WorldWideScience

Sample records for transporter pit1 slc20a1

  1. High levels of the type III inorganic phosphate transporter PiT1 (SLC20A1) can confer faster cell adhesion

    OpenAIRE

    Kongsfelt, Iben Boutrup; Byskov, Kristina; Pedersen, Lasse Ebdrup; Pedersen, Lene

    2014-01-01

    The inorganic phosphate transporter PiT1 (SLC20A1) is ubiquitously expressed in mammalian cells. We recently showed that overexpression of human PiT1 was sufficient to increase proliferation of two strict density-inhibited cell lines, murine fibroblastic NIH3T3 and pre-osteoblastic MC3T3-E1 cells, and allowed the cultures to grow to higher cell densities. In addition, upon transformation NIH3T3 cells showed increased ability to form colonies in soft agar. The cellular regulation of PiT1 expre...

  2. High levels of the type III inorganic phosphate transporter PiT1 (SLC20A1) can confer faster cell adhesion

    DEFF Research Database (Denmark)

    Kongsfelt, Iben Boutrup; Byskov, Kristina; Pedersen, Lasse Ebdrup

    2014-01-01

    overexpression led to faster cell spreading. The final total numbers of attached cells did, however, not differ between cultures of PiT1 overexpressing cells and control cells of neither cell type. We suggest that the PiT1-mediated fast adhesion potentials allow the cells to go faster out of G0/G1 and thereby......The inorganic phosphate transporter PiT1 (SLC20A1) is ubiquitously expressed in mammalian cells. We recently showed that overexpression of human PiT1 was sufficient to increase proliferation of two strict density-inhibited cell lines, murine fibroblastic NIH3T3 and pre-osteoblastic MC3T3-E1 cells......, and allowed the cultures to grow to higher cell densities. In addition, upon transformation NIH3T3 cells showed increased ability to form colonies in soft agar. The cellular regulation of PiT1 expression supports that cells utilize the PiT1 levels to control proliferation, with non-proliferating cells showing...

  3. Inorganic phosphorus (Pi) in CSF is a biomarker for SLC20A2-associated idiopathic basal ganglia calcification (IBGC1).

    Science.gov (United States)

    Hozumi, Isao; Kurita, Hisaka; Ozawa, Kazuhiro; Furuta, Nobuyuki; Inden, Masatoshi; Sekine, Shin-Ichiro; Yamada, Megumi; Hayashi, Yuichi; Kimura, Akio; Inuzuka, Takashi; Seishima, Mitsuru

    2018-05-15

    Idiopathic basal ganglia calcification (IBGC), also called Fahr's disease or recently primary familial brain calcification (PFBC), is characterized by abnormal deposits of minerals including calcium mainly and phosphate in the brain. Mutations in SLC20A2 (IBGC1 (merged with former IBGC2 and IBGC3)), which encodes PiT-2, a phosphate transporter, is the major cause of IBGC. Recently, Slc20a2-KO mice have been showed to have elevated levels of inorganic phosphorus (Pi) in cerebrospinal fluid (CSF); however, CSF Pi levels in patients with IBGC have not been fully examined. We investigated the cases of 29 patients with IBGC including six patients with SLC20A2 mutation and three patients with PDGFB mutation, and 13 controls. The levels of sodium (Na), potassium (K), chloride (Cl), calcium (Ca), and Pi in sera and CSF were determined by potentiometry and colorimetry. Moreover, clinical manifestations were investigated in the IBGC patients with high Pi levels in CSF. The study revealed that the average level of Pi in the CSF of the total group of patients with IBGC is significantly higher than that of the control group, and the levels of Pi in CSF of the IBGC patients with SLC20A2 mutations are significantly higher than those of the IBGC patients with PDGFB mutations, the other IBGC patients and controls. Results of this study suggest that the levels of CSF Pi will be a good biomarker for IBGC1. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. NELL-1 increases pre-osteoblast mineralization using both phosphate transporter Pit1 and Pit2

    Energy Technology Data Exchange (ETDEWEB)

    Cowan, Catherine M. [Department of Bioengineering, University of California, Los Angeles, 420 Westwood Plaza,7523 Boelter Hall, Los Angeles, CA 90095 (United States); Dental and Craniofacial Research Institute and Section of Orthodontics, School of Dentistry, University of California, Los Angeles, 40833 Le Conte Ave, Los Angeles, CA 90095 (United States); Zhang, Xinli; James, Aaron W.; Mari Kim, T.; Sun, Nichole [Dental and Craniofacial Research Institute and Section of Orthodontics, School of Dentistry, University of California, Los Angeles, 40833 Le Conte Ave, Los Angeles, CA 90095 (United States); Wu, Benjamin [Department of Bioengineering, University of California, Los Angeles, 420 Westwood Plaza,7523 Boelter Hall, Los Angeles, CA 90095 (United States); Dental and Craniofacial Research Institute and Section of Orthodontics, School of Dentistry, University of California, Los Angeles, 40833 Le Conte Ave, Los Angeles, CA 90095 (United States); Ting, Kang [Dental and Craniofacial Research Institute and Section of Orthodontics, School of Dentistry, University of California, Los Angeles, 40833 Le Conte Ave, Los Angeles, CA 90095 (United States); Soo, Chia, E-mail: bsoo@ucla.edu [UCLA and Orthopaedic Hospital Department of Orthopaedic Surgery and the Orthopaedic, Hospital Research Center, University of California, Los Angeles, 2641 Charles E. Young Dr. South, Los Angeles, CA 90095 (United States)

    2012-06-08

    Highlights: Black-Right-Pointing-Pointer NELL-1 accelerates extracellular matrix mineralization in MC3T3-E1 pre-osteoblasts. Black-Right-Pointing-Pointer NELL-1 significantly increases intracellular inorganic phosphate levels. Black-Right-Pointing-Pointer NELL-1 positively regulates osteogenesis but not proliferation in MC3T3-E1 cells. Black-Right-Pointing-Pointer NELL-1 regulates inorganic phosphate transporter activity. -- Abstract: NELL-1 is a potent osteoinductive molecule that enhances bone formation in multiple animal models through currently unidentified pathways. In the present manuscript, we hypothesized that NELL-1 may regulate osteogenic differentiation accompanied by alteration of inorganic phosphate (Pi) entry into the osteoblast via sodium dependent phosphate (NaPi) transporters. To determine this, MC3T3-E1 pre-osteoblasts were cultured in the presence of recombinant human (rh)NELL-1 or rhBMP-2. Analysis was performed for intracellular Pi levels through malachite green staining, Pit-1 and Pit-2 expression, and forced upregulation of Pit-1 and Pit-2. Results showed rhNELL-1 to increase MC3T3-E1 matrix mineralization and Pi influx associated with activation of both Pit-1 and Pit-2 channels, with significantly increased Pit-2 production. In contrast, Pi transport elicited by rhBMP-2 showed to be associated with increased Pit-1 production only. Next, neutralizing antibodies against Pit-1 and Pit-2 completely abrogated the Pi influx effect of rhNELL-1, suggesting rhNELL-1 is dependent on both transporters. These results identify one potential mechanism of action for rhNELL-1 induced osteogenesis and highlight a fundamental difference between NELL-1 and BMP-2 signaling.

  5. NELL-1 increases pre-osteoblast mineralization using both phosphate transporter Pit1 and Pit2

    International Nuclear Information System (INIS)

    Cowan, Catherine M.; Zhang, Xinli; James, Aaron W.; Mari Kim, T.; Sun, Nichole; Wu, Benjamin; Ting, Kang; Soo, Chia

    2012-01-01

    Highlights: ► NELL-1 accelerates extracellular matrix mineralization in MC3T3-E1 pre-osteoblasts. ► NELL-1 significantly increases intracellular inorganic phosphate levels. ► NELL-1 positively regulates osteogenesis but not proliferation in MC3T3-E1 cells. ► NELL-1 regulates inorganic phosphate transporter activity. -- Abstract: NELL-1 is a potent osteoinductive molecule that enhances bone formation in multiple animal models through currently unidentified pathways. In the present manuscript, we hypothesized that NELL-1 may regulate osteogenic differentiation accompanied by alteration of inorganic phosphate (Pi) entry into the osteoblast via sodium dependent phosphate (NaPi) transporters. To determine this, MC3T3-E1 pre-osteoblasts were cultured in the presence of recombinant human (rh)NELL-1 or rhBMP-2. Analysis was performed for intracellular Pi levels through malachite green staining, Pit-1 and Pit-2 expression, and forced upregulation of Pit-1 and Pit-2. Results showed rhNELL-1 to increase MC3T3-E1 matrix mineralization and Pi influx associated with activation of both Pit-1 and Pit-2 channels, with significantly increased Pit-2 production. In contrast, Pi transport elicited by rhBMP-2 showed to be associated with increased Pit-1 production only. Next, neutralizing antibodies against Pit-1 and Pit-2 completely abrogated the Pi influx effect of rhNELL-1, suggesting rhNELL-1 is dependent on both transporters. These results identify one potential mechanism of action for rhNELL-1 induced osteogenesis and highlight a fundamental difference between NELL-1 and BMP-2 signaling.

  6. Mapping of the minimal inorganic phosphate transporting unit of human PiT2 suggests a structure universal to PiT-related proteins from all kingdoms of life

    DEFF Research Database (Denmark)

    Bøttger, Pernille; Pedersen, Lene

    2011-01-01

    -keeping functions. Alignment of protein sequences representing PiT family members from all kingdoms reveals the presence of conserved amino acids and that bacterial phosphate permeases and putative phosphate permeases from archaea lack substantial parts of the protein sequence when compared to the mammalian Pi...... PiT2 histidine, H502, and the human PiT1 glutamate, E70, - both conserved in eukaryotic PiT family members - are critical for Pi transport function. Noticeably, human PiT2 H502 is located in the C-terminal PiT family signature sequence, and human PiT1 E70 is located in ProDom domains characteristic....... Conclusions The results suggest that the overall structure of the Pi-transporting unit of the PiT family proteins has remained unchanged during evolution. Moreover, in combination, our studies of the gene structure of the human PiT1 and PiT2 genes (SLC20A1 and SLC20A2, respectively) and alignment of protein...

  7. The renal urate transporter SLC17A1 locus: confirmation of association with gout.

    Science.gov (United States)

    Hollis-Moffatt, Jade E; Phipps-Green, Amanda J; Chapman, Brett; Jones, Gregory T; van Rij, Andre; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B; Montgomery, Grant W; Stamp, Lisa K; Dalbeth, Nicola; Merriman, Tony R

    2012-04-27

    Two major gout-causing genes have been identified, the urate transport genes SLC2A9 and ABCG2. Variation within the SLC17A1 locus, which encodes sodium-dependent phosphate transporter 1, a renal transporter of uric acid, has also been associated with serum urate concentration. However, evidence for association with gout is equivocal. We investigated the association of the SLC17A1 locus with gout in New Zealand sample sets. Five variants (rs1165196, rs1183201, rs9358890, rs3799344, rs12664474) were genotyped across a New Zealand sample set totaling 971 cases and 1,742 controls. Cases were ascertained according to American Rheumatism Association criteria. Two population groups were studied: Caucasian and Polynesian. At rs1183201 (SLC17A1), evidence for association with gout was observed in both the Caucasian (odds ratio (OR) = 0.67, P = 3.0 × 10-6) and Polynesian (OR = 0.74, P = 3.0 × 10-3) groups. Meta-analysis confirmed association of rs1183201 with gout at a genome-wide level of significance (OR = 0.70, P = 3.0 × 10-8). Haplotype analysis suggested the presence of a common protective haplotype. We confirm the SLC17A1 locus as the third associated with gout at a genome-wide level of significance.

  8. Loss of function of Slc20a2 associated with familial idiopathic Basal Ganglia calcification in humans causes brain calcifications in mice

    DEFF Research Database (Denmark)

    Jensen, N.; Schroder, H. D.; Hejbol, E. K.

    2013-01-01

    Familial idiopathic basal ganglia calcification (FIBGC) is a neurodegenerative disorder with neuropsychiatric and motor symptoms. Deleterious mutations in SLC20A2, encoding the type III sodium-dependent phosphate transporter 2 (PiT2), were recently linked to FIBGC in almost 50% of the families...... reported worldwide. Here, we show that knockout of Slc20a2 in mice causes calcifications in the thalamus, basal ganglia, and cortex, demonstrating that reduced PiT2 expression alone can cause brain calcifications....

  9. Deletion of Slc26a1 and Slc26a7 Delays Enamel Mineralization in Mice

    Directory of Open Access Journals (Sweden)

    Kaifeng Yin

    2017-05-01

    Full Text Available Amelogenesis features two major developmental stages—secretory and maturation. During maturation stage, hydroxyapatite deposition and matrix turnover require delicate pH regulatory mechanisms mediated by multiple ion transporters. Several members of the Slc26 gene family (Slc26a1, Slc26a3, Slc26a4, Slc26a6, and Slc26a7, which exhibit bicarbonate transport activities, have been suggested by previous studies to be involved in maturation-stage amelogenesis, especially the key process of pH regulation. However, details regarding the functional role of these genes in enamel formation are yet to be clarified, as none of the separate mutant animal lines demonstrates any discernible enamel defects. Continuing with our previous investigation of Slc26a1−/− and Slc26a7−/− animal models, we generated a double-mutant animal line with the absence of both Slc26a1 and Slc26a7. We showed in the present study that the double-mutant enamel density was significantly lower in the regions that represent late maturation-, maturation- and secretory-stage enamel development in wild-type mandibular incisors. However, the “maturation” and “secretory” enamel microstructures in double-mutant animals resembled those observed in wild-type secretory and/or pre-secretory stages. Elemental composition analysis revealed a lack of mineral deposition and an accumulation of carbon and chloride in double-mutant enamel. Deletion of Slc26a1 and Slc26a7 did not affect the stage-specific morphology of the enamel organ. Finally, compensatory expression of pH regulator genes and ion transporters was detected in maturation-stage enamel organs of double-mutant animals when compared to wild-type. Combined with the findings from our previous study, these data indicate the involvement of SLC26A1and SLC26A7 as key ion transporters in the pH regulatory network during enamel maturation.

  10. Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures

    DEFF Research Database (Denmark)

    Carvill, Gemma L; McMahon, Jacinta M; Schneider, Amy

    2015-01-01

    GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutatio...

  11. Molecular Properties of Drugs Interacting with SLC22 Transporters OAT1, OAT3, OCT1, and OCT2: A Machine-Learning Approach.

    Science.gov (United States)

    Liu, Henry C; Goldenberg, Anne; Chen, Yuchen; Lun, Christina; Wu, Wei; Bush, Kevin T; Balac, Natasha; Rodriguez, Paul; Abagyan, Ruben; Nigam, Sanjay K

    2016-10-01

    Statistical analysis was performed on physicochemical descriptors of ∼250 drugs known to interact with one or more SLC22 "drug" transporters (i.e., SLC22A6 or OAT1, SLC22A8 or OAT3, SLC22A1 or OCT1, and SLC22A2 or OCT2), followed by application of machine-learning methods and wet laboratory testing of novel predictions. In addition to molecular charge, organic anion transporters (OATs) were found to prefer interacting with planar structures, whereas organic cation transporters (OCTs) interact with more three-dimensional structures (i.e., greater SP3 character). Moreover, compared with OAT1 ligands, OAT3 ligands possess more acyclic tetravalent bonds and have a more zwitterionic/cationic character. In contrast, OCT1 and OCT2 ligands were not clearly distinquishable form one another by the methods employed. Multiple pharmacophore models were generated on the basis of the drugs and, consistent with the machine-learning analyses, one unique pharmacophore created from ligands of OAT3 possessed cationic properties similar to OCT ligands; this was confirmed by quantitative atomic property field analysis. Virtual screening with this pharmacophore, followed by transport assays, identified several cationic drugs that selectively interact with OAT3 but not OAT1. Although the present analysis may be somewhat limited by the need to rely largely on inhibition data for modeling, wet laboratory/in vitro transport studies, as well as analysis of drug/metabolite handling in Oat and Oct knockout animals, support the general validity of the approach-which can also be applied to other SLC and ATP binding cassette drug transporters. This may make it possible to predict the molecular properties of a drug or metabolite necessary for interaction with the transporter(s), thereby enabling better prediction of drug-drug interactions and drug-metabolite interactions. Furthermore, understanding the overlapping specificities of OATs and OCTs in the context of dynamic transporter tissue

  12. Structure of Bor1 supports an elevator transport mechanism for SLC4 anion exchangers.

    Science.gov (United States)

    Thurtle-Schmidt, Bryan H; Stroud, Robert M

    2016-09-20

    Boron is essential for plant growth because of its incorporation into plant cell walls; however, in excess it is toxic to plants. Boron transport and homeostasis in plants is regulated in part by the borate efflux transporter Bor1, a member of the solute carrier (SLC) 4 transporter family with homology to the human bicarbonate transporter Band 3. Here, we present the 4.1-Å resolution crystal structure of Arabidopsis thaliana Bor1. The structure displays a dimeric architecture in which dimerization is mediated by centralized Gate domains. Comparisons with a structure of Band 3 in an outward-open state reveal that the Core domains of Bor1 have rotated inwards to achieve an occluded state. Further structural comparisons with UapA, a xanthine transporter from the nucleobase-ascorbate transporter family, show that the downward pivoting of the Core domains relative to the Gate domains may access an inward-open state. These results suggest that the SLC4, SLC26, and nucleobase-ascorbate transporter families all share an elevator transport mechanism in which alternating access is provided by Core domains that carry substrates across a membrane.

  13. Na+-taurocholate cotransporting polypeptide (NTCP/SLC10A1) ortholog in the marine skate Leucoraja erinacea is not a physiological bile salt transporter.

    Science.gov (United States)

    Yu, Dongke; Zhang, Han; Lionarons, Daniel A; Boyer, James L; Cai, Shi-Ying

    2017-04-01

    The Na + -dependent taurocholate cotransporting polypeptide (NTCP/SLC10A1) is a hepatocyte-specific solute carrier, which plays an important role in maintaining bile salt homeostasis in mammals. The absence of a hepatic Na + -dependent bile salt transport system in marine skate and rainbow trout raises a question regarding the function of the Slc10a1 gene in these species. Here, we have characterized the Slc10a1 gene in the marine skate, Leucoraja erinacea The transcript of skate Slc10a1 (skSlc10a1) encodes 319 amino acids and shares 46% identity to human NTCP (hNTCP) with similar topology to mammalian NTCP. SkSlc10a1 mRNA was mostly confined to the brain and testes with minimal expression in the liver. An FXR-bile salt reporter assay indicated that skSlc10a1 transported taurocholic acid (TCA) and scymnol sulfate, but not as effectively as hNTCP. An [ 3 H]TCA uptake assay revealed that skSlc10a1 functioned as a Na + -dependent transporter, but with low affinity for TCA ( K m = 92.4 µM) and scymnol sulfate ( K i = 31 µM), compared with hNTCP (TCA, K m = 5.4 µM; Scymnol sulfate, K i = 3.5 µM). In contrast, the bile salt concentration in skate plasma was 2 µM, similar to levels seen in mammals. Interestingly, skSlc10a1 demonstrated transport activity for the neurosteroids dehydroepiandrosterone sulfate and estrone-3-sulfate at physiological concentration, similar to hNTCP. Together, our findings indicate that skSlc10a1 is not a physiological bile salt transporter, providing a molecular explanation for the absence of a hepatic Na + -dependent bile salt uptake system in skate. We speculate that Slc10a1 is a neurosteroid transporter in skate that gained its substrate specificity for bile salts later in vertebrate evolution. Copyright © 2017 the American Physiological Society.

  14. Characterization of SLC transporters in human skin

    Directory of Open Access Journals (Sweden)

    Marion Alriquet

    2015-03-01

    Full Text Available Most identified drug transporters belong to the ATP-binding Cassette (ABC and Solute Carrier (SLC families. Recent research indicates that some of these transporters play an important role in the absorption, distribution and excretion of drugs, and are involved in clinically relevant drug-drug interactions for systemic drugs. However, very little is known about the role of drug transporters in human skin in the disposition of topically applied drugs and their involvement in drug-drug interactions. The aim of this work was to compare the expression in human skin (vs human hepatocytes and kidney of SLC transporters included in the EMA guidance as the most likely clinical sources of drug interactions. The expression of SLC transporters in human tissues was analyzed by quantitative RT-PCR. Modulation of SLC47A1 and SLC47A2 (MATE1 and MATE2 expression was analyzed after treatment of human skin in organ-culture with rifampicin and UV irradiation. The expression of SLCO2B1 (OATPB, SLCO3A1 (OATPD, SLCO4A1 (OATPE, SLC47A1 and SLC47A2 (MATE1 and MATE2 was detected in human skin, OATPE and MATE1 being the most expressed. OATPE is about 70 times more expressed in human skin than in human hepatocytes. Moreover, the expression of SLC47A1 and SLC47A2 was down-regulated after treatment with rifampicin or after exposure to UV light. The present findings demonstrate that SLCO4A1 (OATPE and SLC47A1 (MATE1 are highly expressed in human skin and suggest the involvement of SLC transporters in the disposition of topically applied drugs.

  15. Development of imatinib and dasatinib resistance: dynamics of expression of drug transporters ABCB1, ABCC1, ABCG2, MVP, and SLC22A1.

    Science.gov (United States)

    Gromicho, Marta; Dinis, Joana; Magalhães, Marta; Fernandes, Alexandra R; Tavares, Purificação; Laires, António; Rueff, José; Rodrigues, António Sebastião

    2011-10-01

    About 20% of patients with chronic myeloid leukemia (CML) do not respond to treatment with imatinib either initially or because of acquired resistance. To study the development of CML drug resistance, an in vitro experimental system comprising cell lines with different resistance levels was established by exposing K562 cells to increasing concentrations of imatinib and dasatinib anticancer agents. The mRNA levels of BCR- ABL1 and of genes involved in drug transport or redistribution (ABCB1, ABCC1, ABCC3, ABCG2, MVP, and SLC22A1) were measured and the ABL1 kinase domain sequenced. Results excluded BCR- ABL1 overexpression and mutations as relevant resistance mechanisms. Most studied transporters were overexpressed in the majority of resistant cell lines. Their expression pattern was dynamic: varying with resistance level and chronic drug exposure. Studied efflux transporters may have an important role at the initial stages of resistance, but after prolonged exposure and for higher doses of drugs other mechanisms might take place.

  16. OCD candidate gene SLC1A1/EAAT3 impacts basal ganglia-mediated activity and stereotypic behavior.

    Science.gov (United States)

    Zike, Isaac D; Chohan, Muhammad O; Kopelman, Jared M; Krasnow, Emily N; Flicker, Daniel; Nautiyal, Katherine M; Bubser, Michael; Kellendonk, Christoph; Jones, Carrie K; Stanwood, Gregg; Tanaka, Kenji Fransis; Moore, Holly; Ahmari, Susanne E; Veenstra-VanderWeele, Jeremy

    2017-05-30

    Obsessive-compulsive disorder (OCD) is a chronic, disabling condition with inadequate treatment options that leave most patients with substantial residual symptoms. Structural, neurochemical, and behavioral findings point to a significant role for basal ganglia circuits and for the glutamate system in OCD. Genetic linkage and association studies in OCD point to SLC1A1 , which encodes the neuronal glutamate/aspartate/cysteine transporter excitatory amino acid transporter 3 (EAAT3)/excitatory amino acid transporter 1 (EAAC1). However, no previous studies have investigated EAAT3 in basal ganglia circuits or in relation to OCD-related behavior. Here, we report a model of Slc1a1 loss based on an excisable STOP cassette that yields successful ablation of EAAT3 expression and function. Using amphetamine as a probe, we found that EAAT3 loss prevents expected increases in ( i ) locomotor activity, ( ii ) stereotypy, and ( iii ) immediate early gene induction in the dorsal striatum following amphetamine administration. Further, Slc1a1 -STOP mice showed diminished grooming in an SKF-38393 challenge experiment, a pharmacologic model of OCD-like grooming behavior. This reduced grooming is accompanied by reduced dopamine D 1 receptor binding in the dorsal striatum of Slc1a1 -STOP mice. Slc1a1 -STOP mice also exhibit reduced extracellular dopamine concentrations in the dorsal striatum both at baseline and following amphetamine challenge. Viral-mediated restoration of Slc1a1 /EAAT3 expression in the midbrain but not in the striatum results in partial rescue of amphetamine-induced locomotion and stereotypy in Slc1a1 -STOP mice, consistent with an impact of EAAT3 loss on presynaptic dopaminergic function. Collectively, these findings indicate that the most consistently associated OCD candidate gene impacts basal ganglia-dependent repetitive behaviors.

  17. SLC37A1 and SLC37A2 are phosphate-linked, glucose-6-phosphate antiporters.

    Directory of Open Access Journals (Sweden)

    Chi-Jiunn Pan

    Full Text Available Blood glucose homeostasis between meals depends upon production of glucose within the endoplasmic reticulum (ER of the liver and kidney by hydrolysis of glucose-6-phosphate (G6P into glucose and phosphate (P(i. This reaction depends on coupling the G6P transporter (G6PT with glucose-6-phosphatase-α (G6Pase-α. Only one G6PT, also known as SLC37A4, has been characterized, and it acts as a P(i-linked G6P antiporter. The other three SLC37 family members, predicted to be sugar-phosphate:P(i exchangers, have not been characterized functionally. Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to couple with G6Pase-α. G6PT- and mock-proteoliposomes are used as positive and negative controls, respectively. We show that SLC37A1 and SLC37A2 are ER-associated, P(i-linked antiporters, that can transport G6P. Unlike G6PT, neither is sensitive to chlorogenic acid, a competitive inhibitor of physiological ER G6P transport, and neither couples to G6Pase-α. We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. However, only G6PT/SLC37A4 matches the characteristics of the physiological ER G6P transporter, suggesting the other SLC37 proteins have roles independent of blood glucose homeostasis.

  18. Transport by SLC5A8 with subsequent inhibition of histone deacetylase 1 (HDAC1) and HDAC3 underlies the antitumor activity of 3-bromopyruvate.

    Science.gov (United States)

    Thangaraju, Muthusamy; Karunakaran, Senthil K; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D; Ganapathy, Vadivel

    2009-10-15

    3-bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of adenosine triphosphate production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The current studies uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. The transport of 3-bromopyruvate by sodium-coupled monocarboxylate transporter SMCT1 (SLC5A8), a tumor suppressor and a sodium (Na+)-coupled, electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by fluorescence-activated cell-sorting analysis and colony-formation assay. The acetylation status of histone H4 was evaluated by Western blot analysis. 3-Bromopyruvate is a transportable substrate for SLC5A8, and that transport process is Na+-coupled and electrogenic. MCF7 cells did not express SLC5A8 and were not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells underwent apoptosis in the presence of 3-bromopyruvate. This cell death was associated with the inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identified HDAC1 and HDAC3 as the targets for 3-bromopyruvate. 3-Bromopyruvate was transported into cells actively through the tumor suppressor SLC5A8, and the process was energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells led to apoptosis, and the mechanism involved the inhibition of HDAC1/HDAC3. Copyright (c) 2009 American Cancer Society.

  19. Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures

    Science.gov (United States)

    Carvill, Gemma L.; McMahon, Jacinta M.; Schneider, Amy; Zemel, Matthew; Myers, Candace T.; Saykally, Julia; Nguyen, John; Robbiano, Angela; Zara, Federico; Specchio, Nicola; Mecarelli, Oriano; Smith, Robert L.; Leventer, Richard J.; Møller, Rikke S.; Nikanorova, Marina; Dimova, Petia; Jordanova, Albena; Petrou, Steven; Helbig, Ingo; Striano, Pasquale; Weckhuysen, Sarah; Berkovic, Samuel F.; Scheffer, Ingrid E.; Mefford, Heather C.

    2015-01-01

    GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutations in seven individuals, all of whom have epilepsy with myoclonic-atonic seizures (MAE). We describe two truncations and four missense alterations, all of which most likely lead to loss of function of GAT-1 and thus reduced GABA re-uptake from the synapse. These individuals share many of the electrophysiological properties of Gat1-deficient mice, including spontaneous spike-wave discharges. Overall, pathogenic mutations occurred in 6/160 individuals with MAE, accounting for ∼4% of unsolved MAE cases. PMID:25865495

  20. Genetic polymorphisms and haplotypes of the organic cation transporter 1 gene (SLC22A1 in the Xhosa population of South Africa

    Directory of Open Access Journals (Sweden)

    Clifford Jacobs

    2014-06-01

    Full Text Available Human organic cation transporter 1 is primarily expressed in hepatocytes and mediates the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for human organic cation transporter 1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response to clinical drugs, which are substrates for this transporter. The genotypic and allelic distributions of 19 nonsynonymous and one intronic SLC22A1 single nucleotide polymorphisms were determined in 148 healthy Xhosa participants from South Africa, using a SNAPshot® multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F (rs34447885, P341L (rs2282143, V519F (rs78899680, and the intronic variant rs622342 were 1.7%, 8.4%, 3.0%, and 21.6%, respectively. None of the participants carried the variant allele for R61C (rs12208357, C88R (rs55918055, S189L (rs34104736, G220V (rs36103319, P283L (rs4646277, R287G (rs4646278, G401S (rs34130495, M440I (rs35956182, or G465R (rs34059508. In addition, no variant alleles were observed for A306T (COSM164365, A413V (rs144322387, M420V (rs142448543, I421F (rs139512541, C436F (rs139512541, V501E (rs143175763, or I542V (rs137928512 in the population. Eight haplotypes were inferred from the genotypic data. This study reports important genetic data that could be useful for future pharmacogenetic studies of drug transporters in the indigenous Sub-Saharan African populations.

  1. Inhibition of SLC1A5 sensitizes colorectal cancer to cetuximab.

    Science.gov (United States)

    Ma, Huanrong; Wu, Zhenzhen; Peng, Jianjun; Li, Yang; Huang, Hongxiang; Liao, Yi; Zhou, Minyu; Sun, Li; Huang, Na; Shi, Min; Bin, Jianping; Liao, Yulin; Rao, Jinjun; Wang, Lin; Liao, Wangjun

    2018-06-15

    Cetuximab resistance is a key barrier in treating metastatic colorectal cancer (mCRC). Targeting of metabolic resources import could resensitize drug-resistant cancer cells to anticancer treatments. Here we showed that the expression of the glutamine transporter solute carrier 1 family member 5 (SLC1A5) in clinical CRC samples of patients resisted to cetuximab was significantly higher than in those of patients responded to cetuximab. Inhibition of SLC1A5 by shRNA-mediated gene silencing or pharmacological inhibitor significantly suppressed the growth of CRC. Moreover, inhibition of SLC1A5 significantly enhanced the inhibitory efficacy of cetuximab on CRC proliferation both in vitro and in vivo. Mechanistically, SLC1A5 inhibition facilitated EGFR degradation through the ubiquitin-proteasome pathway, and decreased the expression of nuclear EGFR, both of which might have contribution to the improved response to cetuximab. This study provides the metabolic molecule SLC1A5 as a potential therapeutic target to increase the efficacy of cetuximab on CRC. © 2018 UICC.

  2. Sequence variation and linkage disequilibrium in the GABA transporter-1 gene (SLC6A1 in five populations: implications for pharmacogenetic research

    Directory of Open Access Journals (Sweden)

    Sughondhabirom Atapol

    2007-10-01

    Full Text Available Abstract Background GABA transporter-1 (GAT-1; genetic locus SLC6A1 is emerging as a novel target for treatment of neuropsychiatric disorders. To understand how population differences might influence strategies for pharmacogenetic studies, we identified patterns of genetic variation and linkage disequilibrium (LD in SLC6A1 in five populations representing three continental groups. Results We resequenced 12.4 kb of SLC6A1, including the promoters, exons and flanking intronic regions in African-American, Thai, Hmong, Finnish, and European-American subjects (total n = 40. LD in SLC6A1 was examined by genotyping 16 SNPs in larger samples. Sixty-three variants were identified through resequencing. Common population-specific variants were found in African-Americans, including a novel 21-bp promoter region variable number tandem repeat (VNTR, but no such variants were found in any of the other populations studied. Low levels of LD and the absence of major LD blocks were characteristic of all five populations. African-Americans had the highest genetic diversity. European-Americans and Finns did not differ in genetic diversity or LD patterns. Although the Hmong had the highest level of LD, our results suggest that a strategy based on the use of tag SNPs would not translate to a major improvement in genotyping efficiency. Conclusion Owing to the low level of LD and presence of recombination hotspots, SLC6A1 may be an example of a problematic gene for association and haplotype tagging-based genetic studies. The 21-bp promoter region VNTR polymorphism is a putatively functional candidate allele for studies focusing on variation in GAT-1 function in the African-American population.

  3. Lack of SLC2A1 (glucose transporter 1) mutations in 30 Italian patients with alternating hemiplegia of childhood.

    Science.gov (United States)

    De Grandis, Elisa; Stagnaro, Michela; Biancheri, Roberta; Giannotta, Melania; Gobbi, Giuseppe; Traverso, Monica; Veneselli, Edvige; Zara, Federico

    2013-07-01

    Alternating hemiplegia of childhood is a rare, predominantly sporadic disorder. Diagnosis is clinical, and little is known about genetics. Glucose transporter 1 deficiency syndrome shares with alternating hemiplegia of childhood paroxysmal and nonparoxysmal symptoms. The aim of the study was to investigate glucose transporter 1 mutations in 30 Italian patients. Genetic material was analyzed by DNA amplification and glucose transporter 1 region sequencing. Mutational analysis findings of the SLC2A1 gene were negative in all patients. The pattern of movement disorders was reviewed. Interictal dystonia and multiple paroxysmal events were typical of alternating hemiplegia of childhood. In conclusion, alternating hemiplegia of childhood is a heterogeneous clinical condition, and although glucose transporter 1 deficiency can represent an undiagnosed cause of this disorder, mutational analysis is not routinely recommended. Alternatively, a careful clinical analysis and the 3-O-methyl-D-glucose uptake test can allow prompt identification of a subgroup of patients with alternating hemiplegia of childhood treatable with a ketogenic diet.

  4. Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore.

    Science.gov (United States)

    Lean, Choo Bee; Lee, Edmund Jon Deoon

    2009-01-01

    MCT1(SLC16A1) is the first member of the monocarboxylate transporter (MCT) and its family is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study identifies genetic variations in SLC16A1 in the ethnic Chinese group of the Singaporean population (n=95). The promoter, coding region and exon-intron junctions of the SLC16A1 gene encoding the MCT1 transporter were screened for genetic variation in the study population by DNA sequencing. Seven genetic variations of SLC16A1, including 4 novel ones, were found: 2 in the promoter region, 2 in the coding exons (both nonsynonymous variations), 2 in the 3' untranslated region (3'UTR) and 1 in the intron. Of the two mutations detected in the promoter region, the -363-855T>C is a novel mutation. The 1282G>A (Val(428)Ile) is a novel SNP and was found as heterozygotic in 4 subjects. The 1470T>A (Asp(490)Glu) was found to be a common polymorphism in this study. Lastly, IVS3-17A>C in intron 3 and 2258 (755)A>G in 3'UTR are novel mutations found to be common polymorphisms in the local Chinese population. To our knowledge, this is the first report of a comprehensive analysis on the MCT1 gene in any population.

  5. Function and expression of the proton-coupled amino acid transporter Slc36a1 along the rat gastrointestinal tract

    DEFF Research Database (Denmark)

    Broberg, M. L.; Holm, Rasmus Koldborg; Tønsberg, H

    2012-01-01

    BACKGROUND AND PURPOSE: Intestinal absorption via membrane transporters may determine the pharmacokinetics of drug compounds. The hypothesis is that oral absorption of gaboxadol (4, 5, 6, 7-tetrahydroisoxazolo [5,4-c] pyridine-3-ol) in rats occurs via the proton-coupled amino acid transporter, r....... The intestinal expression of rSlc36a1 mRNA was measured by quantitative real-time PCR (q-RT-PCR). Furthermore, the hPAT1-/rPAT1-mediated transport of gaboxadol or L-proline was studied in hPAT1-expressing X. laevis oocytes, Caco-2 cell monolayers and excised segments of the rat intestine. KEY RESULTS......). The in vitro carrier-mediated uptake rate of L-proline in the excised intestinal segments was highest in the mid jejunum and low in the colon. The in vitro uptake and the in vivo absorption correlated with the expression of rSlc36a1 mRNA along the rat intestine. CONCLUSIONS AND IMPLICATIONS: The results...

  6. SLC6A1 Mutation and Ketogenic Diet in Epilepsy With Myoclonic-Atonic Seizures.

    Science.gov (United States)

    Palmer, Samantha; Towne, Meghan C; Pearl, Phillip L; Pelletier, Renee C; Genetti, Casie A; Shi, Jiahai; Beggs, Alan H; Agrawal, Pankaj B; Brownstein, Catherine A

    2016-11-01

    Epilepsy with myoclonic-atonic seizures, also known as myoclonic-astatic epilepsy or Doose syndrome, has been recently linked to variants in the SLC6A1 gene. Epilepsy with myoclonic-atonic seizures is often refractory to antiepileptic drugs, and the ketogenic diet is known for treating medically intractable seizures, although the mechanism of action is largely unknown. We report a novel SLC6A1 variant in a patient with epilepsy with myoclonic-atonic seizures, analyze its effects, and suggest a mechanism of action for the ketogenic diet. We describe a ten-year-old girl with epilepsy with myoclonic-atonic seizures and a de novo SLC6A1 mutation who responded well to the ketogenic diet. She carried a c.491G>A mutation predicted to cause p.Cys164Tyr amino acid change, which was identified using whole exome sequencing and confirmed by Sanger sequencing. High-resolution structural modeling was used to analyze the likely effects of the mutation. The SLC6A1 gene encodes a transporter that removes gamma-aminobutyric acid from the synaptic cleft. Mutations in SLC6A1 are known to disrupt the gamma-aminobutyric acid transporter protein 1, affecting gamma-aminobutyric acid levels and causing seizures. The p.Cys164Tyr variant found in our study has not been previously reported, expanding on the variants linked to epilepsy with myoclonic-atonic seizures. A 10-year-old girl with a novel SLC6A1 mutation and epilepsy with myoclonic-atonic seizures had an excellent clinical response to the ketogenic diet. An effect of the diet on gamma-aminobutyric acid reuptake mediated by gamma-aminobutyric acid transporter protein 1 is suggested. A personalized approach to epilepsy with myoclonic-atonic seizures patients carrying SLC6A1 mutation and a relationship between epilepsy with myoclonic-atonic seizures due to SLC6A1 mutations, GABAergic drugs, and the ketogenic diet warrants further exploration. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Overexpression of monocarboxylate transporter-1 (Slc16a1) in mouse pancreatic ß-cells leads to relative hyperinsulinism during exercise

    DEFF Research Database (Denmark)

    Pullen, Timothy J; Sylow, Lykke; Sun, Gao

    2012-01-01

    Exercise-induced hyperinsulinism (EIHI) is an autosomal dominant disorder characterized by inappropriate insulin secretion in response to vigorous physical exercise or pyruvate injection. Activating mutations in the monocarboxylate transporter-1 (MCT1, SLC16A1) promoter have been linked to EIHI....... Expression of this pyruvate transporter is specifically repressed (disallowed) in pancreatic ß-cells, despite nearly universal expression across other tissues. It has been impossible to determine, however, whether EIHI mutations cause MCT1 expression in patient ß-cells. The hypothesis that MCT1 expression...... in ß-cells is sufficient to cause EIHI by allowing entry of pyruvate and triggering insulin secretion thus remains unproven. Therefore, we generated a transgenic mouse capable of doxycycline-induced, ß-cell-specific overexpression of MCT1 to test this model directly. MCT1 expression caused isolated...

  8. Hypoxic Stress Upregulates the Expression of Slc38a1 in Brown Adipocytes via Hypoxia-Inducible Factor-1α.

    Science.gov (United States)

    Horie, Tetsuhiro; Fukasawa, Kazuya; Iezaki, Takashi; Park, Gyujin; Onishi, Yuki; Ozaki, Kakeru; Kanayama, Takashi; Hiraiwa, Manami; Kitaguchi, Yuka; Kaneda, Katsuyuki; Hinoi, Eiichi

    2018-01-01

    The availability of amino acid in the brown adipose tissue (BAT) has been shown to be altered under various conditions; however, little is known about the possible expression and pivotal role of amino acid transporters in BAT under physiological and pathological conditions. The present study comprehensively investigated whether amino acid transporters are regulated by obesogenic conditions in BAT in vivo. Moreover, we investigated the mechanism underlying the regulation of the expression of amino acid transporters by various stressors in brown adipocytes in vitro. The expression of solute carrier family 38 member 1 (Slc38a1; gene encoding sodium-coupled neutral amino acid transporter 1) was preferentially upregulated in the BAT of both genetic and acquired obesity mice in vivo. Moreover, the expression of Slc38a1 was induced by hypoxic stress through hypoxia-inducible factor-1α, which is a master transcription factor of the adaptive response to hypoxic stress, in brown adipocytes in vitro. These results indicate that Slc38a1 is an obesity-associated gene in BAT and a hypoxia-responsive gene in brown adipocytes. © 2017 S. Karger AG, Basel.

  9. Effects of fasting and refeeding on gene expression of slc15a1a, a gene encoding an oligopeptide transporter (PepT1), in the intestine of Mozambique tilapia.

    Science.gov (United States)

    Orozco, Zenith Gaye A; Soma, Satoshi; Kaneko, Toyoji; Watanabe, Soichi

    2017-01-01

    The tissue distribution of slc15a1a, a gene that encodes an oligopeptide transporter, PepT1, and its response to fasting and refeeding were investigated in the intestinal epithelium of Mozambique tilapia for a better understanding of its role on nutrient absorption. The slc15a1a was predominantly expressed in the absorptive epithelia of the anterior part of the intestine, suggesting that digested oligopeptides are primarily absorbed in the anterior intestine. The response of slc15a1a to fasting was evaluated at 1, 2, 4, 7 and 14days after the last feeding. Fasting revealed a biphasic effect, where short-term fasting significantly upregulated slc15a1a expression and long-term fasting resulted in downregulation. The expression level continued to decrease and fell below the pre-fasted level from day 4 to 14. Proximal (the hepatic loop, HL) and distal parts (the proximal major coil, PMC) of the anterior intestine showed different magnitudes of responses to fasting; slc15a1a expression in the PMC showed greater upregulation and downregulation than that in the HL. Refeeding significantly stimulated slc15a1a expression at day 3, although the expression did not exceed the pre-fasted level. Observed responses of slc15a1a to fasting and refeeding suggest that the expression level of this gene can serve as a sensitive indicator of the changes that may occur in altering nutritional conditions. These findings contribute to a better understanding of the role of PepT1 in nutrition and of the complex mechanisms underlying the absorption of oligopeptides and amino acids in the intestine, and may lead to development of possible means to manipulate the absorption processes for the improvement of growth and other metabolic and physiological conditions in fish. Copyright © 2016. Published by Elsevier Inc.

  10. Regulators of Slc4 bicarbonate transporter activity

    Directory of Open Access Journals (Sweden)

    Ian M. Thornell

    2015-06-01

    Full Text Available The Slc4 family of transporters is comprised of anion exchangers (AE1-4, Na-coupled bicarbonate transporters (NCBTs including electrogenic Na/bicarbonate cotransporters (NBCe1 and NBCe2, electroneutral Na/bicarbonate cotransporters (NBCn1 and NBCn2, and the electroneutral Na-driven Cl-bicarbonate exchanger (NDCBE, as well as a borate transporter (BTR1. These transporters regulate intracellular pH (pHi and contribute to steady-state pHi, but are also involved in other physiological processes including CO2 carriage by red blood cells and solute secretion/reabsorption across epithelia. Acid-base transporters function as either acid extruders or acid loaders, with the Slc4 proteins moving HCO3– either into or out of cells. According to results from both molecular and functional studies, multiple Slc4 proteins and/or associated splice variants with similar expected effects on pHi are often found in the same tissue or cell. Such apparent redundancy is likely to be physiologically important. In addition to regulating pHi, a HCO3– transporter contributes to a cell’s ability to fine tune the intracellular regulation of the cotransported/exchanged ion(s (e.g., Na+ or Cl–. In addition, functionally similar transporters or splice variants with different regulatory profiles will optimize pH physiology and solute transport under various conditions or within subcellular domains. Such optimization will depend on activated signaling pathways and transporter expression profiles. In this review, we will summarize and discuss both classical and more recently identified regulators of the Slc4 proteins. Some of these regulators include traditional second messengers, lipids, binding proteins, autoregulatory domains, and less conventional regulators. The material presented will provide insight into the diversity and physiological significance of multiple members within the Slc4 gene family.

  11. The role of SLC2A1 in early onset and childhood absence epilepsies

    DEFF Research Database (Denmark)

    Muhle, Hiltrud; Helbig, Ingo; Frøslev, Tobias Guldberg

    2013-01-01

    Early Onset Absence Epilepsy constitutes an Idiopathic Generalized Epilepsy with absences starting before the age of four years. Mutations in SLC2A1, encoding the glucose transporter, account for approximately 10% of EOAE cases. The role of SLC2A1 mutations in absence epilepsies with a later onset...

  12. Fructose Synthesis and Transport at the Uterine-Placental Interface of Pigs: Cell-Specific Localization of SLC2A5, SLC2A8, and Components of the Polyol Pathway.

    Science.gov (United States)

    Steinhauser, Chelsie B; Landers, McKinsey; Myatt, Louise; Burghardt, Robert C; Vallet, Jeffrey L; Bazer, Fuller W; Johnson, Greg A

    2016-11-01

    The fetal fluids and uterine flushings of pigs contain higher concentrations of fructose than glucose, but fructose is not detected in maternal blood. Fructose can be synthesized from glucose via enzymes of the polyol pathway, aldose reductase (AKR1B1) and sorbitol dehydrogenase (SORD), transported across cell membranes by solute carriers SLC2A5 and SLC2A8, and converted to fructose-1-phosphate by ketohexokinase (KHK). SLC2A8, SLC2A5, AKR1B1, SORD, and KHK mRNAs and proteins were analyzed using quantitative PCR and immunohistochemistry or in situ hybridization in endometria and placentae of cyclic and pregnant gilts, cyclic gilts injected with estrogen, and ovariectomized gilts injected with progesterone. Progesterone up-regulated SLC2A8 protein in uterine luminal (LE) and glandular epithelia during the peri-implantation period, and expression became exclusively placental, chorion and blood vessels, after Day 30. P4 up-regulated SLC2A5 mRNA in uterine LE and glandular epithelia after implantation, and the chorion expressed SLC2A5 between Days 30 and 85. AKR1B1 and SORD proteins localized to uterine LE during the peri-implantation period, but expression switched to chorion by Day 20 and was maintained through Day 85. Uterine expression of AKR1B1 mRNA was down-regulated by estrogen. KHK protein localized to trophectoderm/chorion throughout gestation. These results provide evidence that components for the conversion of glucose to fructose and for fructose transport are present at the uterine-placental interface of pigs. The shift in expression from LE to chorion during pregnancy suggests free-floating conceptuses are supported by fructose synthesized by the uterus, but after implantation, the chorion becomes self-sufficient for fructose synthesis and transport. © 2016 by the Society for the Study of Reproduction, Inc.

  13. Deletions at SLC18A1 increased the risk of CRC and lower SLC18A1 expression associated with poor CRC outcome.

    Science.gov (United States)

    Zhang, Dandan; Li, Zhenli; Xu, Xiaohong; Zhou, Dan; Tang, Shunli; Yin, Xiaoyang; Xu, Fangying; Li, Hui; Zhou, Yuan; Zhu, Tao; Deng, Hong; Zhang, Shuai; Huang, Qiong; Wang, Jing; Yin, Wei; Zhu, Yimin; Lai, Maode

    2017-10-26

    Copy number variations (CNVs) contribute to the development of colorectal cancer (CRC). We conducted a two-stage association study to identify CNV risk loci for CRC. We performed a gene-based rare CNV study on 694 sporadic CRC and 1641 controls using Illumina Human-OmniExpress-12v1.0 BeadChips, and further replicated in 934 CRC cases and 2680 controls for risk CNVs by using TaqMan Copy Number Assay. Tumor buddings, cancer cells in the center of primary tumor and normal intestinal epithelial cells were captured using laser capture microdissection (LCM) and were assayed using AffymetrixGeneChip® Human Genome U133 Plus 2.0 Array. In addition, The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus data were assessed for the effects of risk CNVs. We found that germline deletions affecting the last six exons of SLC18A1 significantly associated with CRC with a combined P value of 6.4 × 10-5 by a two-stage analysis. Both in TCGA CRC RNA seq dataset and GDS4382, SLC18A1 was significantly down regulated in CRC tissues than in paired normal tissues (N = 32 and 17 pairs, P = 0.004 and 0.009, respectively). In LCM samples, similar observations were obtained that the expression levels of SLC18A1 in the tumor buddings, cancer cells in the center of primary tumor, and stroma of both tumor budding and cancer cells were lower than normal intestinal epithelial and stromal cells (fold change = 0.17-0.62, 0.12-0.57 and 0.37-0.68, respectively). In summary, the germline deletions at SLC18A1 contributed to the development of CRC. The role of SLC18A1 required further exploration. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  14. The blood-brain barrier fatty acid transport protein 1 (FATP1/SLC27A1) supplies docosahexaenoic acid to the brain, and insulin facilitates transport.

    Science.gov (United States)

    Ochiai, Yusuke; Uchida, Yasuo; Ohtsuki, Sumio; Tachikawa, Masanori; Aizawa, Sanshiro; Terasaki, Tetsuya

    2017-05-01

    We purposed to clarify the contribution of fatty acid transport protein 1 (FATP1/SLC 27A1) to the supply of docosahexaenoic acid (DHA) to the brain across the blood-brain barrier in this study. Transport experiments showed that the uptake rate of [ 14 C]-DHA in human FATP1-expressing HEK293 cells was significantly greater than that in empty vector-transfected (mock) HEK293 cells. The steady-state intracellular DHA concentration was nearly 2-fold smaller in FATP1-expressing than in mock cells, suggesting that FATP1 works as not only an influx, but also an efflux transporter for DHA. [ 14 C]-DHA uptake by a human cerebral microvascular endothelial cell line (hCMEC/D3) increased in a time-dependent manner, and was inhibited by unlabeled DHA and a known FATP1 substrate, oleic acid. Knock-down of FATP1 in hCMEC/D3 cells with specific siRNA showed that FATP1-mediated uptake accounts for 59.2-73.0% of total [ 14 C]-DHA uptake by the cells. Insulin treatment for 30 min induced translocation of FATP1 protein to the plasma membrane in hCMEC/D3 cells and enhanced [ 14 C]-DHA uptake. Immunohistochemical analysis of mouse brain sections showed that FATP1 protein is preferentially localized at the basal membrane of brain microvessel endothelial cells. We found that two neuroprotective substances, taurine and biotin, in addition to DHA, undergo FATP1-mediated efflux. Overall, our results suggest that FATP1 localized at the basal membrane of brain microvessels contributes to the transport of DHA, taurine and biotin into the brain, and insulin rapidly increases DHA supply to the brain by promoting translocation of FATP1 to the membrane. Read the Editorial Comment for this article on page 324. © 2016 International Society for Neurochemistry.

  15. Transport via SLC5A8 with Subsequent Inhibition of Histone Deacetylases HDAC1 and HDAC3 Underlies the Antitumor Activity of 3-Bromopyruvate

    Science.gov (United States)

    Thangaraju, Muthusamy; Karunakaran, Senthil K.; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D.; Ganapathy, Vadivel

    2009-01-01

    Background 3-Bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of ATP production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The present studies have uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. Methods Transport of 3-bromopyruvate via SLC5A8, a tumor suppressor and a Na+-coupled electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by FACS analysis and colony formation assay. Acetylation status of histone H4 was evaluated by Western blot. Results 3-Bromopyruvate is a transportable substrate for SLC5A8, with the transport process being Na+-coupled and electrogenic. MCF7 cells do not express SLC5A8 and are not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells undergo apoptosis in the presence of 3-bromopyruvate. This cell death is associated with inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identify HDAC1 and HDAC3 as the targets for 3-bromopyruvate. Conclusions 3-Bromopyruvate is transported into cells actively via the tumor suppressor SLC5A8 and the process is energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells leads to apoptosis, and the mechanism involves inhibition of HDAC1/HDAC3. PMID:19637353

  16. Drug Clearance from Cerebrospinal Fluid Mediated by Organic Anion Transporters 1 (Slc22a6) and 3 (Slc22a8) at Arachnoid Membrane of Rats.

    Science.gov (United States)

    Zhang, Zhengyu; Tachikawa, Masanori; Uchida, Yasuo; Terasaki, Tetsuya

    2018-03-05

    Although arachnoid mater epithelial cells form the blood-arachnoid barrier (BAB), acting as a blood-CSF interface, it has been generally considered that the BAB is impermeable to water-soluble substances and plays a largely passive role. Here, we aimed to clarify the function of transporters at the BAB in regulating CSF clearance of water-soluble organic anion drugs based on quantitative targeted absolute proteomics (QTAP) and in vivo analyses. Protein expression levels of 61 molecules, including 19 ATP-binding-cassette (ABC) transporters and 32 solute-carrier (SLC) transporters, were measured in plasma membrane fraction of rat leptomeninges using QTAP. Thirty-three proteins were detected; others were under the quantification limits. Expression levels of multidrug resistance protein 1 (Mdr1a/P-gp/Abcb1a) and breast cancer resistance protein (Bcrp/Abcg2) were 16.6 and 3.27 fmol/μg protein (51.9- and 9.82-fold greater than in choroid plexus, respectively). Among those organic anion transporters detected only at leptomeninges, not choroid plexus, organic anion transporter 1 (oat1/Slc22a6) showed the greatest expression (2.73 fmol/μg protein). On the other hand, the protein expression level of oat3 at leptomeninges was 6.65 fmol/μg protein, and the difference from choroid plexus was within two-fold. To investigate oat1's role, we injected para-aminohippuric acid (PAH) with or without oat1 inhibitors into cisterna magna (to minimize the contribution of choroid plexus function) of rats. A bulk flow marker, FITC-inulin, was not taken up from CSF up to 15 min, whereas uptake clearance of PAH was 26.5 μL/min. PAH uptake was completely blocked by 3 mM cephalothin (inhibits both oat1 and oat3), while 17% of PAH uptake was inhibited by 0.2 mM cephalothin (selectively inhibits oat3). These results indicate that oat1 and oat3 at the BAB provide a distinct clearance pathway of organic anion drugs from CSF independently of choroid plexus.

  17. Partial deletion of the sulfate transporter SLC13A1 is associated with an osteochondrodysplasia in the Miniature Poodle breed.

    Directory of Open Access Journals (Sweden)

    Mark W Neff

    Full Text Available A crippling dwarfism was first described in the Miniature Poodle in Great Britain in 1956. Here, we resolve the genetic basis of this recessively inherited disorder. A case-control analysis (8:8 of genotype data from 173 k SNPs revealed a single associated locus on CFA14 (P(raw <10(-8. All affected dogs were homozygous for an ancestral haplotype consistent with a founder effect and an identical-by-descent mutation. Systematic failure of nine, nearly contiguous SNPs, was observed solely in affected dogs, suggesting a deletion was the causal mutation. A 130-kb deletion was confirmed both by fluorescence in situ hybridization (FISH analysis and by cloning the physical breakpoints. The mutation was perfectly associated in all cases and obligate heterozygotes. The deletion ablated all but the first exon of SLC13A1, a sodium/sulfate symporter responsible for regulating serum levels of inorganic sulfate. Our results corroborate earlier findings from an Slc13a1 mouse knockout, which resulted in hyposulfatemia and syndromic defects. Interestingly, the metabolic disorder in Miniature Poodles appears to share more clinical signs with a spectrum of human disorders caused by SLC26A2 than with the mouse Slc13a1 model. SLC26A2 is the primary sodium-independent sulfate transporter in cartilage and bone and is important for the sulfation of proteoglycans such as aggregan. We propose that disruption of SLC13A1 in the dog similarly causes undersulfation of proteoglycans in the extracellular matrix (ECM, which impacts the conversion of cartilage to bone. A co-dominant DNA test of the deletion was developed to enable breeders to avoid producing affected dogs and to selectively eliminate the mutation from the gene pool.

  18. SLC1 and SLC4 encode partially redundant acyl-coenzyme A 1-acylglycerol-3-phosphate O-acyltransferases of budding yeast

    DEFF Research Database (Denmark)

    Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath

    2007-01-01

    Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...

  19. Na(+) dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies

    DEFF Research Database (Denmark)

    Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D

    2013-01-01

    The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells....... Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular p...

  20. SLC2A9 is a high-capacity urate transporter in humans.

    Directory of Open Access Journals (Sweden)

    Mark J Caulfield

    2008-10-01

    ] 0.9 to 1.05, p > 0.33 by meta-analysis of an SLC2A9 variant in six case-control studies including 11,897 participants. In a separate meta-analysis of four population studies including 11,629 participants we found no association of SLC2A9 with systolic (effect size -0.12 mm Hg, 95% CI -0.68 to 0.43, p = 0.664 or diastolic blood pressure (effect size -0.03 mm Hg, 95% CI -0.39 to 0.31, p = 0.82.This study provides evidence that SLC2A9 splice variants act as high-capacity urate transporters and is one of the first functional characterisations of findings from genome-wide association scans. We did not find an association of the SLC2A9 gene with blood pressure in this study. Our findings suggest potential pathogenic mechanisms that could offer a new drug target for gout.

  1. Epigenetic regulation of the glucose transporter gene Slc2a1 by β-hydroxybutyrate underlies preferential glucose supply to the brain of fasted mice.

    Science.gov (United States)

    Tanegashima, Kosuke; Sato-Miyata, Yukiko; Funakoshi, Masabumi; Nishito, Yasumasa; Aigaki, Toshiro; Hara, Takahiko

    2017-01-01

    We carried out liquid chromatography-tandem mass spectrometry analysis of metabolites in mice. Those metabolome data showed that hepatic glucose content is reduced, but that brain glucose content is unaffected, during fasting, consistent with the priority given to brain glucose consumption during fasting. The molecular mechanisms for this preferential glucose supply to the brain are not fully understood. We also showed that the fasting-induced production of the ketone body β-hydroxybutyrate (β-OHB) enhances expression of the glucose transporter gene Slc2a1 (Glut1) via histone modification. Upon β-OHB treatment, Slc2a1 expression was up-regulated, with a concomitant increase in H3K9 acetylation at the critical cis-regulatory region of the Slc2a1 gene in brain microvascular endothelial cells and NB2a neuronal cells, shown by quantitative PCR analysis and chromatin immunoprecipitation assay. CRISPR/Cas9-mediated disruption of the Hdac2 gene increased Slc2a1 expression, suggesting that it is one of the responsible histone deacetylases (HDACs). These results confirm that β-OHB is a HDAC inhibitor and show that β-OHB plays an important role in fasting-induced epigenetic activation of a glucose transporter gene in the brain. © 2016 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  2. Positive selection in the SLC11A1 gene in the family Equidae

    DEFF Research Database (Denmark)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan

    2016-01-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...

  3. Neurosteroid Transport in the Brain: Role of ABC and SLC Transporters

    Directory of Open Access Journals (Sweden)

    Markus Grube

    2018-04-01

    Full Text Available Neurosteroids, comprising pregnane, androstane, and sulfated steroids can alter neuronal excitability through interaction with ligand-gated ion channels and other receptors and have therefore a therapeutic potential in several brain disorders. They can be formed in brain cells or are synthesized by an endocrine gland and reach the brain by penetrating the blood–brain barrier (BBB. Especially sulfated steroids such as pregnenolone sulfate (PregS and dehydroepiandrosterone sulfate (DHEAS depend on transporter proteins to cross membranes. In this review, we discuss the involvement of ATP-binding cassette (ABC- and solute carrier (SLC-type membrane proteins in the transport of these compounds at the BBB and in the choroid plexus (CP, but also in the secretion from neurons and glial cells. Among the ABC transporters, especially BCRP (ABCG2 and several MRP/ABCC subfamily members (MRP1, MRP4, MRP8 are expressed in the brain and known to efflux conjugated steroids. Furthermore, several SLC transporters have been shown to mediate cellular uptake of steroid sulfates. These include members of the OATP/SLCO subfamily, namely OATP1A2 and OATP2B1, as well as OAT3 (SLC22A3, which have been reported to be expressed at the BBB, in the CP and in part in neurons. Furthermore, a role of the organic solute transporter OSTα-OSTβ (SLC51A/B in brain DHEAS/PregS homeostasis has been proposed. This transporter was reported to be localized especially in steroidogenic cells of the cerebellum and hippocampus. To date, the impact of transporters on neurosteroid homeostasis is still poorly understood. Further insights are desirable also with regard to the therapeutic potential of these compounds.

  4. The role of SLC2A1 mutations in myoclonic astatic epilepsy and absence epilepsy, and the estimated frequency of GLUT1 deficiency syndrome

    DEFF Research Database (Denmark)

    Larsen, Jan; Johannesen, Katrine Marie; Ek, Jakob

    2015-01-01

    The first mutations identified in SLC2A1, encoding the glucose transporter type 1 (GLUT1) protein of the blood-brain barrier, were associated with severe epileptic encephalopathy. Recently, dominant SLC2A1 mutations were found in rare autosomal dominant families with various forms of epilepsy inc...

