perform HRV analysis.

    Science.gov (United States)

    Cassirame, Johan; Vanhaesebrouck, Romain; Chevrolat, Simon; Mourot, Laurent

    2017-12-01

    Heart rate variability (HRV) analysis is widely used to investigate autonomous cardiac drive. This method requires periodogram measurement, which can be obtained by an electrocardiogram (ECG) or from a heart rate monitor (HRM), e.g. the Garmin 920 XT device. The purpose of this investigation was to assess the accuracy of RR time series measurements from a Garmin 920 XT HRM as compared to a standard ECG, and to verify whether the measurements thus obtained are suitable for HRV analysis. RR time series were collected simultaneously with an ECG (Powerlab system, AD Instruments, Castell Hill, Australia) and a Garmin XT 920 in 11 healthy subjects during three conditions, namely in the supine position, the standing position and during moderate exercise. In a first step, we compared RR time series obtained with both tools using the Bland and Altman method to obtain the limits of agreement in all three conditions. In a second step, we compared the results of HRV analysis between the ECG RR time series and Garmin 920 XT series. Results show that the accuracy of this system is in accordance with the literature in terms of the limits of agreement. In the supine position, bias was 0.01, - 2.24, + 2.26 ms; in the standing position, - 0.01, - 3.12, + 3.11 ms respectively, and during exercise, - 0.01, - 4.43 and + 4.40 ms. Regarding HRV analysis, we did not find any difference for HRV analysis in the supine position, but the standing and exercise conditions both showed small modifications.

  7. Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct.

    Science.gov (United States)

    Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu

    2011-09-30

    Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity) in a Chinese population. In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group), 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group), 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group), and 16 patients with other types of inner ear malformations (IEM group) were identified. The coding exons of SLC26A4 were analyzed in all subjects. DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%). In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%). There were significant differences in the frequency of SLC26A4 mutation among the groups (P0.5). Although mutations in the SLC26A4 gene were frequently found in Chinese EVA patients with and

  8. Response to crizotinib in a lung adenocarcinoma patient harboring a novel SLC34A2-ROS1 fusion variant

    Science.gov (United States)

    Zhao, Zheng; Song, Zhangjun; Wang, Xuwei; Sun, Haifeng; Yang, Xiaomin; Yuan, Yong; Yu, Pan

    2017-01-01

    ROS1 fusion is a common genetic alteration in non-small-cell lung cancer. Crizotinib, an anaplastic lymphoma kinase inhibitor, shows efficacy in the treatment of lung cancer cases with ROS1 translocation. We report the response to crizotinib of a lung adenocarcinoma patient harboring a novel SLC34A2-ROS1 fusion variant, which was different from the two common SLC34A2-ROS1 fusion types reported in the literature. After crizotinib administration, overall recovery was good in this patient; the primary lesion was successfully treated, the lymph node metastases had disappeared, and the metabolism was normal. PMID:28860822

  9. Molecular mechanisms of reduced glutathione transport: role of the MRP/CFTR/ABCC and OATP/SLC21A families of membrane proteins

    International Nuclear Information System (INIS)

    Ballatori, Nazzareno; Hammond, Christine L.; Cunningham, Jennifer B.; Krance, Suzanne M.; Marchan, Rosemarie

    2005-01-01

    The initial step in reduced glutathione (GSH) turnover in all mammalian cells is its transport across the plasma membrane into the extracellular space; however, the mechanisms of GSH transport are not clearly defined. GSH export is required for the delivery of its constituent amino acids to other tissues, detoxification of drugs, metals, and other reactive compounds of both endogenous and exogenous origin, protection against oxidant stress, and secretion of hepatic bile. Recent studies indicate that some members of the multidrug resistance-associated protein (MRP/CFTR or ABCC) family of ATP-binding cassette (ABC) proteins, as well as some members of the organic anion transporting polypeptide (OATP or SLC21A) family of transporters contribute to this process. In particular, five of the 12 members of the MRP/CFTR family appear to mediate GSH export from cells namely, MRP1, MRP2, MRP4, MRP5, and CFTR. Additionally, two members of the OATP family, rat Oatp1 and Oatp2, have been identified as GSH transporters. For the Oatp1 transporter, efflux of GSH may provide the driving force for the uptake of extracellular substrates. In humans, OATP-B and OATP8 do not appear to transport GSH; however, other members of this family have yet to be characterized in regards to GSH transport. In yeast, the ABC proteins Ycf1p and Bpt1p transport GSH from the cytosol into the vacuole, whereas Hgt1p mediates GSH uptake across the plasma membrane. Because transport is a key step in GSH homeostasis and is intimately linked to its biological functions, GSH export proteins are likely to modulate essential cellular functions

  10. Recessive mutations in SLC38A8 cause foveal hypoplasia and optic nerve misrouting without albinism.

    Science.gov (United States)

    Poulter, James A; Al-Araimi, Musallam; Conte, Ivan; van Genderen, Maria M; Sheridan, Eamonn; Carr, Ian M; Parry, David A; Shires, Mike; Carrella, Sabrina; Bradbury, John; Khan, Kamron; Lakeman, Phillis; Sergouniotis, Panagiotis I; Webster, Andrew R; Moore, Anthony T; Pal, Bishwanath; Mohamed, Moin D; Venkataramana, Anandula; Ramprasad, Vedam; Shetty, Rohit; Saktivel, Murugan; Kumaramanickavel, Govindasamy; Tan, Alex; Mackey, David A; Hewitt, Alex W; Banfi, Sandro; Ali, Manir; Inglehearn, Chris F; Toomes, Carmel

    2013-12-05

    Foveal hypoplasia and optic nerve misrouting are developmental defects of the visual pathway and only co-occur in connection with albinism; to date, they have only been associated with defects in the melanin-biosynthesis pathway. Here, we report that these defects can occur independently of albinism in people with recessive mutations in the putative glutamine transporter gene SLC38A8. Nine different mutations were identified in seven Asian and European families. Using morpholino-mediated ablation of Slc38a8 in medaka fish, we confirmed that pigmentation is unaffected by loss of SLC38A8. Furthermore, by undertaking an association study with SNPs at the SLC38A8 locus, we showed that common variants within this gene modestly affect foveal thickness in the general population. This study reveals a melanin-independent component underpinning the development of the visual pathway that requires a functional role for SLC38A8. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  11. SLC6A3 polymorphism and response to methylphenidate in children with ADHD: A systematic review and meta-analysis.

    Science.gov (United States)

    Soleimani, Robabeh; Salehi, Zivar; Soltanipour, Soheil; Hasandokht, Tolou; Jalali, Mir Mohammad

    2018-04-01

    Methylphenidate (MPH) is the most commonly used treatment for attention-deficit hyperactivity disorder (ADHD) in children. However, the response to MPH is not similar in all patients. This meta-analysis investigated the potential role of SLC6A3 polymorphisms in response to MPH in children with ADHD. Clinical trials or naturalistic studies were selected from electronic databases. A meta-analysis was conducted using a random-effects model. Cohen's d effect size and 95% confidence intervals (CIs) were determined. Sensitivity analysis and meta-regression were performed. Q-statistic and Egger's tests were conducted to evaluate heterogeneity and publication bias, respectively. The Grading of Recommendations Assessment, Development and Evaluation (GRADE) system was used to assess the quality of evidence. Sixteen studies with follow-up periods of 1-28 weeks were eligible. The mean treatment acceptability of MPH was 97.2%. In contrast to clinical trials, the meta-analysis of naturalistic studies indicated that children without 10/10 repeat carriers had better response to MPH (Cohen's d: -0.09 and 0.44, respectively). The 9/9 repeat polymorphism had no effect on the response rate (Cohen's d: -0.43). In the meta-regression, a significant association was observed between baseline severity of ADHD, MPH dosage, and combined type of ADHD in some genetic models. Sensitivity analysis indicated the robustness of our findings. No publication bias was observed in our meta-analysis. The GRADE evaluations revealed very low levels of confidence for each outcome of response to MPH. The results of clinical trials and naturalistic studies regarding the effect size between different polymorphisms of SLC6A3 were contradictory. Therefore, further research is recommended. © 2017 Wiley Periodicals, Inc.

  12. A deletion mutation in bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle

    Directory of Open Access Journals (Sweden)

    Beever Jonathan E

    2010-05-01

    Full Text Available Abstract Background Osteopetrosis is a skeletal disorder of humans and animals characterized by the formation of overly dense bones, resulting from a deficiency in the number and/or function of bone-resorbing osteoclast cells. In cattle, osteopetrosis can either be induced during gestation by viral infection of the dam, or inherited as a recessive defect. Genetically affected calves are typically aborted late in gestation, display skull deformities and exhibit a marked reduction of osteoclasts. Although mutations in several genes are associated with osteopetrosis in humans and mice, the genetic basis of the cattle disorder was previously unknown. Results We have conducted a whole-genome association analysis to identify the mutation responsible for inherited osteopetrosis in Red Angus cattle. Analysis of >54,000 SNP genotypes for each of seven affected calves and nine control animals localized the defective gene to the telomeric end of bovine chromosome 4 (BTA4. Homozygosity analysis refined the interval to a 3.4-Mb region containing the SLC4A2 gene, encoding an anion exchanger protein necessary for proper osteoclast function. Examination of SLC4A2 from normal and affected animals revealed a ~2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3, predicted to prevent normal protein function. Analysis of RNA from a proven heterozygous individual confirmed the presence of transcripts lacking exons 2 and 3, in addition to normal transcripts. Genotyping of additional animals demonstrated complete concordance of the homozygous deletion genotype with the osteopetrosis phenotype. Histological examination of affected tissues revealed scarce, morphologically abnormal osteoclasts displaying evidence of apoptosis. Conclusions These results indicate that a deletion mutation within bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle. Loss of SLC4A2 function appears to induce premature cell death, and

  13. High frequency of the IVS2-2A>G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss

    Directory of Open Access Journals (Sweden)

    Pereira Fred A

    2005-08-01

    Full Text Available Abstract Background Cochlear outer hair cells change their length in response to variations in membrane potential. This capability, called electromotility, is believed to enable the sensitivity and frequency selectivity of the mammalian cochlea. Prestin is a transmembrane protein required for electromotility. Homozygous prestin knockout mice are profoundly hearing impaired. In humans, a single nucleotide change in SLC26A5, encoding prestin, has been reported in association with hearing loss. This DNA sequence variation, IVS2-2A>G, occurs in the exon 3 splice acceptor site and is expected to abolish splicing of exon 3. Methods To further explore the relationship between hearing loss and the IVS2-2A>G transition, and assess allele frequency, genomic DNA from hearing impaired and control subjects was analyzed by DNA sequencing. SLC26A5 genomic DNA sequences from human, chimp, rat, mouse, zebrafish and fruit fly were aligned and compared for evolutionary conservation of the exon 3 splice acceptor site. Alternative splice acceptor sites within intron 2 of human SLC26A5 were sought using a splice site prediction program from the Berkeley Drosophila Genome Project. Results The IVS2-2A>G variant was found in a heterozygous state in 4 of 74 hearing impaired subjects of Hispanic, Caucasian or uncertain ethnicity and 4 of 150 Hispanic or Caucasian controls (p = 0.45. The IVS2-2A>G variant was not found in 106 subjects of Asian or African American descent. No homozygous subjects were identified (n = 330. Sequence alignment of SLC26A5 orthologs demonstrated that the A nucleotide at position IVS2-2 is invariant among several eukaryotic species. Sequence analysis also revealed five potential alternative splice acceptor sites in intron 2 of human SLC26A5. Conclusion These data suggest that the IVS2-2A>G variant may not occur more frequently in hearing impaired subjects than in controls. The identification of five potential alternative splice acceptor sites in

  14. Associations of serum uric acid and SLC2A9 variant with depressive and anxiety disorders: a population-based study.

    Directory of Open Access Journals (Sweden)

    Tanica Lyngdoh

    Full Text Available Limited information exists regarding the association between serum uric acid (SUA and psychiatric disorders. We explored the relationship between SUA and subtypes of major depressive disorder (MDD and specific anxiety disorders. Additionally, we examined the association of SLC2A9 rs6855911 variant with anxiety disorders.We conducted a cross-sectional analysis on 3,716 individuals aged 35-66 years previously selected for the population-based CoLaus survey and who agreed to undergo further psychiatric evaluation. SUA was measured using uricase-PAP method. The French translation of the semi-structured Diagnostic Interview for Genetic Studies was used to establish lifetime and current diagnoses of depression and anxiety disorders according to the DSM-IV criteria.Men reported significantly higher levels of SUA compared to women (357±74 µmol/L vs. 263±64 µmol/L. The prevalence of lifetime and current MDD was 44% and 18% respectively while the corresponding estimates for any anxiety disorders were 18% and 10% respectively. A quadratic hockey-stick shaped curve explained the relationship between SUA and social phobia better than a linear trend. However, with regards to the other specific anxiety disorders and other subtypes of MDD, there was no consistent pattern of association. Further analyses using SLC2A9 rs6855911 variant, known to be strongly associated with SUA, supported the quadratic relationship observed between SUA phenotype and social phobia.A quadratic relationship between SUA and social phobia was observed consistent with a protective effect of moderately elevated SUA on social phobia, which disappears at higher concentrations. Further studies are needed to confirm our observations.

