Directory of Open Access Journals (Sweden)
Rosa Gagliardi B.
2015-01-01
Full Text Available Objective. The objective of this study is to analyze the frequency of mdr1-1Δ mutation in German Shepherd, Doberman, Border Collie and Greyhound dog breeds in Uruguay. Materials and methods. A total of 95 animals from the four breeds mentioned above were studied. DNA was isolated from blood using potassium acetate with a subsequent degradation from RNA with RNAsaH. The concentration and quality of the DNA obtained was evaluated with a Nanodrop, ND-1000 spectrophotometer. To determine the presence or absence of the mdr1-1Δ mutation, DNA samples were sent to Gene Seek, Neogen Corporation of Chicago, United States, for genotyping. Results. In all 95 animals studied, the mdr1-1Δ mutation was not present. Conclusions. Based on the preliminary results obtained, other elements that may cause adverse drug reactions must be considered: unidentified mutations in other regions of the MDR1 gene; mutations in other genes involved in the transport of drugs from the same subfamily or another; mutations in enzymes involved in drug metabolism (e.g. Cytochrome P450. Moreover, especially with Border Collies and Greyhounds, it is advisable to increase the number of animals in the study.
El-Ariss, Mohamad
Cancer is the leading cause of death in Canada and is responsible for about 30% of all deaths in the country.[1] It is estimated that by 2015, one in four Canadians (24% women and 29% men) will die from cancer. In the world and only for 2012, 14 million new cancer cases and 8.2 million deaths from the disease were reported.[2] The worst is yet to come because, according to World Health Organization, the number of new cases is expected to increase by about 70% over the next two decades. The high mortality associated with cancer is partly explained by the acquisition of drug resistance that make patients refractory to chemotherapy. In fact, cancer cells exposed to a cytotoxic agent during chemotherapy, may develop a resistance to this agent as well as various agents sharing structural or functional similarities. These cancer cells are known for multidrug resistance ("Multiple Drug resistant cells"). The development of resistance to chimiodrogues is a major public health problem that presents an obstacle for the development of new cancer treatments. MCF-7 MDR are established cell lines of human breast cancer that have developed resistance to chimiodrogues such as doxorubicin. MCF-7 MDR have the particularity to over-express P-gp protein that is responsible for the detoxification of cells by reflux of chimiodrogues. The purpose of this study was therefore to reduce the expression of P-gp, encoded by the MDR1 gene (also called gene ABCB1) in cancer cells MCF-7, and re-sensitize MCF-7 MDR cells to anti-cancer treatments. In order to modify MDR1 gene expression, we used small RNAi called siRNA that are specific to the MDR1 gene. In total, 4 duplexes of siRNA have been used: siRNA_1, siRNA_1M, siRNA_2 and siRNA_2M. Each of the duplexes strands is consists of 21 nucleic acids and has two protruding nucleic acids (overhangs) at the 3' end. siRNA_1 and siRNA_1M are complementary to the nucleic acid sequence (577-595 nucleic acids ) of the MDR1 gene, whereas siARN_2 and si
Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids
Directory of Open Access Journals (Sweden)
Buddhasukh Duang
2004-04-01
Full Text Available Abstract Background Multidrug resistance (MDR is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170, thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. Methods In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn, were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Results Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. Conclusion These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents.
Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids
International Nuclear Information System (INIS)
Limtrakul, Pornngarm; Anuchapreeda, Songyot; Buddhasukh, Duang
2004-01-01
Multidrug resistance (MDR) is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170), thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn), were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin) decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents
MDR1 P-glycoprotein transports endogenous opioid peptides
Oude Elferink, R. P.; Zadina, J.
2001-01-01
MDR1 P-glycoprotein is generally regarded as an efflux pump for amphipathic toxic compounds. The question remains, however, whether certain endogenous compounds are also substrates for this transporter. Certain peptides have been shown to interact with MDR1 Pgp as well and we have therefore
Analysis of mdr1-1Δ mutation of MDR1 gene in the “Cimarron Uruguayo” dog
Directory of Open Access Journals (Sweden)
Rosa Gagliardi B.
2013-08-01
Full Text Available Objective. The aim of this paper is to analyze the frequency of the mdr1-1D mutation of the MDR1 gene in a dog sample of the Uruguayan Cimarron breed with the objective of increasing the knowledge of this breed’s genome. Materials and methods. Thirty-six animals of this breed were analyzed. The MDR1 gene region, which includes the location where the mutation would be present, was amplified by PCR. Results. The mutation was not detected in any of the analyzed Uruguayan Cimarron. Conclusions. The lack of described ivermectin intoxication cases in veterinary clinic in this breed is explained by the lack of the mutation object of this study. The sequence studied in Cimarron dogs is kept compared to other breeds, except Collies and related breeds (Border Collie, Bearded Collie, Old English sheepdog.
Directory of Open Access Journals (Sweden)
Mary Dyszlewski
2002-01-01
Full Text Available Multidrug resistance (MDR mediated by overexpression of MDR1 P-glycoprotein (Pgp is one of the best characterized barriers to chemotherapy in cancer patients. Furthermore, the protective function of Pgp-mediated efflux of xenobiotics in various organs has a profound effect on the bioavailability of drugs in general. Thus, there is an expanding requirement to noninvasively interrogate Pgp transport activity in vivo. We herein report the Pgp recognition properties of a novel 99mTc(I-tricarbonyl complex, [99mTc(CO3(MIBI3] + (Tc-CO-MIBI. Tc-CO-MIBI showed 60-fold higher accumulation in drug-sensitive KB 3–1 cells compared to colchicine-selected drug-resistant KB 8-5 cells. In KB 8-5 cells, tracer enhancement was observed with the potent MDR modulator LY335979 (EC50 = 62 nM. Similar behavior was observed using drug-sensitive MCF-7 breast adenocarcinoma cells and MCF-7/MDR1 stable transfectants, confirming that Tc-CO-MIBI is specifically excluded by overexpression of MDR1 Pgp. By comparison, net accumulation in control H69 lung tumor cells was 9-fold higher than in MDR-associated protein (MRP1-expressing H69AR cells, indicating only modest transport by MRP1. Biodistribution analysis following tail vein injection of Tc-CO-MIBI showed delayed liver clearance as well as enhanced brain uptake and retention in mdr1a/1b(−/− gene deleted mice versus wild-type mice, directly demonstrating that Tc-CO-MIBI is a functional probe of Pgp transport activity in vivo.
Re, G G; Willingham, M C; el Bahtimi, R; Brownlee, N A; Hazen-Martin, D J; Garvin, A J
1997-02-01
One reason for the failure of chemotherapy is the overexpression of the multidrug resistance gene, MDR1. The product of this gene is the multidrug transporter P-glycoprotein, an ATP-dependent pump that extrudes drugs from the cytoplasm. Some tumors inherently express P-glycoprotein, whereas others acquire the ability to do so after exposure to certain chemotherapeutic agents, often by the mechanism of gene amplification. Classical Wilms' tumors (nephroblastoma) typically respond to therapy and have a good prognosis. On the contrary, anaplastic Wilms' tumors are generally refractory to chemotherapy. These anaplastic variants are rare (4.5% of all Wilms' tumors reported in the United States), aggressive, and often fatal forms of tumor, which are commonly thought to result from the progression of classical Wilms' tumors. To investigate the basis for this differential response to therapy, we examined a number of classical and anaplastic Wilms' tumors for the expression of the MDR1 gene by immunohistochemical and mRNA analysis. Classical Wilms' tumors consistently did not express P-glycoprotein except in areas of tubular differentiation, as in normal kidney. Similarly, two of three anaplastic tumors failed to show P-glycoprotein expression. In contrast, cultured cells derived from a third anaplastic tumor, W4, exhibited strong P-glycoprotein expression and were drug resistant in vitro. Southern analysis revealed that W4 cells contained a single copy of the MDR1 gene per haploid genome similar to normal cells, demonstrating that the overexpression of MDR1 was not caused by gene amplification. Transcriptional activation of the MDR1 gene would be in keeping with the concept that p53 might act as a transcriptional repressor of the MDR1 gene.
Wielandt, Ana María; Vollrath, Valeska; Chianale, José
2004-09-01
There are significant differences in drug responses among different ethnic groups. The multidrug transporter P-gp, encoded by the MDR1 gene, plays a key role in determining drug bioavailability, and an association between a polymorphism in exon 26 (C3435T) and lower P-gp expression has been found. The co-segregation of this polymorphism with the polymorphism in exon 12 (C1236T) and in exon 21 (G2677T/A) determines several MDR1 haplotypes in humans. To characterize the polymorphisms of exons 26, 21 and 12 of the MDR1 gene in different Chilean populations. Using a polymerase chain reaction and restriction fragment length polymorphism technique, we studied the allelic frequencies and the distribution of MDR1 haplotypes in 3 Chilean populations: Mestizo (n=104), Mapuche (n=96, living in the National Reservation of the Huapi Island, Ranico Lake) and Maori (n=52, living in Eastern Island). The frequency of the normal MDR1*1 haplotype, without mutations, was lower in Mapuches than in Mestizos or Maoris (p0.0.5), but lower than the frequencies reported in Caucasians or Asians (p<0.05). We found significant differences in the frequencies of genetic polymorphisms of the MDR1 gene in Chilean populations, related to the ethnic origins of our ancestors.
Schinkel, A. H.; Mayer, U.; Wagenaar, E.; Mol, C. A.; van Deemter, L.; Smit, J. J.; van der Valk, M. A.; Voordouw, A. C.; Spits, H.; van Tellingen, O.; Zijlmans, J. M.; Fibbe, W. E.; Borst, P.
1997-01-01
The mdr1-type P-glycoproteins (P-gps) confer multidrug resistance to cancer cells by active extrusion of a wide range of drugs from the cell. To study their physiological roles, we have generated mice genetically deficient in the mdr1b gene [mdr1b (-/-) mice] and in both the mdr1a and mdr1b genes
HIV-1 integrase inhibitors are substrates for the multidrug transporter MDR1-P-glycoprotein
Directory of Open Access Journals (Sweden)
Cara Andrea
2007-03-01
Full Text Available Abstract Background The discovery of diketoacid-containing derivatives as inhibitors of HIV-1 Integrase (IN (IN inhibitors, IINs has played a major role in validating this enzyme as an important target for antiretroviral therapy. Since the in vivo efficacy depends on access of these drugs to intracellular sites where HIV-1 replicates, we determined whether the IINs are recognized by the multidrug transporter MDR1-P-glycoprotein (P-gp thereby reducing their intracellular accumulation. To address the effect of IINs on drug transport, nine quinolonyl diketo acid (DKA derivatives active on the HIV-1 IN strand transfer (ST step and with EC50 ranging from 1.83 to >50 μm in cell-based assays were tested for their in vitro interaction with P-gp in the CEM-MDR cell system. IINs were investigated for the inhibition and induction of the P-gp function and expression as well as for multidrug resistance (MDR reversing ability. Results The HIV-1 IINs act as genuine P-gp substrates by inhibiting doxorubicin efflux and inducing P-gp functional conformation changes as evaluated by the modulation of UIC2 mAb epitope. Further, IINs chemosensitize MDR cells to vinblastine and induce P-gp expression in drug sensitive revertants of CEM-MDR cells. Conclusion To our knowledge, this is the first demonstration that HIV-1 IINs are P-gp substrates. This biological property may influence the absorption, distribution and elimination of these novels anti HIV-1 compounds.
International Nuclear Information System (INIS)
Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B.; Wunder, J.S.; Andrulis, I.L.; Gazdar, A.F.; Willman, C.L.; Griffith, B.; Von Hoff, D.D.
1990-01-01
The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy
DEFF Research Database (Denmark)
Stein, Ulrike; Lage, Hermann; Jordan, Andreas
2002-01-01
The impact of the ABC transporters breast cancer resistance protein/mitoxantrone resistance associated transporter (BCRP/MXR), multidrug resistance-associated protein 1 (MRP1) and multidrug resistance gene-1/P-glycoprotein (MDR1/PGP) on the multidrug resistance (MDR) phenotype in chemoresistance...... expression of BCRP/MXR and of MRP1 were clearly enhanced (vs. parental and classical MDR lines). MDR1/PGP expression was distinctly elevated in the classical MDR subline EPG85-257RDB (vs. parental and atypical MDR sublines). In all thermoresistant counterparts basal expression of BCRP/MXR, MRP1 and MDR1/PGP...... was increased relative to thermosensitive sublines. Although it could be shown that the overexpressed ABC transporters were functionally active, however, no decreased drug accumulations of doxorubicin, mitoxantrone and rhodamine 123 were observed. Thus, expression of BCRP/MXR, MRP1 and MDR1/PGP was found...
Personalized Medicine Digoxin Theraphy in Individuals with MDR Gene Polymorphism
Directory of Open Access Journals (Sweden)
Em Sutrisna
2015-06-01
Full Text Available Digoxin is one of digitalis drugs. Wider applicability to heart failure and arrhythmias (supraventricular requires fairly strict scrutiny because of its narrow therapeutic index. Digoxin is a substrate of P-glycoprotein (P-gp encoded by multi drugs resistance-1 (MDR1. MDR-1 gen located on chromosome 7q21.1. This gene contains 28 exons that encoded a protein of 1280 amino acids. This gene plays an important role in the absorption, distribution and elimination of many drugs. MDR1C3435T polymorphism occurs in exon 26. There are three types of MDR1C3435T gene namely MDR1C3435T CC, MDR1C3435T CT and MDR1C3435T TT. These polymorphisms will affect to the formation of P-gp and consequently to change the kinetic profile of digoxin. The change of kinetic profile causes changes in the digoxin blood levels. The method used in this review is data search based on pubmed, medline, and embase with keywords MDR and digoxin. There are several different studies of the influence of polymorphisms MDR1C3435T on blood digoxin levels. Increased levels of digoxin in the blood due to polymorphism of MDR1C3435T will be at risk of digitalis intoxication. Long-term digoxin treatment or large dose should consider the patient’s genetic profile. Distribution of polymorphism of MDR1C3435T in Javanese population is approximately TT (0,10, CT (0,52, and CC(0, 38.
EXSPRESSION OF MDR-GENES AND MONORESISTANCE GENES IN NON-SMALL-CELL LUNG CANCER
Directory of Open Access Journals (Sweden)
E. L. Yumov
2014-01-01
Full Text Available We studied the expression of multidrug resistance genes (MDR and monoresistance genes in normal bronchial tissue and tumor tissue of the non-small cell lung cancer (NSCLC after neoadjuvant chemotherapy (NACT (vinorelbine-carboplatine. The study included 30 patients with NSCLC (Т2–4N0–3M0. Normal bronchial tissue, normal lung tissue and tumor tissue collected during surgery following neoadjuvant chemotherapy (NACT served as a material of the study. The expression levels of MDR genes (ABCB1, ABCB2, ABCC1, ABCC2, ABCС5, ABCG1, ABCG2, GSTP and MVP, and monoresistance genes (BRCA1, ERCC1, RRM1, TOP1, TOP2A, TUBB3 and TYMS were estimated by quantitative reverse transcriptase PCR (RT-qPCR. The expression levels of some MDR genes and monoresistance genes (АВСВ1, АВСВ2, ABCG1, ERCC1, GSTP1 and MVP were significantly higher in the bronchi than in tumor tissue. The expression of ABCG1, ABCG2 and ERCC1 genes was higher in patients with T1-2 cancer than in patients with T3-4 cancer. Patients with adenocarcinoma had higher expression of BRCA1, MVP and ABCB1 genes than patients with squamous cell lung cancer. A tendency towards reduction in the expression level of MDR-genes and monoresistance genes was observed in patients with partial tumor regression compared to that observed in patients with stable disease. These findings were consistent with the previous data on reduction in the MDR-gene expression after chemotherapy with a good response in breast cancer patients.
Bouzidi, Amira; Mesbah-Amroun, Hamida; Boukercha, Aziza; Benhassine, Fadila; Belboueb, Réda; Berkouk, Karima; Messadi, Wassila; Touil-Boukoffa, Chafia
2016-12-01
The multi-drug resistance gene (MDR1) has raised increasing interest as a susceptibility gene for Crohn's disease (CD). The role of MDR1 single-nucleotide polymorphisms (SNPs) in the predisposition and behavior of CD in the pediatric population is still elusive. Here, we investigated whether SNPs in MDR1 are associated with CD in Algerian pediatric patients. A case-control study was conducted enrolling 47 pediatric CD patients and 100 controls. All subjects were genotyped for the most common MDR1 SNPs (C3434T, C1236T, and G2677A/T) using PCR-RFLP method. We also explored the association between polymorphisms and clinical sub-phenotypes. We have detected no significant association of C3435T SNP and pediatric CD. However, we observed a significantly higher frequency of the risk alleles, 1236T and 2677T/A among the CD patients compared to controls. Moreover, the risk allele 1236T was associated to a higher risk for resective surgery. Our data suggest that the C1236T and G2677A/T SNPs in the MDR1 gene are associated with CD and the C1236T risk allele with a more severe course of disease in Algerian pediatric patients. Further analysis using larger patients group and functional studies would be interesting to elucidate the role of MDR1 gene in pediatric CD.Pediatric Research (2016); doi:10.1038/pr.2016.163.
Mdr65 decreases toxicity of multiple insecticides in Drosophila melanogaster.
Sun, Haina; Buchon, Nicolas; Scott, Jeffrey G
2017-10-01
ABC transporters are ubiquitous membrane-bound proteins, present in both prokaryotes and eukaryotes. The major function of eukaryotic ABC transporters is to mediate the efflux of a variety of substrates (including xenobiotics) out of cells. ABC transporters have been widely investigated in humans, particularly for their involvement in multidrug resistance (MDR). Considerably less is known about their roles in transport and/or excretion in insects. ABC transporters are only known to function as exporters in insects. Drosophila melanogaster has 56 ABC transporter genes, including eight which are phylogenetically most similar to the human Mdr genes (ABCB1 clade). We investigated the role of ABC transporters in the ABCB1 clade in modulating the susceptibility to insecticides. We took advantage of the GAL4/UAS system in D. melanogaster to knockdown the expression levels of Mdr65, Mdr50, Mdr49 and ABCB6 using transgenic UAS-RNAi lines and conditional driver lines. The most notable effects were increased sensitivities to nine different insecticides by silencing of Mdr65. Furthermore, a null mutation of Mdr65 decreased the malathion, malaoxon and fipronil LC 50 values by a factor of 1.9, 2.1 and 3.9, respectively. Altogether, this data demonstrates the critical role of ABC transporters, particularly Mdr65, in altering the toxicity of specific, structurally diverse, insecticides in D. melanogaster. Copyright © 2017 Elsevier Ltd. All rights reserved.
Harivenkatesh, Natarajan; Kumar, Lalit; Bakhshi, Sameer; Sharma, Atul; Kabra, Madhulika; Velpandian, Thirumurthy; Gogia, Ajay; Shastri, Shivaram S; Gupta, Yogendra Kumar
2017-09-01
Influence of polymorphisms in the genes coding for imatinib transporters and metabolizing enzymes on cytogenetic relapse in patients with chronic myeloid leukemia (CML) is not known. One hundred and four patients (52 cases with cytogenetic relapse and 52 controls without relapse) with chronic-phase CML on imatinib therapy and have completed 5 years of follow-up were enrolled. The following single nucleotide polymorphisms (SNPs) were genotyped; C1236T, C3435T, G2677T/A in MDR1 gene and A6986G in CYP3A5 gene, using PCR-RFLP method and validated by direct gene sequencing. Imatinib trough levels were measured using LC-MS/MS. Patients with CC genotype for MDR1-C1236T polymorphism were at significantly higher risk for cytogenetic relapse [OR =4.382, 95% CI (1.145, 16.774), p = .022], while those with TT genotype for MDR1-C3435T polymorphism had significantly lower risk of relapse [OR =0.309, 95% CI (0.134, 0.708), p = .005]. Imatinib trough levels were lower in patients with relapse compared to those without relapse (1551.4 ± 1324.1 vs. 2154.2 ± 1358.3 ng/mL; p = .041). MDR1-C3435T genotype [adjusted-OR: 0.266; 95% CI (0.111, 0.636); p = .003] and trough levels (p = .014) were independent predictors of relapse in multivariate analysis. To conclude, C1236T and C3435T polymorphisms in MDR1 gene and trough levels significantly influence the risk of cytogenetic relapse. MDR1-C3435T genotype might emerge as a potential biomarker to predict the risk of cytogenetic relapse in patients with CML.
Specificity of drug transport mediated by CaMDR1: a major facilitator ...
Indian Academy of Sciences (India)
Unknown
CaMDR1 encodes a major facilitator superfamily (MFS) protein in Candida albicans whose expression has been linked to .... by plaque assay and the integration of CaMDR1 at the ... with recombinant virus, vAcCaMDR1 and cells infected.