  5. The Role of Na:K:2Cl Cotransporter 1 (NKCC1/SLC12A2) in Dental Epithelium during Enamel Formation in Mice

    Science.gov (United States)

    Jalali, Rozita; Lodder, Johannes C.; Zandieh-Doulabi, Behrouz; Micha, Dimitra; Melvin, James E.; Catalan, Marcelo A.; Mansvelder, Huibert D.; DenBesten, Pamela; Bronckers, Antonius

    2017-01-01

    Na+:K+:2Cl− cotransporters (NKCCs) belong to the SLC12A family of cation-coupled Cl− transporters. We investigated whether enamel-producing mouse ameloblasts express NKCCs. Transcripts for Nkcc1 were identified in the mouse dental epithelium by RT-qPCR and NKCC1 protein was immunolocalized in outer enamel epithelium and in the papillary layer but not the ameloblast layer. In incisors of Nkcc1-null mice late maturation ameloblasts were disorganized, shorter and the mineral density of the enamel was reduced by 10% compared to wild-type controls. Protein levels of gap junction protein connexin 43, Na+-dependent bicarbonate cotransporter e1 (NBCe1), and the Cl−-dependent bicarbonate exchangers SLC26A3 and SLC26A6 were upregulated in Nkcc1-null enamel organs while the level of NCKX4/SLC24A4, the major K+, Na+ dependent Ca2+ transporter in maturation ameloblasts, was slightly downregulated. Whole-cell voltage clamp studies on rat ameloblast-like HAT-7 cells indicated that bumetanide increased ion-channel activity conducting outward currents. Bumetanide also reduced cell volume of HAT-7 cells. We concluded that non-ameloblast dental epithelium expresses NKCC1 to regulate cell volume in enamel organ and provide ameloblasts with Na+, K+ and Cl− ions required for the transport of mineral- and bicarbonate-ions into enamel. Absence of functional Nkcc1 likely is compensated by other types of ion channels and ion transporters. The increased amount of Cx43 in enamel organ cells in Nkcc1-null mice suggests that these cells display a higher number of gap junctions to increase intercellular communication. PMID:29209227

  6. Significance of downregulation of renal organic cation transporter (SLC47A1 in cisplatin-induced proximal tubular injury

    Directory of Open Access Journals (Sweden)

    Mizuno T

    2015-07-01

    Full Text Available Tomohiro Mizuno,1–3 Waichi Sato,2,3 Kazuhiro Ishikawa,4 Yuki Terao,1 Kazuo Takahashi,2 Yukihiro Noda,5 Yukio Yuzawa,2 Tadashi Nagamatsu1 1Department of Analytical Pharmacology, Meijo University Faculty of Pharmacy, Nagoya, 2Department of Nephrology, School of Medicine, Fujita Health University, Toyoake, 3Department of Nephrology, Nagoya University School of Medicine, Nagoya, 4Department of Neuropsychopharmacology and Hospital Pharmacy, Nagoya University Graduate School of Medicine, Nagoya, 5Division of Clinical Sciences and Neuropsychopharmacology, Meijo University Faculty of Pharmacy, Nagoya, Japan Background/aim: To elucidate the mechanism responsible for developing acute kidney injury in patients with diabetes mellitus, we also evaluated the issue of whether advanced glycation endproducts (AGEs influence the expressions of multi antimicrobial extrusion protein (MATE1/SLC47A1 in tubular cells. Materials and methods: To detect changing expression of MATE1/SLC47A1 in dose- and time-dependent manners, human proximal tubular epithelial cells were incubated with AGE-aggregated-human serum albumin. As a function assay for MATE1/SLC47A1, human proximal tubular epithelial cells were incubated with cisplatin or carboplatin. Results: On incubation with AGEs, the expressions of MATE1/SLC47A1 were decreased in tubular cells. In addition, the toxicities of cisplatin were increased in tubular cells that had been pretreated with AGEs. However, the toxicities of carboplatin were smaller than that of cisplatin in proximal tubular epithelial cells. Conclusion: The expression of the MATE1/SLC47A1 is decreased by AGEs, which increases the risk for proximal tubular injury. Keywords: advanced glycation endproducts, cisplatin, SLC47A1, diabetes mellitus, acute kidney injury

  7. S113R mutation in SLC33A1 leads to neurodegeneration and augmented BMP signaling in a mouse model

    Directory of Open Access Journals (Sweden)

    Pingting Liu

    2017-01-01

    Full Text Available The S113R mutation (c.339T>G (MIM #603690.0001 in SLC33A1 (MIM #603690, an ER membrane acetyl-CoA transporter, has been previously identified in individuals with hereditary spastic paraplegia type 42 (SPG42; MIM #612539. SLC33A1 has also been shown to inhibit the bone morphogenetic protein (BMP signaling pathway in zebrafish. To better understand the function of SLC33A1, we generated and characterized Slc33a1S113R knock-in mice. Homozygous Slc33a1S113R mutant mice were embryonic lethal, whereas heterozygous Slc33a1 mutant mice (Slc33a1wt/mut exhibited behavioral abnormalities and central neurodegeneration, which is consistent with hereditary spastic paraplegia (HSP phenotypes. Importantly, we found an upregulation of BMP signaling in the nervous system and mouse embryonic fibroblasts of Slc33a1wt/mut mice. Using a sciatic nerve crush injury model in vivo and dorsal root ganglion (DRG culture in vitro we showed that injury-induced axonal regeneration in Slc33a1wt/mut mice was accelerated and mediated by upregulated BMP signaling. Exogenous addition of BMP signaling antagonist, noggin, could efficiently alleviate the accelerated injury-induced axonal regrowth. These results indicate that SLC33A1 can negatively regulate BMP signaling in mice, further supporting the notion that upregulation of BMP signaling is a common mechanism of a subset of hereditary spastic paraplegias.

  8. mTORC1 Activator SLC38A9 Is Required to Efflux Essential Amino Acids from Lysosomes and Use Protein as a Nutrient.

    Science.gov (United States)

    Wyant, Gregory A; Abu-Remaileh, Monther; Wolfson, Rachel L; Chen, Walter W; Freinkman, Elizaveta; Danai, Laura V; Vander Heiden, Matthew G; Sabatini, David M

    2017-10-19

    The mTORC1 kinase is a master growth regulator that senses many environmental cues, including amino acids. Activation of mTORC1 by arginine requires SLC38A9, a poorly understood lysosomal membrane protein with homology to amino acid transporters. Here, we validate that SLC38A9 is an arginine sensor for the mTORC1 pathway, and we uncover an unexpectedly central role for SLC38A9 in amino acid homeostasis. SLC38A9 mediates the transport, in an arginine-regulated fashion, of many essential amino acids out of lysosomes, including leucine, which mTORC1 senses through the cytosolic Sestrin proteins. SLC38A9 is necessary for leucine generated via lysosomal proteolysis to exit lysosomes and activate mTORC1. Pancreatic cancer cells, which use macropinocytosed protein as a nutrient source, require SLC38A9 to form tumors. Thus, through SLC38A9, arginine serves as a lysosomal messenger that couples mTORC1 activation to the release from lysosomes of the essential amino acids needed to drive cell growth. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Linking chronic infection and autoimmune diseases: Mycobacterium avium subspecies paratuberculosis, SLC11A1 polymorphisms and type-1 diabetes mellitus.

    Directory of Open Access Journals (Sweden)

    Daniela Paccagnini

    2009-09-01

    Full Text Available The etiology of type 1 diabetes mellitus (T1DM is still unknown; numerous studies are performed to unravel the environmental factors involved in triggering the disease. SLC11A1 is a membrane transporter that is expressed in late endosomes of antigen presenting cells involved in the immunopathogenic events leading to T1DM. Mycobacterium avium subsp. paratuberculosis (MAP has been reported to be a possible trigger in the development of T1DM.Fifty nine T1DM patients and 79 healthy controls were genotyped for 9 polymorphisms of SLC11A1 gene, and screened for the presence of MAP by PCR. Differences in genotype frequency were evaluated for both T1DM patients and controls. We found a polymorphism in the SLC11A1 gene (274C/T associated to type 1 diabetic patients and not to controls. The presence of MAP DNA was also significantly associated with T1DM patients and not with controls.The 274C/T SCL11A1 polymorphism was found to be associated with T1DM as well as the presence of MAP DNA in blood. Since MAP persists within macrophages and it is also processed by dendritic cells, further studies are necessary to evaluate if mutant forms of SLC11A1 alter the processing or presentation of MAP antigens triggering thereby an autoimmune response in T1DM patients.

  10. Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction

    Directory of Open Access Journals (Sweden)

    Yun-Fang Jia

    2017-07-01

    Full Text Available While downregulation of excitatory amino acid transporter 2 (EAAT2, the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD, the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR and thymine–adenine (TA cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150 with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32. In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009 and binge eating (p = 0.0002 remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156 in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.

  11. Upregulation of the Creatine Transporter Slc6A8 by Klotho

    Directory of Open Access Journals (Sweden)

    Ahmad Almilaji

    2014-11-01

    Full Text Available Background/Aims: The transmembrane Klotho protein contributes to inhibition of 1,25(OH2D3 formation. The extracellular domain of Klotho protein could function as an enzyme with e.g. β-glucuronidase activity, be cleaved off and be released into blood and cerebrospinal fluid. Klotho regulates several cellular transporters. Klotho protein deficiency accelerates the appearance of age related disorders including neurodegeneration and muscle wasting and eventually leads to premature death. The main site of Klotho protein expression is the kidney. Klotho protein is also appreciably expressed in other tissues including chorioid plexus. The present study explored the effect of Klotho protein on the creatine transporter CreaT (Slc6A8, which participates in the maintenance of neuronal function and survival. Methods: To this end cRNA encoding Slc6A8 was injected into Xenopus oocytes with and without additional injection of cRNA encoding Klotho protein. Creatine transporter CreaT (Slc6A8 activity was estimated from creatine induced current determined by two-electrode voltage-clamp. Results: Coexpression of Klotho protein significantly increased creatine-induced current in Slc6A8 expressing Xenopus oocytes. Coexpression of Klotho protein delayed the decline of creatine induced current following inhibition of carrier insertion into the cell membrane by brefeldin A (5 µM. The increase of creatine induced current by coexpression of Klotho protein in Slc6A8 expressing Xenopus oocytes was reversed by β-glucuronidase inhibitor (DSAL. Similarly, treatment of Slc6A8 expressing Xenopus oocytes with recombinant human alpha Klotho protein significantly increased creatine induced current. Conclusion: Klotho protein up-regulates the activity of creatine transporter CreaT (Slc6A8 by stabilizing the carrier protein in the cell membrane, an effect requiring β-glucuronidase activity of Klotho protein.

  12. Solute carrier protein family 11 member 1 (Slc11a1) activation efficiently inhibits Leishmania donovani survival in host macrophages.

    Science.gov (United States)

    Singh, Nisha; Gedda, Mallikarjuna Rao; Tiwari, Neeraj; Singh, Suya P; Bajpai, Surabhi; Singh, Rakesh K

    2017-09-01

    Visceral leishmaniasis (kala-azar), a life threatening disease caused by L. donovani , is a latent threat to more than 147 million people living in disease endemic South East Asia region of the Indian subcontinent. The therapeutic option to control leishmanial infections are very limited, and at present comprise only two drugs, an antifungal amphotericin B and an antitumor miltefosine, which are also highly vulnerable for parasitic resistance. Therefore, identification and development of alternate control measures is an exigent requirement to control leishmanial infections. In this study, we report that functionally induced expression of solute carrier protein family 11 member 1 ( Slc11a1), a transmembrane divalent cationic transporter recruited on the surface of phagolysosomes after phagocytosis of parasites, effectively inhibits Leishmania donovani growth in host macrophages. Further, the increased Slc11a1 functionality also resulted in increased production of NOx, TNF-α and IL-12 by activated macrophages. The findings of this study signify the importance of interplay between Slc11a1 expression and macrophages activation that can be effectively used to control of Leishmania growth and survival.

  13. Plasma Membrane Na+-Coupled Citrate Transporter (SLC13A5 and Neonatal Epileptic Encephalopathy

    Directory of Open Access Journals (Sweden)

    Yangzom D. Bhutia

    2017-02-01

    Full Text Available SLC13A5 is a Na+-coupled transporter for citrate that is expressed in the plasma membrane of specific cell types in the liver, testis, and brain. It is an electrogenic transporter with a Na+:citrate3− stoichiometry of 4:1. In humans, the Michaelis constant for SLC13A5 to transport citrate is ~600 μM, which is physiologically relevant given that the normal concentration of citrate in plasma is in the range of 150–200 μM. Li+ stimulates the transport function of human SLC13A5 at concentrations that are in the therapeutic range in patients on lithium therapy. Human SLC13A5 differs from rodent Slc13a5 in two important aspects: the affinity of the human transporter for citrate is ~30-fold less than that of the rodent transporter, thus making human SLC13A5 a low-affinity/high-capacity transporter and the rodent Slc13a5 a high-affinity/low-capacity transporter. In the liver, SLC13A5 is expressed exclusively in the sinusoidal membrane of the hepatocytes, where it plays a role in the uptake of circulating citrate from the sinusoidal blood for metabolic use. In the testis, the transporter is expressed only in spermatozoa, which is also only in the mid piece where mitochondria are located; the likely function of the transporter in spermatozoa is to mediate the uptake of citrate present at high levels in the seminal fluid for subsequent metabolism in the sperm mitochondria to generate biological energy, thereby supporting sperm motility. In the brain, the transporter is expressed mostly in neurons. As astrocytes secrete citrate into extracellular medium, the potential function of SLC13A5 in neurons is to mediate the uptake of circulating citrate and astrocyte-released citrate for subsequent metabolism. Slc13a5-knockout mice have been generated; these mice do not have any overt phenotype but are resistant to experimentally induced metabolic syndrome. Recently however, loss-of-function mutations in human SLC13A5 have been found to cause severe epilepsy

  14. Subsidence of the pit slab at SLC experimental hall

    International Nuclear Information System (INIS)

    Inaba, J.; Himeno, Yoichi; Katsura, Yutaka

    1992-01-01

    Detectors installed at particle accelerator facilities are quite heavy, weighing thousands of tons. On the other hand, ground subsidence caused by the installation of a detector adversely affects the beam line alignment of the collider. It becomes, therefore, very important to figure out the expected amount of ground settlement by means of adequate evaluation methods in advance. At Stanford Linear Accelerator Center (SLAC), a 1700 mT (metric tons) Mark II detector was replaced with a 4000 mT SLD detector in Stanford Linear Collider (SLC). The exchange started in December 1990 and lasted until March 1991, and the amount of ground settlement was measured by SLAC during that period. We performed simulation studies to evaluate the subsidence of the pit slab using several analysis methods. Parameters used for the analyses were decided based on the information of the SLC structure and the ground conditions at the SLAC area. The objective of this study is to verify the applicability of several simulation methods by comparing the analytical results with the actual subsidence data obtained by SLAC

  15. The copper transporter (SLC31A1/CTR1) is expressed in bovine spermatozoa and oocytes: Copper in IVF medium improves sperm quality.

    Science.gov (United States)

    Anchordoquy, J P; Anchordoquy, J M; Pascua, A M; Nikoloff, N; Peral-García, P; Furnus, C C

    2017-07-15

    Adequate dietary intake of copper (Cu) is required for normal reproductive performance in cattle. The objective of this study was to investigate the pregnancy rates from cattle with deficient, marginal and adequate Cu plasma concentration at the beginning of artificial insemination protocol. Moreover, we determined Cu concentrations present in bovine oviductal fluid (OF), and the effects of Cu on fertilizing ability of bovine spermatozoa. Also, the presence of Cu transporter, SLC31A1 (also known as CTR1), in spermatozoa and in vitro matured oocyte were investigated. We found no differences in pregnancy rates among animals with adequate, marginal, and deficient Cu concentrations measured in plasma at the beginning of fixed-time artificial insemination (FTAI) protocol. Copper concentrations in OF were 38.3 ± 2.17 μg/dL (mean ± SEM) regardless of cupremia levels. The addition of 40 μg/dL Cu to IVF medium enhanced total and progressive motility, sperm viability, functional sperm membrane integrity (HOST), sperm-zona binding, and pronuclear formation. On the other hand, the presence of Cu in IVF medium did not modify acrosome integrity and cleavage rates after IVF, but impaired blastocyst rates. Cu transporter SLC31A1 was detected in bovine spermatozoa in the apical segment of acrosome, and in the oocyte matured in vitro. In conclusion, the results obtained in the present study determined that cupremia levels at the beginning of FTAI protocol did not influence the pregnancy rates at 60 d after insemination. The presence of CTR1 in bovine mature oocyte and spermatozoa, as well as the beneficial effect of Cu on sperm quality would suggest an important role of this mineral during the fertilization process. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Metformin Is a Substrate and Inhibitor of the Human Thiamine Transporter, THTR-2 (SLC19A3).

    Science.gov (United States)

    Liang, Xiaomin; Chien, Huan-Chieh; Yee, Sook Wah; Giacomini, Marilyn M; Chen, Eugene C; Piao, Meiling; Hao, Jia; Twelves, Jolyn; Lepist, Eve-Irene; Ray, Adrian S; Giacomini, Kathleen M

    2015-12-07

    The biguanide metformin is widely used as first-line therapy for the treatment of type 2 diabetes. Predominately a cation at physiological pH's, metformin is transported by membrane transporters, which play major roles in its absorption and disposition. Recently, our laboratory demonstrated that organic cation transporter 1, OCT1, the major hepatic uptake transporter for metformin, was also the primary hepatic uptake transporter for thiamine, vitamin B1. In this study, we tested the reverse, i.e., that metformin is a substrate of thiamine transporters (THTR-1, SLC19A2, and THTR-2, SLC19A3). Our study demonstrated that human THTR-2 (hTHTR-2), SLC19A3, which is highly expressed in the small intestine, but not hTHTR-1, transports metformin (Km = 1.15 ± 0.2 mM) and other cationic compounds (MPP(+) and famotidine). The uptake mechanism for hTHTR-2 was pH and electrochemical gradient sensitive. Furthermore, metformin as well as other drugs including phenformin, chloroquine, verapamil, famotidine, and amprolium inhibited hTHTR-2 mediated uptake of both thiamine and metformin. Species differences in the substrate specificity of THTR-2 between human and mouse orthologues were observed. Taken together, our data suggest that hTHTR-2 may play a role in the intestinal absorption and tissue distribution of metformin and other organic cations and that the transporter may be a target for drug-drug and drug-nutrient interactions.

  17. SLC3A1 and SLC7A9 mutations in autosomal recessive or dominant canine cystinuria: a new classification system.

    Science.gov (United States)

    Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U

    2013-01-01

    Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.

  18. SLC25 Family Member Genetic Interactions Identify a Role for HEM25 in Yeast Electron Transport Chain Stability.

    Science.gov (United States)

    Dufay, J Noelia; Fernández-Murray, J Pedro; McMaster, Christopher R

    2017-06-07

    The SLC25 family member SLC25A38 (Hem25 in yeast) was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25 Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1 Δ hem25 Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components. Copyright © 2017 Dufay et al.

  19. SLC25 Family Member Genetic Interactions Identify a Role for HEM25 in Yeast Electron Transport Chain Stability

    Directory of Open Access Journals (Sweden)

    J. Noelia Dufay

    2017-06-01

    Full Text Available The SLC25 family member SLC25A38 (Hem25 in yeast was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25. Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1Δ hem25Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components.

  20. The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters*

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

  1. Glucose transporter-1 deficiency syndrome : the expanding clinical and genetic spectrum of a treatable disorder

    NARCIS (Netherlands)

    Leen, Wilhelmina G.; Klepper, Joerg; Verbeek, Marcel M.; Leferink, Maike; Hofste, Tom; van Engelen, Baziel G.; Wevers, Ron A.; Arthur, Todd; Bahi-Buisson, Nadia; Ballhausen, Diana; Bekhof, Jolita; van Bogaert, Patrick; Carrilho, Ines; Chabrol, Brigitte; Champion, Michael P.; Coldwell, James; Clayton, Peter; Donner, Elizabeth; Evangeliou, Athanasios; Ebinger, Friedrich; Farrell, Kevin; Forsyth, Rob J.; de Goede, Christian G. E. L.; Gross, Stephanie; Grunewald, Stephanie; Holthausen, Hans; Jayawant, Sandeep; Lachlan, Katherine; Laugel, Vincent; Leppig, Kathy; Lim, Ming J.; Mancini, Grazia; Della Marina, Adela; Martorell, Loreto; McMenamin, Joe; Meuwissen, Marije E. C.; Mundy, Helen; Nilsson, Nils O.; Panzer, Axel; Poll-The, Bwee T.; Rauscher, Christian; Rouselle, Christophe M. R.; Sandvig, Inger; Scheffner, Thomas; Sheridan, Eamonn; Simpson, Neil; Sykora, Parol; Tomlinson, Richard; Trounce, John; Webb, David; Weschke, Bernhard; Scheffer, Hans; Willemsen, Michel A.

    Glucose transporter-1 deficiency syndrome is caused by mutations in the SLC2A1 gene in the majority of patients and results in impaired glucose transport into the brain. From 2004-2008, 132 requests for mutational analysis of the SLC2A1 gene were studied by automated Sanger sequencing and multiplex

  2. Glucose transporter-1 deficiency syndrome: The expanding clinical and genetic spectrum of a treatable disorder

    NARCIS (Netherlands)

    W.G. Leen (Wilhelmina); J. Klepper (Joerg); M.M. Verbeek (Marcel); M. Leferink (Maike); T. Hofste (Tom); B.G.M. van Engelen (Baziel); R.A. Wevers (Ron); T. Arthur (Todd); N. Bahi-Buisson (Nadia); D. Ballhausen (Diana); J. Bekhof (Jolita); P. van Bogaert (Patrick); I. Carrilho (Inês); B. Chabrol (Brigitte); M.P. Champion (Michael); J. Coldwell (James); P. Clayton (Peter); E. Donner (Elizabeth); A. Evangeliou (Athanasios); F. Ebinger (Friedrich); K. Farrell (Kevin); R.J. Forsyth (Rob); C.G.E.L. de Goede (Christian); S. Gross (Stephanie); S. Grünewald (Sonja); H. Holthausen (Hans); S. Jayawant (Sandeep); K. Lachlan (Katherine); V. Laugel (Vincent); K. Leppig (Kathy); M.J. Lim (Ming); G.M.S. Mancini (Grazia); A.D. Marina; L. Martorell (Loreto); J. McMenamin (Joe); M.E.C. Meuwissen (Marije); H. Mundy (Helen); N.O. Nilsson (Nils); A. Panzer (Axel); B.T. Poll-The; C. Rauscher (Christian); C.M.R. Rouselle (Christophe); I. Sandvig (Inger); T. Scheffner (Thomas); E. Sheridan (Eamonn); N. Simpson (Neil); P. Sykora (Parol); R. Tomlinson (Richard); J. Trounce (John); D.W.M. Webb (David); B. Weschke (Bernhard); H. Scheffer (Hans); M.A. Willemsen (Michél)

    2010-01-01

    textabstractGlucose transporter-1 deficiency syndrome is caused by mutations in the SLC2A1 gene in the majority of patients and results in impaired glucose transport into the brain. From 2004-2008, 132 requests for mutational analysis of the SLC2A1 gene were studied by automated Sanger sequencing

  3. Glucose transporter-1 deficiency syndrome: the expanding clinical and genetic spectrum of a treatable disorder

    NARCIS (Netherlands)

    Leen, Wilhelmina G.; Klepper, Joerg; Verbeek, Marcel M.; Leferink, Maike; Hofste, Tom; van Engelen, Baziel G.; Wevers, Ron A.; Arthur, Todd; Bahi-Buisson, Nadia; Ballhausen, Diana; Bekhof, Jolita; van Bogaert, Patrick; Carrilho, Inês; Chabrol, Brigitte; Champion, Michael P.; Coldwell, James; Clayton, Peter; Donner, Elizabeth; Evangeliou, Athanasios; Ebinger, Friedrich; Farrell, Kevin; Forsyth, Rob J.; de Goede, Christian G. E. L.; Gross, Stephanie; Grunewald, Stephanie; Holthausen, Hans; Jayawant, Sandeep; Lachlan, Katherine; Laugel, Vincent; Leppig, Kathy; Lim, Ming J.; Mancini, Grazia; Marina, Adela Della; Martorell, Loreto; McMenamin, Joe; Meuwissen, Marije E. C.; Mundy, Helen; Nilsson, Nils O.; Panzer, Axel; Poll-The, Bwee T.; Rauscher, Christian; Rouselle, Christophe M. R.; Sandvig, Inger; Scheffner, Thomas; Sheridan, Eamonn; Simpson, Neil; Sykora, Parol; Tomlinson, Richard; Trounce, John; Webb, David; Weschke, Bernhard; Scheffer, Hans; Willemsen, Michél A.

    2010-01-01

    Glucose transporter-1 deficiency syndrome is caused by mutations in the SLC2A1 gene in the majority of patients and results in impaired glucose transport into the brain. From 2004-2008, 132 requests for mutational analysis of the SLC2A1 gene were studied by automated Sanger sequencing and multiplex

  4. Glucose transporter-1 deficiency syndrome: the expanding clinical and genetic spectrum of a treatable disorder.

    NARCIS (Netherlands)

    Leen, W.G.; Klepper, J.; Verbeek, M.M.; Leferink, M.; Hofste, T.; Engelen, B.G.M. van; Wevers, R.A.; Arthur, T.; Bahi-Buisson, N.; Ballhausen, D.; Bekhof, J.; Bogaert, P. van; Carrilho, I.; Chabrol, B.; Champion, M.P.; Coldwell, J.; Clayton, P.; Donner, E.; Evangeliou, A.; Ebinger, F.; Farrell, K.; Forsyth, R.J.; Goede, C.G. de; Gross, S.; Grunewald, S.; Holthausen, H.; Jayawant, S.; Lachlan, K.; Laugel, V.; Leppig, K.; Lim, M.J.; Mancini, G.; Marina, A.D.; Martorell, L.; McMenamin, J.; Meuwissen, M.E.; Mundy, H.; Nilsson, N.O.; Panzer, A.; Poll-The, B.T.; Rauscher, C.; Rouselle, C.M.; Sandvig, I.; Scheffner, T.; Sheridan, E.; Simpson, N.; Sykora, P.; Tomlinson, R.; Trounce, J.; Webb, D.; Weschke, B.; Scheffer, H.; Willemsen, M.A.A.P.

    2010-01-01

    Glucose transporter-1 deficiency syndrome is caused by mutations in the SLC2A1 gene in the majority of patients and results in impaired glucose transport into the brain. From 2004-2008, 132 requests for mutational analysis of the SLC2A1 gene were studied by automated Sanger sequencing and multiplex

  5. Risk and protective genetic variants in suicidal behaviour: association with SLC1A2, SLC1A3, 5-HTR1B &NTRK2 polymorphisms.

    LENUS (Irish Health Repository)

    Murphy, Therese M

    2012-02-01

    BACKGROUND: Suicidal behaviour is known to aggregate in families. Patients with psychiatric disorders are at higher risk for suicide attempts (SA), however protective and risk genetic variants for suicide appear to be independent of underlying psychiatric disorders. Here we investigate genetic variants in genes important for neurobiological pathways linked to suicidal behaviour and\\/or associated endophenotypes, for association with SA among patients with co-existing psychiatric illness. Selected gene-gene and gene-environment interactions were also tested. METHODS: DNA was obtained from bloods of 159 patients (76 suicide attempters and 83 non-attempters), who were profiled for DSM-IV Axis I psychiatric diagnosis. Twenty-eight single nucleotide polymorphisms (SNPs) from 18 candidate genes (COMT, 5-HT2A, 5-HT1A, 5-HTR1B, TPH1, MAO-A, TPH2, DBH, CNR1, BDNF, ABCG1, GABRA5, GABRG2, GABRB2, SLC1A2, SLC1A3, NTRK2, CRHR1) were genotyped. Genotyping was performed by KBioscience. Tests of association between genetic variants and SA were conducted using Chi squared and Armitage Trend tests. Binary logistical regression analyses were performed to evaluate the contribution of individual genetic variants to the prediction of SA, and to examine SNPs for potential gene-gene and gene-environment interactions. RESULTS: Our analysis identified 4 SNPs (rs4755404, rs2269272, rs6296 and rs1659400), which showed evidence of association with SA compared to a non-attempter control group. We provide evidence of a 3-locus gene-gene interaction, and a putative gene-environment interaction, whereby genetic variation at the NTRK2 locus may moderate the risk associated with history of childhood abuse. CONCLUSION: Preliminary findings suggest that allelic variability in SLC1A2\\/3, 5-HTR1B and NTRK2 may be relevant to the underlying diathesis for suicidal acts.

  6. The emerging physiological roles of the SLC14A family of urea transporters

    Science.gov (United States)

    Stewart, Gavin

    2011-01-01

    In mammals, urea is the main nitrogenous breakdown product of protein catabolism and is produced in the liver. In certain tissues, the movement of urea across cell membranes is specifically mediated by a group of proteins known as the SLC14A family of facilitative urea transporters. These proteins are derived from two distinct genes, UT-A (SLC14A2) and UT-B (SLC14A1). Facilitative urea transporters play an important role in two major physiological processes – urinary concentration and urea nitrogen salvaging. Although UT-A and UT-B transporters both have a similar basic structure and mediate the transport of urea in a facilitative manner, there are a number of significant differences between them. UT-A transporters are mainly found in the kidney, are highly specific for urea, have relatively lower transport rates and are highly regulated at both gene expression and cellular localization levels. In contrast, UT-B transporters are more widespread in their tissue location, transport both urea and water, have a relatively high transport rate, are inhibited by mercurial compounds and currently appear to be less acutely regulated. This review details the fundamental research that has so far been performed to investigate the function and physiological significance of these two types of urea transporters. PMID:21449978

  7. A Study of Single Nucleotide Polymorphisms of the SLC19A1/RFC1 Gene in Subjects with Autism Spectrum Disorder

    Directory of Open Access Journals (Sweden)

    Naila Al Mahmuda

    2016-05-01

    Full Text Available Autism Spectrum Disorder (ASD is a group of neurodevelopmental disorders with complex genetic etiology. Recent studies have indicated that children with ASD may have altered folate or methionine metabolism, suggesting that the folate–methionine cycle may play a key role in the etiology of ASD. SLC19A1, also referred to as reduced folate carrier 1 (RFC1, is a member of the solute carrier group of transporters and is one of the key enzymes in the folate metabolism pathway. Findings from multiple genomic screens suggest the presence of an autism susceptibility locus on chromosome 21q22.3, which includes SLC19A1. Therefore, we performed a case-control study in a Japanese population. In this study, DNA samples obtained from 147 ASD patients at the Kanazawa University Hospital in Japan and 150 unrelated healthy Japanese volunteers were examined by the sequence-specific primer-polymerase chain reaction method pooled with fluorescence correlation spectroscopy. p < 0.05 was considered to represent a statistically significant outcome. Of 13 single nucleotide polymorphisms (SNPs examined, a significant p-value was obtained for AA genotype of one SNP (rs1023159, OR = 0.39, 95% CI = 0.16–0.91, p = 0.0394; Fisher’s exact test. Despite some conflicting results, our findings supported a role for the polymorphism rs1023159 of the SLC19A1 gene, alone or in combination, as a risk factor for ASD. However, the findings were not consistent after multiple testing corrections. In conclusion, although our results supported a role of the SLC19A1 gene in the etiology of ASD, it was not a significant risk factor for the ASD samples analyzed in this study.

  8. The human SLC25A33 and SLC25A36 genes of solute carrier family 25 encode two mitochondrial pyrimidine nucleotide transporters.

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-11-28

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Differential expression of the Slc4 bicarbonate transporter family in murine corneal endothelium and cell culture.

    Science.gov (United States)

    Shei, William; Liu, Jun; Htoon, Hla M; Aung, Tin; Vithana, Eranga N

    2013-01-01

    To characterize the relative expression levels of all the solute carrier 4 (Slc4) transporter family members (Slc4a1-Slc4a11) in murine corneal endothelium using real-time quantitative (qPCR), to identify further important members besides Slc4a11 and Slc4a4, and to explore how close to the baseline levels the gene expressions remain after cells have been subjected to expansion and culture. Descemet's membrane-endothelial layers of 8-10-week-old C57BL6 mice were stripped from corneas and used for both primary cell culture and direct RNA extraction. Total RNA (from uncultured cells as well as cultured cells at passages 2 and 7) was reverse transcribed, and the cDNA was used for real time qPCR using specific primers for all the Slc4 family members. The geNorm method was applied to determine the most stable housekeeping genes and normalization factor, which was calculated from multiple housekeeping genes for more accurate and robust quantification. qPCR analyses revealed that all Slc4 bicarbonate transporter family members were expressed in mouse corneal endothelium. Slc4a11 showed the highest expression, which was approximately three times higher than that of Slc4a4 (3.4±0.3; p=0.004). All Slc4 genes were also expressed in cultured cells, and interestingly, the expression of Slc4a11 in cultured cells was significantly reduced by approximately 20-fold (0.05±0.001; p=0.000001) in early passage and by approximately sevenfold (0.14±0.002; p=0.000002) in late passage cells. Given the known involvement of SLC4A4 and SLC4A11 in corneal dystrophies, we speculate that the other two highly expressed genes in the uncultured corneal endothelium, SLC4A2 and SLC4A7, are worthy of being considered as potential candidate genes for corneal endothelial diseases. Moreover, as cell culture can affect expression levels of Slc4 genes, caution and careful design of experiments are necessary when undertaking studies of Slc4-mediated ion transport in cultured cells.

  10. Genome-wide association analysis identifies a mutation in the thiamine transporter 2 (SLC19A3 gene associated with Alaskan Husky encephalopathy.

    Directory of Open Access Journals (Sweden)

    Karen M Vernau

    Full Text Available Alaskan Husky Encephalopathy (AHE has been previously proposed as a mitochondrial encephalopathy based on neuropathological similarities with human Leigh Syndrome (LS. We studied 11 Alaskan Husky dogs with AHE, but found no abnormalities in respiratory chain enzyme activities in muscle and liver, or mutations in mitochondrial or nuclear genes that cause LS in people. A genome wide association study was performed using eight of the affected dogs and 20 related but unaffected control AHs using the Illumina canine HD array. SLC19A3 was identified as a positional candidate gene. This gene controls the uptake of thiamine in the CNS via expression of the thiamine transporter protein THTR2. Dogs have two copies of this gene located within the candidate interval (SLC19A3.2 - 43.36-43.38 Mb and SLC19A3.1 - 43.411-43.419 Mb on chromosome 25. Expression analysis in a normal dog revealed that one of the paralogs, SLC19A3.1, was expressed in the brain and spinal cord while the other was not. Subsequent exon sequencing of SLC19A3.1 revealed a 4bp insertion and SNP in the second exon that is predicted to result in a functional protein truncation of 279 amino acids (c.624 insTTGC, c.625 C>A. All dogs with AHE were homozygous for this mutation, 15/41 healthy AH control dogs were heterozygous carriers while 26/41 normal healthy AH dogs were wild type. Furthermore, this mutation was not detected in another 187 dogs of different breeds. These results suggest that this mutation in SLC19A3.1, encoding a thiamine transporter protein, plays a critical role in the pathogenesis of AHE.

  11. Sodium-coupled neutral amino acid (System N/A) transporters of the SLC38 gene family.

    Science.gov (United States)

    Mackenzie, Bryan; Erickson, Jeffrey D

    2004-02-01

    The sodium-coupled neutral amino acid transporters (SNAT) of the SLC38 gene family resemble the classically-described System A and System N transport activities in terms of their functional properties and patterns of regulation. Transport of small, aliphatic amino acids by System A subtypes (SNAT1, SNAT2, and SNAT4) is rheogenic and pH sensitive. The System N subtypes SNAT3 and SNAT5 also countertransport H(+), which may be key to their operation in reverse, and have narrower substrate profiles than do the System A subtypes. Glutamine emerges as a favored substrate throughout the family, except for SNAT4. The SLC38 transporters undoubtedly play many physiological roles including the transfer of glutamine from astrocyte to neuron in the CNS, ammonia detoxification and gluconeogenesis in the liver, and the renal response to acidosis. Probing their regulation has revealed additional roles, and recent work has considered SLC38 transporters as therapeutic targets in neoplasia.

  12. Multicenter cohort association study of SLC2A1 single nucleotide polymorphisms and age-related macular degeneration

    Science.gov (United States)

    Baas, Dominique C.; Ho, Lintje; Tanck, Michael W.T.; Fritsche, Lars G.; Merriam, Joanna E.; van het Slot, Ruben; Koeleman, Bobby P.C.; Gorgels, Theo G.M.F.; van Duijn, Cornelia M.; Uitterlinden, André G.; de Jong, Paulus T.V.M.; Hofman, Albert; ten Brink, Jacoline B.; Vingerling, Johannes R.; Klaver, Caroline C.W.; Dean, Michael; Weber, Bernhard H. F.; Allikmets, Rando; Hageman, Gregory S.

    2012-01-01

    Purpose Age-related macular degeneration (AMD) is a major cause of blindness in older adults and has a genetically complex background. This study examines the potential association between single nucleotide polymorphisms (SNPs) in the glucose transporter 1 (SLC2A1) gene and AMD. SLC2A1 regulates the bioavailability of glucose in the retinal pigment epithelium (RPE), which might influence oxidative stress–mediated AMD pathology. Methods Twenty-two SNPs spanning the SLC2A1 gene were genotyped in 375 cases and 199 controls from an initial discovery cohort (the Amsterdam-Rotterdam-Netherlands study). Replication testing was performed in The Rotterdam Study (the Netherlands) and study populations from Würzburg (Germany), the Age Related Eye Disease Study (AREDS; United States), Columbia University (United States), and Iowa University (United States). Subsequently, a meta-analysis of SNP association was performed. Results In the discovery cohort, significant genotypic association between three SNPs (rs3754219, rs4660687, and rs841853) and AMD was found. Replication in five large independent (Caucasian) cohorts (4,860 cases and 4,004 controls) did not yield consistent association results. The genotype frequencies for these SNPs were significantly different for the controls and/or cases among the six individual populations. Meta-analysis revealed significant heterogeneity of effect between the studies. Conclusions No overall association between SLC2A1 SNPs and AMD was demonstrated. Since the genotype frequencies for the three SLC2A1 SNPs were significantly different for the controls and/or cases between the six cohorts, this study corroborates previous evidence that population dependent genetic risk heterogeneity in AMD exists. PMID:22509097

  13. Neurotransmitter Transporter-Like: a male germline-specific SLC6 transporter required for Drosophila spermiogenesis.

    Directory of Open Access Journals (Sweden)

    Nabanita Chatterjee

    2011-01-01

    Full Text Available The SLC6 class of membrane transporters, known primarily as neurotransmitter transporters, is increasingly appreciated for its roles in nutritional uptake of amino acids and other developmentally specific functions. A Drosophila SLC6 gene, Neurotransmitter transporter-like (Ntl, is expressed only in the male germline. Mobilization of a transposon inserted near the 3' end of the Ntl coding region yields male-sterile mutants defining a single complementation group. Germline transformation with Ntl cDNAs under control of male germline-specific control elements restores Ntl/Ntl homozygotes to normal fertility, indicating that Ntl is required only in the germ cells. In mutant males, sperm morphogenesis appears normal, with elongated, individualized and coiled spermiogenic cysts accumulating at the base of the testes. However, no sperm are transferred to the seminal vesicle. The level of polyglycylation of Ntl mutant sperm tubulin appears to be significantly lower than that of wild type controls. Glycine transporters are the most closely related SLC6 transporters to Ntl, suggesting that Ntl functions as a glycine transporter in developing sperm, where augmentation of the cytosolic pool of glycine may be required for the polyglycylation of the massive amounts of tubulin in the fly's giant sperm. The male-sterile phenotype of Ntl mutants may provide a powerful genetic system for studying the function of an SLC6 transporter family in a model organism.

  14. AVPR1a and SLC6A4 Gene Polymorphisms Are Associated with Creative Dance Performance.

    Directory of Open Access Journals (Sweden)

    2005-09-01

    Full Text Available Dancing, which is integrally related to music, likely has its origins close to the birth of Homo sapiens, and throughout our history, dancing has been universally practiced in all societies. We hypothesized that there are differences among individuals in aptitude, propensity, and need for dancing that may partially be based on differences in common genetic polymorphisms. Identifying such differences may lead to an understanding of the neurobiological basis of one of mankind's most universal and appealing behavioral traits-dancing. In the current study, 85 current performing dancers and their parents were genotyped for the serotonin transporter (SLC6A4: promoter region HTTLPR and intron 2 VNTR and the arginine vasopressin receptor 1a (AVPR1a: promoter microsatellites RS1 and RS3. We also genotyped 91 competitive athletes and a group of nondancers/nonathletes (n = 872 subjects from 414 families. Dancers scored higher on the Tellegen Absorption Scale, a questionnaire that correlates positively with spirituality and altered states of consciousness, as well as the Reward Dependence factor in Cloninger's Tridimensional Personality Questionnaire, a measure of need for social contact and openness to communication. Highly significant differences in AVPR1a haplotype frequencies (RS1 and RS3, especially when conditional on both SLC6A4 polymorphisms (HTTLPR and VNTR, were observed between dancers and athletes using the UNPHASED program package (Cocaphase: likelihood ratio test [LRS] = 89.23, p = 0.000044. Similar results were obtained when dancers were compared to nondancers/nonathletes (Cocaphase: LRS = 92.76, p = 0.000024. These results were confirmed using a robust family-based test (Tdtphase: LRS = 46.64, p = 0.010. Association was also observed between Tellegen Absorption Scale scores and AVPR1a (Qtdtphase: global chi-square = 26.53, p = 0.047, SLC6A4 haplotypes (Qtdtphase: chi-square = 2.363, p = 0.018, and AVPR1a conditional on SCL6A4 (Tdtphase: LRS

  15. AVPR1a and SLC6A4 gene polymorphisms are associated with creative dance performance.

    Directory of Open Access Journals (Sweden)

    Rachel Bachner-Melman

    2005-09-01

    Full Text Available Dancing, which is integrally related to music, likely has its origins close to the birth of Homo sapiens, and throughout our history, dancing has been universally practiced in all societies. We hypothesized that there are differences among individuals in aptitude, propensity, and need for dancing that may partially be based on differences in common genetic polymorphisms. Identifying such differences may lead to an understanding of the neurobiological basis of one of mankind's most universal and appealing behavioral traits--dancing. In the current study, 85 current performing dancers and their parents were genotyped for the serotonin transporter (SLC6A4: promoter region HTTLPR and intron 2 VNTR and the arginine vasopressin receptor 1a (AVPR1a: promoter microsatellites RS1 and RS3. We also genotyped 91 competitive athletes and a group of nondancers/nonathletes (n = 872 subjects from 414 families. Dancers scored higher on the Tellegen Absorption Scale, a questionnaire that correlates positively with spirituality and altered states of consciousness, as well as the Reward Dependence factor in Cloninger's Tridimensional Personality Questionnaire, a measure of need for social contact and openness to communication. Highly significant differences in AVPR1a haplotype frequencies (RS1 and RS3, especially when conditional on both SLC6A4 polymorphisms (HTTLPR and VNTR, were observed between dancers and athletes using the UNPHASED program package (Cocaphase: likelihood ratio test [LRS] = 89.23, p = 0.000044. Similar results were obtained when dancers were compared to nondancers/nonathletes (Cocaphase: LRS = 92.76, p = 0.000024. These results were confirmed using a robust family-based test (Tdtphase: LRS = 46.64, p = 0.010. Association was also observed between Tellegen Absorption Scale scores and AVPR1a (Qtdtphase: global chi-square = 26.53, p = 0.047, SLC6A4 haplotypes (Qtdtphase: chi-square = 2.363, p = 0.018, and AVPR1a conditional on SCL6A4 (Tdtphase: LRS

  16. Impaired riboflavin transport due to missense mutations in SLC52A2 causes Brown-Vialetto-Van Laere syndrome.

    Science.gov (United States)

    Haack, Tobias B; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M; Meitinger, Thomas; Yonezawa, Atsushi; Prokisch, Holger

    2012-11-01

    Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin transporter 3 (hRFT3), another member of the riboflavin transporter family, is also associated with BVVLS. Overexpression studies confirmed that the gene products of both mutant alleles have reduced riboflavin transport activities. While mutations in SLC52A3 cause decreased plasma riboflavin levels, concordant with a role of SLC52A3 in riboflavin uptake from food, the SLC52A2-mutant individual had normal plasma riboflavin concentrations, a finding in line with a postulated function of SLC52A2 in riboflavin uptake from blood into target cells. Our results contribute to the understanding of human riboflavin metabolism and underscore its role in the pathogenesis of BVVLS, thereby providing a rational basis for a high-dose riboflavin treatment.

  17. Positive selection in the SLC11A1 gene in the family Equidae.

    Science.gov (United States)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr

    2016-05-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.

  18. Transcript levels of members of the SLC2 and SLC5 families of glucose transport proteins in eel swimbladder tissue: the influence of silvering and the influence of a nematode infection.

    Science.gov (United States)

    Schneebauer, Gabriel; Mauracher, David; Fiechtner, Birgit; Pelster, Bernd

    2018-04-01

    The rate of glucose metabolism has been shown to be correlated to glucose uptake in swimbladder gas gland cells. Therefore, it is assumed that in the European eel silvering, i.e., the preparation of the eel for the spawning migration to the Sargasso Sea, coincides with an enhanced capacity for glucose uptake. To test this hypothesis expression of all known glucose transport proteins has been assessed at the transcript level in yellow and in silver eels, and we also included Anguillicola crassus infected swimbladders. Glucose uptake by rete mirabile endothelial cells could be crucial for the countercurrent exchange capacity of the rete. Therefore, this tissue was also included in our analysis. The results revealed expression of ten different members of the slc2 family of glucose transporters, of four slc5 family members, and of kiaa1919 in gas gland tissue. Glucose transporters of the slc2 family were expressed at very high level, and slc2a1b made up about 80% of all slc2 family members, irrespective of the developmental state or the infection status of the eel. Overall, the slc5 family contributed to only about 8% of all detected glucose transport transcripts in gas gland tissue, and the slc2 family to more than 85%. In rete capillaries, the contribution of sodium-dependent glucose transporters was significantly higher, leaving only 66% for the slc2 family of glucose transporters. Neither silvering nor the infection status had a significant effect on the expression of glucose transporters in swimbladder gas gland tissue, suggesting that glucose metabolism of eel gas gland cells may not be related to transcriptional changes of glucose transport proteins.

  19. The mitochondrial citrate carrier, SLC25A1, drives stemness and therapy resistance in non-small cell lung cancer.

    Science.gov (United States)

    Fernandez, Harvey R; Gadre, Shreyas M; Tan, Mingjun; Graham, Garrett T; Mosaoa, Rami; Ongkeko, Martin S; Kim, Kyu Ah; Riggins, Rebecca B; Parasido, Erika; Petrini, Iacopo; Pacini, Simone; Cheema, Amrita; Varghese, Rency; Ressom, Habtom W; Zhang, Yuwen; Albanese, Christopher; Üren, Aykut; Paige, Mikell; Giaccone, Giuseppe; Avantaggiati, Maria Laura

    2018-04-12

    Therapy resistance represents a clinical challenge for advanced non-small cell lung cancer (NSCLC), which still remains an incurable disease. There is growing evidence that cancer-initiating or cancer stem cells (CSCs) provide a reservoir of slow-growing dormant populations of cells with tumor-initiating and unlimited self-renewal ability that are left behind by conventional therapies reigniting post-therapy relapse and metastatic dissemination. The metabolic pathways required for the expansion of CSCs are incompletely defined, but their understanding will likely open new therapeutic opportunities. We show here that lung CSCs rely upon oxidative phosphorylation for energy production and survival through the activity of the mitochondrial citrate transporter, SLC25A1. We demonstrate that SLC25A1 plays a key role in maintaining the mitochondrial pool of citrate and redox balance in CSCs, whereas its inhibition leads to reactive oxygen species build-up thereby inhibiting the self-renewal capability of CSCs. Moreover, in different patient-derived tumors, resistance to cisplatin or to epidermal growth factor receptor (EGFR) inhibitor treatment is acquired through SLC25A1-mediated implementation of mitochondrial activity and induction of a stemness phenotype. Hence, a newly identified specific SLC25A1 inhibitor is synthetic lethal with cisplatin or with EGFR inhibitor co-treatment and restores antitumor responses to these agents in vitro and in animal models. These data have potential clinical implications in that they unravel a metabolic vulnerability of drug-resistant lung CSCs, identify a novel SLC25A1 inhibitor and, lastly, provide the first line of evidence that drugs, which block SLC25A1 activity, when employed in combination with selected conventional antitumor agents, lead to a therapeutic benefit.

  20. Interaction of environmental contaminants with zebrafish organic anion transporting polypeptide, Oatp1d1 (Slco1d1)

    Energy Technology Data Exchange (ETDEWEB)

    Popovic, Marta; Zaja, Roko [Laboratory for Molecular Ecotoxicology, Division for Marine and Environmental Research, Rudjer Boskovic Institute, Bijenicka 54, 10 000 Zagreb (Croatia); Fent, Karl [University of Applied Sciences Northwestern Switzerland, School of Life Sciences, Gründenstrasse 40, CH-4132 Muttenz (Switzerland); Swiss Federal Institute of Technology (ETH Zürich), Department of Environmental System Sciences, Institute of Biogeochemistry and Pollution Dynamics, CH-8092 Zürich (Switzerland); Smital, Tvrtko, E-mail: smital@irb.hr [Laboratory for Molecular Ecotoxicology, Division for Marine and Environmental Research, Rudjer Boskovic Institute, Bijenicka 54, 10 000 Zagreb (Croatia)

    2014-10-01

    Polyspecific transporters from the organic anion transporting polypeptide (OATP/Oatp) superfamily mediate the uptake of a wide range of compounds. In zebrafish, Oatp1d1 transports conjugated steroid hormones and cortisol. It is predominantly expressed in the liver, brain and testes. In this study we have characterized the transport of xenobiotics by the zebrafish Oatp1d1 transporter. We developed a novel assay for assessing Oatp1d1 interactors using the fluorescent probe Lucifer yellow and transient transfection in HEK293 cells. Our data showed that numerous environmental contaminants interact with zebrafish Oatp1d1. Oatp1d1 mediated the transport of diclofenac with very high affinity, followed by high affinity towards perfluorooctanesulfonic acid (PFOS), nonylphenol, gemfibrozil and 17α-ethinylestradiol; moderate affinity towards carbaryl, diazinon and caffeine; and low affinity towards metolachlor. Importantly, many environmental chemicals acted as strong inhibitors of Oatp1d1. A strong inhibition of Oatp1d1 transport activity was found by perfluorooctanoic acid (PFOA), chlorpyrifos-methyl, estrone (E1) and 17β-estradiol (E2), followed by moderate to low inhibition by diethyl phthalate, bisphenol A, 7-acetyl-1,1,3,4,4,6-hexamethyl-1,2,3,4 tetrahydronapthalene and clofibrate. In this study we identified Oatp1d1 as a first Solute Carrier (SLC) transporter involved in the transport of a wide range of xenobiotics in fish. Considering that Oatps in zebrafish have not been characterized before, our work on zebrafish Oatp1d1 offers important new insights on the understanding of uptake processes of environmental contaminants, and contributes to the better characterization of zebrafish as a model species. - Highlights: • We optimized a novel assay for determination of Oatp1d1 interactors • Oatp1d1 is the first SLC characterized fish xenobiotic transporter • PFOS, nonylphenol, diclofenac, EE2, caffeine are high affinity Oatp1d1substrates • PFOA, chlorpyrifos

  1. Interaction of environmental contaminants with zebrafish organic anion transporting polypeptide, Oatp1d1 (Slco1d1)

    International Nuclear Information System (INIS)

    Popovic, Marta; Zaja, Roko; Fent, Karl; Smital, Tvrtko

    2014-01-01

    Polyspecific transporters from the organic anion transporting polypeptide (OATP/Oatp) superfamily mediate the uptake of a wide range of compounds. In zebrafish, Oatp1d1 transports conjugated steroid hormones and cortisol. It is predominantly expressed in the liver, brain and testes. In this study we have characterized the transport of xenobiotics by the zebrafish Oatp1d1 transporter. We developed a novel assay for assessing Oatp1d1 interactors using the fluorescent probe Lucifer yellow and transient transfection in HEK293 cells. Our data showed that numerous environmental contaminants interact with zebrafish Oatp1d1. Oatp1d1 mediated the transport of diclofenac with very high affinity, followed by high affinity towards perfluorooctanesulfonic acid (PFOS), nonylphenol, gemfibrozil and 17α-ethinylestradiol; moderate affinity towards carbaryl, diazinon and caffeine; and low affinity towards metolachlor. Importantly, many environmental chemicals acted as strong inhibitors of Oatp1d1. A strong inhibition of Oatp1d1 transport activity was found by perfluorooctanoic acid (PFOA), chlorpyrifos-methyl, estrone (E1) and 17β-estradiol (E2), followed by moderate to low inhibition by diethyl phthalate, bisphenol A, 7-acetyl-1,1,3,4,4,6-hexamethyl-1,2,3,4 tetrahydronapthalene and clofibrate. In this study we identified Oatp1d1 as a first Solute Carrier (SLC) transporter involved in the transport of a wide range of xenobiotics in fish. Considering that Oatps in zebrafish have not been characterized before, our work on zebrafish Oatp1d1 offers important new insights on the understanding of uptake processes of environmental contaminants, and contributes to the better characterization of zebrafish as a model species. - Highlights: • We optimized a novel assay for determination of Oatp1d1 interactors • Oatp1d1 is the first SLC characterized fish xenobiotic transporter • PFOS, nonylphenol, diclofenac, EE2, caffeine are high affinity Oatp1d1substrates • PFOA, chlorpyrifos

  2. Family-Based Association Study Between SLC2A1, HK1, and LEPR Polymorphisms With Myelomeningocele in Chile

    Science.gov (United States)

    Suazo, José; Castillo, Silvia; Martin, Luz Maria; Rojas, Francisca; Santos, José Luis; Rotter, Karin; Solar, Margarita; Tapia, Eva

    2013-01-01

    Obese/diabetic mothers present a higher risk to develop offspring with myelomeningocele (MM), evidence supporting the role of energy homeostasis-related genes in neural tube defects. Using polymerase chain reaction–restriction fragment length polymorphism, we have genotyped SLC2A1, HK1, and LEPR single-nucleotide polymorphisms in 105 Chilean patients with MM and their parents in order to evaluate allele–phenotype associations by means of allele/haplotype transmission test (TDT) and parent-of-origin effects. We detected an undertransmission for the SLC2A1 haplotype T-A (rs710218-rs2229682; P = .040), which was not significant when only lower MM (90% of the cases) was analyzed. In addition, the leptin receptor rs1137100 G allele showed a significant increase in the risk of MM for maternal-derived alleles in the whole sample (2.43-fold; P = .038) and in lower MM (3.20-fold; P = .014). Our results support the role of genes involved in energy homeostasis in the risk of developing MM, thus sustaining the hypothesis of diverse pathways and genetic mechanisms acting in the expression of such birth defect. PMID:23427181

  3. MBL, P2X7, and SLC11A1 gene polymorphisms in patients with oropharyngeal tularemia.

    Science.gov (United States)

    Somuk, Battal Tahsin; Koc, Sema; Ates, Omer; Göktas, Göksel; Soyalic, Harun; Uysal, Ismail Onder; Gurbuzler, Levent; Sapmaz, Emrah; Sezer, Saime; Eyibilen, Ahmet

    2016-11-01

    A significant association was found of oropharyngeal tularemia with SLC11A1 allele polymorphism (INT4 G/C) and MBL2 C + 4T (P/Q). These results indicate C allele and Q allele might be a risk factor for the development of oropharyngeal tularemia. This study aimed to investigate the relationship of SLC11A1, MBL, and P2X 7 gene polymorphism with oropharyngeal tularemia. The study included totally 120 patients who were diagnosed with oropharyngeal tularemia. Frequencies of polymorphisms in the following genes were analyzed both in the patient and control groups in the study: SLC11A1 (5'(GT) n Allele 2/3, Int4 G/C, 3' UTR, D543N G/A), MBL (MBL2 C + 4T (P/Q), and P2X 7 (-762 C/T and 1513 A/C). Among all polymorphisms that were investigated in this study, SLC11A1 gene showed a significance in the distriburtion of polymorphism allelle frequency at the INT4 region. Frequency of C allele was 54 (28%) in patients with oropharyngeal tularemia, and 31 (13%) in the control group (p = 0.006 and OR = 1.96 (1.21-3.20)). An association was detected between MBL2 C + 4T (P/Q) gene polymorphism and oropharyngeal tularemia (p tularemia in this study (p > 0.05).

  4. Mutations in SLC33A1 cause a lethal autosomal-recessive disorder with congenital cataracts, hearing loss, and low serum copper and ceruloplasmin

    DEFF Research Database (Denmark)

    Huppke, Peter; Brendel, Cornelia; Kalscheuer, Vera

    2012-01-01

    or compound heterozygous mutations for all affected subjects in SLC33A1 encoding a highly conserved acetylCoA transporter (AT-1) required for acetylation of multiple gangliosides and glycoproteins. The mutations were found to cause reduced or absent AT-1 expression and abnormal intracellular localization...

  5. A 40-bp VNTR polymorphism in the 3'-untranslated region of DAT1/SLC6A3 is associated with ADHD but not with alcoholism.

    Science.gov (United States)

    Šerý, Omar; Paclt, Ivo; Drtílková, Ivana; Theiner, Pavel; Kopečková, Marta; Zvolský, Petr; Balcar, Vladimir J

    2015-06-11

    ADHD and alcoholism are psychiatric diseases with pathophysiology related to dopamine system. DAT1 belongs to the SLC6 family of transporters and is involved in the regulation of extracellular dopamine levels. A 40 bp variable number tandem repeat (VNTR) polymorphism in the 3'-untranslated region of DAT1/SLC6A3 gene was previously reported to be associated with various phenotypes involving disturbed regulation of dopaminergic neurotransmission. A total of 1312 subjects were included and genotyped for 40 bp VNTR polymorphism of DAT1/SLC6A3 gene in this study (441 alcoholics, 400 non-alcoholic controls, 218 ADHD children and 253 non ADHD children). Using miRBase software, we have performed a computer analysis of VNTR part of DAT1 gene for presence of miRNA binding sites. We have found significant relationships between ADHD and the 40 bp VNTR polymorphisms of DAT1/SLC6A3 gene (P VNTR polymorphism of DAT1/SLC6A3 gene has been detected. We have found an association between 40 bp VNTR polymorphism of DAT1/SLC6A3 gene and ADHD in the Czech population; in a broad agreement with studies in other population samples. Furthermore, we detected rare genotypes 8/10, 7/10 and 10/11 present in ADHD boys only and identified miRNAs that should be looked at as potential novel targets in the research on ADHD.

  6. ASCT2 (SLC1A5-Deficient Mice Have Normal B-Cell Development, Proliferation, and Antibody Production

    Directory of Open Access Journals (Sweden)

    Etienne Masle-Farquhar

    2017-05-01

    Full Text Available SLC1A5 (solute carrier family 1, member 5 is a small neutral amino acid exchanger that is upregulated in rapidly proliferating lymphocytes but also in many primary human cancers. Furthermore, cancer cell lines have been shown to require SLC1A5 for their survival in vitro. One of SLC1A5’s primary substrates is the immunomodulatory amino acid glutamine, which plays an important role in multiple key processes, such as energy supply, macromolecular synthesis, nucleotide biosynthesis, redox homeostasis, and resistance against oxidative stress. These processes are also essential to immune cells, including neutrophils, macrophages, B and T lymphocytes. We show here that mice with a stop codon in Slc1a5 have reduced glutamine uptake in activated lymphocytes and primary fibroblasts. B and T cell populations and maturation in resting mice were not affected by absence of SLC1A5. Antibody production in resting and immunized mice and the germinal center response to immunization were also found to be normal. SLC1A5 has been recently described as a novel target for the treatment of a variety of cancers, and our results indicate that inhibition of SLC1A5 in cancer therapy may be tolerated well by the immune system of cancer patients.

  7. Two novel mutations in the SLC40A1 and HFE genes implicated in iron overload in a Spanish man.

    Science.gov (United States)

    Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Alvarez-Sala-Walther, Luis-Antonio; Cuadrado-Grande, Nuria; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

    2011-03-01

    The most common form of hemochromatosis is caused by mutations in the HFE gene. Rare forms of the disease are caused by mutations in other genes. We present a patient with hyperferritinemia and iron overload, and facial flushing. Magnetic resonance imaging was performed to measure hepatic iron overload, and a molecular study of the genes involved in iron metabolism was undertaken. The iron overload was similar to that observed in HFE hemochromatosis, and the patient was double heterozygous for two novel mutations, c.-20G>A and c.718A>G (p.K240E), in the HFE and ferroportin (FPN1 or SLC40A1) genes, respectively. Hyperferritinemia and facial flushing improved after phlebotomy. Two of the patient's children were also studied, and the daughter was heterozygous for the mutation in the SLC40A1 gene, although she did not have hyperferritinemia. The patient presented a mild iron overload phenotype probably because of the two novel mutations in the HFE and SLC40A1 genes. © 2011 John Wiley & Sons A/S.

  8. The orphan transporter v7-3 (slc6a15) is a Na+-dependent neutral amino acid transporter (B0AT2)

    DEFF Research Database (Denmark)

    Bröer, Angelika; Tietze, Nadine; Kowalczuk, Sonja

    2006-01-01

    . The transporter is functionally and sequence related to B(0)AT1 (slc6a19) and was hence named B(0)AT2. Leucine, isoleucine, valine, proline and methionine were recognized by the transporter, with values of K(0.5) (half-saturation constant) ranging from 40 to 200 microM. Alanine, glutamine and phenylalanine were...

  9. Organic anion and cation SLC22 "drug" transporter (Oat1, Oat3, and Oct1 regulation during development and maturation of the kidney proximal tubule.

    Directory of Open Access Journals (Sweden)

    Thomas F Gallegos

    Full Text Available Proper physiological function in the pre- and post-natal proximal tubule of the kidney depends upon the acquisition of selective permeability, apical-basolateral epithelial polarity and the expression of key transporters, including those involved in metabolite, toxin and drug handling. Particularly important are the SLC22 family of transporters, including the organic anion transporters Oat1 (originally identified as NKT and Oat3 as well as the organic cation transporter Oct1. In ex vivo cultures of metanephric mesenchyme (MM; the embryonic progenitor tissue of the nephron Oat function was evident before completion of nephron segmentation and corresponded with the maturation of tight junctions as measured biochemically by detergent extractability of the tight junction protein, ZO-1. Examination of available time series microarray data sets in the context of development and differentiation of the proximal tubule (derived from both in vivo and in vitro/ex vivo developing nephrons allowed for correlation of gene expression data to biochemically and functionally defined states of development. This bioinformatic analysis yielded a network of genes with connectivity biased toward Hnf4α (but including Hnf1α, hyaluronic acid-CD44, and notch pathways. Intriguingly, the Oat1 and Oat3 genes were found to have strong temporal co-expression with Hnf4α in the cultured MM supporting the notion of some connection between the transporters and this transcription factor. Taken together with the ChIP-qPCR finding that Hnf4α occupies Oat1, Oat3, and Oct1 proximal promoters in the in vivo differentiating rat kidney, the data suggest a network of genes with Hnf4α at its center plays a role in regulating the terminal differentiation and capacity for drug and toxin handling by the nascent proximal tubule of the kidney.