  15. Dicty_cDB: SLC832 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC832 (Link to dictyBase) - - - Contig-U13922-1 SLC832Z (Link... to Original site) - - SLC832Z 638 - - - - Show SLC832 Library SL (Link to library) Clone ID SLC832 (Link to dic..._1( EU565733 |pid:none) Uncultured soil bacterium clone gl... 35 2.4 CP000010_276....1 AP009385_2728( AP009385 |pid:none) Burkholderia multivorans ATCC 1... 33 5.3 A... 20.0 %: nuclear 16.0 %: vesicles of secretory system 12.0 %: mitochondrial 8.0 %: Golgi 8.0 %: endoplasmic reticul

  16. Feedback systems in the SLC

    International Nuclear Information System (INIS)

    Thompson, K.A.; Jobe, R.K.; Johnson, R.; Phinney, N.

    1987-02-01

    Two classes of computer-controlled feedback have been implemented to stabilize parameters in subsystems of the SLC: (1) ''slow'' (time scales ∼ minutes) feedback, and (2) ''fast'', i.e., pulse-to-pulse, feedback. The slow loops run in a single FEEDBACK process in the SLC host VAX, which acquires signals and sets control parameters via communication with the database and the network of normal SLC microprocessors. Slow loops exist to stabilize beam energy and energy spread, beam position and angle, and timing of kicker magnets, and to compensate for changes in the phase length of the rf drive line. The fast loops run in dedicated microprocessors, and may sample and/or feedback on particular parameters as often as every pulse of the SLC beam. The first implementations of fast feedback are to control transverse beam blow-up and to stabilize the energy and energy spread of bunches going into the SLC arcs. The overall architecture of the feedback software and the operator interface for controlling loops are discussed

  17. Enhanced Fructose Utilization Mediated by SLC2A5 Is a Unique Metabolic Feature of Acute Myeloid Leukemia with Therapeutic Potential.

    Science.gov (United States)

    Chen, Wen-Lian; Wang, Yue-Ying; Zhao, Aihua; Xia, Li; Xie, Guoxiang; Su, Mingming; Zhao, Linjing; Liu, Jiajian; Qu, Chun; Wei, Runmin; Rajani, Cynthia; Ni, Yan; Cheng, Zhen; Chen, Zhu; Chen, Sai-Juan; Jia, Wei

    2016-11-14

    Rapidly proliferating leukemic progenitor cells consume substantial glucose, which may lead to glucose insufficiency in bone marrow. We show that acute myeloid leukemia (AML) cells are prone to fructose utilization with an upregulated fructose transporter GLUT5, which compensates for glucose deficiency. Notably, AML patients with upregulated transcription of the GLUT5-encoding gene SLC2A5 or increased fructose utilization have poor outcomes. Pharmacological blockage of fructose uptake ameliorates leukemic phenotypes and potentiates the cytotoxicity of the antileukemic agent, Ara-C. In conclusion, this study highlights enhanced fructose utilization as a metabolic feature of AML and a potential therapeutic target. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Importance of high order momentum terms in SLC optics

    International Nuclear Information System (INIS)

    Kozanecki, W.

    1985-01-01

    The evaluation of background levels at the SLC relies, in several cases, on the proper representation of how low momentum electrons propagate through the Arcs and the Final Focus System (FFS). For example, beam - gas bremsstrahlung in the arcs causes electrons of up to 6% energy loss to be transported through to the IP; secondary showers on edges of masks and collimators yield debris with a very wide momentum spectrum. This note is a naive attempt at checking the validity of TRANSPORT and TURTLE calculations, by evaluating the contributions of the momentum terms to increasingly higher order, and checking the mutual consistency of the results produced by the two methods on a beam of wide momentum spread. 8 refs., 4 figs., 1 tab

  19. Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct

    Directory of Open Access Journals (Sweden)

    Yan Xiaofei

    2011-09-01

    Full Text Available Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity. The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity in a Chinese population. Methods In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group, 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group, 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group, and 16 patients with other types of inner ear malformations (IEM group were identified. The coding exons of SLC26A4 were analyzed in all subjects. Results DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%. In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%. There were significant differences in the frequency of SLC26A4 mutation among the groups (P SLC26A4 mutation in the isolated MD group was

  20. Serum uric acid concentrations and SLC2A9 genetic variation in Hispanic children: the Viva La Familia Study.

    Science.gov (United States)

    Voruganti, V Saroja; Laston, Sandra; Haack, Karin; Mehta, Nitesh R; Cole, Shelley A; Butte, Nancy F; Comuzzie, Anthony G

    2015-04-01

    Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it is not known whether the association of serum uric acid with SLC2A9 polymorphisms manifests in children. The aim was to investigate whether variation in serum uric acid is under genetic influence and whether the association with SLC2A9 polymorphisms generalizes to Hispanic children of the Viva La Familia Study. We conducted a genomewide association study with 1.1 million genetic markers in 815 children. We found serum uric acid to be significantly heritable [h(2) ± SD = 0.45 ± 0.08, P = 5.8 × 10(-11)] and associated with SLC2A9 variants (P values between 10(-16) and 10(-7)). Several of the significantly associated polymorphisms were previously identified in studies in adults. We also found positive genetic correlations between serum uric acid and BMI z score (ρG = 0.45, P = 0.002), percentage of body fat (ρG = 0.28, P = 0.04), fat mass (ρG = 0.34, P = 0.02), waist circumference (ρG = 0.42, P = 0.003), and waist-to-height ratio (ρG = 0.46, P = 0.001). Our results show that variation in serum uric acid in Hispanic children is under considerable genetic influence and is associated with obesity-related phenotypes. As in adults, genetic variation in SLC2A9 is associated with serum uric acid concentrations, an important biomarker of renal and cardiovascular disease risk, in Hispanic children. © 2015 American Society for Nutrition.

  1. Nutrient transport in the mammary gland: calcium, trace minerals and water soluble vitamins.

    Science.gov (United States)

    Montalbetti, Nicolas; Dalghi, Marianela G; Albrecht, Christiane; Hediger, Matthias A

    2014-03-01

    Milk nutrients are secreted by epithelial cells in the alveoli of the mammary gland by several complex and highly coordinated systems. Many of these nutrients are transported from the blood to the milk via transcellular pathways that involve the concerted activity of transport proteins on the apical and basolateral membranes of mammary epithelial cells. In this review, we focus on transport mechanisms that contribute to the secretion of calcium, trace minerals and water soluble vitamins into milk with particular focus on the role of transporters of the SLC series as well as calcium transport proteins (ion channels and pumps). Numerous members of the SLC family are involved in the regulation of essential nutrients in the milk, such as the divalent metal transporter-1 (SLC11A2), ferroportin-1 (SLC40A1) and the copper transporter CTR1 (SLC31A1). A deeper understanding of the physiology and pathophysiology of these transporters will be of great value for drug discovery and treatment of breast diseases.

  2. Dicty_cDB: SLC403 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL

  3. A Missense Mutation in SLC45A2 Is Associated with Albinism in Several Small Long Haired Dog Breeds.

    Science.gov (United States)

    Wijesena, Hiruni R; Schmutz, Sheila M

    2015-01-01

    Homozygosity for a large deletion in the solute carrier family 45, member 2 (SLC45A2) gene causes oculocutaneous albinism (OCA) in the Doberman Pinscher breed. An albino Lhasa Apso did not have this g.27141_31223del (CanFam2) deletion in her SLC45A2 sequence. Therefore, SLC45A2 was investigated in this female Lhasa Apso to search for other possible variants that caused her albinism. The albino Lhasa Apso was homozygous for a nonsynonymous substitution in the seventh exon, a c.1478G>A base change that resulted in a glycine to aspartic acid substitution (p.G493D). This mutation was not found in a wolf, a coyote, or any of the 15 other Lhasa Apso dogs or 32 other dogs of breeds related to the Lhasa Apso. However, an albino Pekingese, 2 albino Pomeranians, and an albino mixed breed dog that was small and long haired were also homozygous for the 493D allele. The colored puppies of the albino Lhasa Apso and the colored dam of the 2 albino Pomeranians were heterozygous for this allele. However, an albino Pug was homozygous for the 493G allele and therefore although we suggest the 493D allele causes albinism when homozygous in several small, long haired dog breeds, it does not explain all albinism in dogs. A variant effect prediction for the albino Lhasa Apso confirms that p.G493D is a deleterious substitution, and a topology prediction for SLC45A2 suggests that the 11th transmembrane domain where the 493rd amino acid was located, has an altered structure. © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Hypoxic Stress Upregulates the Expression of Slc38a1 in Brown Adipocytes via Hypoxia-Inducible Factor-1α.

    Science.gov (United States)

    Horie, Tetsuhiro; Fukasawa, Kazuya; Iezaki, Takashi; Park, Gyujin; Onishi, Yuki; Ozaki, Kakeru; Kanayama, Takashi; Hiraiwa, Manami; Kitaguchi, Yuka; Kaneda, Katsuyuki; Hinoi, Eiichi

    2018-01-01

    The availability of amino acid in the brown adipose tissue (BAT) has been shown to be altered under various conditions; however, little is known about the possible expression and pivotal role of amino acid transporters in BAT under physiological and pathological conditions. The present study comprehensively investigated whether amino acid transporters are regulated by obesogenic conditions in BAT in vivo. Moreover, we investigated the mechanism underlying the regulation of the expression of amino acid transporters by various stressors in brown adipocytes in vitro. The expression of solute carrier family 38 member 1 (Slc38a1; gene encoding sodium-coupled neutral amino acid transporter 1) was preferentially upregulated in the BAT of both genetic and acquired obesity mice in vivo. Moreover, the expression of Slc38a1 was induced by hypoxic stress through hypoxia-inducible factor-1α, which is a master transcription factor of the adaptive response to hypoxic stress, in brown adipocytes in vitro. These results indicate that Slc38a1 is an obesity-associated gene in BAT and a hypoxia-responsive gene in brown adipocytes. © 2017 S. Karger AG, Basel.

  5. Overexpression of monocarboxylate transporter-1 (Slc16a1) in mouse pancreatic ß-cells leads to relative hyperinsulinism during exercise

    DEFF Research Database (Denmark)

    Pullen, Timothy J; Sylow, Lykke; Sun, Gao

    2012-01-01

    Exercise-induced hyperinsulinism (EIHI) is an autosomal dominant disorder characterized by inappropriate insulin secretion in response to vigorous physical exercise or pyruvate injection. Activating mutations in the monocarboxylate transporter-1 (MCT1, SLC16A1) promoter have been linked to EIHI....... Expression of this pyruvate transporter is specifically repressed (disallowed) in pancreatic ß-cells, despite nearly universal expression across other tissues. It has been impossible to determine, however, whether EIHI mutations cause MCT1 expression in patient ß-cells. The hypothesis that MCT1 expression...... in ß-cells is sufficient to cause EIHI by allowing entry of pyruvate and triggering insulin secretion thus remains unproven. Therefore, we generated a transgenic mouse capable of doxycycline-induced, ß-cell-specific overexpression of MCT1 to test this model directly. MCT1 expression caused isolated...

  6. Downregulation of SLC7A7 Triggers an Inflammatory Phenotype in Human Macrophages and Airway Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Bianca Maria Rotoli

    2018-03-01

    Full Text Available Lysinuric protein intolerance (LPI is a recessively inherited aminoaciduria caused by mutations of SLC7A7, the gene encoding y+LAT1 light chain of system y+L for cationic amino acid transport. The pathogenesis of LPI is still unknown. In this study, we have utilized a gene silencing approach in macrophages and airway epithelial cells to investigate whether complications affecting lung and immune system are directly ascribable to the lack of SLC7A7 or, rather, mediated by an abnormal accumulation of arginine in mutated cells. When SLC7A7/y+LAT1 was silenced in human THP-1 macrophages and A549 airway epithelial cells by means of short interference RNA (siRNA, a significant induction of the expression and release of the inflammatory mediators IL1β and TNFα was observed, no matter the intracellular arginine availability. This effect was mainly regulated at transcriptional level through the activation of NFκB signaling pathway. Moreover, since respiratory epithelial cells are the important sources of chemokines in response to pro-inflammatory stimuli, the effect of IL1β has been addressed on SLC7A7 silenced A549 cells. Results obtained indicated that the downregulation of SLC7A7/y+LAT1 markedly strengthened the stimulatory effect of the cytokine on CCL5/RANTES expression and release without affecting the levels of CXCL8/IL8. Consistently, also the conditioned medium of silenced THP-1 macrophages activated airway epithelial cells in terms of CCL5/RANTES expression due to the presence of elevated amount of proinflammatory cytokines. In conclusion, our results point to a novel thus far unknown function of SLC7A7/y+LAT1, that, under physiological conditions, besides transporting arginine, may act as a brake to restrain inflammation.