Role of hypoxia-inducible factor-α in hepatitis-B-virus X protein-mediated MDR1 activation
International Nuclear Information System (INIS)
Han, Hyo-Kyung; Han, Chang Yeob; Cheon, Eun-Pa; Lee, Jaewon; Kang, Keon Wook
2007-01-01
The transition from chemotherapy-responsive cancer cells to chemotherapy-resistant cancer cells is mainly accompanied by the increased expression of multi-drug resistance 1 (MDR1). We found that hepatitis-B-virus X protein (HBx) increases the transcriptional activity and protein level of MDR1 in a hepatoma cell line, H4IIE. In addition, HBx overexpression made H4IIE cells more resistant to verapamil-uptake. HBx stabilized hypoxia-inducible factor-1α (HIF-1α) and induced the nuclear translocation of C/EBPβ. Reporter gene analyses showed that HBx increased the reporter activity in the cells transfected with the reporter containing MDR1 gene promoter. Moreover, the luciferase reporter gene activity was significantly inhibited by HIF-1α siRNA but not by overexpression of C/EBP dominant negative mutant. These results imply that HBx increases the MDR1 transporter activity through the transcriptional activation of the MDR1 gene with HIF-1α activation, and suggest HIF-1α for the therapeutic target of HBV-mediated chemoresistance
Directory of Open Access Journals (Sweden)
Jianfang Chen
Full Text Available Multidrug resistance (MDR is one of the major reasons chemotherapy-based treatments fail. Hypoxia is generally associated with tumor chemoresistance. However, the correlation between the heterodimeric hypoxia-inducible factor-1 (HIF-1 and the multidrug resistance (MDR1 gene/transporter P-glycoprotein (P-gp remains unclear. This study aims to explore the molecular mechanisms of reversing colon cancer MDR by focusing on the target gene HIF-1α.A chemotherapeutic sensitivity assay was used to observe the efficiency of MDR reversal in LoVo multicellular spheroids (MCS. The apoptotic level induced by different drugs was examined by flow cytometry (FCM. Binding of HIF-1α to the MDR1 gene promoter was evaluated by Chromatin immunoprecipitation (ChIP. The relationship between HIF-1α/P-gp expression and sensitivity to chemotherapy was analyzed.The sensitivity of LoVo MCS to all four chemotherapy drugs was decreased to varying degrees under hypoxic conditions. After silencing the HIF-1α gene, the sensitivities of LoVo MCS to all four chemotherapy drugs were restored. The apoptotic levels that all the drugs induced were all decreased to various extents in the hypoxic group. After silencing HIF-1α, the apoptosis level induced by all four chemotherapy drugs increased. The expression of HIF-1α and P-gp was significantly enhanced in LoVo MCS after treatment with hypoxia. Inhibiting HIF-1α significantly decreased the expression of MDR1/P-gp mRNA or protein in both the LoVo monolayers and LoVo MCS. The ChIP assay showed that HIF-1α was bound to the MDR1 gene promoter. Advanced colon carcinoma patients with expression of both HIF-1α and P-gp were more resistant to chemotherapy than that with non expression.HIF-1α inhibition reverses multidrug resistance in colon cancer cells via downregulation of MDR1/P-gp. The expression of HIF-1α and MDR1/P-gp can be used as a predictive marker for chemotherapy resistance in colon cancer.
Dhandapani, Mohanapriya Chinambedu; Venkatesan, Vettriselvi; Rengaswamy, Nammalwar Bollam; Gowrishankar, Kalpana; Nageswaran, Prahlad; Perumal, Venkatachalam
2015-08-01
The purpose of the study was to investigate the distribution of insertion/deletion (I/D) polymorphisms of the angiotensin-converting enzyme (ACE) gene and three exonic polymorphisms of the multidrug resistance 1 (MDR1) gene (C3435T, C1236T, and G2677T) in children diagnosed with idiopathic nephrotic syndrome (INS). The study group consisted of 100 healthy controls and 150 INS patients, of which 50 were steroid resistant. Genomic DNA from blood samples was isolated from both of these groups and genotyping of the ACE and MDR1 genes was performed by polymerase chain reaction (PCR) using specific primers. There was no significant difference observed in the genotypic distribution and D allele frequency of the ACE gene. The two single-nucleotide polymorphisms (SNPs), C1236T and C3435T, of the MDR1 gene showed no significance, whereas the SNP G2677T/A was significantly associated with the genotypes GT and GA of the MDR1 gene, indicating it may be a potential marker to detect drug resistance. Screening these polymorphisms will pave the way to better understand the molecular mechanisms of the disease, which may be useful in developing targeted therapies for INS patients.
Cao, Wei; Kayama, Hisako; Chen, Mei Lan; Delmas, Amber; Sun, Amy; Kim, Sang Yong; Rangarajan, Erumbi S; McKevitt, Kelly; Beck, Amanda P; Jackson, Cody B; Crynen, Gogce; Oikonomopoulos, Angelos; Lacey, Precious N; Martinez, Gustavo J; Izard, Tina; Lorenz, Robin G; Rodriguez-Palacios, Alex; Cominelli, Fabio; Abreu, Maria T; Hommes, Daniel W; Koralov, Sergei B; Takeda, Kiyoshi; Sundrud, Mark S
2017-12-19
CD4 + T cells are tightly regulated by microbiota in the intestine, but whether intestinal T cells interface with host-derived metabolites is less clear. Here, we show that CD4 + T effector (Teff) cells upregulated the xenobiotic transporter, Mdr1, in the ileum to maintain homeostasis in the presence of bile acids. Whereas wild-type Teff cells upregulated Mdr1 in the ileum, those lacking Mdr1 displayed mucosal dysfunction and induced Crohn's disease-like ileitis following transfer into Rag1 -/- hosts. Mdr1 mitigated oxidative stress and enforced homeostasis in Teff cells exposed to conjugated bile acids (CBAs), a class of liver-derived emulsifying agents that actively circulate through the ileal mucosa. Blocking ileal CBA reabsorption in transferred Rag1 -/- mice restored Mdr1-deficient Teff cell homeostasis and attenuated ileitis. Further, a subset of ileal Crohn's disease patients displayed MDR1 loss of function. Together, these results suggest that coordinated interaction between mucosal Teff cells and CBAs in the ileum regulate intestinal immune homeostasis. Copyright © 2017 Elsevier Inc. All rights reserved.
Wang, Hualiang; Wang, Jinghua; Yu, Peijuan; Ge, Ping; Jiang, Yanqun; Xu, Rong; Chen, Rong; Liu, Xuejie
2017-02-01
This study aimed to investigate antibiotic resistance genes in the multidrug-resistant (MDR) Acinetobacter baumannii (A. baumanii) strain, MDR-SHH02, using whole‑genome sequencing (WGS). The antibiotic resistance of MDR-SHH02 isolated from a patient with breast cancer to 19 types of antibiotics was determined using the Kirby‑Bauer method. WGS of MDR-SHH02 was then performed. Following quality control and transcriptome assembly, functional annotation of genes was conducted, and the phylogenetic tree of MDR-SHH02, along with another 5 A. baumanii species and 2 Acinetobacter species, was constructed using PHYLIP 3.695 and FigTree v1.4.2. Furthermore, pathogenicity islands (PAIs) were predicted by the pathogenicity island database. Potential antibiotic resistance genes in MDR-SHH02 were predicted based on the information in the Antibiotic Resistance Genes Database (ARDB). MDR-SHH02 was found to be resistant to all of the tested antibiotics. The total draft genome length of MDR-SHH02 was 4,003,808 bp. There were 74.25% of coding sequences to be annotated into 21 of the Clusters of Orthologous Groups (COGs) of protein terms, such as 'transcription' and 'amino acid transport and metabolism'. Furthermore, there were 45 PAIs homologous to the sequence MDRSHH02000806. Additionally, a total of 12 gene sequences in MDR-SHH02 were highly similar to the sequences of antibiotic resistance genes in ARDB, including genes encoding aminoglycoside‑modifying enzymes [e.g., aac(3)-Ia, ant(2'')‑Ia, aph33ib and aph(3')-Ia], β-lactamase genes (bl2b_tem and bl2b_tem1), sulfonamide-resistant dihydropteroate synthase genes (sul1 and sul2), catb3 and tetb. These results suggest that numerous genes mediate resistance to various antibiotics in MDR-SHH02, and provide a clinical guidance for the personalized therapy of A. baumannii-infected patients.
Stasiołek, Mariusz; Romanowicz, Hanna; Połatyńska, Katarzyna; Chamielec, Maciej; Skalski, Dominik; Makowska, Marianna; Smolarz, Beata
2016-07-08
Epilepsy is a disease of neurological character. Approximately one third of epileptic patients demonstrate a drug-resistant phenotype, which is associated with the development of drug-resistant epilepsy. The multidrug resistance protein 1 and glycoprotein P, encoded by MDR1, play a significant role in the transmembrane transport of anti-epileptic agents. Single nucleotide polymorphism C3435T (rs1045642) within MDR1 gene may be associated with an increased expression of P-gp which affects the levels of antiepileptic drugs in plasma. The presented studies analysed the association between C3435T polymorphism of MDR1 gene and the incidence of drug-resistant epilepsy in the population of Polish children. C3435T polymorphism of MDR1 gene was analysed by the high resolution melting technique in a group of patients with drug-resistant (n = 106) and drug-responsive epilepsy (n = 67), as well as in non-epileptic children (n = 98) hospitalised at the Department of Neurology, Polish Mother's Memorial Hospital in Lodz. Genotype and allele distributions were evaluated and their compatibility with the Hardy-Weinberg distribution was assessed by means of the χ(2) test. Genotype and allele evaluation, regarding their relationship with a given feature, was supported by an analysis of odds ratio and 95 % confidence interval, calculated according to the logistic regression model. An association was observed between the incidence rate of DRE and the presence of C allele in C3435T polymorphism of MDR1 gene, which may enhance the risk of the disease. The T allele may then play a protective role. No differences were found in the studied groups, regarding either genotype or allele distribution in reference to patient's gender or concomitant diseases. Following the obtained results, C3435T polymorphism of MDR1 gene may be connected with the incidence of drug-resistant epilepsy in the population of Polish children. ISRCTN ISRCTN73824458. Registered 28th September 2014.
Nakamura, Tsutomu; Sakaeda, Toshiyuki; Horinouchi, Masanori; Tamura, Takao; Aoyama, Nobuo; Shirakawa, Toshiro; Matsuo, Masafumi; Kasuga, Masato; Okumura, Katsuhiko
2002-04-01
The effect of the C3435T mutation at exon 26 of the MDR1 gene on the expression levels of MDR1 messenger ribonucleic acid (mRNA) was evaluated by means of real-time polymerase chain reaction in 51 biopsy specimens of duodenum obtained from 13 healthy Japanese subjects. The mRNA levels of MDR1 were 0.38 +/- 0.15, 0.56 +/- 0.14, and 1.13 +/- 0.42 (mean value +/- SE) in the subjects with the homozygote of wild-type allele (C/C), compound heterozygote with mutant T allele (C/T), and the homozygote of the mutant allele (T/T), respectively, reasonably explaining the lower digoxin serum concentration after administration of a single oral dose to subjects harboring a mutant T allele. Good correlation (r =.797; P CYP3A4 in the individual biopsy specimens. This finding suggested a lower plasma concentration of the substrates for CYP3A4 in subjects harboring the C3435T mutation of the MDR1 gene.
Functional evidence of multidrug resistance transporters (MDR in rodent olfactory epithelium.
Directory of Open Access Journals (Sweden)
Adrien Molinas
Full Text Available P-glycoprotein (Pgp and multidrug resistance-associated protein (MRP1 are membrane transporter proteins which function as efflux pumps at cell membranes and are considered to exert a protective function against the entry of xenobiotics. While evidence for Pgp and MRP transporter activity is reported for olfactory tissue, their possible interaction and participation in the olfactory response has not been investigated.Functional activity of putative MDR transporters was assessed by means of the fluorometric calcein acetoxymethyl ester (calcein-AM accumulation assay on acute rat and mouse olfactory tissue slices. Calcein-AM uptake was measured as fluorescence intensity changes in the presence of Pgp or MRP specific inhibitors. Epifluorescence microscopy measured time course analysis in the olfactory epithelium revealed significant inhibitor-dependent calcein uptake in the presence of each of the selected inhibitors. Furthermore, intracellular calcein accumulation in olfactory receptor neurons was also significantly increased in the presence of either one of the Pgp or MRP inhibitors. The presence of Pgp or MRP1 encoding genes in the olfactory mucosa of rat and mouse was confirmed by RT-PCR with appropriate pairs of species-specific primers. Both transporters were expressed in both newborn and adult olfactory mucosa of both species. To assess a possible involvement of MDR transporters in the olfactory response, we examined the electrophysiological response to odorants in the presence of the selected MDR inhibitors by recording electroolfactograms (EOG. In both animal species, MRPs inhibitors induced a marked reduction of the EOG magnitude, while Pgp inhibitors had only a minor or no measurable effect.The findings suggest that both Pgp and MRP transporters are functional in the olfactory mucosa and in olfactory receptor neurons. Pgp and MRPs may be cellular constituents of olfactory receptor neurons and represent potential mechanisms for modulation
Gagliardi, Rosa; Llambí, Silvia; Arruga, M Victoria
2015-01-01
The fields of pharmacogenetics and pharmacogenomics have become increasingly promising regarding the clinical application of genetic data to aid in prevention of adverse reactions. Specific screening tests can predict which animals express modified proteins or genetic sequences responsible for adverse effects associated with a drug. Among the genetic variations that have been investigated in dogs, the multidrug resistance gene (MDR) is the best studied. However, other genes such as CYP1A2 and CYP2B11 control the protein syntheses involved in the metabolism of many drugs. In the present study, the MDR-1, CYP1A2 and CYP2B11 genes were examined to identify SNP polymorphisms associated with these genes in the following four canine breeds: Uruguayan Cimarron, Border Collie, Labrador Retriever and German Shepherd. The results revealed that several SNPs of the CYP1A2 and CYP2B11 genes are potential targets for drug sensitivity investigations.
Construction of retrovirus vector taking MDR1/ACBC1 and its ...
African Journals Online (AJOL)
We successfully observed the expression of the reporter gene-GFP by using the green light fluorescence microscope and the p-glycoprotein (P-gp) expressed by exogenous gene MDR1 by Western Blotting. All these facts indicated that the retroviral vector PMX-flag-MDR1-GFP had successfully been transfected into ...
Detekce polymorfismu v genu MDR1 u ovčáckých a honáckých psů
Staroveská, Marieta
2016-01-01
This thesis is focused on polymorphism of MDR1 gene and related drug resistance. Resistance is caused by deletion of four nucleotids, that resulting in a frame shift and synthesis of nonfunctional transport of P-glycoprotein. The text describes a polymorphism of MDR1 (ABCB1) gene, which results in reduced resistance to drugs belonging to the group of macrocyclic lactones. It also describes inheritance of this phenomenon and it deals with the detection of mutation using PCR (polymerase chain r...
DEFF Research Database (Denmark)
Andersen, V.; Agerstjerne, L.; Jensen, D.
2009-01-01
Background: Smoking, dietary factors, and alcohol consumption are known life style factors contributing to gastrointestinal carcinogenesis. Genetic variations in carcinogen handling may affect cancer risk. The multidrug resistance 1(MDR1/ABCB1) gene encodes the transport protein P-glycoprotein (a...... in inflammation, and may thereby affect the risk of malignity. Hence, genetic variations that modify the function of P-glycoprotein may be associated with the risk of colorectal cancer (CRC). We have previously found an association between the MDR1 intron 3 G-rs3789243-A polymorphism and the risk of CRC...... of colorectal carcinomas and adenomas in the Norwegian population was assessed in 167 carcinomas, 990 adenomas, and 400 controls. Genotypes were determined by allelic discrimination. Odds ratio (OR) and 95 confidence interval (95% CI) were estimated by binary logistic regression. Results: No association...
Hosohata, Keiko; Masuda, Satohiro; Yonezawa, Atsushi; Katsura, Toshiya; Oike, Fumitaka; Ogura, Yasuhiro; Takada, Yasutsugu; Egawa, Hiroto; Uemoto, Shinji; Inui, Ken-Ichi
2009-07-01
This study investigated whether haplotypes in the multidrug resistance 1 (MDR1) gene had effects on mRNA expression levels of MDR1 and cytochrome P450 (CYP) 3A4, and on the pharmacokinetics of tacrolimus in living-donor liver transplant (LDLT) patients, considering the gender difference. Haplotype analysis of MDR1 with G2677T/A and C3435T was performed in 63 de novo Japanese LDLT patients (17 to 55 years; 44.4% women). The expression levels of MDR1 and CYP3A4 mRNAs in jejunal biopsy specimens were quantified by real-time PCR. Intestinal CYP3A4 mRNA expression levels (amol/microg total RNA) showed significantly higher values in women carrying the 2677TT-3435TT haplotype (median, 10.7; range, 5.92-15.2) than those with 2677GG-3435CC (3.03; range 1.38-4.68) and 2677GT-3435CT (median, 4.31; range, 0.07-9.42) (P = 0.022), but not in men (P = 0.81). However, MDR1 haplotype did not influence mRNA expression levels of MDR1 nor the concentration/dose ratio [(ng/mL)/(mg/day)] of oral tacrolimus for the postoperative 7 days, irrespective of gender. MDR1 haplotype may have a minor association with the tacrolimus pharmacokinetics after LDLT, but could be a good predictor of the inter-individual variation of intestinal expression of CYP3A4 in women.
Remy, Estelle; Duque, Paula
2014-01-01
Higher plants possess a multitude of Multiple Drug Resistance (MDR) transporter homologs that group into three distinct and ubiquitous families—the ATP-Binding Cassette (ABC) superfamily, the Major Facilitator Superfamily (MFS), and the Multidrug And Toxic compound Extrusion (MATE) family. As in other organisms, such as fungi, mammals, and bacteria, MDR transporters make a primary contribution to cellular detoxification processes in plants, mainly through the extrusion of toxic compounds from the cell or their sequestration in the central vacuole. This review aims at summarizing the currently available information on the in vivo roles of MDR transporters in plant systems. Taken together, these data clearly indicate that the biological functions of ABC, MFS, and MATE carriers are not restricted to xenobiotic and metal detoxification. Importantly, the activity of plant MDR transporters also mediates biotic stress resistance and is instrumental in numerous physiological processes essential for optimal plant growth and development, including the regulation of ion homeostasis and polar transport of the phytohormone auxin. PMID:24910617
Directory of Open Access Journals (Sweden)
Overvad Kim
2009-11-01
Full Text Available Abstract Background The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1 and Breast Cancer Resistance Protein (BCRP/ABCG2 may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA and polycyclic aromatic hydrocarbons (PAH. Cyclooxygenase-2 (COX-2 derived prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC, and to investigate possible interactions with lifestyle factors such as smoking, meat consumption, and NSAID use. Methods The following polymorphisms were analyzed; a synonymous MDR1 C3435T (rs1045642 in exon26, G-rs3789243-A in intron3, the functional BCRP C421A (rs2231142, the two COX-2 A-1195G (rs689466 and G-765C (rs20417 in the promoter region, and the COX-2 T8473C (rs5275 polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Results Carriers of the variant allele of MDR1 intron 3 polymorphism were at 1.52-fold higher risk of CRC than homozygous wild type allele carriers (Incidence rate ratio (IRR = 1.52, 95% Confidence Interval (CI: 1.12-2.06. Carriers of the variant allele of MDR1 C3435T exon 26 had a lower risk of CRC than homozygous C-allele carriers (IRR = 0.71 (CI:0.50-1.00. There was interaction between these MDR1 polymorphisms and intake of red and processed meat in relation to CRC risk. Homozygous MDR1 C3435T C-allele carriers were at 8% increased risk pr 25 gram meat per day (CI: 1.00-1.16 whereas variant allele carriers were not at increased risk (p for interaction = 0.02. COX-2 and BCRP polymorphisms were not associated with CRC risk. There was interaction between NSAID use and MDR1 C3435T and COX-2 T
International Nuclear Information System (INIS)
Andersen, Vibeke; Østergaard, Mette; Christensen, Jane; Overvad, Kim; Tjønneland, Anne; Vogel, Ulla
2009-01-01
The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1) and Breast Cancer Resistance Protein (BCRP/ABCG2) may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA) and polycyclic aromatic hydrocarbons (PAH). Cyclooxygenase-2 (COX-2) derived prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC), and to investigate possible interactions with lifestyle factors such as smoking, meat consumption, and NSAID use. The following polymorphisms were analyzed; a synonymous MDR1 C3435T (rs1045642) in exon26, G-rs3789243-A in intron3, the functional BCRP C421A (rs2231142), the two COX-2 A-1195G (rs689466) and G-765C (rs20417) in the promoter region, and the COX-2 T8473C (rs5275) polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Carriers of the variant allele of MDR1 intron 3 polymorphism were at 1.52-fold higher risk of CRC than homozygous wild type allele carriers (Incidence rate ratio (IRR) = 1.52, 95% Confidence Interval (CI): 1.12-2.06). Carriers of the variant allele of MDR1 C3435T exon 26 had a lower risk of CRC than homozygous C-allele carriers (IRR = 0.71 (CI:0.50-1.00)). There was interaction between these MDR1 polymorphisms and intake of red and processed meat in relation to CRC risk. Homozygous MDR1 C3435T C-allele carriers were at 8% increased risk pr 25 gram meat per day (CI: 1.00-1.16) whereas variant allele carriers were not at increased risk (p for interaction = 0.02). COX-2 and BCRP polymorphisms were not associated with CRC risk. There was interaction between NSAID use and MDR1 C3435T and COX-2 T8473C (p-values for interaction 0
Expression of the MDR1 gene and P-glycoprotein in canine mast cell tumor cell lines
NAKAICHI, Munekazu; TAKESHITA, Yoko; OKUDA, Masaru; NAKAMOTO, Yuya; ITAMOTO, Kazuhito; UNE, Satoshi; SASAKI, Nobuo; KADOSAWA, Tsuyoshi; TAKAHASHI, Tomoko; TAURA, Yasuho
2007-01-01
Cellular drug resistance to antineoplastic drugs is often due to the presence of a drug efflux pump that reduces intracellular drug accumulation and chemosensitivity. P-glycoprotein (P-gp), which is encoded by the MDR1 gene, is considered to function as an ATP-driven membrane drug efflux pump and appears to play an important role in tumor cell resistance. In the present report, we assessed the expression of MDR1 by RT-PCR in three canine mast cell tumor cell lines, TiMC, CoMS and LuMC, origin...
Czech Academy of Sciences Publication Activity Database
Campa, D.; Sainz, J.; Pardini, Barbara; Vodičková, Ludmila; Naccarati, Alessio; Rudolph, A.; Novotný, J.; Försti, A.; Buch, S.; von Schönfels, W.; Schafmayer, C.; Völzke, H.; Hoffmeister, M.; Frank, B.; Barale, R.; Hemminki, K.; Hampe, J.; Chang-Claude, J.; Brenner, H.; Vodička, Pavel; Canzian, F.
2012-01-01
Roč. 7, č. 3 (2012), e32784 E-ISSN 1932-6203 R&D Projects: GA ČR GA310/07/1430; GA ČR GAP304/10/1286 Institutional research plan: CEZ:AV0Z50390703 Keywords : single-nucleotide polymorphisms * resistance 1 mdr1 * p-glycoprotein Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.730, year: 2012
DEFF Research Database (Denmark)
Andersen, Vibeke; Svenningsen, Katrine; Knudsen, Lina Almind
2015-01-01
transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1....../Mdr1a, abcc2/Mrp2, abcg2/Bcrp, knock-out mice, tight junction, membrane lipid function. RESULTS: Recently, human studies reported that changes in the levels of ABC transporters were early events in the adenoma-carcinoma sequence leading to CRC. A link between ABCB1, high fat diet and gut microbes...