  10. SLC39A8 Deficiency: A Disorder of Manganese Transport and Glycosylation.

    Science.gov (United States)

    Park, Julien H; Hogrebe, Max; Grüneberg, Marianne; DuChesne, Ingrid; von der Heiden, Ava L; Reunert, Janine; Schlingmann, Karl P; Boycott, Kym M; Beaulieu, Chandree L; Mhanni, Aziz A; Innes, A Micheil; Hörtnagel, Konstanze; Biskup, Saskia; Gleixner, Eva M; Kurlemann, Gerhard; Fiedler, Barbara; Omran, Heymut; Rutsch, Frank; Wada, Yoshinao; Tsiakas, Konstantinos; Santer, René; Nebert, Daniel W; Rust, Stephan; Marquardt, Thorsten

    2015-12-03

    SLC39A8 is a membrane transporter responsible for manganese uptake into the cell. Via whole-exome sequencing, we studied a child that presented with cranial asymmetry, severe infantile spasms with hypsarrhythmia, and dysproportionate dwarfism. Analysis of transferrin glycosylation revealed severe dysglycosylation corresponding to a type II congenital disorder of glycosylation (CDG) and the blood manganese levels were below the detection limit. The variants c.112G>C (p.Gly38Arg) and c.1019T>A (p.Ile340Asn) were identified in SLC39A8. A second individual with the variants c.97G>A (p.Val33Met) and c.1004G>C (p.Ser335Thr) on the paternal allele and c.610G>T (p.Gly204Cys) on the maternal allele was identified among a group of unresolved case subjects with CDG. These data demonstrate that variants in SLC39A8 impair the function of manganese-dependent enzymes, most notably β-1,4-galactosyltransferase, a Golgi enzyme essential for biosynthesis of the carbohydrate part of glycoproteins. Impaired galactosylation leads to a severe disorder with deformed skull, severe seizures, short limbs, profound psychomotor retardation, and hearing loss. Oral galactose supplementation is a treatment option and results in complete normalization of glycosylation. SLC39A8 deficiency links a trace element deficiency with inherited glycosylation disorders. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  11. Effect of SLC34A2 gene mutation on extracellular phosphorus transport in PAM alveolar epithelial cells.

    Science.gov (United States)

    Ma, Tiangang; Qu, Danhua; Yan, Bingdi; Zhang, Qinghua; Ren, Jin; Hu, Yanbing

    2018-01-01

    A mutation in the IIb sodium phosphate transporter SLC34A2 gene has recently been described in pulmonary alveolar microlithiasis (PAM) patients. Experiments in this study were aimed at confirming the role of the gene product in PAM by comparing phosphorylated products in extracellular fluid of alveolar epithelial cells overexpressing the SLC34A2 gene or its mutated version. Eukaryotic expression vectors were constructed and transfected into A549 human alveolar epithelial cells. There were three groups of cells including those transfected with empty vector plasmid pcDNA3.1(+) (plasmid control group), those transfected with normal SLC34A2 gene expressed from pcDNA3.1 (normal control group), and those transfected with a version of the PAM SLC34A2 gene linked to the pcDNA3.1(+) (PAM group). Transfection efficiencies were detected by reverse transcription-polymerase chain reaction (RT-PCR). At 48 h after transfection, the concentration of inorganic phosphorus in the culture medium was detected using an automatic biochemical analyzer. Our results showed the concentration of inorganic phosphorus in the supernatant of the normal control group was significantly lower than that in the plasmid control and PAM groups (PPAM group was significantly lower than that in the plasmid control group (PPAM patients, given that the function of the phosphate transporter seems to be affected and it is conceivable that it would lead to extracellular fluid alterations in vivo .

  12. Activation of lysosomal P2X4 by ATP transported into lysosomes via VNUT/SLC17A9 using V‐ATPase generated voltage gradient as the driving force

    Science.gov (United States)

    Zhong, Xi Zoë; Cao, Qi; Sun, Xue

    2016-01-01

    Key points SLC17A9 proteins function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation.P2X4 receptors act as lysosomal ion channels activated by luminal ATP.SLC17A9‐mediated ATP transport across the lysosomal membrane is suppressed by Bafilomycin A1, the V‐ATPase inhibitor.SLC17A9 mainly uses voltage gradient but not pH gradient generated by the V‐ATPase as the driving force to transport ATP into the lysosome to activate P2X4. Abstract The lysosome contains abundant ATP which plays important roles in lysosome functions and in cell signalling. Recently, solute carrier family 17 member 9 (SLC17A9, also known as VNUT for vesicular nucleotide transporter) proteins were suggested to function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation, and P2X4 receptors were suggested to be lysosomal ion channels that are activated by luminal ATP. However, the molecular mechanism of SLC17A9 transporting ATP and the regulatory mechanism of lysosomal P2X4 are largely unknown. In this study, we report that SLC17A9‐mediated ATP transport across lysosomal membranes is suppressed by Bafilomycin A1, the V‐ATPase inhibitor. By measuring P2X4 activity, which is indicative of ATP transport across lysosomal membranes, we further demonstrated that SLC17A9 mainly uses voltage gradient but not pH gradient as the driving force to transport ATP into lysosomes. This study provides a molecular mechanism for lysosomal ATP transport mediated by SLC17A9. It also suggests a regulatory mechanism of lysosomal P2X4 by SLC17A9. PMID:27477609

  13. SLC22A1-ABCB1 haplotype profiles predict imatinib pharmacokinetics in Asian patients with chronic myeloid leukemia.

    Directory of Open Access Journals (Sweden)

    Onkar Singh

    Full Text Available OBJECTIVE: This study aimed to explore the influence of SLC22A1, PXR, ABCG2, ABCB1 and CYP3A5 3 genetic polymorphisms on imatinib mesylate (IM pharmacokinetics in Asian patients with chronic myeloid leukemia (CML. PATIENTS AND METHODS: Healthy subjects belonging to three Asian populations (Chinese, Malay, Indian; n = 70 each and CML patients (n = 38 were enrolled in a prospective pharmacogenetics study. Imatinib trough (C(0h and clearance (CL were determined in the patients at steady state. Haplowalk method was applied to infer the haplotypes and generalized linear model (GLM to estimate haplotypic effects on IM pharmacokinetics. Association of haplotype copy numbers with IM pharmacokinetics was defined by Mann-Whitney U test. RESULTS: Global haplotype score statistics revealed a SLC22A1 sub-haplotypic region encompassing three polymorphisms (rs3798168, rs628031 and IVS7+850C>T, to be significantly associated with IM clearance (p = 0.013. Haplotype-specific GLM estimated that the haplotypes AGT and CGC were both associated with 22% decrease in clearance compared to CAC [CL (10(-2 L/hr/mg: CAC vs AGT: 4.03 vs 3.16, p = 0.017; CAC vs CGC: 4.03 vs 3.15, p = 0.017]. Patients harboring 2 copies of AGT or CGC haplotypes had 33.4% lower clearance and 50% higher C(0h than patients carrying 0 or 1 copy [CL (10(-2 L/hr/mg: 2.19 vs 3.29, p = 0.026; C(0h (10(-6 1/ml: 4.76 vs 3.17, p = 0.013, respectively]. Further subgroup analysis revealed SLC22A1 and ABCB1 haplotypic combinations to be significantly associated with clearance and C(0h (p = 0.002 and 0.009, respectively. CONCLUSION: This exploratory study suggests that SLC22A1-ABCB1 haplotypes may influence IM pharmacokinetics in Asian CML patients.

  14. SLC6 Neurotransmitter Transporters: Structure, Function, and Regulation

    DEFF Research Database (Denmark)

    Kristensen, Anders S; Andersen, Jacob; Jørgensen, Trine N

    2011-01-01

    The neurotransmitter transporters (NTTs) belonging to the solute carrier 6 (SLC6) gene family (also referred to as the neurotransmitter-sodium-symporter family or Na(+)/Cl(-)-dependent transporters) comprise a group of nine sodium- and chloride-dependent plasma membrane transporters...... for the monoamine neurotransmitters serotonin (5-hydroxytryptamine), dopamine, and norepinephrine, and the amino acid neurotransmitters GABA and glycine. The SLC6 NTTs are widely expressed in the mammalian brain and play an essential role in regulating neurotransmitter signaling and homeostasis by mediating uptake...... of released neurotransmitters from the extracellular space into neurons and glial cells. The transporters are targets for a wide range of therapeutic drugs used in treatment of psychiatric diseases, including major depression, anxiety disorders, attention deficit hyperactivity disorder and epilepsy...

  15. Lack of the nucleoside transporter ENT1 results in the Augustine-null blood type and ectopic mineralization.

    Science.gov (United States)

    Daniels, Geoff; Ballif, Bryan A; Helias, Virginie; Saison, Carole; Grimsley, Shane; Mannessier, Lucienne; Hustinx, Hein; Lee, Edmond; Cartron, Jean-Pierre; Peyrard, Thierry; Arnaud, Lionel

    2015-06-04

    The Augustine-negative alias At(a-) blood type, which seems to be restricted to people of African ancestry, was identified half a century ago but remains one of the last blood types with no known genetic basis. Here we report that a nonsynonymous single nucleotide polymorphism in SLC29A1 (rs45458701) is responsible for the At(a-) blood type. The resulting p.Glu391Lys variation in the last extracellular loop of the equilibrative nucleoside transporter 1 (ENT1; also called SLC29a1) is known not to alter its ability to transport nucleosides and nucleoside analog drugs. Furthermore, we identified 3 individuals of European ancestry who are homozygous for a null mutation in SLC29A1 (c.589+1G>C) and thus have the Augustine-null blood type. These individuals lacking ENT1 exhibit periarticular and ectopic mineralization, which confirms an important role for ENT1/SLC29A1 in human bone homeostasis as recently suggested by the skeletal phenotype of aging Slc29a1(-/-) mice. Our results establish Augustine as a new blood group system and place SLC29A1 as a new candidate gene for idiopathic disorders characterized with ectopic calcification/mineralization. © 2015 by The American Society of Hematology.

  16. Prostaglandin transporter (OATP2A1/SLCO2A1) contributes to local disposition of eicosapentaenoic acid-derived PGE3.

    Science.gov (United States)

    Gose, Tomoka; Nakanishi, Takeo; Kamo, Shunsuke; Shimada, Hiroaki; Otake, Katsumasa; Tamai, Ikumi

    2016-01-01

    Eicosapentaenoic acid (EPA)-derived prostaglandin E3 (PGE3) possesses an anti-inflammatory effect; however, information for transporters that regulate its peri-cellular concentration is limited. The present study, therefore, aimed to clarify transporters involved in local disposition of PGE3. PGE3 uptake was assessed in HEK293 cells transfected with OATP2A1/SLCO2A1, OATP1B1/SLCO1B1, OATP2B1/SLCO2B1, OAT1/SLC22A6, OCT1/SLC22A1 or OCT2/SLC22A2 genes, compared with HEK293 cells transfected with plasmid vector alone (Mock). PGE3 uptake by OATP2A1-expressing HEK293 cells (HEK/2A1) was the highest and followed by HEK/1B1, while no significantly higher uptake of PGE3 than Mock cells was detected by other transporters. Saturation kinetics in PGE3 uptake by HEK/2A1 estimated the Km as 7.202 ± 0.595 μM, which was 22 times higher than that of PGE2 (Km=0.331 ± 0.131 μM). Furthermore, tissue disposition of PGE3 was examined in wild-type (WT) and Slco2a1-deficient (Slco2a1(-/-)) mice after oral administration of EPA ethyl ester (EPA-E) when they underwent intraperitoneal injection of endotoxin (e.g., lipopolysaccharide). PGE3 concentration was significantly higher in the lung, and tended to increase in the colon, stomach, and kidney of Slco2a1(-/-), compared to WT mice. Ratio of PGE2 metabolite 15-keto PGE2 over PGE2 concentration was significantly lower in the lung and colon of Slco2a1(-/-) than that of WT mice, suggesting that PGE3 metabolism is downregulated in Slco2a1(-/-) mice. In conclusion, PGE3 was found to be a substrate of OATP2A1, and local disposition of PGE3 could be regulated by OATP2A1 at least in the lung. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Human Sodium Phosphate Transporter 4 (hNPT4/SLC17A3) as a Common Renal Secretory Pathway for Drugs and Urate*

    Science.gov (United States)

    Jutabha, Promsuk; Anzai, Naohiko; Kitamura, Kenichiro; Taniguchi, Atsuo; Kaneko, Shuji; Yan, Kunimasa; Yamada, Hideomi; Shimada, Hidetaka; Kimura, Toru; Katada, Tomohisa; Fukutomi, Toshiyuki; Tomita, Kimio; Urano, Wako; Yamanaka, Hisashi; Seki, George; Fujita, Toshiro; Moriyama, Yoshinori; Yamada, Akira; Uchida, Shunya; Wempe, Michael F.; Endou, Hitoshi; Sakurai, Hiroyuki

    2010-01-01

    The evolutionary loss of hepatic urate oxidase (uricase) has resulted in humans with elevated serum uric acid (urate). Uricase loss may have been beneficial to early primate survival. However, an elevated serum urate has predisposed man to hyperuricemia, a metabolic disturbance leading to gout, hypertension, and various cardiovascular diseases. Human serum urate levels are largely determined by urate reabsorption and secretion in the kidney. Renal urate reabsorption is controlled via two proximal tubular urate transporters: apical URAT1 (SLC22A12) and basolateral URATv1/GLUT9 (SLC2A9). In contrast, the molecular mechanism(s) for renal urate secretion remain unknown. In this report, we demonstrate that an orphan transporter hNPT4 (human sodium phosphate transporter 4; SLC17A3) was a multispecific organic anion efflux transporter expressed in the kidneys and liver. hNPT4 was localized at the apical side of renal tubules and functioned as a voltage-driven urate transporter. Furthermore, loop diuretics, such as furosemide and bumetanide, substantially interacted with hNPT4. Thus, this protein is likely to act as a common secretion route for both drugs and may play an important role in diuretics-induced hyperuricemia. The in vivo role of hNPT4 was suggested by two hyperuricemia patients with missense mutations in SLC17A3. These mutated versions of hNPT4 exhibited reduced urate efflux when they were expressed in Xenopus oocytes. Our findings will complete a model of urate secretion in the renal tubular cell, where intracellular urate taken up via OAT1 and/or OAT3 from the blood exits from the cell into the lumen via hNPT4. PMID:20810651

  18. Genetic variants of SLC11A1 are associated with both autoimmune and infectious diseases: systematic review and meta-analysis.

    Science.gov (United States)

    Archer, N S; Nassif, N T; O'Brien, B A

    2015-06-01

    A systematic review and meta-analyses were undertaken to investigate the association of SLC11A1 genetic variants with disease occurrence. Literature searching indentified 109 publications to include in the meta-analyses assessing the association of 11 SLC11A1 variants with autoimmune and infectious disease. The (GT)n promoter alleles 2 and 3 (rs534448891), which alter SLC11A1 expression, were significantly associated with tuberculosis (OR=1.47 (1.30-1.66), OR=0.76 (0.65-0.89), respectively) and infectious disease (OR=1.25 (1.10-1.42), OR=0.83 (0.74-0.93), respectively). However, although no association was observed with autoimmune disease, a modest significant association was observed with type 1 diabetes (allele 2 OR=0.94 (0.89-0.98)). On the basis of a stronger association of (GT)n allele 2 with tuberculosis, compared with the protective effect of allele 3, we hypothesise that allele 2 is likely the disease-causing variant influencing disease susceptibility. Significant associations were observed between the 469+14G/C polymorphism (rs3731865) and autoimmune disease (OR=1.30 (1.04-1.64)) and rheumatoid arthritis (OR=1.60 (1.20-2.13)) and between the -237C/T polymorphism (rs7573065) and inflammatory bowel disease (OR=0.60 (0.43-0.84)). Further, significant associations were identified between the 469+14G/C, 1730G/A and 1729+55del4 polymorphisms (rs3731865, rs17235409 and rs17235416, respectively) and both infectious disease per se and tuberculosis. These findings show a clear association between variants in the SLC11A1 locus and autoimmune and infectious disease susceptibility.

  19. [The association of polymorphisms in SLC18A1, TPH1 and RELN genes with risk of paranoid schizophrenia].

    Science.gov (United States)

    Galaktionova, D Iu; Gareeva, A E; Khusnutdinova, E K; Nasedkina, T V

    2014-01-01

    We have developed a biochip for the analysis of polymorphisms in candidate genes for schizophrenia: DISC1, RELN, ZNF804A, PLXNA2, COMT, SLC18A41, CACNA1C, ANK3, TPH1, PLAA and SNAP-25. Using biochip the allele and genotype frequencies in 198 patients with schizophrenia and 192 healthy individuals have been obtained. For SLC18A1 polymorphism rs2270641 A>C, the frequencies of A allele (p = 0.007) and AA genotype (p = 0.002) were lower in patients compared with healthy individuals. A significant association was found between AA genotype (p = 0.036) of the TPH1 polymorphism rs1800532 C>A and schizophrenia. The C allele (p = 0.039) of the RELNpolymorphism rs7341475 C>T were lower in patients with schizophrenia compared with healthy individuals in a tatar population. Genotype AA of the TPH1 polymorphism rs1800532 C>A were more frequent in patients with schizophrenia compared with healthy individuals. Ithas been shown that the C allele (p = 0.0001) and GC (p = = 0.0001) genotype of the PLXNA2 polymorphism rs1327175 G>C are associated with the family history in patients with paranoid schizophrenia. The obtained data suggest that SLC18A1, TPH1 and RELN gene polymorphisms are associated with the risk of paranoid schizophrenia.

  20. Genetic Polymorphisms in Organic Cation Transporter 1 Attenuates Hepatic Metformin Exposure in Humans

    DEFF Research Database (Denmark)

    Sundelin, E. I.O.; Gormsen, Lars C; Jensen, J. B.

    2017-01-01

    the transporter protein OCT1, affect the hepatic distribution of metformin in humans. We performed noninvasive 11C-metformin positron emission tomography (PET)/computed tomography (CT) to determine hepatic exposure in 12 subjects genotyped for variants in SLC22A1. Hepatic distribution of metformin...... was significantly reduced after oral intake in carriers of M420del and R61C variants in SLC22A1 without being associated with changes in circulating levels of metformin. Our data show that genetic polymorphisms in transporter proteins cause variation in hepatic exposure to metformin, and it demonstrates......Metformin has been used successfully to treat type 2 diabetes for decades. However, the efficacy of the drug varies considerably from patient to patient and this may in part be due to its pharmacokinetic properties. The aim of this study was to examine if common polymorphisms in SLC22A1, encoding...

  1. The cyanobacterial bicarbonate transporter BicA: its physiological role and the implications of structural similarities with human SLC26 transporters.

    Science.gov (United States)

    Price, G Dean; Howitt, Susan M

    2011-04-01

    The cyanobacterial Na+-dependent HCO3- transporter BicA is a member of the ubiquitous and important SulP/SLC26 family of anion transporters found in eukaryotes and prokaryotes. BicA is an important component of the cyanobacterial CO2 concentrating mechanism, an adaptation that contributes to cyanobacteria being able to achieve an estimated 25% of global primary productivity, largely in the oceans. The human SLC26 members are involved in a range of key cellular functions involving a diverse range of anion transport activities including Cl-/HCO3-, I-/HCO3-, and SO42-/HCO3- exchange; mutations in SLC26 members are known to be associated with debilitating diseases such as Pendred syndrome, chondrodysplasias, and congenital chloride diarrhoea. We have recently experimentally determined the membrane topology of BicA using the phoA-lacZ reporter system and here consider some of the extrapolated implications for topology of the human SLC26 family and the Sultr plant sulphate transporters.

  2. Impaired riboflavin transport due to missense mutations in SLC52A2 causes Brown-Vialetto-Van Laere syndrome

    OpenAIRE

    Haack, Tobias B.; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A.; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M.; Meitinger, Thomas; Yonezawa, Atsushi

    2012-01-01

    Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin tran...

  3. NBCe1 (SLC4A4) a potential pH regulator in enamel organ cells during enamel development in the mouse

    NARCIS (Netherlands)

    Jalali, R.; Guo, J.; Zandieh-Doulabi, B.; Bervoets, T.J.M.; Paine, M.L.; Boron, W.F.; Parker, M.D.; Bijvelds, M.J.C.; Medina, J.F.; DenBesten, P.K.; Bronckers, A.L.J.J.

    2014-01-01

    During the formation of dental enamel, maturation-stage ameloblasts express ion-transporting transmembrane proteins. The SLC4 family of ion-transporters regulates intra- and extracellular pH in eukaryotic cells by cotransporting HCO3 − with Na+. Mutation in SLC4A4 (coding for the sodium-bicarbonate

  4. Variants in SLC18A3, vesicular acetylcholine transporter, cause congenital myasthenic syndrome

    NARCIS (Netherlands)

    O'Grady, Gina L.; Verschuuren, Corien; Yuen, Michaela; Webster, Richard; Menezes, Manoj; Fock, Johanna M.; Pride, Natalie; Best, Heather A.; Damm, Tatiana Benavides; Turner, Christian; Lek, Monkol; Engel, Andrew G.; North, Kathryn N.; Clarke, Nigel F.; MacArthur, Daniel G.; Kamsteeg, Erik-Jan; Cooper, Sandra T.

    2016-01-01

    Objective: To describe the clinical and genetic characteristics of presynaptic congenital myasthenic syndrome secondary to biallelic variants in SLC18A3. Methods: Individuals from 2 families were identified with biallelic variants in SLC18A3, the gene encoding the vesicular acetylcholine transporter

  5. Riboflavin uptake transporter Slc52a2 (RFVT2) is upregulated in the mouse mammary gland during lactation.

    Science.gov (United States)

    Wu, Alex Man Lai; Dedina, Liana; Dalvi, Pooja; Yang, Mingdong; Leon-Cheon, John; Earl, Brian; Harper, Patricia A; Ito, Shinya

    2016-04-01

    While it is well recognized that riboflavin accumulates in breast milk as an essential vitamin for neonates, transport mechanisms for its milk excretion are not well characterized. The multidrug efflux transporter ABCG2 in the apical membrane of milk-producing mammary epithelial cells (MECs) is involved with riboflavin excretion. However, it is not clear whether MECs possess other riboflavin transport systems, which may facilitate its basolateral uptake into MECs. We report here that transcripts encoding the second (SLC52A2) and third (SLC52A3) member of the recently discovered family of SLC52A riboflavin uptake transporters are expressed in milk fat globules from human breast milk. Furthermore, Slc52a2 and Slc52a3 mRNA are upregulated in the mouse mammary gland during lactation. Importantly, the induction ofSlc52a2, which was the major Slc52a riboflavin transporter in the lactating mammary gland, was also observed at the protein level. Subcellular localization studies showed that green fluorescent protein-tagged mouse SLC52A2 mainly localized to the cell membrane, with no preferential distribution to the apical or basolateral membrane in polarized kidney MDCK cells. These results strongly implicate a potential role for SLC52A2 in riboflavin uptake by milk-producing MECs, a critical step in the transfer of riboflavin into breast milk. Copyright © 2016 the American Physiological Society.

  6. Missense mutation in exon 2 of SLC36A1 responsible for champagne dilution in horses.

    Directory of Open Access Journals (Sweden)

    Deborah Cook

    2008-09-01

    Full Text Available Champagne coat color in horses is controlled by a single, autosomal-dominant gene (CH. The phenotype produced by this gene is valued by many horse breeders, but can be difficult to distinguish from the effect produced by the Cream coat color dilution gene (CR. Three sires and their families segregating for CH were tested by genome scanning with microsatellite markers. The CH gene was mapped within a 6 cM region on horse chromosome 14 (LOD = 11.74 for theta = 0.00. Four candidate genes were identified within the region, namely SPARC [Secreted protein, acidic, cysteine-rich (osteonectin], SLC36A1 (Solute Carrier 36 family A1, SLC36A2 (Solute Carrier 36 family A2, and SLC36A3 (Solute Carrier 36 family A3. SLC36A3 was not expressed in skin tissue and therefore not considered further. The other three genes were sequenced in homozygotes for CH and homozygotes for the absence of the dilution allele (ch. SLC36A1 had a nucleotide substitution in exon 2 for horses with the champagne phenotype, which resulted in a transition from a threonine amino acid to an arginine amino acid (T63R. The association of the single nucleotide polymorphism (SNP with the champagne dilution phenotype was complete, as determined by the presence of the nucleotide variant among all 85 horses with the champagne dilution phenotype and its absence among all 97 horses without the champagne phenotype. This is the first description of a phenotype associated with the SLC36A1 gene.

  7. Examining the role of components of Slc11a1 (Nramp1 in the susceptibility of New Zealand sea lions (Phocarctos hookeri to disease.

    Directory of Open Access Journals (Sweden)

    Amy J Osborne

    Full Text Available The New Zealand sea lion (NZSL, Phocarctos hookeri is a Threatened marine mammal with a restricted distribution and a small, declining, population size. The species is susceptible to bacterial pathogens, having suffered three mass mortality events since 1998. Understanding the genetic factors linked to this susceptibility is important in mitigating population decline. The gene solute carrier family 11 member a1 (Slc11a1 plays an important role in mammalian resistance or susceptibility to a wide range of bacterial pathogens. At present, Slc11a1 has not been characterised in many taxa, and despite its known roles in mediating the effects of infectious disease agents, has not been examined as a candidate gene in susceptibility or resistance in any wild population of conservation concern. Here we examine components of Slc11a1 in NZSLs and identify: i a polymorphic nucleotide in the promoter region; ii putative shared transcription factor binding motifs between canids and NZSLs; and iii a conserved polymorphic microsatellite in the first intron of Slc11a1, which together suggest conservation of Slc11a1 gene structure in otariids. At the promoter polymorphism, we demonstrate a shift away from normal allele frequency distributions and an increased likelihood of death from infectious causes with one allelic variant. While this increased likelihood is not statistically significant, lack of significance is potentially due to the complexity of genetic susceptibility to disease in wild populations. Our preliminary data highlight the potential significance of this gene in disease resistance in wild populations; further exploration of Slc11a1 will aid the understanding of susceptibility to infection in mammalian species of conservation significance.

  8. The Human Gene SLC25A29, of Solute Carrier Family 25, Encodes a Mitochondrial Transporter of Basic Amino Acids*

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292

  9. The human gene SLC25A29, of solute carrier family 25, encodes a mitochondrial transporter of basic amino acids.

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-05-09

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.

  10. Essential roles of aspartate aminotransferase 1 and vesicular glutamate transporters in β-cell glutamate signaling for incretin-induced insulin secretion.

    Directory of Open Access Journals (Sweden)

    Naoya Murao

    Full Text Available Incretins (GLP-1 and GIP potentiate insulin secretion through cAMP signaling in pancreatic β-cells in a glucose-dependent manner. We recently proposed a mechanistic model of incretin-induced insulin secretion (IIIS that requires two critical processes: 1 generation of cytosolic glutamate through the malate-aspartate (MA shuttle in glucose metabolism and 2 glutamate transport into insulin granules by cAMP signaling to promote insulin granule exocytosis. To directly prove the model, we have established and characterized CRISPR/Cas9-engineered clonal mouse β-cell lines deficient for the genes critical in these two processes: aspartate aminotransferase 1 (AST1, gene symbol Got1, a key enzyme in the MA shuttle, which generates cytosolic glutamate, and the vesicular glutamate transporters (VGLUT1, VGLUT2, and VGLUT3, gene symbol Slc17a7, Slc17a6, and Slc17a8, respectively, which participate in glutamate transport into secretory vesicles. Got1 knockout (KO β-cell lines were defective in cytosolic glutamate production from glucose and showed impaired IIIS. Unexpectedly, different from the previous finding that global Slc17a7 KO mice exhibited impaired IIIS from pancreatic islets, β-cell specific Slc17a7 KO mice showed no significant impairment in IIIS, as assessed by pancreas perfusion experiment. Single Slc17a7 KO β-cell lines also retained IIIS, probably due to compensatory upregulation of Slc17a6. Interestingly, triple KO of Slc17a7, Slc17a6, and Slc17a8 diminished IIIS, which was rescued by exogenously introduced wild-type Slc17a7 or Slc17a6 genes. The present study provides direct evidence for the essential roles of AST1 and VGLUTs in β-cell glutamate signaling for IIIS and also shows the usefulness of the CRISPR/Cas9 system for studying β-cells by simultaneous disruption of multiple genes.

  11. Inhibition of intestinal bile acid transporter Slc10a2 improves triglyceride metabolism and normalizes elevated plasma glucose levels in mice.

    Directory of Open Access Journals (Sweden)

    Thomas Lundåsen

    Full Text Available Interruption of the enterohepatic circulation of bile acids increases cholesterol catabolism, thereby stimulating hepatic cholesterol synthesis from acetate. We hypothesized that such treatment should lower the hepatic acetate pool which may alter triglyceride and glucose metabolism. We explored this using mice deficient of the ileal sodium-dependent BA transporter (Slc10a2 and ob/ob mice treated with a specific inhibitor of Slc10a2. Plasma TG levels were reduced in Slc10a2-deficient mice, and when challenged with a sucrose-rich diet, they displayed a reduced response in hepatic TG production as observed from the mRNA levels of several key enzymes in fatty acid synthesis. This effect was paralleled by a diminished induction of mature sterol regulatory element-binding protein 1c (Srebp1c. Unexpectedly, the SR-diet induced intestinal fibroblast growth factor (FGF 15 mRNA and normalized bile acid synthesis in Slc10a2-/- mice. Pharmacologic inhibition of Slc10a2 in diabetic ob/ob mice reduced serum glucose, insulin and TGs, as well as hepatic mRNA levels of Srebp1c and its target genes. These responses are contrary to those reported following treatment of mice with a bile acid binding resin. Moreover, when key metabolic signal transduction pathways in the liver were investigated, those of Mek1/2-Erk1/2 and Akt were blunted after treatment of ob/ob mice with the Slc10a2 inhibitor. It is concluded that abrogation of Slc10a2 reduces hepatic Srebp1c activity and serum TGs, and in the diabetic ob/ob model it also reduces glucose and insulin levels. Hence, targeting of Slc10a2 may be a promising strategy to treat hypertriglyceridemia and diabetes.

  12. Dicty_cDB: SLC420 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT

  13. The dopamine transporter protein gene (SLC6A3): Primary linage mapping and linkage studies in Tourette syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Gelernter, J.; Kruger, S.D.; Pakstis, A.J. [Yale Univ., New Haven, CT (United States)]|[West Haven Veterans Affairs Medical Center, CT (United States)] [and others

    1995-12-10

    The dopamine transporter, the molecule responsible for presynaptic reuptake of dopamine and a major site of action of psychostimulant drugs, including cocaine, is encoded by locus SLC6A3 (alias DAT1). The protein`s actions and DAT`s specific localization to dopaminergic neurons make it a candidate gene for several psychiatric illnesses. SLC6A3 has been mapped to distal chromosome 5p, using physical methods. Genetic linkage methods were used to place SLC6A3 in the genetic linkage map. Four extended pedigrees (one of which overlaps with CEPH) were typed. Linkage with Tourette syndrome (TS) was also examined. SLC6A3 showed close linkage with several markers previously mapped to distal chromosome 5p, including D5S11 (Z{sub max} = 16.0, {theta}{sub M} = {theta}{sub F} = 0.03, results from four families) and D5S678 (Z{sub max} = 7.84, {theta}{sub M} = {theta}{sub F} = 0, results from two families). Observed crossovers established that SLC6A3 is a distal marker close to D5S10 and D5S678, but these three distal markers could not be ordered. Linkage between TS and SLC6A3 could be excluded independently in two branches of a large kindred segregating TS; the lod score in a third family was also negative, but not significant. Cumulative results show a lod score of -6.2 at {theta} = 0 and of -3.9 at {theta} = 0.05 (dominant model, narrow disease definition). SLC6A3 thus maps to distal chromosome 5p by linkage analysis, in agreement with previous physical mapping data. A mutation at SLC6A3 is not causative for TS in the two large families that generated significant negative lod scores (if the parameters of our analyses were correct) and is unlikely to be causative in the family that generated a negative lod score that did not reach significance. These results do not exclude a role for the dopamine transporter in influencing risk for TS in combination with other loci. 23 refs., 1 fig., 2 tabs.

  14. Genetic variation of Pit-1 gene in Chinese indigenous and Western ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-07-20

    Jul 20, 2009 ... regulates pituitary development and expression of the growth hormone, prolactin and thyrotropin β- submit genes. Pit-1 ... mice (Camper et al., 1990), as well as including the .... logy Company, Shanghai, China). Statistical ...

  15. The mammalian phosphate carrier SLC25A3 is a mitochondrial copper transporter required for cytochrome c oxidase biogenesis.

    Science.gov (United States)

    Boulet, Aren; Vest, Katherine E; Maynard, Margaret K; Gammon, Micah G; Russell, Antoinette C; Mathews, Alexander T; Cole, Shelbie E; Zhu, Xinyu; Phillips, Casey B; Kwong, Jennifer Q; Dodani, Sheel C; Leary, Scot C; Cobine, Paul A

    2018-02-09

    Copper is required for the activity of cytochrome c oxidase (COX), the terminal electron-accepting complex of the mitochondrial respiratory chain. The likely source of copper used for COX biogenesis is a labile pool found in the mitochondrial matrix. In mammals, the proteins that transport copper across the inner mitochondrial membrane remain unknown. We previously reported that the mitochondrial carrier family protein Pic2 in budding yeast is a copper importer. The closest Pic2 ortholog in mammalian cells is the mitochondrial phosphate carrier SLC25A3. Here, to investigate whether SLC25A3 also transports copper, we manipulated its expression in several murine and human cell lines. SLC25A3 knockdown or deletion consistently resulted in an isolated COX deficiency in these cells, and copper addition to the culture medium suppressed these biochemical defects. Consistent with a conserved role for SLC25A3 in copper transport, its heterologous expression in yeast complemented copper-specific defects observed upon deletion of PIC2 Additionally, assays in Lactococcus lactis and in reconstituted liposomes directly demonstrated that SLC25A3 functions as a copper transporter. Taken together, these data indicate that SLC25A3 can transport copper both in vitro and in vivo . © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Dicty_cDB: SLC832 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC832 (Link to dictyBase) - - - Contig-U13922-1 SLC832Z (Link... to Original site) - - SLC832Z 638 - - - - Show SLC832 Library SL (Link to library) Clone ID SLC832 (Link to dic..._1( EU565733 |pid:none) Uncultured soil bacterium clone gl... 35 2.4 CP000010_276....1 AP009385_2728( AP009385 |pid:none) Burkholderia multivorans ATCC 1... 33 5.3 A... 20.0 %: nuclear 16.0 %: vesicles of secretory system 12.0 %: mitochondrial 8.0 %: Golgi 8.0 %: endoplasmic reticul

  17. LAT1 acts as a crucial transporter of amino acids in human thymic carcinoma cells

    Directory of Open Access Journals (Sweden)

    Keitaro Hayashi

    2016-11-01

    Full Text Available L-type amino acid transporter 1 (LAT1, SLC7A5 incorporates essential amino acids into cells. Recent studies have shown that LAT1 is a predominant transporter in various human cancers. However, the function of LAT1 in thymic carcinoma remains unknown. Here we demonstrate that LAT1 is a critical transporter for human thymic carcinoma cells. LAT1 was strongly expressed in human thymic carcinoma tissues. LAT1-specific inhibitor significantly suppressed leucine uptake and growth of Ty82 human thymic carcinoma cell lines, suggesting that thymic carcinoma takes advantage of LAT1 as a quality transporter and that LAT1-specific inhibitor might be clinically beneficial in therapy for thymic carcinoma.

  18. Genetic moderation of cocaine subjective effects by variation in the TPH1, TPH2, and SLC6A4 serotonin genes.

    Science.gov (United States)

    Patriquin, Michelle A; Hamon, Sara C; Harding, Mark J; Nielsen, Ellen M; Newton, Thomas F; De La Garza, Richard; Nielsen, David A

    2017-10-01

    This study investigated variants of tryptophan hydroxylase (TPH)1, TPH2, and SLC6A4 in the moderation of the subjective effects of cocaine. Non-treatment-seeking cocaine-dependent individuals (N=66) were intravenously administered saline and cocaine (40 mg) in a randomized order. Participants self-reported subjective effects of cocaine using a visual analog scale starting before administration of saline or cocaine (-15 min) to up to 20 min after infusion. Self-report ratings on the visual analog scale ranged from 0 (no effect) to 100 (greatest effect). Participants were genotyped for the TPH1 rs1799913, TPH2 rs4290270, and SLC6A4 5-HTTLPR variants. Repeated-measures analysis of covariance was used to examine changes in subjective effect scores over time while controlling for population structure. Participants carrying the TPH1 rs1799913 A allele reported greater subjective response to cocaine for 'stimulated' and 'access' relative to the CC genotype group. Those carrying the TPH2 rs4290270 A allele reported higher 'good effect' and lower 'depressed' effect relative to the TT genotype group. Those carrying the SLC6A4 5-HTTLPR S' allele reported greater 'desire' and 'access' compared with the L'L' genotype group. These findings indicate that TPH1, TPH2, and SLC6A4 variants moderate the subjective effects of cocaine in non-treatment-seeking cocaine-dependent participants.

  19. Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene.

    Science.gov (United States)

    Rao, Suryadevara S; Hildebrand, David

    2009-10-01

    The wild type (Wt) and mutant form of yeast (sphingolipid compensation) genes, SLC1 and SLC1-1, have been shown to have lysophosphatidic acid acyltransferase (LPAT) activities (Nageic et al. in J Biol Chem 269:22156-22163, 1993). Expression of these LPAT genes was reported to increase oil content in transgenic Arabidopsis and Brassica napus. It is of interest to determine if the TAG content increase would also be seen in soybeans. Therefore, the wild type SLC1 was expressed in soybean somatic embryos under the control of seed specific phaseolin promoter. Some transgenic somatic embryos and in both T2 and T3 transgenic seeds showed higher oil contents. Compared to controls, the average increase in triglyceride values went up by 1.5% in transgenic somatic embryos. A maximum of 3.2% increase in seed oil content was observed in a T3 line. Expression of the yeast Wt LPAT gene did not alter the fatty acid composition of the seed oil.

  20. A novel variant in the SLC12A1 gene in two families with antenatal Bartter syndrome.

    Science.gov (United States)

    Breinbjerg, Anders; Siggaard Rittig, Charlotte; Gregersen, Niels; Rittig, Søren; Hvarregaard Christensen, Jane

    2017-01-01

    Bartter syndrome is an autosomal-recessive inherited disease in which patients present with hypokalaemia and metabolic alkalosis. We present two apparently nonrelated cases with antenatal Bartter syndrome type I, due to a novel variant in the SLC12A1 gene encoding the bumetanide-sensitive sodium-(potassium)-chloride cotransporter 2 in the thick ascending limb of the loop of Henle. Blood samples were received from the two cases and 19 of their relatives, and deoxyribonucleic acid was extracted. The coding regions of the SLC12A1 gene were amplified using polymerase chain reaction, followed by bidirectional direct deoxyribonucleic acid sequencing. Each affected child in the two families was homozygous for a novel inherited variant in the SLC12A1gene, c.1614T>A. The variant predicts a change from a tyrosine codon to a stop codon (p.Tyr538Ter). The two cases presented antenatally and at six months of age, respectively. The two cases were homozygous for the same variant in the SLC12A1 gene, but presented clinically at different ages. This could eventually be explained by the presence of other gene variants or environmental factors modifying the phenotypes. The phenotypes of the patients were similar to other patients with antenatal Bartter syndrome. ©2016 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  1. Analysis of two Pit-1 gene polymorphisms: Single nucleotide ...

    African Journals Online (AJOL)

    Pit-1 is a pituitary-specific transcription factor responsible for pituitary development and hormone expression in mammals. Pit-1 is a member of the POU domain containing proteins, a group of transcriptional regulators with a critical role in cell differentiation and proliferation. It was shown that this group of proteins control the ...

  2. Mutations in SLC20A2 are a major cause of familial idiopathic basal ganglia calcification

    Science.gov (United States)

    Hsu, Sandy Chan; Sears, Renee L.; Lemos, Roberta R.; Quintáns, Beatriz; Huang, Alden; Spiteri, Elizabeth; Nevarez, Lisette; Mamah, Catherine; Zatz, Mayana; Pierce, Kerrie D.; Fullerton, Janice M.; Adair, John C.; Berner, Jon E.; Bower, Matthew; Brodaty, Henry; Carmona, Olga; Dobricić, Valerija; Fogel, Brent L.; García-Estevez, Daniel; Goldman, Jill; Goudreau, John L.; Hopfer, Suellen; Janković, Milena; Jaumà, Serge; Jen, Joanna C.; Kirdlarp, Suppachok; Klepper, Joerg; Kostić, Vladimir; Lang, Anthony E.; Linglart, Agnès; Maisenbacher, Melissa K.; Manyam, Bala V.; Mazzoni, Pietro; Miedzybrodzka, Zofia; Mitarnun, Witoon; Mitchell, Philip B.; Mueller, Jennifer; Novaković, Ivana; Paucar, Martin; Paulson, Henry; Simpson, Sheila A.; Svenningsson, Per; Tuite, Paul; Vitek, Jerrold; Wetchaphanphesat, Suppachok; Williams, Charles; Yang, Michele; Schofield, Peter R.; de Oliveira, João R. M.; Sobrido, María-Jesús

    2014-01-01

    Familial idiopathic basal ganglia calcification (IBGC) or Fahr’s disease is a rare neurodegenerative disorder characterized by calcium deposits in the basal ganglia and other brain regions, which is associated with neuropsychiatric and motor symptoms. Familial IBGC is genetically heterogeneous and typically transmitted in an autosomal dominant fashion. We performed a mutational analysis of SLC20A2, the first gene found to cause IBGC, to assess its genetic contribution to familial IBGC. We recruited 218 subjects from 29 IBGC-affected families of varied ancestry and collected medical history, neurological exam, and head CT scans to characterize each patient’s disease status. We screened our patient cohort for mutations in SLC20A2. Twelve novel (nonsense, deletions, missense, and splice site) potentially pathogenic variants, one synonymous variant, and one previously reported mutation were identified in 13 families. Variants predicted to be deleterious cosegregated with disease in five families. Three families showed nonsegregation with clinical disease of such variants, but retrospective review of clinical and neuroimaging data strongly suggested previous misclassification. Overall, mutations in SLC20A2 account for as many as 41 % of our familial IBGC cases. Our screen in a large series expands the catalog of SLC20A2 mutations identified to date and demonstrates that mutations in SLC20A2 are a major cause of familial IBGC. Non-perfect segregation patterns of predicted deleterious variants highlight the challenges of phenotypic assessment in this condition with highly variable clinical presentation. PMID:23334463

  3. Anti-PIT-1 antibody syndrome; a novel clinical entity leading to hypopituitarism.

    Science.gov (United States)

    Bando, Hironori; Iguchi, Genzo; Yamamoto, Masaaki; Hidaka-Takeno, Ryoko; Takahashi, Yutaka

    2015-03-01

    Various hypothalamic-pituitary diseases cause hypopituitarism. Inflammation related to autoimmunity also causes hypopituitarism. Hypophysitis is a representative disease caused by autoimmunity. Generally, anterior pituitary hormones are non-specifically impaired in this condition, but specific hormone defects have been reported in some cases. Anti-PIT-1 (pituitary-specific transcription factor 1) antibody syndrome is a novel clinical entity that presents an acquired combined pituitary hormone deficiency characterized by a specific defect in growth hormone, prolactin, and thyroid-stimulating hormone. Circulating anti-PIT-1 antibody along with various autoantibodies are detected with multiple endocrine organopathy, meeting the definition of autoimmune polyglandular syndrome. Mechanistically, cytotoxic T lymphocytes that specifically react with PIT-1 protein play an important role in the development of this syndrome.

  4. Epigenetic adaptation of the placental serotonin transporter gene (SLC6A4 to gestational diabetes mellitus.

    Directory of Open Access Journals (Sweden)

    Sofia Blazevic

    Full Text Available We tested the hypothesis that gestational diabetes mellitus (GDM alters the DNA methylation pattern of the fetal serotonin transporter gene (SLC6A4, and examined the functional relevance of DNA methylation for regulation of the SLC6A4 expression in the human placenta. The study included 50 mother-infant pairs. Eighteen mothers were diagnosed with GDM and 32 had normal glucose tolerance (NGT. All neonates were of normal birth weight and born at term by planned Cesarean section. DNA and RNA were isolated from samples of tissue collected from the fetal side of the placenta immediately after delivery. DNA methylation was quantified at 7 CpG sites within the SLC6A4 distal promoter region using PCR amplification of bisulfite treated DNA and subsequent DNA sequencing. SLC6A4 mRNA levels were measured by reverse transcription-quantitative PCR (RT-qPCR. Functional SLC6A4 polymorphisms (5HTTLPR, STin2, rs25531 were genotyped using standard PCR-based procedures. Average DNA methylation across the 7 analyzed loci was decreased in the GDM as compared to the NGT group (by 27.1%, p = 0.037 and negatively correlated, before and after adjustment for potential confounder/s, with maternal plasma glucose levels at the 24th to 28th week of gestation (p0.05. The results suggest that DNA methylation of the fetal SLC6A4 gene is sensitive to the maternal metabolic state in pregnancy. They also indicate a predominant role of epigenetic over genetic mechanisms in the regulation of SLC6A4 expression in the human placenta. Longitudinal studies in larger cohorts are needed to verify these results and determine to which degree placental SLC6A4 changes may contribute to long-term outcomes of infants exposed to GDM.

  5. Hereditary folate malabsorption: A positively charged amino acid at position 113 of the proton-coupled folate transporter (PCFT/SLC46A1) is required for folic acid binding

    International Nuclear Information System (INIS)

    Lasry, Inbal; Berman, Bluma; Glaser, Fabian; Jansen, Gerrit; Assaraf, Yehuda G.

    2009-01-01

    The proton-coupled folate transporter (PCFT/SLC46A1) mediates intestinal folate uptake at acidic pH. Some loss of folic acid (FA) transport mutations in PCFT from hereditary folate malabsorption (HFM) patients cluster in R113, thereby suggesting a functional role for this residue. Herein, unlike non-conservative substitutions, an R113H mutant displayed 80-fold increase in the FA transport Km while retaining parental Vmax, hence indicating a major fall in folate substrate affinity. Furthermore, consistent with the preservation of 9% of parental transport activity, R113H transfectants displayed a substantial decrease in the FA growth requirement relative to mock transfectants. Homology modeling based on the crystal structures of the Escherichia coli transporter homologues EmrD and glycerol-3-phosphate transporter revealed that the R113H rotamer properly protrudes into the cytoplasmic face of the minor cleft normally occupied by R113. These findings constitute the first demonstration that a basic amino acid at position 113 is required for folate substrate binding.

  6. Determination of Unbound Partition Coefficient and in Vitro-in Vivo Extrapolation for SLC13A Transporter-Mediated Uptake.

    Science.gov (United States)

    Riccardi, Keith; Li, Zhenhong; Brown, Janice A; Gorgoglione, Matthew F; Niosi, Mark; Gosset, James; Huard, Kim; Erion, Derek M; Di, Li

    2016-10-01

    Unbound partition coefficient (Kpuu) is important to an understanding of the asymmetric free drug distribution of a compound between cells and medium in vitro, as well as between tissue and plasma in vivo, especially for transporter-mediated processes. Kpuu was determined for a set of compounds from the SLC13A family that are inhibitors and substrates of transporters in hepatocytes and transporter-transfected cell lines. Enantioselectivity was observed, with (R)-enantiomers achieving much higher Kpuu (>4) than the (S)-enantiomers (<1) in human hepatocytes and SLC13A5-transfected human embryonic 293 cells. The intracellular free drug concentration correlated directly with in vitro pharmacological activity rather than the nominal concentration in the assay because of the high Kpuu mediated by SLC13A5 transporter uptake. Delivery of the diacid PF-06649298 directly or via hydrolysis of the ethyl ester prodrug PF-06757303 resulted in quite different Kpuu values in human hepatocytes (Kpuu of 3 for diacid versus 59 for prodrug), which was successfully modeled on the basis of passive diffusion, active uptake, and conversion rate from ester to diacid using a compartmental model. Kpuu values changed with drug concentrations; lower values were observed at higher concentrations possibly owing to a saturation of transporters. Michaelis-Menten constant (Km) of SLC13A5 was estimated to be 24 μM for PF-06649298 in human hepatocytes. In vitro Kpuu obtained from rat suspension hepatocytes supplemented with 4% fatty acid free bovine serum albumin showed good correlation with in vivo Kpuu of liver-to-plasma, illustrating the potential of this approach to predict in vivo Kpuu from in vitro systems. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.

  7. Interaction between the SLC19A1 gene and maternal first trimester fever on offspring neural tube defects.

    Science.gov (United States)

    Pei, Lijun; Zhu, Huiping; Ye, Rongwei; Wu, Jilei; Liu, Jianmeng; Ren, Aiguo; Li, Zhiwen; Zheng, Xiaoying

    2015-01-01

    Many studies have indicated that the reduced folate carrier gene (SLC19A1) is associated with an increased risk of neural tube defects (NTDs). However, the interaction between the SLC19A1 gene variant and maternal fever exposure and NTD risk remains unknown. The aim of this study was to investigate whether the risk for NTDs was influenced by the interactions between the SLC19A1 (rs1051266) variant and maternal first trimester fever. We investigated the potential interaction between maternal first trimester fever and maternal or offspring SLC19A1 polymorphism through a population-based case-control study. One hundred and four nuclear families with NTDs and 100 control families with nonmal newborns were included in the study. SLC19A1 polymorphism was determined using polymerase chain reaction-restricted fragment length polymorphism. Mothers who had the GG/GA genotype and first trimester fever had an elevated risk of NTDs (adjusted odds ratio, 11.73; 95% confidence interval, 3.02-45.58) as compared to absence of maternal first trimester fever and AA genotype after adjusting for maternal education, paternal education, and age, and had a significant interactive coefficient (γ = 3.17) between maternal GG/GA genotype and first trimester fever. However, there was no interaction between offspring's GG/GA genotype and maternal first trimester fever (the interactive coefficient γ = 0.97) after adjusting for confounding factors. Our findings suggested that the risk of NTDs was potentially influenced by a gene-environment interaction between maternal SLC19A1 rs1051266 GG/GA genotype and first trimester fever. Maternal GG/GA genotype may strengthen the effect of maternal fever exposure on NTD risk in this Chinese population. © 2014 Wiley Periodicals, Inc.

  8. A stochastic analysis of the effect of hydrostatic pressure on the pit corrosion of Fe-20Cr alloy

    International Nuclear Information System (INIS)

    Zhang Tao; Yang Yange; Shao Yawei; Meng, Guozhe; Wang, Fuhui

    2009-01-01

    The effect of hydrostatic pressure on the pit corrosion behavior of Fe-20Cr alloy was investigated in 3.5% NaCl solution by means of potentiodynamic polarization and potentiostatic technology, and the experiment data was analyzed based on stochastic theory. With the increase of hydrostatic pressure, the pit corrosion resistance of Fe-20Cr alloy was deteriorated, which was distinguished by the decrease of critical pit potential (E cirt ) and the increase of passive current density. The results also demonstrated that there exist two effects of hydrostatic pressure on the corrosion behavior of Fe-20Cr alloy: (1) the pit generation rate was evidently increased compared to that under lower hydrostatic pressure, and the metastable pits become faster and larger. However, it seemed that pit generation mechanism shows no hydrostatic pressure dependence; (2) the probability of pit growth increased with the increase of hydrostatic pressure, which implied that the metastable pit on Fe-20Cr alloy exhibited higher probability to become larger pit cavity during shorter time interval than that under lower hydrostatic pressure.

  9. Using RFID and PIT tags to Quantify Bedload Transport in the Oregon Coast Range

    Science.gov (United States)

    Sanfilippo, J.; Lancaster, S. T.

    2017-12-01

    Introducing the methods, issues, and data collection techniques and interpretation over one water year using RFID (radio frequency identification) and PIT (passive integrated transponder) tags in Oak Creek, near Corvallis Oregon. We constructed an RFID four-antenna array that runs off of a single radiofrequency reader via a multiplexer board. Using 4 grain sizes we tagged 990 individual rocks, roughly 250 in of each four size ranges (8-16mm, 16-32mm, 32-64mm, 64-128mm). Using 12 mm and 23 mm PIT tags during 1 water year the antennas logged 477 tracer passage events. To calculate bedload transport for each size range, at each antenna, interarrival times yield count rates when combined with grain size fractions of the bed and tracer concentrations, yield bedload transport for each size class. We calculated transport rates for five events of varying magnitude and found that PIT tag RFID method under predicts transport between 1 and 3 orders of magnitude.

  10. Genetic analysis of the GLUT10 glucose transporter (SLC2A10 polymorphisms in Caucasian American type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Mychaleckyj Josyf C

    2005-12-01

    Full Text Available Abstract Background GLUT10 (gene symbol SLC2A10 is a facilitative glucose transporter within the type 2 diabetes (T2DM-linked region on chromosome 20q12-13.1. Therefore, we evaluated GLUT10 as a positional candidate gene for T2DM in Caucasian Americans. Methods Twenty SNPs including 4 coding, 10 intronic and 6 5' and 3' to the coding sequence were genotyped across a 100 kb region containing the SLC2A10 gene in DNAs from 300 T2DM cases and 310 controls using the Sequenom MassArray Genotyping System. Allelic association was evaluated, and linkage disequilibrium (LD and haplotype structure of SLC2A10 were also determined to assess whether any specific haplotypes were associated with T2DM. Results Of these variants, fifteen had heterozygosities greater than 0.80 and were analyzed further for association with T2DM. No evidence of significant association was observed for any variant with T2DM (all P ≥ 0.05, including Ala206Thr (rs2235491 which was previously reported to be associated with fasting insulin. Linkage disequilibrium analysis suggests that the SLC2A10 gene is contained in a single haplotype block of 14 kb. Haplotype association analysis with T2DM did not reveal any significant differences between haplotype frequencies in T2DM cases and controls. Conclusion From our findings, we can conclude that sequence variants in or near GLUT10 are unlikely to contribute significantly to T2DM in Caucasian Americans.

  11. Response to crizotinib in a lung adenocarcinoma patient harboring a novel SLC34A2-ROS1 fusion variant

    Science.gov (United States)

    Zhao, Zheng; Song, Zhangjun; Wang, Xuwei; Sun, Haifeng; Yang, Xiaomin; Yuan, Yong; Yu, Pan

    2017-01-01

    ROS1 fusion is a common genetic alteration in non-small-cell lung cancer. Crizotinib, an anaplastic lymphoma kinase inhibitor, shows efficacy in the treatment of lung cancer cases with ROS1 translocation. We report the response to crizotinib of a lung adenocarcinoma patient harboring a novel SLC34A2-ROS1 fusion variant, which was different from the two common SLC34A2-ROS1 fusion types reported in the literature. After crizotinib administration, overall recovery was good in this patient; the primary lesion was successfully treated, the lymph node metastases had disappeared, and the metabolism was normal. PMID:28860822

  12. The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

    Directory of Open Access Journals (Sweden)

    Anna Rita Cappello

    2018-04-01

    Full Text Available The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P antiporters, catalyzing both homologous (Pi/Pi and heterologous (G6P/Pi exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT, transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib, an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

  13. The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

    Science.gov (United States)

    Cappello, Anna Rita; Curcio, Rosita; Lappano, Rosamaria; Maggiolini, Marcello; Dolce, Vincenza

    2018-04-01

    The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER) membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi) antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P) antiporters, catalyzing both homologous (Pi/Pi) and heterologous (G6P/Pi) exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT), transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α) or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib), an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

  14. In situ vitrification demonstration at Pit 1, Oak Ridge National Laboratory. Volume 2: Site characterization report of the Pit 1 area

    International Nuclear Information System (INIS)

    Spalding, B.P.; Bogle, M.A.; Cline, S.R.; Naney, M.T.; Gu, B.

    1997-12-01

    A treatability study was initiated in October 1993, initially encompassing the application of in situ vitrification (ISV) to at least two segments of Oak Ridge National Laboratory (ORNL) seepage Pit 1 by the end of fiscal year (FY) 1995. This treatability study was to have supported a possible Interim Record of Decision (IROD) or removal action for closure of one or more of the seepage pits and trenches as early as FY 1997. The Remedial Investigation/Feasibility Study for Waste Area Grouping (WAG) 7, which contains these seven seepage pits and trenches, will probably not begin until after the year 2000. This treatability study will establish the field-scale technical performance of ISV for (1) attaining the required depth, nominally 15 ft, to incorporate source contamination within and beneath the pits; (2) demonstrating field capability to overlap melt settings that are necessary to achieve fused, melted segments of the source contamination; (3) demonstrating off-gas handling technology for accommodating and minimizing the volatilization of 137 Cs; (4) demonstrating adequate site characterization techniques to predict ISV melting kinetics, processing temperatures, and product durability; and (5) promoting public acceptance of ISV technology by demonstrating its safety, implementability, site impacts, and air emissions and by coordinating the treatability study within the regulatory closure process. This report summarizes the site characterization information gathered through the end of September 1996 which supports the planning and assessment of ISV for Pit 1 (objective 4 above)

  15. In situ vitrification demonstration at Pit 1, Oak Ridge National Laboratory. Volume 2: Site characterization report of the Pit 1 area

    Energy Technology Data Exchange (ETDEWEB)

    Spalding, B.P.; Bogle, M.A.; Cline, S.R.; Naney, M.T.; Gu, B.

    1997-12-01

    A treatability study was initiated in October 1993, initially encompassing the application of in situ vitrification (ISV) to at least two segments of Oak Ridge National Laboratory (ORNL) seepage Pit 1 by the end of fiscal year (FY) 1995. This treatability study was to have supported a possible Interim Record of Decision (IROD) or removal action for closure of one or more of the seepage pits and trenches as early as FY 1997. The Remedial Investigation/Feasibility Study for Waste Area Grouping (WAG) 7, which contains these seven seepage pits and trenches, will probably not begin until after the year 2000. This treatability study will establish the field-scale technical performance of ISV for (1) attaining the required depth, nominally 15 ft, to incorporate source contamination within and beneath the pits; (2) demonstrating field capability to overlap melt settings that are necessary to achieve fused, melted segments of the source contamination; (3) demonstrating off-gas handling technology for accommodating and minimizing the volatilization of {sup 137}Cs; (4) demonstrating adequate site characterization techniques to predict ISV melting kinetics, processing temperatures, and product durability; and (5) promoting public acceptance of ISV technology by demonstrating its safety, implementability, site impacts, and air emissions and by coordinating the treatability study within the regulatory closure process. This report summarizes the site characterization information gathered through the end of September 1996 which supports the planning and assessment of ISV for Pit 1 (objective 4 above).

  16. Amino acid derivatives are substrates or non-transported inhibitors of the amino acid transporter PAT2 (slc36a2).

    Science.gov (United States)

    Edwards, Noel; Anderson, Catriona M H; Gatfield, Kelly M; Jevons, Mark P; Ganapathy, Vadivel; Thwaites, David T

    2011-01-01

    The H(+)-coupled amino acid transporter PAT2 (SLC36A2) transports the amino acids proline, glycine, alanine and hydroxyproline. A physiological role played by PAT2 in amino acid reabsorption in the renal proximal tubule is demonstrated by mutations in SLC36A2 that lead to an iminoglycinuric phenotype (imino acid and glycine uria) in humans. A number of proline, GABA and tryptophan derivatives were examined to determine if they function either as transported substrates or non-transported inhibitors of PAT2. The compounds were investigated following heterologous expression of rat PAT2 in Xenopus laevis oocytes. PAT2 function was characterised by: radiotracer uptake and competition (cis-inhibition) studies; radiotracer efflux and trans-stimulation; and measurement of substrate-induced positive inward current by two-electrode voltage-clamp. In general, the proline derivatives appeared to be transported substrates and the relative ability to induce current flow was closely related to the inhibitory effects on PAT2-mediated l-[(3)H]proline uptake. In contrast, certain heterocyclic GABA derivatives (e.g. l-pipecolic acid) were translocated only slowly. Finally, the tryptophan derivatives inhibited PAT2 function but did not undergo transport. l-Proline uptake was inhibited by 5-hydroxy-l-tryptophan (IC(50) 1.6±0.4mM), α-methyl-d,l-tryptophan (3.5±1.5mM), l-tryptophan, 1-methyl-l-tryptophan and indole-3-propionic acid. Although neither 5-hydroxy-l-tryptophan nor α-methyl-d,l-tryptophan were able to elicit inward current in PAT2-expressing oocytes both reduced the current evoked by l-proline. 5-Hydroxy-l-tryptophan and α-methyl-d,l-tryptophan were unable to trans-stimulate l-proline efflux from PAT2-expressing oocytes, confirming that the two compounds act as non-transported blockers of PAT2. These two tryptophan derivatives should prove valuable experimental tools in future investigations of the physiological roles of PAT2. Copyright © 2010 Elsevier B.V. All rights

  17. The D543N polymorphism of the SLC11A1/NRAMP1 gene is associated with treatment failure in male patients with pulmonary tuberculosis.

    Science.gov (United States)

    Salinas-Delgado, Yvain; Galaviz-Hernández, Carlos; Toral, René García; Ávila Rejón, Carmen A; Reyes-Lopez, Miguel A; Martínez, Antonio Rojas; Martínez-Aguilar, Gerardo; Sosa-Macías, Martha

    2015-09-01

    Polymorphisms in SLC11A1/NRAMP1 have shown an important association with susceptibility to tuberculosis and progression to active disease. However, whether there is an association of these polymorphisms with treatment failure is unknown. The aim of this study was to determine the association of SLC11A1 polymorphisms with treatment failure in Mexican subjects with pulmonary tuberculosis. Thirty-three subjects with treatment failure were paired by age and body mass index with 33 patients who successfully completed treatment and were considered cured. We assessed the polymorphisms of SLC11A1 in the regions of D543N and INT4 via polymerase chain reaction real-time TaqMan® single nucleotide polymorphism (SNP) genotyping. We found that D543N (G/A genotype) was associated with treatment failure in patients with pulmonary tuberculosis [odds ratio (OR) 11.61, 95% confidence interval (CI) 3.66-36.78]. When adjusted by gender, this association remained significant in males (OR 11.09, 95% CI 3.46-35.51). In our male population, the presence of the D543N polymorphism of SLC11A1 is a risk factor for treatment failure. This finding should be confirmed in other populations.