  7. Wire breakage in SLC wire profile monitors

    International Nuclear Information System (INIS)

    Field, C.; McCormick, D.; Raimondi, P.; Ross, M.

    1998-05-01

    Wire scanning beam profile monitors are used at the Stanford Linear Collider (SLC) for emittance preservation control and beam optics optimization. Twenty such scanners have proven most useful for this purpose and have performed a total of 1.5 million scans in the 4 to 6 years since their installation. Most of the essential scanners are equipped with 20 to 40 microm tungsten wires. SLC bunch intensities and sizes often exceed 2 x 10 7 particles/microm 2 (3C/m 2 ). The authors believe that this has caused a number of tungsten wire failures that appear at the ends of the wire, near the wire support points, after a few hundred scans are accumulated. Carbon fibers, also widely used at SLAC, have been substituted in several scanners and have performed well. In this paper, the authors present theories for the wire failure mechanism and techniques learned in reducing the failures

  8. ASCT2 (SLC1A5-Deficient Mice Have Normal B-Cell Development, Proliferation, and Antibody Production

    Directory of Open Access Journals (Sweden)

    Etienne Masle-Farquhar

    2017-05-01

    Full Text Available SLC1A5 (solute carrier family 1, member 5 is a small neutral amino acid exchanger that is upregulated in rapidly proliferating lymphocytes but also in many primary human cancers. Furthermore, cancer cell lines have been shown to require SLC1A5 for their survival in vitro. One of SLC1A5’s primary substrates is the immunomodulatory amino acid glutamine, which plays an important role in multiple key processes, such as energy supply, macromolecular synthesis, nucleotide biosynthesis, redox homeostasis, and resistance against oxidative stress. These processes are also essential to immune cells, including neutrophils, macrophages, B and T lymphocytes. We show here that mice with a stop codon in Slc1a5 have reduced glutamine uptake in activated lymphocytes and primary fibroblasts. B and T cell populations and maturation in resting mice were not affected by absence of SLC1A5. Antibody production in resting and immunized mice and the germinal center response to immunization were also found to be normal. SLC1A5 has been recently described as a novel target for the treatment of a variety of cancers, and our results indicate that inhibition of SLC1A5 in cancer therapy may be tolerated well by the immune system of cancer patients.

  9. Dicty_cDB: SLC413 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4

  10. Modulation of sodium-bicarbonate co-transporter (SLC4A4/NBCe1) protein and mRNA expression in rat's uteri by sex-steroids and at different phases of the oestrous cycle.

    Science.gov (United States)

    Gholami, Khadijeh; Muniandy, Sekaran; Salleh, Naguib

    2014-02-01

    Oestrogen-induced uterine fluid sodium (Na(+)) and bicarbonate (HCO3(-)) secretion may involve SLC4A4. We hypothesized that uterine SLC4A4 expression changes under different sex-steroid influence, therefore may account for the fluctuation in uterine fluid Na(+) and HCO3(-) content throughout the oestrous cycle. The aim of this study is to investigate the differential effects of sex-steroids and oestrous cycle phases on uterine SLC4A4 expression. Adult female WKY rats were ovariectomised and treated with different doses of 17β-oestradiol (E2) (0.2, 2, 20 and 50 μg/ml/day) or progesterone (P4) (4 mg/ml/day) for three consecutive days and 3 days treatment with 0.2 μg/ml/day E2 followed by another 3 days with P4 to mimic the hormonal changes in early pregnancy. Oestrous cycle phases in intact, non-ovariectomised rats were determined by vaginal smear. The animals were then sacrificed and uteri were removed for protein and mRNA expression analyses by Western blotting and Real Time PCR, respectively. SLC4A4 distribution was observed by immunohistochemistry. Treatment with increasing E2 doses resulted in a dose-dependent increase in SLC4A4 protein expression. High SLC4A4 protein and mRNA expression can be seen at estrus. SLC4A4 is distributed mainly at the apical as well as basolateral membranes of the luminal and glandular epithelia following E2 treatment and at Es. Meanwhile, SLC4A4 expression was reduced following P4 treatment and was low at diestrus. High SLC4A4 expression under estrogen dominance may contribute to the increase in uterine fluid Na(+) and HCO3(-) content, while its low expression under P4 dominance may result in vice versa. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. A customized pigmentation SNP array identifies a novel SNP associated with melanoma predisposition in the SLC45A2 gene.

    Directory of Open Access Journals (Sweden)

    Maider Ibarrola-Villava

    Full Text Available As the incidence of Malignant Melanoma (MM reflects an interaction between skin colour and UV exposure, variations in genes implicated in pigmentation and tanning response to UV may be associated with susceptibility to MM. In this study, 363 SNPs in 65 gene regions belonging to the pigmentation pathway have been successfully genotyped using a SNP array. Five hundred and ninety MM cases and 507 controls were analyzed in a discovery phase I. Ten candidate SNPs based on a p-value threshold of 0.01 were identified. Two of them, rs35414 (SLC45A2 and rs2069398 (SILV/CKD2, were statistically significant after conservative Bonferroni correction. The best six SNPs were further tested in an independent Spanish series (624 MM cases and 789 controls. A novel SNP located on the SLC45A2 gene (rs35414 was found to be significantly associated with melanoma in both phase I and phase II (P<0.0001. None of the other five SNPs were replicated in this second phase of the study. However, three SNPs in TYR, SILV/CDK2 and ADAMTS20 genes (rs17793678, rs2069398 and rs1510521 respectively had an overall p-value<0.05 when considering the whole DNA collection (1214 MM cases and 1296 controls. Both the SLC45A2 and the SILV/CDK2 variants behave as protective alleles, while the TYR and ADAMTS20 variants seem to function as risk alleles. Cumulative effects were detected when these four variants were considered together. Furthermore, individuals carrying two or more mutations in MC1R, a well-known low penetrance melanoma-predisposing gene, had a decreased MM risk if concurrently bearing the SLC45A2 protective variant. To our knowledge, this is the largest study on Spanish sporadic MM cases to date.

  12. Dicty_cDB: SLC404 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4

  13. Dicty_cDB: SLC402 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4

  14. Chromatic correction in the SLC bunch length compressors

    International Nuclear Information System (INIS)

    Adolphsen, C.E.; Emma, P.J.; Fieguth, T.H.; Spence, W.L.

    1991-06-01

    The SLC Ring to Linac (RTL) transport lines employ intense bending and strong transverse focusing to produce the momentum compaction needed for bunch length compression prior to S-band acceleration. In the presence of the large rf induced energy spread needed for compression the consequent chromatic effects -- viz. the variation with energy of residual output dispersion and of the RTL transfer matrix, threaten to destroy the small emittances produced by the damping rings. We report on the tuning methods that have been developed and used to implement the sextupole based chromatic correction scheme. 6 refs., 4 figs

  15. Dicty_cDB: SLC481 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS

  16. Mask locations in the SLC final focus region

    International Nuclear Information System (INIS)

    Cence, R.J.

    1983-01-01

    The location of four sets of masks needed to shield against background in the final focus region of the SLC is shown. The main point of this note is to update the results of Miller and Sens taking into account the recent changes that have been made in the optics of the SLC beams. For the latest beam design we use the TRANSPORT output dated 5-13-83. This design assumes that the final bends will form an S about the interaction point and that the final quadrupoles will be superconducting and will be placed about 8 feet from the interaction point

  17. Dicty_cDB: SLC407 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4

  18. Dicty_cDB: SLC405 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT

  19. Dicty_cDB: SLC415 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4

  20. Dicty_cDB: SLC424 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA

  1. Soy-dairy protein blend and whey protein ingestion after resistance exercise increases amino acid transport and transporter expression in human skeletal muscle

    Science.gov (United States)

    Reidy, P. T.; Walker, D. K.; Dickinson, J. M.; Gundermann, D. M.; Drummond, M. J.; Timmerman, K. L.; Cope, M. B.; Mukherjea, R.; Jennings, K.; Volpi, E.

    2014-01-01

    Increasing amino acid availability (via infusion or ingestion) at rest or postexercise enhances amino acid transport into human skeletal muscle. It is unknown whether alterations in amino acid availability, from ingesting different dietary proteins, can enhance amino acid transport rates and amino acid transporter (AAT) mRNA expression. We hypothesized that the prolonged hyperaminoacidemia from ingesting a blend of proteins with different digestion rates postexercise would enhance amino acid transport into muscle and AAT expression compared with the ingestion of a rapidly digested protein. In a double-blind, randomized clinical trial, we studied 16 young adults at rest and after acute resistance exercise coupled with postexercise (1 h) ingestion of either a (soy-dairy) protein blend or whey protein. Phenylalanine net balance and transport rate into skeletal muscle were measured using stable isotopic methods in combination with femoral arteriovenous blood sampling and muscle biopsies obtained at rest and 3 and 5 h postexercise. Phenylalanine transport into muscle and mRNA expression of select AATs [system L amino acid transporter 1/solute-linked carrier (SLC) 7A5, CD98/SLC3A2, system A amino acid transporter 2/SLC38A2, proton-assisted amino acid transporter 1/SLC36A1, cationic amino acid transporter 1/SLC7A1] increased to a similar extent in both groups (P protein blend resulted in a prolonged and positive net phenylalanine balance during postexercise recovery compared with whey protein (P protein synthesis increased similarly between groups. We conclude that, while both protein sources enhanced postexercise AAT expression, transport into muscle, and myofibrillar protein synthesis, postexercise ingestion of a protein blend results in a slightly prolonged net amino acid balance across the leg compared with whey protein. PMID:24699854

  2. Cray XT4: An Early Evaluation for Petascale Scientific Simulation

    International Nuclear Information System (INIS)

    Alam, Sadaf R.; Barrett, Richard F.; Fahey, Mark R.; Kuehn, Jeffery A.; Sankaran, Ramanan; Worley, Patrick H.; Larkin, Jeffrey M.

    2007-01-01

    The scientific simulation capabilities of next generation high-end computing technology will depend on striking a balance among memory, processor, I/O, and local and global network performance across the breadth of the scientific simulation space. The Cray XT4 combines commodity AMD dual core Opteron processor technology with the second generation of Cray's custom communication accelerator in a system design whose balance is claimed to be driven by the demands of scientific simulation. This paper presents an evaluation of the Cray XT4 using microbenchmarks to develop a controlled understanding of individual system components, providing the context for analyzing and comprehending the performance of several petascale-ready applications. Results gathered from several strategic application domains are compared with observations on the previous generation Cray XT3 and other high-end computing systems, demonstrating performance improvements across a wide variety of application benchmark problems.

  3. Dicty_cDB: SLC435 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4

  4. High levels of the type III inorganic phosphate transporter PiT1 (SLC20A1) can confer faster cell adhesion

    OpenAIRE

    Kongsfelt, Iben Boutrup; Byskov, Kristina; Pedersen, Lasse Ebdrup; Pedersen, Lene

    2014-01-01

    The inorganic phosphate transporter PiT1 (SLC20A1) is ubiquitously expressed in mammalian cells. We recently showed that overexpression of human PiT1 was sufficient to increase proliferation of two strict density-inhibited cell lines, murine fibroblastic NIH3T3 and pre-osteoblastic MC3T3-E1 cells, and allowed the cultures to grow to higher cell densities. In addition, upon transformation NIH3T3 cells showed increased ability to form colonies in soft agar. The cellular regulation of PiT1 expre...

  5. Dicty_cDB: SLC411 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e

  6. Vps35-deficiency impairs SLC4A11 trafficking and promotes corneal dystrophy.

    Directory of Open Access Journals (Sweden)

    Wei Liu

    Full Text Available Vps35 (vacuolar protein sorting 35 is a major component of retromer that selectively promotes endosome-to-Golgi retrieval of transmembrane proteins. Dysfunction of retromer is a risk factor for the pathogenesis of Parkinson's disease (PD and Alzheimer's disease (AD. However, Vps35/retromer's function in the eye or the contribution of Vps35-deficiency to eye degenerative disorders remains to be explored. Here we provide evidence for a critical role of Vps35 in mouse corneal dystrophy. Vps35 is expressed in mouse and human cornea. Mouse cornea from Vps35 heterozygotes (Vps35+/- show features of dystrophy, such as loss of both endothelial and epithelial cell densities, disorganizations of endothelial, stroma, and epithelial cells, excrescences in the Descemet membrane, and corneal edema. Additionally, corneal epithelial cell proliferation was reduced in Vps35-deficient mice. Intriguingly, cell surface targeting of SLC4A11, a membrane transport protein (OH- /H+ /NH3 /H2O of corneal endothelium, whose mutations have been identified in patients with corneal dystrophy, was impaired in Vps35-deficient cells and cornea. Taken together, these results suggest that SLC4A11 appears to be a Vps35/retromer cargo, and Vps35-regulation of SLC4A11 trafficking may underlie Vps35/retromer regulation of corneal dystrophy.