Stein, Ulrike; Jürchott, Karsten; Schläfke, Matthias; Hohenberger, Peter
2002-08-01
Isolated, hyperthermic limb perfusion (ILP) with recombinant human tumor necrosis factor alpha and melphalan is a highly effective treatment for advanced soft tissue sarcoma (STS) and locoregional metastatic malignant melanoma. Multidrug resistance (MDR)-associated genes are known to be inducible by heat and drugs; expression levels of the major vault protein (MVP), MDR1, and MDR-associated protein 1 (MRP1) were determined sequentially before, during, and after ILP of patients. Twenty-one STS or malignant melanoma patients were treated by ILP. Tumor tissue temperatures were recorded continuously and ranged from 33.4 degrees C initially to peak values of 40.4 degrees C during ILP. Serial true-cut biopsy specimens from tumor tissues were routinely microdissected. Expression analyses for MDR genes were performed by real-time reverse transcriptase polymerase chain reaction and immunohistochemistry. In 83% of the patients, MVP expression was induced during hyperthermic ILP. MVP-mRNA inductions often paralleled the increase in temperature during ILP. Increased MVP protein expressions either were observed simultaneously with the MVP-mRNA induction or were delayed until after the induction at the transcriptional level. Inductions of MDR1 and MRP1 were observed in only 13% and 27% of the specimens analyzed. Temperatures and drugs applied preferentially led to an induction of MVP and were not sufficient to induce MDR1 and MRP1 in the majority of tumors. This study is the first to analyze the expression of MDR-associated genes sequentially during ILP of patients and demonstrates that treatment might lead to increased levels of MVP, whereas enhanced levels of MDR1 and MRP1 remain rare events.
LENUS (Irish Health Repository)
Walsh, Naomi
2009-01-01
BACKGROUND: Renal cell carcinoma patients respond poorly to conventional chemotherapy, this unresponsiveness may be attributable to multidrug resistance (MDR). The mechanisms of MDR in renal cancer are not fully understood and the specific contribution of ABC transporter proteins which have been implicated in the chemoresistance of various cancers has not been fully defined in this disease. METHODS: In this retrospective study the expression of two of these transporter efflux pumps, namely MDR-1 P-gp (ABCB1) and MRP-1 (ABCC1) were studied by immunohistochemistry in archival material from 95 renal cell carcinoma patients. RESULTS: In the first study investigating MDR-1 P-gp and MRP-1 protein expression patterns in renal cell carcinoma patients, high levels of expression of both efflux pumps are observed with 100% of tumours studied showing MDR-1 P-gp and MRP-1 positivity. CONCLUSION: Although these findings do not prove a causal role, the high frequency of tumours expressing these efflux pumps suggests that they may be important contributors to the chemoresistance of this tumour type.
Directory of Open Access Journals (Sweden)
Strazzullo Viviana
2006-12-01
Full Text Available Abstract Background A large number of renal cancer patients shows poor or partial response to chemotherapy and the mechanisms have not been still understood. Multi-drug resistance is the principal mechanism by which many cancers develop resistance to chemotherapic drugs. The role of the multi-drug resistant transporter (MDR-1/P-glycoprotein, the gene product of MDR-1, and that one of the so-called multi-drug resistance associated protein (MRP, two energy-dependent efflux pumps, are commonly known to confer drug resistance. We studied MDR-1 expression in selected cases of renal cell carcinoma (RCC, clear cell type, with long-term follow-up, in order to establish its prognostic role and its possible contribution in the choice of post-surgical therapy. Methods MDR-1 has been studied by standard LSAB-HRP immunohistochemical technique, in paraffin embedded RCC samples. Protein expression has been compared to clinical and histopathological data and to disease specific survival of RCC patients, by Kaplan-Meier curve and Cox multivariate regression analyses. Results Two groups of RCCs were obtained by esteeming MDR-1 expression and disease specific survival (obtained with Kaplan-Meier curve and Cox multivariate regression analyses: the first one presents low or absent MDR-1 expression and good survival; the second one is characterized by high MDR-1 expression and significant poor outcome (p p p p Conclusion In our opinion, the results of this study well prove the relationship between MDR-1 expression and worse clinical prognosis in RCC, because MDR-1 over-expressing RCCs can be considered a group of tumours with a more aggressive behavior. This finding outlines a possible role of MDR-1 as prognostic factor, dependent and independent of multidrug resistance. These results could be useful to predict cancer evolution and to choose the appropriate treatment: this is another step that can stimulate further promising and interesting investigations on broader
Directory of Open Access Journals (Sweden)
Ivan V. Chernikov
2017-03-01
Full Text Available Chemical modifications are an effective way to improve the therapeutic properties of small interfering RNAs (siRNAs, making them more resistant to degradation in serum and ensuring their delivery to target cells and tissues. Here, we studied the carrier-free biodistribution and biological activity of a nuclease-resistant anti-MDR1 cholesterol-siRNA conjugate in healthy and tumor-bearing severe combined immune deficiency (SCID mice. The attachment of cholesterol to siRNA provided its efficient accumulation in the liver and in tumors, and reduced its retention in the kidneys after intravenous and intraperitoneal injection. The major part of cholesterol-siRNA after intramuscular and subcutaneous injections remained in the injection place. Confocal microscopy data demonstrated that cholesterol-siRNA spread deep in the tissue and was present in the cytoplasm of almost all the liver and tumor cells. The reduction of P-glycoprotein level in human KB-8-5 xenograft overexpressing the MDR1 gene by 60% was observed at days 5–6 after injection. Then, its initial level recovered by the eighth day. The data showed that, regardless of the mode of administration (intravenous, intraperitoneal, or peritumoral, cholesterol-siMDR efficiently reduced the P-glycoprotein level in tumors. The designed anti-MDR1 conjugate has potential as an adjuvant therapeutic for the reversal of multiple drug resistance of cancer cells.
He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang
2010-08-27
P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
Evers, R.; Kool, M.; Smith, A. J.; van Deemter, L.; de Haas, M.; Borst, P.
2000-01-01
The human multidrug transporter MDR1 P-glycoprotein and the multidrug resistance proteins MRP1 and MRP2 transport a range of cytotoxic drugs, resulting in multidrug resistance in tumour cells. To overcome this form of drug resistance in patients, several inhibitors (reversal agents) of these
Mo, Xianchao; Li, Weizhong
2014-05-01
To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.
Directory of Open Access Journals (Sweden)
Wei Xu
2010-08-01
Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
DEFF Research Database (Denmark)
Andersen, Vibeke; Østergaard, Mette; Christensen, Jane
2009-01-01
(rs5275) polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Results Carriers of the variant......Background The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1) and Breast Cancer Resistance Protein (BCRP/ABCG2) may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA) and polycyclic aromatic hydrocarbons (PAH). Cyclooxygenase-2 (COX-2) derived...... prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC), and to investigate possible interactions with lifestyle factors...
Role of MRP-1 and GST-Pi in MDR and their inhibition by ...
African Journals Online (AJOL)
Samia A. Ebeed
2016-08-16
Aug 16, 2016 ... Various mechanisms were proposed that underlie MDR in malignant cells. ... the gene that confers MDR in lung cancer cells. MRP1 acts in order to protect ... the many physiological and pathophysiological processes influ-.
Elferink, Ronald P. J. Oude; Ottenhoff, Roelof; Fricker, Gert; Seward, David J.; Ballatori, Nazzareno; Boyer, James
2004-01-01
The ABC transporters bile salt export pump ( BSEP; encoded by the ABCB11 gene), MDR3 P-glycoprotein (ABCB4), and sterolin 1 and 2 (ABCG5 and ABCG8) are crucial for the excretion of bile salt, phospholipid, and cholesterol, respectively, into the bile of mammals. The current paradigm is that
Directory of Open Access Journals (Sweden)
David eEscalante-Santiago
2014-10-01
Full Text Available Although the Pgp efflux transport protein is overexpressed in resected tissue of patients with epilepsy, the presence of polymorphisms in MDR1 / ABCB1 and MRP2 / ABCC2 in patients with antiepileptic-drugs resistant epilepsy is controversial. The aim of this study was to perform an exploratory study to identify nucleotide changes and search new and reported mutations in patients with antiepileptic-drugs resistant epilepsy (ADR and patients with good response to anti-epileptic drugs (CTR in a rigorously selected population. We analyzed 22 samples from drug-resistant patients with epilepsy and 7 samples from patients with good response to anti-epileptic drugs. Genomic DNA was obtained from leukocytes. Eleven exons in both genes were genotyped. The concentration of drugs in saliva and plasma was determined. The concentration of valproic acid in saliva was lower in ADR than in CRT. In ABCB1, five reported SNPs and five unreported nucleotide changes were identified; rs2229109 (GA and rs2032582 (AT and AG were found only in the ADR. Of six SNPs associated with the ABCC2 that were found in the study population, rs3740066 (TT and 66744T>A (TG were found only in the ADR. The strongest risk factor in the ABCB1 gene was identified as the TA genotype of rs2032582, whereas for the ABCC2 gene the strongest risk factor was the T allele of rs3740066. The screening of SNPs in ACBC1 and ABCC2 indicates that the Mexican patients with epilepsy in this study display frequently reported ABCC1 polymorphisms; however, in the study subjects with a higher risk factor for drug resistance, new nucleotide changes were found in the ABCC2 gene. Thus, the population of Mexican patients with AED-resistant epilepsy used in this study exhibits genetic variability with respect to those reported in other study populations; however, it is necessary to explore this polymorphism in a larger population of patients with AED-resistant epilepsy.
Directory of Open Access Journals (Sweden)
Linardi Renata Lehn
2006-01-01
Full Text Available (MDR1 gene expressed in tumor cells and also in several normal tissues, such as intestine, liver, kidney, blood-brain barrier, spinal cord, and placenta. P-gp has been identified in mice, rat, bovine, monkey, rodents, and human beings and has been receiving a particular clinical relevance because this protein expression limits brain access and intestinal absorption of many drugs. This protein plays a role as a protective barrier against a wide variety of substrates, avoiding drug entry into the central nervous system. P-glycoprotein also interferes with drug bioavailability and disposition, including absorption, distribution, metabolization, and excretion, influencing pharmacokinetic and pharmacodynamic of drugs. Modulation of P-gp may help the efficacy of treatment of several diseases and can explain some adverse central nervous system effects induced by drugs after intravenous administration and the poor response of oral administration in patients. Alteration in P-gp expression or function has been associated with several diseases susceptibility in humans and animals. Furthermore, additional studies relating MDR1 and P-gp expression has an important clinical implication also in terms of treatment efficacy.
Lai, Yong; Huang, Min; Li, Hui; Wang, Xue-Ding; Li, Jia-Li
2012-11-01
P-Glycoprotein (P-gp, encoded by MDR1 gene) plays an important role in determining bioavailability and pharmacologic effects of many drugs. There is increasing evidence that P-gp activity may be genetically determined. In this study, we investigated the genotype distribution and the haplotype profiles of MDR1 gene in Chinese Han, Bai, Wa and Tibetan subjects. Much lower frequencies of the 1236T allele and the 2677T allele were found in Wa subjects than those in other three ethnic groups, while the 2677A allele was found about 6-fold more frequently in Han subjects than in subjects of other three ethnic groups. The Han, Bai and Tibetan subjects share the same three predominant haplotypes (T-T-T, T-G-C and C-G-C), and T-T-T is the highest and accounts for more than one third of the number of haplotypes in the subjects from each ethnic group. However, T-T-T was less common than T-G-C, T-G-T and C-G-C and occurring at only 13.8% in Wa subjects, furthermore, higher frequencies of T-G-T, C-T-C, C-G-T and C-T-T were observed in Wa subjects compared to those in other three ethnic groups. Frequencies of C-A-C and T-A-C in Han subjects were higher than those in other three ethnic groups. The findings of this study will be of some relevance in predicting MDR1 phenotype and pharmacokinetics as well as pharmacodynamic effects of many commonly used drugs that are P-gp substrates in these four Chinese ethnic groups.
Directory of Open Access Journals (Sweden)
Chen Tingfu
2010-07-01
Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR
Yang, Xiaoqian; Lyer, Arun K.; Singh, Amit; Choy, Edwin; Hornicek, Francis J.; Amiji, Mansoor M.; Duan, Zhenfeng
2015-02-01
Development of multidrug resistance (MDR) is an almost universal phenomenon in patients with ovarian cancer, and this severely limits the ultimate success of chemotherapy in the clinic. Overexpression of the MDR1 gene and corresponding P-glycoprotein (Pgp) is one of the best known MDR mechanisms. MDR1 siRNA based strategies were proposed to circumvent MDR, however, systemic, safe, and effective targeted delivery is still a major challenge. Cluster of differentiation 44 (CD44) targeted hyaluronic acid (HA) based nanoparticle has been shown to successfully deliver chemotherapy agents or siRNAs into tumor cells. The goal of this study is to evaluate the ability of HA-PEI/HA-PEG to deliver MDR1 siRNA and the efficacy of the combination of HA-PEI/HA-PEG/MDR1 siRNA with paclitaxel to suppress growth of ovarian cancer. We observed that HA-PEI/HA-PEG nanoparticles can efficiently deliver MDR1 siRNA into MDR ovarian cancer cells, resulting in down-regulation of MDR1 and Pgp expression. Administration of HA-PEI/HA-PEG/MDR1 siRNA nanoparticles followed by paclitaxel treatment induced a significant inhibitory effect on the tumor growth, decreased Pgp expression and increased apoptosis in MDR ovarian cancer mice model. Our findings suggest that CD44 targeted HA-PEI/HA-PEG/MDR1 siRNA nanoparticles can serve as a therapeutic tool with great potentials to circumvent MDR in ovarian cancer.
Directory of Open Access Journals (Sweden)
Lanying Pan
2015-02-01
Full Text Available Stellera chamaejasme L. (Thymelaeaceae is widely distributed in Mongolia, Tibet and the northern parts of China. Its roots are commonly used as “Langdu”, which is embodied in the Pharmacopoeia of the P.R. China (2010 as a toxic Traditional Chinese Medicine. It is claimed to have antivirus, antitumor and antibacterial properties in China and other Asian countries. Studies were carried out to characterize the inhibition of neochamaejasmin B (NCB on P-glycoprotein (P-gp, ABCB1, MDR1. Rhodamine-123 (R-123 transport and accumulation studies were performed in MDCK-hMDR1 cells. ABCB1 (MDR1 mRNA gene expression and P-gp protein expression were analyzed. Binding selectivity studies based on molecular docking were explored. R-123 transport and accumulation studies in MDCK-hMDR1 cells indicated that NCB inhibited the P-gp-mediated efflux in a concentration-dependent manner. RT-PCR and Western blot demonstrated that the P-gp expression was suppressed by NCB. To investigate the inhibition type of NCB on P-gp, Ki and Ki’ values were determined by double-reciprocal plots in R-123 accumulation studies. Since Ki was greater than Ki’, the inhibition of NCB on P-gp was likely a mixed type of competitive and non-competitive inhibition. The results were confirmed by molecular docking in our current work. The docking data indicated that NCB had higher affinity to P-gp than to Lig1 ((S-5,7-dihydroxy-2-(4-hydroxyphenylchroman-4-one.
Directory of Open Access Journals (Sweden)
Youn Kyung Choi
2013-01-01
Full Text Available Cancer cells acquire anticancer drug resistance during chemotherapy, which aggravates cancer disease. MDR1 encoded from multidrug resistance gene 1 mainly causes multidrug resistance phenotypes of different cancer cells. In this study, we demonstrate that JNK1/2 activation by an extract from the root of Morus alba L. (White mulberry reduces doxorubicin-resistant MCF-7/Dox cell viability by inhibiting YB-1 regulation of MDR1 gene expression. When MCF-7 or MCF-7/Dox cells, where MDR1 is highly expressed were treated with an extract from roots or leaves of Morus alba L., respectively, the root extract from the mulberry (REM but not the leaf extract (LEM reduced cell viabilities of both MCF-7 and MCF-7/Dox cells, which was enhanced by cotreatment with doxorubicin. REM but not LEM further inhibited YB-1 nuclear translocation and its regulation of MDR1 gene expression. Moreover, REM promoted phosphorylation of c-Jun NH2-terminal kinase 1/2 (JNK1/2 and JNK1/2 inhibitor, SP600125 and rescued REM inhibition of both MDR1 expression and viabilities in MCF-7/Dox cells. Consistently, overexpression of JNK1, c-Jun, or c-Fos inhibited YB-1-dependent MDR1 expression and reduced viabilities in MCF-7/Dox cells. In conclusion, our data indicate that REM-activated JNK-cJun/c-Fos pathway decreases the viability of MCF-7/Dox cells by inhibiting YB-1-dependent MDR1 gene expression. Thus, we suggest that REM may be useful for treating multidrug-resistant cancer cells.
Breed distribution of the nt230(del4) MDR1 mutation in dogs.
Gramer, Irina; Leidolf, Regina; Döring, Barbara; Klintzsch, Stefanie; Krämer, Eva-Maria; Yalcin, Ebru; Petzinger, Ernst; Geyer, Joachim
2011-07-01
A 4-bp deletion mutation associated with multiple drug sensitivity exists in the canine multidrug resistance (MDR1) gene. This mutation has been detected in more than 10 purebred dog breeds as well as in mixed breed dogs. To evaluate the breed distribution of this mutation in Germany, 7378 dogs were screened, including 6999 purebred and 379 mixed breed dogs. The study included dog breeds that show close genetic relationship or share breeding history with one of the predisposed breeds but in which the occurrence of the MDR1 mutation has not been reported. The breeds comprised Bearded Collies, Anatolian Shepherd Dog, Greyhound, Belgian Tervuren, Kelpie, Borzoi, Australian Cattle Dog and the Irish Wolfhound. The MDR1 mutation was not detected is any of these breeds, although it was found as expected in the Collie, Longhaired Whippet, Shetland Sheepdog, Miniature Australian Shepherd, Australian Shepherd, Wäller, White Swiss Shepherd, Old English Sheepdog and Border Collie with varying allelic frequencies for the mutant MDR1 allele of 59%, 45%, 30%, 24%, 22%, 17%, 14%, 4% and 1%, respectively. Allelic frequencies of 8% and 2% were determined in herding breed mixes and unclassified mixed breeds, respectively. Because of its widespread breed distribution and occurrence in many mixed breed dogs, it is difficult for veterinarians and dog owners to recognise whether MDR1-related drug sensitivity is relevant for an individual animal. This study provides a comprehensive overview of all affected dog breeds and many dog breeds that are probably unaffected on the basis of ∼15,000 worldwide MDR1 genotyping data. Copyright © 2010 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Elvis Terci Valera
Full Text Available CONTEXT: Despite the advances in the cure rate for acute lymphoblastic leukemia, approximately 25% of affected children suffer relapses. Expression of genes for the multiple drug resistance protein (MDR-1, multidrug resistance-related protein (MRP, and lung resistance protein (LRP may confer the phenotype of resistance to the treatment of neoplasias. OBJECTIVE: To analyze the expression of the MDR-1, MRP and LRP genes in children with a diagnosis of acute lymphoblastic leukemia via the semiquantitative reverse transcription polymerase chain reaction (RT-PCR, and to determine the correlation between expression and event-free survival and clinical and laboratory variables. DESIGN: A retrospective clinical study. SETTING: Laboratory of Pediatric Oncology, Department of Pediatrics, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Brazil. METHODS: Bone marrow aspirates from 30 children with a diagnosis of acute lymphoblastic leukemia were assessed for the expression of messenger RNA for the MDR-1, MRP and LRP genes by semi-quantitative RT-PCR. RESULTS: In the three groups studied, only the increased expression of LRP was related to worsened event-free survival (p = 0.005. The presence of the common acute lymphoblastic leukemia antigen (CALLA was correlated with increased LRP expression (p = 0.009 and increased risk of relapse or death (p = 0.05. The relative risk of relapse or death was six times higher among children with high LRP expression upon diagnosis (p = 0.05, as confirmed by multivariate analysis of the three genes studied (p = 0.035. DISCUSSION: Cell resistance to drugs is a determinant of the response to chemotherapy and its detection via RT-PCR may be of clinical importance. CONCLUSIONS: Evaluation of the expression of genes for resistance to antineoplastic drugs in childhood acute lymphoblastic leukemia upon diagnosis, and particularly the expression of the LRP gene, may be of clinical relevance, and should be the
Directory of Open Access Journals (Sweden)
Kim Kyung-Jong
2008-08-01
Full Text Available Abstract Background The membrane transporters such as P-glycoprotein (Pgp, the MDR1 gene product, are one of causes of treatment failure in cancer patients. In this study, the epigenetic mechanisms involved in differential MDR1 mRNA expression were compared between 10 gastric and 9 colon cancer cell lines. Methods The MDR1 mRNA levels were determined using PCR and real-time PCR assays after reverse transcription. Cytotoxicity was performed using the MTT assay. Methylation status was explored by quantification PCR-based methylation and bisulfite DNA sequencing analyses. Results The MDR1 mRNA levels obtained by 35 cycles of RT-PCR in gastric cancer cells were just comparable to those obtained by 22 cycles of RT-PCR in colon cancer cells. Real-time RT-PCR analysis revealed that MDR1 mRNA was not detected in the 10 gastric cancer cell lines but variable MDR1 mRNA levels in 7 of 9 colon cancer cell lines except the SNU-C5 and HT-29 cells. MTT assay showed that Pgp inhibitors such as cyclosporine A, verapamil and PSC833 sensitized Colo320HSR (colon, highest MDR1 expression but not SNU-668 (gastric, highest and SNU-C5 (gastric, no expression to paclitaxel. Quantification PCR-based methylation analysis revealed that 90% of gastric cancer cells, and 33% of colon cancer cells were methylated, which were completely matched with the results obtained by bisulfite DNA sequencing analysis. 5-aza-2'-deoxcytidine (5AC, a DNA methyltransferase inhibitor increased the MDR1 mRNA levels in 60% of gastric cells, and in 11% of colon cancer cells. Trichostatin A (TSA, histone deacetylase inhibitor increased the MDR1 mRNA levels in 70% of gastric cancer cells and 55% of colon cancer cells. The combined treatment of 5AC with TSA increased the MDR1 mRNA levels additively in 20% of gastric cancer cells, but synergistically in 40% of gastric and 11% of colon cancer cells. Conclusion These results indicate that the MDR1 mRNA levels in gastric cancer cells are significantly
DEFF Research Database (Denmark)
Andersen, Vibeke; Svenningsen, Katrine; Almind Knudsen, Lina
2015-01-01
AIM: To evaluate ATP-binding cassette (ABC) transporters in colonic pathophysiology as they had recently been related to colorectal cancer (CRC) development. METHODS: Literature search was conducted on PubMed using combinations of the following terms: ABC transporters, ATP binding cassette...... with glucocorticoids. The evidence for the involvement of ABCC2 and ABCG2 in colonic pathophysiology was weak. CONCLUSION: ABCB1, diet, and gut microbes mutually interact in colonic inflammation, a well-known risk factor for CRC. Further insight may be translated into preventive and treatment strategies....... transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1...