  18. Cavitation Resistance in Seedless Vascular Plants: The Structure and Function of Interconduit Pit Membranes1[W][OPEN

    Science.gov (United States)

    Brodersen, Craig; Jansen, Steven; Choat, Brendan; Rico, Christopher; Pittermann, Jarmila

    2014-01-01

    Plant water transport occurs through interconnected xylem conduits that are separated by partially digested regions in the cell wall known as pit membranes. These structures have a dual function. Their porous construction facilitates water movement between conduits while limiting the spread of air that may enter the conduits and render them dysfunctional during a drought. Pit membranes have been well studied in woody plants, but very little is known about their function in more ancient lineages such as seedless vascular plants. Here, we examine the relationships between conduit air seeding, pit hydraulic resistance, and pit anatomy in 10 species of ferns (pteridophytes) and two lycophytes. Air seeding pressures ranged from 0.8 ± 0.15 MPa (mean ± sd) in the hydric fern Athyrium filix-femina to 4.9 ± 0.94 MPa in Psilotum nudum, an epiphytic species. Notably, a positive correlation was found between conduit pit area and vulnerability to air seeding, suggesting that the rare-pit hypothesis explains air seeding in early-diverging lineages much as it does in many angiosperms. Pit area resistance was variable but averaged 54.6 MPa s m−1 across all surveyed pteridophytes. End walls contributed 52% to the overall transport resistance, similar to the 56% in angiosperm vessels and 64% in conifer tracheids. Taken together, our data imply that, irrespective of phylogenetic placement, selection acted on transport efficiency in seedless vascular plants and woody plants in equal measure by compensating for shorter conduits in tracheid-bearing plants with more permeable pit membranes. PMID:24777347

  19. Regulation of the human SLC25A20 expression by peroxisome proliferator-activated receptor alpha in human hepatoblastoma cells

    International Nuclear Information System (INIS)

    Tachibana, Keisuke; Takeuchi, Kentaro; Inada, Hirohiko; Yamasaki, Daisuke; Ishimoto, Kenji; Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko; Doi, Takefumi

    2009-01-01

    Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial β-oxidation. The peroxisome proliferator-activated receptor alpha (PPARα) is a ligand-activated transcription factor that plays an important role in the regulation of β-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPARα and found that PPARα induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPARα regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.

  20. The histidine transporter SLC15A4 coordinates mTOR-dependent inflammatory responses and pathogenic antibody production.

    Science.gov (United States)

    Kobayashi, Toshihiko; Shimabukuro-Demoto, Shiho; Yoshida-Sugitani, Reiko; Furuyama-Tanaka, Kaori; Karyu, Hitomi; Sugiura, Yuki; Shimizu, Yukiko; Hosaka, Toshiaki; Goto, Motohito; Kato, Norihiro; Okamura, Tadashi; Suematsu, Makoto; Yokoyama, Shigeyuki; Toyama-Sorimachi, Noriko

    2014-09-18

    SLC15A4 is a lysosome-resident, proton-coupled amino-acid transporter that moves histidine and oligopeptides from inside the lysosome to the cytosol of eukaryotic cells. SLC15A4 is required for Toll-like receptor 7 (TLR7)- and TLR9-mediated type I interferon (IFN-I) productions in plasmacytoid dendritic cells (pDCs) and is involved in the pathogenesis of certain diseases including lupus-like autoimmunity. How SLC15A4 contributes to diseases is largely unknown. Here we have shown that B cell SLC15A4 was crucial for TLR7-triggered IFN-I and autoantibody productions in a mouse lupus model. SLC15A4 loss disturbed the endolysosomal pH regulation and probably the v-ATPase integrity, and these changes were associated with disruption of the mTOR pathway, leading to failure of the IFN regulatory factor 7 (IRF7)-IFN-I regulatory circuit. Importantly, SLC15A4's transporter activity was necessary for the TLR-triggered cytokine production. Our findings revealed that SLC15A4-mediated optimization of the endolysosomal state is integral to a TLR7-triggered, mTOR-dependent IRF7-IFN-I circuit that leads to autoantibody production. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Regulation of the human SLC25A20 expression by peroxisome proliferator-activated receptor alpha in human hepatoblastoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Tachibana, Keisuke, E-mail: nya@phs.osaka-u.ac.jp [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Takeuchi, Kentaro; Inada, Hirohiko [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Yamasaki, Daisuke [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ishimoto, Kenji [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko [Laboratory for System Biology and Medicine, Research Center for Advanced Science and Technology, University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8904 (Japan); Doi, Takefumi [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)

    2009-11-20

    Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial {beta}-oxidation. The peroxisome proliferator-activated receptor alpha (PPAR{alpha}) is a ligand-activated transcription factor that plays an important role in the regulation of {beta}-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPAR{alpha} and found that PPAR{alpha} induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPAR{alpha} regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.

  2. L-type amino-acid transporter 1 (LAT1): a therapeutic target supporting growth and survival of T-cell lymphoblastic lymphoma/T-cell acute lymphoblastic leukemia

    NARCIS (Netherlands)

    Rosilio, C.; Nebout, M.; Imbert, V.; Griessinger, E.; Neffati, Z.; Benadiba, J.; Hagenbeek, T.; Spits, H.; Reverso, J.; Ambrosetti, D.; Michiels, J.-F.; Bailly-Maitre, B.; Endou, H.; Wempe, M. F.; Peyron, J.-F.

    2015-01-01

    The altered metabolism of cancer cells is a treasure trove to discover new antitumoral strategies. The gene (SLC7A5) encoding system L amino-acid transporter 1 (LAT1) is overexpressed in murine lymphoma cells generated via T-cell deletion of the pten tumor suppressor, and also in human T-cell acute

  3. Loss of Slc4a1b chloride/bicarbonate exchanger function protects mechanosensory hair cells from aminoglycoside damage in the zebrafish mutant persephone.

    Directory of Open Access Journals (Sweden)

    Dale W Hailey

    Full Text Available Mechanosensory hair cell death is a leading cause of hearing and balance disorders in the human population. Hair cells are remarkably sensitive to environmental insults such as excessive noise and exposure to some otherwise therapeutic drugs. However, individual responses to damaging agents can vary, in part due to genetic differences. We previously carried out a forward genetic screen using the zebrafish lateral line system to identify mutations that alter the response of larval hair cells to the antibiotic neomycin, one of a class of aminoglycoside compounds that cause hair cell death in humans. The persephone mutation confers resistance to aminoglycosides. 5 dpf homozygous persephone mutants are indistinguishable from wild-type siblings, but differ in their retention of lateral line hair cells upon exposure to neomycin. The mutation in persephone maps to the chloride/bicarbonate exchanger slc4a1b and introduces a single Ser-to-Phe substitution in zSlc4a1b. This mutation prevents delivery of the exchanger to the cell surface and abolishes the ability of the protein to import chloride across the plasma membrane. Loss of function of zSlc4a1b reduces hair cell death caused by exposure to the aminoglycosides neomycin, kanamycin, and gentamicin, and the chemotherapeutic drug cisplatin. Pharmacological block of anion transport with the disulfonic stilbene derivatives DIDS and SITS, or exposure to exogenous bicarbonate, also protects hair cells against damage. Both persephone mutant and DIDS-treated wild-type larvae show reduced uptake of labeled aminoglycosides. persephone mutants also show reduced FM1-43 uptake, indicating a potential impact on mechanotransduction-coupled activity in the mutant. We propose that tight regulation of the ionic environment of sensory hair cells, mediated by zSlc4a1b activity, is critical for their sensitivity to aminoglycoside antibiotics.

  4. Screening of SLC26A4, FOXI1, KCNJ10, and GJB2 in bilateral deafness patients with inner ear malformation.

    Science.gov (United States)

    Chen, Kaitian; Wang, Xianren; Sun, Liang; Jiang, Hongyan

    2012-06-01

    Bilateral nonsyndromic sensorineural hearing loss associated with inner ear malformation is closely related to genetics. SLC26A4 is considered to be the major involved gene. Recently, FOXI1 and KCNJ10 mutations have been linked to enlarged vestibular aqueducts and GJB2 mutations linked to temporal bone malformation. The authors aimed to investigate the mutation spectrums of these genes in Chinese patients with bilateral hearing impairment associated with inner ear malformation. Cross-sectional study. Affiliated hospital of the university. The authors analyzed the GJB2, SLC26A4, FOXI1, and KCNJ10 gene sequences in 43 patients presenting with bilateral hearing impairment associated with inner ear malformation using pyrosequencing and direct DNA sequencing. In total, 74.4% (32/43) of patients carried at least 1 of 14 pathogenic SLC26A4 mutations, including 6 novel mutations and 4 polymorphisms. Patients with enlarged vestibular aqueducts had a higher rate of SLC26A4 mutation than Mondini dysplasia patients. No FOXI1 or KCNJ10 potential pathogenic mutation was present, and GJB2 biallelic pathogenic mutations were uncommon (2.3%; 1/43). No significant correlation was observed between the genotype and phenotype of SLC26A4 mutations. SLC26A4 accounts for 74.4% of inner ear malformations in our cohort, whereas FOXI1, KCNJ10, and GJB2 mutations are not common. Other possible genes or external factors may contribute to this multibranch abnormality.

  5. Expression of RFC/SLC19A1 is associated with tumor type in bladder cancer patients.

    Directory of Open Access Journals (Sweden)

    Alyaa M Abdel-Haleem

    Full Text Available Urinary bladder cancer (UBC ranks ninth in worldwide cancer. In Egypt, the pattern of bladder cancer is unique in that both the transitional and squamous cell types prevail. Despite much research on the topic, it is still difficult to predict tumor progression, optimal therapy and clinical outcome. The reduced folate carrier (RFC/SLC19A1 is the major transport system for folates in mammalian cells and tissues. RFC is also the primary means of cellular uptake for antifolate cancer chemotherapeutic drugs, however, membrane transport of antifolates by RFC is considered as limiting to antitumor activity. The purpose of this study was to compare the mRNA expression level of RFC/SLC19A1 in urothelial and non-urothelial variants of bladder carcinomas. Quantification of RFC mRNA in the mucosa of 41 untreated bladder cancer patients was performed using RT-qPCR. RFC mRNA steady-state levels were ∼9-fold higher (N = 39; P<0.0001 in bladder tumor specimens relative to normal bladder mRNA. RFC upregulation was strongly correlated with tumor type (urothelial vs. non-urothelial; p<0.05 where median RFC mRNA expression was significantly (p<0.05 higher in the urothelial (∼14-fold compared to the non-urothelial (∼4-fold variant. This may account for the variation in response to antifolate-containing regimens used in the treatment of either type. RFC mRNA levels were not associated with tumor grade (I, II and III or stage (muscle-invasive vs. non-muscle invasive implying that RFC cannot be used for prognostic purposes in bladder carcinomas and its increased expression is an early event in human bladder tumors pathogenesis. Further, RFC can be considered as a potential marker for predicting response to antifolate chemotherapy in urothelial carcinomas.

  6. Weekly intra-amniotic IGF-1 treatment increases growth of growth-restricted ovine fetuses and up-regulates placental amino acid transporters.

    Directory of Open Access Journals (Sweden)

    Jibran A Wali

    Full Text Available Frequent treatment of the growth-restricted (IUGR ovine fetus with intra-amniotic IGF-1 increases fetal growth. We aimed to determine whether increased growth was maintained with an extended dosing interval and to examine possible mechanisms. Pregnant ewes were allocated to three groups: Control, and two IUGR groups (induced by placental embolization treated with weekly intra-amniotic injections of either saline (IUGR or 360 µg IGF-1 (IGF1. IUGR fetuses were hypoxic, hyperuremic, hypoglycemic, and grew more slowly than controls. Placental glucose uptake and SLC2A1 (GLUT2 mRNA levels decreased in IUGR fetuses, but SLC2A3 (GLUT3 and SLC2A4 (GLUT4 levels were unaffected. IGF-1 treatment increased fetal growth rate, did not alter uterine blood flow or placental glucose uptake, and increased placental SLC2A1 and SLC2A4 (but not SLC2A3 mRNA levels compared with saline-treated IUGR animals. Following IGF-1 treatment, placental mRNA levels of isoforms of the system A, y(+, and L amino acid transporters increased 1.3 to 5.0 fold, while the ratio of phosphorylated-mTOR to total mTOR also tended to increase. Weekly intra-amniotic IGF-1 treatment provides a promising avenue for intra-uterine treatment of IUGR babies, and may act via increased fetal substrate supply, up-regulating placental transporters for neutral, cationic, and branched-chain amino acids, possibly via increased activation of the mTOR pathway.

  7. Three cysteine residues of SLC52A1, a receptor for the porcine endogenous retrovirus-A (PERV-A), play a critical role in cell surface expression and infectivity.

    Science.gov (United States)

    Colon-Moran, Winston; Argaw, Takele; Wilson, Carolyn A

    2017-07-01

    Porcine endogenous retrovirus-A (PERV-A), a gammaretrovirus, infects human cells in vitro, thus raising the potential risk of cross-species transmission in xenotransplantation. Two members of the solute carrier family 52 (SLC52A1 and SLC52A2) are PERV-A receptors. Site-directed mutagenesis of the cDNA encoding SLC52A1 identified that only one of two putative glycosylation signals is occupied by glycans. In addition, we showed that glycosylation of SLC52A1 is not necessary for PERV-A receptor function. We also identified that at a minimum, three cysteine residues are sufficient for SLC52A1 cell surface expression. Mutation of cysteine at position 365 and either of the two cysteine residues in the C-terminal tail at positions 442 or 446 reduced SLC52A1 surface expression and PERV-A infection suggesting that these residues may contribute to overall structural stability and receptor function. Understanding interactions between PERV-A and its cellular receptor may provide novel strategies to prevent zoonotic infection in the setting of xenotransplantation. Published by Elsevier Inc.

  8. ρ0 Cells Feature De-Ubiquitination of SLC Transporters and Increased Levels and Fluxes of Amino Acids

    Directory of Open Access Journals (Sweden)

    André Bordinassi Medina

    2017-04-01

    Full Text Available Solute carrier (SLC transporters are a diverse group of membrane transporter proteins that regulate the cellular flux and distribution of endogenous and xenobiotic compounds. Post-translational modifications (PTMs, such as ubiquitination, have recently emerged as one of the major regulatory mechanisms in protein function and localization. Previously, we showed that SLC amino acid transporters were on average 6-fold de-ubiquitinated and increased amino acid levels were detected in ρ0 cells (lacking mitochondrial DNA, mtDNA compared to parental cells. Here, we elucidated the altered functionality of SLC transporters and their dynamic ubiquitination status by measuring the uptake of several isotopically labeled amino acids in both human osteosarcoma 143B.TK- and ρ0 cells. Our pulse chase analysis indicated that de-ubiquitinated amino acid transporters in ρ0 cells were accompanied by an increased transport rate, which leads to higher levels of amino acids in the cell. Finding SLC transport enhancers is an aim of the pharmaceutical industry in order to compensate for loss of function mutations in these genes. Thus, the ubiquitination status of SLC transporters could be an indicator for their functionality, but evidence for a direct connection between de-ubiquitination and transporter activity has to be further elucidated.

  9. Major involvement of Na(+) -dependent multivitamin transporter (SLC5A6/SMVT) in uptake of biotin and pantothenic acid by human brain capillary endothelial cells.

    Science.gov (United States)

    Uchida, Yasuo; Ito, Katsuaki; Ohtsuki, Sumio; Kubo, Yoshiyuki; Suzuki, Takashi; Terasaki, Tetsuya

    2015-07-01

    The purpose of this study was to clarify the expression of Na(+) -dependent multivitamin transporter (SLC5A6/SMVT) and its contribution to the supply of biotin and pantothenic acid to the human brain via the blood-brain barrier. DNA microarray and immunohistochemical analyses confirmed that SLC5A6 is expressed in microvessels of human brain. The absolute expression levels of SLC5A6 protein in isolated human and monkey brain microvessels were 1.19 and 0.597 fmol/μg protein, respectively, as determined by a quantitative targeted absolute proteomics technique. Using an antibody-free method established by Kubo et al. (2015), we found that SLC5A6 was preferentially localized at the luminal membrane of brain capillary endothelium. Knock-down analysis using SLC5A6 siRNA showed that SLC5A6 accounts for 88.7% and 98.6% of total [(3) H]biotin and [(3) H]pantothenic acid uptakes, respectively, by human cerebral microvascular endothelial cell line hCMEC/D3. SLC5A6-mediated transport in hCMEC/D3 was markedly inhibited not only by biotin and pantothenic acid, but also by prostaglandin E2, lipoic acid, docosahexaenoic acid, indomethacin, ketoprofen, diclofenac, ibuprofen, phenylbutazone, and flurbiprofen. This study is the first to confirm expression of SLC5A6 in human brain microvessels and to provide evidence that SLC5A6 is a major contributor to luminal uptake of biotin and pantothenic acid at the human blood-brain barrier. In humans, it was unclear (not concluded) about what transport system at the blood-brain barrier (BBB) is responsible for the brain uptakes of two vitamins, biotin and pantothenic acid, which are necessary for brain proper function. This study clarified for the first time that the solute carrier 5A6/Na(+) -dependent multivitamin transporter SLC5A6/SMVT is responsible for the supplies of biotin and pantothenic acid into brain across the BBB in humans. DHA, docosahexaenoic acid; NSAID, non-steroidal anti-inflammatory drug; PGE2, prostaglandin E2. © 2015

  10. Relevance of sodium/glucose cotransporter-1 (SGLT1) to diabetes mellitus and obesity in dogs.

    Science.gov (United States)

    Batchelor, D J; German, A J; Shirazi-Beechey, S P

    2013-04-01

    Glucose transport across the enterocyte brush border membrane by sodium/glucose cotransporter-1 (SGLT1, coded by Slc5a1) is the rate-limiting step for intestinal glucose transport. The relevance of SGLT1 expression in predisposition to diabetes mellitus and to obesity was investigated in dogs. Cultured Caco-2/TC7 cells were shown to express SGLT1 in vitro. A 2-kbp fragment of the Slc5a1 5' flanking region was cloned from canine genomic DNA, ligated into reporter gene plasmids, and shown to drive reporter gene expression in these cells above control (P obesity (Labrador retriever and cocker spaniel). The Slc5a1 5' flanking region was amplified from 10 healthy individuals of each of these breeds by high-fidelity PCR with the use of breed-labeled primers and sequenced by pyrosequencing. The sequence of the Slc5a1 5' flanking region in all individuals of all breeds tested was identical. On this evidence, variations in Slc5a1 promoter sequence between dogs do not influence the pathogenesis of diabetes mellitus or obesity in these breeds. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. SLC ir conceptual design

    International Nuclear Information System (INIS)

    Keller, L.P.

    1982-01-01

    Work on a one interaction-region, push-pull conceptual design for the SLC is described. The concept which has received the most attention is described. It is a below-ground hall - a 15 m deep rectangular pit covered by a surface building which houses counting rooms, power supplies, cryogenics and other auxiliary equipment

  12. Association between a genetic variant in the serotonin transporter gene (SLC6A4 and suicidal behavior in patients with schizophrenia

    Directory of Open Access Journals (Sweden)

    Lindholm Carlström Eva

    2012-05-01

    Full Text Available Abstract Background The serotonin (5-hydroxytryptamin; 5-HT system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT is associated with schizophrenia and suicidal behavior. In this study, we wanted to elucidate whether SLC6A4 variations is involved in attempted suicide among patients with schizophrenia in a Scandinavian case–control sample. Methods Patients diagnosed with schizophrenia from three Scandinavian samples were assessed for presence or absence of suicide attempts, based on record reviews and interview data. Seven SLC6A4 single nucleotide polymorphisms (SNPs were genotyped in 837 schizophrenia patients and 1,473 control individuals. Association analyses and statistical evaluations were performed with the program UNPHASED (version 3.0.9. Results We observed an allele association between the SNP rs16965628, located in intron one of SLC6A4, and attempted suicide (adjusted p-value 0.01, among patients with schizophrenia. No association was found to a diagnosis of schizophrenia, when patients were compared to healthy control individuals. Conclusion The gene SLC6A4 appears to be involved in suicidal ideation among patients with schizophrenia. Independent replication is needed before more firm conclusions can be drawn.

  13. Slc5a8, a Na+-coupled high-affinity transporter for short-chain fatty acids, is a conditional tumour suppressor in colon that protects against colitis and colon cancer under low-fibre dietary conditions.

    Science.gov (United States)

    Gurav, Ashish; Sivaprakasam, Sathish; Bhutia, Yangzom D; Boettger, Thomas; Singh, Nagendra; Ganapathy, Vadivel

    2015-07-15

    Mammalian colon harbours trillions of bacteria under physiological conditions; this symbiosis is made possible because of a tolerized response from the mucosal immune system. The mechanisms underlying this tolerogenic phenomenon remain poorly understood. In the present study we show that Slc5a8 (solute carrier gene family 5a, member 8), a Na(+)-coupled high-affinity transporter in colon for the bacterial fermentation product butyrate, plays a critical role in this process. Among various immune cells in colon, dendritic cells (DCs) are unique not only in their accessibility to luminal contents but also in their ability to induce tolerogenic phenotype in T-cells. We found that DCs exposed to butyrate express the immunosuppressive enzymes indoleamine 2,3-dioxygenase 1 (IDO1) and aldehyde dehydrogenase 1A2 (Aldh1A2), promote conversion of naive T-cells into immunosuppressive forkhead box P3(+) (FoxP3(+)) Tregs (regulatory T-cells) and suppress conversion of naive T-cells into pro-inflammatory interferon (IFN)-γ-producing cells. Slc5a8-null DCs do not induce IDO1 and Aldh1A2 and do not generate Tregs or suppress IFN-γ-producing T-cells in response to butyrate. We also provide in vivo evidence for an obligatory role for Slc5a8 in suppression of IFN-γ-producing T-cells. Furthermore, Slc5a8 protects against colitis and colon cancer under conditions of low-fibre intake but not when dietary fibre intake is optimal. This agrees with the high-affinity nature of the transporter to mediate butyrate entry into cells. We conclude that Slc5a8 is an obligatory link between dietary fibre and mucosal immune system via the bacterial metabolite butyrate and that this transporter is a conditional tumour suppressor in colon linked to dietary fibre content. © 2015 Authors; published by Portland Press Limited.

  14. TGF-β signaling directly regulates transcription and functional expression of the electrogenic sodium bicarbonate cotransporter 1, NBCe1 (SLC4A4), via Smad4 in mouse astrocytes.

    Science.gov (United States)

    Khakipoor, Shokoufeh; Ophoven, Christian; Schrödl-Häußel, Magdalena; Feuerstein, Melanie; Heimrich, Bernd; Deitmer, Joachim W; Roussa, Eleni

    2017-08-01

    The electrogenic sodium bicarbonate cotransporter NBCe1 (SLC4A4) expressed in astrocytes regulates intracellular and extracellular pH. Here, we introduce transforming growth factor beta (TGF-β) as a novel regulator of NBCe1 transcription and functional expression. Using hippocampal slices and primary hippocampal and cortical astrocyte cultures, we investigated regulation of NBCe1 and elucidated the underlying signaling pathways by RT-PCR, immunoblotting, immunofluorescence, intracellular H( + ) recording using the H( + ) -sensitive dye 2',7'-bis-(carboxyethyl)-5-(and-6)-carboxyfluorescein, mink lung epithelial cell (MLEC) assay, and chromatin immunoprecipitation. Activation of TGF-β signaling significantly upregulated transcript, protein, and surface expression of NBCe1. These effects were TGF-β receptor-mediated and suppressed following inhibition of JNK and Smad signaling. Moreover, 4-aminopyridine (4AP)-dependent NBCe1 regulation requires TGF-β. TGF-β increased the rate and amplitude of intracellular H + changes upon challenging NBCe1 in wild-type astrocytes but not in cortical astrocytes from Slc4a4-deficient mice. A Smad4 binding sequence was identified in the NBCe1 promoter and Smad4 binding increased after activation of TGF-β signaling. The data show for the first time that NBCe1 is a direct target of TGF-β/Smad4 signaling. Through activation of the canonical pathway TGF-β acts directly on NBCe1 by binding of Smad4 to the NBCe1 promoter and regulating its transcription, followed by increased protein expression and transport activity. © 2017 The Authors GLIA Published by Wiley Periodicals, Inc.

  15. PCFT/SLC46A1 promoter methylation and restoration of gene expression in human leukemia cells

    International Nuclear Information System (INIS)

    Gonen, Nitzan; Bram, Eran E.; Assaraf, Yehuda G.

    2008-01-01

    The proton-coupled folate transporter (PCFT/SLC46A1) displays optimal and prominent folate and antifolate transport activity at acidic pH in human carcinoma cells but poor activity in leukemia cells. Consistently herein, human leukemia cell lines expressed poor PCFT transcript levels, whereas various carcinoma cell lines showed substantial PCFT gene expression. We identified a CpG island with high density at nucleotides -200 through +100 and explored its role in PCFT promoter silencing. Leukemia cells with barely detectable PCFT transcripts consistently harbored 85-100% methylation of this CpG island, whereas no methylation was found in carcinoma cells. Treatment with 5-Aza-2'-deoxycytidine which induced demethylation but not with the histone deacetylase inhibitor trichostatin A, restored 50-fold PCFT expression only in leukemia cells. These findings constitute the first demonstration of the dominant epigenetic silencing of the PCFT gene in leukemia cells. The potential translational implications of the restoration of PCFT expression in chemotherapy of leukemia are discussed

  16. Relationship between ZnT8Ab, the SLC30A8 gene and disease progression in children with newly diagnosed type 1 diabetes

    DEFF Research Database (Denmark)

    Nielsen, Lotte B; Vaziri-Sani, Fariba; Pörksen, Sven

    2011-01-01

    Autoantibodies against the newly established autoantigen in type 1 diabetes, zinc transporter 8, ZnT8, are presented as two types, ZnT8RAb and ZnT8WAb. The rs13266634 variant of the SLC30A8 gene has recently been found to determine the type of ZnT8Ab. The aim of this study was to explore the impact...

  17. Interaction of GABA-mimetics with the taurine transporter (TauT, Slc6a6) in hyperosmotic treated caco-2, LLC-PK1 and rat renal SKPT cells

    DEFF Research Database (Denmark)

    Rasmussen, Rune Nørgaard; Lagunas, Candela; Plum, Jakob Munk

    2016-01-01

    The aim of the present study was to investigate if basic GABA-mimetics interact with the taurine transporter (TauT, Slc6a6), and to find a suitable cell based model that is robust towards extracellular changes in osmolality during uptake studies. Taurine uptake was measured in human Caco-2 cells....... Uptake of the GABA-mimetics gaboxadol and vigabatrin was investigated in SKPT cells, and quantified by liquid scintillation or HPLC-MS/MS analysis, respectively. The uptake rate of [(3)H]-taurine was Na(+) and Cl(-) and concentration dependent with taurine with an apparent Vmax of 6.3±1.6pmolcm(-2)min(-1......) and a Km of 24.9±15.0μM. β-alanine, nipecotic acid, gaboxadol, GABA, vigabatrin, δ-ALA and guvacine inhibited the taurine uptake rate in a concentration dependent manner. The order of affinity for TauT was β-alanine>GABA>nipecotic acid>guvacine>δ-ALA>vigabatrin>gaboxadol with IC50-values of 0.04, 1.07, 2...

  18. Cellular ATP synthesis mediated by type III sodium-dependent phosphate transporter Pit-1 is critical to chondrogenesis.

    Science.gov (United States)

    Sugita, Atsushi; Kawai, Shinji; Hayashibara, Tetsuyuki; Amano, Atsuo; Ooshima, Takashi; Michigami, Toshimi; Yoshikawa, Hideki; Yoneda, Toshiyuki

    2011-01-28

    Disturbed endochondral ossification in X-linked hypophosphatemia indicates an involvement of P(i) in chondrogenesis. We studied the role of the sodium-dependent P(i) cotransporters (NPT), which are a widely recognized regulator of cellular P(i) homeostasis, and the downstream events in chondrogenesis using Hyp mice, the murine homolog of human X-linked hypophosphatemia. Hyp mice showed reduced apoptosis and mineralization in hypertrophic cartilage. Hyp chondrocytes in culture displayed decreased apoptosis and mineralization compared with WT chondrocytes, whereas glycosaminoglycan synthesis, an early event in chondrogenesis, was not altered. Expression of the type III NPT Pit-1 and P(i) uptake were diminished, and intracellular ATP levels were also reduced in parallel with decreased caspase-9 and caspase-3 activity in Hyp chondrocytes. The competitive NPT inhibitor phosphonoformic acid and ATP synthesis inhibitor 3-bromopyruvate disturbed endochondral ossification with reduced apoptosis in vivo and suppressed apoptosis and mineralization in conjunction with reduced P(i) uptake and ATP synthesis in WT chondrocytes. Overexpression of Pit-1 in Hyp chondrocytes reversed P(i) uptake and ATP synthesis and restored apoptosis and mineralization. Our results suggest that cellular ATP synthesis consequent to P(i) uptake via Pit-1 plays an important role in chondrocyte apoptosis and mineralization, and that chondrogenesis is ATP-dependent.

  19. MicroRNA-20a/b regulates cholesterol efflux through post-transcriptional repression of ATP-binding cassette transporter A1.

    Science.gov (United States)

    Liang, Bin; Wang, Xin; Song, Xiaosu; Bai, Rui; Yang, Huiyu; Yang, Zhiming; Xiao, Chuanshi; Bian, Yunfei

    2017-09-01

    ATP-binding cassette transporter A1 (ABCA1) plays a crucial role in reverse cholesterol transport and exhibits anti-atherosclerosis effects. Some microRNAs (miRs) regulate ABCA1 expression, and recent studies have shown that miR-20a/b might play a critical role in atherosclerotic diseases. Here, we attempted to clarify the potential contribution of miR-20a/b in post-transcriptional regulation of ABCA1, cholesterol efflux, and atherosclerosis. We performed bioinformatics analysis and found that miR-20a/b was highly conserved and directly bound to ABCA1 mRNA with low binding free energy. Luciferase-reporter assay also confirmed that miR-20a/b significantly reduced luciferase activity associated with the ABCA1 3' untranslated region reporter construct. Additionally, miR-20a/b decreased ABCA1 expression, which, in turn, decreased cholesterol efflux and increased cholesterol content in THP-1 and RAW 264.7 macrophage-derived foam cells. In contrast, miR-20a/b inhibitors increased ABCA1 expression and cholesterol efflux, decreased cholesterol content, and inhibited foam-cell formation. Consistent with our in vitro results, miR-20a/b-treated ApoE -/- mice showed decreased ABCA1expression in the liver and reductions of reverse cholesterol transport in vivo. Furthermore, miR-20a/b regulated the formation of nascent high-density lipoprotein and promoted atherosclerotic development, whereas miR-20a/b knockdown attenuated atherosclerotic formation. miR-20 is a new miRNA capable of targeting ABCA1 and regulating ABCA1 expression. Therefore, miR-20 inhibition constitutes a new strategy for ABCA1-based treatment of atherosclerosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. The dependence receptor Ret induces apoptosis in somatotrophs through a Pit-1/p53 pathway, preventing tumor growth.

    Science.gov (United States)

    Cañibano, Carmen; Rodriguez, Noela L; Saez, Carmen; Tovar, Sulay; Garcia-Lavandeira, Montse; Borrello, Maria Grazia; Vidal, Anxo; Costantini, Frank; Japon, Miguel; Dieguez, Carlos; Alvarez, Clara V

    2007-04-18

    Somatotrophs are the only pituitary cells that express Ret, GFRalpha1 and GDNF. This study investigated the effects of Ret in a somatotroph cell line, in primary pituitary cultures and in Ret KO mice. Ret regulates somatotroph numbers by inducing Pit-1 overexpression, leading to increased p53 expression and apoptosis, both of which can be prevented with Ret or Pit-1 siRNA. The Pit-1 overexpression is mediated by sustained activation of PKCdelta, JNK, c/EBPalpha and CREB induced by a complex of Ret, caspase 3 and PKCdelta. In the presence of GDNF, Akt is activated, and the Pit-1 overexpression and resulting apoptosis are blocked. The adenopituitary of Ret KO mice is larger than normal, showing Pit-1 and somatotroph hyperplasia. In normal animals, activation of the Ret/Pit-1/p53 pathway by retroviral introduction of Ret blocked tumor growth in vivo. Thus, somatotrophs have an intrinsic mechanism for controlling Pit-1/GH production through an apoptotic/survival pathway. Ret might be of value for treatment of pituitary adenomas.

  1. Expression of solute carrier 7A4 (SLC7A4) in the plasma membrane is not sufficient to mediate amino acid transport activity.

    OpenAIRE

    Wolf, Sabine; Janzen, Annette; Vékony, Nicole; Martiné, Ursula; Strand, Dennis; Closs, Ellen I

    2002-01-01

    Member 4 of human solute carrier family 7 (SLC7A4) exhibits significant sequence homology with the SLC7 subfamily of human cationic amino acid transporters (hCATs) [Sperandeo, Borsani, Incerti, Zollo, Rossi, Zuffardi, Castaldo, Taglialatela, Andria and Sebastio (1998) Genomics 49, 230-236]. It is therefore often referred to as hCAT-4 even though no convincing transport activity has been shown for this protein. We expressed SLC7A4 in Xenopus laevis oocytes, but could not detect any transport a...

  2. Diversity in the glucose transporter-4 gene (SLC2A4 in humans reflects the action of natural selection along the old-world primates evolution.

    Directory of Open Access Journals (Sweden)

    Eduardo Tarazona-Santos

    Full Text Available BACKGROUND: Glucose is an important source of energy for living organisms. In vertebrates it is ingested with the diet and transported into the cells by conserved mechanisms and molecules, such as the trans-membrane Glucose Transporters (GLUTs. Members of this family have tissue specific expression, biochemical properties and physiologic functions that together regulate glucose levels and distribution. GLUT4 -coded by SLC2A4 (17p13 is an insulin-sensitive transporter with a critical role in glucose homeostasis and diabetes pathogenesis, preferentially expressed in the adipose tissue, heart muscle and skeletal muscle. We tested the hypothesis that natural selection acted on SLC2A4. METHODOLOGY/PRINCIPAL FINDINGS: We re-sequenced SLC2A4 and genotyped 104 SNPs along a approximately 1 Mb region flanking this gene in 102 ethnically diverse individuals. Across the studied populations (African, European, Asian and Latin-American, all the eight common SNPs are concentrated in the N-terminal region upstream of exon 7 ( approximately 3700 bp, while the C-terminal region downstream of intron 6 ( approximately 2600 bp harbors only 6 singletons, a pattern that is not compatible with neutrality for this part of the gene. Tests of neutrality based on comparative genomics suggest that: (1 episodes of natural selection (likely a selective sweep predating the coalescent of human lineages, within the last 25 million years, account for the observed reduced diversity downstream of intron 6 and, (2 the target of natural selection may not be in the SLC2A4 coding sequence. CONCLUSIONS: We propose that the contrast in the pattern of genetic variation between the N-terminal and C-terminal regions are signatures of the action of natural selection and thus follow-up studies should investigate the functional importance of different regions of the SLC2A4 gene.

  3. Additive composite ABCG2, SLC2A9 and SLC22A12 scores of high-risk alleles with alcohol use modulate gout risk.

    Science.gov (United States)

    Tu, Hung-Pin; Chung, Chia-Min; Min-Shan Ko, Albert; Lee, Su-Shin; Lai, Han-Ming; Lee, Chien-Hung; Huang, Chung-Ming; Liu, Chiu-Shong; Ko, Ying-Chin

    2016-09-01

    The aim of the present study was to evaluate the contribution of urate transporter genes and alcohol use to the risk of gout/tophi. Eight variants of ABCG2, SLC2A9, SLC22A12, SLC22A11 and SLC17A3 were genotyped in male individuals in a case-control study with 157 gout (33% tophi), 106 asymptomatic hyperuricaemia and 295 control subjects from Taiwan. The multilocus profiles of the genetic risk scores for urate gene variants were used to evaluate the risk of asymptomatic hyperuricaemia, gout and tophi. ABCG2 Q141K (T), SLC2A9 rs1014290 (A) and SLC22A12 rs475688 (C) under an additive model and alcohol use independently predicted the risk of gout (respective odds ratio for each factor=2.48, 2.03, 1.95 and 2.48). The additive composite Q141K, rs1014290 and rs475688 scores of high-risk alleles were associated with gout risk (Pgout and tophi risk (P for interaction=0.0452, 0.0033). The synergistic effect of genetic urate score 5-6 and alcohol use indicates that these combined factors correlate with gout and tophi occurrence.

  4. Impaired nutrient signaling and body weight control in a Na+ neutral amino acid cotransporter (Slc6a19)-deficient mouse.

    Science.gov (United States)

    Bröer, Angelika; Juelich, Torsten; Vanslambrouck, Jessica M; Tietze, Nadine; Solomon, Peter S; Holst, Jeff; Bailey, Charles G; Rasko, John E J; Bröer, Stefan

    2011-07-29

    Amino acid uptake in the intestine and kidney is mediated by a variety of amino acid transporters. To understand the role of epithelial neutral amino acid uptake in whole body homeostasis, we analyzed mice lacking the apical broad-spectrum neutral (0) amino acid transporter B(0)AT1 (Slc6a19). A general neutral aminoaciduria was observed similar to human Hartnup disorder which is caused by mutations in SLC6A19. Na(+)-dependent uptake of neutral amino acids into the intestine and renal brush-border membrane vesicles was abolished. No compensatory increase of peptide transport or other neutral amino acid transporters was detected. Mice lacking B(0)AT1 showed a reduced body weight. When adapted to a standard 20% protein diet, B(0)AT1-deficient mice lost body weight rapidly on diets containing 6 or 40% protein. Secretion of insulin in response to food ingestion after fasting was blunted. In the intestine, amino acid signaling to the mammalian target of rapamycin (mTOR) pathway was reduced, whereas the GCN2/ATF4 stress response pathway was activated, indicating amino acid deprivation in epithelial cells. The results demonstrate that epithelial amino acid uptake is essential for optimal growth and body weight regulation.

  5. Resistance to diet-induced obesity and associated metabolic perturbations in haploinsufficient monocarboxylate transporter 1 mice.

    OpenAIRE

    Lengacher Sylvain; Nehiri-Sitayeb Touria; Steiner Nadia; Carneiro Lionel; Favrod Céline; Preitner Frédéric; Thorens Bernard; Stehle Jean-Christophe; Dix Laure; Pralong François; Magistretti Pierre J; Pellerin Luc

    2013-01-01

    The monocarboxylate transporter 1 (MCT1 or SLC16A1) is a carrier of short-chain fatty acids, ketone bodies, and lactate in several tissues. Genetically modified C57BL/6J mice were produced by targeted disruption of the mct1 gene in order to understand the role of this transporter in energy homeostasis. Null mutation was embryonically lethal, but MCT1(+/-) mice developed normally. However, when fed high fat diet (HFD), MCT1(+/-) mice displayed resistance to development of diet-induced obesity ...

  6. Deletion of the betaine-GABA transporter (BGT1; slc6a12) gene does not affect seizure thresholds of adult mice

    DEFF Research Database (Denmark)

    Lehre, A C; Rowley, N M; Zhou, Y

    2011-01-01

    of the GAT1 by the clinically available anti-epileptic drug tiagabine has been an effective strategy for the treatment of some patients with partial seizures. Recently, the investigational drug EF1502, which inhibits both GAT1 and BGT1, was found to exert an anti-convulsant action synergistic...... to that of tiagabine, supposedly due to inhibition of BGT1. The present study addresses the role of BGT1 in seizure control and the effect of EF1502 by developing and exploring a new mouse line lacking exons 3-5 of the BGT1 (slc6a12) gene. The deletion of this sequence abolishes the expression of BGT1 mRNA. However......, homozygous BGT1-deficient mice have normal development and show seizure susceptibility indistinguishable from that in wild-type mice in a variety of seizure threshold models including: corneal kindling, the minimal clonic and minimal tonic extension seizure threshold tests, the 6Hz seizure threshold test...

  7. Structural and functional studies on the pituitary-specific transcription factor Pit-1

    NARCIS (Netherlands)

    Augustijn, K.D.

    2002-01-01

    Pit-1 is a pituitary specific transcription factor that plays a central role in the development and maintenance of a number of cell lineages in the anterior pituitary gland. In these cell lineages, Pit-1 is required for the selective expression of the growth hormone (GH), prolactin (PRL) and the

  8. Alternative transcription of sodium/bicarbonate transporter SLC4A7 gene enhanced by single nucleotide polymorphisms.

    Science.gov (United States)

    Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong

    2017-03-01

    Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.

  9. Transport mechanism and regulatory properties of the human amino acid transporter ASCT2 (SLC1A5).

    Science.gov (United States)

    Scalise, Mariafrancesca; Pochini, Lorena; Panni, Simona; Pingitore, Piero; Hedfalk, Kristina; Indiveri, Cesare

    2014-11-01

    The kinetic mechanism of the transport catalyzed by the human glutamine/neutral amino acid transporter hASCT2 over-expressed in P. pastoris was determined in proteoliposomes by pseudo-bi-substrate kinetic analysis of the Na(+)-glutamineex/glutaminein transport reaction. A random simultaneous mechanism resulted from the experimental analysis. Purified functional hASCT2 was chemically cross-linked to a stable dimeric form. The oligomeric structure correlated well with the kinetic mechanism of transport. Half-saturation constants (Km) of the transporter for the other substrates Ala, Ser, Asn and Thr were measured both on the external and internal side. External Km were much lower than the internal ones confirming the asymmetry of the transporter. The electric nature of the transport reaction was determined imposing a negative inside membrane potential generated by K(+) gradients in the presence of valinomycin. The transport reaction resulted to be electrogenic and the electrogenicity originated from external Na(+). Internal Na(+) exerted a stimulatory effect on the transport activity which could be explained by a regulatory, not a counter-transport, effect. Native and deglycosylated hASCT2 extracted from HeLa showed the same transport features demonstrating that the glycosyl moiety has no role in transport function. Both in vitro and in vivo interactions of hASCT2 with the scaffold protein PDZK1 were revealed.

  10. Substrate specificity of the electrogenic sodium/bicarbonate cotransporter NBCe1-A (SLC4A4, variant A) from humans and rabbits.

    Science.gov (United States)

    Lee, Seong-Ki; Boron, Walter F; Parker, Mark D

    2013-04-01

    In the basolateral membrane of proximal-tubule cells, NBCe1-A (SLC4A4, variant A), operating with an apparent Na(+):HCO(3)(-) stoichiometry of 1:3, contributes to the reclamation of HCO(3)(-) from the glomerular filtrate, thereby preventing whole body acidosis. Others have reported that NBCe1-like activity in human, rabbit, and rat renal preparations is substantially influenced by lithium, sulfite, oxalate, and harmaline. These data were taken as evidence for the presence of distinct Na(+) and CO(3)(2-) binding sites in NBCe1-A, favoring a model of 1 Na(+):1 HCO(3)(-):1 CO(3)(2-). Here, we reexamine these findings by expressing human or rabbit NBCe1-A clones in Xenopus oocytes. In oocytes, NBCe1-A exhibits a 1:2 stoichiometry and could operate in one of five thermodynamically equivalent transport modes: 1) cotransport of Na(+) + 2 HCO(3)(-), 2) cotransport of Na(+) + CO(3)(2-), 3) transport of NaCO(3)(-), 4) exchange of Na(+) + HCO(3)(-) for H(+), or 5) HCO(3)(-)-activated exchange of Na(+) for 2 H(+). In contrast to the behavior of NBCe1-like activity in renal preparations, we find that cloned NBCe1-A is only slightly stimulated by Li(+), not at all influenced by sulfite or oxalate, and only weakly inhibited by harmaline. These negative data do not uniquely support any of the five models above. In addition, we find that NBCe1-A mediates a small amount of Na(+)-independent NO(3)(-) transport and that NBCe1-A is somewhat inhibited by extracellular benzamil. We suggest that the features of NBCe1-like activity in renal preparations are influenced by yet-to-be-identified renal factors. Thus the actual ionic substrates of NBCe1 remain to be identified.

  11. Relationship between ZnT8Ab, the SLC30A8 gene and disease progression in children with newly diagnosed type 1 diabetes

    DEFF Research Database (Denmark)

    Nielsen, L. B.; Vaziri-Sani, F.; Porksen, S.

    2011-01-01

    Autoantibodies against the newly established autoantigen in type 1 diabetes, zinc transporter 8, ZnT8, are presented as two types, ZnT8RAb and ZnT8WAb. The rs13266634 variant of the SLC30A8 gene has recently been found to determine the type of ZnT8Ab. The aim of this study was to explore the impact......8 gene is associated with preserved beta-cell function in type 1 diabetes patients. The genetic determination of the rs13266634 variant on the ZnT8Ab specificity is sustained the first 12 months after the diagnosis of type 1 diabetes in a pediatric cohort....

  12. Cathepsin D Specifically Cleaves the Chemokines Macrophage Inflammatory Protein-1α, Macrophage Inflammatory Protein-1β, and SLC That Are Expressed in Human Breast Cancer

    Science.gov (United States)

    Wolf, Marlene; Clark-Lewis, Ian; Buri, Caroline; Langen, Hanno; Lis, Maddalena; Mazzucchelli, Luca

    2003-01-01

    Cathepsin D (Cath-D) expression in human primary breast cancer has been associated with a poor prognosis. In search of a better understanding of the Cath-D substrates possibly involved in cancer invasiveness and metastasis, we investigated the potential interactions between this protease and chemokines. Here we report that purified Cath-D, as well as culture supernatants from the human breast carcinoma cell lines MCF-7 and T47D, selectively degrade macrophage inflammatory protein (MIP)-1α (CCL3), MIP-1β (CCL4), and SLC (CCL21). Proteolysis was totally blocked by the protease inhibitor pepstatin A, and specificity of Cath-D cleavage was demonstrated using a large chemokine panel. Whereas MIP-1α and MIP-1β degradation was rapid and complete, cleavage of SLC was slow and not complete. Mass spectrometry analysis showed that Cath-D cleaves the Leu58 to Trp59 bond of SLC producing two functionally inactive fragments. Analysis of Cath-D proteolysis of a series of monocyte chemoattractant protein-3/MIP-1β hybrids indicated that processing of MIP-1β might start by cleaving off amino acids located in the C-terminal domain. In situ hybridization studies revealed MIP-1α, MIP-1β, and Cath-D gene expression mainly in the stromal compartment of breast cancers whereas SLC transcripts were found in endothelial cells of capillaries and venules within the neoplastic tissues. Cath-D production in the breast carcinoma cell lines MCF-7 and T47D, as assessed by enzyme-linked immunosorbent assay of culture supernatants and cell lysates, was not affected by stimulation with chemokines such as interleukin-8 (CXCL8), SDF-1 (CXCL12), and SLC. These data suggest that inactivation of chemokines by Cath-D possibly influences regulatory mechanisms in the tumoral extracellular microenvironment that in turn may affect the generation of the antitumoral immune response, the migration of cancer cells, or both processes. PMID:12651610

  13. Anticipation in a family with primary familial brain calcification caused by an SLC20A2 variant.

    Science.gov (United States)

    Konno, Takuya; Blackburn, Patrick R; Rozen, Todd D; van Gerpen, Jay A; Ross, Owen A; Atwal, Paldeep S; Wszolek, Zbigniew K

    2018-04-11

    To describe a family with primary familial brain calcification (PFBC) due to SLC20A2 variant showing possible genetic anticipation. We conducted historical, genealogical, clinical, and radiologic studies of a family with PFBC. Clinical evaluations including neurological examination and head computed tomography (CT) scans of a proband and her father were performed. They provided additional information regarding other family members. To identify a causative gene variant, we performed whole-exome sequencing for the proband followed by segregation analysis in other affected members using direct sequencing. In this family, nine affected members were identified over four generations. The proband suffered from chronic daily headache including thunderclap headache. We identified an SLC20A2 (c.509delT, p.(Leu170*)) variant in three affected members over three generations. Interestingly, the age of onset became younger as the disease passed through successive generations, suggestive of genetic anticipation. For clinical purpose, it is important to consider thunderclap headache and genetic anticipation in PFBC caused by SLC20A2 variants. Further investigation is required to validate our observation. Copyright © 2018 Polish Neurological Society. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  14. Downregulation of SLC7A7 Triggers an Inflammatory Phenotype in Human Macrophages and Airway Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Bianca Maria Rotoli

    2018-03-01

    Full Text Available Lysinuric protein intolerance (LPI is a recessively inherited aminoaciduria caused by mutations of SLC7A7, the gene encoding y+LAT1 light chain of system y+L for cationic amino acid transport. The pathogenesis of LPI is still unknown. In this study, we have utilized a gene silencing approach in macrophages and airway epithelial cells to investigate whether complications affecting lung and immune system are directly ascribable to the lack of SLC7A7 or, rather, mediated by an abnormal accumulation of arginine in mutated cells. When SLC7A7/y+LAT1 was silenced in human THP-1 macrophages and A549 airway epithelial cells by means of short interference RNA (siRNA, a significant induction of the expression and release of the inflammatory mediators IL1β and TNFα was observed, no matter the intracellular arginine availability. This effect was mainly regulated at transcriptional level through the activation of NFκB signaling pathway. Moreover, since respiratory epithelial cells are the important sources of chemokines in response to pro-inflammatory stimuli, the effect of IL1β has been addressed on SLC7A7 silenced A549 cells. Results obtained indicated that the downregulation of SLC7A7/y+LAT1 markedly strengthened the stimulatory effect of the cytokine on CCL5/RANTES expression and release without affecting the levels of CXCL8/IL8. Consistently, also the conditioned medium of silenced THP-1 macrophages activated airway epithelial cells in terms of CCL5/RANTES expression due to the presence of elevated amount of proinflammatory cytokines. In conclusion, our results point to a novel thus far unknown function of SLC7A7/y+LAT1, that, under physiological conditions, besides transporting arginine, may act as a brake to restrain inflammation.

  15. Lactate/pyruvate transporter MCT-1 is a direct Wnt target that confers sensitivity to 3-bromopyruvate in colon cancer.

    Science.gov (United States)

    Sprowl-Tanio, Stephanie; Habowski, Amber N; Pate, Kira T; McQuade, Miriam M; Wang, Kehui; Edwards, Robert A; Grun, Felix; Lyou, Yung; Waterman, Marian L

    2016-01-01

    There is increasing evidence that oncogenic Wnt signaling directs metabolic reprogramming of cancer cells to favor aerobic glycolysis or Warburg metabolism. In colon cancer, this reprogramming is due to direct regulation of pyruvate dehydrogenase kinase 1 ( PDK1 ) gene transcription. Additional metabolism genes are sensitive to Wnt signaling and exhibit correlative expression with PDK1. Whether these genes are also regulated at the transcriptional level, and therefore a part of a core metabolic gene program targeted by oncogenic WNT signaling, is not known. Here, we identify monocarboxylate transporter 1 (MCT-1; encoded by SLC16A1 ) as a direct target gene supporting Wnt-driven Warburg metabolism. We identify and validate Wnt response elements (WREs) in the proximal SLC16A1 promoter and show that they mediate sensitivity to Wnt inhibition via dominant-negative LEF-1 (dnLEF-1) expression and the small molecule Wnt inhibitor XAV939. We also show that WREs function in an independent and additive manner with c-Myc, the only other known oncogenic regulator of SLC16A1 transcription. MCT-1 can export lactate, the byproduct of Warburg metabolism, and it is the essential transporter of pyruvate as well as a glycolysis-targeting cancer drug, 3-bromopyruvate (3-BP). Using sulforhodamine B (SRB) assays to follow cell proliferation, we tested a panel of colon cancer cell lines for sensitivity to 3-BP. We observe that all cell lines are highly sensitive and that reduction of Wnt signaling by XAV939 treatment does not synergize with 3-BP, but instead is protective and promotes rapid recovery. We conclude that MCT-1 is part of a core Wnt signaling gene program for glycolysis in colon cancer and that modulation of this program could play an important role in shaping sensitivity to drugs that target cancer metabolism.

  16. In situ vitrification demonstration at Pit 1, Oak Ridge National Laboratory. Volume 1: Results of treatability study

    International Nuclear Information System (INIS)

    Spalding, B.P.; Naney, M.T.; Cline, S.R.; Bogle, M.A.

    1997-12-01

    A treatability study was initiated in October 1993 to apply in situ vitrification (ISV) to at least two segments of Oak Ridge National Laboratory (ORNL) seepage Pit 1 by the end of fiscal year (FY) 1995. This treatability study was later extended to include all of Pit 1 and was performed to support a possible Interim Record of Decision or removal action for closure of one or more of the seepage pits and trenches beginning as early as FY 1997. This treatability study was carried out to establish the field-scale technical performance of ISV for (1) attaining the required depth, nominally 15 ft, to incorporate source contamination within and beneath the pits; (2) demonstrating field capability for the overlap of melt settings which will be necessary to achieve fused, melted segments of the source contamination; (3) demonstrating off-gas handling technology for accommodating and minimizing the volatilization of 137 Cs; (4) demonstrating adequate site characterization techniques to predict ISV melting kinetics, processing temperatures, and product durability; and (5) promoting public acceptance of ISV technology by demonstrating its safety, implementability, site impacts, and air emissions and by coordinating the treatability study within the regulatory closure process. In April 1996 an expulsion of an estimated 10% of the 196 Mg (216 tons) melt body occurred resulting in significant damage to ISV equipment and, ultimately, led to an indefinite suspension of further ISV operations at Pit 1. This report summarizes the technical accomplishments and status of the project in fulfilling these objectives through September 1997

  17. In situ vitrification demonstration at Pit 1, Oak Ridge National Laboratory. Volume 1: Results of treatability study

    Energy Technology Data Exchange (ETDEWEB)

    Spalding, B.P.; Naney, M.T.; Cline, S.R.; Bogle, M.A. [Oak Ridge National Lab., TN (United States). Environmental Sciences Div.; Tixier, J.S. [Pacific Northwest National Lab., Richland, WA (United States)

    1997-12-01

    A treatability study was initiated in October 1993 to apply in situ vitrification (ISV) to at least two segments of Oak Ridge National Laboratory (ORNL) seepage Pit 1 by the end of fiscal year (FY) 1995. This treatability study was later extended to include all of Pit 1 and was performed to support a possible Interim Record of Decision or removal action for closure of one or more of the seepage pits and trenches beginning as early as FY 1997. This treatability study was carried out to establish the field-scale technical performance of ISV for (1) attaining the required depth, nominally 15 ft, to incorporate source contamination within and beneath the pits; (2) demonstrating field capability for the overlap of melt settings which will be necessary to achieve fused, melted segments of the source contamination; (3) demonstrating off-gas handling technology for accommodating and minimizing the volatilization of {sup 137}Cs; (4) demonstrating adequate site characterization techniques to predict ISV melting kinetics, processing temperatures, and product durability; and (5) promoting public acceptance of ISV technology by demonstrating its safety, implementability, site impacts, and air emissions and by coordinating the treatability study within the regulatory closure process. In April 1996 an expulsion of an estimated 10% of the 196 Mg (216 tons) melt body occurred resulting in significant damage to ISV equipment and, ultimately, led to an indefinite suspension of further ISV operations at Pit 1. This report summarizes the technical accomplishments and status of the project in fulfilling these objectives through September 1997.

  18. Complex analysis of urate transporters SLC2A9, SLC22A12 and functional characterization of non-synonymous allelic variants of GLUT9 in the Czech population: no evidence of effect on hyperuricemia and gout.

    Science.gov (United States)

    Hurba, Olha; Mancikova, Andrea; Krylov, Vladimir; Pavlikova, Marketa; Pavelka, Karel; Stibůrková, Blanka

    2014-01-01

    Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects). We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2) and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. We identified a total of 52 sequence variants (12 unpublished). Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.

  19. SLC52A2 [p.P141T] and SLC52A3 [p.N21S] causing Brown-Vialetto-Van Laere Syndrome in an Indian patient: First genetically proven case with mutations in two riboflavin transporters.

    Science.gov (United States)

    Udhayabanu, Tamilarasan; Subramanian, Veedamali S; Teafatiller, Trevor; Gowda, Vykuntaraju K; Raghavan, Varun S; Varalakshmi, Perumal; Said, Hamid M; Ashokkumar, Balasubramaniem

    2016-11-01

    Brown-Vialetto-Van Laere Syndrome (BVVLS), a rare neurological disorder characterized by bulbar palsies and sensorineural deafness, is mainly associated with defective riboflavin transporters encoded by the SLC52A2 and SLC52A3 genes. Here we present a 16-year-old BVVLS patient belonging to a five generation consanguineous family from Indian ethnicity with two homozygous missense mutations viz., c.421C>A [p.P141T] in SLC52A2 and c.62A>G [p.N21S] in SLC52A3. Functional characterization based on 3 H-riboflavin uptake assay and live-cell confocal imaging revealed that the effect of mutation c.421C>A [p.P141T] identified in SLC52A2 had a slight reduction in riboflavin uptake; on the other hand, the c.62A>G [p.N21S] identified in SLC52A3 showed a drastic reduction in riboflavin uptake, which appeared to be due to impaired trafficking and membrane targeting of the hRFVT-3 protein. This is the first report presenting mutations in both riboflavin transporters hRFVT-2 and hRFVT-3 in the same BVVLS patient. Also, c.62A>G [p.N21S] in SLC52A3 appears to contribute more to the disease phenotype in this patient than c.421C>A [p.P141T] in SLC52A2. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Dicty_cDB: SLC405 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT

  1. Modulation of sodium-bicarbonate co-transporter (SLC4A4/NBCe1) protein and mRNA expression in rat's uteri by sex-steroids and at different phases of the oestrous cycle.

    Science.gov (United States)

    Gholami, Khadijeh; Muniandy, Sekaran; Salleh, Naguib

    2014-02-01

    Oestrogen-induced uterine fluid sodium (Na(+)) and bicarbonate (HCO3(-)) secretion may involve SLC4A4. We hypothesized that uterine SLC4A4 expression changes under different sex-steroid influence, therefore may account for the fluctuation in uterine fluid Na(+) and HCO3(-) content throughout the oestrous cycle. The aim of this study is to investigate the differential effects of sex-steroids and oestrous cycle phases on uterine SLC4A4 expression. Adult female WKY rats were ovariectomised and treated with different doses of 17β-oestradiol (E2) (0.2, 2, 20 and 50 μg/ml/day) or progesterone (P4) (4 mg/ml/day) for three consecutive days and 3 days treatment with 0.2 μg/ml/day E2 followed by another 3 days with P4 to mimic the hormonal changes in early pregnancy. Oestrous cycle phases in intact, non-ovariectomised rats were determined by vaginal smear. The animals were then sacrificed and uteri were removed for protein and mRNA expression analyses by Western blotting and Real Time PCR, respectively. SLC4A4 distribution was observed by immunohistochemistry. Treatment with increasing E2 doses resulted in a dose-dependent increase in SLC4A4 protein expression. High SLC4A4 protein and mRNA expression can be seen at estrus. SLC4A4 is distributed mainly at the apical as well as basolateral membranes of the luminal and glandular epithelia following E2 treatment and at Es. Meanwhile, SLC4A4 expression was reduced following P4 treatment and was low at diestrus. High SLC4A4 expression under estrogen dominance may contribute to the increase in uterine fluid Na(+) and HCO3(-) content, while its low expression under P4 dominance may result in vice versa. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Recent SLC developments

    International Nuclear Information System (INIS)

    Ross, M.

    1993-04-01

    The SLAC Linear Collider (SLC) is the forerunner of a new generation of high energy accelerators. As such, it incorporates many novel features that must be fully exploited to achieve optimum performance. In this paper we present an overview of the frontiers of collider performance at SLC. Recent developments have centered on polarization, intensity and emittance preservation issues. A polarized source and spin transport system were successfully commissioned in 1992 and operated with high reliability. Practical intensity limits associated with rapid growth ( S ) bunch length instabilities have been observed in the damping rings. Ring RF voltage manipulations are used to suppress the instabilities. Emittance preservation technique development has focused on controlling system-wide instabilities and improving feedback and tuning procedures. Control of instabilities of all time scales, pulse to pulse, fast and slow, is one of the most challenging aspects of the collider. The challenge is met with (1) very high level of control and automation required for general tuning and optimization, (2) real-time transport line optical correction and monitoring, (3) coupled, high level, trajectory and energy feedback, (4) high order multipole optical correction and monitoring, (5) feedback-based linac beam emittance preservation, and (6) interaction region luminosity optimization. The common thread beneath all of these is the SLC control system which must provide a level of control, diagnosis and feedback not required for simpler machines

  3. Slc3a2 Mediates Branched-Chain Amino-Acid-Dependent Maintenance of Regulatory T Cells

    Directory of Open Access Journals (Sweden)

    Kayo Ikeda

    2017-11-01

    Full Text Available Summary: Foxp3+ regulatory T (Treg cells, which suppress immune responses, are highly proliferative in vivo. However, it remains unclear how the active replication of Treg cells is maintained in vivo. Here, we show that branched-chain amino acids (BCAAs, including isoleucine, are required for maintenance of the proliferative state of Treg cells via the amino acid transporter Slc3a2-dependent metabolic reprogramming. Mice fed BCAA-reduced diets showed decreased numbers of Foxp3+ Treg cells with defective in vivo proliferative capacity. Mice lacking Slc3a2 specifically in Foxp3+ Treg cells showed impaired in vivo replication and decreased numbers of Treg cells. Slc3a2-deficient Treg cells showed impaired isoleucine-induced activation of the mTORC1 pathway and an altered metabolic state. Slc3a2 mutant mice did not show an isoleucine-induced increase of Treg cells in vivo and exhibited multi-organ inflammation. Taken together, these findings demonstrate that BCAA controls Treg cell maintenance via Slc3a2-dependent metabolic regulation. : Treg cells regulate excess immune responses and are highly proliferative in vivo. Ikeda et al. find that branched-chain amino acids (BCAAs are essentially required to maintain expansion and the suppressive capacity of Treg cells via Slc3a2 and mTORC1. Keywords: Treg cells, amino acids, immunometabolism, immune regulation, transporter

  4. Up-Regulation of the Excitatory Amino Acid Transporters EAAT1 and EAAT2 by Mammalian Target of Rapamycin

    Directory of Open Access Journals (Sweden)

    Abeer Abousaab

    2016-11-01

    Full Text Available Background: The excitatory amino-acid transporters EAAT1 and EAAT2 clear glutamate from the synaptic cleft and thus terminate neuronal excitation. The carriers are subject to regulation by various kinases. The EAAT3 isoform is regulated by mammalian target of rapamycin (mTOR. The present study thus explored whether mTOR influences transport by EAAT1 and/or EAAT2. Methods: cRNA encoding wild type EAAT1 (SLC1A3 or EAAT2 (SLC1A2 was injected into Xenopus oocytes without or with additional injection of cRNA encoding mTOR. Dual electrode voltage clamp was performed in order to determine electrogenic glutamate transport (IEAAT. EAAT2 protein abundance was determined utilizing chemiluminescence. Results: Appreciable IEAAT was observed in EAAT1 or EAAT2 expressing but not in water injected oocytes. IEAAT was significantly increased by coexpression of mTOR. Coexpression of mTOR increased significantly the maximal IEAAT in EAAT1 or EAAT2 expressing oocytes, without significantly modifying affinity of the carriers. Moreover, coexpression of mTOR increased significantly EAAT2 protein abundance in the cell membrane. Conclusions: The kinase mTOR up-regulates the excitatory amino acid transporters EAAT1 and EAAT2.