  7. Dicty_cDB: SLC420 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT

  8. Dicty_cDB: SLC409 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4

  9. Dicty_cDB: SLC485 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4

  10. Evolutionary relationships and functional diversity of plant sulfate transporters

    Directory of Open Access Journals (Sweden)

    Hideki eTakahashi

    2012-01-01

    Full Text Available Sulfate is an essential nutrient cycled in nature. Ion transporters that specifically facilitate the transport of sulfate across the membranes are found ubiquitously in living organisms. The phylogenetic analysis of known sulfate transporters and their homologous proteins from eukaryotic organisms indicate two evolutionarily distinct groups of sulfate transport systems. One major group named Tribe 1 represents yeast and fungal SUL, plant SULTR and animal SLC26 families. The evolutionary origin of SULTR family members in land plants and green algae is suggested to be common with yeast and fungal sulfate transporters (SUL and animal anion exchangers (SLC26. The lineage of plant SULTR family is expanded into four subfamilies (SULTR1 to SULTR4 in land plant species. By contrast, the putative SULTR homologues from Chlorophyte green algae are in two separate lineages; one with the subfamily of plant tonoplast-localized sulfate transporters (SULTR4, and the other diverged before the appearance of lineages for SUL, SULTR and SLC26. There also was a group of yet undefined members of putative sulfate transporters in yeast and fungi divergent from these major lineages in Tribe 1. The other distinct group is Tribe 2, primarily composed of animal sodium-dependent sulfate/carboxylate transporters (SLC13 and plant tonoplast-localized dicarboxylate transporters (TDT. The putative sulfur-sensing protein (SAC1 and SAC1-like transporters (SLT of Chlorophyte green algae, bryophyte and lycophyte show low degrees of sequence similarities with SLC13 and TDT. However, the phylogenetic relationship between SAC1/SLT and the other two families, SLC13 and TDT in Tribe 2, is not clearly supported. In addition, the SAC1/SLT family is completely absent in the angiosperm species analyzed. The present study suggests distinct evolutionary trajectories of sulfate transport systems for land plants and green algae.

  11. Impact of nuclear data uncertainties on neutronics parameters of MYRRHA/XT-ADS

    International Nuclear Information System (INIS)

    Sugawara, T.; Stankovskiy, A.; Van den Eynde, G.; Sarotto, M.

    2011-01-01

    A flexible fast spectrum research reactor MYRRHA able to operate in subcritical (driven by a proton accelerator) and critical modes is being developed in SCK-CEN. In the framework of IP EUROTRANS programme the XT-ADS model has been investigated for MYRRHA. This paper reports the comparison of the sensitivity coefficients calculated for different calculation models and the uncertainties deduced from various covariance data for the discussion on the reliability of XT-ADS neutronics design. Sensitivity analysis is based on the comparison of three-dimensional heterogeneous and two-dimensional RZ calculation models. Three covariance data sets were employed to perform uncertainty analysis. The obtained sensitivity coefficients differ substantially between the 3D heterogeneous and RZ homogenized calculation models. The uncertainties deduced from the covariance data strongly depend on the covariance data variation. The covariance data of the nuclear data libraries is an open issue to discuss the reliability of the neutronics design. The uncertainties deduced from the covariance data for XT-ADS are 0.94% and 1.9% by the SCALE-6 44-group and TENDL-2009 covariance data, accordingly. The uncertainties exceed the 0.3% Δk (confidence level 1σ) target accuracy level. To achieve this target accuracy, the uncertainties should be improved by experiments under adequate conditions such as LBE or Pb moderated environment with MOX or Uranium fuel

  12. No-carrier-added (NCA) synthesis of 6-[18F]fluoro-L-DOPA using 3,5,6,7,8,8a-hexahydro-7,7,8a-trimethyl-[6S-(6α, 8α, 8αβ)]-6,8-methano-2H-1,4-benzoxazin-2-one

    International Nuclear Information System (INIS)

    Horti, A.; Yale Univ., West Haven, CT; Redmond, D.E. Jr.; Soufer, R.

    1995-01-01

    3,5,6,7,8,8a-Hexahydro-7,7,8a-trimethyl-[6S-(6α,8α , 8αβ)]-6,8-methano-2H-1,4-benzoxazino-2-one (2) was investigated as chiral auxiliary for asymmetric NCA nucleophilic synthesis of 6-[ 18 F]Fluoro-L-DOPA. Direct condensation of 3,4-dimethoxy-2-[ 18 F]fluorobenzaldehyde (1a) or 6-[ 18 F]fluoro-piperonal (1b) in the presence of NaH with 2 gave the corresponding [ 18 F]-3-[(2-fluorophenyl)methylene]-3,5,6,7,8,8a-hexahydro-7,7,8 a-trimethyl-[6S-(3Z,3α,6α,8α,8αβ)]-6, 8-methano-2H-1,4-benzoxazin-2-one derivative 3a or 3b as a single stereoisomer. L-Selectride promoted hydrogenation of the olefinic double bond of these derivatives, in presence of tertbutyl alcohol, afforded the corresponding [ 18 F]-3-[(2-fluorophenyl) methyl]-3,5,6,7,8,8a-hexahydro-7,7,8a-trimethyl-[3S-(3α, 6α, 8α8αβ)]-6,8-methano-2H-1,4-benzoxazin-2-one derivatives (4a,b) without affecting the orientation of diasterofacial discrimination. Deprotection of the derivatives 4a,b yielded 6-[ 18 F]fluoro-L-DOPA (e.e. >90%, 3% radiochemical yield (EOB), total synthesis time 125 min, specific activity >2000 mCi/μmol). Direct deprotection/reduction of the compounds 3a,b provides the enantiomeric mixture of 6-[ 18 F]fluoro-D,L-DOPA (10-12% radiochemical yield) and, after chiral separation, 6-[ 18 F]fluoro-L-DOPA (e.e. 98%, 4-5% radiochemical yield). (author)

  13. Association between SLC2A9 (GLUT9) gene polymorphisms and gout susceptibility: an updated meta-analysis.

    Science.gov (United States)

    Zhang, Xu; Yang, Xiao; Wang, Mengmeng; Li, Xiaona; Xia, Qing; Xu, Shengqian; Xu, Jianhua; Cai, Guoqi; Wang, Li; Xin, Lihong; Zou, Yanfeng; Pan, Faming

    2016-08-01

    The relationship between the SLC2A9 (solute carrier family 2, member 9) gene polymorphisms and gout was still inconsistent among the individual genetic association studies. Therefore, this present research was aimed to systematically evaluate the association between SLC2A9 gene polymorphisms and gout susceptibility. Relevant studies were enrolled by searching databases systematically. The pooled odds ratios (ORs) with 95 % confidence intervals (CIs) were used to assess the associations. The heterogeneity between each of the studies was calculated by using the Q statistic methods, and Begg's funnel plot and Egger's tests were performed to evaluate publication bias. A total of 13 studies investigated four single nucleotide polymorphisms (SNPs) in SLC2A9 were included. In this study, we found that the allele C of rs3733591 was higher in patients than in controls in both all-pooled population [C vs. T: OR (95 % CI) = 1.432 (1.213-1.691)] and Asians-pooled population [C vs. T: OR (95 % CI) = 1.583 (1.365-1.835)]. The allele frequency C of s6449213 was lower in the gout patients than in controls in both all-pooled population and Caucasians-pooled population. Additionally, the allele frequency T of rs16890979 and the allele frequency C of rs1014290 were lower in gout patients than in controls. This study demonstrated that the genetic susceptibility for gout is associated with the SLC2A9 gene polymorphisms. Four of them except for the rs3733591 are protective SNPs in Caucasians, and rs16890979 and rs1014290 are protective SNPs in both Caucasians and Asians, while rs3733591 may be susceptibility SNP in Asians.

  14. Serum uric acid concentrations and SLC2A9 genetic variation in Hispanic children: the Viva La Familia Study1234

    Science.gov (United States)

    Voruganti, V Saroja; Laston, Sandra; Haack, Karin; Mehta, Nitesh R; Cole, Shelley A; Butte, Nancy F; Comuzzie, Anthony G

    2015-01-01

    Background: Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it is not known whether the association of serum uric acid with SLC2A9 polymorphisms manifests in children. Objective: The aim was to investigate whether variation in serum uric acid is under genetic influence and whether the association with SLC2A9 polymorphisms generalizes to Hispanic children of the Viva La Familia Study. Design: We conducted a genomewide association study with 1.1 million genetic markers in 815 children. Results: We found serum uric acid to be significantly heritable [h2 ± SD = 0.45 ± 0.08, P = 5.8 × 10−11] and associated with SLC2A9 variants (P values between 10−16 and 10−7). Several of the significantly associated polymorphisms were previously identified in studies in adults. We also found positive genetic correlations between serum uric acid and BMI z score (ρG = 0.45, P = 0.002), percentage of body fat (ρG = 0.28, P = 0.04), fat mass (ρG = 0.34, P = 0.02), waist circumference (ρG = 0.42, P = 0.003), and waist-to-height ratio (ρG = 0.46, P = 0.001). Conclusions: Our results show that variation in serum uric acid in Hispanic children is under considerable genetic influence and is associated with obesity-related phenotypes. As in adults, genetic variation in SLC2A9 is associated with serum uric acid concentrations, an important biomarker of renal and cardiovascular disease risk, in Hispanic children. PMID:25833971

  15. Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis

    Directory of Open Access Journals (Sweden)

    Wu Bailin

    2008-11-01

    Full Text Available Abstract Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135 were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43 of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135 of the patients with hearing loss. Together with GJB2 (23/135, SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the

  16. Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis

    Science.gov (United States)

    Dai, Pu; Yuan, Yongyi; Huang, Deliang; Zhu, Xiuhui; Yu, Fei; Kang, Dongyang; Yuan, Huijun; Wu, Bailin; Han, Dongyi; Wong, Lee-Jun C

    2008-01-01

    Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135) were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43) of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135) of the patients with hearing loss. Together with GJB2 (23/135), SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the temporal bone CT scan to

  17. Clinical presentation and outcome of riboflavin transporter deficiency: mini review after five years of experience

    NARCIS (Netherlands)

    Jaeger, Bregje; Bosch, Annet M.

    2016-01-01

    Riboflavin (vitamin B2) is absorbed in the small intestine by the human riboflavin transporters RFVT1 and RFVT3. A third riboflavin transporter (RFVT2) is expressed in the brain. In 2010 it was demonstrated that mutations in the riboflavin transporter genes SLC52A2 (coding for RFVT2) and SLC52A3

  18. Dicyclohexano-18-crown-6 as a novel carrier in the liquid membrane permeation of actinides

    International Nuclear Information System (INIS)

    Kumar, Anil; Singh, R.K.; Bajpai, D.D.; Shukla, J.P.

    1994-01-01

    The proven extractability and profound selectivity of dicyclohexano-18-crown-6 (DC18C6) has been exploited by selecting this crown ether as the ionophore in liquid membrane transport. Macrocycle-facilitated transport of Pu(IV) and U(VI) against their concentration gradient from aqueous nitric acid solutions across organic bulk liquid membrane (BLM) and thin-sheet supported liquid membrane (SLM) containing DC18C6 as the mobile carrier and toluene as the membrane solvent was investigated. (author). 23 refs., 9 tabs., 7 figs

  19. Chemical consequences resulting from multi-millicurie preparation of 6-[18F]-fluoro-6-deoxy-L-ascorbic acid

    International Nuclear Information System (INIS)

    Kothari, P.J.; Finn, R.D.; Bornmann, W.G.; Agus, D.B.; Vera, J.C.; Larson, S.M.

    1997-01-01

    Ascorbic acid is required for human physiology and is particularly important in maintaining normal connective tissue and host defense. Our interest in this carboxylic acid stems from its similarity in transport with glucose in human cells. In order to investigate these phenomena, we report a refined synthesis of 6-[ 18 F]-fluoro-6-deoxy-L-ascorbic acid ( 18 F-FAA) via nucleophilic displacement of the cyclic sulfate with Kryptofix 2.2.2/K 18 F complex which results in multi-millicurie quantities of high specific activity product. The trace carrier-added synthesis has resulted in a decay corrected radiochemical yield of 31.6±3.4% with a specific activity approaching 180 mCi/μmol. Our preliminary experience with the assessment of the chemical stability of both the radiolabelled and stable product is also presented. (orig.)