Zhang, Yu-Xin; Wei, Shi-Jie; Yang, Xiao-Ying; Zhang, Wen-Ping; Wang, Xin-Yu; Dang, Hong-Wan
2014-10-01
To evaluate the influence of CYP2C19*2/*3 and MDR1 C3435T polymorphisms on the pharmacokinetics of lansoprazole (LPZ) in healthy Chinese subjects. All 24 subjects were from a study of bioequivalence. Plasma concentrations of LPZ were determined by liquid chromatography/mass spectrometry. Cytochrome P450 (CYP) 2C19*2/*3 and multidrug resistance transporter gene 1 (MDR1) C3435T of the subjects were genotyped by polymerase chain reaction-restriction fragment length polymorphism. Significant differences were found in the area under the concentration-time curve from predose to T (AUC(0-T)), area under the concentration-time curve from predose to infinity (AUC(0-∞), t(1/2)), and apparent oral clearance (CL/F) of LPZ between CYP2C19 extensive metabolizers and intermediate metabolizers (p < 0.05). The AUC(0-T), AUC(0-∞), maximum plasma concentration, and CL/F of LPZ were significantly different between subjects with the MDR1 C3435T C/C, C/T, and T/T polymorphisms (p < 0.05). CYP2C19*2/*3 and MDR1 C3435T polymorphisms are important determinants of LPZ pharmacokinetics.
Liu, Zhongle; Myers, Lawrence C
2017-11-01
Long-term azole treatment of patients with chronic Candida albicans infections can lead to drug resistance. Gain-of-function (GOF) mutations in the transcription factor Mrr1 and the consequent transcriptional activation of MDR1 , a drug efflux coding gene, is a common pathway by which this human fungal pathogen acquires fluconazole resistance. This work elucidates the previously unknown downstream transcription mechanisms utilized by hyperactive Mrr1. We identified the Swi/Snf chromatin remodeling complex as a key coactivator for Mrr1, which is required to maintain basal and induced open chromatin, and Mrr1 occupancy, at the MDR1 promoter. Deletion of snf2 , the catalytic subunit of Swi/Snf, largely abrogates the increases in MDR1 expression and fluconazole MIC observed in MRR1 GOF mutant strains. Mediator positively and negatively regulates key Mrr1 target promoters. Deletion of the Mediator tail module med3 subunit reduces, but does not eliminate, the increased MDR1 expression and fluconazole MIC conferred by MRR1 GOF mutations. Eliminating the kinase activity of the Mediator Ssn3 subunit suppresses the decreased MDR1 expression and fluconazole MIC of the snf2 null mutation in MRR1 GOF strains. Ssn3 deletion also suppresses MDR1 promoter histone displacement defects in snf2 null mutants. The combination of this work with studies on other hyperactive zinc cluster transcription factors that confer azole resistance in fungal pathogens reveals a complex picture where the induction of drug efflux pump expression requires the coordination of multiple coactivators. The observed variations in transcription factor and target promoter dependence of this process may make the search for azole sensitivity-restoring small molecules more complicated. Copyright © 2017 American Society for Microbiology.
Monoclonal antibody to an external epitope of the human mdr1 P-glycoprotein
Arceci, R. J.; Stieglitz, K.; Bras, J.; Schinkel, A.; Baas, F.; Croop, J.
1993-01-01
A membrane glycoprotein, termed P-glycoprotein, has been shown to be responsible for cross-resistance to a broad range of structurally and functionally distinct cytotoxic agents. P-glycoprotein, encoded in humans by the mdr1 gene, functions as an energy-dependent efflux pump to exclude these
Yu, Zheng; Peng, Sun; Hong-Ming, Pan; Kai-Feng, Wang
2012-01-01
To investigate the expression of multi-drug resistance-related genes, MDR3 and MRP, in clinical specimens of primary liver cancer and their potential as prognostic factors in liver cancer patients. A total of 26 patients with primary liver cancer were enrolled. The expression of MDR3 and MRP genes was measured by real-time PCR and the association between gene expression and the prognosis of patients was analyzed by the Kaplan-Meier method and COX regression model. This study showed that increases in MDR3 gene expression were identified in cholangiocellular carcinoma, cirrhosis and HBsAg-positive patients, while MRP expression increased in hepatocellular carcinoma, non-cirrhosis and HBsAg-negative patients. Moreover, conjugated bilirubin and total bile acid in the serum were significantly reduced in patients with high MRP expression compared to patients with low expression. The overall survival tended to be longer in patients with high MDR3 and MRP expression compared to the control group. MRP might be an independent prognostic factor in patients with liver cancer by COX regression analysis. MDR3 and MRP may play important roles in liver cancer patients as prognostic factors and their underlying mechanisms in liver cancer are worthy of further investigation.
DEFF Research Database (Denmark)
Saaby, Lasse; Helms, Hans Christian Cederberg; Brodin, Birger
2016-01-01
The P-glycoprotein (P-gp) efflux pump has been shown to affect drug distribution and absorption in various organs and to cause drug resistance in cancer therapy. The aim of this work was to develop a cell line to serve as a screening system for potential substrates of P-gp. This requires a cell...... line with high paracellular tightness, low expression of nonhuman ABC transporters, and high expression of functional human P-gp (ABCB1). The porcine intestinal epithelial cell line, IPEC-J2, was selected as a transfection host, due to its ability to form extremely high-resistance monolayers (>10,000 Ω......·cm(2)) and its low endogenous expression of ABC-type efflux transporters. The IPEC-J2 cells were transfected with a plasmid that contained the sequence of the human MDR1 gene, which encodes P-gp, followed by a selection of successfully transfected cells with geneticin and puromycin. The resulting cell...
DEFF Research Database (Denmark)
Litman, Thomas; Druley, T E; Stein, W D
2001-01-01
The ATP binding cassette (ABC) superfamily of membrane transporters is one of the largest protein classes known, and counts numerous proteins involved in the trafficking of biological molecules across cell membranes. The first known human ABC transporter was P-glycoprotein (P-gp), which confers...... multidrug resistance (MDR) to anticancer drugs. In recent years, we have obtained an increased understanding of the mechanism of action of P-gp as its ATPase activity, substrate specificity and pharmacokinetic interactions have been investigated. This review focuses on the functional characterization of P...... for reversal of MDR in cancer and for drug delivery, are discussed....
Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu
2013-01-01
A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type...
Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu
2012-01-01
P-glycoprotein, encoded by the MDR1 or ABCB1 gene, is an integral component of the blood-brain barrier as an efflux pump for xenobiotics crucial in limiting drug uptake into the central nervous system. Dogs homozygous for a 4-base pair deletion of the canine MDR1 gene show altered expression or function of P-glycoprotein, resulting in neurotoxicosis after administration of the substrate drugs. In the present study, the usefulness of microchip electrophoresis for genotyping assays detecting this deletion mutation was evaluated. Mutagenically separated polymerase chain reaction (MS-PCR) and real-time PCR assays were newly developed and evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies dogs in Japan to determine the allele frequency in this breed. Microchip electrophoresis showed advantages in detection sensitivity and time saving over other modes of electrophoresis. The MS-PCR assay clearly discriminated all genotypes. Real-time PCR assay was most suitable for a large-scale survey due to its high throughput and rapidity. The genotyping survey demonstrated that the carrier and mutant allele frequencies were 0.49% and 0.25%, respectively, suggesting that the mutant allele frequency in Border Collies is markedly low compared to that in the susceptible dog breeds such as rough and smooth Collies.
Chowbay, Balram; Cumaraswamy, Sivathasan; Cheung, Yin Bun; Zhou, Qingyu; Lee, Edmund J D
2003-02-01
Intestinal cytochrome P450 3A4 (CYP3A4) and P-glycoprotein (P-gp) both play a vital role in the metabolism of oral cyclosporine (CsA). We investigated the genetic polymorphisms in CYP3A4(promoter region and exons 5, 7 and 9) and MDR1 (exons 12, 21 and 26) genes and the impact of these polymorphisms on the pharmacokinetics of oral CsA in stable heart transplant patients (n = 14). CYP3A4 polymorphisms were rare in the Asian population and transplant patients. Haplotype analysis revealed 12 haplotypes in the Chinese, eight in the Malays and 10 in the Indians. T-T-T was the most common haplotype in all ethnic groups. The frequency of the homozygous mutant genotype at all three loci (TT-TT-TT) was highest in the Indians (31%) compared to 19% and 15% in the Chinese and Malays, respectively. In heart transplant patients, CsA exposure (AUC(0-4 h), AUC(0-12 h) and C(max)) was high in patients with the T-T-T haplotypes compared to those with C-G-C haplotypes. These findings suggest that haplotypes rather than genotypes influence CsA disposition in transplant patients.
Igolnikov, Alexander C; Green, Richard M
2006-03-01
The administration of a methionine and choline deficient (MCD) diet to mice serves as an animal model of NASH. The multidrug resistant 2 (Mdr2) P-glycoprotein encodes for the canalicular phospholipid transporter, and Mdr2 (+/-) mice secrete 40% less phosphatidylcholine than wild-type mice. We have hypothesized that phosphatidylethanolamine-N-methyl transferase (PEMT) up-regulation is a consequence of MCD diet administration, and is important for the pathogenesis of steatohepatitis in this model. However, the effect of decreased phosphatidylcholine secretion and modulation of PEMT on the development of diet-induced steatohepatitis in Mdr2 (+/-) mice has not been explored. Thus, the purpose of the study is to examine the effects of the MCD diet on Mdr2 (+/-) mice. Mdr2 (+/-) and Mdr2 (+/+) mice were treated with an MCD or control diet for up to 30 days, and the severity of steatohepatitis, PEMT activity and hepatic S-adenosylmethionine (SAM), and S-adenosylhomocysteine (SAH) levels were measured. Serum ALT levels, hepatic inflammation, and PEMT activity were significantly lower, and hepatic SAM:SAH ratios were significantly higher in Mdr2 (+/-) mice at 7 and 30 days on the MCD diet. Mdr2 (+/-) mice have diminished susceptibility to MCD diet-induced NASH, which is associated with a relative decrease in PEMT activity and increased SAM:SAH ratios.
Directory of Open Access Journals (Sweden)
Yu-Li Lo
Full Text Available Multidrug resistance (MDR is a major impediment to chemotherapy. In the present study, we designed antisense oligonucleotides (ASOs against MDR1, MDR-associated protein (MRP1, MRP2, and/or BCL-2/BCL-xL to reverse MDR transporters and induce apoptosis, respectively. The cationic liposomes (100 nm composed of N-[1-(2,3-dioleyloxypropyl]-n,n,n-trimethylammonium chloride and dioleoyl phosphotidylethanolamine core surrounded by a polyethylene glycol (PEG shell were prepared to carry ASOs and/or epirubicin, an antineoplastic agent. We aimed to simultaneously suppress efflux pumps, provoke apoptosis, and enhance the chemosensitivity of human colon adenocarcinoma Caco-2 cells to epirubicin. We evaluated encapsulation efficiency, particle size, cytotoxicity, intracellular accumulation, mRNA levels, cell cycle distribution, and caspase activity of these formulations. We found that PEGylated liposomal ASOs significantly reduced Caco-2 cell viability and thus intensified epirubicin-mediated apoptosis. These formulations also decreased the MDR1 promoter activity levels and enhanced the intracellular retention of epirubicin in Caco-2 cells. Epirubicin and ASOs in PEGylated liposomes remarkably decreased mRNA expression levels of human MDR1, MRP1, MRP2, and BCL-2. The combined treatments all significantly increased the mRNA expressions of p53 and BAX, and activity levels of caspase-3, -8, and -9. The formulation of epirubicin and ASOs targeting both pump resistance of MDR1, MRP1, and MRP2 and nonpump resistance of BCL-2/BCL-xL demonstrated more superior effect to all the other formulations used in this study. Our results provide a novel insight into the mechanisms by which PEGylated liposomal ASOs against both resistance types act as activators to epirubicin-induced apoptosis through suppressing MDR1, MRP1, and MRP2, as well as triggering intrinsic mitochondrial and extrinsic death receptor pathways. The complicated regulation of MDR highlights the necessity
Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz
2015-02-20
The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Significance of MDR1 and multiple drug resistance in refractory human epileptic brain
Directory of Open Access Journals (Sweden)
Dini Gabriele
2004-10-01
Full Text Available Abstract Background The multiple drug resistance protein (MDR1/P-glycoprotein is overexpressed in glia and blood-brain barrier (BBB endothelium in drug refractory human epileptic tissue. Since various antiepileptic drugs (AEDs can act as substrates for MDR1, the enhanced expression/function of this protein may increase their active extrusion from the brain, resulting in decreased responsiveness to AEDs. Methods Human drug resistant epileptic brain tissues were collected after surgical resection. Astrocyte cell cultures were established from these tissues, and commercially available normal human astrocytes were used as controls. Uptake of fluorescent doxorubicin and radioactive-labeled Phenytoin was measured in the two cell populations, and the effect of MDR1 blockers was evaluated. Frozen human epileptic brain tissue slices were double immunostained to locate MDR1 in neurons and glia. Other slices were exposed to toxic concentrations of Phenytoin to study cell viability in the presence or absence of a specific MDR1 blocker. Results MDR1 was overexpressed in blood vessels, astrocytes and neurons in human epileptic drug-resistant brain. In addition, MDR1-mediated cellular drug extrusion was increased in human 'epileptic' astrocytes compared to 'normal' ones. Concomitantly, cell viability in the presence of cytotoxic compounds was increased. Conclusions Overexpression of MDR1 in different cell types in drug-resistant epileptic human brain leads to functional alterations, not all of which are linked to drug pharmacokinetics. In particular, the modulation of glioneuronal MDR1 function in epileptic brain in the presence of toxic concentrations of xenobiotics may constitute a novel cytoprotective mechanism.
Frequency of the MDR1 mutant allele associated with multidrug sensitivity in dogs from Brazil
Directory of Open Access Journals (Sweden)
Monobe MM
2015-04-01
Full Text Available Marina M Monobe,1 João P Araujo Junior,2 Kari V Lunsford,3 Rodrigo C Silva,4 Camilo Bulla41Department of Veterinary Clinics, School of Veterinary Medicine and Animal Science, 2Department of Microbiology and Immunology, Biosciences Institute, Sao Paulo State University (UNESP, Botucatu, Brazil; 3Department of Clinical Sciences and Animal Health Center, 4Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, Mississippi, MS, USAAbstract: To date, a 4-bp deletion in the MDR1 gene has been detected in more than ten dog breeds, as well as in mixed breed dogs, in several countries, however information regarding this mutation in dogs from Brazil is lacking. For this reason, 103 Collies, 77 Border Collies, 76 Shetland Sheepdogs, 20 Old English Sheepdogs, 55 German Shepherds, 16 Australian Shepherds, and 53 Whippets from Brazil were screened for the presence of the mutation. The heterozygous mutated genotype, MDR1 (+/−, frequency found for Collies, Australian Shepherd, and Shetland Sheepdog was 50.5% (95% CI =41.1%–59.9%, 31.3% (95% CI =8.6%–53.2%, and 15.8% (95% CI =7.7%–23.9%, respectively. Homozygous mutated genotype, MDR1 (−/−, was detected only in Collies 35.9%. The MDR1 allele mutant frequency found for Collies, Australian Shepherd, and Shetland Sheepdog was 61.2% (95% CI =54.8%–67.5%, 15.6% (95% CI =3.1%–28.2%, and 7.9% (95% CI =3.7%–12.1%, respectively. Additionally, even free of the mutant allele, the maximum mutant prevalence (MMP in that population, with 95% CI, was 3.8%, 5.2%, 5.4%, and 13.8% for Border Collies, German Shepherds, Whippets, and Old English Sheepdogs, respectively. In this way, this information is important, not only for MDR1 genotype-based breeding programs and international exchange of breeding animals of predisposed breeds, but also for modification of drug therapy for breeds at risk.Keywords: P-glycoprotein, MDR1 mutation, ivermectin, dog, drug
Energy Technology Data Exchange (ETDEWEB)
Zhu, Lijun; Wu, Jinjun; Zhao, Min; Song, Wenjie; Qi, Xiaoxiao; Wang, Ying [International Institute for Translational Chinese Medicine, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 510006 (China); Lu, Linlin [International Institute for Translational Chinese Medicine, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 510006 (China); State Key Laboratory of Quality Research in Chinese Medicine, Macau University of Science and Technology, Macau (SAR) 999078 (China); Liu, Zhongqiu, E-mail: liuzq@gzucm.edu.cn [International Institute for Translational Chinese Medicine, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 510006 (China); State Key Laboratory of Quality Research in Chinese Medicine, Macau University of Science and Technology, Macau (SAR) 999078 (China)
2017-04-01
Aconitine (AC) is the primary bioactive/toxic alkaloid in plants of the Aconitum species. Our previous study demonstrated that Mdr1 was involved in efflux of AC. However, the mechanism by which Mdr1 regulates the efficacy/toxicity of AC in vivo remains unclear. The present study aimed to determine the effects of Mdr1a on the efficacy/toxicity and pharmacokinetics of AC in wild-type and Mdr1a{sup −/−} FVB mice. After oral administration of AC, significantly higher analgesic effect was observed in Mdr1a{sup −/−} mice (49% to 105%) compared to wild-type mice (P < 0.05). The levels of s100-β protein and creatine kinase, which indicate cerebral and myocardial damage, respectively, were also significantly increased (P < 0.05) in Mdr1a{sup −/−} mice. Histopathological examination revealed that the Mdr1a{sup −/−} mice suffered from evident cerebral and myocardial damages, but the wild-type mice did not. These findings suggested that Mdr1a deficiency significantly promoted the analgesic effect of AC and exacerbated its toxicity. Pharmacokinetic experiments showed that T{sub 1/2} of AC in the Mdr1a{sup −/−} mice was significantly higher (from 87% to 300%) than that in wild-type mice (P < 0.05). The distribution of AC in the brain of Mdr1a{sup −/−} mice was 2- to 32-fold higher than that in the brains of wild-type mice (P < 0.05). Toxic reactions were more severe in Mdr1a{sup −/−} mice compared to wild-type mice. In conclusion, Mdr1a deficiency significantly enhanced the analgesic effect of AC and exacerbated its toxicity by upregulating its distribution to the brain and decreasing its plasma elimination rate. Thus, Mdr1a dysfunction may cause severe AC poisoning. - Highlights: • The efficacy and toxicity of aconitine were significantly enhanced in Mdr1a{sup −/−} mice. • The distribution of aconitine to the brain was remarkably increased in Mdr1a{sup −/−} mice. • The elimination rate of aconitine was significantly decreased in Mdr1a
Wang, Renxue; Liu, Lin; Sheps, Jonathan A; Forrest, Dana; Hofmann, Alan F; Hagey, Lee R; Ling, Victor
2013-08-15
The bile salt export pump (BSEP), encoded by the abcb11 gene, is the major canalicular transporter of bile acids from the hepatocyte. BSEP malfunction in humans causes bile acid retention and progressive liver injury, ultimately leading to end-stage liver failure. The natural, hydrophilic, bile acid ursodeoxycholic acid (UDCA) is efficacious in the treatment of cholestatic conditions, such as primary biliary cirrhosis and cholestasis of pregnancy. The beneficial effects of UDCA include promoting bile flow, reducing hepatic inflammation, preventing apoptosis, and maintaining mitochondrial integrity in hepatocytes. However, the role of BSEP in mediating UDCA efficacy is not known. Here, we used abcb11 knockout mice (abcb11-/-) to test the effects of acute and chronic UDCA administration on biliary secretion, bile acid composition, liver histology, and liver gene expression. Acutely infused UDCA, or its taurine conjugate (TUDC), was taken up by the liver but retained, with negligible biliary output, in abcb11-/- mice. Feeding UDCA to abcb11-/- mice led to weight loss, retention of bile acids, elevated liver enzymes, and histological damage to the liver. Semiquantitative RT-PCR showed that genes encoding Mdr1a and Mdr1b (canalicular) as well as Mrp4 (basolateral) transporters were upregulated in abcb11-/- mice. We concluded that infusion of UDCA and TUDC failed to induce bile flow in abcb11-/- mice. UDCA fed to abcb11-/- mice caused liver damage and the appearance of biliary tetra- and penta-hydroxy bile acids. Supplementation with UDCA in the absence of Bsep caused adverse effects in abcb11-/- mice.