  5. Role of the urate transporter SLC2A9 gene in susceptibility to gout in New Zealand Māori, Pacific Island, and Caucasian case-control sample sets.

    Science.gov (United States)

    Hollis-Moffatt, Jade E; Xu, Xin; Dalbeth, Nicola; Merriman, Marilyn E; Topless, Ruth; Waddell, Chloe; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B B; Stamp, Lisa K; Merriman, Tony R

    2009-11-01

    To examine the role of genetic variation in the renal urate transporter SLC2A9 in gout in New Zealand sample sets of Māori, Pacific Island, and Caucasian ancestry and to determine if the Māori and Pacific Island samples could be useful for fine-mapping. Patients (n= 56 Māori, 69 Pacific Island, and 131 Caucasian) were recruited from rheumatology outpatient clinics and satisfied the American College of Rheumatology criteria for gout. The control samples comprised 125 Māori subjects, 41 Pacific Island subjects, and 568 Caucasian subjects without arthritis. SLC2A9 single-nucleotide polymorphisms rs16890979 (V253I), rs5028843, rs11942223, and rs12510549 were genotyped (possible etiologic variants in Caucasians). Association of the major allele of rs16890979, rs11942223, and rs5028843 with gout was observed in all sample sets (P = 3.7 x 10(-7), 1.6 x 10(-6), and 7.6 x 10(-5) for rs11942223 in the Māori, Pacific Island, and Caucasian samples, respectively). One 4-marker haplotype (1/1/2/1; more prevalent in the Māori and Pacific Island control samples) was not observed in a single gout case. Our data confirm a role of SLC2A9 in gout susceptibility in a New Zealand Caucasian sample set, with the effect on risk (odds ratio >2.0) greater than previous estimates. We also demonstrate association of SLC2A9 with gout in samples of Māori and Pacific Island ancestry and a consistent pattern of haplotype association. The presence of both alleles of rs16890979 on susceptibility and protective haplotypes in the Māori and Pacific Island sample is evidence against a role for this nonsynonymous variant as the sole etiologic agent. More extensive linkage disequilibrium in Māori and Pacific Island samples suggests that Caucasian samples may be more useful for fine-mapping.

  6. SLC6A1 gene involvement in susceptibility to attention-deficit/hyperactivity disorder: A case-control study and gene-environment interaction.

    Science.gov (United States)

    Yuan, Fang-Fen; Gu, Xue; Huang, Xin; Zhong, Yan; Wu, Jing

    2017-07-03

    Attention-deficit/hyperactivity disorder (ADHD) is an early onset childhood neurodevelopmental disorder with an estimated heritability of approximately 76%. We conducted a case-control study to explore the role of the SLC6A1 gene in ADHD. The genotypes of eight variants were determined using Sequenom MassARRAY technology. The participants in the study were 302 children with ADHD and 411 controls. ADHD symptoms were assessed using the Conners Parent Symptom Questionnaire. In our study, rs2944366 was consistently shown to be associated with the ADHD risk in the dominant model (odds ratio [OR]=0.554, 95% confidence interval [CI]=0.404-0.760), and nominally associated with Hyperactive index score (P=0.027). In addition, rs1170695 has been found to be associated with the ADHD risk in the addictive model (OR=1.457, 95%CI=1.173-1.809), while rs9990174 was associated with the Hyperactive index score (P=0.010). Intriguingly, gene-environmental interactions analysis consistently revealed the potential interactions of rs1170695 with blood lead (P mul =0.044) to modify the ADHD risk. Expression quantitative trait loci analysis suggested that these positive single nucleotide polymorphisms (SNPs) may mediate SLC6A1 gene expression. Therefore, our results suggest that selected SLC6A1 gene variants may have a significant effect on the ADHD risk. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Interaction of GABA-mimetics with the taurine transporter (TauT, Slc6a6) in hyperosmotic treated Caco-2, LLC-PK1 and rat renal SKPT cells.

    Science.gov (United States)

    Rasmussen, Rune Nørgaard; Lagunas, Candela; Plum, Jakob; Holm, René; Nielsen, Carsten Uhd

    2016-01-20

    The aim of the present study was to investigate if basic GABA-mimetics interact with the taurine transporter (TauT, Slc6a6), and to find a suitable cell based model that is robust towards extracellular changes in osmolality during uptake studies. Taurine uptake was measured in human Caco-2 cells, porcine LLC-PK1 cells, and rat SKPT cells using radiolabelled taurine. Hyperosmotic conditions were obtained by incubation with raffinose (final osmolality of 500mOsm) for 24h prior to the uptake experiments. Expression of the taurine transporter, TauT, was investigated at the mRNA level by real-time PCR. Uptake of the GABA-mimetics gaboxadol and vigabatrin was investigated in SKPT cells, and quantified by liquid scintillation or HPLC-MS/MS analysis, respectively. The uptake rate of [(3)H]-taurine was Na(+) and Cl(-) and concentration dependent with taurine with an apparent Vmax of 6.3±1.6pmolcm(-2)min(-1) and a Km of 24.9±15.0μM. β-alanine, nipecotic acid, gaboxadol, GABA, vigabatrin, δ-ALA and guvacine inhibited the taurine uptake rate in a concentration dependent manner. The order of affinity for TauT was β-alanine>GABA>nipecotic acid>guvacine>δ-ALA>vigabatrin>gaboxadol with IC50-values of 0.04, 1.07, 2.02, 4.19, 4.94, 31.4 and 39.9mM, respectively. In conclusion, GABA mimetics inhibited taurine uptake in hyperosmotic rat renal SKPT cells. SKPT cells, which seem to be a useful model for investigating taurine transport in the short-term presence of high concentrations of osmolytes. Furthermore, analogues of β-alanine appear to have higher affinities for TauT than GABA-analogues. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Association of serotonin transporter (SLC6A4 & receptor (5HTR1A, 5HTR2A polymorphisms with response to treatment with escitalopram in patients with major depressive disorder : A preliminary study

    Directory of Open Access Journals (Sweden)

    Aniruddha Basu

    2015-01-01

    Full Text Available Background & objectives: Genetic factors have potential of predicting response to antidepressants in patients with major depressive disorder (MDD. In this study, an attempt was made to find an association between response to escitalopram in patients with MDD, and serotonin transporter (SLC6A4 and receptor (5HTR1A, 5HTR2A polymorphisms. Methods: Fifty five patients diagnosed as suffering from MDD, were selected for the study. The patients were treated with escitalopram over a period of 6-8 wk. Severity of depression, response to treatment and side effects were assessed using standardised instruments. Genetic variations from HTR1A (rs6295, HTR2A (rs6311 and rs6313 and SLC6A4 (44 base-pair insertion/deletion at 5-HTTLPR were genotyped. The genetic data of the responders and non-responders were compared to assess the role of genetic variants in therapeutic outcome. Results: Thirty six (65.5% patients responded to treatment, and 19 (34.5% had complete remission. No association was observed for genotype and allelic frequencies of single nucleotide polymorphisms (SNPs among remitter/non-remitter and responder/non-responder groups, and six most common side-effects, except memory loss which was significantly associated with rs6311 ( p0 =0.03. Interpretation & conclusions: No significant association was found between the SNPs analysed and response to escitalopram in patients with MDD though a significant association was seen between the side effect of memory loss and rs6311. Studies with larger sample are required to find out genetic basis of antidepressant response in Indian patients.

  9. Software Modules for the Proximity-1 Space Link Interleaved Time Synchronization (PITS) Protocol

    Science.gov (United States)

    Woo, Simon S.; Veregge, John R.; Gao, Jay L.; Clare, Loren P.; Mills, David

    2012-01-01

    The Proximity-1 Space Link Interleaved Time Synchronization (PITS) protocol provides time distribution and synchronization services for space systems. A software prototype implementation of the PITS algorithm has been developed that also provides the test harness to evaluate the key functionalities of PITS with simulated data source and sink. PITS integrates time synchronization functionality into the link layer of the CCSDS Proximity-1 Space Link Protocol. The software prototype implements the network packet format, data structures, and transmit- and receive-timestamp function for a time server and a client. The software also simulates the transmit and receive-time stamp exchanges via UDP (User Datagram Protocol) socket between a time server and a time client, and produces relative time offsets and delay estimates.

  10. Characterization of Organic Anion Transporter 2 (SLC22A7): A Highly Efficient Transporter for Creatinine and Species-Dependent Renal Tubular Expression.

    Science.gov (United States)

    Shen, Hong; Liu, Tongtong; Morse, Bridget L; Zhao, Yue; Zhang, Yueping; Qiu, Xi; Chen, Cliff; Lewin, Anne C; Wang, Xi-Tao; Liu, Guowen; Christopher, Lisa J; Marathe, Punit; Lai, Yurong

    2015-07-01

    The contribution of organic anion transporter OAT2 (SLC22A7) to the renal tubular secretion of creatinine and its exact localization in the kidney are reportedly controversial. In the present investigation, the transport of creatinine was assessed in human embryonic kidney (HEK) cells that stably expressed human OAT2 (OAT2-HEK) and isolated human renal proximal tubule cells (HRPTCs). The tubular localization of OAT2 in human, monkey, and rat kidney was characterized. The overexpression of OAT2 significantly enhanced the uptake of creatinine in OAT2-HEK cells. Under physiologic conditions (creatinine concentrations of 41.2 and 123.5 µM), the initial rate of OAT2-mediated creatinine transport was approximately 11-, 80-, and 80-fold higher than OCT2, multidrug and toxin extrusion protein (MATE)1, and MATE2K, respectively, resulting in approximately 37-, 1850-, and 80-fold increase of the intrinsic transport clearance when normalized to the transporter protein concentrations. Creatinine intracellular uptake and transcellular transport in HRPTCs were decreased in the presence of 50 µM bromosulfophthalein and 100 µM indomethacin, which inhibited OAT2 more potently than other known creatinine transporters, OCT2 and multidrug and toxin extrusion proteins MATE1 and MATE2K (IC50: 1.3 µM vs. > 100 µM and 2.1 µM vs. > 200 µM for bromosulfophthalein and indomethacin, respectively) Immunohistochemistry analysis showed that OAT2 protein was localized to both basolateral and apical membranes of human and cynomolgus monkey renal proximal tubules, but appeared only on the apical membrane of rat proximal tubules. Collectively, the findings revealed the important role of OAT2 in renal secretion and possible reabsorption of creatinine and suggested a molecular basis for potential species difference in the transporter handling of creatinine. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.

  11. An Inverse Relationship Links Temperature and Substrate Apparent Affinity in the Ion-Coupled Cotransporters rGAT1 and KAAT1

    Directory of Open Access Journals (Sweden)

    Antonio Peres

    2012-11-01

    Full Text Available The effects of temperature on the operation of two ion-coupled cotransporters of the SLC6A family, namely rat GAT1 (SLC6A1 and KAAT1 (SLC6A19 from Manduca sexta, have been studied by electrophysiological means in Xenopus laevis oocytes expressing these proteins. The maximal transport-associated current (Imax and the apparent substrate affinity (K05 were measured. In addition to the expected increase in transport rate (Q10 = 3–6, both transporters showed greater K05 values (i.e., a decrease in apparent affinity at higher temperatures. The transport efficiency, estimated as Imax/K05, increased at negative potentials in both transporters, but did not show statistically significant differences with temperature. The observation that the apparent substrate affinity is inversely related to the transport rate suggests a kinetic regulation of this parameter. Furthermore, the present results indicate that the affinities estimated at room temperature for mammalian cotransporters may not be simply extrapolated to their physiological operating conditions.

  12. Dicty_cDB: SLC492 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT

  13. Dicty_cDB: SLC432 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA

  14. The cataract and glucosuria associated monocarboxylate transporter MCT12 is a new creatine transporter

    Science.gov (United States)

    Abplanalp, Jeannette; Laczko, Endre; Philp, Nancy J.; Neidhardt, John; Zuercher, Jurian; Braun, Philipp; Schorderet, Daniel F.; Munier, Francis L.; Verrey, François; Berger, Wolfgang; Camargo, Simone M.R.; Kloeckener-Gruissem, Barbara

    2013-01-01

    Creatine transport has been assigned to creatine transporter 1 (CRT1), encoded by mental retardation associated SLC6A8. Here, we identified a second creatine transporter (CRT2) known as monocarboxylate transporter 12 (MCT12), encoded by the cataract and glucosuria associated gene SLC16A12. A non-synonymous alteration in MCT12 (p.G407S) found in a patient with age-related cataract (ARC) leads to a significant reduction of creatine transport. Furthermore, Slc16a12 knockout (KO) rats have elevated creatine levels in urine. Transport activity and expression characteristics of the two creatine transporters are distinct. CRT2 (MCT12)-mediated uptake of creatine was not sensitive to sodium and chloride ions or creatine biosynthesis precursors, breakdown product creatinine or creatine phosphate. Increasing pH correlated with increased creatine uptake. Michaelis–Menten kinetics yielded a Vmax of 838.8 pmol/h/oocyte and a Km of 567.4 µm. Relative expression in various human tissues supports the distinct mutation-associated phenotypes of the two transporters. SLC6A8 was predominantly found in brain, heart and muscle, while SLC16A12 was more abundant in kidney and retina. In the lens, the two transcripts were found at comparable levels. We discuss the distinct, but possibly synergistic functions of the two creatine transporters. Our findings infer potential preventive power of creatine supplementation against the most prominent age-related vision impaired condition. PMID:23578822

  15. Correction of the first order beam transport of the SLC Arcs

    International Nuclear Information System (INIS)

    Walker, N.; Barklow, T.; Emma, P.; Krejcik, P.

    1991-05-01

    Correction of the first order transport of the SLC Arcs has been made possible by a technique which allows the full 4x4 transport matrix across any section of Arc to be experimentally determined. By the introduction of small closed bumps into each achromat, it is possible to substantially correct first order optical errors, and notably the cross plane coupling at the exit of the Arcs. 4 refs., 3 figs

  16. Association of SLC11A1 gene polymorphism with caprine ...

    Indian Academy of Sciences (India)

    Navya

    2017-01-16

    Jan 16, 2017 ... RESEARCH ARTICLE. Evaluation of the ..... Nramp2 (Slc11a2) expressed at the plasma membrane. Blood, 102 ... Received 21 November 2016, in final revised form 11 January 2017; accepted 12 January 2017. Unedited ...

  17. The zinc transporter SLC39A13/ZIP13 is required for connective tissue development; its involvement in BMP/TGF-beta signaling pathways.

    Directory of Open Access Journals (Sweden)

    Toshiyuki Fukada

    Full Text Available BACKGROUND: Zinc (Zn is an essential trace element and it is abundant in connective tissues, however biological roles of Zn and its transporters in those tissues and cells remain unknown. METHODOLOGY/PRINCIPAL FINDINGS: Here we report that mice deficient in Zn transporter Slc39a13/Zip13 show changes in bone, teeth and connective tissue reminiscent of the clinical spectrum of human Ehlers-Danlos syndrome (EDS. The Slc39a13 knockout (Slc39a13-KO mice show defects in the maturation of osteoblasts, chondrocytes, odontoblasts, and fibroblasts. In the corresponding tissues and cells, impairment in bone morphogenic protein (BMP and TGF-beta signaling were observed. Homozygosity for a SLC39A13 loss of function mutation was detected in sibs affected by a unique variant of EDS that recapitulates the phenotype observed in Slc39a13-KO mice. CONCLUSIONS/SIGNIFICANCE: Hence, our results reveal a crucial role of SLC39A13/ZIP13 in connective tissue development at least in part due to its involvement in the BMP/TGF-beta signaling pathways. The Slc39a13-KO mouse represents a novel animal model linking zinc metabolism, BMP/TGF-beta signaling and connective tissue dysfunction.

  18. Inhibitors of GLUT/SLC2A Enhance the Action of BCNU and Temozolomide against High-Grade Gliomas

    Directory of Open Access Journals (Sweden)

    Alberto Azzalin

    2017-04-01

    Full Text Available Glucose transport across glioblastoma membranes plays a crucial role in maintaining the enhanced glycolysis typical of high-grade gliomas and glioblastoma. We tested the ability of two inhibitors of the glucose transporters GLUT/SLC2A superfamily, indinavir (IDV and ritonavir (RTV, and of one inhibitor of the Na/glucose antiporter type 2 (SGLT2/SLC5A2 superfamily, phlorizin (PHZ, in decreasing glucose consumption and cell proliferation of human and murine glioblastoma cells. We found in vitro that RTV, active on at least three different GLUT/SLC2A transporters, was more effective than IDV, a specific inhibitor of GLUT4/SLC2A4, both in decreasing glucose consumption and lactate production and in inhibiting growth of U87MG and Hu197 human glioblastoma cell lines and primary cultures of human glioblastoma. PHZ was inactive on the same cells. Similar results were obtained when cells were grown in adherence or as 3D multicellular tumor spheroids. RTV treatment but not IDV treatment induced AMP-activated protein kinase (AMPKα phosphorylation that paralleled the decrease in glycolytic activity and cell growth. IDV, but not RTV, induced an increase in GLUT1/SLC2A1 whose activity could compensate for the inhibition of GLUT4/SLC2A4 by IDV. RTV and IDV pass poorly the blood brain barrier and are unlikely to reach sufficient liquoral concentrations in vivo to inhibit glioblastoma growth as single agents. Isobologram analysis of the association of RTV or IDV and 1,3-bis(2-chloroethyl-1-nitrosourea (BCNU or 4-methyl-5-oxo-2,3,4,6,8-pentazabicyclo[4.3.0]nona-2,7,9-triene-9-carboxamide (TMZ indicated synergy only with RTV on inhibition of glioblastoma cells. Finally, we tested in vivo the combination of RTV and BCNU on established GL261 tumors. This drug combination increased the overall survival and allowed a five-fold reduction in the dose of BCNU.

  19. Estradiol-induced regulation of GLUT4 in 3T3-L1 cells: involvement of ESR1 and AKT activation.

    Science.gov (United States)

    Campello, Raquel S; Fátima, Luciana A; Barreto-Andrade, João Nilton; Lucas, Thais F; Mori, Rosana C; Porto, Catarina S; Machado, Ubiratan F

    2017-10-01

    Impaired insulin-stimulated glucose uptake involves reduced expression of the GLUT4 (solute carrier family 2 facilitated glucose transporter member 4, SLC2A4 gene). 17β-estradiol (E 2 ) modulates SLC2A4 /GLUT4 expression, but the involved mechanisms are unclear. Although E 2 exerts biological effects by binding to estrogen receptors 1/2 (ESR1/2), which are nuclear transcriptional factors; extranuclear effects have also been proposed. We hypothesize that E 2 regulates GLUT4 through an extranuclear ESR1 mechanism. Thus, we investigated the effects of E 2 upon (1) subcellular distribution of ESRs and the proto-oncogene tyrosine-protein kinases (SRC) involvement; (2) serine/threonine-protein kinase (AKT) activation; (3) Slc2a4 /GLUT4 expression and (4) GLUT4 subcellular distribution and glucose uptake in 3T3-L1 adipocytes. Differentiated 3T3-L1 adipocytes were cultivated or not with E 2 for 24 h, and additionally treated or not with ESR1-selective agonist (PPT), ESR1-selective antagonist (MPP) or selective SRC inhibitor (PP2). Subcellular distribution of ESR1, ESR2 and GLUT4 was analyzed by immunocytochemistry; Slc2a4 mRNA and GLUT4 were quantified by qPCR and Western blotting, respectively; plasma membrane GLUT4 translocation and glucose uptake were analyzed under insulin stimulus for 20 min or not. E 2 induced (1) translocation of ESR1, but not of ESR2, from nucleus to plasma membrane and AKT phosphorylation, effects mimicked by PPT and blocked by MPP and PP2; (2) increased Slc2a4 /GLUT4 expression and (3) increased insulin-stimulated GLUT4 translocation and glucose uptake. In conclusion, E 2 treatment promoted a SRC-mediated nucleus-plasma membrane shuttle of ESR1, and increased AKT phosphorylation, Slc2a4 /GLUT4 expression and plasma membrane GLUT4 translocation; consequently, improving insulin-stimulated glucose uptake. These results unravel mechanisms through which estrogen improves insulin sensitivity. © 2017 Society for Endocrinology.

  20. Complex analysis of urate transporters SLC2A9, SLC22A12 and functional characterization of non-synonymous allelic variants of GLUT9 in the Czech population: no evidence of effect on hyperuricemia and gout.

    Directory of Open Access Journals (Sweden)

    Olha Hurba

    Full Text Available OBJECTIVE: Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. METHODS: The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects. We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2 and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. RESULTS: We identified a total of 52 sequence variants (12 unpublished. Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. CONCLUSION: Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.

  1. Immuno-detection of OCTN1 (SLC22A4) in HeLa cells and characterization of transport function.

    Science.gov (United States)

    Pochini, Lorena; Scalise, Mariafrancesca; Indiveri, Cesare

    2015-11-01

    OCTN1 was immuno-detected in the cervical cancer cell HeLa, in which the complete pattern of acetylcholine metabolizing enzymes is expressed. Comparison of immuno-staining intensity of HeLa OCTN1 with the purified recombinant human OCTN1 allowed measuring the specific OCTN1 concentration in the HeLa cell extract and, hence calculating the HeLa OCTN1 specific transport activity that was about 10 nmol×min(-1)×mg protein(-1), measured as uptake of [(3)H]acetylcholine in proteoliposomes reconstituted with HeLa extract. This value was very similar to the specific activity of the recombinant protein. Acetylcholine transport was suppressed by incubation of the protein or proteoliposomes with the anti-OCTN1 antibody and was strongly inhibited by PLP and MTSEA, known inhibitors of OCTN1. The absence of ATP in the internal side of proteoliposomes strongly impaired transport function of both the HeLa and, as expected, the recombinant OCTN1. HeLa OCTN1 was inhibited by spermine, NaCl (Na(+)), TEA, γ-butyrobetaine, choline, acetylcarnitine and ipratropium but not by neostigmine. Besides acetylcholine, choline was taken up by HeLa OCTN1 proteoliposomes. The transporter catalyzed also acetylcholine and choline efflux which, differently from uptake, was not inhibited by MTSEA. Time course of [(3)H]acetylcholine uptake in intact HeLa cells was measured. As in proteoliposomes, acetylcholine transport in intact cells was inhibited by TEA and NaCl. Efflux of [(3)H]acetylcholine occurred in intact cells, as well. The experimental data concur in demonstrating a role of OCTN1 in transporting acetylcholine and choline in HeLa cells. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Intestinal drug transport via the proton-coupled amino acid transporter PAT1 (SLC36A1) is inhibited by Gly-X(aa) dipeptides

    DEFF Research Database (Denmark)

    Frølund, Sidsel; Langthaler, Louise; Kall, Morten A

    2012-01-01

    -Sar as substrates of the amino acid transporter PAT1. The aim of the present study is to investigate if other Gly-containing dipeptides interact with PAT1, and whether they can inhibit PAT1 mediated drug absorption, in vitro and in vivo. The in vitro methods included two-electrode voltage clamp measurements on h...... of different dipeptides. The in vivo part consisted of a pharmacokinetic study in rats following oral administration of gaboxadol and preadministration of 200 mg/kg dipeptide. The results showed that in hPAT1 expressing oocytes Gly-Tyr, Gly-Pro, and Gly-Phe inhibited currents induced by drug substances......, the present study identifies selected dipeptides as inhibitors of PAT1 mediated drug absorption in various in vitro models....

  3. OCT2 and MATE1 Provide Bi-directional Agmatine Transport

    Science.gov (United States)

    Winter, Tate N.; Elmquist, William F.; Fairbanks, Carolyn A.

    2015-01-01

    Agmatine is a biogenic amine (l-arginine metabolite) of potential relevance to several central nervous system (CNS) conditions. The identities of transporters underlying agmatine and polyamine disposition in mammalian systems are not well defined. The SLC-family organic cation transporters (OCT) OCT1 and OCT2 and multidrug and toxin extrusion transporter-1 (MATE1) are transport systems that may be of importance for the cellular disposition of agmatine and putrescine. We investigated the transport of [3H]-agmatine and [3H]-putrescine in human embryonic kidney (HEK293) cells stably-transfected with hOCT1-, hOCT2-, and hMATE1. Agmatine transport by hOCT1 and hOCT2 was concentration-dependent, whereas only hOCT2 demonstrated pH-dependent transport. hOCT2 exhibited a greater affinity for agmatine (Km = 1.84 ± 0.38 mM) than did hOCT1 (Km = 18.73 ± 4.86 mM). Putrescine accumulation was pH- and concentration-dependent in hOCT2-HEK cells (Km = 11.29 ± 4.26 mM) but not hOCT1-HEK cells. Agmatine accumulation, in contrast to putrescine, was significantly enhanced by hMATE1 over-expression, and was saturable (Km = 240 ± 31 μM; Vmax = 192 ± 10 pmol/min/mg protein). Intracellular agmatine was also trans-stimulated (effluxed) from hMATE1-HEK cells in the presence of an inward proton-gradient. The hMATE1-mediated transport of agmatine was inhibited by polyamines, the prototypical substrates MPP+ and paraquat, as well as guanidine and arcaine, but not l-arginine. These results suggest that agmatine disposition may be influenced by hOCT2 and hMATE1, two transporters critical in the renal elimination of xenobiotic compounds. PMID:21128598

  4. PCR-RFLP analyses for studying the diversity of GH and Pit-1 genes in Slovak Simmental cattle

    Directory of Open Access Journals (Sweden)

    Anna Trakovická

    2013-10-01

    Full Text Available The aim of this study was evaluation of growth hormone (GH and specific pituitary transcription factor (Pit-1 genes diversity in population of 353 Slovak Simmental cows. The analyses were based on single nucleotide polymorphisms GH/AluI and Pit-1/HinfI detections. A polymorphic site of GH gene (AluI has been linked to differences in circulating metabolites, metabolic hormones and milk yield. Bovine Pit-1 is responsible for pituitary development and hormone secreting gene expression, including GH gene. The Pit-1/HinfI locus was associated with growth, milk production and reproduction performance in cattle. Samples of genomic DNA were analyzed by PCR-RFLP method. Digestion of GH gene PCR products with restriction enzyme AluI revealed allele L and V with frequency 0.695 and 0.305, respectively. The digested Pit-1 gene PCR products with enzyme HinfI revealed alleles A (0.249 and B (0.751. Dominant genotypes were for GH gene heterozygous LV (0.47 and for Pit-1 gene homozygous BB (0.56 animals. The observed heterozygosity, effective allele numbers and polymorphism information content of GH/AluI and Pit-1/HinfI bovine loci population were 0.42/0.37, 1.73/1.59 and 0.33/0.30, respectively. The median polymorphic information content of loci was also transferred to the higher observed homozygosity in population (0.58/0.63. Keywords: cattle, growth hormone, leptin, PCR, Pit-1, polymorphism.

  5. Physiology of SLC12 transporters: lessons from inherited human genetic mutations and genetically engineered mouse knockouts.

    Science.gov (United States)

    Gagnon, Kenneth B; Delpire, Eric

    2013-04-15

    Among the over 300 members of the solute carrier (SLC) group of integral plasma membrane transport proteins are the nine electroneutral cation-chloride cotransporters belonging to the SLC12 gene family. Seven of these transporters have been functionally described as coupling the electrically silent movement of chloride with sodium and/or potassium. Although in silico analysis has identified two additional SLC12 family members, no physiological role has been ascribed to the proteins encoded by either the SLC12A8 or the SLC12A9 genes. Evolutionary conservation of this gene family from protists to humans confirms their importance. A wealth of physiological, immunohistochemical, and biochemical studies have revealed a great deal of information regarding the importance of this gene family to human health and disease. The sequencing of the human genome has provided investigators with the capability to link several human diseases with mutations in the genes encoding these plasma membrane proteins. The availability of bacterial artificial chromosomes, recombination engineering techniques, and the mouse genome sequence has simplified the creation of targeting constructs to manipulate the expression/function of these cation-chloride cotransporters in the mouse in an attempt to recapitulate some of these human pathologies. This review will summarize the three human disorders that have been linked to the mutation/dysfunction of the Na-Cl, Na-K-2Cl, and K-Cl cotransporters (i.e., Bartter's, Gitleman's, and Andermann's syndromes), examine some additional pathologies arising from genetically modified mouse models of these cotransporters including deafness, blood pressure, hyperexcitability, and epithelial transport deficit phenotypes.

  6. Potential for food-drug interactions by dietary phenolic acids on human organic anion transporters 1 (SLC22A6), 3 (SLC22A8), and 4 (SLC22A11).

    Science.gov (United States)

    Wang, Li; Sweet, Douglas H

    2012-10-15

    Phenolic acids exert beneficial health effects such as anti-oxidant, anti-carcinogenic, and anti-inflammatory activities and show systemic exposure after consumption of common fruits, vegetables, and beverages. However, knowledge regarding which components convey therapeutic benefits and the mechanism(s) by which they cross cell membranes is extremely limited. Therefore, we determined the inhibitory effects of nine food-derived phenolic acids, p-coumaric acid, ferulic acid, gallic acid, gentisic acid, 4-hydroxybenzoic acid, protocatechuic acid, sinapinic acid, syringic acid, and vanillic acid, on human organic anion transporter 1 (hOAT1), hOAT3, and hOAT4. In the present study, inhibition of OAT-mediated transport of prototypical substrates (1 μM) by phenolic acids (100 μM) was examined in stably expressing cell lines. All compounds significantly inhibited hOAT3 transport, while just ferulic, gallic, protocatechuic, sinapinic, and vanillic acid significantly blocked hOAT1 activity. Only sinapinic acid inhibited hOAT4 (~35%). For compounds exhibiting inhibition > ~60%, known clinical plasma concentration levels and plasma protein binding in humans were examined to select compounds to evaluate further with dose-response curves (IC(50) values) and drug-drug interaction (DDI) index determinations. IC(50) values ranged from 1.24 to 18.08 μM for hOAT1 and from 7.35 to 87.36 μM for hOAT3. Maximum DDI indices for gallic and gentisic acid (≫0.1) indicated a very strong potential for DDIs on hOAT1 and/or hOAT3. This study indicates that gallic acid from foods or supplements, or gentisic acid from salicylate-based drug metabolism, may significantly alter the pharmacokinetics (efficacy and toxicity) of concomitant therapeutics that are hOAT1 and/or hOAT3 substrates. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Single Amino Acid Insertion in Loop 4 Confers Amphotropic Murine Leukemia Virus Receptor Function upon Murine Pit1

    DEFF Research Database (Denmark)

    Lundorf, Mikkel D.; Pedersen, Finn Skou; O'Hara, Bryan

    1998-01-01

    Pit1 is the human receptor for gibbon ape leukemia virus (GALV) and feline leukemia virus subgroup B (FeLV-B), while the related human protein Pit2 is a receptor for amphotropic murine leukemia virus (A-MuLV). The A-MuLV-related isolate 10A1 can utilize both Pit1 and Pit2 as receptors. A stretch...

  8. Dicty_cDB: SLC411 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e

  9. Burkholderia pseudomallei Evades Nramp1 (Slc11a1- and NADPH Oxidase-Mediated Killing in Macrophages and Exhibits Nramp1-Dependent Virulence Gene Expression

    Directory of Open Access Journals (Sweden)

    Veerachat Muangsombut

    2017-08-01

    Full Text Available Bacterial survival in macrophages can be affected by the natural resistance-associated macrophage protein 1 (Nramp1; also known as solute carrier family 11 member a1 or Slc11a1 which localizes to phagosome membranes and transports divalent cations, including iron. Little is known about the role of Nramp1 in Burkholderia infection, in particular whether this differs for pathogenic species like Burkholderia pseudomallei causing melioidosis or non-pathogenic species like Burkholderia thailandensis. Here we show that transfected macrophages stably expressing wild-type Nramp1 (Nramp1+ control the net replication of B. thailandensis, but not B. pseudomallei. Control of B. thailandensis was associated with increased cytokine responses, and could be abrogated by blocking NADPH oxidase-mediated production of reactive oxygen species but not by blocking generation of reactive nitrogen species. The inability of Nramp1+ macrophages to control B. pseudomallei was associated with rapid escape of bacteria from phagosomes, as indicated by decreased co-localization with LAMP1 compared to B. thailandensis. A B. pseudomallei bipB mutant impaired in escape from phagosomes was controlled to a greater extent than the parent strain in Nramp1+ macrophages, but was also attenuated in Nramp1− cells. Consistent with reduced escape from phagosomes, B. thailandensis formed fewer multinucleated giant cells in Nramp1+ macrophages at later time points compared to B. pseudomallei. B. pseudomallei exhibited elevated transcription of virulence-associated genes of Type VI Secretion System cluster 1 (T6SS-1, the Bsa Type III Secretion System (T3SS-3 and the bimA gene required for actin-based motility in Nramp1+ macrophages. Nramp1+ macrophages were found to contain decreased iron levels that may impact on expression of such genes. Our data show that B. pseudomallei is able to evade Nramp1- and NADPH oxidase-mediated killing in macrophages and that expression of virulence

  10. SLC and SLD: Experimental experience with a linear collider

    International Nuclear Information System (INIS)

    Breidenbach, M.

    1993-08-01

    The SLAC Linear Collider (SLC) is the prototype e + e - linear collider. This talk will consist of an introduction to SLC, a description of the strategy for luminosity, a description of the systems for the transport and measurement of the polarized electrons, and a description of the present performance of the SLC and planned upgrades. The detector, SLD, and the status of the polarization asymmetry measurement A LR will be described

  11. Dicty_cDB: SLC424 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA

  12. Active Hydrophilic Components of the Medicinal Herb Salvia miltiorrhiza (Danshen Potently Inhibit Organic Anion Transporters 1 (Slc22a6 and 3 (Slc22a8

    Directory of Open Access Journals (Sweden)

    Li Wang

    2012-01-01

    Full Text Available Many active components of herbal products are small organic anions, and organic anion transporters were previously demonstrated to be a potential site of drug-drug interactions. In this study, we assessed the inhibitory effects of six hydrophilic components of the herbal medicine Danshen, lithospermic acid, protocatechuic acid, rosmarinic acid, salvianolic acid A, salvianolic acid B, and tanshinol, on the function of the murine organic anion transporters, mOat1 and mOat3. All of Danshen components significantly inhibited mOat1- and mOat3-mediated substrate uptake (<0.001 with lithospermic acid (LSA, protocatechuic acid, rosmarinic acid (RMA, and salvianolic acid A (SAA producing virtually complete inhibition under test conditions. Kinetic analysis demonstrated that LSA, RMA, and SAA were competitive inhibitors. As such, values were estimated as 14.9±4.9 μM for LSA, 5.5±2.2 μM for RMA, and 4.9±2.2 μM for SAA on mOat1-mediated transport, and as 31.1±7.0 μM for LSA, 4.3±0.2 μM for RMA, and 21.3±7.7 μM for SAA on mOat3-mediated transport. These data suggest that herb-drug interactions may occur in vivo on the human orthologs of these transporters in situations of polypharmacy involving Danshen and clinical therapeutics known to be organic anion transporter substrates.

  13. Neutron transport by TRIPOLI-2 code in the lower part of a PWR pit and in the pit-access cell

    International Nuclear Information System (INIS)

    Vergnaud, T.; Bourdet, L.; Gonnord, J.; Nimal, J.C.; Champion, G.

    1984-09-01

    The neutrons, which exit the reactor vessel, leak between the reactor vessel and the primary concrete shield and provide high dose rate in the lower part of the reactor pit. In this part of the reactor the biological shield is reduced at the level of the pit-access cell door and of the ventilation duct. Consequently there is a pin-point increase of dose rate at reactor place where access must be free during power operation. Studies concern 900 MWe and 1300 MWe plants; calculation results are compared with dose rate measurements which have been done at several interesting points of reactor. Neutron transport is studied in two steps: - first Monte Carlo calculation carried out by the TRIPOLI-2 system gives the current of neutrons entering into the pit-access cell; - a second calculation is about neutron transport in this cell; it is also performed with the TRIPOLI-2 code which uses a very realistic model for cell geometry. Then the door efficiency is evaluated by a SN one dimension code

  14. CryoEM structure of the human SLC4A4 sodium-coupled acid-base transporter NBCe1.

    Science.gov (United States)

    Huynh, Kevin W; Jiang, Jiansen; Abuladze, Natalia; Tsirulnikov, Kirill; Kao, Liyo; Shao, Xuesi; Newman, Debra; Azimov, Rustam; Pushkin, Alexander; Zhou, Z Hong; Kurtz, Ira

    2018-03-02

    Na + -coupled acid-base transporters play essential roles in human biology. Their dysfunction has been linked to cancer, heart, and brain disease. High-resolution structures of mammalian Na + -coupled acid-base transporters are not available. The sodium-bicarbonate cotransporter NBCe1 functions in multiple organs and its mutations cause blindness, abnormal growth and blood chemistry, migraines, and impaired cognitive function. Here, we have determined the structure of the membrane domain dimer of human NBCe1 at 3.9 Å resolution by cryo electron microscopy. Our atomic model and functional mutagenesis revealed the ion accessibility pathway and the ion coordination site, the latter containing residues involved in human disease-causing mutations. We identified a small number of residues within the ion coordination site whose modification transformed NBCe1 into an anion exchanger. Our data suggest that symporters and exchangers utilize comparable transport machinery and that subtle differences in their substrate-binding regions have very significant effects on their transport mode.

  15. Dicty_cDB: SLC481 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS

  16. Imaging the L-type amino acid transporter-1 (LAT1 with Zr-89 immunoPET.

    Directory of Open Access Journals (Sweden)

    Oluwatayo F Ikotun

    Full Text Available The L-type amino acid transporter-1 (LAT1, SLC7A5 is upregulated in a wide range of human cancers, positively correlated with the biological aggressiveness of tumors, and a promising target for both imaging and therapy. Radiolabeled amino acids such as O-(2-[(18F]fluoroethyl-L-tyrosine (FET that are transport substrates for system L amino acid transporters including LAT1 have met limited success for oncologic imaging outside of the brain, and thus new strategies are needed for imaging LAT1 in systemic cancers. Here, we describe the development and biological evaluation of a novel zirconium-89 labeled antibody, [(89Zr]DFO-Ab2, targeting the extracellular domain of LAT1 in a preclinical model of colorectal cancer. This tracer demonstrated specificity for LAT1 in vitro and in vivo with excellent tumor imaging properties in mice with xenograft tumors. PET imaging studies showed high tumor uptake, with optimal tumor-to-non target contrast achieved at 7 days post administration. Biodistribution studies demonstrated tumor uptake of 10.5 ± 1.8 percent injected dose per gram (%ID/g at 7 days with a tumor to muscle ratio of 13 to 1. In contrast, the peak tumor uptake of the radiolabeled amino acid [(18F]FET was 4.4 ± 0.5 %ID/g at 30 min after injection with a tumor to muscle ratio of 1.4 to 1. Blocking studies with unlabeled anti-LAT1 antibody demonstrated a 55% reduction of [(89Zr]DFO-Ab2 accumulation in the tumor at 7 days. These results are the first report of direct PET imaging of LAT1 and demonstrate the potential of immunoPET agents for imaging specific amino acid transporters.

  17. Prevention of the disrupted enamel phenotype in Slc4a4-null mice using explant organ culture maintained in a living host kidney capsule.

    Directory of Open Access Journals (Sweden)

    Xin Wen

    Full Text Available Slc4a4-null mice are a model of proximal renal tubular acidosis (pRTA. Slc4a4 encodes the electrogenic sodium base transporter NBCe1 that is involved in transcellular base transport and pH regulation during amelogenesis. Patients with mutations in the SLC4A4 gene and Slc4a4-null mice present with dysplastic enamel, amongst other pathologies. Loss of NBCe1 function leads to local abnormalities in enamel matrix pH regulation. Loss of NBCe1 function also results in systemic acidemic blood pH. Whether local changes in enamel pH and/or a decrease in systemic pH are the cause of the abnormal enamel phenotype is currently unknown. In the present study we addressed this question by explanting fetal wild-type and Slc4a4-null mandibles into healthy host kidney capsules to study enamel formation in the absence of systemic acidemia. Mandibular E11.5 explants from NBCe1-/- mice, maintained in host kidney capsules for 70 days, resulted in teeth with enamel and dentin with morphological and mineralization properties similar to cultured NBCe1+/+ mandibles grown under identical conditions. Ameloblasts express a number of proteins involved in dynamic changes in H+/base transport during amelogenesis. Despite the capacity of ameloblasts to dynamically modulate the local pH of the enamel matrix, at least in the NBCe1-/- mice, the systemic pH also appears to contribute to the enamel phenotype. Extrapolating these data to humans, our findings suggest that in patients with NBCe1 mutations, correction of the systemic metabolic acidosis at a sufficiently early time point may lead to amelioration of enamel abnormalities.

  18. Impact of genetic polymorphisms of SLC2A2, SLC2A5, and KHK on metabolic phenotypes in hypertensive individuals.

    Directory of Open Access Journals (Sweden)

    MyPhuong T Le

    Full Text Available In the past few decades, consumption of added sugars has increased dramatically. Studies have linked high sugar intake with increased risk for a number of diseases. Importantly, fructose, a component of sugar, has been linked with the development of features of metabolic syndrome. This study determined if single nucleotide polymorphisms in genes involved in fructose transport (solute carrier family 2 facilitated glucose transporter, member 2 (SLC2A2 and solute carrier family 2 facilitated glucose/fructose transporter, member 5 (SLC2A5 and metabolism (ketohexokinase (KHK affect inter-individual variability in metabolic phenotypes, such as increased serum uric acid levels.The influence of SLC2A2, SLC2A5, and KHK SNPs on metabolic phenotypes was tested in 237 European Americans and 167 African Americans from the Pharmacogenomic Evaluation and Antihypertensive Responses (PEAR study. Using baseline untreated fasting data, associations were considered significant if p≤0.005. These SNPs were then evaluated for potential replication (p≤0.05 using data from the Genetic Epidemiology of Responses to Antihypertensives (GERA studies.SLC2A5 rs5438 was associated with an increase in serum uric acid in European American males. However, we were unable to replicate the association in GERA. The minor allele of SLC2A2 rs8192675 showed an association with lower high-density lipoproteins in European Americans (A/A: 51.0 mg/dL, A/G: 47.0 mg/dL, G/G: 41.5 mg/dL, p = 0.0034 in PEAR. The association between rs8192675 and lower high-density lipoproteins was replicated in the combined European American GERA study samples (A/A: 47.6 mg/dL, A/G: 48.6 mg/dL, G/G: 41.9 mg/dL, p = 0.0315.The association between SLC2A2 rs8192675 and high-density lipoproteins suggests the polymorphism may play a role in influencing high-density lipoproteins and thus metabolic risk of cardiovascular disease.

  19. Up-Regulation of Excitatory Amino Acid Transporters EAAT1 and EAAT2 by ß-Klotho

    Directory of Open Access Journals (Sweden)

    Jamshed Warsi

    2015-12-01

    Full Text Available Background/Aims: Klotho, a transmembrane protein expressed in chorioid plexus of the brain, kidney, and several other tissues, is required for inhibition of 1,25(OH2D3 formation by FGF23. The extracellular domain of Klotho protein could be cleaved off, thus being released into blood or cerebrospinal fluid. At least in part by exerting β-glucuronidase activity, soluble klotho regulates several ion channels and carriers. Klotho protein deficiency accelerates the appearance of age related disorders including neurodegeneration and muscle wasting and eventually leads to premature death. The present study explored the effect of Klotho protein on the excitatory glutamate transporters EAAT1 (SLC1A3 and EAAT2 (SLC1A2, Na+ coupled carriers clearing excitatory amino acids from the synaptic cleft and thus participating in the regulation of neuronal excitability. Methods: cRNA encoding EAAT1 or EAAT2 was injected into Xenopus laevis oocytes and glutamate (2 mM-induced inward current (IGlu taken as measure of glutamate transport. Measurements were made without or with prior 24 h treatment with soluble ß-Klotho protein (30 ng/ml in the absence and presence of β-glucuronidase inhibitor D-saccharic acid 1,4-lactone monohydrate (DSAL,10 µM. Results: IGlu was observed in EAAT1 and in EAAT2 expressing oocytes but not in water injected oocytes. In both, EAAT1 and EAAT2 expressing oocytes IGlu was significantly increased by treatment with soluble ß-Klotho protein, an effect reversed by DSAL. Treatment with ß-klotho protein increased significantly the maximal transport rate without significantly modifying the affinity of the carriers. Conclusion: ß-Klotho up-regulates the excitatory glutamate transporters EAAT1 and EAAT2 and thus participates in the regulation of neuronal excitation.

  20. Hypotonic activation of the myo-inositol transporter SLC5A3 in HEK293 cells probed by cell volumetry, confocal and super-resolution microscopy.

    Directory of Open Access Journals (Sweden)

    Joseph Andronic

    Full Text Available Swelling-activated pathways for myo-inositol, one of the most abundant organic osmolytes in mammalian cells, have not yet been identified. The present study explores the SLC5A3 protein as a possible transporter of myo-inositol in hyponically swollen HEK293 cells. To address this issue, we examined the relationship between the hypotonicity-induced changes in plasma membrane permeability to myo-inositol P ino [m/s] and expression/localization of SLC5A3. P ino values were determined by cell volumetry over a wide tonicity range (100-275 mOsm in myo-inositol-substituted solutions. While being negligible under mild hypotonicity (200-275 mOsm, P ino grew rapidly at osmolalities below 200 mOsm to reach a maximum of ∼ 3 nm/s at 100-125 mOsm, as indicated by fast cell swelling due to myo-inositol influx. The increase in P ino resulted most likely from the hypotonicity-mediated incorporation of cytosolic SLC5A3 into the plasma membrane, as revealed by confocal fluorescence microscopy of cells expressing EGFP-tagged SLC5A3 and super-resolution imaging of immunostained SLC5A3 by direct stochastic optical reconstruction microscopy (dSTORM. dSTORM in hypotonic cells revealed a surface density of membrane-associated SLC5A3 proteins of 200-2000 localizations/μm2. Assuming SLC5A3 to be the major path for myo-inositol, a turnover rate of 80-800 myo-inositol molecules per second for a single transporter protein was estimated from combined volumetric and dSTORM data. Hypotonic stress also caused a significant upregulation of SLC5A3 gene expression as detected by semiquantitative RT-PCR and Western blot analysis. In summary, our data provide first evidence for swelling-mediated activation of SLC5A3 thus suggesting a functional role of this transporter in hypotonic volume regulation of mammalian cells.

  1. Dicty_cDB: SLC419 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4

  2. Dicty_cDB: SLC409 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4

  3. Dynamic Interactions between Pit-1 and C/EBPα in the Pituitary Cell Nucleus▿

    OpenAIRE

    Demarco, Ignacio A.; Voss, Ty C.; Booker, Cynthia F.; Day, Richard N.

    2006-01-01

    The homeodomain (HD) transcription factors are a structurally conserved family of proteins that, through networks of interactions with other nuclear proteins, control patterns of gene expression during development. For example, the network interactions of the pituitary-specific HD protein Pit-1 control the development of anterior pituitary cells and regulate the expression of the hormone products in the adult cells. Inactivating mutations in Pit-1 disrupt these processes, giving rise to the s...

  4. Dicty_cDB: SLC451 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4

  5. Flat beams in the SLC

    International Nuclear Information System (INIS)

    Adolphsen, C.; Barklow, T.; Burke, D.; Decker, F.J.; Emma, P.; Hildreth, M.; Himel, T.; Krejcik, P.; Limberg, T.; Minty, M.

    1993-01-01

    The Stanford Linear Collider was designed to operate with round beams; horizontal and vertical emittance made equal in the damping rings. The main motivation was to facilitate the optical matching through beam lines with strong coupling elements like the solenoid spin rotator magnets and the SLC arcs. Tests in 1992 showed that open-quote flat close-quote beams with a vertical to horizontal emittance ratio of around 1/10 can be successfully delivered to the end of the linac. Techniques developed to measure and control the coupling of the SLC arcs allow These beams to be transported to the Interaction Point (IP). Before flat beams could be used for collisions with polarized electrons, a new method of rotating the electron spin orientation with vertical arc orbit bumps had to be developed. Early in the 1993 run, the SLC was switched to open-quote flat close-quote beam operation. Within a short time the peak luminosity of the previous running cycle was reached and then surpassed. The average daily luminosity is now a factor of about two higher than the best achieved last year. In the following the authors present an overview of the problems encountered and their solutions for different parts of the SLC

  6. Dicty_cDB: SLC494 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4

  7. Dicty_cDB: SLC418 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4

  8. 200 West Area Ash Pit Demolition Site closure plan. Revision 1

    International Nuclear Information System (INIS)

    Ruck, F.R.

    1994-01-01

    The Ash Pit Demolition Site had two known demolition events, the first occurred in November of 1984, and the second occurred in June of 1986. These demolition events were a form of thermal treatment for discarded explosive chemical products. Because the Ash Pit Demolition Site will no longer be used for this thermal activity, the site will be closed. Closure will be conducted pursuant to the requirements of the Washington State Department of Ecology (Ecology) ''Dangerous Waste Regulations'', Washington Administrative Code (WAC) 173-303-610 and 40 Code of Federal Regulations (CFR) 270.1. The 200 West Area Ash Pit Demolition Site Closure Plan consists of a Part A, Form 3, Dangerous Waste Permit Application (Revision 4) and a closure plan. An explanation of the Part A, Form 3, submitted with this closure plan is provided at the beginning of the Part A Section. The closure plan consists of nine chapters and five appendices. This closure plan presents a description of the Ash,Pit Demolition Site, the history of the waste treated, and the approach that will be followed to close the Ash Pit Demolition Site. Because there were no radioactively contaminated chemicals involved in the demolitions, the information on radionuclides is provided for ''information only''. Remediation of any radioactive contamination is not within the scope of this closure plan. Only dangerous constituents derived from Ash Pit Demolition Site operations will be addressed in this closure plan in accordance with WAC 173-303-610(2)(b)(i)

  9. Association study of serotonin transporter SLC6A4 gene with Chinese Han irritable bowel syndrome.

    Directory of Open Access Journals (Sweden)

    Jing Yuan

    Full Text Available OBJECTIVE: Irritable bowel syndrome (IBS is a common clinical gastrointestinal dysfunction disorders. 5-sertonon (5-hydroxytryptamine, 5-HT is a very important neurotransmitter, which is involved in gastrointestinal motion and sensation. Solute carrier family 6 member 4 (SLC6A4 gene encode serotonin transporter (SERT which function is to rapidly reuptake the most of 5-HT. Therefore, it is needed to explore the association between SLC6A4 gene polymorphisms and IBS. METHODS: 119 patients and 238 healthy controls were administrated to detect the SLC6A4 gene polymorphisms including 5-HT-transporter-gene-linked polymorphic region (5-HTTLPR, variable number of tandem repeats (VNTRs and three selected tag Single Nucleotide Polymorphisms (SNPs rs1042173, rs3794808, rs2020936 by using polymerase chain reaction (PCR and TaqMan® SNP Genotyping. RESULTS: There were significant difference for 5-HTTLPR between IBS and control groups (X2 = 106.168, P<0.0001. In control group, genotypes were mainly L/L (58.4%, however, the genotypes in IBS were S/S (37.8%. The significant difference was shown in D-IBS subjects when compared to the controls (X(2 = 50.850, P<0.0001 for 5-HTTLPR. For STin2 VNTR, rs1042173, rs3794808, and rs2020936 polymorphisms, there were no any significant differences between IBS and control groups. There were no statistical significantly haplotypes for 5-HTTLPR, VNTRs and the three SNPs between IBS and controls. CONCLUSION: The S allele in 5-HTTLPR was a susceptible allele with Chinese Han IBS, but other associations of VNTRs, three selected Tag SNPs and positive haplotype with IBS were not found. It is indicated that much research are needed to study the relationship between other polymorphisms in SLC6A4 gene and IBS.

  10. Association between norepinephrine transporter gene (SLC6A2) polymorphisms and suicide in patients with major depressive disorder.

    Science.gov (United States)

    Kim, Yong-Ku; Hwang, Jung-A; Lee, Heon-Jeong; Yoon, Ho-Kyoung; Ko, Young-Hoon; Lee, Bun-Hee; Jung, Han-Yong; Hahn, Sang-Woo; Na, Kyoung-Sae

    2014-04-01

    Although several studies have investigated possible associations between norepinephrine neurotransmitter transporter gene (SLC6A2) polymorphisms and depression, few studies have examined associations between SLC6A2 polymorphisms and suicide. Three single-nucleotide polymorphisms (rs2242446, rs28386840, and rs5569) were measured in 550 patients: 201 with major depressive disorder (MDD) and suicide attempt/s, 160 with MDD without suicide attempts, and 189 healthy controls. Analysis of single-nucleotide polymorphisms (SNPs) and haplotype was conducted for the three groups. Subsequently, multivariate logistic regression analysis adjusting for age and gender was conducted to identify independent influences of each SNP. A possible association between suicide lethality and SLC6A2 polymorphisms was also investigated. In the genotype and allele frequency analysis, there were significant differences in rs28386840 between suicidal MDD patients and healthy controls. In the haplotype analysis, TAA (rs2242446-rs28386840-rs5569, from left to right) was associated with suicide attempts in MDD, although the significance (p=0.043) disappeared after Bonferroni correction. There were no relationships between lethality scores and SLC6A2 polymorphisms in suicidal MDD. Modest sample size and a single type of neurotransmitter analyzed (norepinephrine) are the primary limitations. Our results suggest that SLC6A2 polymorphisms were associated with suicide risk in patients with MDD. Future studies are warranted to elucidate possible mechanisms by which SLC6A2 polymorphisms influence suicide risk. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Insights into the Structure, Function, and Ligand Discovery of the Large Neutral Amino Acid Transporter 1, LAT1

    Directory of Open Access Journals (Sweden)

    Natesh Singh

    2018-04-01

    Full Text Available The large neutral amino acid transporter 1 (LAT1, or SLC7A5 is a sodium- and pH-independent transporter, which supplies essential amino acids (e.g., leucine, phenylalanine to cells. It plays an important role at the Blood–Brain Barrier (BBB where it facilitates the transport of thyroid hormones, pharmaceuticals (e.g., l-DOPA, gabapentin, and metabolites into the brain. Moreover, its expression is highly upregulated in various types of human cancer that are characterized by an intense demand for amino acids for growth and proliferation. Therefore, LAT1 is believed to be an important drug target for cancer treatment. With the crystallization of the arginine/agmatine antiporter (AdiC from Escherichia Coli, numerous homology models of LAT1 have been built to elucidate the substrate binding site, ligand–transporter interaction, and structure–function relationship. The use of these models in combination with molecular docking and experimental testing has identified novel chemotypes of ligands of LAT1. Here, we highlight the structure, function, transport mechanism, and homology modeling of LAT1. Additionally, results from structure–function studies performed on LAT1 are addressed, which have enhanced our knowledge of the mechanism of substrate binding and translocation. This is followed by a discussion on ligand- and structure-based approaches, with an emphasis on elucidating the molecular basis of LAT1 inhibition. Finally, we provide an exhaustive summary of different LAT1 inhibitors that have been identified so far, including the recently discovered irreversible covalent inhibitors.

  12. Dicty_cDB: SLC431 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4

  13. Dicty_cDB: SLC465 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG

  14. Dicty_cDB: SLC426 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG

  15. Dicty_cDB: SLC461 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu

  16. Dicty_cDB: SLC437 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.

  17. Dicty_cDB: SLC433 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4

  18. Dicty_cDB: SLC441 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2

  19. Dicty_cDB: SLC487 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4

  20. Genetic variation of the GLUT10 glucose transporter (SLC2A10) and relationships to type 2 diabetes and intermediary traits

    DEFF Research Database (Denmark)

    Andersen, Gitte; Rose, Christian Schack; Hamid, Yasmin Hassan

    2003-01-01

    The SLC2A10 gene encodes the GLUT10 facilitative glucose transporter, which is expressed in high amounts in liver and pancreas. The gene is mapped to chromosome 20q12-q13.1, a region that has been shown to be linked to type 2 diabetes. The gene was examined in 61 Danish type 2 diabetic patients......, and a total of six variants (-27C-->T, Ala206Thr, Ala272Ala, IVS2 + 10G-->A, IVS4 + 18T-->G, and IVS4 + 26G-->A) were identified and investigated in an association study, which included 503 type 2 diabetic patients and 510 glucose-tolerant control subjects. None of the variants were associated with type 2...... substantially to the pathogenesis of type 2 diabetes in the examined study population. However, the codon 206 polymorphism may be related to the interindividual variation in fasting and oral glucose-induced serum insulin levels....

  1. Dicty_cDB: SLC440 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA

  2. Intramolecular cross-linking in a bacterial homolog of mammalian SLC6 neurotransmitter transporters suggests an evolutionary conserved role of transmembrane segments 7 and 8

    DEFF Research Database (Denmark)

    Kniazeff, Julie; Loland, Claus Juul; Goldberg, Naomi

    2005-01-01

    The extracellular concentration of the neurotransmitters dopamine, serotonin, norepinephrine, GABA and glycine is tightly controlled by plasma membrane transporters belonging to the SLC6 gene family. A very large number of putative transport proteins with a remarkable homology to the SLC6...... proximity between TM 7 and 8 in the tertiary structure of TnaT as previously suggested for the mammalian counterparts. Furthermore, the inhibition of uptake upon cross-linking the two cysteines provides indirect support for a conserved conformational role of these transmembrane domains in the transport...

  3. SLC polarized beam source electron optics design

    International Nuclear Information System (INIS)

    Eppley, K.R.; Lavine, T.L.; Early, R.A.; Herrmannsfeldt, W.B.; Miller, R.H.; Schultz, D.C.; Spencer, C.M.; Yeremian, A.D.

    1991-05-01

    This paper describes the design of the beam-line from the polarized electron gun to the linac injector in the Stanford Linear Collider (SLC). The polarized electron source is a GaAs photocathode, requiring 10 -11 -Torr-range pressure for adequate quantum efficiency and longevity. The photocathode is illuminated by 3-nsec-long laser pulses. The quality of the optics for the 160-kV beam is crucial since electron-stimulated gas desorption from beam loss in excess of 0.1% of the 20-nC pulses may poison the photocathode. Our design for the transport line consists of a differential pumping region isolated by a pair of valves. Focusing is provided by a pair of Helmholtz coils and by several iron-encased solenoidal lenses. Our optics design is based on beam transport simulations using 2 1/2-D particle-in-cell codes to model the gun and to solve the fully-relativistic time-dependent equations of motion in three dimensions for electrons in the presence of azimuthally symmetric electromagnetic fields. 6 refs., 6 figs

  4. Cystinuria Associated with Different SLC7A9 Gene Variants in the Cat.

    Directory of Open Access Journals (Sweden)

    Keijiro Mizukami

    Full Text Available Cystinuria is a classical inborn error of metabolism characterized by a selective proximal renal tubular defect affecting cystine, ornithine, lysine, and arginine (COLA reabsorption, which can lead to uroliths and urinary obstruction. In humans, dogs and mice, cystinuria is caused by variants in one of two genes, SLC3A1 and SLC7A9, which encode the rBAT and bo,+AT subunits of the bo,+ basic amino acid transporter system, respectively. In this study, exons and flanking regions of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA of cats (Felis catus with COLAuria and cystine calculi. Relative to the Felis catus-6.2 reference genome sequence, DNA sequences from these affected cats revealed 3 unique homozygous SLC7A9 missense variants: one in exon 5 (p.Asp236Asn from a non-purpose-bred medium-haired cat, one in exon 7 (p.Val294Glu in a Maine Coon and a Sphinx cat, and one in exon 10 (p.Thr392Met from a non-purpose-bred long-haired cat. A genotyping assay subsequently identified another cystinuric domestic medium-haired cat that was homozygous for the variant originally identified in the purebred cats. These missense variants result in deleterious amino acid substitutions of highly conserved residues in the bo,+AT protein. A limited population survey supported that the variants found were likely causative. The remaining 2 sequenced domestic short-haired cats had a heterozygous variant at a splice donor site in intron 10 and a homozygous single nucleotide variant at a branchpoint in intron 11 of SLC7A9, respectively. This study identifies the first SLC7A9 variants causing feline cystinuria and reveals that, as in humans and dogs, this disease is genetically heterogeneous in cats.

  5. Nutrient transport in the mammary gland: calcium, trace minerals and water soluble vitamins.

    Science.gov (United States)

    Montalbetti, Nicolas; Dalghi, Marianela G; Albrecht, Christiane; Hediger, Matthias A

    2014-03-01

    Milk nutrients are secreted by epithelial cells in the alveoli of the mammary gland by several complex and highly coordinated systems. Many of these nutrients are transported from the blood to the milk via transcellular pathways that involve the concerted activity of transport proteins on the apical and basolateral membranes of mammary epithelial cells. In this review, we focus on transport mechanisms that contribute to the secretion of calcium, trace minerals and water soluble vitamins into milk with particular focus on the role of transporters of the SLC series as well as calcium transport proteins (ion channels and pumps). Numerous members of the SLC family are involved in the regulation of essential nutrients in the milk, such as the divalent metal transporter-1 (SLC11A2), ferroportin-1 (SLC40A1) and the copper transporter CTR1 (SLC31A1). A deeper understanding of the physiology and pathophysiology of these transporters will be of great value for drug discovery and treatment of breast diseases.

  6. Increased NBCn1 expression, Na+/ HCO 3 ? co-transport and intracellular pH in human vascular smooth muscle cells with a risk allele for hypertension

    OpenAIRE

    Ng, Fu Liang; Boedtkjer, Ebbe; Witkowska, Kate; Ren, Meixia; Zhang, Ruoxin; Tucker, Arthur; Aalkj?r, Christian; Caulfield, Mark J.; Ye, Shu

    2017-01-01

    Abstract Genome-wide association studies have revealed an association between variation at the SLC4A7 locus and blood pressure. SLC4A7 encodes the electroneutral Na+/ HCO 3 ? co-transporter NBCn1 which regulates intracellular pH (pH i ). We conducted a functional study of variants at this locus in primary cultures of vascular smooth muscle and endothelial cells. In both cell types, we found genotype-dependent differences for rs13082711 in DNA-nuclear protein interactions, where the risk allel...