  20. Evolutionary relationships and functional diversity of plant sulfate transporters.

    Science.gov (United States)

    Takahashi, Hideki; Buchner, Peter; Yoshimoto, Naoko; Hawkesford, Malcolm J; Shiu, Shin-Han

    2011-01-01

    Sulfate is an essential nutrient cycled in nature. Ion transporters that specifically facilitate the transport of sulfate across the membranes are found ubiquitously in living organisms. The phylogenetic analysis of known sulfate transporters and their homologous proteins from eukaryotic organisms indicate two evolutionarily distinct groups of sulfate transport systems. One major group named Tribe 1 represents yeast and fungal SUL, plant SULTR, and animal SLC26 families. The evolutionary origin of SULTR family members in land plants and green algae is suggested to be common with yeast and fungal SUL and animal anion exchangers (SLC26). The lineage of plant SULTR family is expanded into four subfamilies (SULTR1-SULTR4) in land plant species. By contrast, the putative SULTR homologs from Chlorophyte green algae are in two separate lineages; one with the subfamily of plant tonoplast-localized sulfate transporters (SULTR4), and the other diverged before the appearance of lineages for SUL, SULTR, and SLC26. There also was a group of yet undefined members of putative sulfate transporters in yeast and fungi divergent from these major lineages in Tribe 1. The other distinct group is Tribe 2, primarily composed of animal sodium-dependent sulfate/carboxylate transporters (SLC13) and plant tonoplast-localized dicarboxylate transporters (TDT). The putative sulfur-sensing protein (SAC1) and SAC1-like transporters (SLT) of Chlorophyte green algae, bryophyte, and lycophyte show low degrees of sequence similarities with SLC13 and TDT. However, the phylogenetic relationship between SAC1/SLT and the other two families, SLC13 and TDT in Tribe 2, is not clearly supported. In addition, the SAC1/SLT family is absent in the angiosperm species analyzed. The present study suggests distinct evolutionary trajectories of sulfate transport systems for land plants and green algae.

  1. DNA methylation of amino acid transporter genes in the human placenta.

    Science.gov (United States)

    Simner, C; Novakovic, B; Lillycrop, K A; Bell, C G; Harvey, N C; Cooper, C; Saffery, R; Lewis, R M; Cleal, J K

    2017-12-01

    Placental transfer of amino acids via amino acid transporters is essential for fetal growth. Little is known about the epigenetic regulation of amino acid transporters in placenta. This study investigates the DNA methylation status of amino acid transporters and their expression across gestation in human placenta. BeWo cells were treated with 5-aza-2'-deoxycytidine to inhibit methylation and assess the effects on amino acid transporter gene expression. The DNA methylation levels of amino acid transporter genes in human placenta were determined across gestation using DNA methylation array data. Placental amino acid transporter gene expression across gestation was also analysed using data from publically available Gene Expression Omnibus data sets. The expression levels of these transporters at term were established using RNA sequencing data. Inhibition of DNA methylation in BeWo cells demonstrated that expression of specific amino acid transporters can be inversely associated with DNA methylation. Amino acid transporters expressed in term placenta generally showed low levels of promoter DNA methylation. Transporters with little or no expression in term placenta tended to be more highly methylated at gene promoter regions. The transporter genes SLC1A2, SLC1A3, SLC1A4, SLC7A5, SLC7A11 and SLC7A10 had significant changes in enhancer DNA methylation across gestation, as well as gene expression changes across gestation. This study implicates DNA methylation in the regulation of amino acid transporter gene expression. However, in human placenta, DNA methylation of these genes remains low across gestation and does not always play an obvious role in regulating gene expression, despite clear evidence for differential expression as gestation proceeds. Copyright © 2017. Published by Elsevier Ltd.

  2. OCT2 and MATE1 Provide Bi-directional Agmatine Transport

    Science.gov (United States)

    Winter, Tate N.; Elmquist, William F.; Fairbanks, Carolyn A.

    2015-01-01

    Agmatine is a biogenic amine (l-arginine metabolite) of potential relevance to several central nervous system (CNS) conditions. The identities of transporters underlying agmatine and polyamine disposition in mammalian systems are not well defined. The SLC-family organic cation transporters (OCT) OCT1 and OCT2 and multidrug and toxin extrusion transporter-1 (MATE1) are transport systems that may be of importance for the cellular disposition of agmatine and putrescine. We investigated the transport of [3H]-agmatine and [3H]-putrescine in human embryonic kidney (HEK293) cells stably-transfected with hOCT1-, hOCT2-, and hMATE1. Agmatine transport by hOCT1 and hOCT2 was concentration-dependent, whereas only hOCT2 demonstrated pH-dependent transport. hOCT2 exhibited a greater affinity for agmatine (Km = 1.84 ± 0.38 mM) than did hOCT1 (Km = 18.73 ± 4.86 mM). Putrescine accumulation was pH- and concentration-dependent in hOCT2-HEK cells (Km = 11.29 ± 4.26 mM) but not hOCT1-HEK cells. Agmatine accumulation, in contrast to putrescine, was significantly enhanced by hMATE1 over-expression, and was saturable (Km = 240 ± 31 μM; Vmax = 192 ± 10 pmol/min/mg protein). Intracellular agmatine was also trans-stimulated (effluxed) from hMATE1-HEK cells in the presence of an inward proton-gradient. The hMATE1-mediated transport of agmatine was inhibited by polyamines, the prototypical substrates MPP+ and paraquat, as well as guanidine and arcaine, but not l-arginine. These results suggest that agmatine disposition may be influenced by hOCT2 and hMATE1, two transporters critical in the renal elimination of xenobiotic compounds. PMID:21128598

  3. Dicty_cDB: SLC495 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C

  4. Genetic polymorphisms associated to folate transport as predictors of increased risk for acute lymphoblastic leukemia in Mexican children

    Directory of Open Access Journals (Sweden)

    Fausto Zaruma-Torres

    2016-08-01

    Full Text Available Acute lymphoblastic leukemia (ALL is a frequent neoplasia occurring in children. The most commonly used drug for the treatment of ALL is methotrexate (MTX, an anti-folate agent. Previous studies suggest that folate transporters play a role in ALL prognosis and that genetic polymorphism of genes encoding folate transporters may increase the risk of ALL. Therefore, the main goal of this study was to determine the associations among six genetic polymorphisms in four genes related with the folate transporter pathway to determine a relationship with the occurrence of ALL in Mexican children.A case-control study was performed in 73 ALL children and 133 healthy children from Northern and Northwestern Mexico. COL18A1 (rs2274808, SLC19A1 (rs2838956, ABCB1 (rs1045642 and rs1128503 and ABCC5 (rs9838667 and rs3792585. polymorphisms were assayed through qPCR.Our results showed an increased ALL risk in children carrying CT genotype (OR=2.55, CI 95% 1.11-5.83, p=0.0001 and TT genotype (OR=21.05, CI 95% 5.62-78.87, p<0.0001 of COL18A1 rs2274808; in SLC19A1 rs2838956 AG carriers (OR=44.69, CI 95% 10.42-191.63, p=0.0001; in ABCB1 rs1045642 TT carriers (OR=13.76, CI 95% 5.94-31.88, p=0.0001; in ABCC5 rs9838667 AC carriers (OR=2.61, CI 95% 1.05-6.48, p<0.05; and in ABCC5 rs3792585 CC carriers (OR=9.99, CI 95% 3.19-31.28, p=0.004. Moreover, several combinations of genetic polymorphisms were found to be significantly associated with a risk for ALL. Finally, two combinations of ABCC5 polymorphisms resulted in protection from this neoplasia.In conclusion, certain genetic polymorphisms related to the folate transport pathway, particularly COL18A1 rs2274808, SLC19A1 rs2838956, ABCB1 rs1045642 and ABCC5 rs3792585, were associated with an increased risk for ALL in Mexican children.

  5. Identification of E6-generated Z' from combined CHARM II, LEP 1, SLC high-precision measurements

    International Nuclear Information System (INIS)

    Lynn, B.W.; Renard, F.M.; Verzegnassi, C.

    1988-01-01

    We show that a combined analysis of three specific longitudinal polarization asymmetries in electron-positron annihilation on Z 0 resonance, of the mass ratio M w /M z and of the neutrino-electron neutral cross-section ratio, which could be measured in the near future at SLC, LEP, ACOL and CHARM II, would lead to a well-defined identification of a single new E 6 -generated Z'. In particular, it might be possible to disentangle a superstring-inspired model from other currently considered possibilities down to values of the mixing angle vertical strokeθ η vertical stroke = 0.02 and, at the same time, to fix the mass ratio ε = M Z 2 /Msub(Z') 2 with known accuracy. (orig.)

  6. Dicty_cDB: SLC443 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4

  7. Dicty_cDB: SLC429 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q

  8. Dicty_cDB: SLC428 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0

  9. The gene expression of the neuronal protein, SLC38A9, changes in mouse brain after in vivo starvation and high-fat diet.

    Directory of Open Access Journals (Sweden)

    Sofie V Hellsten

    Full Text Available SLC38A9 is characterized as a lysosomal component of the amino acid sensing Ragulator-RAG GTPase complex, controlling the mechanistic target of rapamycin complex 1 (mTORC1. Here, immunohistochemistry was used to map SLC38A9 in mouse brain and staining was detected throughout the brain, in cortex, hypothalamus, thalamus, hippocampus, brainstem and cerebellum. More specifically, immunostaining was found in areas known to be involved in amino acid sensing and signaling pathways e.g. piriform cortex and hypothalamus. SLC38A9 immunoreactivity co-localized with both GABAergic and glutamatergic neurons, but not with astrocytes. SLC38A9 play a key role in the mTORC1 pathway, and therefore we performed in vivo starvation and high-fat diet studies, to measure gene expression alterations in specific brain tissues and in larger brain regions. Following starvation, Slc38a9 was upregulated in brainstem and cortex, and in anterior parts of the brain (Bregma 3.2 to -2.1mm. After high-fat diet, Slc38a9 was specifically upregulated in hypothalamus, while overall downregulation was noticed throughout the brain (Bregma 3.2 to -8.6mm.

  10. Dicty_cDB: SLC494 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4

  11. The blood-brain barrier fatty acid transport protein 1 (FATP1/SLC27A1) supplies docosahexaenoic acid to the brain, and insulin facilitates transport.

    Science.gov (United States)

    Ochiai, Yusuke; Uchida, Yasuo; Ohtsuki, Sumio; Tachikawa, Masanori; Aizawa, Sanshiro; Terasaki, Tetsuya

    2017-05-01

    We purposed to clarify the contribution of fatty acid transport protein 1 (FATP1/SLC 27A1) to the supply of docosahexaenoic acid (DHA) to the brain across the blood-brain barrier in this study. Transport experiments showed that the uptake rate of [ 14 C]-DHA in human FATP1-expressing HEK293 cells was significantly greater than that in empty vector-transfected (mock) HEK293 cells. The steady-state intracellular DHA concentration was nearly 2-fold smaller in FATP1-expressing than in mock cells, suggesting that FATP1 works as not only an influx, but also an efflux transporter for DHA. [ 14 C]-DHA uptake by a human cerebral microvascular endothelial cell line (hCMEC/D3) increased in a time-dependent manner, and was inhibited by unlabeled DHA and a known FATP1 substrate, oleic acid. Knock-down of FATP1 in hCMEC/D3 cells with specific siRNA showed that FATP1-mediated uptake accounts for 59.2-73.0% of total [ 14 C]-DHA uptake by the cells. Insulin treatment for 30 min induced translocation of FATP1 protein to the plasma membrane in hCMEC/D3 cells and enhanced [ 14 C]-DHA uptake. Immunohistochemical analysis of mouse brain sections showed that FATP1 protein is preferentially localized at the basal membrane of brain microvessel endothelial cells. We found that two neuroprotective substances, taurine and biotin, in addition to DHA, undergo FATP1-mediated efflux. Overall, our results suggest that FATP1 localized at the basal membrane of brain microvessels contributes to the transport of DHA, taurine and biotin into the brain, and insulin rapidly increases DHA supply to the brain by promoting translocation of FATP1 to the membrane. Read the Editorial Comment for this article on page 324. © 2016 International Society for Neurochemistry.