Cheng, Qilai; Liao, Meixiang; Hu, Haibo; Li, Hongliang; Wu, Longhuo
2018-01-01
P-glycoprotein (P-gp, i.e., MDR1) is associated with the phenotype of multidrug resistance (MDR) and causes chemotherapy failure in the management of cancers. Searching for effective MDR modulators and combining them with anticancer drugs is a promising strategy against MDR. Asiatic acid (AA), a natural triterpene isolated from the plant Centella asiatica, may have an antitumor activity. The present study assessed the reversing effect of AA on MDR and possible molecular mechanisms of AA action in MDR1-overexpressing cisplatin (DDP)-resistant lung cancer cells, A549/DDP. Human lung adenocarcinoma A549/DDP cells were either exposed to different concentrations of AA or treated with DDP, and their viability was measured by the MTT assay. A Rhodamine 123 efflux assay, immunofluorescent staining, ATPase assay, reverse-transcription PCR (RT-PCR), and western blot analysis were conducted to elucidate the mechanisms of action of AA on MDR. Our results showed that AA significantly enhanced the cytotoxicity of DDP toward A549/DDP cells but not its parental A549 cells. Furthermore, AA strongly inhibited P-gp expression by blocking MDR1 gene transcription and increased the intracellular accumulation of the P-gp substrate Rhodamine 123 in A549/DDP cells. Nuclear factor (NF)-kB (p65) activity, IkB degradation, and NF-kB/p65 nuclear translocation were markedly inhibited by pretreatment with AA. Additionally, AA inhibited the MAPK-ERK pathway, as indicated by decreased phosphorylation of ERK1 and -2, AKT, p38, and JNK, thus resulting in reduced activity of the Y-box binding protein 1 (YB1) via blockage of its nuclear translocation. AA reversed P-gp-mediated MDR by inhibition of P-gp expression. This effect was likely related to downregulation of YB1, and this effect was mediated by the NF-kB and MAPK-ERK pathways. AA may be useful as an MDR reversal agent for combination therapy in clinical trials. © 2018 The Author(s). Published by S. Karger AG, Basel.
Elmi, Omar Salad; Hasan, Habsah; Abdullah, Sarimah; Mat Jeab, Mat Zuki; Ba, Zilfalil; Naing, Nyi Nyi
2016-07-01
Treating patients with multidrug-resistant tuberculosis (MDR-TB) strains is more complicated, complex, toxic, expensive, than treating patients with susceptible TB strains. This study aims to compare the treatment outcomes and potential factors associated between patients with MDR-TB and non MDR TB infections in peninsular Malaysia. This study was a retrospective cohort study. Data were collected from the medical records of all registered MDR-TB patients and Non-MDR-TB patients at five TB hospitals in peninsular Malaysia from January 2010 to January 2014. A total of 314 subjects were studied, including 105 MDR-TB cases and 209 non-MDR-TB. After TB treatment, 24.8% of the MDR-TB patients and 17.7% of non MDR TB relapsed; 17.1% of the MDR-TB patients and 16.3% of non MDR TB defaulted from TB treatment. A significant difference seen in treatment success rate 17.1% for MDR-TB; 63.1% for non MDR TB (P history of TB treatment, and presence of HIV infection.
Importancia pronóstica de la expresión de MDR-1 en la leucemia mieloblástica aguda
Directory of Open Access Journals (Sweden)
J. Arbelbide
2003-08-01
Full Text Available Una proporción importante de pacientes con leucemia mieloblástica aguda (LMA presentan recaída o resistencia con el tratamiento. Uno de los mecanismos involucrados en la resistencia a drogas, es la presencia de la glicoproteína P 170 (gp-P 170 resultante de la expresión del gen MDR-1 sobre las células leucémicas. El objetivo de este trabajo es valorar el impacto pronóstico de la expresión de MDR-1 en una población de pacientes tratados por LMA. Se evaluó retrospectivamente la expresión de MDR-1 en una cohorte de 55 pacientes con LMA, mayores de 16 años, que recibieron tratamiento quimioterápico desde 1990 hasta el 2000. Se evaluó sobre biopsia de médula ósea, la expresión de MDR-1/gp-P 170 por inmunohistoquímica. Mediante una curva ROC, se estableció que una expresión de MDR-1 > 50% en células blásticas, resultó significativa para el logro de remisión completa. Esta expresión de MDR-1+ correlacionó con la presencia de leucocitosis: (p:0.002, expresion de células CD34+ (p:0.006, menor tasa de remisión completa (p:0.001, mayor tasa de recaída (p:0.02 y de estudios citogenéticos no favorables (p:0.02. La SLE fue de 21.2% ES:9.3 con un seguimiento de 22 meses para el grupo MDR-1+ versus 56.4% ES:12.5 con un seguimiento de 78 meses en los casos MDR-1- (p:0.007. Se puede concluir que la expresion de MDR-1 ha demostrado ser un factor pronóstico de resistencia a la quimioterapia. Estos pacientes presentan una menor tasa de remisión completa, una mayor tasa de recaída por persistencia de enfermedad residual post-tratamiento, lo que produce una menor sobrevida global.An important number of patients with Acute Myeloid Leukemia (AML experience relapse or resistance to chemotherapy. One of the mechanisms involved in this resistance is the presence of glycoprotein P170 (gp-P 170, which results of the MDR-1 gene in leukemic cells. The objective of this article is to assess the prognostic impact of the expression of MDR-1 in a
Directory of Open Access Journals (Sweden)
N. AZARPIRA
2006-11-01
Full Text Available Background:It is well recognized that different patients respond in different ways to medications. The inter-individual variations are greater than the intera- individual variations,a finding consistent with the notion that inheritance is a determinant of drug responses. The recent identification of genetic polymorphisms in drug-metabolizing enzymes and drug transporters led to the hypothesis that genetic factors may be implicated in this interindividual variation. Single nucleotide polymorphism in common metabolic pathway,cytochrome P450 and common transporter,multidrug resistance-1 gene are two important sites that might involve clinically significant genetic variations. Ethnicity greatly influences these genetic polymorphism distributions. Methods: We studied the inheritance patterns of polymorphisms for MDR1 and CYP3A5 genes in the Iranian population and compared its genotype and allele frequencies with 3 different ethnic groups: Caucasian (United Kingdom, Chinese and Japanese. Results: We found striking differences in the distribution of MDR allelic variants between Iranian,Japanese and Chinese (p<0.02 and similar between the Iranian and Caucasian population.(p=0.06.Almost 50% of Iranian and Caucasian individuals were homozygous carriers of the variant T allele compared with 32% of the Japanese and 43% of the Chinese (p<0.02.More than half of Iranian subjects have at least one T allele,with lower P-gp level in small intestine.We also noted dramatic differences in the CYP3A5 alleles and genotypes distribution between Iranian subjects with other compared populations.99% of Iranian individuals were homozygous carriers of the variant G allele compared with about 70% of the Chinese and Japanese and 19% of the Caucasian population. The G/G genotype has a very low level of active cytochrome P450 enzyme.Conclusion:Our results emphasize the role of ethnicity in interindividual variability of the pharmacokinetic and pharmacodynamic characteristics
Dioscin enhances methotrexate absorption by down-regulating MDR1 in vitro and in vivo
Energy Technology Data Exchange (ETDEWEB)
Wang, Lijuan, E-mail: jlwang1979@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Wang, Changyuan, E-mail: wangcyuan@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Peng, Jinyong, E-mail: jinyongpeng2005@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Liu, Qi, E-mail: llaqii@yahoo.com.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Meng, Qiang, E-mail: mengq531@yahoo.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Sun, Huijun, E-mail: sunhuijun@hotmail.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Huo, Xiaokui, E-mail: huoxiaokui@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); and others
2014-06-01
The purpose of this study was to investigate the enhancing effect of dioscin on the absorption of methotrexate (MTX) and clarify the molecular mechanism involved in vivo and in vitro. Dioscin increased MTX chemosensitivity and transepithelial flux in the absorptive direction, significantly inhibiting multidrug resistance 1 (MDR1) mRNA and protein expression and MDR1 promoter and nuclear factor κ-B (NF-κB) activities in Caco-2 cells. Moreover, inhibitor κB-α (IκB-α) degradation was inhibited by dioscin. Dioscin enhanced the intracellular concentration of MTX by down-regulating MDR1 expression through a mechanism that involves NF-κB signaling pathway inhibition in Caco-2 cells. Dioscin strengthened MTX absorption by inhibiting MDR1 expression in rat intestine. In addition, even though MTX is absorbed into the enterocytes, there was no increase in toxicity observed, and that, in fact, decreased toxicity was seen. - Highlights: • Dioscin raised MTX concentration by inhibiting MDR1 in Caco-2 cells. • Dioscin suppresses MDR1 by inhibiting NF-κB signaling pathway in Caco-2 cells. • Dioscin can enhance MTX absorption via inhibiting MDR1 in vivo and in vitro. • Dioscin did not increase MTX-induced gastrointestinal mucosal toxicity.
Directory of Open Access Journals (Sweden)
Michiro Susa
2010-05-01
Full Text Available The use of neo-adjuvant chemotherapy in treating osteosarcoma has improved patients' average 5 year survival rate from 20% to 70% in the past 30 years. However, for patients who progress after chemotherapy, its effectiveness diminishes due to the emergence of multi-drug resistance (MDR after prolonged therapy.In order to overcome both the dose-limiting side effects of conventional chemotherapeutic agents and the therapeutic failure resulting from MDR, we designed and evaluated a novel drug delivery system for MDR1 siRNA delivery. Novel biocompatible, lipid-modified dextran-based polymeric nanoparticles were used as the platform for MDR1 siRNA delivery; and the efficacy of combination therapy with this system was evaluated. In this study, multi-drug resistant osteosarcoma cell lines (KHOS(R2 and U-2OS(R2 were treated with the MDR1 siRNA nanocarriers and MDR1 protein (P-gp expression, drug retention, and immunofluoresence were analyzed. Combination therapy of the MDR1 siRNA loaded nanocarriers with increasing concentrations of doxorubicin was also analyzed. We observed that MDR1 siRNA loaded dextran nanoparticles efficiently suppresses P-gp expression in the drug resistant osteosarcoma cell lines. The results also demonstrated that this approach may be capable of reversing drug resistance by increasing the amount of drug accumulation in MDR cell lines.Lipid-modified dextran-based polymeric nanoparticles are a promising platform for siRNA delivery. Nanocarriers loaded with MDR1 siRNA are a potential treatment strategy for reversing MDR in osteosarcoma.
Xiong, Yuqing; Yuan, Zhao; Yang, Jingzhi; Xia, Chunhua; Li, Xinhua; Huang, Shibo; Zhang, Hong; Liu, Mingyi
2016-04-01
Rupatadine (RUP) is an oral antihistamine and platelet-activating factor antagonist and is shown as the substrate of CYP3A5 and P-gp. The significant interindividual differences of CYP3A5 and P-gp often cause bioavailability differences of some clinical drugs. The present study is aimed to evaluate the effect of genetic polymorphisms of CYP3A5 and MDR1 on RUP pharmacokinetics in healthy male Chinese volunteer subjects. Blood samples were collected from 36 subjects before and after a single, oral RUP 10 mg dose. A PCR-RFLP assay was used to genotype CYP3A5*3 and assess MDR1 C3435T variation. A validated LC-MS/MS method quantified plasma RUP concentration. The relationship between RUP plasma concentration, pharmacokinetic parameters, and polymorphic alleles (CYP3A5 and MDR1) were assessed. Plasma RUP concentrations were lower for CYP3A5*1/*1 carriers than for CYP3A5*3/*3 and CYP3A5*1/*3 carriers. Mean C(max), AUC(0-t) and AUC(0-∞) were significantly lower, and the CLz and Vd were significantly higher in the CYP3A5 wild-type group, than in the CYP3A5 mutated group. MDR1 CT and MDR1 TT carriers had lower plasma RUP concentrations than MDR1 CC carriers. The mean C(max), AUC(0-t), AUC(0-∞) and T max were significantly lower in the TT group than in the CC and CT groups. The mean CLz was higher in the TT group than in the CC and CT groups, but not significantly. These results suggest that CYP3A5 and MDR1 may play a key role in the variability of RUP metabolism and transport, respectively. CYP3A5 and MDR1 polymorphisms may be the main explanation for the differences observed in RUP pharmacokinetics, and therefore may provide a rationale for safe and effective clinical use of RUP. Our research lays down a solid theory foundation to guide the safe and effective clinical use of RUP and a route to achieve individualized therapy.
International Nuclear Information System (INIS)
Sokova, O.I.; Siyanova, E.Yu.; Gudkov, A.V.; Kopnin, B.P.
1988-01-01
Using in situ hybridization, the mdr gene was mapped in chromosomes of Dzungarian hamster embryonic cells, amplification of which accompanies development of multidrug resistance (MDR). It was shown that the mdr gene is located in chromosome segment 4q15-21, in which, according to data obtained previously, amplified copes of open quotes MDR genes close quotes (mdr, et al.) are distributed, as a rule. Results obtained, as well as data of other investigators, attest to the fact that integration recombination of amplified copies of DNA occurs primarily at the site of disposition of homologous sequences
Directory of Open Access Journals (Sweden)
Tom Cattaert
Full Text Available We propose a novel multifactor dimensionality reduction method for epistasis detection in small or extended pedigrees, FAM-MDR. It combines features of the Genome-wide Rapid Association using Mixed Model And Regression approach (GRAMMAR with Model-Based MDR (MB-MDR. We focus on continuous traits, although the method is general and can be used for outcomes of any type, including binary and censored traits. When comparing FAM-MDR with Pedigree-based Generalized MDR (PGMDR, which is a generalization of Multifactor Dimensionality Reduction (MDR to continuous traits and related individuals, FAM-MDR was found to outperform PGMDR in terms of power, in most of the considered simulated scenarios. Additional simulations revealed that PGMDR does not appropriately deal with multiple testing and consequently gives rise to overly optimistic results. FAM-MDR adequately deals with multiple testing in epistasis screens and is in contrast rather conservative, by construction. Furthermore, simulations show that correcting for lower order (main effects is of utmost importance when claiming epistasis. As Type 2 Diabetes Mellitus (T2DM is a complex phenotype likely influenced by gene-gene interactions, we applied FAM-MDR to examine data on glucose area-under-the-curve (GAUC, an endophenotype of T2DM for which multiple independent genetic associations have been observed, in the Amish Family Diabetes Study (AFDS. This application reveals that FAM-MDR makes more efficient use of the available data than PGMDR and can deal with multi-generational pedigrees more easily. In conclusion, we have validated FAM-MDR and compared it to PGMDR, the current state-of-the-art MDR method for family data, using both simulations and a practical dataset. FAM-MDR is found to outperform PGMDR in that it handles the multiple testing issue more correctly, has increased power, and efficiently uses all available information.
In vitro detection of mdr1 mRNA in murine leukemia cells with 111In-labeled oligonucleotide
International Nuclear Information System (INIS)
Bai Jingming; Yokoyama, Kunihiko; Kinuya, Seigo; Michigishi, Takatoshi; Tonami, Norihisa; Shiba, Kazuhiro; Matsushita, Ryo; Nomura, Masaaki
2004-01-01
The feasibility of intracellular mdr1 mRNA expression detection with radiolabeled antisense oligonucleotide (ODN) was investigated in the murine leukemia cell line, P388/S, and its subclonal, adriamycin-resistant cell line, P388/R. The expression level of mdr1 mRNA was analyzed by reverse transcription-polymerase chain reaction (RT-PCR). Existence of the multidrug resistance (MDR) phenomenon was assessed via cellular uptake of 99m Tc-sestamibi (MIBI), a known substrate for P-glycoprotein. A 15-mer phosphorothioate antisense ODN complementary to the sequences located at -1 to 14 of mdr1 mRNA and its corresponding sense ODN were conjugated with the cyclic anhydride of diethylene triamine penta-acetic acid (cDTPA) via an amino group linked to the terminal phosphate at the 5' end at pH 8-9. The DTPA-ODN complexes at concentrations of 0.1-17.4 μMwere reacted with 111 InCl 3 at pH 5 for 1 h. The hybridization affinity of labeled ODN was evaluated with size-exclusion high-performance liquid chromatography following incubation with the complementary sequence. Cellular uptake of labeled ODN was examined in vitro. Furthermore, enhancing effects of synthetic lipid carriers (Transfast) on transmembrane delivery of ODN were assessed. P388/R cells displayed intense mdr1 mRNA expression in comparison with P388/S cells. 99m Tc-MIBI uptake in P388/S cells was higher than that in P388/R cells. Specific radioactivity up to 1,634 MBq/nmol was achieved via elevation of added radioactivity relative to ODN molar amount. The hybridization affinity of antisense 111 In-ODN was preserved at approximately 85% irrespective of specific activity. Cellular uptake of antisense 111 In-ODN did not differ from that of sense 111 In-ODN in either P388/S cells or P388/R cells. However, lipid carrier incorporation significantly increased transmembrane delivery of 111 In-ODN; moreover, specific uptake of antisense 111 In-ODN was demonstrated in P388/R cells. Radiolabeling of ODN at high specific
International Nuclear Information System (INIS)
Schneiderman, Rosa S; Shmueli, Esther; Kirson, Eilon D; Palti, Yoram
2010-01-01
Exposure of cancer cells to chemotherapeutic agents may result in reduced sensitivity to structurally unrelated agents, a phenomenon known as multidrug resistance, MDR. The purpose of this study is to investigate cell growth inhibition of wild type and the corresponding MDR cells by Tumor Treating Fields - TTFields, a new cancer treatment modality that is free of systemic toxicity. The TTFields were applied alone and in combination with paclitaxel and doxorubicin. Three pairs of wild type/MDR cell lines, having resistivity resulting from over-expression of ABC transporters, were studied: a clonal derivative (C11) of parental Chinese hamster ovary AA8 cells and their emetine-resistant sub-line Emt R1 ; human breast cancer cells MCF-7 and their mitoxantrone-resistant sub lines MCF-7/Mx and human breast cancer cells MDA-MB-231 and their doxorubicin resistant MDA-MB-231/Dox cells. TTFields were applied for 72 hours with and without the chemotherapeutic agents. The numbers of viable cells in the treated cultures and the untreated control groups were determined using the XTT assay. Student t-test was applied to asses the significance of the differences between results obtained for each of the three cell pairs. TTFields caused a similar reduction in the number of viable cells of wild type and MDR cells. Treatments by TTFields/drug combinations resulted in a similar increased reduction in cell survival of wild type and MDR cells. TTFields had no effect on intracellular doxorubicin accumulation in both wild type and MDR cells. The results indicate that TTFields alone and in combination with paclitaxel and doxorubicin effectively reduce the viability of both wild type and MDR cell sub-lines and thus can potentially be used as an effective treatment of drug resistant tumors
The process behind the expression of mdr-1/P-gp and mrp/MRP in human leukemia/lymphoma.
Hirose, Masao
2009-04-01
There is a controversy over the link between phenotypes of multidrug resistance (MDR) and clinical outcome in leukemia/lymphoma patients. This may be because the process behind the induction and loss of expression of genotypes and phenotypes by which MDR develops and the role of MDR in fresh cells of human leukemia/lymphoma are not clearly defined. P-glycoprotein (P-gp) increased and decreased along with mdr-1 expression in three cell lines out of five vincristine (VCR)-resistant cell lines. MRP appeared with increased mrp expression in the other two cell lines. After the drug was removed from the culture system, mdr-1/P-gp changed in parallel with the level of VCR resistance, although mrp and MRP did not. It was concluded that P-gp is directly derived from mdr-1 and that mdr-1/P-gp supports the VCR-resistance but mrp/MRP is not directly linked to the VCR-resistance. These results should contribute to a better understanding of MDR phenomenon in cancer.
Establishment of optimized MDCK cell lines for reliable efflux transport studies.
Gartzke, Dominik; Fricker, Gert
2014-04-01
Madin-Darby canine kidney (MDCK) cells transfected with human MDR1 gene (MDCK-MDR1) encoding for P-glycoprotein (hPgp, ABCB1) are widely used for transport studies to identify drug candidates as substrates of this efflux protein. Therefore, it is necessary to rely on constant and comparable expression levels of Pgp to avoid false negative or positive results. We generated a cell line with homogenously high and stable expression of hPgp through sorting single clones from a MDCK-MDR1 cell pool using fluorescence-activated cell sorting (FACS). To obtain control cell lines for evaluation of cross-interactions with endogenous canine Pgp (cPgp) wild-type cells were sorted with a low expression pattern of cPgp in comparison with the MDCK-MDR1. Expression of other transporters was also characterized in both cell lines by quantitative real-time PCR and Western blot. Pgp function was investigated applying the Calcein-AM assay as well as bidirectional transport assays using (3) H-Digoxin, (3) H-Vinblastine, and (3) H-Quinidine as substrates. Generated MDCK-MDR1 cell lines showed high expression of hPgp. Control MDCK-WT cells were optimized in showing a comparable expression level of cPgp in comparison with MDCK-MDR1 cell lines. Generated cell lines showed higher and more selective Pgp transport compared with parental cells. Therefore, they provide a significant improvement in the performance of efflux studies yielding more reliable results. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.
Denecke, Shane; Fusetto, Roberto; Batterham, Philip
2017-12-01
ABC transporters have a well-established role in drug resistance, effluxing xenobiotics from cells and tissues within the organism. More recently, research has been dedicated to understanding the role insect ABC transporters play in insecticide toxicity, but progress in understanding the contribution of specific transporters has been hampered by the lack of functional genetic tools. Here, we report knockouts of three Drosophila melanogaster ABC transporter genes, Mdr49, Mdr50, and Mdr65, that are homologous to the well-studied mammalian ABCB1 (P-glycoprotein). Each knockout mutant was created in the same wild type background and tested against a panel of insecticides representing different chemical classes. Mdr65 knockouts were more susceptible to all neuroactive insecticides tested, but Mdr49 and Mdr50 knockouts showed increased susceptibility or resistance depending on the insecticide used. Mdr65 was chosen for further analysis. Calculation of LC 50 values for the Mdr65 knockout allowed the substrate specificity of this transporter to be examined. No obvious distinguishing structural features were shared among MDR65 substrates. A role for Mdr65 in insecticide transport was confirmed by testing the capacity of the knockout to synergize with the ABC inhibitor verapamil and by measuring the levels of insecticide retained in the body of knockout flies. These data unambiguously establish the influence of ABC transporters on the capacity of wild type D. melanogaster to tolerate insecticide exposure and suggest that both tissue and substrate specificity underpin this capacity. Copyright © 2017 Elsevier Ltd. All rights reserved.