  7. Somatotropinomas, but not nonfunctioning pituitary adenomas, maintain a functional apoptotic RET/Pit1/ARF/p53 pathway that is blocked by excess GDNF.

    Science.gov (United States)

    Diaz-Rodriguez, Esther; Garcia-Rendueles, Angela R; Ibáñez-Costa, Alejandro; Gutierrez-Pascual, Ester; Garcia-Lavandeira, Montserrat; Leal, Alfonso; Japon, Miguel A; Soto, Alfonso; Venegas, Eva; Tinahones, Francisco J; Garcia-Arnes, Juan A; Benito, Pedro; Angeles Galvez, Maria; Jimenez-Reina, Luis; Bernabeu, Ignacio; Dieguez, Carlos; Luque, Raul M; Castaño, Justo P; Alvarez, Clara V

    2014-11-01

    Acromegaly is caused by somatotroph cell adenomas (somatotropinomas [ACROs]), which secrete GH. Human and rodent somatotroph cells express the RET receptor. In rodents, when normal somatotrophs are deprived of the RET ligand, GDNF (Glial Cell Derived Neurotrophic Factor), RET is processed intracellularly to induce overexpression of Pit1 [Transcription factor (gene : POUF1) essential for transcription of Pituitary hormones GH, PRL and TSHb], which in turn leads to p19Arf/p53-dependent apoptosis. Our purpose was to ascertain whether human ACROs maintain the RET/Pit1/p14ARF/p53/apoptosis pathway, relative to nonfunctioning pituitary adenomas (NFPAs). Apoptosis in the absence and presence of GDNF was studied in primary cultures of 8 ACROs and 3 NFPAs. Parallel protein extracts were analyzed for expression of RET, Pit1, p19Arf, p53, and phospho-Akt. When GDNF deprived, ACRO cells, but not NFPAs, presented marked level of apoptosis that was prevented in the presence of GDNF. Apoptosis was accompanied by RET processing, Pit1 accumulation, and p14ARF and p53 induction. GDNF prevented all these effects via activation of phospho-AKT. Overexpression of human Pit1 (hPit1) directly induced p19Arf/p53 and apoptosis in a pituitary cell line. Using in silico studies, 2 CCAAT/enhancer binding protein alpha (cEBPα) consensus-binding sites were found to be 100% conserved in mouse, rat, and hPit1 promoters. Deletion of 1 cEBPα site prevented the RET-induced increase in hPit1 promoter expression. TaqMan qRT-PCR (real time RT-PCR) for RET, Pit1, Arf, TP53, GDNF, steroidogenic factor 1, and GH was performed in RNA from whole ACRO and NFPA tumors. ACRO but not NFPA adenomas express RET and Pit1. GDNF expression in the tumors was positively correlated with RET and negatively correlated with p53. In conclusion, ACROs maintain an active RET/Pit1/p14Arf/p53/apoptosis pathway that is inhibited by GDNF. Disruption of GDNF's survival function might constitute a new therapeutic route in

  8. LAPTM4b recruits the LAT1-4F2hc Leu transporter to lysosomes and promotes mTORC1 activation.

    Science.gov (United States)

    Milkereit, Ruth; Persaud, Avinash; Vanoaica, Liviu; Guetg, Adriano; Verrey, Francois; Rotin, Daniela

    2015-05-22

    Mammalian target of rapamycin 1 (mTORC1), a master regulator of cellular growth, is activated downstream of growth factors, energy signalling and intracellular essential amino acids (EAAs) such as Leu. mTORC1 activation occurs at the lysosomal membrane, and involves V-ATPase stimulation by intra-lysosomal EAA (inside-out activation), leading to activation of the Ragulator, RagA/B-GTP and mTORC1 via Rheb-GTP. How Leu enters the lysosomes is unknown. Here we identified the lysosomal protein LAPTM4b as a binding partner for the Leu transporter, LAT1-4F2hc (SLC7A5-SLAC3A2). We show that LAPTM4b recruits LAT1-4F2hc to lysosomes, leading to uptake of Leu into lysosomes, and is required for mTORC1 activation via V-ATPase following EAA or Leu stimulation. These results demonstrate a functional Leu transporter at the lysosome, and help explain the inside-out lysosomal activation of mTORC1 by Leu/EAA.

  9. Defective enamel and bone development in sodium-dependent citrate transporter (NaCT Slc13a5 deficient mice.

    Directory of Open Access Journals (Sweden)

    Armando R Irizarry

    Full Text Available There has been growing recognition of the essential roles of citrate in biomechanical properties of mineralized tissues, including teeth and bone. However, the sources of citrate in these tissues have not been well defined, and the contribution of citrate to the regulation of odontogenesis and osteogenesis has not been examined. Here, tooth and bone phenotypes were examined in sodium-dependent citrate transporter (NaCT Slc13a5 deficient C57BL/6 mice at 13 and 32 weeks of age. Slc13a5 deficiency led to defective tooth development, characterized by absence of mature enamel, formation of aberrant enamel matrix, and dysplasia and hyperplasia of the enamel organ epithelium that progressed with age. These abnormalities were associated with fragile teeth with a possible predisposition to tooth abscesses. The lack of mature enamel was consistent with amelogenesis imperfecta. Furthermore, Slc13a5 deficiency led to decreased bone mineral density and impaired bone formation in 13-week-old mice but not in older mice. The findings revealed the potentially important role of citrate and Slc13a5 in the development and function of teeth and bone.

  10. Molecular mechanisms of reduced glutathione transport: role of the MRP/CFTR/ABCC and OATP/SLC21A families of membrane proteins

    International Nuclear Information System (INIS)

    Ballatori, Nazzareno; Hammond, Christine L.; Cunningham, Jennifer B.; Krance, Suzanne M.; Marchan, Rosemarie

    2005-01-01

    The initial step in reduced glutathione (GSH) turnover in all mammalian cells is its transport across the plasma membrane into the extracellular space; however, the mechanisms of GSH transport are not clearly defined. GSH export is required for the delivery of its constituent amino acids to other tissues, detoxification of drugs, metals, and other reactive compounds of both endogenous and exogenous origin, protection against oxidant stress, and secretion of hepatic bile. Recent studies indicate that some members of the multidrug resistance-associated protein (MRP/CFTR or ABCC) family of ATP-binding cassette (ABC) proteins, as well as some members of the organic anion transporting polypeptide (OATP or SLC21A) family of transporters contribute to this process. In particular, five of the 12 members of the MRP/CFTR family appear to mediate GSH export from cells namely, MRP1, MRP2, MRP4, MRP5, and CFTR. Additionally, two members of the OATP family, rat Oatp1 and Oatp2, have been identified as GSH transporters. For the Oatp1 transporter, efflux of GSH may provide the driving force for the uptake of extracellular substrates. In humans, OATP-B and OATP8 do not appear to transport GSH; however, other members of this family have yet to be characterized in regards to GSH transport. In yeast, the ABC proteins Ycf1p and Bpt1p transport GSH from the cytosol into the vacuole, whereas Hgt1p mediates GSH uptake across the plasma membrane. Because transport is a key step in GSH homeostasis and is intimately linked to its biological functions, GSH export proteins are likely to modulate essential cellular functions

  11. A haplotype of the norepinephrine transporter gene (SLC6A2) is associated with visual memory in attention-deficit/hyperactivity disorder.

    Science.gov (United States)

    Shang, Chi-Yung; Chiang, Huey-Ling; Gau, Susan Shur-Fen

    2015-04-03

    Attention-deficit/hyperactivity disorder (ADHD) is a common heritable childhood-onset psychiatric disorder with impaired visual memory. Based on the evidence from treatment effect of atomoxetine, which interacts directly with the norepinephrine transporter, on visual memory in children with ADHD, this study examined the linkage disequilibrium structure of the norepinephrine transporter gene (SLC6A2) and the association between SLC6A2 and ADHD and visual memory, a promising endophenotype for ADHD. This family-based association sample consisted of 382 probands with DSM-IV ADHD and their family members (n=1298 in total) of Han Chinese in Taiwan. Visual memory was assessed by the Pattern Recognition Memory (PRM) and Spatial Recognition Memory (SRM) tasks of the Cambridge Neuropsychological Test Automated Battery (CANTAB). We screened 21 polymorphisms across SLC6A2 and used the Family-Based Association Test (FBAT) to test the associations of SLC6A2 polymorphisms with ADHD and the PRM and SRM measures. In haplotype analyses, a haplotype rs36011 (T)/rs1566652 (G) was significantly associated with ADHD (minimal p=0.045) after adjustment for multiple testing. In quantitative analyses, this TG haplotype also demonstrated significant associations with visual memory measures, including mean latency of correct responses in PRM (minimal p=0.019), total correct responses in PRM (minimal p=0.018), and total correct responses in SRM (minimal p=0.015). Our novel finding of the haplotype rs36011 (T)/rs1566652 (G) as a novel genetic marker involved in both ADHD disease susceptibility and visual memory suggests that allelic variations in SLC6A2 could provide insight into the pathways leading from genotype to phenotype of ADHD. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Modeling and management of pit lake water chemistry 1: Theory

    International Nuclear Information System (INIS)

    Castendyk, D.N.; Eary, L.E.; Balistrieri, L.S.

    2015-01-01

    Highlights: • Review of pit lake literature in the context of pit lake predictions. • Review of approaches used to predict pit wall-rock runoff and leachate. • Review of approaches used to generate a pit lake water balance. • Review of approaches used to generate a hydrodynamic prediction. • Review of approaches used to generate a geochemical prediction of a future pit lake. - Abstract: Pit lakes are permanent hydrologic/landscape features that can result from open pit mining for metals, coal, uranium, diamonds, oil sands, and aggregates. Risks associated with pit lakes include local and regional impacts to water quality and related impacts to aquatic and terrestrial ecosystems. Stakeholders rely on predictive models of water chemistry to prepare for and manage these risks. This paper is the first of a two part series on the modeling and management of pit lakes. Herein, we review approaches that have been used to quantify wall-rock runoff geochemistry, wall-rock leachate geochemistry, pit lake water balance, pit lake limnology (i.e. extent of vertical mixing), and pit lake water quality, and conclude with guidance on the application of models within the mine life cycle. The purpose of this paper is to better prepare stakeholders, including future modelers, mine managers, consultants, permitting agencies, land management agencies, regulators, research scientists, academics, and other interested parties, for the challenges of predicting and managing future pit lakes in un-mined areas

  13. Cation-Coupled Bicarbonate Transporters

    OpenAIRE

    Aalkjaer, Christian; Boedtkjer, Ebbe; Choi, Inyeong; Lee, Soojung

    2014-01-01

    Cation-coupled HCO3− transport was initially identified in the mid-1970s when pioneering studies showed that acid extrusion from cells is stimulated by CO2/HCO3− and associated with Na+ and Cl− movement. The first Na+-coupled bicarbonate transporter (NCBT) was expression-cloned in the late 1990s. There are currently five mammalian NCBTs in the SLC4-family: the electrogenic Na,HCO3-cotransporters NBCe1 and NBCe2 (SLC4A4 and SLC4A5 gene products); the electroneutral Na,HCO3-cotransporter NBCn1 ...

  14. Ras-dva is a novel Pit-1- and glucocorticoid-regulated gene in the embryonic anterior pituitary gland.

    Science.gov (United States)

    Ellestad, Laura E; Porter, Tom E

    2013-01-01

    Glucocorticoids play a role in functional differentiation of pituitary somatotrophs and lactotrophs during embryogenesis. Ras-dva was identified as a gene regulated by anterior neural fold protein-1/homeobox expressed in embryonic stem cells-1, a transcription factor known to be critical in pituitary development, and has an expression profile in the chicken embryonic pituitary gland that is consistent with in vivo regulation by glucocorticoids. The objective of this study was to characterize expression and regulation of ras-dva mRNA in the developing chicken anterior pituitary. Pituitary ras-dva mRNA levels increased during embryogenesis to a maximum on embryonic day (e) 18 and then decreased and remained low or undetectable after hatch. Ras-dva expression was highly enriched in the pituitary gland on e18 relative to other tissues examined. Glucocorticoid treatment of pituitary cells from mid- and late-stage embryos rapidly increased ras-dva mRNA, suggesting it may be a direct transcriptional target of glucocorticoids. A reporter construct driven by 4 kb of the chicken ras-dva 5'-flanking region, containing six putative pituitary-specific transcription factor-1 (Pit-1) binding sites and two potential glucocorticoid receptor (GR) binding sites, was highly activated in embryonic pituitary cells and up-regulated by corticosterone. Mutagenesis of the most proximal Pit-1 site decreased promoter activity in chicken e11 pituitary cells, indicating regulation of ras-dva by Pit-1. However, mutating putative GR binding sites did not substantially reduce induction of ras-dva promoter activity by corticosterone, suggesting additional DNA elements within the 5'-flanking region are responsible for glucocorticoid regulation. We have identified ras-dva as a glucocorticoid-regulated gene that is likely expressed in cells of the Pit-1 lineage within the developing anterior pituitary gland.

  15. Pharmacotherapy in pregnancy; effect of ABC and SLC transporters on drug transport across the placenta and fetal drug exposure.

    Science.gov (United States)

    Staud, Frantisek; Cerveny, Lukas; Ceckova, Martina

    2012-11-01

    Pharmacotherapy during pregnancy is often inevitable for medical treatment of the mother, the fetus or both. The knowledge of drug transport across placenta is, therefore, an important topic to bear in mind when deciding treatment in pregnant women. Several drug transporters of the ABC and SLC families have been discovered in the placenta, such as P-glycoprotein, breast cancer resistance protein, or organic anion/cation transporters. It is thus evident that the passage of drugs across the placenta can no longer be predicted simply on the basis of their physical-chemical properties. Functional expression of placental drug transporters in the trophoblast and the possibility of drug-drug interactions must be considered to optimize pharmacotherapy during pregnancy. In this review we summarize current knowledge on the expression and function of ABC and SLC transporters in the trophoblast. Furthermore, we put this data into context with medical conditions that require maternal and/or fetal treatment during pregnancy, such as gestational diabetes, HIV infection, fetal arrhythmias and epilepsy. Proper understanding of the role of placental transporters should be of great interest not only to clinicians but also to pharmaceutical industry for future drug design and development to control the degree of fetal exposure.

  16. Cleanup Verification Package for the 126-F-1, 184-F Powerhouse Ash Pit

    International Nuclear Information System (INIS)

    Clark, S.W.; Sulloway, H.M.

    2007-01-01

    This cleanup verification package documents completion of remedial action for the 126-F-1, 184-F Powerhouse Ash Pit. This waste site received coal ash from the 100-F Area coal-fired steam plant. Leakage of process effluent from the 116-F-14 , 107-F Retention Basins flowed south into the ash pit, contaminating the northern portion

  17. Disruption of Slc52a3 gene causes neonatal lethality with riboflavin deficiency in mice

    OpenAIRE

    Yoshimatsu, Hiroki; Yonezawa, Atsushi; Yamanishi, Kaori; Yao, Yoshiaki; Sugano, Kumiko; Nakagawa, Shunsaku; Imai, Satoshi; Omura, Tomohiro; Nakagawa, Takayuki; Yano, Ikuko; Masuda, Satohiro; Inui, Ken-ichi; Matsubara, Kazuo

    2016-01-01

    Homeostasis of riboflavin should be maintained by transporters. Previous in vitro studies have elucidated basic information about riboflavin transporter RFVT3 encoded by SLC52A3 gene. However, the contribution of RFVT3 to the maintenance of riboflavin homeostasis and the significance in vivo remain unclear. Here, we investigated the physiological role of RFVT3 using Slc52a3 knockout (Slc52a3−/−) mice. Most Slc52a3−/− mice died with hyperlipidemia and hypoglycemia within 48 hr after birth. The...

  18. Dicty_cDB: SLC413 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4

  19. Dicty_cDB: SLC404 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4

  20. Dicty_cDB: SLC403 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL

  1. Dicty_cDB: SLC415 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4

  2. Loss-of-function mutations in SLC30A8 protect against type 2 diabetes.

    Science.gov (United States)

    Flannick, Jason; Thorleifsson, Gudmar; Beer, Nicola L; Jacobs, Suzanne B R; Grarup, Niels; Burtt, Noël P; Mahajan, Anubha; Fuchsberger, Christian; Atzmon, Gil; Benediktsson, Rafn; Blangero, John; Bowden, Don W; Brandslund, Ivan; Brosnan, Julia; Burslem, Frank; Chambers, John; Cho, Yoon Shin; Christensen, Cramer; Douglas, Desirée A; Duggirala, Ravindranath; Dymek, Zachary; Farjoun, Yossi; Fennell, Timothy; Fontanillas, Pierre; Forsén, Tom; Gabriel, Stacey; Glaser, Benjamin; Gudbjartsson, Daniel F; Hanis, Craig; Hansen, Torben; Hreidarsson, Astradur B; Hveem, Kristian; Ingelsson, Erik; Isomaa, Bo; Johansson, Stefan; Jørgensen, Torben; Jørgensen, Marit Eika; Kathiresan, Sekar; Kong, Augustine; Kooner, Jaspal; Kravic, Jasmina; Laakso, Markku; Lee, Jong-Young; Lind, Lars; Lindgren, Cecilia M; Linneberg, Allan; Masson, Gisli; Meitinger, Thomas; Mohlke, Karen L; Molven, Anders; Morris, Andrew P; Potluri, Shobha; Rauramaa, Rainer; Ribel-Madsen, Rasmus; Richard, Ann-Marie; Rolph, Tim; Salomaa, Veikko; Segrè, Ayellet V; Skärstrand, Hanna; Steinthorsdottir, Valgerdur; Stringham, Heather M; Sulem, Patrick; Tai, E Shyong; Teo, Yik Ying; Teslovich, Tanya; Thorsteinsdottir, Unnur; Trimmer, Jeff K; Tuomi, Tiinamaija; Tuomilehto, Jaakko; Vaziri-Sani, Fariba; Voight, Benjamin F; Wilson, James G; Boehnke, Michael; McCarthy, Mark I; Njølstad, Pål R; Pedersen, Oluf; Groop, Leif; Cox, David R; Stefansson, Kari; Altshuler, David

    2014-04-01

    Loss-of-function mutations protective against human disease provide in vivo validation of therapeutic targets, but none have yet been described for type 2 diabetes (T2D). Through sequencing or genotyping of ~150,000 individuals across 5 ancestry groups, we identified 12 rare protein-truncating variants in SLC30A8, which encodes an islet zinc transporter (ZnT8) and harbors a common variant (p.Trp325Arg) associated with T2D risk and glucose and proinsulin levels. Collectively, carriers of protein-truncating variants had 65% reduced T2D risk (P = 1.7 × 10(-6)), and non-diabetic Icelandic carriers of a frameshift variant (p.Lys34Serfs*50) demonstrated reduced glucose levels (-0.17 s.d., P = 4.6 × 10(-4)). The two most common protein-truncating variants (p.Arg138* and p.Lys34Serfs*50) individually associate with T2D protection and encode unstable ZnT8 proteins. Previous functional study of SLC30A8 suggested that reduced zinc transport increases T2D risk, and phenotypic heterogeneity was observed in mouse Slc30a8 knockouts. In contrast, loss-of-function mutations in humans provide strong evidence that SLC30A8 haploinsufficiency protects against T2D, suggesting ZnT8 inhibition as a therapeutic strategy in T2D prevention.

  3. Dicty_cDB: SLC407 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4

  4. Dicty_cDB: SLC402 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4

  5. Dicty_cDB: SLC435 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4

  6. Triiodothyronine Acutely Stimulates Glucose Transport into L6 Muscle Cells Without Increasing Surface GLUT4, GLUT1, or GLUT3

    Science.gov (United States)

    Teixeira, Silvania Silva; Tamrakar, Akhilesh K.; Goulart-Silva, Francemilson; Serrano-Nascimento, Caroline; Klip, Amira

    2012-01-01

    Background Thyroid hormones (THs) act genomically to stimulate glucose transport by elevating glucose transporter (Slc2a) expression and glucose utilization by cells. However, nongenomic effects of THs are now emerging. Here, we assess how triiodothyronine (T3) acutely affects glucose transport and the content of GLUT4, GLUT1, and GLUT3 at the surface of muscle cells, and possible interactions between T3 and insulin action. Methods Differentiated L6 myotubes transfected with myc-tagged Slc2a4 (L6-GLUT4myc) or Slc2a1 (L6-GLUT1myc) and wild-type L6 myotubes were studied in the following conditions: control, hypothyroid (Tx), Tx plus T3, Tx plus insulin, and Tx plus insulin and T3. Results Glucose uptake and GLUT4 content at the cell surface decreased in the Tx group relative to controls. T3 treatment for 30 minutes increased glucose transport into L6-GLUT4myc cells without altering surface GLUT4 content, which increased only thereafter. The total amount of GLUT4 protein remained unchanged among the groups studied. The surface GLUT1 content of L6-GLUT1myc cells also remained unaltered after T3 treatment; however, in these cells glucose transport was not stimulated by T3. In wild-type L6 cells, although T3 treatment increased the total amount of GLUT3, it did not change the surface GLUT3 content. Moreover, within 30 minutes, T3 stimulation of glucose uptake was additive to that of insulin in L6-GLUT4myc cells. As expected, insulin elevated surface GLUT4 content and glucose uptake. However, interestingly, surface GLUT4 content remained unchanged or even dropped with T3 plus insulin. Conclusions These data reveal that T3 rapidly increases glucose uptake in L6-GLUT4myc cells, which, at least for 30 minutes, did not depend on an increment in GLUT4 at the cell surface yet potentiates insulin action. We propose that this rapid T3 effect involves activation of GLUT4 transporters at the cell surface, but cannot discount the involvement of an unknown GLUT. PMID:22663547

  7. Evolutionary relationships and functional diversity of plant sulfate transporters

    Directory of Open Access Journals (Sweden)

    Hideki eTakahashi

    2012-01-01

    Full Text Available Sulfate is an essential nutrient cycled in nature. Ion transporters that specifically facilitate the transport of sulfate across the membranes are found ubiquitously in living organisms. The phylogenetic analysis of known sulfate transporters and their homologous proteins from eukaryotic organisms indicate two evolutionarily distinct groups of sulfate transport systems. One major group named Tribe 1 represents yeast and fungal SUL, plant SULTR and animal SLC26 families. The evolutionary origin of SULTR family members in land plants and green algae is suggested to be common with yeast and fungal sulfate transporters (SUL and animal anion exchangers (SLC26. The lineage of plant SULTR family is expanded into four subfamilies (SULTR1 to SULTR4 in land plant species. By contrast, the putative SULTR homologues from Chlorophyte green algae are in two separate lineages; one with the subfamily of plant tonoplast-localized sulfate transporters (SULTR4, and the other diverged before the appearance of lineages for SUL, SULTR and SLC26. There also was a group of yet undefined members of putative sulfate transporters in yeast and fungi divergent from these major lineages in Tribe 1. The other distinct group is Tribe 2, primarily composed of animal sodium-dependent sulfate/carboxylate transporters (SLC13 and plant tonoplast-localized dicarboxylate transporters (TDT. The putative sulfur-sensing protein (SAC1 and SAC1-like transporters (SLT of Chlorophyte green algae, bryophyte and lycophyte show low degrees of sequence similarities with SLC13 and TDT. However, the phylogenetic relationship between SAC1/SLT and the other two families, SLC13 and TDT in Tribe 2, is not clearly supported. In addition, the SAC1/SLT family is completely absent in the angiosperm species analyzed. The present study suggests distinct evolutionary trajectories of sulfate transport systems for land plants and green algae.

  8. Isochronous 180 degree turns for the SLC positron system

    International Nuclear Information System (INIS)

    Helm, R.H.; Clendenin, J.E.; Ecklund, S.D.; Kulikov, A.V.; Pitthan, R.

    1991-05-01

    The design of the compact, achromatic, second order isochronous 180 degrees turn for the SLC positron transport system will be described. Design criteria require an energy range of 200±20 MeV, energy acceptance of ±5%, transverse admittance of 25π mm-mr, and minimal lengthening of the 3 to 4 mm (rms) positron bunch. The devices had to fit within a maximum height or width of about 10 ft. Optics specifications and theoretical performance are presented and compared to experimental results based on streak camera measurements of bunch length immediately after the first isochronous turn (200 MeV) and positron beam energy spread after S-band acceleration to 1.15 GeV. 5 refs., 7 figs

  9. [Polymorphism in the Serotonin Transporter Gene (SLC6A4) and Emotional Bipolar Disorder in Two Regional Mental Health Centers from the Eje Cafetero (Colombia)].

    Science.gov (United States)

    Ramos, Lucero Rengifo; Arias, Duverney Gaviria; Salazar, Liliana Salazar; Vélez, Juan Pablo; Pardo, Stella Lozano

    2012-03-01

    The indel polymorphisms in the promoting region and the 2(nd) intron polymorphisms in the serotonin transporter gene (SLC6A4) have been associated to bipolar disorder 1 (BD1) in several population studies. The objective was to analyze the genotypic and allelic frequencies in both gene regions in a study of cases and controls with individuals from Risaralda and Quindío (Colombia) so as to establish possible associations to BD1, and compare results with previous and similar studies. 133 patients and 120 controls were studied. L and S indel polymorphisms in the promoting region were analyzed by PCR, together with VNTR STin2.10 and STin 2.12 VNTRs polymorphisms in the 2(nd) intron of the SL-C6A4 gene Genotypic and allelic frequencies for the S and L polymorphisms were similar both in cases and controls. However, the LL genotype was significantly increased both in BD1 population (OR=1.89; CI95%=1.1-3.68), and when discriminated by gender. This particular genotype in general population is OR=2.22; IC95%=1.04-5.66 for women, and OR=1.62; IC 95%=0.71-4.39 for men. No significant genotypic and allelic differences were found for VNTR STin2.10 and STin 2.12. polymorphisms. No association was found between polymorphisms of 5-HTTLPR polymorphisms and the 2(nd) intron of the serotonin transporting gene in general patients with BD1, nor when compared by gender. Our results are similar to those reported for Caucasian populations and differ from those of Asian and Brazilian populations. Copyright © 2012 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  10. Dicty_cDB: SLC485 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4

  11. SLC5A8 gene, a transporter of butyrate: a gut flora metabolite, is frequently methylated in African American colon adenomas.

    Directory of Open Access Journals (Sweden)

    Hassan Brim

    Full Text Available Colon cancer is one of the leading causes of cancer related deaths. Its impact on African Americans (AAs is higher than in the general population both in the incidence and mortality from the disease. Colon cancer aggressiveness in AAs as well as non-frequent check-ups and follow up in this population have been proposed as ways to explain the observed discrepancies. These facts made the detection of early carcinogenesis markers in this population a priority.Here, we analyzed 50 colon adenomas from AA patients for both microsatellite instability (MSI and the methylation status of SLC5A8 gene. This gene's product is involved in the transport of butyrate that has anti-proliferative properties through its effects on histone acetylation and gene expression. A proteomic analysis to check the expressed histones in adenoma and normal tissues was also performed.The analyzed samples displayed 82% (n = 41 methylation level of SLC5A8 gene in adenomas. The MSI-H (high adenoma were about 18% (n = 9 while the rest were mostly MSS (microsatellite stable with few MSI-L (Low. No association was found between SLC5A8 methylation and the MSI status. Also, there was no association between SLC5A8 methylation and the sex and age of the patients. However, there were more right sided adenomas with SLC5A8 methylation than the left sided ones. The proteomic analysis revealed distinct histone expression profiles between normal and adenoma tissues.SLC5A8 is highly methylated in AA colon adenomas which points to its potential use as a marker for early detection. The MSI rate is similar to that found in colon cancer tumors in AAs. These findings suggest that both processes stem from the same epigenetic and genetic events occurring at an early stage in colon carcinogenesis in AAs.

  12. Dicty_cDB: SLC489 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4

  13. Evolutionary relationships and functional diversity of plant sulfate transporters.

    Science.gov (United States)

    Takahashi, Hideki; Buchner, Peter; Yoshimoto, Naoko; Hawkesford, Malcolm J; Shiu, Shin-Han

    2011-01-01

    Sulfate is an essential nutrient cycled in nature. Ion transporters that specifically facilitate the transport of sulfate across the membranes are found ubiquitously in living organisms. The phylogenetic analysis of known sulfate transporters and their homologous proteins from eukaryotic organisms indicate two evolutionarily distinct groups of sulfate transport systems. One major group named Tribe 1 represents yeast and fungal SUL, plant SULTR, and animal SLC26 families. The evolutionary origin of SULTR family members in land plants and green algae is suggested to be common with yeast and fungal SUL and animal anion exchangers (SLC26). The lineage of plant SULTR family is expanded into four subfamilies (SULTR1-SULTR4) in land plant species. By contrast, the putative SULTR homologs from Chlorophyte green algae are in two separate lineages; one with the subfamily of plant tonoplast-localized sulfate transporters (SULTR4), and the other diverged before the appearance of lineages for SUL, SULTR, and SLC26. There also was a group of yet undefined members of putative sulfate transporters in yeast and fungi divergent from these major lineages in Tribe 1. The other distinct group is Tribe 2, primarily composed of animal sodium-dependent sulfate/carboxylate transporters (SLC13) and plant tonoplast-localized dicarboxylate transporters (TDT). The putative sulfur-sensing protein (SAC1) and SAC1-like transporters (SLT) of Chlorophyte green algae, bryophyte, and lycophyte show low degrees of sequence similarities with SLC13 and TDT. However, the phylogenetic relationship between SAC1/SLT and the other two families, SLC13 and TDT in Tribe 2, is not clearly supported. In addition, the SAC1/SLT family is absent in the angiosperm species analyzed. The present study suggests distinct evolutionary trajectories of sulfate transport systems for land plants and green algae.

  14. Dicty_cDB: SLC458 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743

  15. Dicty_cDB: SLC474 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se

  16. Dicty_cDB: SLC425 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4

  17. Dicty_cDB: SLC443 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4

  18. Dicty_cDB: SLC429 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q

  19. Dicty_cDB: SLC428 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0

  20. Developmental expression of SLC26A4 (Pendrin) during amelogenesis in developing rodent teeth

    Science.gov (United States)

    Bronckers, Antonius LJJ; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M.; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela

    2012-01-01

    Ameloblasts need to regulate pH during formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as pH regulator. SLC26A4 does not appear critical for ameloblast functioning and is likely compensated by other pH regulators. PMID:22243245

  1. Brain calcification process and phenotypes according to age and sex: Lessons from SLC20A2, PDGFB, and PDGFRB mutation carriers.

    Science.gov (United States)

    Nicolas, Gaël; Charbonnier, Camille; de Lemos, Roberta Rodrigues; Richard, Anne-Claire; Guillin, Olivier; Wallon, David; Legati, Andrea; Geschwind, Daniel; Coppola, Giovanni; Frebourg, Thierry; Campion, Dominique; de Oliveira, João Ricardo Mendes; Hannequin, Didier

    2015-10-01

    Primary Familial Brain Calcification (PFBC) is a dominantly inherited cerebral microvascular calcifying disorder with diverse neuropsychiatric expression. Three causative genes have been identified: SLC20A2, PDGFRB and, recently, PDGFB, whose associated phenotype has not yet been extensively studied. We included in the largest published case series of genetically confirmed PFBC, 19 PDGFB (including three new mutations), 24 SLC20A2 (including 4 new mutations), and 14 PDGFRB mutation carriers, from two countries (France and Brazil). We studied clinical features and applied our visual rating scale on all 49 available CT scans. Among the symptomatic mutation carriers (33/57, 58%), the three most frequently observed categories of clinical features were psychiatric signs (72.7%, 76.5%, and 80% for PDGFB, SLC20A2, and PDGFRB, respectively), movement disorders (45.5%, 76.5%, and 40%), and cognitive impairment (54.6%, 64.7%, and 40%). The median age of clinical onset was 31 years, 25% had an early onset (before 18) and 25% a later onset (after 53). Patients with an early clinical onset exhibited mostly isolated psychiatric or cognitive signs, while patients with a later onset exhibited mostly movement disorders, especially in association with other clinical features. CT scans rating allowed identifying four patterns of calcification. The total calcification score was best predicted by the combined effects of gene (SLC20A2 > PDGFB > PDGFRB mutations), sex (male), and (increasing) age, defining three risk classes, which correlated with the four patterns of calcification. These calcification patterns could reflect the natural history of the calcifying process, with distinct risk classes characterized by different age at onset or rate of progression. © 2015 Wiley Periodicals, Inc.

  2. Dicty_cDB: SLC473 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4

  3. Dicty_cDB: SLC442 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4

  4. Dicty_cDB: SLC478 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4

  5. Dicty_cDB: SLC448 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4

  6. Dicty_cDB: SLC456 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -

  7. Dicty_cDB: SLC495 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C

  8. Dicty_cDB: SLC483 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651

  9. Dicty_cDB: SLC434 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4

  10. Dicty_cDB: SLC450 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V

  11. Dicty_cDB: SLC469 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4

  12. Dicty_cDB: SLC452 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4

  13. Dicty_cDB: SLC455 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4

  14. Dicty_cDB: SLC464 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4

  15. Dicty_cDB: SLC477 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4

  16. Dicty_cDB: SLC436 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4

  17. Dicty_cDB: SLC466 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid

  18. Dicty_cDB: SLC444 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq

  19. Dicty_cDB: SLC490 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4

  20. Dicty_cDB: SLC484 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4

  1. Stationary and transient thermal states of barometric pumping in the access pit of an underground quarry.

    Science.gov (United States)

    Perrier, Frédéric; Le Mouël, Jean-Louis

    2016-04-15

    The transition zone between free and underground atmospheres hosts spectacular phenomena, as demonstrated by temperature measurements performed in the 4.6m diameter and 20m deep vertical access pit of an abandoned underground quarry located in Vincennes, near Paris. In summer, a stable stratification of the atmosphere is maintained, with coherent temperature variations associated with atmospheric pressure changes, with a barometric tide S2 larger than 0.1°C peak to peak. When the winter regime of turbulent cold air avalanches is initiated, stratification with pressure induced signals can be restored transiently in the upper part of the pit, while the lower part remains fully mixed and insensitive to pressure variations. The amplitude of the pressure to temperature transfer function increases with frequency below 5×10(-4)Hz, with values at 3×10(-5)Hz varying from 0.1°C·hPa(-1) at the bottom up to 2°C·hPa(-1) towards the top of the pit. These temperature variations are accounted for by cave breathing, which is pressure induced motion of air amplified by the large volume of the quarry. This understanding is supported by a numerical model including advective heat transport, heat diffusion, and heat exchange with the pit walls. Mean lifetime in the pit is of the order of 9 to 13h, and barometric pumping results in an effective ventilation rate of the quarry of the order of 10(-7)s(-1). This study illustrates the important role of barometric pumping in heat and matter transport between atmosphere and lithosphere. The resulting stationary and transient states, revealed in this pit, are probably a general feature of functioning interface systems, and therefore are an important aspect to consider in problems of contaminant transport, or the preservation of precious heritage such as rare ecosystems or painted caves. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Variation in the SLC23A1 gene does not influence cardiometabolic outcomes to the extent expected given its association with l-ascorbic acid 1 2 3 4

    OpenAIRE

    Wade, Kaitlin H; Forouhi, Nita G; Cook, Derek G; Johnson, Paul; McConnachie, Alex; Morris, Richard W; Rodriguez, Santiago; Ye, Zheng; Ebrahim, Shah; Padmanabhan, Sandosh; Watt, Graham; Bruckdorfer, K Richard; Wareham, Nick J; Whincup, Peter H; Chanock, Stephen

    2014-01-01

    Background: Observational studies showed that circulating l-ascorbic acid (vitamin C) is inversely associated with cardiometabolic traits. However, these studies were susceptible to confounding and reverse causation.\\ud \\ud Objectives:We assessed the relation between l-ascorbic acid and 10 cardiometabolic traits by using a single nucleotide polymorphism in the solute carrier family 23 member 1 (SLC23A1) gene (rs33972313) associated with circulating l-ascorbic acid concentrations. The observed...

  3. Dicty_cDB: SLC486 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4

  4. Dicty_cDB: SLC470 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4

  5. Dicty_cDB: SLC438 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC438 (Link to dictyBase) - - - Contig-U10771-1 SLC438Z (Link... to Original site) - - SLC438Z 549 - - - - Show SLC438 Library SL (Link to library) Clone ID SLC438 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC438Q.Seq.d/ Representative seq. ID SLC43...8Z (Link to Original site) Representative DNA sequence >SLC438 (SLC438Q) /CSM/SL/SLC4-B/SLC438Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSM825 (SSM825Q) /CSM/SS/SSM8-B/SSM825Q.Seq.d/ 948 0.0 SLC438 (SLC4

  6. Dicty_cDB: SLC480 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC480 (Link to dictyBase) - - - Contig-U13538-1 SLC480Z (Link... to Original site) - - SLC480Z 455 - - - - Show SLC480 Library SL (Link to library) Clone ID SLC480 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC480Q.Seq.d/ Representative seq. ID SLC48...0Z (Link to Original site) Representative DNA sequence >SLC480 (SLC480Q) /CSM/SL/SLC4-D/SLC480Q.Seq.d/ XXXXX...ial 8.0 %: peroxisomal >> prediction for SLC480 is nuc 5' end seq. ID - 5' end seq. - Length of 5' end seq. - 3' end seq. ID SLC4

  7. Distribution and expression of SLC45A2 in the skin of sheep with different coat colors.

    Science.gov (United States)

    Wang, Haidong; Xue, Linli; Li, Yanan; Zhao, Bingling; Chen, Tianzhi; Liu, Ying; Chang, Lucheng; Wang, Juan

    2016-01-01

    To investigate whether the membrane-associated transporter protein SLC45A2 is differentially expressed in the skin of sheep with different coat colors and to determine its correlation with coat color establishment in sheep. The expression of SLC45A2 in sheep skin samples with different coat colors was qualitatively and quantitatively analyzed by PCR amplification, RT-PCR, immunohistochemical staining and Western blotting. A 193-bp SLC45A2 CDS sequence was successfully amplified from sheep skin samples with diverse coat colors. RT-PCR analysis revealed that SLC45A2 mRNA was expressed in all sheep skin samples tested, with relative expression levels of 512.74 ± 121.51 in black skin, 143.38 ± 119.31 and 1.36 ± 0.09 in black dots and white dots of piebald skin, respectively, and 1.02 ± 0.23 in white skin (p coat colors. These patterns were quantified by optical density (OD) analysis, which yielded relative expression levels of 0.23 ± 0.11 in black skin, 0.19 ± 0.09 and 0.10 ± 0.03 in black dots and white dots of piebald skin, respectively, and 0.08 ± 0.01 in white skin (p coat colors, though at significantly different levels. SLC45A2 may participate in the establishment of coat color by regulating the synthesis and trafficking of melanin.

  8. Deafness and permanently reduced potassium channel gene expression and function in hypothyroid Pit1dw mutants

    Science.gov (United States)

    Mustapha, Mirna; Fang, Qing; Gong, Tzy-Wen; Dolan, David F.; Raphael, Yehoash; Camper, Sally A.; Duncan, R. Keith

    2012-01-01

    The absence of thyroid hormone (TH) during late gestation and early infancy can cause irreparable deafness in both humans and rodents. A variety of rodent models have been utilized in an effort to identify the underlying molecular mechanism. Here, we characterize a mouse model of secondary hypothyroidism, pituitary transcription factor 1 (Pit1dw), which has profound, congenital deafness that is rescued by oral TH replacement. These mutants have tectorial membrane abnormalities, including a prominent Hensen's stripe, elevated β-tectorin composition, and disrupted striated-sheet matrix. They lack distortion product otoacoustic emissions and cochlear microphonic responses, and exhibit reduced endocochlear potentials, suggesting defects in outer hair cell function and potassium recycling. Auditory system and hair cell physiology, histology and anatomy studies reveal novel defects of hormone deficiency related to deafness: (1) permanently impaired expression of KCNJ10 in the stria vascularis of Pit1dw mice, which likely contributes to the reduced endocochlear potential, (2) significant outer hair cell loss in the mutants, which may result from cellular stress induced by the lower KCNQ4 expression and current levels in Pit1dw mutant outer hair cells and (3) sensory and strial cell deterioration, which may have implications for thyroid hormone dysregulation in age related hearing impairment. In summary, we suggest that these defects in outer hair cell and strial cell function are important contributors to the hearing impairment in Pit1dw mice. PMID:19176829

  9. Soy-dairy protein blend and whey protein ingestion after resistance exercise increases amino acid transport and transporter expression in human skeletal muscle

    Science.gov (United States)

    Reidy, P. T.; Walker, D. K.; Dickinson, J. M.; Gundermann, D. M.; Drummond, M. J.; Timmerman, K. L.; Cope, M. B.; Mukherjea, R.; Jennings, K.; Volpi, E.

    2014-01-01

    Increasing amino acid availability (via infusion or ingestion) at rest or postexercise enhances amino acid transport into human skeletal muscle. It is unknown whether alterations in amino acid availability, from ingesting different dietary proteins, can enhance amino acid transport rates and amino acid transporter (AAT) mRNA expression. We hypothesized that the prolonged hyperaminoacidemia from ingesting a blend of proteins with different digestion rates postexercise would enhance amino acid transport into muscle and AAT expression compared with the ingestion of a rapidly digested protein. In a double-blind, randomized clinical trial, we studied 16 young adults at rest and after acute resistance exercise coupled with postexercise (1 h) ingestion of either a (soy-dairy) protein blend or whey protein. Phenylalanine net balance and transport rate into skeletal muscle were measured using stable isotopic methods in combination with femoral arteriovenous blood sampling and muscle biopsies obtained at rest and 3 and 5 h postexercise. Phenylalanine transport into muscle and mRNA expression of select AATs [system L amino acid transporter 1/solute-linked carrier (SLC) 7A5, CD98/SLC3A2, system A amino acid transporter 2/SLC38A2, proton-assisted amino acid transporter 1/SLC36A1, cationic amino acid transporter 1/SLC7A1] increased to a similar extent in both groups (P protein blend resulted in a prolonged and positive net phenylalanine balance during postexercise recovery compared with whey protein (P protein synthesis increased similarly between groups. We conclude that, while both protein sources enhanced postexercise AAT expression, transport into muscle, and myofibrillar protein synthesis, postexercise ingestion of a protein blend results in a slightly prolonged net amino acid balance across the leg compared with whey protein. PMID:24699854

  10. Association between a genetic variant in the serotonin transporter gene (SLC6A4) and suicidal behavior in patients with schizophrenia

    DEFF Research Database (Denmark)

    Lindholm Carlstrom, Eva; Saetre, Peter; Rosengren, Anders

    2012-01-01

    ABSTRACT: BACKGROUND: The serotonin (5-hydroxytryptamin; 5-HT) system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT) is associated with schizophrenia and suicidal behavior. ...

  11. Association between SLC19A1 Gene Polymorphism and High Dose Methotrexate Toxicity in Childhood Acute Lymphoblastic Leukaemia and Non Hodgkin Malignant Lymphoma: Introducing a Haplotype based Approach

    Science.gov (United States)

    Kotnik, Barbara Faganel; Jazbec, Janez; Grabar, Petra Bohanec; Rodriguez-Antona, Cristina

    2017-01-01

    Abstract Background We investigated the clinical relevance of SLC 19A1 genetic variability for high dose methotrexate (HD-MTX) related toxicities in children and adolescents with acute lymphoblastic leukaemia (ALL) and non Hodgkin malignant lymphoma (NHML). Patients and methods Eighty-eight children and adolescents with ALL/NHML were investigated for the influence of SLC 19A1 single nucleotide polymorphisms (SNPs) and haplotypes on HD-MTX induced toxicities. Results Patients with rs2838958 TT genotype had higher probability for mucositis development as compared to carriers of at least one rs2838958 C allele (OR 0.226 (0.071–0.725), p < 0.009). Haplotype TGTTCCG (H4) statistically significantly reduced the risk for the occurrence of adverse events during treatment with HD-MTX (OR 0.143 (0.023–0.852), p = 0.030). Conclusions SLC 19A1 SNP and haplotype analysis could provide additional information in a personalized HD-MTX therapy for children with ALL/NHML in order to achieve better treatment outcome. However further studies are needed to validate the results. PMID:29333125

  12. A genetic-demographic approach reveals a gender-specific association of SLC6A3/DAT1 40 bp-VNTR with life-expectancy.

    Science.gov (United States)

    Hadi, Fazal; Dato, Serena; Carpi, Francesco M; Prontera, Paolo; Crucianelli, Francesca; Renda, Federica; Passarino, Giuseppe; Napolioni, Valerio

    2015-06-01

    Several recent lines of evidence are proving an important role for dopamine in the aging process and in the determination of life span. Components of the dopaminergic system may represent good candidates for longevity studies. Herein, we tested the possible association of the functional SLC6A3/DAT1 40-bp VNTR with life-expectancy in a healthy population of Central Italy (N = 993) by applying a genetic-demographic approach that takes into account the demographic information and different survival rates between sexes for modeling the survival of specific allele carriers in the population. Male carriers of S*/S* genotype showed a lower survival chance across most of the lifespan respect to the survival of DAT1*L-carriers (P = 0.021). The same analyses gave non-significant results in females. Several studies already reported significant sex differences in dopamine metabolism and its related biological pathways. Thus, we can hypothesize that the SLC6A3/DAT1 40 bp-VNTR may affect life expectancy in a sex-specific way. Moreover, it is conceivable that DAT1 S*/S* carriers, who are prone to assume "risk" type behaviors, may be dropped out of the "healthy" population by a sort of "demographic selection".

  13. Cell-Type Specific Determinants of NRAMP1 Expression in Professional Phagocytes

    Directory of Open Access Journals (Sweden)

    Mathieu F. M. Cellier

    2013-01-01

    Full Text Available The Natural resistance-associated macrophage protein 1 (Nramp1 or Solute carrier 11 member 1, Slc11a1 transports divalent metals across the membrane of late endosomes and lysosomes in professional phagocytes. Nramp1 represents an ancient eukaryotic cell-autonomous defense whereas the gene duplication that yielded Nramp1 and Nramp2 predated the origin of Sarcopterygians (lobe-finned fishes and tetrapods. SLC11A1 genetic polymorphisms associated with human resistance to tuberculosis consist of potential regulatory variants. Herein, current knowledge of the regulation of SLC11A1 gene expression is reviewed and comprehensive analysis of ENCODE data available for hematopoietic cell-types suggests a hypothesis for the regulation of SLC11A1 expression during myeloid development and phagocyte functional polarization. SLC11A1 is part of a 34.6 kb CTCF-insulated locus scattered with predicted regulatory elements: a 3' enhancer, a large 5' enhancer domain and four elements spread around the transcription start site (TSS, including several C/EBP and PU.1 sites. SLC11A1 locus ends appear mobilized by ETS-related factors early during myelopoiesis; activation of both 5' and 3' enhancers in myelo-monocytic cells correlate with transcription factor binding at the TSS. Characterizing the corresponding cis/trans determinants functionally will establish the mechanisms involved and possibly reveal genetic variation that impacts susceptibility to infectious or immune diseases.

  14. Mutations in the HFE, TFR2, and SLC40A1 genes in patients with hemochromatosis.

    Science.gov (United States)

    Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Cuadrado-Grande, Nuria; Alvarez-Sala-Walther, Luis-Antonio; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

    2012-10-15

    Hereditary hemochromatosis causes iron overload and is associated with a variety of genetic and phenotypic conditions. Early diagnosis is important so that effective treatment can be administered and the risk of tissue damage avoided. Most patients are homozygous for the c.845G>A (p.C282Y) mutation in the HFE gene; however, rare forms of genetic iron overload must be diagnosed using a specific genetic analysis. We studied the genotype of 5 patients who had hyperferritinemia and an iron overload phenotype, but not classic mutations in the HFE gene. Two patients were undergoing phlebotomy and had no iron overload, 1 with metabolic syndrome and no phlebotomy had mild iron overload, and 2 patients had severe iron overload despite phlebotomy. The patients' first-degree relatives also underwent the analysis. We found 5 not previously published mutations: c.-408_-406delCAA in HFE, c.1118G>A (p.G373D), c.1473G>A (p.E491E) and c.2085G>C (p.S695S) in TFR2; and c.-428_-427GG>TT in SLC40A1. Moreover, we found 3 previously published mutations: c.221C>T (p.R71X) in HFE; c.1127C>A (p.A376D) in TFR2; and c.539T>C (p.I180T) in SLC40A1. Four patients were double heterozygous or compound heterozygous for the mutations mentioned above, and the patient with metabolic syndrome was heterozygous for a mutation in the TFR2 gene. Our findings show that hereditary hemochromatosis is clinically and genetically heterogeneous and that acquired factors may modify or determine the phenotype. Copyright © 2012. Published by Elsevier B.V.

  15. Language disorder with mild intellectual disability in a child affected by a novel mutation of SLC6A8 gene.

    Science.gov (United States)

    Battini, R; Chilosi, A M; Casarano, M; Moro, F; Comparini, A; Alessandrì, M G; Leuzzi, V; Tosetti, M; Cioni, G

    2011-02-01

    We describe the clinical and molecular features of a child harboring a novel mutation in SLC6A8 gene in association with a milder phenotype than other creatine transporter (CT1) deficient patients (OMIM 300352) [1-7]. The mutation c.757 G>C p.G253R in exon 4 of SLC6A8 was hemizygous in the child, aged 6 years and 6 months, who showed mild intellectual disability with severe speech and language delay. His carrier mother had borderline intellectual functioning. Although the neurochemical and biochemical parameters were fully consistent with those reported in the literature for subjects with CT1 deficit, in our patient within a general cognitive disability, a discrepancy between nonverbal and verbal skills was observed, confirming the peculiar vulnerability of language development under brain Cr depletion. Copyright © 2010 Elsevier Inc. All rights reserved.

  16. Effect of heat stress on the gene expression of ion transporters/channels in the uterus of laying hens during eggshell formation.

    Science.gov (United States)

    Bahadoran, Shahab; Dehghani Samani, Amir; Hassanpour, Hossein

    2018-01-01

    Heat stress is a problem in laying hens as it decreases egg quality by decreasing eggshell mineralization. Heat stress alters gene expression, hence our aim was to investigate effects of heat stress on gene expression of ion transport elements involving in uterine mineralization (TRPV6, CALB1, ITPR3, SCNN1G, SLC4A4, KCNJ15, SLC4A9, and CLCN2) by real time quantitative PCR. Forty 23-week-old White Leghorn laying hens were housed in two rooms. The control group (n = 20) was maintained at 21-23 °C, and the heat stress group (n = 20) was exposed to 36-38 °C for 8 weeks. All parameters of egg quality including egg weight, surface area, volume, and eggshell weight, thickness, ash weight, and calcium content were decreased in the heat stress group compared to the control group (by 26.9%, 32.7%, 44.1%, 38.4%, 31.7%, 39.4%, and 11.1%, respectively). Total plasma calcium was decreased by 13.4%. Levels of ITPR3, SLC4A4, and SLC4A9 transcripts in the uterine lining were decreased in the heat stress group compared to the control group (by 61.4%, 66.1%, and 66.1%, respectively). CALB1 transcript level was increased (by 34.2 fold) in the heat stress group of hens compared to controls. TRPV6, SCNN1G, KCNJ15, and CLCN2 transcript levels did not significantly differ between control and heat stress groups of laying hens. It is concluded that the down-expression of ITPR3, SLC4A4, and SLC4A9 genes may impair transportation of Cl - , HCO 3 - , and Na + in eggshell mineralization during heat stress. Increased CALB1 gene expression may increase resistance of uterine cells to detrimental effects of heat stress.

  17. A partial gene deletion of SLC45A2 causes oculocutaneous albinism in Doberman pinscher dogs.

    Directory of Open Access Journals (Sweden)

    Paige A Winkler

    Full Text Available The first white Doberman pinscher (WDP dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1 produce a detailed description of the ocular phenotype of WDPs, (2 objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3 determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs; cutaneous tumors were noted in 12/20 WDP (5 years of age: 8/8 and 1/20 SDPs (p<0.00001. Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968-77,067,051. This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model.

  18. Functional expression of a human GDP-L-fucose transporter in Escherichia coli.

    Science.gov (United States)

    Förster-Fromme, Karin; Schneider, Sarah; Sprenger, Georg A; Albermann, Christoph

    2017-02-01

    To investigate the translocation of nucleotide-activated sugars from the cytosol across a membrane into the endoplasmatic reticulum or the Golgi apparatus which is an important step in the synthesis of glycoproteins and glycolipids in eukaryotes. The heterologous expression of the recombinant and codon-adapted human GDP-L-fucose antiporter gene SLC35C1 (encoding an N-terminal OmpA-signal sequence) led to a functional transporter protein located in the cytoplasmic membrane of Escherichia coli. The in vitro transport was investigated using inverted membrane vesicles. SLC35C1 is an antiporter specific for GDP-L-fucose and depending on the concomitant reverse transport of GMP. The recombinant transporter FucT1 exhibited an activity for the transport of 3 H-GDP-L-fucose with a V max of 8 pmol/min mg with a K m of 4 µM. The functional expression of SLC35C1 in GDP-L-fucose overproducing E. coli led to the export of GDP-L-fucose to the culture supernatant. The export of GDP-L-fucose by E. coli provides the opportunity for the engineering of a periplasmatic fucosylation reaction in recombinant bacterial cells.

  19. Paroxysmal Exercise-induced Dyskinesias Caused by GLUT1 Deficiency Syndrome

    Directory of Open Access Journals (Sweden)

    Marie Mongin

    2016-03-01

    Full Text Available Background: Glucose transporter type 1 deficiency syndrome is due to de novo mutations in the SLC2A1 gene encoding the glucose transporter type 1. Phenomenology Shown: Paroxysmal motor manifestations induced by exercise or fasting may be the main manifestations of glucose transporter type 1 deficiency syndrome. Educational Value: Proper identification of the paroxysmal events and early diagnosis is important since the disease is potentially treatable.

  20. FENDL/MG-2.0 and FENDL/MC-2.0. The processed cross-section libraries for neutron photon transport calculations. Version 1, March 1997. Summary documentation

    International Nuclear Information System (INIS)

    Wienke, H.; Herman, M.

    1998-01-01

    Evaluated neutron reaction data and photon-atom interaction cross sections for materials contained in the general purpose Fusion Evaluated Nuclear Data Library (FENDL/E2.0) have been processed with the NJOY code system into VITAMIN-J multigroup structure, for use in discrete-ordinates transport codes, and into continuous energy ACE format, for use in the Monte Carlo transport code MCNP. This document summarizes the resulting data libraries FENDL/MG-2.0 version 1 and FENDL/MC-2.0 version 1. The data are available costfree from the IAEA Nuclear Data Section online or on magnetic tape. (author)

  1. Action Potential Shortening and Impairment of Cardiac Function by Ablation of Slc26a6.

    Science.gov (United States)

    Sirish, Padmini; Ledford, Hannah A; Timofeyev, Valeriy; Thai, Phung N; Ren, Lu; Kim, Hyo Jeong; Park, Seojin; Lee, Jeong Han; Dai, Gu; Moshref, Maryam; Sihn, Choong-Ryoul; Chen, Wei Chun; Timofeyeva, Maria Valeryevna; Jian, Zhong; Shimkunas, Rafael; Izu, Leighton T; Chiamvimonvat, Nipavan; Chen-Izu, Ye; Yamoah, Ebenezer N; Zhang, Xiao-Dong

    2017-10-01

    Intracellular pH (pH i ) is critical to cardiac excitation and contraction; uncompensated changes in pH i impair cardiac function and trigger arrhythmia. Several ion transporters participate in cardiac pH i regulation. Our previous studies identified several isoforms of a solute carrier Slc26a6 to be highly expressed in cardiomyocytes. We show that Slc26a6 mediates electrogenic Cl - /HCO 3 - exchange activities in cardiomyocytes, suggesting the potential role of Slc26a6 in regulation of not only pH i , but also cardiac excitability. To test the mechanistic role of Slc26a6 in the heart, we took advantage of Slc26a6 knockout ( Slc26a6 -/ - ) mice using both in vivo and in vitro analyses. Consistent with our prediction of its electrogenic activities, ablation of Slc26a6 results in action potential shortening. There are reduced Ca 2+ transient and sarcoplasmic reticulum Ca 2+ load, together with decreased sarcomere shortening in Slc26a6 -/ - cardiomyocytes. These abnormalities translate into reduced fractional shortening and cardiac contractility at the in vivo level. Additionally, pH i is elevated in Slc26a6 -/ - cardiomyocytes with slower recovery kinetics from intracellular alkalization, consistent with the Cl - /HCO 3 - exchange activities of Slc26a6. Moreover, Slc26a6 -/ - mice show evidence of sinus bradycardia and fragmented QRS complex, supporting the critical role of Slc26a6 in cardiac conduction system. Our study provides mechanistic insights into Slc26a6, a unique cardiac electrogenic Cl - /HCO 3 - transporter in ventricular myocytes, linking the critical roles of Slc26a6 in regulation of pH i , excitability, and contractility. pH i is a critical regulator of other membrane and contractile proteins. Future studies are needed to investigate possible changes in these proteins in Slc26a6 -/ - mice. © 2017 American Heart Association, Inc.

  2. Identification of IGF1, SLC4A4, WWOX, and SFMBT1 as hypertension susceptibility genes in Han Chinese with a genome-wide gene-based association study.

    Directory of Open Access Journals (Sweden)

    Hsin-Chou Yang

    Full Text Available Hypertension is a complex disorder with high prevalence rates all over the world. We conducted the first genome-wide gene-based association scan for hypertension in a Han Chinese population. By analyzing genome-wide single-nucleotide-polymorphism data of 400 matched pairs of young-onset hypertensive patients and normotensive controls genotyped with the Illumina HumanHap550-Duo BeadChip, 100 susceptibility genes for hypertension were identified and also validated with permutation tests. Seventeen of the 100 genes exhibited differential allelic and expression distributions between patient and control groups. These genes provided a good molecular signature for classifying hypertensive patients and normotensive controls. Among the 17 genes, IGF1, SLC4A4, WWOX, and SFMBT1 were not only identified by our gene-based association scan and gene expression analysis but were also replicated by a gene-based association analysis of the Hong Kong Hypertension Study. Moreover, cis-acting expression quantitative trait loci associated with the differentially expressed genes were found and linked to hypertension. IGF1, which encodes insulin-like growth factor 1, is associated with cardiovascular disorders, metabolic syndrome, decreased body weight/size, and changes of insulin levels in mice. SLC4A4, which encodes the electrogenic sodium bicarbonate cotransporter 1, is associated with decreased body weight/size and abnormal ion homeostasis in mice. WWOX, which encodes the WW domain-containing protein, is related to hypoglycemia and hyperphosphatemia. SFMBT1, which encodes the scm-like with four MBT domains protein 1, is a novel hypertension gene. GRB14, TMEM56 and KIAA1797 exhibited highly significant differential allelic and expressed distributions between hypertensive patients and normotensive controls. GRB14 was also found relevant to blood pressure in a previous genetic association study in East Asian populations. TMEM56 and KIAA1797 may be specific to

  3. Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.

    Science.gov (United States)

    Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W

    2014-04-01

    Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.

  4. The application of PIT tags to measure transport of detrital coral fragments on a fringing reef: Majuro Atoll, Marshall Islands

    Science.gov (United States)

    Ford, Murray R.

    2014-06-01

    Passive integrated transponder (PIT) tags are a radio-frequency identification device widely used as a machine-readable identification tool in fisheries research. PIT tags have also been employed, to a lesser extent, to track the movement of gravel-sized clasts within fluvial and coastal systems. In this study, PIT tags were inserted into detrital coral fragments and used to establish source-sink transport pathways on a fringing reef on Majuro Atoll in the Marshall Islands. Results suggest the transport of gravel-sized material on the inter-tidal reef flat is exclusively across-reef towards the lagoon. Considerable variation in the distance travelled by fragments was observed. Fragments were largely intact and visually recognisable after almost 5 months on the reef flat. However, the branches of some recovered fragments had broken off and corallite abrasion was observed in recovered fragments. This study indicates that PIT tags are an inexpensive and powerful new addition to the suite of sediment transport and taphonomic tools for researchers working within coral reef systems.

  5. Insulin-increased L-arginine transport requires A(2A adenosine receptors activation in human umbilical vein endothelium.

    Directory of Open Access Journals (Sweden)

    Enrique Guzmán-Gutiérrez

    Full Text Available Adenosine causes vasodilation of human placenta vasculature by increasing the transport of arginine via cationic amino acid transporters 1 (hCAT-1. This process involves the activation of A(2A adenosine receptors (A(2AAR in human umbilical vein endothelial cells (HUVECs. Insulin increases hCAT-1 activity and expression in HUVECs, and A(2AAR stimulation increases insulin sensitivity in subjects with insulin resistance. However, whether A(2AAR plays a role in insulin-mediated increase in L-arginine transport in HUVECs is unknown. To determine this, we first assayed the kinetics of saturable L-arginine transport (1 minute, 37°C in the absence or presence of nitrobenzylthioinosine (NBTI, 10 µmol/L, adenosine transport inhibitor and/or adenosine receptors agonist/antagonists. We also determined hCAT-1 protein and mRNA expression levels (Western blots and quantitative PCR, and SLC7A1 (for hCAT-1 reporter promoter activity. Insulin and NBTI increased the extracellular adenosine concentration, the maximal velocity for L-arginine transport without altering the apparent K(m for L-arginine transport, hCAT-1 protein and mRNA expression levels, and SLC7A1 transcriptional activity. An A2AAR antagonist ZM-241385 blocked these effects. ZM241385 inhibited SLC7A1 reporter transcriptional activity to the same extent in cells transfected with pGL3-hCAT-1(-1606 or pGL3-hCAT-1(-650 constructs in the presence of NBTI + insulin. However, SLC7A1 reporter activity was increased by NBTI only in cells transfected with pGL3-hCAT-1(-1606, and the ZM-241385 sensitive fraction of the NBTI response was similar in the absence or in the presence of insulin. Thus, insulin modulation of hCAT-1 expression and activity requires functional A(2AAR in HUVECs, a mechanism that may be applicable to diseases associated with fetal insulin resistance, such as gestational diabetes.