  12. Dicty_cDB: SLC458 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743

  13. Dicty_cDB: SLC451 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4

  14. Dicty_cDB: SLC474 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se

  15. Dicty_cDB: SLC425 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4

  16. Dicty_cDB: SLC483 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651

  17. Dicty_cDB: SLC434 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4

  18. Dicty_cDB: SLC450 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V

  19. Dicty_cDB: SLC469 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4

  20. Dicty_cDB: SLC452 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4

  1. Dicty_cDB: SLC473 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4

  2. Dicty_cDB: SLC487 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4

  3. Dicty_cDB: SLC455 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4

  4. Dicty_cDB: SLC431 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4

  5. Dicty_cDB: SLC465 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG

  6. Dicty_cDB: SLC426 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG

  7. Dicty_cDB: SLC464 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4

  8. Dicty_cDB: SLC477 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4

  9. Dicty_cDB: SLC492 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT

  10. Dicty_cDB: SLC432 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA

  11. No-carrier-added (NCA) synthesis of 6-[{sup 18}F]fluoro-L-DOPA using 3,5,6,7,8,8a-hexahydro-7,7,8a-trimethyl-[6S-(6{alpha}, 8{alpha}, 8{alpha}{beta})]-6,8-methano-2H-1,4-benzoxazin-2-one

    Energy Technology Data Exchange (ETDEWEB)

    Horti, A. [Yale Univ., New Haven, CT (United States). School of Medicine]|[Yale Univ., West Haven, CT (United States). PET Center; Redmond, D.E. Jr. [Yale Univ., New Haven, CT (United States). School of Medicine; Soufer, R. [Yale Univ., West Haven, CT (United States). PET Center

    1995-12-31

    3,5,6,7,8,8a-Hexahydro-7,7,8a-trimethyl-[6S-(6{alpha},8{alpha} , 8{alpha}{beta})]-6,8-methano-2H-1,4-benzoxazino-2-one (2) was investigated as chiral auxiliary for asymmetric NCA nucleophilic synthesis of 6-[{sup 18}F]Fluoro-L-DOPA. Direct condensation of 3,4-dimethoxy-2-[{sup 18}F]fluorobenzaldehyde (1a) or 6-[{sup 18}F]fluoro-piperonal (1b) in the presence of NaH with 2 gave the corresponding [{sup 18}F]-3-[(2-fluorophenyl)methylene]-3,5,6,7,8,8a-hexahydro-7,7,8 a-trimethyl-[6S-(3Z,3{alpha},6{alpha},8{alpha},8{alpha}{beta})]-6, 8-methano-2H-1,4-benzoxazin-2-one derivative 3a or 3b as a single stereoisomer. L-Selectride promoted hydrogenation of the olefinic double bond of these derivatives, in presence of tertbutyl alcohol, afforded the corresponding [{sup 18}F]-3-[(2-fluorophenyl) methyl]-3,5,6,7,8,8a-hexahydro-7,7,8a-trimethyl-[3S-(3{alpha}, 6{alpha}, 8{alpha}8{alpha}{beta})]-6,8-methano-2H-1,4-benzoxazin-2-one derivatives (4a,b) without affecting the orientation of diasterofacial discrimination. Deprotection of the derivatives 4a,b yielded 6-[{sup 18}F]fluoro-L-DOPA (e.e. >90%, 3% radiochemical yield (EOB), total synthesis time 125 min, specific activity >2000 mCi/{mu}mol). Direct deprotection/reduction of the compounds 3a,b provides the enantiomeric mixture of 6-[{sup 18}F]fluoro-D,L-DOPA (10-12% radiochemical yield) and, after chiral separation, 6-[{sup 18}F]fluoro-L-DOPA (e.e. 98%, 4-5% radiochemical yield). (author).

  12. Dicty_cDB: SLC478 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4

  13. Dicty_cDB: SLC448 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4

  14. Study of Sr sup 2+ and Eu sup 2+ complexing with 18-crown-6 in aqueous-ethanolic solutions. Izuchenie kompleksoobrazovaniya Sr sup 2+ i Eu sup 2+ s 18-kraun-6 v vodno-ehtanol'nykh rastvorakh

    Energy Technology Data Exchange (ETDEWEB)

    Kulyukhin, S A; Majorov, A V; Kamenskaya, A N; Mikheev, N B

    1989-01-01

    Using cocrystallization and conductometry methods Sr{sup 2+} and Eu{sup 2+} complexing with 18-crown-6 in aqueous-ethanolic solutions at (H{sub 2}O)=10 mol/l is studied. Stability constants of Sr{sup 2+} and Eu{sup 2+} complexes with 18-crown-6 in C{sub 2}H{sub 5}OH, for which lg{beta} is equal to (4.76{plus minus}0.12) and (4.72{plus minus}0.13) respectively, are determined. Comparison of the investigated elements features during complexing with 18-crown-6 in aqueous and aqueous-ethanolic solutions is carried out. It is shown that both in water and in C{sub 2}H{sub 5}OH -10 mol/l H{sub 2}O system under Sr{sup 2+} and Eu{sup 2+} complexing with 18-crown-6 the differences in properties of these elements are not detected.

  15. Dicty_cDB: SLC438 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC438 (Link to dictyBase) - - - Contig-U10771-1 SLC438Z (Link... to Original site) - - SLC438Z 549 - - - - Show SLC438 Library SL (Link to library) Clone ID SLC438 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC438Q.Seq.d/ Representative seq. ID SLC43...8Z (Link to Original site) Representative DNA sequence >SLC438 (SLC438Q) /CSM/SL/SLC4-B/SLC438Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSM825 (SSM825Q) /CSM/SS/SSM8-B/SSM825Q.Seq.d/ 948 0.0 SLC438 (SLC4

  16. Dicty_cDB: SLC440 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA

  17. Dicty_cDB: SLC480 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC480 (Link to dictyBase) - - - Contig-U13538-1 SLC480Z (Link... to Original site) - - SLC480Z 455 - - - - Show SLC480 Library SL (Link to library) Clone ID SLC480 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC480Q.Seq.d/ Representative seq. ID SLC48...0Z (Link to Original site) Representative DNA sequence >SLC480 (SLC480Q) /CSM/SL/SLC4-D/SLC480Q.Seq.d/ XXXXX...ial 8.0 %: peroxisomal >> prediction for SLC480 is nuc 5' end seq. ID - 5' end seq. - Length of 5' end seq. - 3' end seq. ID SLC4

  18. Morphological study on dental caries induced in WBN/KobSlc rats (Rattus norvegicus) fed a standard laboratory diet.

    Science.gov (United States)

    Fukuzato, Yoko; Matsuura, Tetsuro; Ozaki, Kiyokazu; Matsuura, Masahiro; Sano, Tomoya; Nakahara, Yutaka; Kodama, Yasushi; Nakagawa, Akihito; Okamura, Sumie; Suido, Hirohisa; Torii, Kayo; Makino, Taketoshi; Narama, Isao

    2009-10-01

    In our previous studies, WBN/KobSlc was characterized as a rat strain in which only males began to develop pancreatitis, and then presented with diabetic symptoms. In the course of studying their pancreatic inflammation, we detected molar caries in prediabetic males feeding on a standard diet (CRF-1) widely used for experimental animals. The purpose of this study is to confirm whether the WBN/KobSlc strain is caries-susceptible to the diet reported to be non-cariogenic, and to examine the effect of a prediabetic condition on their dental caries. For a morphological study, 25 male WBN/KobSlc rats aged 3.2-7.8 months and 24 females of the same strain aged 3.3-6.6 months were used, along with 10 males and 10 females of 8.2-month-old F344 rats. Marked dental caries were detected in the mandibular molars of male and female WBN/KobSlc rats regardless of pancreatitis, although no similar changes were observed in any teeth of the F344 strain fed the same diet. Soft X-ray examination revealed that the caries began in the crown and progressed horizontally and vertically, and that a severe radiolucent lesion extensively expanded to the entire crown, corresponding to a macroscopically deleted molar. The caries had gradually developed mainly in the second mandibular molar from more than 3.5 months of age, while none were seen in any rats before that time. The WBN/KobSlc rats were caries-susceptible even to the standard laboratory diet, and pancreatitis was not directly associated with the onset of dental caries in this strain.

  19. A genetic-demographic approach reveals a gender-specific association of SLC6A3/DAT1 40 bp-VNTR with life-expectancy.

    Science.gov (United States)

    Hadi, Fazal; Dato, Serena; Carpi, Francesco M; Prontera, Paolo; Crucianelli, Francesca; Renda, Federica; Passarino, Giuseppe; Napolioni, Valerio

    2015-06-01

    Several recent lines of evidence are proving an important role for dopamine in the aging process and in the determination of life span. Components of the dopaminergic system may represent good candidates for longevity studies. Herein, we tested the possible association of the functional SLC6A3/DAT1 40-bp VNTR with life-expectancy in a healthy population of Central Italy (N = 993) by applying a genetic-demographic approach that takes into account the demographic information and different survival rates between sexes for modeling the survival of specific allele carriers in the population. Male carriers of S*/S* genotype showed a lower survival chance across most of the lifespan respect to the survival of DAT1*L-carriers (P = 0.021). The same analyses gave non-significant results in females. Several studies already reported significant sex differences in dopamine metabolism and its related biological pathways. Thus, we can hypothesize that the SLC6A3/DAT1 40 bp-VNTR may affect life expectancy in a sex-specific way. Moreover, it is conceivable that DAT1 S*/S* carriers, who are prone to assume "risk" type behaviors, may be dropped out of the "healthy" population by a sort of "demographic selection".

  20. {sup 18}F-FBPA as a tumor-specific probe of L-type amino acid transporter 1 (LAT1): a comparison study with {sup 18}F-FDG and {sup 11}C-Methionine PET

    Energy Technology Data Exchange (ETDEWEB)

    Watabe, Tadashi [Osaka University Graduate School of Medicine, Department of Nuclear Medicine and Tracer Kinetics, Osaka (Japan); Osaka University Graduate School of Medicine, PET Molecular Imaging Center, Osaka (Japan); Ikeda, Hayato; Aoki, Masanao [Osaka University Graduate School of Medicine, Department of Nuclear Medicine and Tracer Kinetics, Osaka (Japan); Nagamori, Shushi; Wiriyasermkul, Pattama; Tanaka, Yoko; Hagiwara, Kohei; Kanai, Yoshikatsu [Osaka University Graduate School of Medicine, Department of Bio-system Pharmacology, Osaka (Japan); Naka, Sadahiro [Osaka University, Osaka University Graduate School of Medicine, Osaka University Hospital, Osaka (Japan); Kanai, Yasukazu [Osaka University Graduate School of Medicine, PET Molecular Imaging Center, Osaka (Japan); Osaka University Graduate School of Medicine, Department of Molecular Imaging in Medicine, Osaka (Japan); Shimosegawa, Eku [Osaka University Graduate School of Medicine, Department of Nuclear Medicine and Tracer Kinetics, Osaka (Japan); Osaka University Graduate School of Medicine, PET Molecular Imaging Center, Osaka (Japan); Osaka University, Osaka University Graduate School of Medicine, Osaka University Hospital, Osaka (Japan); Hatazawa, Jun [Osaka University Graduate School of Medicine, Department of Nuclear Medicine and Tracer Kinetics, Osaka (Japan); Osaka University Graduate School of Medicine, PET Molecular Imaging Center, Osaka (Japan); Osaka University, Immunology Frontier Research Center, Osaka (Japan)

    2017-02-15

    The purpose of this study was to evaluate the usefulness of L-4-borono-2-{sup 18}F-fluoro-phenylalanine ({sup 18}F-FBPA) as a tumor-specific probe, in comparison to {sup 18}F-FDG and {sup 11}C-methionine (Met), focusing on its transport selectivity by L-type amino acid transporter 1 (LAT1), which is highly upregulated in cancers. Cellular analyses of FBPA were performed to evaluate the transportability and K{sub m} value. PET studies were performed in rat xenograft models of C6 glioma (n = 12) and in rat models of turpentine oil-induced subcutaneous inflammation (n = 9). The kinetic parameters and uptake values on static PET images were compared using the one-tissue compartment model (K{sub 1}, k{sub 2}) and maximum standardized uptake value (SUVmax). The cellular analyses showed that FBPA had a lower affinity to a normal cell-type transporter LAT2 and induced less efflux through LAT2 among FBPA, Met, and BPA, while the efflux through LAT1 induced by FBPA was similar among the three compounds. The K{sub m} value of {sup 18}F-FBPA for LAT1 (196.8 ± 11.4 μM) was dramatically lower than that for LAT2 (2813.8 ± 574.5 μM), suggesting the higher selectivity of {sup 18}F-FBPA for LAT1. K{sub 1} and k{sub 2} values were significantly smaller in {sup 18}F-FBPA PET (K{sub 1} = 0.04 ± 0.01 ml/ccm/min and k{sub 2} = 0.07 ± 0.01 /min) as compared to {sup 11}C-Met PET (0.22 ± 0.09 and 0.52 ± 0.10, respectively) in inflammatory lesions. Static PET analysis based on the SUVmax showed significantly higher accumulation of {sup 18}F-FDG in the tumor and inflammatory lesions (7.2 ± 2.1 and 4.6 ± 0.63, respectively) as compared to both {sup 18}F-FBPA (3.2 ± 0.40 and 1.9 ± 0.19) and {sup 11}C-Met (3.4 ± 0.43 and 1.6 ± 0.11). No significant difference was observed between {sup 18}F-FBPA and {sup 11}C-Met in the static PET images. This study shows the utility of {sup 18}F-FBPA as a tumor-specific probe of LAT1 with low accumulation in the inflammatory lesions. (orig.)