Polymorphism in ABC transporter genes of Dirofilaria immitis
Directory of Open Access Journals (Sweden)
Thangadurai Mani
2017-08-01
Full Text Available Dirofilaria immitis, a filarial nematode, causes dirofilariasis in dogs, cats and occasionally in humans. Prevention of the disease has been mainly by monthly use of the macrocyclic lactone (ML endectocides during the mosquito transmission season. Recently, ML resistance has been confirmed in D. immitis and therefore, there is a need to find new classes of anthelmintics. One of the mechanisms associated with ML resistance in nematodes has been the possible role of ATP binding cassette (ABC transporters in reducing drug concentrations at receptor sites. ABC transporters, mainly from sub-families B, C and G, may contribute to multidrug resistance (MDR by active efflux of drugs out of the cell. Gene products of ABC transporters may thus serve as the targets for agents that may modulate susceptibility to drugs, by inhibiting drug transport. ABC transporters are believed to be involved in a variety of physiological functions critical to the parasite, such as sterol transport, and therefore may also serve as the target for drugs that can act as anthelmintics on their own. Knowledge of polymorphism in these ABC transporter genes in nematode parasites could provide useful information for the process of drug design. We have identified 15 ABC transporter genes from sub-families A, B, C and G, in D. immitis, by comparative genomic approaches and analyzed them for polymorphism. Whole genome sequencing data from four ML susceptible (SUS and four loss of efficacy (LOE pooled populations were used for single nucleotide polymorphism (SNP genotyping. Out of 231 SNPs identified in those 15 ABC transporter genes, 89 and 75 of them were specific to the SUS or LOE populations, respectively. A few of the SNPs identified may affect gene expression, protein function, substrate specificity or resistance development and may be useful for transporter inhibitor/anthelmintic drug design, or in order to anticipate resistance development. Keywords: Dirofilaria immitis
Conserved hydrogen bonds and water molecules in MDR HIV-1 protease substrate complexes
Energy Technology Data Exchange (ETDEWEB)
Liu, Zhigang [Wayne State Univ., Detroit, MI (United States); Case Western Reserve Univ., Cleveland, OH (United States); Harbor Hospital Baltimore, MD (United States); Wang, Yong [Wayne State Univ., Detroit, MI (United States); Yedidi, Ravikiran S. [Wayne State Univ., Detroit, MI (United States); National Institutes of Health, Bethesda, MD (United States); Dewdney, Tamaria G. [Wayne State Univ., Detroit, MI (United States); Reiter, Samuel J. [Wayne State Univ., Detroit, MI (United States); Brunzelle, Joseph S. [Northwestern Univ. Feinberg School of Medicine, Chicago, IL (United States); Kovari, Iulia A. [Wayne State Univ., Detroit, MI (United States); Kovari, Ladislau C. [Wayne State Univ., Detroit, MI (United States)
2012-12-19
Success of highly active antiretroviral therapy (HAART) in anti-HIV therapy is severely compromised by the rapidly developing drug resistance. HIV-1 protease inhibitors, part of HAART, are losing their potency and efficacy in inhibiting the target. Multi-drug resistant (MDR) 769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, 90) was selected for the present study to understand the binding to its natural substrates. The nine crystal structures of MDR769 HIV-1 protease substrate hepta-peptide complexes were analyzed in order to reveal the conserved structural elements for the purpose of drug design against MDR HIV-1 protease. Our structural studies demonstrated that highly conserved hydrogen bonds between the protease and substrate peptides, together with the conserved crystallographic water molecules, played a crucial role in the substrate recognition, substrate stabilization and protease stabilization. Additionally, the absence of the key flap-ligand bridging water molecule might imply a different catalytic mechanism of MDR769 HIV-1 protease compared to that of wild type (WT) HIV-1 protease.
Directory of Open Access Journals (Sweden)
Ana Martins
2015-01-01
Full Text Available Ecdysteroids, analogs of the insect molting hormone, are known for their various mild, nonhormonal bioactivities in mammals. Previously, we reported that less-polar ecdysteroids can modulate the doxorubicin resistance of a multidrug resistant (MDR mouse lymphoma cell line expressing the human ABCB1 transporter. Here, we describe the ability of 20-hydroxyecdysone (1 and its mono- (2 and diacetonide (3 derivatives to sensitize various MDR and non-MDR cancer cell lines towards doxorubicin, paclitaxel, vincristine, or cisplatin. Drug IC50 values with or without ecdysteroid were determined by MTT assay. Compound 3 significantly sensitized all cell lines to each chemotherapeutic except for cisplatin, whose activity was decreased. In order to overcome solubility and stability issues for the future in vivo administration of compound 3, liposomal formulations were developed. By means of their combination index values obtained via checkerboard microplate method, a formulation showed superior activity to that of compound 3 alone. Because ecdysteroids act also on non-ABCB1 expressing (sensitive cell lines, our results demonstrate that they do not or not exclusively exert their adjuvant anticancer activity as ABCB1 inhibitors, but other mechanisms must be involved, and they opened the way towards their in vivo bioactivity testing against various cancer xenografts.
Splice form variant and amino acid changes in MDR49 confers DDT resistance in transgenic Drosophila.
Seong, Keon Mook; Sun, Weilin; Clark, John M; Pittendrigh, Barry R
2016-03-22
The ATP-binding cassette (ABC) transporters represent a superfamily of proteins that have important physiological roles in both prokaryotes and eukaryotes. In insects, ABC transporters have previously been implicated in insecticide resistance. The 91-R strain of Drosophila melanogaster has been intensely selected with DDT over six decades. A recent selective sweeps analysis of 91-R implicated the potential role of MDR49, an ABC transporter, in DDT resistance, however, to date the details of how MDR49 may play a role in resistance have not been elucidated. In this study, we investigated the impact of structural changes and an alternative splicing event in MDR49 on DDT-resistance in 91-R, as compared to the DDT susceptible strain 91-C. We observed three amino acid differences in MDR49 when 91-R was compared with 91-C, and only one isoform (MDR49B) was implicated in DDT resistance. A transgenic Drosophila strain containing the 91-R-MDR49B isoform had a significantly higher LD50 value as compared to the 91-C-MDR49B isoform at the early time points (6 h to 12 h) during DDT exposure. Our data support the hypothesis that the MDR49B isoform, with three amino acid mutations, plays a role in the early aspects of DDT resistance in 91-R.
Mayer, U; Wagenaar, E; Beijnen, J.H; Smit, J.W; Meijer, D.K F; van Asperen, J.; Borst, P; Schinkel, A.H
1 We have used mice with a disrupted mdrla P-glycoprotein gene (mdrIa (-/-) mice) to study the role of P-glycoprotein in the pharmacokinetics of digoxin, a model P-glycoprotein substrate. 2 [K-3]-digoxin at a dose of 0.2 mg kg(-1) was administered as a single i.v. or oral bolus injection. We
Cho, Hyun-Jong; Choi, Min-Koo; Lin, Hongxia; Kim, Jung Sun; Chung, Suk-Jae; Shim, Chang-Koo; Kim, Dae-Duk
2011-03-01
P-glycoprotein (P-gp) is an efflux transporter encoded by the multidrug resistance gene (MDR1), which is also known as the human ABCB1 gene (ATP-binding cassette, subfamily-B). The objectives of this study were to investigate the expression of P-gp in passaged primary human nasal epithelial (HNE) cell monolayer, cultured by the air-liquid interface (ALI) method, and to evaluate its feasibility as an in-vitro model for cellular uptake and transport studies of P-gp substrates. Reverse transcriptase-polymerase chain reaction (RT-PCR) was performed to verify the expression of the MDR1 gene. Transport and cellular uptake studies with P-gp substrate (rhodamine123) and P-gp inhibitors (verapamil and cyclosporin A) were conducted to assess the functional activity of P-gp in HNE cell monolayers cultured by the ALI method. MDR1 gene expression in primary HNE cell monolayers cultured by ALI method was confirmed by RT-PCR. The apparent permeability coefficient (P(app) ) of the P-gp substrate (rhodamine123) in the basolateral to apical (B to A) direction was 6.9 times higher than that in the apical to basolateral (A to B) direction. B to A transport was saturated at high rhodamine123 concentration, and the treatment of P-gp inhibitors increased cellular uptake of rhodamine123 in a time- and concentration-dependent manner. These results support the MDR1 gene expression and the functional activity of P-gp in primary HNE cell monolayers cultured by the ALI method. © 2011 The Authors. JPP © 2011 Royal Pharmaceutical Society.
Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu
2013-01-01
A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.
African Journals Online (AJOL)
User
Among the MDR-TB cases rifampicin resistance was associated with rpoB WT gene and rpoB MUT gene in 100% and 62% of the ... diagnosis of TB patients, and proper treatment and management of the infected cases to minimize the spread and ..... in an amino acid change and concluded that this is one of the reasons ...
Directory of Open Access Journals (Sweden)
Deep Agnani
Full Text Available P-glycoprotein, a human multidrug resistance transporter, has been extensively studied due to its importance to human health and disease. In order to understand transport kinetics via P-gp, confluent cell monolayers overexpressing P-gp are widely used. The purpose of this study is to obtain the mass action elementary rate constants for P-gp's transport and to functionally characterize members of P-gp's network, i.e., other transporters that transport P-gp substrates in hMDR1-MDCKII confluent cell monolayers and are essential to the net substrate flux. Transport of a range of concentrations of amprenavir, loperamide, quinidine and digoxin across the confluent monolayer of cells was measured in both directions, apical to basolateral and basolateral to apical. We developed a global optimization algorithm using the Particle Swarm method that can simultaneously fit all datasets to yield accurate and exhaustive fits of these elementary rate constants. The statistical sensitivity of the fitted values was determined by using 24 identical replicate fits, yielding simple averages and standard deviations for all of the kinetic parameters, including the efflux active P-gp surface density. Digoxin required additional basolateral and apical transporters, while loperamide required just a basolateral tranporter. The data were better fit by assuming bidirectional transporters, rather than active importers, suggesting that they are not MRP or active OATP transporters. The P-gp efflux rate constants for quinidine and digoxin were about 3-fold smaller than reported ATP hydrolysis rate constants from P-gp proteoliposomes. This suggests a roughly 3∶1 stoichiometry between ATP hydrolysis and P-gp transport for these two drugs. The fitted values of the elementary rate constants for these P-gp substrates support the hypotheses that the selective pressures on P-gp are to maintain a broad substrate range and to keep xenobiotics out of the cytosol, but not out of the
Fairchild, C R; Ivy, S P; Rushmore, T; Lee, G; Koo, P; Goldsmith, M E; Myers, C E; Farber, E; Cowan, K H
1987-11-01
We have previously reported the isolation of a human breast cancer cell line resistant to doxorubicin (adriamycin; AdrR MCF-7 cells) that has also developed the phenotype of multidrug resistance (MDR). MDR in this cell line is associated with increased expression of mdr (P glycoprotein) gene sequences. The development of MDR in AdrR MCF-7 cells is also associated with changes in the expression of several phase I and phase II drug-detoxifying enzymes. These changes are remarkably similar to those associated with development of xenobiotic resistance in rat hyperplastic liver nodules, a well-studied model system of chemical carcinogenesis. Using an mdr-encoded cDNA sequence isolated from AdrR MCF-7 cells, we have examined the expression of mdr sequences in rat livers under a variety of experimental conditions. The expression of mdr increased 3-fold in regenerating liver. It was also elevated (3- to 12-fold) in several different samples of rat hyperplastic nodules and in four of five hepatomas that developed in this system. This suggests that overexpression of mdr, a gene previously associated with resistance to antineoplastic agents, may also be involved in the development of resistance to xenobiotics in rat hyperplastic nodules. In addition, although the acute administration of 2-acetylaminofluorene induced an 8-fold increase in hepatic mdr-encoded RNA, performance of a partial hepatectomy either before or after administration of 2-acetylaminofluorene resulted in a greater than 80-fold increase in mdr gene expression over that in normal untreated livers. This represents an important in vivo model system in which to study the acute regulation of this drug resistance gene.
Directory of Open Access Journals (Sweden)
Mrozikiewicz Przemyslaw M.
2014-06-01
Full Text Available There are a number of compounds that can modify the activity of ABC (ATP-binding cassette and SLC (solute carrier transporters in the blood-brain barrier (BBB. The aim of this study was to investigate the effect of natural and synthetic substances on the expression level of genes encoding transporters present in the BBB (mdr1a, mdr1b, mrp1, mrp2, oatp1a4, oatp1a5 and oatp1c1. Our results showed that verapamil caused the greatest reduction in the mRNA level while other synthetic (piracetam, phenobarbital and natural (codeine, cyclosporine A, quercetin substances showed a selective inhibitory effect. Further, the extract from the roots of Panax ginseng C. A. Meyer exhibited a decrease of transcription against selected transporters whereas the extract from Ginkgo biloba L. leaves resulted in an increase of the expression level of tested genes, except for mrp2. Extract from the aerial parts of Hypericum perforatum L. was the only one to cause an increased mRNA level for mdr1 and oatp1c1. These findings suggest that herbs can play an important role in overcoming the BBB and multidrug resistance to pharmacotherapy of brain cancer and mental disorders, based on the activity of selected drug-metabolizing enzymes and transporters located in the BBB
Directory of Open Access Journals (Sweden)
Keijiro Mizukami
2013-01-01
Full Text Available A single nucleotide substitution (c.-6-180T>G associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9% in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.
Zhang, Yun-Kai; Zhang, Guan-Nan; Wang, Yi-Jun; Patel, Bhargav A.; Talele, Tanaji T.; Yang, Dong-Hua; Chen, Zhe-Sheng
2016-05-01
ATP-Binding Cassette transporters are involved in the efflux of xenobiotic compounds and are responsible for decreasing drug accumulation in multidrug resistant (MDR) cells. Discovered by structure-based virtual screening algorithms, bafetinib, a Bcr-Abl/Lyn tyrosine kinase inhibitor, was found to have inhibitory effects on both ABCB1- and ABCG2-mediated MDR in this in-vitro investigation. Bafetinib significantly sensitized ABCB1 and ABCG2 overexpressing MDR cells to their anticancer substrates and increased the intracellular accumulation of anticancer drugs, particularly doxorubicin and [3H]-paclitaxel in ABCB1 overexpressing cells; mitoxantrone and [3H]-mitoxantrone in ABCG2 overexpressing cells, respectively. Bafetinib stimulated ABCB1 ATPase activities while inhibited ABCG2 ATPase activities. There were no significant changes in the expression level or the subcellular distribution of ABCB1 and ABCG2 in the cells exposed to 3 μM of bafetinib. Overall, our study indicated that bafetinib reversed ABCB1- and ABCG2-mediated MDR by blocking the drug efflux function of these transporters. These findings might be useful in developing combination therapy for MDR cancer treatment.
Ménez, Cécile; Sutra, Jean-François; Prichard, Roger; Lespine, Anne
2012-01-01
The anthelmintics ivermectin (IVM) and moxidectin (MOX) display differences in toxicity in several host species. Entrance into the brain is restricted by the P-glycoprotein (P-gp) efflux transporter, while toxicity is mediated through the brain GABA(A) receptors. This study compared the toxicity of IVM and MOX in vivo and their interaction with GABA(A) receptors in vitro. Drug toxicity was assessed in Mdr1ab(−/−) mice P-gp-deficient after subcutaneous administration of increasing doses (0.11–2.0 and 0.23–12.9 µmol/kg for IVM and MOX in P-gp-deficient mice and half lethal doses (LD50) in wild-type mice). Survival was evaluated over 14-days. In Mdr1ab(−/−) mice, LD50 was 0.46 and 2.3 µmol/kg for IVM and MOX, respectively, demonstrating that MOX was less toxic than IVM. In P-gp-deficient mice, MOX had a lower brain-to-plasma concentration ratio and entered into the brain more slowly than IVM. The brain sublethal drug concentrations determined after administration of doses close to LD50 were, in Mdr1ab(−/−) and wild-type mice, respectively, 270 and 210 pmol/g for IVM and 830 and 740–1380 pmol/g for MOX, indicating that higher brain concentrations are required for MOX toxicity than IVM. In rat α1β2γ2 GABA channels expressed in Xenopus oocytes, IVM and MOX were both allosteric activators of the GABA-induced response. The Hill coefficient was 1.52±0.45 for IVM and 0.34±0.56 for MOX (p<0.001), while the maximum potentiation caused by IVM and MOX relative to GABA alone was 413.7±66.1 and 257.4±40.6%, respectively (p<0.05), showing that IVM causes a greater potentiation of GABA action on this receptor. Differences in the accumulation of IVM and MOX in the brain and in the interaction of IVM and MOX with GABA(A) receptors account for differences in neurotoxicity seen in intact and Mdr1-deficient animals. These differences in neurotoxicity of IVM and MOX are important in considering their use in humans. PMID:23133688
International Nuclear Information System (INIS)
Berger, W.
1993-08-01
The present thesis deals with the resistance of human malignant cells against cellular toxicity of anticancer drugs, a phenomenon representing one of the major obstacles to successful chemotherapy. One mechanism underlying a cross-resistance to different drugs called multidrug resistance (MDR) is characterized by the expression of an active transport protein (P-glycoprotein), causing decreased intracellular drug retention and cytotoxicity. The main subjects of the present work were to establish different detection methods for MDR and its modulation (by substances blocking activity of P-glycoprotein) including immunological methods (immunocytochemistry, radioimmunoassay), molecular biology (slot-blot analysis, in-situ hybridization) and functional assays (drug-accumulation analysis, drug-cytotoxicity analysis). The methods were evaluated and compared using human and mouse MDR control cell lines and human tumor cell lines established in our laboratory. In cell lines derived from human melanoma - a malignancy insensitive to chemotherapy - expression of P-glycoprotein of relatively low transporting activity was detected by different methods in 8 of 33 cases. Furthermore a new sensitive in vitro assay for the functional detection of MDR was established using the biological features of cytochalasins, a microfilament disrupting substance group. These compounds were shown to be substrates for the P-glycoprotein efflux pump and their effects on cell division (blockade of cytokinesis resulting in multinucleate cells) correlated with MDR-activity of the tested cells. With this new assay P-glycoprotein activity can be demonstrated and analysed over a wide range of resistance against different cytotoxic drugs. Therefore it may by a suitable tool for research and diagnosis in the field of drug resistance
Trezise, A E; Ratcliff, R; Hawkins, T E; Evans, M J; Freeman, T C; Romano, P R; Higgins, C F; Colledge, W H
1997-04-01
The cystic fibrosis (Cftr and multidrug resistance (Mdr1) genes encode structurally similar proteins which are members of the ABC transporter superfamily. These genes exhibit complementary patterns of expression in vivo, suggesting that the regulation of their expression may be co-ordinated. We have tested this hypothesis in vivo by examining Cftr and Mdr1 expression in cystic fibrosis knockout transgenic mice (Cftr(tm1CAM)). Cftr mRNA expression in Cftr(tm1CAM)/Cftr(tm1CAM) mice was 4-fold reduced in the intestine, as compared with littermate wild-type mice. All other Cftr(tm1CAM)/Cftr(tm1CAM) mouse tissues examined showed similar reductions in Cftr expression. In contrast, we observed a 4-fold increase in Mdr1 mRNA expression in the intestines of neonatal and 3- to 4-week-old Cftr(tm1CAM)/Cftr(tm1CAM) mice, as compared with age-matched +/+ mice, and an intermediate level of Mdr1 mRNA in heterozygous Cftr(tm1CAM) mice. In 10-week-old, Cftr(tm1CAM)/Cftr(tm1CAM) mice and in contrast to the younger mice, Mdr1 mRNA expression was reduced, by 3-fold. The expression of two control genes, Pgk-1 and Mdr2, was similar in all genotypes, suggesting that the changes in Mdr1 mRNA levels observed in the Cftr(tm1CAM)/Cftr(tm1CAM) mice are specific to the loss of Cftr expression and/or function. These data provide further evidence supporting the hypothesis that the regulation Cftr and Mdr1 expression is co-ordinated in vivo, and that this co-ordinate regulation is influenced by temporal factors.
Gene-gene interactions of IRF5, STAT4, IKZF1 and ETS1 in systemic lupus erythematosus.
Dang, J; Shan, S; Li, J; Zhao, H; Xin, Q; Liu, Y; Bian, X; Liu, Q
2014-06-01
Interferon (IFN) activation signaling and T helper 17 (Th17)-cell/B-cell regulation play a critical role in the pathogenesis of systemic lupus erythematosus (SLE). Several studies have provided convincing evidence that polymorphisms in IRF5, STAT4, IKZF1 and ETS1 from these pathways may be involved in SLE by affecting gene expression or epistasis. We analyzed the genetic interaction in known SLE susceptibility loci from the four genes in northern Han Chinese. A total of 946 northern Han Chinese participated in this study (370 unrelated SLE patients and 576 healthy controls). Subjects underwent genotyping for the single-nucleotide polymorphisms (SNPs) rs2004640 in IRF5, rs7574865 in STAT4, rs4917014 in IKZF1 and rs1128334 in ETS1 by use of a TaqMan SNP genotyping assay and direct sequencing. Gene-gene interaction analysis involved direct counting, multifactor dimensionality reduction (MDR) and linear regression analysis. SLE patients and controls differed in allele frequencies of rs7574865, rs1128334 (P < 0.001) and rs4917014 (P < 0.01). Direct counting revealed that the frequency of risk homozygote combinations was higher for SLE patients than controls (P < 0.01). Furthermore, 2-, 3- and 4-way gene-gene epistasis in SLE was confirmed by parametric methods and MDR analysis. Gene expression analysis partially supported the findings. Our study confirmed the association of the IFN pathway or Th17/B-cells and the pathogenesis of SLE, and gene-gene interaction in this pathway may increase the risk of SLE. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Dekel, Yaron; Machluf, Yossy; Stoler, Aviad; Aderet, Arava; Baumel, Daniel; Kellerman, Efrat; Plotsky, Yoram; Noked Partouche, Oshrat; Elhalal, Gal; Ben-Shlomo, Izhar; Bercovich, Dani
2017-11-13
Sensitivity to macrocyclic lactones, which are commonly used in veterinary clinics, was first found in Rough Collies, and was attributed in 2001 to a 4 bp deletion in the MDR1 gene. The list of affected breeds currently includes 13 breeds. Researchers from different countries and continents examined the allelic frequencies of the nt230(del4) MDR1 mutation, emphasizing the clinical importance of this test not only to mutation-prone dogs, but also to their crosses and mongrels, since treatment of a deletion carrier with these compounds may lead to its death. In this study, the allelic frequencies of nt230(del4) MDR1 mutation in affected breeds, their crosses, unrelated pure breeds and mongrels are reported for the state of Israel (n = 1416 dogs). The Israeli data were compared with reports from the US, Europe, UK, Australia and Japan. The allelic frequencies of nt230(del4) MDR1 mutation in Israel for Australian, Swiss and German Shepherds (31%, 17% and 2.4%, respectively) are similar to the corresponding frequencies worldwide, much higher for Border Collies (4.8%), twice lower for Rough Collies (28%, compared to 55% or more elsewhere), and ~1% for mongrels. The frequencies for crosses of Australian Shepherd and Border Collies in Israel are 4 and 1.6 times lower, respectively, compared to the frequencies for the respective pure breeds. This work, that for the first time presents the frequency of nt230(del4) MDR1 mutation in Israel, along with a worldwide survey, has implications for clinicians, owners and breeders of sheepdogs and their crosses and supports the need for extra care in treatment and in future breeding. Of note, the relative proportion of affected breeds, in the overall tested dogs, might be higher than their actual proportion in Israel due to directed samples collection by veterinarians for clinical purposes, as these are mainly limited to certain affected breeds or dogs that resemble them.