  6. A single base deletion in the SLC45A2 gene in a Bullmastiff with oculocutaneous albinism.

    Science.gov (United States)

    Caduff, M; Bauer, A; Jagannathan, V; Leeb, T

    2017-10-01

    Oculocutaneous albinism type 4 (OCA4) in humans and similar phenotypes in many animal species are caused by variants in the SLC45A2 gene, encoding a putative sugar transporter. In dog, two independent SLC45A2 variants are known that cause oculocutaneous albinism in Doberman Pinschers and several small dog breeds respectively. For the present study, we investigated a Bullmastiff with oculocutaneous albinism. The affected dog was highly inbred and resulted from the mating of a sire to its own grandmother. We obtained whole genome sequence data from the affected dog and searched specifically for variants in candidate genes known to cause albinism. We detected a single base deletion in exon 6 of the SLC45A2 gene (NM_001037947.1:c.1287delC) that has not been reported thus far. This deletion is predicted to result in an early premature stop codon. It was confirmed by Sanger sequencing and perfectly co-segregated with the phenotype in the available family members. We genotyped 174 unrelated dogs from diverse breeds, all of which were homozygous wildtype. We therefore suggest that SLC45A2:c.1287delC causes the observed oculocutaneous albinism in the affected Bullmastiff. © 2017 Stichting International Foundation for Animal Genetics.

  7. Reduced Slc6a15 in Nucleus Accumbens D2-Neurons Underlies Stress Susceptibility.

    Science.gov (United States)

    Chandra, Ramesh; Francis, T Chase; Nam, Hyungwoo; Riggs, Lace M; Engeln, Michel; Rudzinskas, Sarah; Konkalmatt, Prasad; Russo, Scott J; Turecki, Gustavo; Iniguez, Sergio D; Lobo, Mary Kay

    2017-07-05

    Previous research demonstrates that Slc6a15, a neutral amino acid transporter, is associated with depression susceptibility. However, no study examined Slc6a15 in the ventral striatum [nucleus accumbens (NAc)] in depression. Given our previous characterization of Slc6a15 as a striatal dopamine receptor 2 (D2)-neuron-enriched gene, we examined the role of Slc6a15 in NAc D2-neurons in mediating susceptibility to stress in male mice. First, we showed that Slc6a15 mRNA was reduced in NAc of mice susceptible to chronic social defeat stress (CSDS), a paradigm that produces behavioral and molecular adaptations that resemble clinical depression. Consistent with our preclinical data, we observed Slc6a15 mRNA reduction in NAc of individuals with major depressive disorder (MDD). The Slc6a15 reduction in NAc occurred selectively in D2-neurons. Next, we used Cre-inducible viruses combined with D2-Cre mice to reduce or overexpress Slc6a15 in NAc D2-neurons. Slc6a15 reduction in D2-neurons caused enhanced susceptibility to a subthreshold social defeat stress (SSDS) as observed by reduced social interaction, while a reduction in social interaction following CSDS was not observed when Slc6a15 expression in D2-neurons was restored. Finally, since both D2-medium spiny neurons (MSNs) and D2-expressing choline acetyltransferase (ChAT) interneurons express Slc6a15, we examined Slc6a15 protein in these interneurons after CSDS. Slc6a15 protein was unaltered in ChAT interneurons. Consistent with this, reducing Slc5a15 selectively in NAc D2-MSNs, using A2A-Cre mice that express Cre selectively in D2-MSNs, caused enhanced susceptibility to SSDS. Collectively, our data demonstrate that reduced Slc6a15 in NAc occurs in MDD individuals and that Slc6a15 reduction in NAc D2-neurons underlies stress susceptibility. SIGNIFICANCE STATEMENT Our study demonstrates a role for reduced Slc6a15, a neutral amino acid transporter, in nucleus accumbens (NAc) in depression and stress susceptibility. The

  8. PAT1 (SLC36A1) shows nuclear localization and affect growth of smooth muscle cells from rats

    DEFF Research Database (Denmark)

    Jensen, Anne; Figueiredo-Larsen, Evan Manuel; Holm, René

    2014-01-01

    The proton-coupled amino acid transporter 1 (PAT1) is a transporter of amino acids in small intestinal enterocytes. PAT1 is, however, also capable of regulating cell growth and sensing the availability of amino acids in other cell types. The aim of the present study was to investigate the localiz...

  9. Magnesium prevents phosphate-induced vascular calcification via TRPM7 and Pit-1 in an aortic tissue culture model.

    Science.gov (United States)

    Sonou, Tomohiro; Ohya, Masaki; Yashiro, Mitsuru; Masumoto, Asuka; Nakashima, Yuri; Ito, Teppei; Mima, Toru; Negi, Shigeo; Kimura-Suda, Hiromi; Shigematsu, Takashi

    2017-06-01

    Previous clinical and experimental studies have indicated that magnesium may prevent vascular calcification (VC), but mechanistic characterization has not been reported. This study investigated the influence of increasing magnesium concentrations on VC in a rat aortic tissue culture model. Aortic segments from male Sprague-Dawley rats were incubated in serum-supplemented high-phosphate medium for 10 days. The magnesium concentration in this medium was increased to demonstrate its role in preventing VC, which was assessed by imaging and spectroscopy. The mineral composition of the calcification was analyzed using Fourier transform infrared (FTIR) spectroscopic imaging, scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDX) mapping. Magnesium supplementation of high-phosphate medium dose-dependently suppressed VC (quantified as aortic calcium content), and almost ablated it at 2.4 mm magnesium. The FTIR images and SEM-EDX maps indicated that the distribution of phosphate (as hydroxyapatite), phosphorus and Mg corresponded with calcium content in the aortic ring and VC. The inhibitory effect of magnesium supplementation on VC was partially reduced by 2-aminoethoxy-diphenylborate, an inhibitor of TRPM7. Furthermore, phosphate transporter-1 (Pit-1) protein expression was increased in tissues cultured in HP medium and was gradually-and dose dependently-decreased by magnesium. We conclude that a mechanism involving TRPM7 and Pit-1 underpins the magnesium-mediated reversal of high-phosphate-associated VC.

  10. Identification of novel mutations in HFE, HFE2, TfR2, and SLC40A1 genes in Chinese patients affected by hereditary hemochromatosis.

    Science.gov (United States)

    Wang, Yongwei; Du, Yali; Liu, Gang; Guo, Shanshan; Hou, Bo; Jiang, Xianyong; Han, Bing; Chang, Yanzhong; Nie, Guangjun

    2017-04-01

    Hereditary hemochromatosis (HH) is a group of inherited iron-overload disorders associated with pathogenic defects in the genes encoding hemochromatosis (HFE), hemojuvelin (HJV/HFE2), hepcidin (HAMP), transferrin receptor 2 (TfR2), and ferroportin (FPN1/SLC40A1) proteins, and the clinical features are well described. However, there have been only a few detailed reports of HH in Chinese populations. Thus, there is insufficient patient information for population-based analyses in Chinese populations or comparative studies among different ethical groups. In the current work, we describe eight Chinese cases of hereditary hemochromatosis. Gene sequencing results revealed eight mutations (five novel mutations) in HFE, HFE2, TfR2, and SLC40A1 genes in these Chinese HH patients. In addition, we used Polymorphism Phenotyping v2 (Polyphen), Sorting Intolerant From Tolerant (SIFT), and a sequence alignment program to predict the molecular consequences of missense mutations.

  11. Immunohistochemical expression profiles of solute carrier transporters in alpha-fetoprotein-producing gastric cancer.

    Science.gov (United States)

    Shimakata, Takaaki; Kamoshida, Shingo; Kawamura, Jumpei; Ogane, Naoki; Kameda, Yoichi; Yanagita, Emmy; Itoh, Tomoo; Takeda, Risa; Naka, Ayano; Sakamaki, Kuniko; Hayashi, Yurie; Kuwao, Sadahito

    2016-11-01

    Alpha-fetoprotein (AFP)-producing gastric cancer (GC) is an aggressive tumour with high rates of liver metastasis and poor prognosis, and for which a validated chemotherapy regimen has not been established. Drug uptake by solute carrier (SLC) transporters is proposed as one of the mechanisms involved in sensitivity to chemotherapy. In this study, we aimed to develop important insights into effective chemotherapeutic regimens for AFP-producing GC. We evaluated immunohistochemically the expression levels of a panel of SLC transporters in 20 AFP-producing GCs and 130 conventional GCs. SLC transporters examined were human equilibrative nucleoside transporter 1 (hENT1), organic anion transporter 2 (OAT2), organic cation transporter (OCT) 2, OCT6 and organic anion-transporting polypeptide 1B3 (OATP1B3). The rates of high expression levels of hENT1 (hENT1 high ) and OAT2 (OAT2 high ) were statistically higher in AFP-producing GC, compared with conventional GC. When analysing hENT1 and OAT2 in combination, hENT1 high /OAT2 high was the most particular expression profile for AFP-producing GC, with a greater significance than hENT1 or OAT2 alone. However, no significant differences in OCT2, OCT6 or OATP1B3 levels were detected between AFP-producing and conventional GCs. However, immunoreactivity for hENT1, OAT2 and OCT6 tended to be increased in GC tissues compared with non-neoplastic epithelia. Because hENT1 and OAT2 are crucial for the uptake of gemcitabine and 5-fluorouracil, respectively, our results suggest that patients with AFP-producing GC could potentially benefit from gemcitabine/fluoropyrimidine combination chemotherapy. Increased expression of hENT1, OAT2 and OCT6 may also be associated with the progression of GC. © 2016 John Wiley & Sons Ltd.

  12. A Pilot Study Evaluating the Contribution of SLC19A1 (RFC-1 80G>A Polymorphism to Alzheimer’s Disease in Italian Caucasians

    Directory of Open Access Journals (Sweden)

    Fabio Coppedè

    2014-01-01

    Full Text Available Alzheimer’s disease (AD is the most common neurodegenerative disorder and the primary form of dementia in the elderly. Polymorphisms of genes involved in folate metabolism have been frequently suggested as risk factors for sporadic AD. A common c.80G>A polymorphism (rs1051266 in the gene coding for the reduced folate carrier (SLC19A1 gene, commonly known as RFC-1 gene was investigated as AD risk factor in Asian populations, yielding conflicting results. We screened a Caucasian population of Italian origin composed of 192 sporadic AD patients and 186 healthy matched controls, for the presence of the RFC-1 c.80G>A polymorphism, and searched for correlation with circulating levels of folate, homocysteine, and vitamin B12. No difference in the distribution of allele and genotype frequencies was observed between AD patients and controls. No correlation was observed among the genotypes generated by the RFC-1 c.80G>A polymorphism and circulating levels of folate, homocysteine, and vitamin B12 either in the whole cohort of subjects or after stratification into clinical subtypes. Present results do not support a role for the RFC-1 c.80G>A polymorphism as independent risk factor for sporadic AD in Italian Caucasians.

  13. Dynamic interactions of the asialoglycoprotein receptor subunits with coated pits. Enhanced interactions of H2 following association with H1.

    Science.gov (United States)

    Katzir, Z; Nardi, N; Geffen, I; Fuhrer, C; Henis, Y I

    1994-08-26

    Lateral mobility studies comparing native and mutated membrane proteins, combined with treatments that alter clathrin lattice structure, can measure membrane protein-coated pit interactions in intact cells (Fire, E., Zwart, D., Roth, M. G., and Henis, Y. I. (1991) J. Cell Biol. 115, 1585-1594). We applied this approach to study the interactions of the H1 and H2 human asialoglycoprotein receptor subunits with coated pits. The lateral mobilities of singly expressed and coexpressed H1 and H2B (the H2 species that reaches the cell surface) were measured by fluorescence photobleaching recovery. They were compared with mutant proteins, H1(5A) (Tyr-5 replaced by Ala) and H2(5A) (Phe-5 replaced by Ala). While the mobile fractions of H1, H2B, and their mutants were similar, the lateral diffusion rate (measured by D, the lateral diffusion coefficient) was significantly slower for H1, whether expressed alone or with H2B. Coexpression with H1 reduced D of H2B to that of H1. Disruption of the clathrin lattices by hypertonic medium elevated D of H1, H1(5A), H2B, and H2(5A) to the same final level, without affecting their mobile fractions. Cytosol acidification, which retains altered clathrin lattices attached to the membrane and prevents coated vesicle formation, immobilized part of the H1 molecules, reflecting stable entrapment in "frozen" coated pits. H1(5A), H2B, and H2(5A) were not affected; however, coexpression of H2B with H1 conferred the sensitivity to cytosol acidification on H2B. Our results suggest that H1 lateral mobility is inhibited by dynamic interactions with coated pits in which Tyr-5 is involved. H2B resembles H1(5A) rather than H1, and its interactions with coated pits are weaker; efficient interaction of H2B with coated pits depends on complex formation with H1.

  14. SLC injector simulation and tuning for high charge transport

    International Nuclear Information System (INIS)

    Yeremian, A.D.; Miller, R.H.; Clendenin, J.E.; Early, R.A.; Ross, M.C.; Turner, J.L.; Wang, J.W.

    1992-01-01

    We have simulated the SLC injector from the thermionic gun through the first accelerating section and used the resulting parameters to tune the injector for optimum performance and high charge transport. Simulations are conducted using PARMELA, a three-dimensional space-charge model. The magnetic field profile due to the existing magnetic optics is calculated using POISSON, while SUPERFISH is used to calculate the space harmonics of the various bunchers and the accelerator cavities. The initial beam conditions in the PARMELA code are derived from the EGUN model of the gun. The resulting injector parameters from the PARMELA simulation are used to prescribe experimental settings of the injector components. The experimental results are in agreement with the results of the integrated injector model. (Author) 5 figs., 7 refs

  15. Genetic variants in the regulatory region of SLC10A1 are not associated with the risk of hepatitis B virus infection and clearance.

    Science.gov (United States)

    Chen, Xueqin; Wang, Ying; Chen, Xiaohua; Cheng, Kailiang; Li, Jiaoyuan; Lou, Jiao; Ke, Juntao; Yang, Yang; Gong, Yajie; Zhu, Ying; Wang, Li; Zhong, Rong

    2016-10-01

    The Na/taurocholate cotransporter NTCP (encoded by SLC10A1) was identified as a cellular entry receptor for the human hepatitis B virus (HBV), advancing our understanding of the molecular mechanism of HBV infection. An alternative hypothesis was put forward that regulatory variants in SLC10A1 might play an important role in HBV susceptibility by potentially influencing expression levels of NTCP. The three regulatory SNPs (rs8011311, rs7154439, rs111409076) were genotyped in 1023 HBV-persistent carriers, 735 subjects with HBV natural clearance and 732 HBV marker-negative subjects in a Han Chinese population. Real-time reverse transcription PCR analysis and luciferase assays have been performed to dissect the potential functionality. In logistic regression analysis, when subjects with HBV natural clearance were compared with HBV marker-negative subjects, no significant associations with the risk of HBV infection were observed for any of the three SNPs after adjusting for age, sex, smoking status and alcohol consumption (P>0.05). Similar negative results were also found for the three SNPs when HBV-persistent carriers were compared with HBV marker-negative subjects. Likewise, no significant associations with the risk of HBV clearance were observed when HBV-persistent carriers were compared with subjects with HBV natural clearance (P>0.05). Quantitative RT/PCR showed no significant difference in NTCP expression levels in normal liver tissue amongst individuals with different rs111409076 genotypes (P=0.317 for the general linear model). Moreover, no evident effect of the SLC10A1 rs111409076 AACA/- polymorphism on transcriptional activity was found by luciferase assay in either HepG2 (P=0.161) or Hep3b (P=0.129) cell lines. The present study indicated that the common variants in the regulatory region of SLC10A1 may not influence the expression of NTCP at the level of transcriptional regulation, and ultimately may not be associated with HBV susceptibility in this Chinese

  16. Characteristics of Mammalian Rh Glycoproteins (SLC42 transporters) and Their Role in Acid-Base Transport

    Science.gov (United States)

    Nakhoul, Nazih L.; Hamm, L. Lee

    2012-01-01

    The mammalian Rh glycoproteins belong to the solute transporter family SLC42 and include RhAG, present in red blood cells, and two non-erythroid members RhBG and RhCG that are expressed in various tissues, including kidney, liver, skin and the GI tract. The Rh proteins in the red blood cell form an “Rh complex” made up of one D-subunit, one CE-subunit and two RhAG subunits. The Rh complex has a well-known antigenic effect but also contributes to the stability of the red cell membrane. RhBG and RhCG are related to the NH4+ transporters of the yeast and bacteria but their exact function is yet to be determined. This review describes the expression and molecular properties of these membrane proteins and their potential role as NH3/NH4+ and CO2 transporters. The likelihood that these proteins transport gases such as CO2 or NH3 is novel and significant. The review also describes the physiological importance of these proteins and their relevance to human disease. PMID:23506896

  17. Drosophila SLC5A11 Mediates Hunger by Regulating K(+) Channel Activity.

    Science.gov (United States)

    Park, Jin-Yong; Dus, Monica; Kim, Seonil; Abu, Farhan; Kanai, Makoto I; Rudy, Bernardo; Suh, Greg S B

    2016-08-08

    Hunger is a powerful drive that stimulates food intake. Yet, the mechanism that determines how the energy deficits that result in hunger are represented in the brain and promote feeding is not well understood. We previously described SLC5A11-a sodium/solute co-transporter-like-(or cupcake) in Drosophila melanogaster, which is required for the fly to select a nutritive sugar over a sweeter nonnutritive sugar after periods of food deprivation. SLC5A11 acts on approximately 12 pairs of ellipsoid body (EB) R4 neurons to trigger the selection of nutritive sugars, but the underlying mechanism is not understood. Here, we report that the excitability of SLC5A11-expressing EB R4 neurons increases dramatically during starvation and that this increase is abolished in the SLC5A11 mutation. Artificial activation of SLC5A11-expresssing neurons is sufficient to promote feeding and hunger-driven behaviors; silencing these neurons has the opposite effect. Notably, SLC5A11 transcript levels in the brain increase significantly when flies are starved and decrease shortly after starved flies are refed. Furthermore, expression of SLC5A11 is sufficient for promoting hunger-driven behaviors and enhancing the excitability of SLC5A11-expressing neurons. SLC5A11 inhibits the function of the Drosophila KCNQ potassium channel in a heterologous expression system. Accordingly, a knockdown of dKCNQ expression in SLC5A11-expressing neurons produces hunger-driven behaviors even in fed flies, mimicking the overexpression of SLC5A11. We propose that starvation increases SLC5A11 expression, which enhances the excitability of SLC5A11-expressing neurons by suppressing dKCNQ channels, thereby conferring the hunger state. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Molecular Mechanisms of Urea Transport in Health and Disease

    Science.gov (United States)

    Klein, Janet D.; Blount, Mitsi A.; Sands, Jeff M.

    2012-01-01

    In the late 1980s, urea permeability measurements produced values that could not be explained by paracellular transport or lipid phase diffusion. The existence of urea transport proteins were thus proposed and less than a decade later, the first urea transporter was cloned. The SLC14A family of urea transporters has two major subgroups, designated SLC14A1 (or UT-B) and Slc14A2 (or UT-A). UT-B and UT-A gene products are glycoproteins located in various extra-renal tissues however, a majority of the resulting isoforms are found in the kidney. The UT-B (Slc14A1) urea transporter was originally isolated from erythrocytes and two isoforms have been reported. In kidney, UT-B is located primarily in the descending vasa recta. The UT-A (Slc14A2) urea transporter yields 6 distinct isoforms, of which 3 are found chiefly in the kidney medulla. UT-A1 and UT-A3 are found in the inner medullary collecting duct (IMCD), while UT-A2 is located in the thin descending limb. These transporters are crucial to the kidney’s ability to concentrate urine. The regulation of urea transporter activity in the IMCD involves acute modification through phosphorylation and subsequent movement to the plasma membrane. UT-A1 and UT-A3 accumulate in the plasma membrane in response to stimulation by vasopressin or hypertonicity. Long term regulation of the urea transporters in the IMCD involves altering protein abundance in response to changes in hydration status, low protein diets, or adrenal steroids. Urea transporters have been studied using animal models of disease including diabetes mellitus, lithium intoxication, hypertension, and nephrotoxic drug responses. Exciting new genetically engineered mouse models are being developed to study these transporters. PMID:23007461

  19. Sodium/bicarbonate cotransporter NBCn1/slc4a7 increases cytotoxicity in magnesium depletion in primary cultures of hippocampal neurons

    Science.gov (United States)

    Cooper, Deborah S.; Yang, Han Soo; He, Peijian; Kim, Eunjin; Rajbhandari, Ira; Yun, Chris C.; Choi, Inyeong

    2009-01-01

    Growing evidence suggests that pharmacological inhibition of Na/H exchange and Na/HCO3 transport provides protection against damage or injury in cardiac ischemia. In this study, we examined the contribution of the sodium/bicarbonate cotransporter NBCn1 (slc4a7) to cytotoxicity in cultured hippocampal neurons of rats. In neurons exposed to extracellular pH (pHo) ranging from 6.2 to 8.3, NBCn1 protein expression increased by fivefold at pH < 6.5 compared to the expression at pHo 7.4. At pHo 6.5, the intracellular pH of neurons was ~1 unit lower than that at pH 7.4. Immunochemistry showed a marked increase in NBCn1 immunofluorescence in plasma membranes and cytosol of the soma as well as in dendrites, at pHo 6.5. NBCn1 expression also increased by 40% in a prolonged Mg2+-free incubation at normal pHo. Knockdown of NBCn1 in neurons had negligible effect on cell viability. The effect of NBCn1 knockdown on cytotoxicity was then determined by exposing neurons to 0.5 mM glutamate for 10 min and measuring lactate dehydrogenase (LDH) release from neurons. Compared to normal incubation (pHo 7.2 for 6 h) after glutamate exposure, acidic incubation (pHo 6.3 for 6 h) reduced cytotoxicity by 75% for control neurons and 78% for NBCn1-knockdown neurons. Thus, both controls and knockdown neurons showed acidic protection from cytotoxicity. However, in Mg2+-free incubation after glutamate exposure, NBCn1 knockdown progressively attenuated cytotoxicity. This attenuation was unaffected by acidic preincubation before glutamate exposure. We conclude that NBCn1 has a dynamic upregulation in low pHo and Mg2+ depletion. NBCn1 is not required for acidic protection, but increases cytotoxicity in Mg2+-free conditions. PMID:19170751

  20. A DATABASE OF >20 keV ELECTRON GREEN'S FUNCTIONS OF INTERPLANETARY TRANSPORT AT 1 AU

    Energy Technology Data Exchange (ETDEWEB)

    Agueda, N.; Sanahuja, B. [Departament d' Astronomia i Meteorologia, Institut de Ciencies del Cosmos, Universitat de Barcelona, Barcelona (Spain); Vainio, R. [Department of Physics, University of Helsinki, Helsinki (Finland)

    2012-10-15

    We use interplanetary transport simulations to compute a database of electron Green's functions, i.e., differential intensities resulting at the spacecraft position from an impulsive injection of energetic (>20 keV) electrons close to the Sun, for a large number of values of two standard interplanetary transport parameters: the scattering mean free path and the solar wind speed. The nominal energy channels of the ACE, STEREO, and Wind spacecraft have been used in the interplanetary transport simulations to conceive a unique tool for the study of near-relativistic electron events observed at 1 AU. In this paper, we quantify the characteristic times of the Green's functions (onset and peak time, rise and decay phase duration) as a function of the interplanetary transport conditions. We use the database to calculate the FWHM of the pitch-angle distributions at different times of the event and under different scattering conditions. This allows us to provide a first quantitative result that can be compared with observations, and to assess the validity of the frequently used term beam-like pitch-angle distribution.

  1. Deletion of the γ-Aminobutyric Acid Transporter 2 (GAT2 and SLC6A13) Gene in Mice Leads to Changes in Liver and Brain Taurine Contents*

    Science.gov (United States)

    Zhou, Yun; Holmseth, Silvia; Guo, Caiying; Hassel, Bjørnar; Höfner, Georg; Huitfeldt, Henrik S.; Wanner, Klaus T.; Danbolt, Niels C.

    2012-01-01

    The GABA transporters (GAT1, GAT2, GAT3, and BGT1) have mostly been discussed in relation to their potential roles in controlling the action of transmitter GABA in the nervous system. We have generated the first mice lacking the GAT2 (slc6a13) gene. Deletion of GAT2 (both mRNA and protein) neither affected growth, fertility, nor life span under nonchallenging rearing conditions. Immunocytochemistry showed that the GAT2 protein was predominantly expressed in the plasma membranes of periportal hepatocytes and in the basolateral membranes of proximal tubules in the renal cortex. This was validated by processing tissue from wild-type and knockout mice in parallel. Deletion of GAT2 reduced liver taurine levels by 50%, without affecting the expression of the taurine transporter TAUT. These results suggest an important role for GAT2 in taurine uptake from portal blood into liver. In support of this notion, GAT2-transfected HEK293 cells transported [3H]taurine. Furthermore, most of the uptake of [3H]GABA by cultured rat hepatocytes was due to GAT2, and this uptake was inhibited by taurine. GAT2 was not detected in brain parenchyma proper, excluding a role in GABA inactivation. It was, however, expressed in the leptomeninges and in a subpopulation of brain blood vessels. Deletion of GAT2 increased brain taurine levels by 20%, suggesting a taurine-exporting role for GAT2 in the brain. PMID:22896705

  2. SLC injector simulation and tuning for high charge transport

    International Nuclear Information System (INIS)

    Yeremian, A.D.; Miller, R.H.; Clendenin, J.E.; Early, R.A.; Ross, M.C.; Turner, J.L.; Wang, J.W.

    1992-08-01

    We have simulated the SLC injector from the thermionic gun through the first accelerating section and used the resulting parameters to tune the injector for optimum performance and high charge transport. Simulations are conducted using PARMELA, a three-dimensional ray-trace code with a two-dimensional space-charge model. The magnetic field profile due to the existing magnetic optics is calculated using POISSON, while SUPERFISH is used to calculate the space harmonics of the various bunchers and the accelerator cavities. The initial beam conditions in the PARMELA code are derived from the EGUN model of the gun. The resulting injector parameters from the PARMELA simulation are used to prescribe experimental settings of the injector components. The experimental results are in agreement with the results of the integrated injector model

  3. MCT1-mediated transport of a toxic molecule is an effective strategy for targeting glycolytic tumors

    Science.gov (United States)

    Birsoy, Kivanc; Wang, Tim; Possemato, Richard; Yilmaz, Omer H.; Koch, Catherine E.; Chen, Walter W.; Hutchins, Amanda W.; Gultekin, Yetis; Peterson, Tim R.; Carette, Jan E.; Brummelkamp, Thijn R.; Clish, Clary B.; Sabatini, David M.

    2012-01-01

    SUMMARY There is increasing evidence that oncogenic transformation modifies the metabolic program of cells. A common alteration is the upregulation of glycolysis, and efforts to target glycolytic enzymes for anti-cancer therapy are underway. Here, we performed a genome-wide haploid genetic screen to identify resistance mechanisms to 3-bromopyruvate (3-BrPA), a drug candidate that inhibits glycolysis in a poorly understood fashion. We identified the SLC16A1 gene product, MCT1, as the main determinant of 3-BrPA sensitivity. MCT1 is necessary and sufficient for 3-BrPA uptake by cancer cells. Additionally, MCT1 mRNA levels are the best predictor of 3-BrPA sensitivity and are most elevated in glycolytic cancer cells. Lastly, forced MCT1 expression in 3-BrPA resistant cancer cells sensitizes tumor xenografts to 3-BrPA treatment in vivo. Our results identify a potential biomarker for 3-BrPA sensitivity and provide proof of concept that the selectivity of cancer-expressed transporters can be exploited for delivering toxic molecules to tumors. PMID:23202129

  4. Calcium Overload Accelerates Phosphate-Induced Vascular Calcification Via Pit-1, but not the Calcium-Sensing Receptor.

    Science.gov (United States)

    Masumoto, Asuka; Sonou, Tomohiro; Ohya, Masaki; Yashiro, Mitsuru; Nakashima, Yuri; Okuda, Kouji; Iwashita, Yuko; Mima, Toru; Negi, Shigeo; Shigematsu, Takashi

    2017-07-01

    Vascular calcification (VC) is a risk factor of cardiovascular and all-cause mortality in patients with chronic kidney disease (CKD). CKD-mineral and bone metabolism disorder is an important problem in patients with renal failure. Abnormal levels of serum phosphate and calcium affect CKD-mineral and bone metabolism disorder and contribute to bone disease, VC, and cardiovascular disease. Hypercalcemia is a contributing factor in progression of VC in patients with CKD. However, the mechanisms of how calcium promotes intracellular calcification are still unclear. This study aimed to examine the mechanisms underlying calcium-induced calcification in a rat aortic tissue culture model. Aortic segments from 7-week-old male Sprague-Dawley rats were cultured in serum-supplemented medium for 10 days. We added high calcium (HiCa; calcium 3.0 mM) to high phosphate (HPi; phosphate 3.8 mM) medium to accelerate phosphate and calcium-induced VC. We used phosphonoformic acid and the calcimimetic R-568 to determine whether the mechanism of calcification involves Pit-1 or the calcium-sensing receptor. Medial VC was significantly augmented by HPi+HiCa medium compared with HPi alone (300%, p<0.05), and was associated with upregulation of Pit-1 protein. Pit-1 protein concentrations in HPi+HiCa medium were greater than those in HPi medium. Phosphonoformic acid completely negated the augmentation of medial VC induced by HPi+HiCa. R-568 had no additive direct effect on medial VC. These results indicated that exposure to HPi+HiCa accelerates medial VC, and this is mediated through Pit-1, not the calcium-sensing receptor.

  5. Importance of uncharged polar residues and proline in the proximal two-thirds (Pro107–Ser128 of the highly conserved region of mouse ileal Na+-dependent bile acid transporter, Slc10a2, in transport activity and cellular expression

    Directory of Open Access Journals (Sweden)

    Saeki Tohru

    2013-02-01

    Full Text Available Abstract Background SLC10A2-mediated reabsorption of bile acids at the distal end of the ileum is the first step in enterohepatic circulation. Because bile acids act not only as detergents but also as signaling molecules in lipid metabolism and energy production, SLC10A2 is important as the key transporter for understanding the in vivo kinetics of bile acids. SLC10A family members and the homologous genes of various species share a highly conserved region corresponding to Gly104–Pro142 of SLC10A2. The functional importance of this region has not been fully elucidated. Results To elucidate the functional importance of this region, we previously performed mutational analysis of the uncharged polar residues and proline in the distal one-third (Thr130–Pro142 of the highly conserved region in mouse Slc10a2. In this study, proline and uncharged polar residues in the remaining two-thirds of this region in mouse Slc10a2 were subjected to mutational analysis, and taurocholic acid uptake and cell surface localization were examined. Cell surface localization of Slc10a2 is necessary for bile acid absorption. Mutants in which Asp or Leu were substituted for Pro107 (P107N or P107L were abundantly expressed, but their cell surface localization was impaired. The S126A mutant was completely impaired in cellular expression. The T110A and S128A mutants exhibited remarkably enhanced membrane expression. The S112A mutant was properly expressed at the cell surface but transport activity was completely lost. Replacement of Tyr117 with various amino acids resulted in reduced transport activity. The degree of reduction roughly depended on the van der Waals volume of the side chains. Conclusions The functional importance of proline and uncharged polar residues in the highly conserved region of mouse Slc10a2 was determined. This information will contribute to the design of bile acid-conjugated prodrugs for efficient drug delivery or SLC10A2 inhibitors for

  6. DNA methylation of amino acid transporter genes in the human placenta.

    Science.gov (United States)

    Simner, C; Novakovic, B; Lillycrop, K A; Bell, C G; Harvey, N C; Cooper, C; Saffery, R; Lewis, R M; Cleal, J K

    2017-12-01

    Placental transfer of amino acids via amino acid transporters is essential for fetal growth. Little is known about the epigenetic regulation of amino acid transporters in placenta. This study investigates the DNA methylation status of amino acid transporters and their expression across gestation in human placenta. BeWo cells were treated with 5-aza-2'-deoxycytidine to inhibit methylation and assess the effects on amino acid transporter gene expression. The DNA methylation levels of amino acid transporter genes in human placenta were determined across gestation using DNA methylation array data. Placental amino acid transporter gene expression across gestation was also analysed using data from publically available Gene Expression Omnibus data sets. The expression levels of these transporters at term were established using RNA sequencing data. Inhibition of DNA methylation in BeWo cells demonstrated that expression of specific amino acid transporters can be inversely associated with DNA methylation. Amino acid transporters expressed in term placenta generally showed low levels of promoter DNA methylation. Transporters with little or no expression in term placenta tended to be more highly methylated at gene promoter regions. The transporter genes SLC1A2, SLC1A3, SLC1A4, SLC7A5, SLC7A11 and SLC7A10 had significant changes in enhancer DNA methylation across gestation, as well as gene expression changes across gestation. This study implicates DNA methylation in the regulation of amino acid transporter gene expression. However, in human placenta, DNA methylation of these genes remains low across gestation and does not always play an obvious role in regulating gene expression, despite clear evidence for differential expression as gestation proceeds. Copyright © 2017. Published by Elsevier Ltd.

  7. SLC4A11 Prevents Osmotic Imbalance Leading to Corneal Endothelial Dystrophy, Deafness, and Polyuria*

    Science.gov (United States)

    Gröger, Nicole; Fröhlich, Henning; Maier, Hannes; Olbrich, Andrea; Kostin, Sawa; Braun, Thomas; Boettger, Thomas

    2010-01-01

    Maintenance of ion concentration gradients is essential for the function of many organs, including the kidney, the cornea, and the inner ear. Ion concentrations and fluid content in the cornea are regulated by endothelial cells that separate the collagenous avascular corneal stroma from the anterior eye chamber. Failure to maintain correct ion concentrations leads to swelling and destruction of the cornea. In the inner ear, the stria vascularis is responsible for generating proper ion concentrations in the endolymph, which is essential for hearing. Mutations of SLC4A11 in humans lead to syndromes associated with corneal dystrophy and perceptive deafness. The molecular mechanisms underlying these symptoms are poorly understood, impeding therapeutic interventions. The ion transporter SLC4A11 mediates sodium-dependent transport of borate as well as flux of sodium and hydroxyl ions in vitro. Here, we show that SLC4A11 is expressed in the endothelial cells of the cornea where it prevents severe morphological changes of the cornea caused by increased sodium chloride concentrations in the stroma. In the inner ear, SLC4A11 is located in fibrocytes underlying the stria vascularis. Loss of SLC4A11 leads to morphological changes in the fibrocytes and deafness. We demonstrate that SLC4A11 is essential for the generation of the endocochlear potential but not for regulation of potassium concentrations in the endolymph. In the kidney, SLC4A11 is expressed in the thin descending limb of Henle loop. SLC4A11 is essential for urinary concentration, suggesting that SLC4A11 participates in the countercurrent multiplication that concentrates urine in the kidney medulla. PMID:20185830

  8. SLC2A3 single-nucleotide polymorphism and duplication influence cognitive processing and population-specific risk for attention-deficit/hyperactivity disorder.

    Science.gov (United States)

    Merker, Sören; Reif, Andreas; Ziegler, Georg C; Weber, Heike; Mayer, Ute; Ehlis, Ann-Christine; Conzelmann, Annette; Johansson, Stefan; Müller-Reible, Clemens; Nanda, Indrajit; Haaf, Thomas; Ullmann, Reinhard; Romanos, Marcel; Fallgatter, Andreas J; Pauli, Paul; Strekalova, Tatyana; Jansch, Charline; Vasquez, Alejandro Arias; Haavik, Jan; Ribasés, Marta; Ramos-Quiroga, Josep Antoni; Buitelaar, Jan K; Franke, Barbara; Lesch, Klaus-Peter

    2017-07-01

    Attention-deficit/hyperactivity disorder (ADHD) is a common, highly heritable neurodevelopmental disorder with profound cognitive, behavioral, and psychosocial impairments with persistence across the life cycle. Our initial genome-wide screening approach for copy number variants (CNVs) in ADHD implicated a duplication of SLC2A3, encoding glucose transporter-3 (GLUT3). GLUT3 plays a critical role in cerebral glucose metabolism, providing energy for the activity of neurons, which, in turn, moderates the excitatory-inhibitory balance impacting both brain development and activity-dependent neural plasticity. We therefore aimed to provide additional genetic and functional evidence for GLUT3 dysfunction in ADHD. Case-control association analyses of SLC2A3 single-nucleotide polymorphisms (SNPs) and CNVs were conducted in several European cohorts of patients with childhood and adult ADHD (SNP, n = 1,886 vs. 1,988; CNV, n = 1,692 vs. 1,721). These studies were complemented by SLC2A3 expression analyses in peripheral cells, functional EEG recordings during neurocognitive tasks, and ratings of food energy content. Meta-analysis of all cohorts detected an association of SNP rs12842 with ADHD. While CNV analysis detected a population-specific enrichment of SLC2A3 duplications only in German ADHD patients, the CNV + rs12842 haplotype influenced ADHD risk in both the German and Spanish cohorts. Duplication carriers displayed elevated SLC2A3 mRNA expression in peripheral blood cells and altered event-related potentials reflecting deficits in working memory and cognitive response control, both endophenotypic traits of ADHD, and an underestimation of energy units of high-caloric food. Taken together, our results indicate that both common and rare SLC2A3 variation impacting regulation of neuronal glucose utilization and energy homeostasis may result in neurocognitive deficits known to contribute to ADHD risk. © 2017 Association for Child and Adolescent Mental Health.

  9. Epsin 1 is involved in recruitment of ubiquitinated EGF receptors into clathrin-coated pits

    DEFF Research Database (Denmark)

    Kazazic, Maja; Bertelsen, Vibeke; Pedersen, Ketil Winther

    2008-01-01

    . Furthermore, RNAi-mediated knock down of epsin 1 was found to inhibit internalization of the EGFR, while having no effect on endocytosis of the transferrin receptor. Additionally, upon knock down of epsin 1, translocation of the EGFR to central parts of clathrin-coated pits was inhibited. This supports...

  10. Lack of Association between SLC30A8 Variants and Type 2 Diabetes in Mexican American Families

    Directory of Open Access Journals (Sweden)

    Hemant Kulkarni

    2016-01-01

    Full Text Available SLC30A8 encodes zinc transporter 8 which is involved in packaging and release of insulin. Evidence for the association of SLC30A8 variants with type 2 diabetes (T2D is inconclusive. We interrogated single nucleotide polymorphisms (SNPs around SLC30A8 for association with T2D in high-risk, pedigreed individuals from extended Mexican American families. This study of 118 SNPs within 50 kb of the SLC30A8 locus tested the association with eight T2D-related traits at four levels: (i each SNP using measured genotype approach (MGA; (ii interaction of SNPs with age and sex; (iii combinations of SNPs using Bayesian Quantitative Trait Nucleotide (BQTN analyses; and (iv entire gene locus using the gene burden test. Only one SNP (rs7817754 was significantly associated with incident T2D but a summary statistic based on all T2D-related traits identified 11 novel SNPs. Three SNPs and one SNP were weakly but interactively associated with age and sex, respectively. BQTN analyses could not demonstrate any informative combination of SNPs over MGA. Lastly, gene burden test results showed that at best the SLC30A8 locus could account for only 1-2% of the variability in T2D-related traits. Our results indicate a lack of association of the SLC30A8 SNPs with T2D in Mexican American families.

  11. Organic anion transporter 3- and organic anion transporting polypeptides 1B1- and 1B3-mediated transport of catalposide

    Directory of Open Access Journals (Sweden)

    Jeong HU

    2015-01-01

    Full Text Available Hyeon-Uk Jeong,1 Mihwa Kwon,2 Yongnam Lee,3 Ji Seok Yoo,3 Dae Hee Shin,3 Im-Sook Song,2 Hye Suk Lee1 1College of Pharmacy, The Catholic University of Korea, Bucheon 420-743, Korea; 2College of Pharmacy and Research Institute of Pharmaceutical Sciences, Kyungpook National University, Daegu 702-701, Korea; 3Central R&D Institute, Yungjin Pharm Co., Ltd., Suwon 443-270, Korea Abstract: We investigated the in vitro transport characteristics of catalposide in HEK293 cells overexpressing organic anion transporter 1 (OAT1, OAT3, organic anion transporting polypeptide 1B1 (OATP1B1, OATP1B3, organic cation transporter 1 (OCT1, OCT2, P-glycoprotein (P-gp, and breast cancer resistance protein (BCRP. The transport mechanism of catalposide was investigated in HEK293 and LLC-PK1 cells overexpressing the relevant transporters. The uptake of catalposide was 319-, 13.6-, and 9.3-fold greater in HEK293 cells overexpressing OAT3, OATP1B1, and OATP1B3 transporters, respectively, than in HEK293 control cells. The increased uptake of catalposide via the OAT3, OATP1B1, and OATP1B3 transporters was decreased to basal levels in the presence of representative inhibitors such as probenecid, furosemide, and cimetidine (for OAT3 and cyclosporin A, gemfibrozil, and rifampin (for OATP1B1 and OATP1B3. The concentration-dependent OAT3-mediated uptake of catalposide revealed the following kinetic parameters: Michaelis constant (Km =41.5 µM, maximum uptake rate (Vmax =46.2 pmol/minute, and intrinsic clearance (CLint =1.11 µL/minute. OATP1B1- and OATP1B3-mediated catalposide uptake also showed concentration dependency, with low CLint values of 0.035 and 0.034 µL/minute, respectively. However, the OCT1, OCT2, OAT1, P-gp, and BCRP transporters were apparently not involved in the uptake of catalposide into cells. In addition, catalposide inhibited the transport activities of OAT3, OATP1B1, and OATP1B3 with half-maximal inhibitory concentration values of 83, 200, and 235 µ

  12. P-OTX: a PIT-1-interacting homeodomain factor expressed during anterior pituitary gland development.

    OpenAIRE

    Szeto, D P; Ryan, A K; O'Connell, S M; Rosenfeld, M G

    1996-01-01

    A novel OTX-related homeodomain transcription factor has been identified on the basis of its ability to interact with the transactivation domain of the pituitary-specific POU domain protein, Pit-1. This factor, referred to as P-OTX (pituitary OTX-related factor), is expressed in primordial Rathke's pouch, oral epithelium, first bronchial arch, duodenum, and hindlimb. In the developing anterior pituitary, it is expressed in all regions from which cells with distinct phenotypes will emerge in t...

  13. Chemical mass transport between fluid fine tailings and the overlying water cover of an oil sands end pit lake

    Science.gov (United States)

    Dompierre, Kathryn A.; Barbour, S. Lee; North, Rebecca L.; Carey, Sean K.; Lindsay, Matthew B. J.

    2017-06-01

    Fluid fine tailings (FFT) are a principal by-product of the bitumen extraction process at oil sands mines. Base Mine Lake (BML)—the first full-scale demonstration oil sands end pit lake (EPL)—contains approximately 1.9 × 108 m3 of FFT stored under a water cover within a decommissioned mine pit. Chemical mass transfer from the FFT to the water cover can occur via two key processes: (1) advection-dispersion driven by tailings settlement; and (2) FFT disturbance due to fluid movement in the water cover. Dissolved chloride (Cl) was used to evaluate the water cover mass balance and to track mass transport within the underlying FFT based on field sampling and numerical modeling. Results indicated that FFT was the dominant Cl source to the water cover and that the FFT is exhibiting a transient advection-dispersion mass transport regime with intermittent disturbance near the FFT-water interface. The advective pore water flux was estimated by the mass balance to be 0.002 m3 m-2 d-1, which represents 0.73 m of FFT settlement per year. However, the FFT pore water Cl concentrations and corresponding mass transport simulations indicated that advection rates and disturbance depths vary between sample locations. The disturbance depth was estimated to vary with location between 0.75 and 0.95 m. This investigation provides valuable insight for assessing the geochemical evolution of the water cover and performance of EPLs as an oil sands reclamation strategy.

  14. Congenital Chloride-Losing Diarrhea in a Mexican child with the novel homozygous SLC26A3 mutation G393W

    Directory of Open Access Journals (Sweden)

    Fabian R. Reimold

    2015-06-01

    Full Text Available Congenital chloride diarrhea is an autosomal recessive disease caused by mutations in the intestinal lumenal membrane Cl-/HCO3- exchanger, SLC26A3.We report here the novel SLC26A3 mutation G393W in a Mexican child, the first such report in a patient from Central America. SLC26A3 G393W expression in Xenopus oocytes exhibits a mild hypomorphic phenotype, with normal surface expression and moderately reduced anion transport function. However, expression of HA-SLC26A3 in HEK-293 cells reveals intracellular retention and greatly decreased steady-state levels of the mutant polypeptide, in contrast to peripheral membrane expression of the wildtype protein. Whereas wildtype HA-SLC26A3 is apically localized in polarized monolayers of filter-grown MDCK cells and Caco2 cells, mutant HA-SLC26A3 G393W exhibits decreased total polypeptide abundance, with reduced or absent surface expression and sparse punctate (or absent intracellular distribution. The WT protein is similarly localized in LLCPK1 cells, but the mutant fails to accumulate to detectable levels. We conclude that the chloride-losing diarrhea phenotype associated with homozygous expression of SLC26A3 G393W likely reflects lack of apical surface expression in enterocytes, secondary to combined abnormalities in polypeptide trafficking and stability. Future progress in development of general or target-specific folding chaperonins and correctors may hold promise for pharmacological rescue of this and similar genetic defects in membrane protein targeting.

  15. Mycotoxin occurrence on baled and pit silages collected in Co. Meath

    Directory of Open Access Journals (Sweden)

    McElhinney C.

    2015-12-01

    Full Text Available Recent studies of baled silages produced in Ireland have identified considerable filamentous fungal contamination. Many of these fungi are toxigenic, capable of producing secondary metabolites, namely mycotoxins. Mycotoxins are potentially detrimental to livestock health and some can pose a risk to consumers of animal products. Baled (n=20 and pit (n=18 silages from a sample of farms (n=38 in Co. Meath were examined to assess the occurrence of mycotoxins and ascertain whether sampling position within the pit silos (feed face vs. 3 m behind the feed face has an effect on mycotoxin content or other chemical compositional variables. Of the 20 mycotoxins assayed, baled silages contained [mean of positive values (no. of values in mean] mycotoxin concentrations (μg/kg dry matter of beauvericin 36 (2, enniatin (enn. A 9.3 (3, enn. A1 54 (8, enn. B 351 (9, enn. B1 136 (10, mycophenolic acid (MPA 11,157 (8 and roquefortine C (Roq. C 1037 (8 and pit silages contained beauvericin 25 (2 enn. A1 18 (2, enn. B 194 (9, enn. B1 57 (3, MPA 287 (6, Roq. C 3649 (6 and zearalenone 76 (1. There was no difference (P>0.05 observed in the mycotoxin concentrations between baled and pit silages, and 11 of the 20 mycotoxins assayed were below the limits of detection. The position of sampling had no effect on the mycotoxin concentration detected in pit silages. It is concluded that mycotoxin concentrations detected in these pit and baled silages in Co. Meath did not exceed EU regulation or guidance limits, and that similar chemical composition and mycotoxin concentration values occurred at the pit silage feed face and 3 m behind this feed face.

  16. Quantifying the relative contributions of different solute carriers to aggregate substrate transport

    Science.gov (United States)

    Taslimifar, Mehdi; Oparija, Lalita; Verrey, Francois; Kurtcuoglu, Vartan; Olgac, Ufuk; Makrides, Victoria

    2017-01-01

    Determining the contributions of different transporter species to overall cellular transport is fundamental for understanding the physiological regulation of solutes. We calculated the relative activities of Solute Carrier (SLC) transporters using the Michaelis-Menten equation and global fitting to estimate the normalized maximum transport rate for each transporter (Vmax). Data input were the normalized measured uptake of the essential neutral amino acid (AA) L-leucine (Leu) from concentration-dependence assays performed using Xenopus laevis oocytes. Our methodology was verified by calculating Leu and L-phenylalanine (Phe) data in the presence of competitive substrates and/or inhibitors. Among 9 potentially expressed endogenous X. laevis oocyte Leu transporter species, activities of only the uniporters SLC43A2/LAT4 (and/or SLC43A1/LAT3) and the sodium symporter SLC6A19/B0AT1 were required to account for total uptake. Furthermore, Leu and Phe uptake by heterologously expressed human SLC6A14/ATB0,+ and SLC43A2/LAT4 was accurately calculated. This versatile systems biology approach is useful for analyses where the kinetics of each active protein species can be represented by the Hill equation. Furthermore, its applicable even in the absence of protein expression data. It could potentially be applied, for example, to quantify drug transporter activities in target cells to improve specificity. PMID:28091567

  17. Study of the serotonin transporter (SLC6A4 and BDNF genes in French patients with non syndromic mental deficiency

    Directory of Open Access Journals (Sweden)

    Mignon Laurence

    2010-02-01

    Full Text Available Abstract Background Mental deficiency has been linked to abnormalities in cortical neuronal network connectivity and plasticity. These mechanisms are in part under the control of two interacting signalling pathways, the serotonergic and the brain-derived neurotrophic (BDNF pathways. The aim of the current paper is to determine whether particular alleles or genotypes of two crucial genes of these systems, the serotonin transporter gene (SLC6A4 and the brain-derived neurotrophic factor gene (BDNF, are associated with mental deficiency (MD. Methods We analyzed four functional polymorphisms (rs25531, 5-HTTLPR, VNTR, rs3813034 of the SLC6A4 gene and one functional polymorphism (Val66 Met of the BDNF gene in 98 patients with non-syndromic mental deficiency (NS-MD and in an ethnically matched control population of 251 individuals. Results We found no significant differences in allele and genotype frequencies in the five polymorphisms studied in the SLC6A4 and BDNF genes of NS-MD patients versus control patients. While the comparison of the patterns of linkage disequilibrium (D' in the control and NS-MD populations revealed a degree of variability it did not, however, reach significance. No significant differences in frequencies of haplotypes and genotypes for VNTR/rs3813034 and rs25531/5-HTTLPR were observed. Conclusion Altogether, results from the present study do not support a role for any of the five functional polymorphisms of SLC6A4 and BDNF genes in the aetiology of NS-RM. Moreover, they suggest no epistatic interaction in NS-MD between polymorphisms in BDNF and SLC6A4. However, we suggest that further studies on these two pathways in NS-MD remain necessary.

  18. AHAR: Part 1 - PIT Estimates of Homelessness

    Data.gov (United States)

    Department of Housing and Urban Development — This report outlines the key findings of the 2014 Point-In-Time (PIT) and Housing Inventory (HIC) counts conducted in January 2014. Specifically, this report...

  19. Association between the SLC6A3 A1343G polymorphism and schizophrenia Associação entre o polimorfismo A1343G do SLC6A3 e esquizofrenia

    Directory of Open Access Journals (Sweden)

    Quirino Cordeiro

    2010-10-01

    Full Text Available Epidemiological studies have demonstrated that the genetic component is an important risk factor for the development of schizophrenia. The genes that codify the different compounds of the dopaminergic system have created interest for molecular investigations in patients with schizophrenia because the antipsychotic drugs, especially those of first generation, act on this cerebral system. Thus the aim of the present study was to investigate the possible association between a new single nucleotide polymorphism (rs6347 located in exon 9 of the protein transporter (SLC6A3 and schizophrenia. The distribution of the alleles and genotypes of the studied polymorphism was investigated in a sample of 235 patients and 834 controls matched by gender and age. There were statistical differences in the allelic (χ2=5.97, 1d.f. , p=0.01, OR=1.33-1.05Estudos epidemiológicos têm demonstrado que o componente genético é um importante fator de risco para a esquizofrenia. Os genes que codificam os diferentes componentes do sistema dopaminérgico passaram a despertar interesse para estudos moleculares em pacientes com esquizofrenia, pois os antipsicóticos, em especial os de primeira geração, exercem sua ação nesse sistema. Assim, o objetivo do presente estudo foi investigar a associação entre um novo polimorfismo de nucleotídeo único (rs6347 localizado no exon 9 do gene do transportador de dopamina (SLC6A3 e esquizofrenia. Um total de 235 pacientes e 834 controles pareados para sexo e idade foi selecionado para a investigação da distribuição dos alelos e genótipos do polimorfismo investigado entre os grupos de pacientes e controles. Houve diferenças estatisticamente significantes nas distribuições alélicas (χ2=5,97, 1d.f. , p=0,01, OR=1,33-1,051,69 e genotípicas (χ2=6,56, 2d.f. , p=0,03 entre pacientes e controles. Assim, o polimorfismo SLC6A3 A1343G mostrou associação com esquizofrenia na amostra estudada.

  20. SLC-2000: A luminosity upgrade for the SLC

    International Nuclear Information System (INIS)

    Breidenbach, M.; Decker, F.-J.; Helm, R.; Napoly, O.; Phinney, N.; Raimondi, P.; Raubenheimer, T.O.; Siemann, R.; Zimmermann, F.; Hertzbach, S.

    1996-01-01

    We discuss a possible upgrade to the Stanford Linear Collider (SLC), whose objective is to increase the SLC luminosity by at least a factor 7, to an average Z production rate of more than 35,000 per week. The centerpiece of the upgrade is the installation of a new superconducting final doublet with a field gradient of 240 T/m, which will be placed at a distance of only 70 cm from the interaction point. In addition, several bending magnets in each final focus will be lengthened and two octupole correctors are added. A complementary upgrade of damping rings and bunch compressors will allow optimum use of the modified final focus and can deliver, or exceed, the targeted luminosity. The proposed upgrade will place the SLC physics program in a very competitive position, and will also enable it to pursue its pioneering role as the first and only linear collider. (author)

  1. Treatment of a mud pit by bioremediation.

    Science.gov (United States)

    Avdalović, Jelena; Đurić, Aleksandra; Miletić, Srdjan; Ilić, Mila; Milić, Jelena; Vrvić, Miroslav M

    2016-08-01

    The mud generated from oil and natural gas drilling, presents a considerable ecological problem. There are still insufficient remedies for the removal and minimization of these very stable emulsions. Existing technologies that are in use, more or less successfully, treat about 20% of generated waste drilling mud, while the rest is temporarily deposited in so-called mud pits. This study investigated in situ bioremediation of a mud pit. The bioremediation technology used in this case was based on the use of naturally occurring microorganisms, isolated from the contaminated site, which were capable of using the contaminating substances as nutrients. The bioremediation was stimulated through repeated inoculation with a zymogenous microbial consortium, along with mixing, watering and biostimulation. Application of these bioremediation techniques reduced the concentration of total petroleum hydrocarbons from 32.2 to 1.5 g kg(-1) (95% degradation) during six months of treatment. © The Author(s) 2016.

  2. Status of the SLC

    International Nuclear Information System (INIS)

    Moffeit, K.C.

    1987-01-01

    The status and research possibilities of the Stanford Linear Collider (SLC) are reviewed. The physics program concentrates on production of Z 0 's and their decay. The SLC systems include a new injector and booster, two damping rings to provide the small beam emittance, a new positron source, the existing LINAC structure upgraded for higher energy and better beam control, beam transport arcs, a final focus section, and experimental halls are detectors. Energy spectrometers with an accuracy of ± 50 MeV/c 2 for pulse-to-pulse center of mass energy measurement are to be installed. Longitudinal polarized electrons are expected, and will allow more precise tests of the standard model

  3. Feedback systems in the SLC

    International Nuclear Information System (INIS)

    Thompson, K.A.; Jobe, R.K.; Johnson, R.; Phinney, N.

    1987-02-01

    Two classes of computer-controlled feedback have been implemented to stabilize parameters in subsystems of the SLC: (1) ''slow'' (time scales ∼ minutes) feedback, and (2) ''fast'', i.e., pulse-to-pulse, feedback. The slow loops run in a single FEEDBACK process in the SLC host VAX, which acquires signals and sets control parameters via communication with the database and the network of normal SLC microprocessors. Slow loops exist to stabilize beam energy and energy spread, beam position and angle, and timing of kicker magnets, and to compensate for changes in the phase length of the rf drive line. The fast loops run in dedicated microprocessors, and may sample and/or feedback on particular parameters as often as every pulse of the SLC beam. The first implementations of fast feedback are to control transverse beam blow-up and to stabilize the energy and energy spread of bunches going into the SLC arcs. The overall architecture of the feedback software and the operator interface for controlling loops are discussed

  4. SLC30A9 mutation affecting intracellular zinc homeostasis causes a novel cerebro-renal syndrome.

    Science.gov (United States)

    Perez, Yonatan; Shorer, Zamir; Liani-Leibson, Keren; Chabosseau, Pauline; Kadir, Rotem; Volodarsky, Michael; Halperin, Daniel; Barber-Zucker, Shiran; Shalev, Hanna; Schreiber, Ruth; Gradstein, Libe; Gurevich, Evgenia; Zarivach, Raz; Rutter, Guy A; Landau, Daniel; Birk, Ohad S

    2017-04-01

    A novel autosomal recessive cerebro-renal syndrome was identified in consanguineous Bedouin kindred: neurological deterioration was evident as of early age, progressing into severe intellectual disability, profound ataxia, camptocormia and oculomotor apraxia. Brain MRI was normal. Four of the six affected individuals also had early-onset nephropathy with features of tubulo-interstitial nephritis, hypertension and tendency for hyperkalemia, though none had rapid deterioration of renal function. Genome wide linkage analysis identified an ∼18 Mb disease-associated locus on chromosome 4 (maximal logarithm of odds score 4.4 at D4S2971; θ = 0). Whole exome sequencing identified a single mutation in SLC30A9 within this locus, segregating as expected within the kindred and not found in a homozygous state in 300 Bedouin controls. We showed that SLC30A9 (solute carrier family 30 member 9; also known as ZnT-9) is ubiquitously expressed with high levels in cerebellum, skeletal muscle, thymus and kidney. Confocal analysis of SH-SY5Y cells overexpressing SLC30A9 fused to enhanced green fluorescent protein demonstrated vesicular cytosolic localization associated with the endoplasmic reticulum, not co-localizing with endosomal or Golgi markers. SLC30A9 encodes a putative zinc transporter (by similarity) previously associated with Wnt signalling. However, using dual-luciferase reporter assay in SH-SY5Y cells we showed that Wnt signalling was not affected by the mutation. Based on protein modelling, the identified mutation is expected to affect SLC30A9's highly conserved cation efflux domain, putatively disrupting its transmembrane helix structure. Cytosolic Zn2+ measurements in HEK293 cells overexpressing wild-type and mutant SLC30A9 showed lower zinc concentration within mutant rather than wild-type SLC30A9 cells. This suggests that SLC30A9 has zinc transport properties affecting intracellular zinc homeostasis, and that the molecular mechanism of the disease is through

  5. Long-term fate and transport of arsenic in an in-pit uranium mine tailings facility

    International Nuclear Information System (INIS)

    Moldovan, B.; Hendry, M.J.

    2006-01-01

    An important environmental issue facing the uranium mining industry in Saskatchewan is the quantification of the long-term migration of arsenic from its tailings facilities to the adjacent groundwater system. Decommissioning of these arsenic-rich tailings requires that the long-term arsenic source term for the tailings to the groundwater be defined. To meet this need, arsenic-rich uranium mine tailings from one in-pit tailings facility (tailings emplaced in a mined out open pit) were studied in detail. The tailings facility selected for study was the Rabbit Lake in-pit tailings management facility (RLITMF) in northern Saskatchewan, Canada. The tailings body in the RLITMF is 425 m long x 300 m wide x 100 m deep at its center and mill tailings were deposited in layers between 1985 (base) and 2004 (top). Associated with the low-level radioactive tailings is approximately 23,000 tonnes of arsenic. The in-pit design limits solute transport in these fine-grained tailings to diffusion. Because the layers of tailings have varying chemical characteristics (controlled by the ore being milled at the time), the total arsenic concentrations in the layers and their associated pore fluids range from 56 to 9,871 μ/g and 0.24 to 140 mg/l, respectively. As was the case for arsenic, the concentration of iron present in the layers was also variable (ranging from 8,967 to 30,247 μ/g). Synchrotron-based studies show that the arsenic in these tailings is strongly attenuated by adsorption to secondary 2-line ferrihydrite through inner sphere bidentate linkages. Single reservoir diffusion cell testing shows that the effective diffusion coefficient for arsenic in the tailings is 4.5 x 10 -10 m 2 s- 1 . Based on results from our field- and laboratory-based studies, the redistribution (via diffusion) and attenuation (via adsorption) of arsenic in the RLITMF was modelled using a one-dimensional geochemical reactive transport model to provide a source term for arsenic migration from the

  6. Organic anion transporting polypeptide 1B transporters modulate hydroxyurea pharmacokinetics.

    Science.gov (United States)

    Walker, Aisha L; Lancaster, Cynthia S; Finkelstein, David; Ware, Russell E; Sparreboom, Alex

    2013-12-15

    Hydroxyurea is currently the only FDA-approved drug that ameliorates the pathophysiology of sickle cell anemia. Unfortunately, substantial interpatient variability in the pharmacokinetics (PK) of hydroxyurea may result in variation of the drug's efficacy. However, little is known about mechanisms that modulate hydroxyurea PK. Recent in vitro studies identifying hydroxyurea as a substrate for organic anion transporting polypeptide (OATP1B) transporters prompted the current investigation assessing the role of OATP1B transporters in modulating hydroxyurea PK. Using wild-type and Oatp1b knockout (Oatp1b(-/-)) mice, hydroxyurea PK was analyzed in vivo by measuring [(14)C]hydroxyurea distribution in plasma, kidney, liver, urine, or the exhaled (14)CO2 metabolite. Plasma levels were significantly reduced by 20% in Oatp1b(-/-) mice compared with wild-type (area under the curve of 38.64 or 48.45 μg·h(-1)·ml(-1), respectively) after oral administration, whereas no difference was observed between groups following intravenous administration. Accumulation in the kidney was significantly decreased by twofold in Oatp1b(-/-) mice (356.9 vs. 748.1 pmol/g), which correlated with a significant decrease in urinary excretion. Hydroxyurea accumulation in the liver was also decreased (136.6 vs. 107.3 pmol/g in wild-type or Oatp1b(-/-) mice, respectively) correlating with a decrease in exhaled (14)CO2. These findings illustrate that deficiency of Oatp1b transporters alters the absorption, distribution, and elimination of hydroxyurea thus providing the first in vivo evidence that cell membrane transporters may play a significant role in modulating hydroxyurea PK. Future studies to investigate other transporters and their role in hydroxyurea disposition are warranted for understanding the sources of variation in hydroxyurea's PK.