  1. The copper transporter (SLC31A1/CTR1) is expressed in bovine spermatozoa and oocytes: Copper in IVF medium improves sperm quality.

    Science.gov (United States)

    Anchordoquy, J P; Anchordoquy, J M; Pascua, A M; Nikoloff, N; Peral-García, P; Furnus, C C

    2017-07-15

    Adequate dietary intake of copper (Cu) is required for normal reproductive performance in cattle. The objective of this study was to investigate the pregnancy rates from cattle with deficient, marginal and adequate Cu plasma concentration at the beginning of artificial insemination protocol. Moreover, we determined Cu concentrations present in bovine oviductal fluid (OF), and the effects of Cu on fertilizing ability of bovine spermatozoa. Also, the presence of Cu transporter, SLC31A1 (also known as CTR1), in spermatozoa and in vitro matured oocyte were investigated. We found no differences in pregnancy rates among animals with adequate, marginal, and deficient Cu concentrations measured in plasma at the beginning of fixed-time artificial insemination (FTAI) protocol. Copper concentrations in OF were 38.3 ± 2.17 μg/dL (mean ± SEM) regardless of cupremia levels. The addition of 40 μg/dL Cu to IVF medium enhanced total and progressive motility, sperm viability, functional sperm membrane integrity (HOST), sperm-zona binding, and pronuclear formation. On the other hand, the presence of Cu in IVF medium did not modify acrosome integrity and cleavage rates after IVF, but impaired blastocyst rates. Cu transporter SLC31A1 was detected in bovine spermatozoa in the apical segment of acrosome, and in the oocyte matured in vitro. In conclusion, the results obtained in the present study determined that cupremia levels at the beginning of FTAI protocol did not influence the pregnancy rates at 60 d after insemination. The presence of CTR1 in bovine mature oocyte and spermatozoa, as well as the beneficial effect of Cu on sperm quality would suggest an important role of this mineral during the fertilization process. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Dicty_cDB: SLC437 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.

  3. Dicty_cDB: SLC444 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq

  4. Dicty_cDB: SLC490 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4

  5. Dicty_cDB: SLC484 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4

  6. Dicty_cDB: SLC433 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4

  7. Dicty_cDB: SLC460 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT

  8. Dicty_cDB: SLC496 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC496 (Link to dictyBase) - - - - SLC496E (Link to Original site) - - - - - - SLC4...96E 443 Show SLC496 Library SL (Link to library) Clone ID SLC496 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...96Q.Seq.d/ Representative seq. ID SLC496E (Link to Original site) R...epresentative DNA sequence >SLC496 (SLC496Q) /CSM/SL/SLC4-D/SLC496Q.Seq.d/ AAGAAATTTGAATCACTCCAAATCATTATCCCA

  9. Dicty_cDB: SLC449 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC449 (Link to dictyBase) - - - - SLC449Z (Link to Original site) - - SLC4...49Z 384 - - - - Show SLC449 Library SL (Link to library) Clone ID SLC449 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...49Q.Seq.d/ Representative seq. ID SLC449Z (Link to Original site) R...epresentative DNA sequence >SLC449 (SLC449Q) /CSM/SL/SLC4-C/SLC449Q.Seq.d/ XXXXXXXXXXGTAAAAAGGAACACCAAGCCACT

  10. Putative sugar transporters of the mustard leaf beetle Phaedon cochleariae: their phylogeny and role for nutrient supply in larval defensive glands.

    Directory of Open Access Journals (Sweden)

    Magdalena Stock

    Full Text Available BACKGROUND: Phytophagous insects have emerged successfully on the planet also because of the development of diverse and often astonishing defensive strategies against their enemies. The larvae of the mustard leaf beetle Phaedon cochleariae, for example, secrete deterrents from specialized defensive glands on their back. The secretion process involves ATP-binding cassette transporters. Therefore, sugar as one of the major energy sources to fuel the ATP synthesis for the cellular metabolism and transport processes, has to be present in the defensive glands. However, the role of sugar transporters for the production of defensive secretions was not addressed until now. RESULTS: To identify sugar transporters in P. cochleariae, a transcript catalogue was created by Illumina sequencing of cDNA libraries. A total of 68,667 transcripts were identified and 68 proteins were annotated as either members of the solute carrier 2 (SLC2 family or trehalose transporters. Phylogenetic analyses revealed an extension of the mammalian GLUT6/8 class in insects as well as one group of transporters exhibiting distinctive conserved motifs only present in the insect order Coleoptera. RNA-seq data of samples derived from the defensive glands revealed six transcripts encoding sugar transporters with more than 3,000 counts. Two of them are exclusively expressed in the glandular tissue. Reduction in secretions production was accomplished by silencing two of four selected transporters. RNA-seq experiments of transporter-silenced larvae showed the down-regulation of the silenced transporter but concurrently the up-regulation of other SLC2 transporters suggesting an adaptive system to maintain sugar homeostasis in the defensive glands. CONCLUSION: We provide the first comprehensive phylogenetic study of the SLC2 family in a phytophagous beetle species. RNAi and RNA-seq experiments underline the importance of SLC2 transporters in defensive glands to achieve a chemical defense

  11. Identification of a large intronic transposal insertion in SLC17A5 causing sialic acid storage disease

    NARCIS (Netherlands)

    Tarailo-Graovac, M. (Maja); Drögemöller, B.I. (Britt I.); Wasserman, W.W. (Wyeth W.); C.J. Ross; A.M.W. van den Ouweland (Ans); N. Darin (Niklas); Kollberg, G. (Gittan); Van Karnebeek, C.D.M. (Clara D. M.); Blomqvist, M. (Maria)

    2017-01-01

    textabstractBackground: Sialic acid storage diseases are neurodegenerative disorders characterized by accumulation of sialic acid in the lysosome. These disorders are caused by mutations in SLC17A5, the gene encoding sialin, a sialic acid transporter located in the lysosomal membrane. The most

  12. Precise system stabilization at SLC using dither techniques

    International Nuclear Information System (INIS)

    Ross, M.C.; Hendrickson, L.; Himel, T.; Miller, E.

    1993-01-01

    A data acquisition method has been developed at the SLAC Linear Collider (SLC) that provides accurate beam parameter information using sub-tolerance excitation and synchronized detection. This is being applied to several SLC sub-systems to provide high speed feedback on beam parameters such as linac output energy spread. The method has significantly improved control of the linac energy spread. The linac average phase offset (θ), used to compensate the effects of longitudinal wakefields, is adjusted ±l control bit (about 0.18 degree S-band or 20% of tolerance), in a continuous fashion. Properly coordinated beam energy measurements provide a measure of the derivative of the accelerating voltage (dE/dθ). The position of the beam on the RF wave can thus be determined to ± 0.3 degree in about 5 seconds. The dithering does not contribute significantly to the energy jitter of the SLC and therefore does not adversely affect routine operation. Future applications include control of the interaction region beam size and orientation

  13. Aortic Regurgitation in Patients Undergoing Transcatheter Aortic Valve Replacement With the Self-Expanding CoreValve Versus the Balloon-Expandable SAPIEN XT Valve.

    Science.gov (United States)

    Kiramijyan, Sarkis; Magalhaes, Marco A; Koifman, Edward; Didier, Romain; Escarcega, Ricardo O; Baker, Nevin C; Negi, Smita I; Minha, Sa'ar; Torguson, Rebecca; Jiaxiang, Gai; Asch, Federico M; Wang, Zuyue; Okubagzi, Petros; Gaglia, Michael A; Ben-Dor, Itsik; Satler, Lowell F; Pichard, Augusto D; Waksman, Ron

    2016-05-01

    The incidence of aortic regurgitation (AR) after transcatheter aortic valve replacement (TAVR) in a self-expanding and a balloon-expandable system is controversial. This study aimed to examine the incidence and severity of post-TAVR AR with the CoreValve (CV) versus the Edwards XT Valve (XT). Baseline, procedural, and postprocedural inhospital outcomes were compared. The primary end point was the incidence of post-TAVR AR of any severity, assessed with a transthoracic echocardiogram, in the CV versus XT groups. A multivariate logistic regression analysis was completed to evaluate for correlates of the primary end point. The secondary end points included the change in severity of AR at 30-day and 1-year follow-up. A total of 223 consecutive patients (53% men, mean age 82 years) who had transfemoral TAVR with either a CV (n = 119) or XT (n = 104) were evaluated. The rates of post-TAVR AR in the groups were similar, and there was no evidence of more-than-moderate AR in either group. There were significant differences in the rates of intraprocedural balloon postdilation with the CV (17.1%) versus XT valve (5.8%; p = 0.009) and in the rates of intraprocedural implantation of a second valve-in-valve prosthesis with the CV (9.9%) versus XT valve (2.2%; p = 0.036). There were no significant differences in inhospital safety outcomes between the 2 groups. In conclusion, the incidence of post-TAVR AR is similar between the CV and the XT valve when performed by experienced operators using optimal intraprocedural strategies, as deemed appropriate, to mitigate the severity of AR. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. "1"8F-FBPA as a tumor-specific probe of L-type amino acid transporter 1 (LAT1): a comparison study with "1"8F-FDG and "1"1C-Methionine PET

    International Nuclear Information System (INIS)

    Watabe, Tadashi; Ikeda, Hayato; Aoki, Masanao; Nagamori, Shushi; Wiriyasermkul, Pattama; Tanaka, Yoko; Hagiwara, Kohei; Kanai, Yoshikatsu; Naka, Sadahiro; Kanai, Yasukazu; Shimosegawa, Eku; Hatazawa, Jun

    2017-01-01

    The purpose of this study was to evaluate the usefulness of L-4-borono-2-"1"8F-fluoro-phenylalanine ("1"8F-FBPA) as a tumor-specific probe, in comparison to "1"8F-FDG and "1"1C-methionine (Met), focusing on its transport selectivity by L-type amino acid transporter 1 (LAT1), which is highly upregulated in cancers. Cellular analyses of FBPA were performed to evaluate the transportability and K_m value. PET studies were performed in rat xenograft models of C6 glioma (n = 12) and in rat models of turpentine oil-induced subcutaneous inflammation (n = 9). The kinetic parameters and uptake values on static PET images were compared using the one-tissue compartment model (K_1, k_2) and maximum standardized uptake value (SUVmax). The cellular analyses showed that FBPA had a lower affinity to a normal cell-type transporter LAT2 and induced less efflux through LAT2 among FBPA, Met, and BPA, while the efflux through LAT1 induced by FBPA was similar among the three compounds. The K_m value of "1"8F-FBPA for LAT1 (196.8 ± 11.4 μM) was dramatically lower than that for LAT2 (2813.8 ± 574.5 μM), suggesting the higher selectivity of "1"8F-FBPA for LAT1. K_1 and k_2 values were significantly smaller in "1"8F-FBPA PET (K_1 = 0.04 ± 0.01 ml/ccm/min and k_2 = 0.07 ± 0.01 /min) as compared to "1"1C-Met PET (0.22 ± 0.09 and 0.52 ± 0.10, respectively) in inflammatory lesions. Static PET analysis based on the SUVmax showed significantly higher accumulation of "1"8F-FDG in the tumor and inflammatory lesions (7.2 ± 2.1 and 4.6 ± 0.63, respectively) as compared to both "1"8F-FBPA (3.2 ± 0.40 and 1.9 ± 0.19) and "1"1C-Met (3.4 ± 0.43 and 1.6 ± 0.11). No significant difference was observed between "1"8F-FBPA and "1"1C-Met in the static PET images. This study shows the utility of "1"8F-FBPA as a tumor-specific probe of LAT1 with low accumulation in the inflammatory lesions. (orig.)

  15. Influence of labelling with radiohalogens in 2-sup(18)F-,6-sup(18)F- and 6-sup(123)I-nicotinic acid diethylamide on biodistribution in mice

    International Nuclear Information System (INIS)

    Knust, E.J.; Machulla, H.-J.; Kafka, Ch.

    1985-01-01

    By comparison of three halogenated nicotinic acid derivatives, viz. 2-sup(18)F-, 6-sup(18)F- and 6-sup(123)I-nicotinic acid diethylamide (2-sup(18)F-NADA, 6-sup(18)F-NADA, 6-sup(123)I-NADA), the biodistribution of sup(18)F- and sup(123)I-radioactivity in mice was determined. For the two fluoro-compounds the results indicate nearly similar time-activity curves in almost all organs investigated, while the iodo-derivative exhibits significant differences: for the brain and the heart a complete elimination of sup(123)I-radioactivity takes place within 4 hours, time-activity curves of the liver and the kidneys show higher maximal accumulation compared to the fluorinated derivatives and activity in the stomach increases continuously. For the lung drastic differences can also be observed. De-fluorination reactions from the aromatic ring can be excluded as could be shown by the low accumulation of sup(18)F-radioactivity in bones after application of 6-sup(18)F-NADA. (author)

  16. 5-(2-18F-fluoroethoxy)-L-tryptophan as a substrate of system L transport for tumor imaging by PET.