Directory of Open Access Journals (Sweden)
Ting-Ting Song
Full Text Available Multidrug resistance (MDR confers agrochemical compatibility to fungal cells-based mycoinsecticdes but mechanisms involved in MDR remain poorly understood for entomopathogenic fungi, which have been widely applied as biocontrol agents against arthropod pests. Here we characterized the functions of five ATP-binding cassette (ABC transporters, which were classified to the subfamilies ABC-B (Mdr1, ABC-C (Mrp1 and ABC-G (Pdr1, Pdr2 and Pdr5 and selected from 54 full-size ABC proteins of Beauveria bassiana based on their main domain architecture, membrane topology and transcriptional responses to three antifungal inducers. Disruption of each transporter gene resulted in significant reduction in resistance to four to six of eight fungicides or antifungal drugs tested due to their differences in structure and function. Compared with wild-type and complemented (control strains, disruption mutants of all the five transporter genes became significantly less tolerant to the oxidants menadione and H₂O₂ based on 22-41% and 10-31% reductions of their effective concentrations required for the suppression of 50% colony growth at 25°C. Under a standardized spray, the killing actions of ΔPdr5 and ΔMrp1 mutants against Spodoptera litura second-instar larvae were delayed by 59% and 33% respectively. However, no significant virulence change was observed in three other delta mutants. Taken together, the examined five ABC transporters contribute differentially to not only the fungal MDR but antioxidant capability, a phenotype rarely associated with ABC efflux pumps in previous reports; at least some of them are required for the full virulence of B. bassiana, thereby affecting the fungal biocontrol potential. Our results indicate that ABC pump-dependent MDR mechanisms exist in entomopathogenic fungi as do in yeasts and human and plant pathogenic fungi.
International Nuclear Information System (INIS)
Shah, T.; Hayat, A.; Shah, Z.; Hayat, A.; Khan, S.B.
2017-01-01
Objective: To determine the drugs susceptibility pattern of mycobacterium tuberculosis (M.TB) in multi-drug resistant tuberculosis (MDR-TB) patients' attendants in North Western, Pakistan. Study Design: Cross sectional study. Place and Duration of Study: This study was conducted at Peshawar Tuberculosis Research Laboratory (PTRL), Provincial TB Control Program Hayatabad Medical Complex Peshawar, (KP) from August 2013 to March 2014. Material and Methods: A cross sectional study in which four hundred and eighty sputum samples from MDR-TB patients' attendants were processed for the detection of M.TB through Ziehl-Neelsen staining, Lowenstein-Jensen, BACTEC MGIT-960 culture and line probe assay. Results: Out of 480 samples, 06 (2.1%) were found positive for M.TB through Ziehl-Neelsen staining while 10 (2.8%) were positive through LJ and BACTEC MGIT-960 culture. The 10 positive samples were further subjected to drugs susceptibility testing and line probes assay test to find out rifampicin, isoniazid, streptomycin and ethambutol resistant and it was found that 6 M.TB isolates were resistant while 4 were sensitive to rifampicin and isoniazid. Among the 6 resistant M.TB strains, 4 showed mutation in rpoB gene at 531, 516 and 526 codons. Conclusion: Majority of MDR-TB patients' attendants had drug-resistant tuberculosis and the rate of drug susceptible TB was low. (author)
DEFF Research Database (Denmark)
Robey, R W; Medina-Pérez, W Y; Nishiyama, K
2001-01-01
We sought to characterize the interactions of flavopiridol with members of the ATP-binding cassette (ABC) transporter family. Cells overexpressing multidrug resistance-1 (MDR-1) and multidrug resistance-associated protein (MRP) did not exhibit appreciable flavopiridol resistance, whereas cell lines...... overexpressing the ABC half-transporter, ABCG2 (MXR/BCRP/ABCP1), were found to be resistant to flavopiridol. Flavopiridol at a concentration of 10 microM was able to prevent MRP-mediated calcein efflux, whereas Pgp-mediated transport of rhodamine 123 was unaffected at flavopiridol concentrations of up to 100...... analysis revealed overexpression of the ABCG2 gene. Western blot confirmed overexpression of ABCG2; neither P-glycoprotein nor MRP overexpression was detected. These results suggest that ABCG2 plays a role in resistance to flavopiridol....
Directory of Open Access Journals (Sweden)
Hui Li
Full Text Available Previous studies reported the associations between the ATP-binding cassette sub-family B member 1 (ABCB1, also known as MDR1 polymorphisms and their haplotypes with risk of response to antiepileptic drugs in epilepsy, however, the results were inconclusive.The Pubmed, Embase, Web of Science, CNKI and Chinese Biomedicine databases were searched up to July 15, 2014. Pooled odds ratios (ORs and 95% confidence intervals (CIs were calculated using a fixed-effects or random-effects model based on heterogeneity tests. Meta-regression and Galbraith plot analysis were carried out to explore the possible heterogeneity.A total of 57 studies involving 12407 patients (6083 drug-resistant and 6324 drug-responsive patients with epilepsy were included in the pooled-analysis. For all three polymorphisms (C3435T, G2677T/A, and C1236T, we observed a wide spectrum of minor allele frequencies across different ethnicities. A significantly decreased risk of AEDs resistance was observed in Caucasian patients with T allele of C3435T variant, which was still significant after adjusted by multiple testing corrections (T vs C: OR=0.83, 95%CI=0.71-0.96, p=0.01. However, no significant association was observed between the other two variants and AEDs resistance. Of their haplotypes in ABCB1 gene (all studies were in Indians and Asians, no significant association was observed with AEDs resistance. Moreover, sensitivity and Cumulative analysis showed that the results of this meta-analysis were stable.In summary, this meta-analysis demonstrated that effect of C3435T variant on risk of AEDs resistance was ethnicity-dependent, which was significant in Caucasians. Additionally, further studies in different ethnic groups are warranted to clarify possible roles of haplotypes in ABCB1 gene in AEDs resistance, especially in Caucasians.
Expression of the human multidrug transporter in insect cells by a recombinant baculovirus
International Nuclear Information System (INIS)
Germann, U.A.; Willingham, M.C.; Pastan, I.; Gottesman, M.M.
1990-01-01
The plasma membrane associated human multidrug resistance (MDR1) gene product, known as the 170-kDa P-glycoprotein or the multidrug transporter, acts as an ATP-dependent efflux pump for various cytotoxic agents. The authors expressed recombinant human multidrug transporter in a baculovirus expression system to obtain large quantities and further investigate its structure and mechanism of action. MDR1 cDNA was inserted into the genome of the Autographa californica nuclear polyhedrosis virus under the control of the polyhedrin promoter. Spodoptera frugiperda insect cells synthesized high levels of recombinant multidrug transporter 2-3 days after infection. The transporter was localized by immunocytochemical methods on the external surface of the plasma membranes, in the Golgi apparatus, and within the nuclear envelope. The human multidrug transporter expressed in insect cells is not susceptible to endoglycosidase F treatment and has a lower apparent molecular weight of 140,000, corresponding to the nonglycosylated precursor of its authentic counterpart expressed in multidrug-resistant cells. Labeling experiments showed that the recombinant multidrug transporter is phosphorylated and can be photoaffinity labeled by [ 3 H]azidopine, presumably at the same two sites as the native protein. Various drugs and reversing agents compete with the [ 3 H]azidopine binding reaction when added in excess, indicating that the recombinant human multidrug transporter expressed in insect cells is functionally similar to its authentic counterpart
PD173074, a selective FGFR inhibitor, reverses MRP7 (ABCC10-mediated MDR
Directory of Open Access Journals (Sweden)
Nagaraju Anreddy
2014-06-01
Full Text Available Multidrug resistance protein 7 (MRP7, ABCC10 is a recently identified member of the ATP-binding cassette (ABC transporter family, which adequately confers resistance to a diverse group of antineoplastic agents, including taxanes, vinca alkaloids and nucleoside analogs among others. Clinical studies indicate an increased MRP7 expression in non-small cell lung carcinomas (NSCLC compared to a normal healthy lung tissue. Recent studies revealed increased paclitaxel sensitivity in the Mrp7−/− mouse model compared to their wild-type counterparts. This demonstrates that MRP7 is a key contributor in developing drug resistance. Recently our group reported that PD173074, a specific fibroblast growth factor receptor (FGFR inhibitor, could significantly reverse P-glycoprotein-mediated MDR. However, whether PD173074 can interact with and inhibit other MRP members is unknown. In the present study, we investigated the ability of PD173074 to reverse MRP7-mediated MDR. We found that PD173074, at non-toxic concentration, could significantly increase the cellular sensitivity to MRP7 substrates. Mechanistic studies indicated that PD173074 (1 μmol/L significantly increased the intracellular accumulation and in-turn decreased the efflux of paclitaxel by inhibiting the transport activity without altering expression levels of the MRP7 protein, thereby representing a promising therapeutic agent in the clinical treatment of chemoresistant cancer patients.
Rijpma, Sanna R; van der Velden, Maarten; Annoura, Takeshi; Matz, Joachim M; Kenthirapalan, Sanketha; Kooij, Taco W A; Matuschewski, Kai; van Gemert, Geert-Jan; van de Vegte-Bolmer, Marga; Siebelink-Stoter, Rianne; Graumans, Wouter; Ramesar, Jai; Klop, Onny; Russel, Frans G M; Sauerwein, Robert W; Janse, Chris J; Franke-Fayard, Blandine M; Koenderink, Jan B
2016-07-01
Multidrug resistance (MDR) proteins belong to the B subfamily of the ATP Binding Cassette (ABC) transporters, which export a wide range of compounds including pharmaceuticals. In this study, we used reverse genetics to study the role of all seven Plasmodium MDR proteins during the life cycle of malaria parasites. Four P. berghei genes (encoding MDR1, 4, 6 and 7) were refractory to deletion, indicating a vital role during blood stage multiplication and validating them as potential targets for antimalarial drugs. Mutants lacking expression of MDR2, MDR3 and MDR5 were generated in both P. berghei and P. falciparum, indicating a dispensable role for blood stage development. Whereas P. berghei mutants lacking MDR3 and MDR5 had a reduced blood stage multiplication in vivo, blood stage growth of P. falciparum mutants in vitro was not significantly different. Oocyst maturation and sporozoite formation in Plasmodium mutants lacking MDR2 or MDR5 was reduced. Sporozoites of these P. berghei mutants were capable of infecting mice and life cycle completion, indicating the absence of vital roles during liver stage development. Our results demonstrate vital and dispensable roles of MDR proteins during blood stages and an important function in sporogony for MDR2 and MDR5 in both Plasmodium species. © 2016 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Mohd Zakihalani A. Halim
2016-03-01
Full Text Available Here, we report the draft genome sequence and annotation of a multidrug resistant Mycobacterium tuberculosis strain PR10 (MDR-TB PR10 isolated from a patient diagnosed with tuberculosis. The size of the draft genome MDR-TB PR10 is 4.34 Mbp with 65.6% of G + C content and consists of 4637 predicted genes. The determinants were categorized by RAST into 400 subsystems with 4286 coding sequences and 50 RNAs. The whole genome shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession number CP010968. Keywords: Mycobacterium tuberculosis, Genome, MDR, Extrapulmonary
Nasilowska-Adamska, Barbara; Solarska, Iwona; Paluszewska, Monika; Malinowska, Iwona; Jedrzejczak, Wieslaw W; Warzocha, Krzysztof
2014-04-01
Fms-like tyrosine kinase 3-internal tandem duplication (FLT3-ITD) and mixed-lineage leukemia gene-partial tandem duplication (MLL-PTD) are aberrations associated with leukemia which indicate unsatisfactory prognosis. Downstream regulatory targets of FLT3-ITD and MLL-PTD are not well defined. We have analyzed the expression of MDR-1, multidrug resistant protein-1 (MRP-1), breast cancer resistance protein (BCRP), and lung resistance protein (LRP) messenger RNA (mRNA) in relation to the mutational status of FLT3-ITD and MLL-PTD in 185 acute myeloid leukemia (AML) adult patients. The real-time quantitative polymerase chain reaction method was performed to assess the expression of the MDR-1, MRP-1, BCRP, and LRP mRNA, and the results were presented as coefficients calculated using an intermediate method according to Pfaffl's rule. Significantly higher expressions of MDR-1 mRNA were found in patients who did not harbor FLT3-ITD (0.20 vs. 0.05; p = 0.0001) and MRP-1 mRNA in patients with this mutation (0.96 vs. 0.70; p = 0.002) and of BCRP mRNA in patients with MLL-PTD (0.61 vs. 0.38; p = 0.03). In univariate analysis, the high expression of MDR-1 mRNA (≥0.1317) negatively influenced the outcome of induction therapy (p = 0.05), whereas the high expression of BCRP mRNA (≥1.1487) was associated with a high relapse rate (RR) (p = 0.013). We found that the high expression of MDR-1 (≥0.1317), MRP-1 (≥0.8409), and BCRP mRNA (≥1.1487) significantly influenced disease-free survival (DFS; p = 0.059, 0.032, and 0.009, respectively) and overall survival (0.048, 0.014, and 0.059, respectively). Moreover, a high expression of BCRP mRNA (≥1.1487) proved to be an independent prognostic factor for RR (p = 0.01) and DFS (p = 0.002) in multivariate analysis. The significant correlation between the expression of MDR-1, MRP-1, and BCRP mRNA and FLT3-ITD or MLL-PTD in AML patients requires further investigation.
International Nuclear Information System (INIS)
Wang Ruoyu; Wang Hui; Fan Kai; Lv Shen
2007-01-01
Objective: To mimick a clinical fractionated protocol of exposure to X-radiation in vitro in order to investigate the changes in the function of MDR1 and P-gp in nasopharyngeal carcinoma (NPC) CNE cell before and after irradiation to determine the sequential order of radiotherapy and chemotherapy or the time of chemotherapy after radiotherapy in the treatment of NPC. Methods: Exponentially growing CNE cells were treated with fractionated X-radiation with total dose of 10 Gy (2 Gy per day for 5 days consecutively) in vitro. The expression of MDR1 gene was examined in CNE cells before irradiation and on days 4,8,13,17 and 21 after irradiation by RT-PCR, and its protein P-gp were detected by immunocytochemistry. The function of multidrug resistance protein P-gp was examined by MTT method. Results: Expression of MDR1 gene was below the level of detection before irradiation. Irradiation induced an overexpression of MDR1 gene on day 4, expression of MDR1 was decreased from day 8 to day 21. The overall expression of MDR1 was significantly more than that before irradiation (P<0.05) Expression of P-gp was below the level of detection before irradiation, which demonstrated that irradiation induced an overexpression of P-gp. This overexpression was increased from day 8 to day 21. The overpression of MDR1 gene was maintained dining a short period, however, the emergence of overpression of protein P-gp was later than that of MDR1 gene. Resistance index was 1 for both pre-irradiation and on day 8, and up to 8,10,11.2 on days 13, 17 and 21, respectively. The change of resistance index was accordant with the condition of overexpression of P-gp . Conclusions: Expression of P-gp in nasopharyngeal carcinoma (NPC) CNE cell was below the level of detection before irradiation. Irradiation can induce an overexpression of MDR1 gene and its protein P-gp in CNE cells. The overexpression of MDR1 gene and its protein P-gp lasted a long term. (authors)
Vidgren, Virve; Huuskonen, Anne; Virtanen, Hannele; Ruohonen, Laura; Londesborough, John
2009-04-01
The use of more concentrated, so-called high-gravity and very-high-gravity (VHG) brewer's worts for the manufacture of beer has economic and environmental advantages. However, many current strains of brewer's yeasts ferment VHG worts slowly and incompletely, leaving undesirably large amounts of maltose and especially maltotriose in the final beers. alpha-Glucosides are transported into Saccharomyces yeasts by several transporters, including Agt1, which is a good carrier of both maltose and maltotriose. The AGT1 genes of brewer's ale yeast strains encode functional transporters, but the AGT1 genes of the lager strains studied contain a premature stop codon and do not encode functional transporters. In the present work, one or more copies of the AGT1 gene of a lager strain were repaired with DNA sequence from an ale strain and put under the control of a constitutive promoter. Compared to the untransformed strain, the transformants with repaired AGT1 had higher maltose transport activity, especially after growth on glucose (which represses endogenous alpha-glucoside transporter genes) and higher ratios of maltotriose transport activity to maltose transport activity. They fermented VHG (24 degrees Plato) wort faster and more completely, producing beers containing more ethanol and less residual maltose and maltotriose. The growth and sedimentation behaviors of the transformants were similar to those of the untransformed strain, as were the profiles of yeast-derived volatile aroma compounds in the beers.
Lu, Y P; Li, Z S; Rea, P A
1997-07-22
Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.
Ferreira, Pedro Eduardo; Veiga, Maria Isabel; Cavaco, Isa; Martins, J Paulo; Andersson, Björn; Mushin, Shaliya; Ali, Abullah S; Bhattarai, Achuyt; Ribeiro, Vera; Björkman, Anders; Gil, José Pedro
2008-02-01
Artemisinin-based combination therapy is a main strategy for malaria control in Africa. Zanzibar introduced this new treatment policy in 2003. The authors have studied the prevalence of a number of functional single nucleotide polymorphisms (SNPs) in genes associated with the elimination of the artemisinin-based combination therapy compounds in use in Zanzibar to investigate the frequencies of subgroups potentially at higher drug exposure and therefore possible higher risk of toxicity. One hundred three unrelated children with uncomplicated malaria from the Unguja and Pemba islands of Zanzibar were enrolled. With use of polymerase chain reaction (PCR)-restriction fragment length polymorphism and real-time PCR-based allele discrimination methods, the CYP2B6 (G15631T), CYP3A4 (A-392G), CYP3A5 (A6986G, G14690A, 27131-132 insT, C3699T) SNPs and MDR1 SNPs C3435T, G2677T/A, and T-129C were analyzed. PCR product sequencing was applied to regulatory regions of MDR1, the CYP3A4 proximal promoter, and to exons 2 and 5 of PXR, a gene coding for a nuclear factor activated by artemisinin antimalarials and associated with the transcription induction of most of the studied genes. Homozygous subjects for alleles coding for low activity proteins were found at the following frequencies: 1) MDR1: 2.9%; 2) CYP2B6: 9.7%; 3) CYP3A5: 14.1%; and 4) CYP3A4: 49.5%. No functionally relevant allele was found in the analyzed regions of PXR. A new MDR1 SNP was found (T-158C), located in a putative antigen recognition element. Ten (10.1%) subjects were predicted to be low metabolizers simultaneously for CYP3A4 and CYP3A5. This fraction of the population is suggested to be under higher exposure to certain antimalarials, including lumefantrine and quinine.
Kikuta, Shingo; Kikawada, Takahiro; Hagiwara-Komoda, Yuka; Nakashima, Nobuhiko; Noda, Hiroaki
2010-11-01
The brown planthopper (BPH), Nilaparvata lugens, attacks rice plants and feeds on their phloem sap, which contains large amounts of sugars. The main sugar component of phloem sap is sucrose, a disaccharide composed of glucose and fructose. Sugars appear to be incorporated into the planthopper body by sugar transporters in the midgut. A total of 93 expressed sequence tags (ESTs) for putative sugar transporters were obtained from a BPH EST database, and 18 putative sugar transporter genes (Nlst1-18) were identified. The most abundantly expressed of these genes was Nlst1. This gene has previously been identified in the BPH as the glucose transporter gene NlHT1, which belongs to the major facilitator superfamily. Nlst1, 4, 6, 9, 12, 16, and 18 were highly expressed in the midgut, and Nlst2, 7, 8, 10, 15, 17, and 18 were highly expressed during the embryonic stages. Functional analyses were performed using Xenopus oocytes expressing NlST1 or 6. This showed that NlST6 is a facilitative glucose/fructose transporter that mediates sugar uptake from rice phloem sap in the BPH midgut in a manner similar to NlST1. Copyright © 2010 Elsevier Ltd. All rights reserved.
ECG-triggered MDR-CT for the detection of pulmonary metastases
International Nuclear Information System (INIS)
Pauls, S.; Wahl, J.; Aschoff, A.J.; Brambs, H.J.; Fleiter, T.R.
2003-01-01
Purpose: Comparison of multidetector-row CT (MDR-CT) of the chest with and without ECG triggering for the detection of pulmonary metastases. Materials and Methods: Fifty patients with malignant tumors underwent CT of the chest. The unenhanced phase was performed with ECG-triggered MDR-CT and the contrast-enhanced phase with helical MDR-CT. The ECG-triggered and standard helical scans were interpreted in separate sessions, with the analysis determining the number and demarcation of the intrapulmonary nodules and the delineation of the mediastinal structure (rated 1 = excellent to 5 = poor). Results: ECG-MDR-CT images detected 38% more pulmonary nodules than MDR-CT. The detection rate for tumors [de
DEFF Research Database (Denmark)
Bramow, S; Ott, P; Thomsen Nielsen, F
2001-01-01
then analysed as were hepatic mRNA levels of canalicular transport proteins (Mrp2, Bsep, Mdr1b and Mdr2), sinusoidal transport proteins (Ntcp, Oatp1 and Oatp2), GSH related enzymes (gamma-glutamylcysteine synthetase light (GCSlc) and heavy (GCShc) chain subunits and glutathione-S-transferase) and CYPs (CYP3A9...... secondary to cyclosporine A could be related to reduction in mRNA expression of GSH synthesising enzymes and Mrp2, leading to reduced protection against oxidative stress and reduced bile acid-independent bile flow. After sirolimus treatment, Mrp2 mRNA was also reduced together with reduced levels of most...... CYPs and increased Oatp2, possibly leading to accumulation of toxic metabolites in the hepatocytes. The enhanced cholestatic effect of the combination treatment could be related to reduced GSH synthesising enzymes and even more pronounced reduction in Mrp2 mRNA and increase of Oatp2 mRNA....