  7. Organic solute carrier 22 (SLC22 family: Potential for interactions with food, herbal/dietary supplements, endogenous compounds, and drugs

    Directory of Open Access Journals (Sweden)

    Raymond E. Lai

    2018-04-01

    Full Text Available Many drugs, hormones, components of herbal medicines, environmental pesticides and toxins are Solute Carrier family 22 (SLC22 substrates. The last twenty years has seen great progress in determining SLC22 tissue expression profiles, membrane localization, energetics, substrate profiles and biopharmaceutical significance. However, much still remains to be answered in terms of SLC22 family member's roles in ‘normal’ physiology as compared to pathophysiological states, as well as in drug interactions that impact pharmacokinetics, efficacy and toxicity. This review begins with a brief synopsis of SLC22 family discovery, function and tissue expression. Subsequent sections provide examples establishing a role for SLC22 transporters in food-drug, herbal supplement-drug, endogenous substrate-drug and drug–drug interactions. Keywords: Hepatic transport, Nephrotoxicity, Organic anion transporter, Organic cation transporter, Renal transport

  8. Wire breakage in SLC wire profile monitors

    International Nuclear Information System (INIS)

    Field, C.; McCormick, D.; Raimondi, P.; Ross, M.

    1998-05-01

    Wire scanning beam profile monitors are used at the Stanford Linear Collider (SLC) for emittance preservation control and beam optics optimization. Twenty such scanners have proven most useful for this purpose and have performed a total of 1.5 million scans in the 4 to 6 years since their installation. Most of the essential scanners are equipped with 20 to 40 microm tungsten wires. SLC bunch intensities and sizes often exceed 2 x 10 7 particles/microm 2 (3C/m 2 ). The authors believe that this has caused a number of tungsten wire failures that appear at the ends of the wire, near the wire support points, after a few hundred scans are accumulated. Carbon fibers, also widely used at SLAC, have been substituted in several scanners and have performed well. In this paper, the authors present theories for the wire failure mechanism and techniques learned in reducing the failures

  9. Developmental expression of solute carrier family 26A member 4 (SLC26A4/pendrin) during amelogenesis in developing rodent teeth.

    Science.gov (United States)

    Bronckers, Antonius L J J; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela

    2011-12-01

    Ameloblasts need to regulate pH during the formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine, and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear, and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues, including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts, and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as a pH regulator. SLC26A4 does not appear to be critical for ameloblast function and is probably compensated by other pH regulators. © 2011 Eur J Oral Sci.

  10. Effects of frequently used pharmaceutical excipients on the organic cation transporters 1-3 and peptide transporters 1/2 stably expressed in MDCKII cells.

    Science.gov (United States)

    Otter, Marcus; Oswald, Stefan; Siegmund, Werner; Keiser, Markus

    2017-03-01

    There is ample evidence that pharmaceutical excipients, which are supposed to be pharmacologically inactive, have an impact on drug metabolism and efflux transport. So far, little is known whether they also modulate uptake transporter proteins. We have recently shown that commonly used solubilizing agents exert significant effects on the function of organic anion uptake transporting polypeptides. Therefore, we investigated in this study the influence of frequently used pharmaceutical excipients on the transport activity of organic cation transporters OCT1, OCT2 and OCT3 and the peptide transporters PEPT1 and PEPT2. Inhibition of the OCTs and PEPTs by the excipients polyethylene glycol 400 (PEG), hydroxypropyl-β-cyclodextrin (HPCD), Solutol® HS15 (SOL), Cremophor® EL (CrEL), Tween® 20 (Tw20), Tween® 80 (Tw80), Kolliphor® P188 (P188) and Kolliphor® P407 (P407) was evaluated using stably transfected MDCKII cells with radio-labeled reference substrates and established inhibitors as controls. Intracellular accumulation of [3H]-1-methyl-4-phenylpyridinium (MPP + ) for the OCTs and [3H]-glycyl-sarcosine (Gly-Sar) for the PEPTs was measured by liquid scintillation counting after cell lysis. Our studies revealed that PEG, HPCD, SOL, CrEL, Tw20 and Tw80 were potent inhibitors of OCT1-3 (e.g., Tw20 IC 50 values<0.04%). Cellular uptake of Gly-Sar by PEPT1 and PEPT2 was strongly inhibited by both Tw20 and Tw80. SOL was also a strong inhibitor of PEPT1 and PEPT2 (e.g., SOL IC 50 values<0.02%), while CrEL showed significantly inhibition of only PEPT2. The substantial inhibitory effects of certain solubilizing agents on OCTs and PEPTs should be considered if they are to be used in dosage forms for new chemical entities and registered drugs to avoid misinterpretation of pharmacokinetic data and undesired drug interactions. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. The rise and fall of novel renal magnesium transporters.

    Science.gov (United States)

    Schäffers, Olivier J M; Hoenderop, Joost G J; Bindels, René J M; de Baaij, Jeroen H F

    2018-06-01

    Body Mg 2+ balance is finely regulated in the distal convoluted tubule (DCT), where a tight interplay among transcellular reabsorption, mitochondrial exchange, and basolateral extrusion takes place. In the last decades, several research groups have aimed to identify the molecular players in these processes. A multitude of proteins have been proposed to function as Mg 2+ transporter in eukaryotes based on phylogenetic analysis, differential gene expression, and overexpression studies. However, functional evidence for many of these proteins is lacking. The aim of this review is, therefore, to critically reconsider all putative Mg 2+ transporters and put their presumed function in context of the renal handling of Mg 2+ . Sufficient experimental evidence exists to acknowledge transient receptor potential melastatin (TRPM) 6 and TRPM7, solute carrier family 41 (SLC41) A1 and SLC41A3, and mitochondrial RNA splicing 2 (MRS2) as Mg 2+ transporters. TRPM6/7 facilitate Mg 2+ influx, SLC41A1 mediates Mg 2+ extrusion, and MRS2 and SLC41A3 are implicated in mitochondrial Mg 2+ homeostasis. These proteins are highly expressed in the DCT. The function of cyclin M (CNNM) proteins is still under debate. For the other proposed Mg 2+ transporters including Mg 2+ transporter subtype 1 (MagT1), nonimprinted in Prader-Willi/Angelman syndrome (NIPA), membrane Mg 2+ transport (MMgT), Huntingtin-interacting protein 14 (HIP14), and ATP13A4, functional evidence is limited, or functions alternative to Mg 2+ transport have been suggested. Additional characterization of their Mg 2+ transport proficiency should be provided before further claims about their role as Mg 2+ transporter can be made.

  12. Association between SLC19A1 gene polymorphism and high dose methotrexate toxicity in childhood acute lymphoblastic leukaemia and non Hodgkin malignant lymphoma: introducing a haplotype based approach

    Directory of Open Access Journals (Sweden)

    Kotnik Barbara Faganel

    2017-09-01

    Full Text Available We investigated the clinical relevance of SLC 19A1 genetic variability for high dose methotrexate (HD-MTX related toxicities in children and adolescents with acute lymphoblastic leukaemia (ALL and non Hodgkin malignant lymphoma (NHML.

  13. Potent inhibitors of human LAT1 (SLC7A5) transporter based on dithiazole and dithiazine compounds for development of anticancer drugs.

    Science.gov (United States)

    Napolitano, Lara; Scalise, Mariafrancesca; Koyioni, Maria; Koutentis, Panayiotis; Catto, Marco; Eberini, Ivano; Parravicini, Chiara; Palazzolo, Luca; Pisani, Leonardo; Galluccio, Michele; Console, Lara; Carotti, Angelo; Indiveri, Cesare

    2017-11-01

    The LAT1 transporter is acknowledged as a pharmacological target of tumours since it is strongly overexpressed in many human cancers. The purpose of this work was to find novel compounds exhibiting potent and prolonged inhibition of the transporter. To this aim, compounds based on dithiazole and dithiazine scaffold have been screened in the proteoliposome experimental model. Inhibition was tested on the antiport catalysed by hLAT1 as transport of extraliposomal [ 3 H]histidine in exchange with intraliposomal histidine. Out of 59 compounds tested, 8 compounds, showing an inhibition higher than 90% at 100µM concentration, were subjected to dose-response analysis. Two of them exhibited IC 50 lower than 1µM. Inhibition kinetics, performed on the two best inhibitors, indicated a mixed type of inhibition with respect to the substrate. Furthermore, inhibition of the transporter was still present after removal of the compounds from the reaction mixture, but was reversed on addition of dithioerythritol, a S-S reducing agent, indicating the formation of disulfide(s) between the compounds and the protein. Molecular docking of the two best inhibitors on the hLAT1 homology structural model, highlighted interaction with the substrate binding site and formation of a covalent bond with the residue C407. Indeed, the inhibition was impaired in the hLAT1 mutant C407A confirming the involvement of that Cys residue. Treatment of SiHa cells expressing hLAT1 at relatively high level, with the two most potent inhibitors led to cell death which was not observed after treatment with a compound exhibiting very poor inhibitory effect. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Fasting induces basolateral uptake transporters of the SLC family in the liver via HNF4alpha and PGC1alpha.

    Science.gov (United States)

    Dietrich, Christoph G; Martin, Ina V; Porn, Anne C; Voigt, Sebastian; Gartung, Carsten; Trautwein, Christian; Geier, Andreas

    2007-09-01

    Fasting induces numerous adaptive changes in metabolism by several central signaling pathways, the most important represented by the HNF4alpha/PGC-1alpha-pathway. Because HNF4alpha has been identified as central regulator of basolateral bile acid transporters and a previous study reports increased basolateral bile acid uptake into the liver during fasting, we hypothesized that HNF4alpha is involved in fasting-induced bile acid uptake via upregulation of basolateral bile acid transporters. In rats, mRNA of Ntcp, Oatp1, and Oatp2 were significantly increased after 48 h of fasting. Protein expression as determined by Western blot showed significant increases for all three transporters 72 h after the onset of fasting. Whereas binding activity of HNF1alpha in electrophoretic mobility shift assays remained unchanged, HNF4alpha binding activity to the Ntcp promoter was increased significantly. In line with this result, we found significantly increased mRNA expression of HNF4alpha and PGC-1alpha. Functional studies in HepG2 cells revealed an increased endogenous NTCP mRNA expression upon cotransfection with either HNF4alpha, PGC-1alpha, or a combination of both. We conclude that upregulation of the basolateral bile acid transporters Ntcp, Oatp1, and Oatp2 in fasted rats is mediated via the HNF4alpha/PGC-1alpha pathway.

  15. Acid Pit Stabilization Project (Volume 1 - Cold Testing) and (Volume 2 - Hot Testing)

    International Nuclear Information System (INIS)

    Loomis, G. G.; Zdinak, A. P.; Ewanic, M. A.; Jessmore, J. J.

    1998-01-01

    During the summer and fall of Fiscal Year 1997, a Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) Treatability Study was performed at the Idaho National Engineering and Environmental Laboratory. The study involved subsurface stabilization of a mixed waste contaminated soil site called the Acid Pit. This study represents the culmination of a successful technology development effort that spanned Fiscal Years 1994-1996. Research and development of the in situ grout stabilization technique was conducted. Hardware and implementation techniques are currently documented in a patent pending with the United States Patent and Trademark Office. The stabilization technique involved using jet grouting of an innovative grouting material to form a monolith out of the contamination zone. The monolith simultaneously provides a barrier to further contaminant migration and closes voids in the soil structure against further subsidence. This is accomplished by chemical incorporation of contaminants into less soluble species and achieving a general reduction in hydraulic conductivity within the monolith. The grout used for this study was TECT-HG, a relatively dense iron oxide-based cementitious grout. The treatability study involved cold testing followed by in situ stabilization of the Acid Pit. Volume 1 of this report discusses cold testing, performed as part of a ''Management Readiness Assessment'' in preparation for going hot. Volume 2 discusses the results of the hot Acid Pit Stabilization phase of this project. Drilling equipment was specifically rigged to reduce the spread of contamination, and all grouting was performed under a concrete block containing void space to absorb any grout returns. Data evaluation included examination of implementability of the grouting process and an evaluation of the contaminant spread during grouting. Following curing of the stabilized pit, cores were obtained and evaluated for toxicity characteristic leach ing

  16. Intronic deletions in the SLC34A3 gene: A cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria

    OpenAIRE

    Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.

    2013-01-01

    Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine cal...

  17. Identification of Pit-1 Gen Using PCR-RFLP of Padjadjaran Sheep and Evaluate of Growth Rate

    Science.gov (United States)

    Prajoga, S. B. K.; Andriani, L.; Subhandiana, H.

    2018-02-01

    The objectives of this research were to evaluate variation of Pit-1 gen of Padjadjaran Sheep and evaluate of their growth rate. The data comprised of 15 lambs female and 15 lambs male records of 0 - 12 mouths old lambs. Variation of Padjadjaran Sheep PIT-1 gen was analyzed using PCR-RFLP and used primer by 5’-GAGGGATAATTACAAATGGTCC-3’ and 5’-TGTTAACAGCTGTGGGACACAC-3’, length fragment analyse using HinfI restriction enzyme. Presence or absence of deference bands in a PCR fragment of the result can be distinguished by differences in the electrophoretic migration of the fragment. The result showed that the variation Pit1 gene showed that there was in the position 345 bp, 137 bp and 115 bp. In this experiment the difference migration did occur in all samples (monomorphic), that was amplificated with reverse and forward primer. The average male birth weight (BW), weaning weight (WN) and Yearling Weight (YW) was 2.29 ±0.42kg 8.96 ±1,89 kg and 30.12 ±5,65 kg. The average female birth weight (BW), weaning weight (WN) and Yearling Weight (YW) was 2.33 ±0.49 kg; 8.23 ±1.99 kg and 26.11 ±5.50 kg. Correlation value between age and body weight was 0,99 for female and 0,97 for male. The highest body weight gain per month was 2.85 kg for female at the age of six months and 3.4 kg for male at the age of one year. The best equition of growth rate was Ŷ = 1,862 + 0,127X1 0,076X2

  18. Pits and adatoms at the interface of 1-ML C84/Ag (111)

    International Nuclear Information System (INIS)

    Wang Peng; Zhang Han-Jie; Li Yan-Jun; Sheng Chun-Qi; Li Wen-Jie; Xing Xiu-Na; Li Hai-Yang; He Pi-Mo; Bao Shi-Ning; Li Hong-Nian

    2013-01-01

    We prepare a well-defined C 84 monolayer on the surface of Ag (111) and study the geometric structure by scanning tunneling microscopy (STM). The C 84 molecules form a nearly close-packed incommensurate R30° lattice. The lattice is long-distance ordered with numerous local disorders. The monolayer exhibits complex bright/dim contrast; the largest height difference between the molecules can be greater than 0.4 nm. Annealing the monolayer at 380 °C can desorb part of the molecules, but more than sixty percent molecules stay on the Ag (111) surface even after the sample has been annealed at 650 °C. Our analyses reveal that the 7-atom pits form beneath many molecules. Some other molecules sit at the 1-atom pits. Ag adatoms (those removed substrate atoms, accompanying the pit formation) play a very important role in this system. The adatoms can either stabilize or destabilize the monolayer, depending on the distribution manner of the adatoms at the interface. The distribution manner is determined by the co-play of the following factors: the dimension of the interstitial regions of the C 84 overlayer, the number of the adatoms, and the long-distance migration of part adatoms. (condensed matter: structural, mechanical, and thermal properties)

  19. ON ETREPRENUERSHIP AT MAIN CLAY PITS AND BRICKYARDS OF CENTRAL CROATIA AT THE END OF 19TH AND BEGINNING OF 20TH CENTURIES

    Directory of Open Access Journals (Sweden)

    Berislav šebečić

    2003-12-01

    Full Text Available In central Croatia at the beginning of 20th century, clay pits were mostly managed by individual entrepreneurs, and less by joint stock companies and municipal or district local authorities. Majority of clay pit met the local and regional requirements i.e. demands, and quality products were exported. Exploitation of brickwork clay was carried out from open pits, while potter's, stove-maker's and porcelain clays were exploited from mining shafts and tunnels. From the clay raw material, annual production of minor brickyards amounted to 200-300,000 bricks, and that of major ones was 1-2,000,000 pieces of bricks or roofing-tiles. The number of workers in brickyards and cement works was growing in the first decade of 20th century, while that of potter's and stove-maker's crafts was decreasing. Pottery became a secondary trade in the majority of Croatian and Slavonian counties (the paper is published in Croatian.

  20. Glucose transporter type 1 deficiency syndrome with carbohydrate-responsive symptoms but without epilepsy.

    Science.gov (United States)

    Koy, Anne; Assmann, Birgit; Klepper, Joerg; Mayatepek, Ertan

    2011-12-01

    Glucose transporter type 1 deficiency syndrome (GLUT1-DS) is caused by a defect in glucose transport across the blood-brain barrier. The main symptoms are epilepsy, developmental delay, movement disorders, and deceleration of head circumference. A ketogenic diet has been shown to be effective in controlling epilepsy in GLUT1-DS. We report a female child (3 y 4 mo) who presented with delayed psychomotor development and frequent episodes of staggering, impaired vigilance, and vomiting that resolved promptly after food intake. Electroencephalography was normal. The cerebrospinal fluid-blood glucose ratio was 0.42 (normal ≥ 0.45). GLUT1-DS was confirmed by molecular genetic testing, which showed a novel de novo heterozygous mutation in the SLC2A1 gene (c.497_499delTCG, p.VAL166del). Before starting a ketogenic diet, the child's cognitive development was tested using the Snijders-Oomen Non-Verbal Intelligence Test, which revealed a heterogeneous intelligence profile with deficits in her visuomotor skills and spatial awareness. Her motor development was delayed. Three months after introducing a ketogenic diet, she showed marked improvement in speech and motor development, as tested by the Movement Assessment Battery for Children (manual dexterity 16th centile, ball skills 1st centile, static and dynamic balance 5th centile). This case demonstrates that GLUT1-DS should be investigated in individuals with unexplained developmental delay. Epilepsy is not a mandatory symptom. The ketogenic diet is also beneficial for non-epileptic symptoms in GLUT1-DS. © The Authors. Developmental Medicine & Child Neurology © 2011 Mac Keith Press.

  1. SLC26A4 Variations Among Graves’ Hyper-Functioning Thyroid Gland

    Directory of Open Access Journals (Sweden)

    Hassen Hadj-Kacem

    2010-01-01

    Full Text Available Deleterious mutations of SLC26A4 cause Pendred syndrome (PS, an autosomal recessive disorder comprising goitre and deafness with enlarged vestibular aqueducts (EVA, and nonsyndromic hearing loss (NSHL. However, the SLC26A4 hyperactivity was recently associated with the emergence of autoimmune thyroid diseases (AITD and asthma among human and mouse model. Here, by direct sequencing, we investigate the sequences of the 20 coding exons (2 to 21 of SLC26A4 and their flanking intron-exon junctions among patients affected with Graves' disease (GD hyperthyroidism. Ten mono-allelic variants were identified, seven of which are intronic and previously unreported. Two, c.898A>C (p.I300L and c.1061T>C (p.F354S, of the three exonic variants are non synonymous. The p.F354S variant is already described to be involved in PS or NSHL inheritances. The exploration by PCR-RFLP of p.I300L and p.F354S variants among 132 GD patients, 105 Hashimoto thyroiditis (HT, 206 Healthy subjects and 102 families with NSHL have shown the presence of both variants. The p.F354S variation was identified both among patients (1~HT and 3 GD and healthy subjects (n=5. Whereas, the p.I300L variant was identified only in GD patients (n=3. Our studies provide evidence of the importance of systematic analysis of SLC26A4 gene sequences on models other than deafness. This approach allows the identification of new variants and the review of the pathogenic effects of certain mono-allelic variants reported responsible for PS and NSHL development.

  2. Bicarbonate Transport During Enamel Maturation.

    Science.gov (United States)

    Yin, Kaifeng; Paine, Michael L

    2017-11-01

    Amelogenesis (tooth enamel formation) is a biomineralization process consisting primarily of two stages (secretory stage and maturation stage) with unique features. During the secretory stage, the inner epithelium of the enamel organ (i.e., the ameloblast cells) synthesizes and secretes enamel matrix proteins (EMPs) into the enamel space. The protein-rich enamel matrix forms a highly organized architecture in a pH-neutral microenvironment. As amelogenesis transitions to maturation stage, EMPs are degraded and internalized by ameloblasts through endosomal-lysosomal pathways. Enamel crystallite formation is initiated early in the secretory stage, however, during maturation stage the more rapid deposition of calcium and phosphate into the enamel space results in a rapid expansion of crystallite length and mineral volume. During maturation-stage amelogenesis, the pH value of enamel varies considerably from slightly above neutral to acidic. Extracellular acid-base balance during enamel maturation is tightly controlled by ameloblast-mediated regulatory networks, which include significant synthesis and movement of bicarbonate ions from both the enamel papillary layer cells and ameloblasts. In this review we summarize the carbonic anhydrases and the carbonate transporters/exchangers involved in pH regulation in maturation-stage amelogenesis. Proteins that have been shown to be instrumental in this process include CA2, CA6, CFTR, AE2, NBCe1, SLC26A1/SAT1, SLC26A3/DRA, SLC26A4/PDS, SLC26A6/PAT1, and SLC26A7/SUT2. In addition, we discuss the association of miRNA regulation with bicarbonate transport in tooth enamel formation.

  3. The glutamate transport inhibitor DL-Threo-β-Benzyloxyaspartic acid (DL-TBOA) differentially affects SN38- and oxaliplatin-induced death of drug-resistant colorectal cancer cells

    DEFF Research Database (Denmark)

    Cuesta, Elena Pedraz; Christensen, Sandra; Jensen, Anders A.

    2015-01-01

    affinity glutamate transporters Solute Carrier (SLC)-1A1 and -1A3 (EAAT3, EAAT1) is associated with the resistant phenotypes. Analyses included real-time quantitative PCR, immunoblotting and immunofluorescence analyses, radioactive tracer flux measurements, and biochemical analyses of cell viability...... was undetectable. The changes in SLC1A1 expression were accompanied by parallel changes in DL-Threo-β-Benzyloxyaspartic acid (TBOA)-sensitive, UCPH101-insensitive [(3)H]-D-Aspartate uptake, consistent with increased activity of SLC1A1 (or other family members), yet not of SLC1A3. DL-TBOA co-treatment concentration...... and glutamate transporter activity are altered in SN38-resistant CRC cells. Importantly, the non-selective glutamate transporter inhibitor DL-TBOA reduces chemotherapy-induced p53 induction and augments CRC cell death induced by SN38, while attenuating that induced by oxaliplatin. These findings may point...

  4. Transcellular movement of hydroxyurea is mediated by specific solute carrier transporters

    Science.gov (United States)

    Walker, Aisha L.; Franke, Ryan M.; Sparreboom, Alex; Ware, Russell E.

    2015-01-01

    Objective Hydroxyurea has proven laboratory and clinical therapeutic benefits for sickle cell anemia (SCA) and other diseases, yet many questions remain regarding its in vivo pharmacokinetic and pharmacodynamic profiles. Previous reports suggest that hydroxyurea passively diffuses across cells, but its observed rapid absorption and distribution are more consistent with facilitated or active transport. We investigated the potential role of solute carrier (SLC) transporters in cellular uptake and accumulation of hydroxyurea. Materials and Methods Passive diffusion of hydroxyurea across cell membranes was determined using the parallel artificial membrane permeability assay. SLC transporter screens were conducted using in vitro intracellular drug accumulation and transcellular transport assays in cell lines and oocytes overexpressing SLC transporters. Gene expression of SLC transporters was measured by real-time PCR in human tissues and cell lines. Results Hydroxyurea had minimal diffusion across a lipid bilayer but was a substrate for 5 different SLC transporters belonging to the OCTN and OATP families of transporters and urea transporters A and B. Further characterization of hydroxyurea transport revealed that cellular uptake by OATP1B3 is time and temperature dependent and inhibited by known substrates of OATP1B3. Urea transporters A and B are expressed differentially in human tissues and erythroid cells, and transport hydroxyurea bidirectionally via facilitated diffusion. Conclusions These studies provide new insight into drug transport proteins that may be involved in the in vivo absorption, cellular distribution, and elimination of hydroxyurea. Elucidation of hydroxyurea transcellular movement should improve our understanding of its pharmacokinetics and pharmacodynamics, and may help explain some of the inter-patient drug variability observed in patients with SCA. PMID:21256917

  5. Lack of Association between a 3'UTR VNTR Polymorphism of Dopamine Transporter Gene (SLC6A3) and ADHD in a Brazilian Sample of Adult Patients

    Science.gov (United States)

    Aperecida da Silva, Maria; Cordeiro, Quirino; Louza, Mario; Vallada, Homero

    2011-01-01

    Objective: To investigate a possible association between a 3'UTR VNTR polymorphism of the dopamine transporter gene (SLC6A3) and ADHD in a Brazilian sample of adult patients. Method: Study Case-control with 102 ADHD adult outpatients ("DSM-IV" criteria) and 479 healthy controls. The primers' sequence used were: 3'UTR-Forward: 5' TGT GGT…

  6. Pitting corrosion of copper. An equilibrium - mass transport study

    Energy Technology Data Exchange (ETDEWEB)

    Taxen, C

    1996-11-01

    A mathematical model for the propagation of corrosion pits on copper is described. The model is used to predict the potentials below which copper is immune to pitting. The criteria used for immunity against pitting is that the volume of the cuprous oxide formed at the site of the metal oxidation at the bottom of a corrosion pit must be smaller than the volume of the oxidised metal. Equal volumes would give a complete coverage of the metal in a pit by adherent cuprous oxide and propagation would not be possible. For potentials where copper is not immune to pitting an estimate of the maximum growth rate is given. The model uses equilibrium data and diffusion coefficients and calculates the stationary concentration profiles from the bulk water outside a corrosion pit to the site of the metal dissolution at the bottom a corrosion pit. Precipitation of oxides as well as of basic salts of copper is considered. A total of 26 aqueous species are considered in waters with compositions ranging from those of tap waters to that of sea water. Calculations are made for the temperatures 25 deg C and 75 deg C. 38 refs, 60 figs, 17 tabs

  7. Statement of basis/proposed plan for the Central Shops Burning/Rubble Pit (631-6G). Revision 1, Final

    International Nuclear Information System (INIS)

    Palmer, E.

    1996-01-01

    The purpose of this plan is to describe the preferred alternative for addressing the Central Shops Burning/Rubble Pit 631-6G (BRP6G) located at SRS, in northwestern Barnwell County, South Carolina and to provide an opportunity for public input into the remedial action selection process. Arsenic, beryllium, iron, and octachloro-dibenzo-p-dioxin isomers (OCDD) concentrations in the pit soil are at levels consistent with those found in the background. Therefore, the only contamination attributable to actions in BRP6G is PCB-1254. After the risk contributions of these chemicals are eliminated, the only remaining risk attributable to the pit soil is from PCB-1254 (about 2 x 10 -6 via ingestion of vegetables grown on-site). The maximum concentration of PCB-1254 detected in the pit was 0.115 mg/kg, approximately 10% of the residential action level for PCBs of 1 mg/kg. Based on the results of the remedial investigation and the BRA, it is proposed that No Action be performed for the BRP6G. Considering the low levels of residual contamination present principally below 1.2 meters (4 feet) within the pit and the associated risks (about 2 x 10 -6 ) within the lower level of EPA's target risk range, action is not warranted for this unit

  8. Rate and Regulation of Copper Transport by Human Copper Transporter 1 (hCTR1)*

    Science.gov (United States)

    Maryon, Edward B.; Molloy, Shannon A.; Ivy, Kristin; Yu, Huijun; Kaplan, Jack H.

    2013-01-01

    Human copper transporter 1 (hCTR1) is a homotrimer of a 190-amino acid monomer having three transmembrane domains believed to form a pore for copper permeation through the plasma membrane. The hCTR1-mediated copper transport mechanism is not well understood, nor has any measurement been made of the rate at which copper ions are transported by hCTR1. In this study, we estimated the rate of copper transport by the hCTR1 trimer in cultured cells using 64Cu uptake assays and quantification of plasma membrane hCTR1. For endogenous hCTR1, we estimated a turnover number of about 10 ions/trimer/s. When overexpressed in HEK293 cells, a second transmembrane domain mutant of hCTR1 (H139R) had a 3-fold higher Km value and a 4-fold higher turnover number than WT. Truncations of the intracellular C-terminal tail and an AAA substitution of the putative metal-binding HCH C-terminal tripeptide (thought to be required for transport) also exhibited elevated transport rates and Km values when compared with WT hCTR1. Unlike WT hCTR1, H139R and the C-terminal mutants did not undergo regulatory endocytosis in elevated copper. hCTR1 mutants combining methionine substitutions that block transport (M150L,M154L) on the extracellular side of the pore and the high transport H139R or AAA intracellular side mutations exhibited the blocked transport of M150L,M154L, confirming that Cu+ first interacts with the methionines during permeation. Our results show that hCTR1 elements on the intracellular side of the hCTR1 pore, including the carboxyl tail, are not essential for permeation, but serve to regulate the rate of copper entry. PMID:23658018

  9. Clinical presentation and outcome of riboflavin transporter deficiency: mini review after five years of experience

    NARCIS (Netherlands)

    Jaeger, Bregje; Bosch, Annet M.

    2016-01-01

    Riboflavin (vitamin B2) is absorbed in the small intestine by the human riboflavin transporters RFVT1 and RFVT3. A third riboflavin transporter (RFVT2) is expressed in the brain. In 2010 it was demonstrated that mutations in the riboflavin transporter genes SLC52A2 (coding for RFVT2) and SLC52A3

  10. Serotonin Transporter Gene ("SLC6A4") Methylation Associates with Neonatal Intensive Care Unit Stay and 3-month-old Temperament in Preterm Infants

    Science.gov (United States)

    Montirosso, Rosario; Provenzi, Livio; Fumagalli, Monica; Sirgiovanni, Ida; Giorda, Roberto; Pozzoli, Uberto; Beri, Silvana; Menozzi, Giorgia; Tronick, Ed; Morandi, Francesco; Mosca, Fabio; Borgatti, Renato

    2016-01-01

    Preterm birth and Neonatal Intensive Care Unit (NICU) stay are early adverse stressful experiences, which may result in an altered temperamental profile. The serotonin transporter gene ("SLC6A4"), which has been linked to infant temperament, is susceptible to epigenetic regulation associated with early stressful experience. This study…

  11. Pathogenic mutations of the human mitochondrial citrate carrier SLC25A1 lead to impaired citrate export required for lipid, dolichol, ubiquinone and sterol synthesis.

    Science.gov (United States)

    Majd, Homa; King, Martin S; Smith, Anthony C; Kunji, Edmund R S

    2018-01-01

    Missense mutations of the human mitochondrial citrate carrier, encoded by the SLC25A1 gene, lead to an autosomal recessive neurometabolic disorder characterised by neonatal-onset encephalopathy with severe muscular weakness, intractable seizures, respiratory distress, and lack of psychomotor development, often resulting in early death. Here, we have measured the effect of all twelve known pathogenic mutations on the transport activity. The results show that nine mutations abolish transport of citrate completely, whereas the other three reduce the transport rate by >70%, indicating that impaired citrate transport is the most likely primary cause of the disease. Some mutations may be detrimental to the structure of the carrier, whereas others may impair key functional elements, such as the substrate binding site and the salt bridge network on the matrix side of the carrier. To understand the consequences of impaired citrate transport on metabolism, the substrate specificity was also determined, showing that the human citrate carrier predominantly transports citrate, isocitrate, cis-aconitate, phosphoenolpyruvate and malate. Although D-2- and L-2 hydroxyglutaric aciduria is a metabolic hallmark of the disease, it is unlikely that the citrate carrier plays a significant role in the removal of hydroxyglutarate from the cytosol for oxidation to oxoglutarate in the mitochondrial matrix. In contrast, computer simulations of central metabolism predict that the export of citrate from the mitochondrion cannot be fully compensated by other pathways, restricting the cytosolic production of acetyl-CoA that is required for the synthesis of lipids, sterols, dolichols and ubiquinone, which in turn explains the severe disease phenotypes. Copyright © 2017. Published by Elsevier B.V.

  12. Variations in CCR5, but not HFE, ELMO1, or SLC12A3, are associated with susceptibility to kidney disease in north Indian individuals with type 2 diabetes.

    Science.gov (United States)

    Yadav, Ashok K; Kumar, Vinod; Dutta, Pinaki; Bhansali, Anil; Jha, Vivekanand

    2014-11-01

    Diabetic nephropathy (DN), the leading cause of end-stage renal disease worldwide, may have a genetic component. In the present study, we investigated variations in a set of genes with susceptibility to DN in a north Indian population. Four genes (HFE, ELMO1, SLC12A3, and CCR5) were selected on the basis of reported association with type 2 diabetes and nephropathy. In all, 417 diabetic subjects (215 without kidney disease [DM] and 202 with DN) and 197 healthy controls (HC) were evaluated for variations in HFE (845 G>A and 187G>C), SLC12A3 (g.34372G>A), CCR5 (59029A>G), and ELMO1 (+9170 G>A). Polymorphism analysis was performed by polymerase chain reaction-restriction fragment length polymorphism and Taqman allele discrimination assays. Significant differences were found in genotype and allelic frequency in SLC12A3 (g.34372G>A) between diabetic subjects and HC (P A (AA+GA) genotype between diabetic subjects with and without nephropathy. However, the CCR5 59029AA genotype and A allele were significantly more frequent in diabetics compared with the HC (P = 0.01 and 0.03, respectively) and subjects with DN versus DM (P = 0.002 and 0.01, respectively). For ELMO1 (+9170 G>A), the GG genotype frequency was higher in the diabetic versus HC group. There were no differences in the frequency of HFE-845 G>A and HFE-187G>C among the groups. This study shows that the CCR5 AA genotype is over-represented in subjects with kidney disease due to type 2 diabetes. The CCR5 59029G>A and ELMO1 (+9170 G>A) loci are more frequent, and the SLC12A3 34372 AA genotype is associated with a reduced risk of diabetes. © 2014 Ruijin Hospital, Shanghai Jiaotong University School of Medicine and Wiley Publishing Asia Pty Ltd.

  13. SLC polarized beam source ultra-high-vacuum design

    International Nuclear Information System (INIS)

    Lavine, T.L.; Clendenin, J.E.; Garwin, E.L.; Hoyt, E.W.; Hoyt, M.W.; Miller, R.H.; Nuttall, J.A.; Schultz, D.C.; Wright, D.

    1991-05-01

    This paper describes the design of the ultra-high vacuum system for the beam-line from the 160-kV polarized electron gun to the linac injector in the Stanford Linear Collider (SLC). The polarized electron source is a GaAs photocathode, requiring 10 -11 -Torr-range pressure for adequate quantum efficiency and longevity. The photo-cathode is illuminated by 3-nsec-long laser pulses. Photo-cathode maintenance and improvements require occasional substitution of guns with rapid restoration of UHV conditions. Differential pumping is crucial since the pressure in the injector is more than 10 times greater than the photocathode can tolerate, and since electron-stimulated gas desorption from beam loss in excess of 0.1% of the 20-nC pulses may poison the photocathode. Our design for the transport line contains a differential pumping region isolated by a pair of valves. Exchange of guns requires venting only this isolated region which can be restored to UHV rapidly by baking. The differential pumping is performed by non-evaporable getters (NEGs) and an ion pump. 3 refs., 3 figs

  14. Seedling and Sapling Dynamics of Treefall Pits in Puerto Rico1

    Science.gov (United States)

    Lawrence R. Walker

    2000-01-01

    Seedling and sapling dynamics in a Puerto Rican rain forest were compared between forest understory and soil pits created by the uprooting of 27 trees during Hurricane Hugo. Soil N and P, organic matter, and soil moisture were lower and bulk densities were higher in the disturbed mineral soils of the pits than in undisturbed forest soils ten months after the hurricane...

  15. Dispersive effects of transverse displacements of SLC Arc magnets

    International Nuclear Information System (INIS)

    Murray, J.J.; Fieguth, T.; Kheifets, S.

    1986-01-01

    The SLC Arc magnets are subject to random displacements and field errors resulting in unpredictable transverse displacement of the central trajectory from that of the design. The chosen method of correcting this perturbed trajectory in the SLC Arcs utilizes mechanical movement of the combined function magnets which compose the Arc transport lines. Here we present the results of a recent investigation substantiating the earlier results which led to the adoption of this method

  16. Autosomal-Recessive Intellectual Disability with Cerebellar Atrophy Syndrome Caused by Mutation of the Manganese and Zinc Transporter Gene SLC39A8

    Science.gov (United States)

    Boycott, Kym M.; Beaulieu, Chandree L.; Kernohan, Kristin D.; Gebril, Ola H.; Mhanni, Aziz; Chudley, Albert E.; Redl, David; Qin, Wen; Hampson, Sarah; Küry, Sébastien; Tetreault, Martine; Puffenberger, Erik G.; Scott, James N.; Bezieau, Stéphane; Reis, André; Uebe, Steffen; Schumacher, Johannes; Hegele, Robert A.; McLeod, D. Ross; Gálvez-Peralta, Marina; Majewski, Jacek; Ramaekers, Vincent T.; Nebert, Daniel W.; Innes, A. Micheil; Parboosingh, Jillian S.; Abou Jamra, Rami

    2015-01-01

    Manganese (Mn) and zinc (Zn) are essential divalent cations used by cells as protein cofactors; various human studies and animal models have demonstrated the importance of Mn and Zn for development. Here we describe an autosomal-recessive disorder in six individuals from the Hutterite community and in an unrelated Egyptian sibpair; the disorder is characterized by intellectual disability, developmental delay, hypotonia, strabismus, cerebellar atrophy, and variable short stature. Exome sequencing in one affected Hutterite individual and the Egyptian family identified the same homozygous variant, c.112G>C (p.Gly38Arg), affecting a conserved residue of SLC39A8. The affected Hutterite and Egyptian individuals did not share an extended common haplotype, suggesting that the mutation arose independently. SLC39A8 is a member of the solute carrier gene family known to import Mn, Zn, and other divalent cations across the plasma membrane. Evaluation of these two metal ions in the affected individuals revealed variably low levels of Mn and Zn in blood and elevated levels in urine, indicating renal wasting. Our findings identify a human Mn and Zn transporter deficiency syndrome linked to SLC39A8, providing insight into the roles of Mn and Zn homeostasis in human health and development. PMID:26637978

  17. Making electron beams for the SLC linac

    International Nuclear Information System (INIS)

    Clendenin, J.E.; Ecklund, S.D.; James, M.B.; Miller, R.H.; Sheppard, J.C.; Sodja, J.; Truher, J.B.; Minten, A.

    1984-01-01

    A source of high-intensity, single-bunch electron beams has been developed at SLAC for the SLC. The properties of these beams have been studied extensively utilizing the first 100-m of the SLAC linac and the computer-based control system being developed for the SLC. The source is described and the properties of the beams are summarized. 9 references, 2 figures, 1 table

  18. Genome-wide association analysis confirms and extends the association of SLC2A9 with serum uric acid levels to Mexican Americans

    Directory of Open Access Journals (Sweden)

    Venkata Saroja eVoruganti

    2013-12-01

    Full Text Available Increased serum uric acid (SUA is a risk factor for gout and renal and cardiovascular disease. The purpose of this study was to identify genetic factors that affect the variation in SUA in 632 Mexican Americans participants of the San Antonio Family Heart Study (SAFHS. A genome-wide association analysis was performed using the Illumina Human Hap 550K single nucleotide polymorphism (SNP microarray. We used a linear regression-based association test under an additive model of allelic effect, while accounting for non-independence among family members via a kinship variance component. All analyses were performed in the software package SOLAR. SNPs rs6832439, rs13131257 and rs737267 in solute carrier protein 2 family, member 9 (SLC2A9 were associated with SUA at genome-wide significance (p <1.3×10-7. The minor alleles of these SNPs had frequencies of 36.2%, 36.2%, and 38.2 %, respectively, and were associated with decreasing SUA levels. All of these SNPs were located in introns 3-7 of SLC2A9, the location of the previously reported associations in European populations. When analyzed for association with cardiovascular-renal disease risk factors, conditional on SLC2A9 SNPs strongly associated with SUA, significant associations were found for SLC2A9 SNPs with BMI, body weight and waist circumference (p < 1.4 x 10-3 and suggestive associations with albumin-creatinine ratio and total antioxidant status. The SLC2A9 gene encodes an urate transporter that has considerable influence on variation in SUA. In addition to the primary association locus, suggestive evidence (p<1.9×10-6 for joint linkage/association was found at a previously-reported urate quantitative trait locus (Logarithm of odds score = 3.6 on 3p26.3. In summary, our GWAS extends and confirms the association of SLC2A9 with SUA for the first time in a Mexican American cohort and also shows for the first time its association with cardiovascular-renal disease risk factors.

  19. Association of a serotonin transporter gene (SLC6A4) 5-HTTLPR polymorphism with body mass index categories but not type 2 diabetes mellitus in Mexicans

    Science.gov (United States)

    Peralta-Leal, Valeria; Leal-Ugarte, Evelia; Meza-Espinoza, Juan P.; Dávalos-Rodríguez, Ingrid P.; Bocanegra-Alonso, Anabel; Acosta-González, Rosa I.; Gonzales, Enrique; Nair, Saraswathy; Durán-González, Jorge

    2012-01-01

    The serotonergic system has been hypothesized to contribute to the biological susceptibility to type 2 diabetes mellitus (T2DM) and body-mass index (BMI) categories. We investigate a possible association of 5-HTTLPR polymorphism (L and S alleles) in the promoter region of the serotonin transporter gene (SLC6A4) with the development of T2DM and/or higher BMI by analyzing a sample of 138 individuals diagnosed with T2DM and 172 unrelated controls from the Mexican general population. In the total sample genotypes were distributed according to Hardy-Weinberg equilibrium, and S allele frequency was 0.58. There was no statistical association between 5-HTTLPR polymorphism and the development of T2DM in this Mexican population sample (p = 0.12). Nevertheless, logistic regression analysis of the L allele and increased BMI disclosed an association, after adjusting for age, sex and T2DM (p = 0.02, OR 1.74, 95% CI: 1.079–2.808). PMID:23055796

  20. Topology mapping to characterize cyanobacterial bicarbonate transporters: BicA (SulP/SLC26 family) and SbtA.

    Science.gov (United States)

    Price, G Dean; Howitt, Susan M

    2014-09-01

    This mini-review addresses advances in understanding the transmembrane topologies of two unrelated, single-subunit bicarbonate transporters from cyanobacteria, namely BicA and SbtA. BicA is a Na(+)-dependent bicarbonate transporter that belongs to the SulP/SLC26 family that is widespread in both eukaryotes and prokaryotes. Topology mapping of BicA via the phoA/lacZ fusion reporter method identified 12 transmembrane helices with an unresolved hydrophobic region just beyond helix 8. Re-interpreting this data in the light of a recent topology study on rat prestin leads to a consensus topology of 14 transmembrane domains with a 7+7 inverted repeat structure. SbtA is also a Na(+)-dependent bicarbonate transporter, but of considerably higher affinity (Km 2-5 μM versus >100 μM for BicA). Whilst SbtA is widespread in cyanobacteria and a few bacteria, it appears to be absent from eukaryotes. Topology mapping of SbtA via the phoA/lacZ fusion reporter method identified 10 transmembrane helices. The topology consists of a 5+5 inverted repeat, with the two repeats separated by a large intracellular loop. The unusual location of the N and C-termini outside the cell raises the possibility that SbtA forms a novel fold, not so far identified by structural and topological studies on transport proteins.

  1. 26 CFR 49.4262(a)-1 - Taxable transportation.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 16 2010-04-01 2010-04-01 true Taxable transportation. 49.4262(a)-1 Section 49...) MISCELLANEOUS EXCISE TAXES FACILITIES AND SERVICES EXCISE TAXES Transportation of Persons § 49.4262(a)-1 Taxable transportation. (a) In general. Unless excluded under section 4262(b) (see § 49.4262(b)-1), taxable...

  2. Importance of high order momentum terms in SLC optics

    International Nuclear Information System (INIS)

    Kozanecki, W.

    1985-01-01

    The evaluation of background levels at the SLC relies, in several cases, on the proper representation of how low momentum electrons propagate through the Arcs and the Final Focus System (FFS). For example, beam - gas bremsstrahlung in the arcs causes electrons of up to 6% energy loss to be transported through to the IP; secondary showers on edges of masks and collimators yield debris with a very wide momentum spectrum. This note is a naive attempt at checking the validity of TRANSPORT and TURTLE calculations, by evaluating the contributions of the momentum terms to increasingly higher order, and checking the mutual consistency of the results produced by the two methods on a beam of wide momentum spread. 8 refs., 4 figs., 1 tab

  3. Pitting corrosion of copper. An equilibrium - mass transport study

    International Nuclear Information System (INIS)

    Taxen, C.

    2002-08-01

    A mathematical model for the propagation of corrosion pits is described and used to calculate the potentials below which copper is immune to pitting. The model uses equilibrium data and diffusion coefficients and calculates the stationary concentration profiles of 26 aqueous species from the bulk water outside a corrosion pit to the site of the metal dissolution. Precipitation of oxides and salts of copper is considered. Studied conditions include water compositions from tap waters to seawater at the temperatures 25 deg C and 75 deg C. Carbonate and sulphate are aggressive towards copper because of complex formation with divalent copper. Carbonate is less aggressive in a corrosion pit than outside at the pH of the bulk. Carbonate carries acidity out from the pit, favours oxide formation and may prevent the initiation of acidic corrosion pits. The concentration profiles are used to estimate the maximum propagation rates for a corrosion pit. A high potential is found to be the most important factor for the rate of propagation. The levels of potential copper can sustain, as corrosion potentials are discussed in terms of the stability of cuprous oxide as a cathode material for oxygen reduction relative to non-conducting cupric phases

  4. Pitting corrosion of copper. An equilibrium - mass transport study

    Energy Technology Data Exchange (ETDEWEB)

    Taxen, C. [Swedish Corrosion Inst., Stockholm (Sweden)

    2002-08-01

    A mathematical model for the propagation of corrosion pits is described and used to calculate the potentials below which copper is immune to pitting. The model uses equilibrium data and diffusion coefficients and calculates the stationary concentration profiles of 26 aqueous species from the bulk water outside a corrosion pit to the site of the metal dissolution. Precipitation of oxides and salts of copper is considered. Studied conditions include water compositions from tap waters to seawater at the temperatures 25 deg C and 75 deg C. Carbonate and sulphate are aggressive towards copper because of complex formation with divalent copper. Carbonate is less aggressive in a corrosion pit than outside at the pH of the bulk. Carbonate carries acidity out from the pit, favours oxide formation and may prevent the initiation of acidic corrosion pits. The concentration profiles are used to estimate the maximum propagation rates for a corrosion pit. A high potential is found to be the most important factor for the rate of propagation. The levels of potential copper can sustain, as corrosion potentials are discussed in terms of the stability of cuprous oxide as a cathode material for oxygen reduction relative to non-conducting cupric phases.

  5. Characterization of substrate preference for Slc1p and Cst26p in Saccharomyces cerevisiae using lipidomic approaches and an LPAAT activity assay.

    Directory of Open Access Journals (Sweden)

    Guanghou Shui

    Full Text Available BACKGROUND: Phosphatidic acid (PA is a key regulated intermediate and precursor for de novo biosynthesis of all glycerophospholipids. PA can be synthesized through the acylation of lysophosphatidic acid (LPA by 1-acyl-3-phosphate acyltransferase (also called lysophosphatidic acid acyltransferase, LPAAT. Recent findings have substantiated the essential roles of acyltransferases in various biological functions. METHODOLOGIES/PRINCIPAL FINDINGS: We used a flow-injection-based lipidomic approach with approximately 200 multiple reaction monitoring (MRM transitions to pre-screen fatty acyl composition of phospholipids in the yeast Saccharomyces cerevisiae mutants. Dramatic changes were observed in fatty acyl composition in some yeast mutants including Slc1p, a well-characterized LPAAT, and Cst26p, a recently characterized phosphatidylinositol stearoyl incorporating 1 protein and putative LPAAT in S. cerevisiae. A comprehensive high-performance liquid chromatography-based multi-stage MRM approach (more than 500 MRM transitions was developed and further applied to quantify individual phospholipids in both strains to confirm these changes. Our data suggest potential fatty acyl substrates as well as fatty acyls that compensate for defects in both Cst26p and Slc1p mutants. These results were consistent with those from a non-radioactive LPAAT enzymatic assay using C17-LPA and acyl-CoA donors as substrates. CONCLUSIONS: We found that Slc1p utilized fatty acid (FA 18:1 and FA 14:0 as substrates to synthesize corresponding PAs; moreover, it was probably the only acyltransferase responsible for acylation of saturated short-chain fatty acyls (12:0 and 10:0 in S. cerevisiae. We also identified FA 18:0, FA 16:0, FA 14:0 and exogenous FA 17:0 as preferred substrates for Cst26p because transformation with a GFP-tagged CST26 restored the phospholipid profile of a CST26 mutant. Our current findings expand the enzymes and existing scope of acyl-CoA donors for

  6. Astrophysical s-factor measurements for {sup 1}20Te(p,{gamma}){sup 1}21I and {sup 1}20Te(p,n){sup 1}20I reactions; {sup 1}20Te(p,{gamma}){sup 1}21I ve {sup 1}20Te(p,n){sup 1}20I reaksiyonlarinin astrofiziksel s-factor oelcuemleri

    Energy Technology Data Exchange (ETDEWEB)

    Gueray, R T; Oezkan, N; Yalcin, C [Kocaeli University, Kocaeli (Turkey); Goerres, J; DeBoer, R; Palumbo, A; Tan, W P; Wiescher, M [University of Notre Dame, (United States); Fueloep, Zs; Somorjai, E [Institute of Nuclear Research ATOMKI (Hungary); Lee, H Y [Argonne National Laboratory (United States)

    2009-07-01

    Astrophysical S-factors for the {sup 1}20Te(p,{gamma}){sup 1}21I and {sup 1}20Te(p,n){sup 1}20I reactions have been measured in the effective center-of-mass energies between 2.47 MeV and 7.93 MeV. Experimental data have been compared with the Hauser-Fesbach statistical model calculations obtained with the model codes NON-SMOKER and TALYS. The discrepancies between the experimental results and calculations can mainly be attributed to the optical model potentials used in the codes.

  7. Treatment of intractable epilepsy in a female with SLC6A8 deficiency

    NARCIS (Netherlands)

    Mercimek-Mahmutoglu, S.; Connolly, M.B.; Poskitt, K.J.; Horvath, G.A.; Lowry, N.; Salomons, G.S.; Casey, B.; Sinclair, G.; Davis, C.; Jakobs, C.; Stockler-Ipsiroglu, S.

    2010-01-01

    A female heterozygous for a novel, disease causing, missense mutation in the X-linked cerebral creatine transporter (SLC6A8) gene (c.1067G > T, p.Gly356Val) presented with intractable epilepsy, mild intellectual disability and moderately reduced cerebral creatine levels. Treatment with creatine

  8. Functional assessment of allelic variants in the SLC26A4 gene involved in Pendred syndrome and nonsyndromic EVA

    Science.gov (United States)

    Pera, Alejandra; Dossena, Silvia; Rodighiero, Simona; Gandía, Marta; Bottà, Guido; Meyer, Giuliano; Moreno, Felipe; Nofziger, Charity; Hernández-Chico, Concepción; Paulmichl, Markus

    2008-01-01

    Pendred syndrome is an autosomal recessive disorder characterized by sensorineural hearing loss, with malformations of the inner ear, ranging from enlarged vestibular aqueduct (EVA) to Mondini malformation, and deficient iodide organification in the thyroid gland. Nonsyndromic EVA (ns-EVA) is a separate type of sensorineural hearing loss showing normal thyroid function. Both Pendred syndrome and ns-EVA seem to be linked to the malfunction of pendrin (SLC26A4), a membrane transporter able to exchange anions between the cytosol and extracellular fluid. In the past, the pathogenicity of SLC26A4 missense mutations were assumed if the mutations fulfilled two criteria: low incidence of the mutation in the control population and substitution of evolutionary conserved amino acids. Here we show that these criteria are insufficient to make meaningful predictions about the effect of these SLC26A4 variants on the pendrin-induced ion transport. Furthermore, we functionally characterized 10 missense mutations within the SLC26A4 ORF, and consistently found that on the protein level, an addition or omission of a proline or a charged amino acid in the SLC26A4 sequence is detrimental to its function. These types of changes may be adequate for predicting SLC26A4 functionality in the absence of direct functional tests. PMID:19017801

  9. Organic cation transporter 2 (SLC22A2), a low-affinity and high-capacity choline transporter, is preferentially enriched on synaptic vesicles in cholinergic neurons.

    Science.gov (United States)

    Nakata, T; Matsui, T; Kobayashi, K; Kobayashi, Y; Anzai, N

    2013-11-12

    Organic cation transporters (OCTs) are expressed mainly in the kidney and liver. OCTs transport intrinsic organic cations, including monoamine, dopamine, serotonine and choline, across the plasma membrane. Here, we demonstrate that OCT2 (SLC22A2) is expressed in cholinergic neurons, motoneurons in the anterior horn of the spinal cord, and is implicated in acetylcholine (Ach) recycling in presynaptic terminals. Application of rabbit anti-peptide antibody revealed that OCT2 was expressed in the anterior horn of the spinal cord. Double immunostaining of muscle sections with anti-OCT2 and alpha-bungarotoxin (BTX) revealed that OCT2 was localized in the neuromuscular junctions (NMJs). Immunoelectron microscopy revealed that OCT2 was localized both in synaptic vesicles (SVs) in presynaptic terminals around the motoneurons (C-terminals) and in SVs in nerve terminals in NMJs. The similarity in the distribution of OCT2 in cholinergic neurons and that of vesicular acetyl choline transporter (VAchT), and the fact that OCT2 can transport choline suggest that OCT2 could work as a low-affinity and high-capacity choline transporter at presynaptic terminals in cholinergic neurons in a firing-dependent manner. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.

  10. SLCO1B1 and SLC19A1 gene variants and irinotecan-induced rapid response and survival: a prospective multicenter pharmacogenetics study of metastatic colorectal cancer.

    Directory of Open Access Journals (Sweden)

    Liu Huang

    Full Text Available Rapid response to chemotherapy in metastatic colorectal cancer (mCRC patients (response within 12 weeks of chemotherapy may increase the chance of complete resection and improved survival. Few molecular markers predict irinotecan-induced rapid response and survival. Single-nucleotide polymorphisms (SNPs in solute carrier genes are reported to correlate with the variable pharmacokinetics of irinotecan and folate in cancer patients. This study aims to evaluate the predictive role of 3 SNPs in mCRC patients treated with irinotecan and fluoropyrimidine-containing regimens.Three SNPs were selected and genotyped in 137 mCRC patients from a Chinese prospective multicenter trial (NCT01282658. The chi-squared test, univariate and multivariable logistic regression model, and receiver operating characteristic analysis were used to evaluate correlations between the genotypes and rapid response. Kaplan-Meier survival analysis and Cox proportional hazard models were used to evaluate the associations between genotypes and survival outcomes. Benjamini and Hochberg False Discovery Rate correction was used in multiple testing.Genotype GA/AA of SNP rs2306283 of the gene SLCO1B1 and genotype GG of SNP rs1051266 of the gene SLC19A1 were associated with a higher rapid response rate (odds ratio [OR] =3.583 and 3.521, 95%CI =1.301-9.871 and 1.271-9.804, p=0.011 and p=0.013, respectively. The response rate was 70% in patients with both genotypes, compared with only 19.7% in the remaining patients (OR = 9.489, 95%CI = 2.191-41.093, Fisher's exact test p=0.002. Their significances were all maintained even after multiple testing (all p c < 0.05. The rs2306283 GA/AA genotype was also an independent prognostic factor of longer progression-free survival (PFS (hazard ratio = 0.402, 95%CI = 0.171-0.945, p=0.037. None of the SNPs predicted overall survival.Polymorphisms of solute carriers' may be useful to predict rapid response to irinotecan plus fluoropyrimidine and PFS in m

  11. Measurement of electron beam polarization at the SLC

    International Nuclear Information System (INIS)

    Steiner, H.; California Univ., Berkeley

    1988-01-01

    One of the unique features of the SLC is its capability to accelerate longitudinally polarized electrons. The SLC polarization group has been performed to implement the polarization program at the SLC. Technically the polarization project consists of three main parts: (1) a polarized source, (2) spin-rotating superconducting solenoid magnets to be used to manipulate the direction of the electron spin, and (3) the polarimeters needed to monitor and measure the electron beam polarization. It is this last topic that will concern us here. Two types of polarimeters will be used - Compton and Moeller. (orig./HSI)

  12. L-Theanine Administration Modulates the Absorption of Dietary Nutrients and Expression of Transporters and Receptors in the Intestinal Mucosa of Rats

    Directory of Open Access Journals (Sweden)

    Qiongxian Yan

    2017-01-01

    Full Text Available L-theanine has various advantageous functions for human health; whether or not it could mediate the nutrients absorption is unknown yet. The effects of L-theanine on intestinal nutrients absorption were investigated using rats ingesting L-theanine solution (0, 50, 200, and 400 mg/kg body weight per day for two weeks. The decline of insulin secretion and glucose concentration in the serum was observed by L-theanine. Urea and high-density lipoprotein were also reduced by 50 mg/kg L-theanine. Jejunal and ileac basic amino acids transporters SLC7a1 and SLC7a9, neutral SLC1a5 and SLC16a10, and acidic SLC1a1 expression were upregulated. The expression of intestinal SGLT3 and GLUT5 responsible for carbohydrates uptake and GPR120 and FABP2 associated with fatty acids transport were inhibited. These results indicated that L-theanine could inhibit the glucose uptake by downregulating the related gene expression in the small intestine of rats. Intestinal gene expression of transporters responding to amino acids absorption was stimulated by L-theanine administration.

  13. Urine screening for patients with developmental disabilities detected a patient with creatine transporter deficiency due to a novel missense mutation in SLC6A8.

    Science.gov (United States)

    Kato, Hidekazu; Miyake, Fuyu; Shimbo, Hiroko; Ohya, Makoto; Sugawara, Hidenori; Aida, Noriko; Anzai, Rie; Takagi, Mariko; Okuda, Mitsuko; Takano, Kyoko; Wada, Takahito; Iai, Mizue; Yamashita, Sumimasa; Osaka, Hitoshi

    2014-08-01

    Creatine transporter deficiency (CTD) is an example of X-linked intellectual disability syndromes, caused by mutations in SLC6A8 on Xq28. Although this is the second most frequent genetic cause of intellectual disabilities in Europe or America after Fragile X syndrome, information on the morbidity of this disease is limited in Japan. Using the HPLC screening method we have established recently, we examined samples of urine of 105 patients (73 males and 32 females) with developmental disabilities at our medical center. And we have found a family with three ID boys with a novel missense mutation in SLC6A8. This is the second report of a Japanese family case of CTD. A systematic diagnostic system of this syndrome should be established in Japan to enable us to estimate its frequency and treatment. Copyright © 2013 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  14. Métodos para predição de bitter pit em maçãs 'Fuji' e 'Braeburn' Methods for bitter pit prediction in Fuji and Braeburn apples

    Directory of Open Access Journals (Sweden)

    Ivan Sestari

    2009-07-01

    Full Text Available Experimentos foram conduzidos com objetivo de avaliar a eficiência de métodos para predição da ocorrência de bitter pit em maçãs 'Fuji' e 'Braeburn' em duas épocas de amostragem. Os frutos, provenientes de seis pomares distintos, três para cada cultivar, foram coletados antecipadamente (20 dias em relação à colheita e na data prevista para a colheita comercial. Os métodos de predição utilizados foram: a infiltração dos frutos com solução 0,10M MgCl2 mais 0,01% Tween-20 e 0,4M de sorbitol; b imersão dos frutos em solução com 2500nL L-1 de ethephon mais 0,01% Tween-20. Os frutos foram armazenados em atmosfera controlada (AC por cinco meses mais 12 dias, a 20°C, simulando a incidência real de bitter pit em armazenamento comercial. Cada tratamento foi constituído por quatro repetições de 25 frutos. A incidência e severidade de bitter pit, prevista por ambos os métodos foi semelhante à ocorrência real de bitter pit após o armazenamento em atmosfera controlada para cada uma das cultivares utilizadas, quando os frutos foram amostrados antecipadamente em relação à colheita comercial. Na avaliação realizada com frutos amostrados na colheita comercial, nenhum dos métodos foi capaz de prever a incidência de bitter pit após o armazenamento de maneira confiável. Para ambas as cultivares, a infiltração com magnésio e a imersão dos frutos em ethephon só são eficientes na predição da incidência de bitter pit em frutos coletados 20 dias antes da colheita comercial.Experiments were carried out with objective to evaluate the efficiency of methods for bitter pit prediction in 'Fuji' and 'Braeburn' apples sampled at two harvest dates. Fruits from 6 orchards, three for each cultivar, were sampled earlier (20 days before harvest and at commercial harvest date. The prediction methods assessed were: infiltration of apples with 0.10M MgCl2 solution containing 0.01% Tween-20 and 0.4M sorbitol; and immersion of fruits in 2

  15. The glutamate transport inhibitor DL-Threo-β-Benzyloxyaspartic acid (DL-TBOA) differentially affects SN38- and oxaliplatin-induced death of drug-resistant colorectal cancer cells

    International Nuclear Information System (INIS)

    Pedraz-Cuesta, Elena; Christensen, Sandra; Jensen, Anders A.; Jensen, Niels Frank; Bunch, Lennart; Romer, Maria Unni; Brünner, Nils; Stenvang, Jan; Pedersen, Stine Falsig

    2015-01-01

    Colorectal cancer (CRC) is a leading cause of cancer death globally and new biomarkers and treatments are severely needed. Here, we employed HCT116 and LoVo human CRC cells made resistant to either SN38 or oxaliplatin, to investigate whether altered expression of the high affinity glutamate transporters Solute Carrier (SLC)-1A1 and -1A3 (EAAT3, EAAT1) is associated with the resistant phenotypes. Analyses included real-time quantitative PCR, immunoblotting and immunofluorescence analyses, radioactive tracer flux measurements, and biochemical analyses of cell viability and glutathione content. Results were evaluated using one- and two-way ANOVA and Students two-tailed t-test, as relevant. In SN38-resistant HCT116 and LoVo cells, SLC1A1 expression was down-regulated ~60 % and up-regulated ~4-fold, respectively, at both mRNA and protein level, whereas SLC1A3 protein was undetectable. The changes in SLC1A1 expression were accompanied by parallel changes in DL-Threo-β-Benzyloxyaspartic acid (TBOA)-sensitive, UCPH101-insensitive [ 3 H]-D-Aspartate uptake, consistent with increased activity of SLC1A1 (or other family members), yet not of SLC