    Science.gov (United States)

    Krämer, Stefanie D; Mu, Linjing; Müller, Adrienne; Keller, Claudia; Kuznetsova, Olga F; Schweinsberg, Christian; Franck, Dominic; Müller, Cristina; Ross, Tobias L; Schibli, Roger; Ametamey, Simon M

    2012-03-01

    Large neutral l-amino acids are substrates of system L amino acid transporters. The level of one of these, LAT1, is increased in many tumors. Aromatic l-amino acids may also be substrates of aromatic l-amino acid decarboxylase (AADC), the level of which is enhanced in endocrine tumors. Increased amino acid uptake and subsequent decarboxylation result in the intracellular accumulation of the amino acid and its decarboxylation product. (18)F- and (11)C-labeled neutral aromatic amino acids, such as l-3,4-dihydroxy-6-(18)F-fluorophenylalanine ((18)F-FDOPA) and 5-hydroxy-l-[β-(11)C]tryptophan, are thus successfully used in PET to image endocrine tumors. However, 5-hydroxy-l-[β-(11)C]tryptophan has a relatively short physical half-life (20 min). In this work, we evaluated the in vitro and in vivo characteristics of the (18)F-labeled tryptophan analog 5-(2-(18)F-fluoroethoxy)-l-tryptophan ((18)F-l-FEHTP) as a PET probe for tumor imaging. (18)F-l-FEHTP was synthesized by no-carrier-added (18)F fluorination of 5-hydroxy-l-tryptophan. In vitro cell uptake and efflux of (18)F-l-FEHTP and (18)F-FDOPA were studied with NCI-H69 endocrine small cell lung cancer cells, PC-3 pseudoendocrine prostate cancer cells, and MDA-MB-231 exocrine breast cancer cells. Small-animal PET was performed with the respective xenograft-bearing mice. Tissues were analyzed for potential metabolites. (18)F-l-FEHTP specific activity and radiochemical purity were 50-150 GBq/μmol and greater than 95%, respectively. In vitro cell uptake of (18)F-l-FEHTP was between 48% and 113% of added radioactivity per milligram of protein within 60 min at 37°C and was blocked by greater than 95% in all tested cell lines by the LAT1/2 inhibitor 2-amino-2-norboranecarboxylic acid. (18)F-FDOPA uptake ranged from 26% to 53%/mg. PET studies revealed similar xenograft-to-reference tissue ratios for (18)F-l-FEHTP and (18)F-FDOPA at 30-45 min after injection. In contrast to the (18)F-FDOPA PET results, pretreatment with the

  17. Generation of novel metabolites of dietary linoleic acid (18:2n6) by guinea pig epidermis

    Energy Technology Data Exchange (ETDEWEB)

    Chapkin, R.S.; Ziboh, V.A.

    1986-03-05

    Although the authors have demonstrated the inability of rat and guinea pig (GP) skin enzyme preparations to desaturate 18:2n6 into gammalinolenic acid (18:3n6) using an in vitro microsomal system, the fate of this dietary essential fatty acid in the GP epidermis is unknown. To explore the fate of 18:2n6, intact tissue slices from GP epidermis were incubated with (1-/sup 14/C)18:2n6. After incubation, the extracted lipids were transesterified using methanolic-HCL. The fatty acid methyl esters were analyzed using a combination of (i) argentation TLC, scanned using a proportional TLC radioscanner, and (ii) reverse phase HPLC, equipped with a flow through radioscanner. The results indicate that the intact epidermis metabolized /sup 14/C-18:2n6 to a group of novel products more polar than 18:2n6. In subsequent experiments, /sup 14/C-18:2n6 was either incubated with the 800 xg supernatant, the 105,000 xg pellet or supernatant from GP epidermis. Metabolism of 18:2n6 by the high speed supernatant resulted in the generation of polar products with chromatographic properties of not greater than 2 double bonds. These results indicate that although the GP epidermis lacks the capacity to desaturate 18:2n6 to 18:3n6, it can convert dietary 18:2n6 into a group of novel polar metabolites via a cytosolic mediated process. The function of these metabolites in the GP integumentary system remains to be determined.

  18. Generation of novel metabolites of dietary linoleic acid (18:2n6) by guinea pig epidermis

    International Nuclear Information System (INIS)

    Chapkin, R.S.; Ziboh, V.A.

    1986-01-01

    Although the authors have demonstrated the inability of rat and guinea pig (GP) skin enzyme preparations to desaturate 18:2n6 into gammalinolenic acid (18:3n6) using an in vitro microsomal system, the fate of this dietary essential fatty acid in the GP epidermis is unknown. To explore the fate of 18:2n6, intact tissue slices from GP epidermis were incubated with [1- 14 C]18:2n6. After incubation, the extracted lipids were transesterified using methanolic-HCL. The fatty acid methyl esters were analyzed using a combination of (i) argentation TLC, scanned using a proportional TLC radioscanner, and (ii) reverse phase HPLC, equipped with a flow through radioscanner. The results indicate that the intact epidermis metabolized 14 C-18:2n6 to a group of novel products more polar than 18:2n6. In subsequent experiments, 14 C-18:2n6 was either incubated with the 800 xg supernatant, the 105,000 xg pellet or supernatant from GP epidermis. Metabolism of 18:2n6 by the high speed supernatant resulted in the generation of polar products with chromatographic properties of not greater than 2 double bonds. These results indicate that although the GP epidermis lacks the capacity to desaturate 18:2n6 to 18:3n6, it can convert dietary 18:2n6 into a group of novel polar metabolites via a cytosolic mediated process. The function of these metabolites in the GP integumentary system remains to be determined

  19. Solute carrier transporters: potential targets for digestive system neoplasms.

    Science.gov (United States)

    Xie, Jing; Zhu, Xiao Yan; Liu, Lu Ming; Meng, Zhi Qiang

    2018-01-01

    Digestive system neoplasms are the leading causes of cancer-related death all over the world. Solute carrier (SLC) superfamily is composed of a series of transporters that are ubiquitously expressed in organs and tissues of digestive systems and mediate specific uptake of small molecule substrates in facilitative manner. Given the important role of SLC proteins in maintaining normal functions of digestive system, dysregulation of these protein in digestive system neoplasms may deliver biological and clinical significance that deserves systemic studies. In this review, we critically summarized the recent advances in understanding the role of SLC proteins in digestive system neoplasms. We highlighted that several SLC subfamilies, including metal ion transporters, transporters of glucose and other sugars, transporters of urea, neurotransmitters and biogenic amines, ammonium and choline, inorganic cation/anion transporters, transporters of nucleotide, amino acid and oligopeptide organic anion transporters, transporters of vitamins and cofactors and mitochondrial carrier, may play important roles in mediating the initiation, progression, metastasis, and chemoresistance of digestive system neoplasms. Proteins in these SLC subfamilies may also have diagnostic and prognostic values to particular cancer types. Differential expression of SLC proteins in tumors of digestive system was analyzed by extracting data from human cancer database, which revealed that the roles of SLC proteins may either be dependent on the substrates they transport or be tissue specific. In addition, small molecule modulators that pharmacologically regulate the functions of SLC proteins were discussed for their possible application in the treatment of digestive system neoplasms. This review highlighted the potential of SLC family proteins as drug target for the treatment of digestive system neoplasms.

  20. An improved synthesis of 4-[18F]-ADAM, a potent serotonin transporter imaging agent

    International Nuclear Information System (INIS)

    Huang, Y.-Y.; Huang, W.-S.; Chu, T.-C.; Shiue, C.-Y.

    2009-01-01

    An improved synthesis of N,N-dimethyl-2-(2-amino-4-[ 18 F]fluorophenylthio)benzylamine (4-[ 18 F]-ADAM, 2) as a potent serotonin transporter (SERT) imaging agent is described. Molecular orbital (MO) calculation predicts that N,N-dimethyl-2- (2-nitro-4-trimethylammoniumtrifluoromethanesulfonylphenylthio)benzamide (8) is probably a better precursor than N,N-dimethyl-2-(2,4-dinitrophenylthio)benzylamine (1) for preparing 2. Radioligand 2 was synthesized by the reaction of either precursor 1 or precursor 8 with K[ 18 F]/K 2.2.2 at 120 deg. C followed by reduction with BH 3 at 80 deg. C. The radiochemical yield (EOB) of 2 synthesized from precursor 1 and 8 was 5.7±2.4% (n=6) and 14.8±4.0% (n=5), respectively, in a synthesis time of 120 min from EOB. The specific activity of 2 was 3 Ci/μmol or 111 GBq/μmol (EOB). Thus, this new synthetic method has significantly improved the radiochemical yield of 4-[ 18 F]-ADAM and makes this radioligand more accessible to PET Centers without a cyclotron.

  1. Characterization of 2 MeV, 4 MeV, 6 MeV and 18 MeV buildup caps for use with a 0.6 cubic centimeter thimble ionization chamber

    International Nuclear Information System (INIS)

    Salyer, R.L.; VanDenburg, J.W.; Prinja, A.K.; Kirby, T.; Busch, R.; Hong-Nian Jow

    1996-07-01

    The purpose of this research is to characterize existing 2 MeV, 4 MeV and 6 MeV buildup caps, and to determine if a buildup cap can be made for the 0.6 cm 3 thimble ionization chamber that will accurately measure exposures in a high-energy photon radiation field. Two different radiation transport codes were used to computationally characterize existing 2 MeV, 4 MeV, and 6 MeV buildup caps for a 0.6 cm 3 active volume thimble ionization chamber: ITS, The Integrated TIGER Series of Coupled Electron-Photon Monte Carlo Transport Codes; and CEPXS/ONEDANT, A One-Dimensional Coupled Electron-Photon Discrete Ordinates Code Package. These codes were also used to determine the design characteristics of a buildup cap for use in the 18 MeV photon beam produced by the 14 TW pulsed power HERMES-III electron accelerator. The maximum range of the secondary electron, the depth at which maximum dose occurs, and the point where dose and collision kerma are equal have been determined to establish the validity of electronic equilibrium. The ionization chamber with the appropriate buildup cap was then subjected to a 4 MeV and a 6 MeV bremmstrahlung radiation spectrum to determine the detector response

  2. Radiosynthesis of a novel potential adenosine A3 receptor ligand, 5-ethyl 2,4-diethyl-3-((2-[18F]fluoroethyl)sulfanylcarbonyl) -6-phenylpyridine-5-carbox ylate ([18F]FE rate at SUPPY:2)

    International Nuclear Information System (INIS)

    Haeusler, D.; Mitterhauser, M.; Mien, L.K.; Shanab, K.; Spreitzer, H.; Lanzenberger, R.R; Schirmer, E.; Ungersboeck, J.; Wadsak, W.; Nics, L.; Viernstein, H.; Dudezak, R.; Kletter, K.

    2009-01-01

    Since, to date very limited information on the distribution and function of the adenosine A 3 receptor is available, the development of suitable radioligands is needed. Recently, we introduced [ 18 F]FE rate at SUPPY (5-(2-[ 18 F]fluoroethyl) 2,4-diethyl-3-(ethylsulfanylcarbonyl)-6-phenylpyridine-5-carboxylate) as the first PET-ligand for the A3R. Regarding the metabolic profile - this class of dialkylpyridines comprises two ester functions within one molecule, one carboxylic and one thiocarboxylic - one could expect carboxylesterases significantly contributing to cleavage and degradation. Therefore, our aim was the development of [ 18 F]FE rate at SUPPY:2 (5-ethyl 2,4-diethyl-3-((2-[ 18 F]fluoroethyl)sulfanylcarbonyl)-6-phenylpyridine -5-carbox ylate), the functional isomer containing the label at the thiocarboxylic moiety. For satisfactory yields in high scale radiosyntheses, a reaction temperature of 75 C has to be applied for at least 20 min using 20 mg/mL of precursor. So far, 6 complete high-scale radiosyntheses were performed. Starting from an average of 51.2 ± 21.8 GBq (mean±SD) [ 18 F]fluoride, 5.8 ± 4.1 GBq of formulated [ 18 F]FE rate at SUPPY:2 (12.0±5.4%, based on [ 18 F]fluoride, not corrected for decay) were prepared in 75 ± 8 min. (orig.)

  3. The neXtProt peptide uniqueness checker: a tool for the proteomics community.

    Science.gov (United States)

    Schaeffer, Mathieu; Gateau, Alain; Teixeira, Daniel; Michel, Pierre-André; Zahn-Zabal, Monique; Lane, Lydie

    2017-11-01

    The neXtProt peptide uniqueness checker allows scientists to define which peptides can be used to validate the existen