Zhao, Xu; Qin, Shengying; Shi, Yongyong; Zhang, Aiping; Zhang, Jing; Bian, Li; Wan, Chunling; Feng, Guoyin; Gu, Niufan; Zhang, Guangqi; He, Guang; He, Lin
2007-07-01
Several studies have suggested the dysfunction of the GABAergic system as a risk factor in the pathogenesis of schizophrenia. In the present study, case-control association analysis was conducted in four GABAergic genes: two glutamic acid decarboxylase genes (GAD1 and GAD2), a GABA(A) receptor subunit beta2 gene (GABRB2) and a GABA(B) receptor 1 gene (GABBR1). Using a universal DNA microarray procedure we genotyped a total of 20 SNPs on the above four genes in a study involving 292 patients and 286 controls of Chinese descent. Statistically significant differences were observed in the allelic frequencies of the rs187269C/T polymorphism in the GABRB2 gene (P=0.0450, chi(2)=12.40, OR=1.65) and the -292A/C polymorphism in the GAD1 gene (P=0.0450, chi(2)=14.64 OR=1.77). In addition, using an electrophoretic mobility shift assay (EMSA), we discovered differences in the U251 nuclear protein binding to oligonucleotides representing the -292 SNP on the GAD1 gene, which suggests that the -292C allele has reduced transcription factor binding efficiency compared with the 292A allele. Using the multifactor-dimensionality reduction method (MDR), we found that the interactions among the rs187269C/T polymorphism in the GABRB2 gene, the -243A/G polymorphism in the GAD2 gene and the 27379C/T and 661C/T polymorphisms in the GAD1 gene revealed a significant association with schizophrenia (Pschizophrenia in the Chinese population.
Chen, R.; Hilson, P.; Sedbrook, J.; Rosen, E.; Caspar, T.; Masson, P. H.
1998-01-01
Auxins are plant hormones that mediate many aspects of plant growth and development. In higher plants, auxins are polarly transported from sites of synthesis in the shoot apex to their sites of action in the basal regions of shoots and in roots. Polar auxin transport is an important aspect of auxin functions and is mediated by cellular influx and efflux carriers. Little is known about the molecular identity of its regulatory component, the efflux carrier [Estelle, M. (1996) Current Biol. 6, 1589-1591]. Here we show that mutations in the Arabidopsis thaliana AGRAVITROPIC 1 (AGR1) gene involved in root gravitropism confer increased root-growth sensitivity to auxin and decreased sensitivity to ethylene and an auxin transport inhibitor, and cause retention of exogenously added auxin in root tip cells. We used positional cloning to show that AGR1 encodes a putative transmembrane protein whose amino acid sequence shares homologies with bacterial transporters. When expressed in Saccharomyces cerevisiae, AGR1 promotes an increased efflux of radiolabeled IAA from the cells and confers increased resistance to fluoro-IAA, a toxic IAA-derived compound. AGR1 transcripts were localized to the root distal elongation zone, a region undergoing a curvature response upon gravistimulation. We have identified several AGR1-related genes in Arabidopsis, suggesting a global role of this gene family in the control of auxin-regulated growth and developmental processes.
Experience with LDR and MDR brachytherapy for cervical cancer
International Nuclear Information System (INIS)
Okawa, Tomohiko; Okawa, Midori-Kita; Kaneyasu, Yuko; Karasawa, Kumiko; Fukuhara, Noboru
1996-01-01
As the brachytherapy dose-rate increases, it is necessary to reduce the total dose or to increase the fraction number with reducing the fraction dose in order not to increase the incidence of the late effect. With the introduction to the Tokyo Women's Medical College, Hospital of a remote afterloading system of Selectron - MDR, delivering dose-rate to point A became approximately twice of that with our classical cesium LDR manual afterloading technique. Material and Methods: Between 1987 to 1993 a total of, previously untreated 74 patients with cervical cancer received MDR brachytherapy using a Selection - MDR. This analysis is therefore of those patients series who underwent radical radioradiotherapy with MDR, 1987-1993, in comparison with the 347 cases who were treated with classical manual LDR afterloading machine, 1969-1986. The treatment was a brachytherapy during external radiotherapy and dos-rate at point A was 160-180 cGy/hour with MDR and 80-90 cGy/hour with LDR. The mean fraction dose was 800-1000 cGy by MDR and 1000-1200 cGy by LDR and fraction number was increased 1-2times in the MDR group with no change of a total dose at point A. Results: The mean age was 63.3 years in the MDR group and 60.2 in the LDR group. In the MDR group, 4 patients were at stage I, 16 stage II, 32 stage III, and 22 stage IV. In the LDR group, 32 were at stage I, 83 stage II, 183 stage III, and 49 stage IV. The medical rate was not significantly different between two groups. The tumor response by manual examination one month after radiotherapy showed no significant difference. The 5-year survival rate for the MDR and LDR groups were 100% : 78% at stage I, 61% : 71% at stage II and 52% : 53% at stage III, with no significant differences. Late complications by severity with grade II-III according to Kottureire's classification were not significantly different in the rectum or bladder. These results suggested that MDR brachytherapy was useful for the patients' QOL as it reduced the
Rupasree, Yedluri; Naushad, Shaik Mohammad; Varshaa, Ravi; Mahalakshmi, Govindaraj Swathika; Kumaraswami, Konda; Rajasekhar, Liza; Kutala, Vijay Kumar
2016-02-01
In view of our previous studies showing an independent association of genetic polymorphisms in folate, xenobiotic, and toll-like receptor (TLR) pathways with the risk for systemic lupus erythematosus (SLE), we have developed three statistical models to delineate complex gene-gene interactions between folate, xenobiotic, TLR, and signal transducer and activator of transcription 4 (STAT4) signaling pathways in association with the molecular pathophysiology of SLE. We developed additive, multifactor dimensionality reduction (MDR), and artificial neural network (ANN) models. The additive model, although the simplest, suggested a moderate predictability of 30 polymorphisms of these four pathways (area under the curve [AUC] 0.66). MDR analysis revealed significant gene-gene interactions among glutathione-S-transferase (GST)T1 and STAT4 (rs3821236 and rs7574865) polymorphisms, which account for moderate predictability of SLE. The MDR model for specific auto-antibodies revealed the importance of gene-gene interactions among cytochrome P450, family1, subfamily A, polypeptide 1 (CYP1A1) m1, catechol-O-methyltransferase (COMT) H108L, solute carrier family 19 (folate transporter), member 1 (SLC19A1) G80A, estrogen receptor 1 (ESR1), TLR5, 5-methyltetrahydrofolate-homocysteine methyltransferase reductase (MTRR), thymidylate synthase (TYMS). and STAT4 polymorphisms. The ANN model for disease prediction showed reasonably good predictability of SLE risk with 30 polymorphisms (AUC 0.76). These polymorphisms contribute towards the production of SSB and anti-dsDNA antibodies to the extent of 48 and 40%, respectively, while their contribution for the production of antiRNP, SSA, and anti-cardiolipin antibodies varies between 20 and 30%. The current study highlighted the importance of genetic polymorphisms in folate, xenobiotic, TLR, and STAT4 signaling pathways as moderate predictors of SLE risk and delineates the molecular pathophysiology associated with these single nucleotide
Zhang, Xuejun C; Liu, Min; Lu, Guangyuan; Heng, Jie
2018-03-01
Multidrug resistance (MDR) presents a growing challenge to global public health. Drug extrusion transporters play a critical part in MDR; thus, their mechanisms of substrate recognition are being studied in great detail. In this work, we review common structural features of key transporters involved in MDR. Based on our membrane potential-driving hypothesis, we propose a general energy-coupling mechanism for secondary-active antiporters. This putative mechanism provides a common framework for understanding poly-specificity of most-if not all-MDR transporters. © 2017 The Protein Society.
Aleo, Michael D; Shah, Falgun; He, Kan; Bonin, Paul D; Rodrigues, A David
2017-05-15
The role of bile salt export protein (BSEP) inhibition in drug-induced liver injury (DILI) has been investigated widely, while inhibition of the canalicular multidrug resistant protein 3 (MDR3) has received less attention. This transporter plays a pivotal role in secretion of phospholipids into bile and functions coordinately with BSEP to mediate the formation of bile acid-containing biliary micelles. Therefore, inhibition of MDR3 in human hepatocytes was examined across 125 drugs (70 of Most-DILI-concern and 55 of No-DILI-concern). Of these tested, 41% of Most-DILI-concern and 47% of No-DILI-concern drugs had MDR3 IC 50 values of <50 μM. A better distinction across DILI classifications occurred when systemic exposure was considered where safety margins of 50-fold had low sensitivity (0.29), but high specificity (0.96). Analysis of physical chemical property space showed that basic compounds were twice as likely to be MDR3 inhibitors as acids, neutrals, and zwitterions and that inhibitors were more likely to have polar surface area (PSA) values of <100 Å 2 and cPFLogD values between 1.5 and 5. These descriptors, with different cutoffs, also highlighted a group of compounds that shared dual potency as MDR3 and BSEP inhibitors. Nine drugs classified as Most-DILI-concern compounds (four withdrawn, four boxed warning, and one liver injury warning in their approved label) had intrinsic potency features of <20 μM in both assays, thereby reinforcing the notion that multiple inhibitory mechanisms governing bile formation (bile acid and phospholipid efflux) may confer additional risk factors that play into more severe forms of DILI as shown by others for BSEP inhibitors combined with multidrug resistance-associated protein (MRP2, MRP3, MRP4) inhibitory properties. Avoiding physical property descriptors that highlight dual BSEP and MDR3 inhibition or testing drug candidates for inhibition of multiple efflux transporters (e.g., BSEP, MDR3, and MRPs) may be an effective
Shao, Jing; Zhang, MengXiang; Wang, TianMing; Li, Yue; Wang, ChangZhong
2016-01-01
Fungal infections caused by fluconazole-resistant Candida albicans are an intractable clinical problem, calling for new efficient antifungal drugs. Kaempferol, an active flavonoid, has been considered a potential candidate against Candida species. This work investigates the resistance reversion of kaempferol in fluconazole-resistant C. albicans and the underlying mechanism. The antifungal activities of fluconazole and/or kaempferol were assessed by a series of standard procedures including broth microdilution method, checkerboard assay and time-kill (T-K) test in nine clinical strains as well as a standard reference isolate of C. albicans. Subsequently, the morphological changes, the efflux of rhodamine 6G, and the expressions of CDR 1, CDR 2, and MDR 1 were analysed by scanning electron microscope (SEM), inverted fluorescence microscope and quantitative reverse transcription polymerase chain reaction (qRT-PCR) in C. albicans z2003. For all the tested C. albicans strains, the minimum inhibitory concentrations (MICs) of fluconazole and kaempferol ranged 0.25-32 and 128-256 μg/mL with a range of fractional inhibitory concentration index of 0.257-0.531. In C. albicans z2003, the expression of both CDR 1 and CDR 2 were decreased after exposure to kaempferol alone with negligible rhodamine 6G accumulation, while the expression of CDR 1, CDR 2 and MDR 1 were all decreased when fluconazole and kaempferol were used concomitantly with notable fluorescence of rhodamine 6G observed. Kaempferol-induced reversion in fluconazole-resistant C. albicans might be likely due to the suppression of the expression of CDR1, CDR2 and MDR1.
Shiokawa, Zenyu; Hashimoto, Kentaro; Saito, Bunnai; Oguro, Yuya; Sumi, Hiroyuki; Yabuki, Masato; Yoshimatsu, Mie; Kosugi, Yohei; Debori, Yasuyuki; Morishita, Nao; Dougan, Douglas R; Snell, Gyorgy P; Yoshida, Sei; Ishikawa, Tomoyasu
2013-12-15
We previously reported octahydropyrrolo[1,2-a]pyrazine derivative 2 (T-3256336) as a potent antagonist for inhibitors of apoptosis (IAP) proteins. Because compound 2 was susceptible to MDR1 mediated efflux, we developed another scaffold, hexahydropyrazino[1,2-a]indole, using structure-based drug design. The fused benzene ring of this scaffold was aimed at increasing the lipophilicity and decreasing the basicity of the scaffold to improve the membrane permeability across MDR1 expressing cells. We established a chiral pool synthetic route to yield the desired tricyclic chiral isomers. Chemical modification of the core scaffold led to a representative compound 50, which showed strong inhibition of IAP binding (X chromosome-linked IAP [XIAP]: IC50 23 nM and cellular IAP [cIAP]: IC50 1.1 nM) and cell growth inhibition (MDA-MB-231 cells: GI50 2.8 nM) with high permeability and low potential of MDR1 substrate. Copyright © 2013 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Schneider, José; Gonzalez-Roces, Severino; Pollán, Marina; Lucas, Raul; Tejerina, Armando; Martin, Miguel; Alba, Alfonso
2001-01-01
Axillary node status after induction chemotherapy for locally advanced breast cancer has been shown on multivariate analysis to be an independent predictor of relapse. However, it has been postulated that responders to induction chemotherapy with a clinically negative axilla could be spared the burden of lymphadenectomy, because most of them will not show histological nodal invasion. P-glycoprotein expression in the rescue mastectomy specimen has finally been identified as a significant predictor of patient survival. We studied the expression of the genes encoding multidrug resistance associated protein (MDR1) and lung cancer associated resistance protein (LRP) in formalin-fixed, paraffin-embedded tumor samples from 52 patients treated for locally advanced breast cancer by means of induction chemotherapy followed by rescue mastectomy. P-glycoprotein expression was assessed by means of immunohistochemistry before treatment in 23 cases, and by means of reverse-transcriptase-mediated polymerase chain reaction (RT-PCR) after treatment in 46 (6 failed). LRP expression was detected by means of immunohistochemistry, with the LRP-56 monoclonal antibody, in 31 cases before treatment. Immunohistochemistry for detecting the expression of c-erb-B2, p53, Ki67, estrogen receptor and progesterone receptor are routinely performed in our laboratory in every case, and the results obtained were included in the study. All patients had received between two and six cycles of standard 5-fluorouracil, doxorubicin and cyclophosphamide (FAC) chemotherapy, with two exceptions [one patient received four cycles of a docetaxel-adriamycin combination, and the other four cycles of standard cyclophosphamide-methotrexate-5-fluorouracil (CMF) polychemotherapy]. Response was assessed in accordance with the Response Evaluation Criteria In Solid Tumors (RECIST). By these, 2 patients achieved a complete clinical response, 37 a partial response, and the remaining 13 showed stable disease. This makes a
Girlich, Delphine; Dortet, Laurent; Poirel, Laurent; Nordmann, Patrice
2015-01-01
To decipher the mechanisms and their associated genetic determinants responsible for β-lactam resistance in a Proteus mirabilis clinical isolate. The entire genetic structure surrounding the β-lactam resistance genes was characterized by PCR, gene walking and DNA sequencing. Genes encoding the carbapenemase NDM-1 and the ESBL VEB-6 were located in a 38.5 kb MDR structure, which itself was inserted into a new variant of the Proteus genomic island 1 (PGI1). This new PGI1-PmPEL variant of 64.4 kb was chromosomally located, as an external circular form in the P. mirabilis isolate, suggesting potential mobility. This is the first known description of the bla(NDM-1) gene in a genomic island structure, which might further enhance the spread of the bla(NDM-1) carbapenemase gene among enteric pathogens. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Mouse ATP-Binding Cassette (ABC) Transporters Conferring Multi-Drug Resistance
Shuaizhang, L I; Zhang, Wen; Yin, Xuejiao; Xing, Shilai; Xie, Qunhui; Cao, Zhengyu; Zhao, Bin
2015-04-28
The ABC (ATP-binding cassette) transporter is one of the largest and most ancient protein families with members functioning from protozoa to human. The resistance of cancer and tumor cells to anticancer drugs is due to the over-expression of some ABC transporters, which may finally lead to chemotherapy failure. The mouse ABC transporters are classified into seven subfamilies by phylogenetic analysis. The mouse ABC transporter gene, alias, chromosomal location and function have been determined. Within the ABC super-family, the MDR transporters (Abcb1, Abcc1, Abcg2) in mouse models have been proved to be valuable to investigate the biochemistry and physiological functions. This review concentrates on the multidrug resistance of mouse ABC transporters in cancer and tumor cells.
Aly, M M; Abu Alsoud, N M; Elrobh, M S; Al Johani, S M; Balkhy, H H
2016-11-01
The prevalence of carbapenem-resistant Acinetobacter baumannii in Saudi Arabia and their resistance genetic mechanisms are yet to be identified. We studied the prevalence and genetic diversity of extended-spectrum beta-lactamase genes, particularly the PER-1 gene, among carbapenem-resistant A. baumannii strains from patients at a tertiary care hospital in Riyadh, Saudi Arabia between 2006 and 2014. Fresh subcultured samples were tested for antimicrobial susceptibility minimum inhibitory concentration (MIC). Total genomic DNA was extracted from each isolate and further used for polymerase chain reaction (PCR) genotyping, sequence-based typing (SBT) of PER-1 and OXA-51-like gene, and multilocus sequence typing (MLST) of positive isolates. Randomly selected clinical isolates (n = 100) were subjected to MLST. A total of 503 isolates were characterized as multidrug-resistant (MDR) using the MIC. Isolates were further PCR tested for bla -TEM and bla -PER-1 resistance genes (n = 503). The genotyping results showed that 68/503 (14 %) isolates were positive to bla TEM. The genotyping results of PER-1-like genes showed that 384/503 (76.3 %) were positive among MDR Acinetobacter isolates. Based on SBT, the majority of these isolates were clustered into three main groups including isolates harboring PER-1: AB11 (bla -PER-1 ), isolate AB16 (bla -PER-1 ), and, finally, the plasmid pAB154 (bla -PER-7 ). Remarkably, many isolates were concealing the PER-1 gene and harboring the TEM resistance genes as well. MLST results for selected isolates (n = 100) identified four main sequence types (STs: 2, 19, 20, and 25) and four novel isolates (ST 486-489). We report 76.3 % prevalence of the PER-1 resistance gene among Acinetobacter clinical isolates from Riyadh, Saudi Arabia. Further work is needed to explore the clinical risks and patient outcome with such resistance related to healthcare-associated infections and investigate the genetic and molecular mechanisms that confer the MDR
Treatment outcomes of MDR-tuberculosis patients in Brazil: a retrospective cohort analysis
Directory of Open Access Journals (Sweden)
Mayara Lisboa Bastos
2017-11-01
Full Text Available Abstract Background Multidrug-resistant tuberculosis (MDR-TB is a threat for the global TB epidemic control. Despite existing evidence that individualized treatment of MDR-TB is superior to standardized regimens, the latter are recommended in Brazil, mainly because drug-susceptibility tests (DST are often restricted to first-line drugs in public laboratories. We compared treatment outcomes of MDR-TB patients using standardized versus individualized regimens in Brazil, a high TB-burden, low resistance setting. Methods The 2007–2013 cohort of the national electronic database (SITE-TB, which records all special treatments including drug-resistance, was analysed. Patients classified as MDR-TB in SITE-TB were eligible. Treatment outcomes were classified as successful (cure/treatment completed or unsuccessful (failure/relapse/death/loss to follow-up. The odds for successful treatment according to type of regimen were controlled for demographic and clinical variables. Results Out of 4029 registered patients, we included 1972 recorded from 2010 to 2012, who had more complete outcome data. The overall success proportion was 60%. Success was more likely in non-HIV patients, sputum-negative at baseline, with unilateral disease and without prior DR-TB. Adjusted for these variables, those receiving standardized regimens had 2.7-fold odds of success compared to those receiving individualized treatments when failure/relapse were considered, and 1.4-fold odds of success when death was included as an unsuccessful outcome. When loss to follow-up was added, no difference between types of treatment was observed. Patients who used levofloxacin instead of ofloxacin had 1.5-fold odds of success. Conclusion In this large cohort of MDR-TB patients with a low proportion of successful outcomes, standardized regimens had superior efficacy than individualized regimens, when adjusted for relevant variables. In addition to the limitations of any retrospective observational
Human proton/oligopeptide transporter (POT) genes
DEFF Research Database (Denmark)
Botka, C. W.; Wittig, T. W.; Graul, R. C.
2000-01-01
The proton-dependent oligopeptide transporters (POT) gene family currently consists of approximately 70 cloned cDNAs derived from diverse organisms. In mammals, two genes encoding peptide transporters, PepT1 and PepT2 have been cloned in several species including humans, in addition to a rat...... histidine/peptide transporter (rPHT1). Because the Candida elegans genome contains five putative POT genes, we searched the available protein and nucleic acid databases for additional mammalian/human POT genes, using iterative BLAST runs and the human expressed sequence tags (EST) database. The apparent...... and introns of the likely human orthologue (termed hPHT2). Northern analyses with EST clones indicated that hPHT1 is primarily expressed in skeletal muscle and spleen, whereas hPHT2 is found in spleen, placenta, lung, leukocytes, and heart. These results suggest considerable complexity of the human POT gene...
DEFF Research Database (Denmark)
Brodin, Birger; Ozgür, Burak; Saaby, Lasse
that new API's are evaluated with respect to P-gp interactions. Aim : The aim of the present work was to validate the suitability of the newly developed iP-gp cell line for investigating P-gp interactions with human P-gp. Methods: IPEC-J2 MDR1 (iP-gp) cells were cultured on permeable supports for 17......Background : The efflux transporter P-glycoprotein (P-gp, product of the MDR1/ABCB1 gene) hinders uptake of drug compounds to the brain, limits intestinal uptake, is a cause of resistance to chemoterapeutics and a potential "site" for drug-drug interaction. Regulatory agencies therefore recommend.......04 +/- 0.01 µM in transport experiments including digoxin and rhodamine 123, respectively. Summary/Conclusion : The iP-gp cell line may become a useful screening tool for interactions between drug compounds and human P-gp....
Directory of Open Access Journals (Sweden)
Raj N Yadav
Full Text Available The objectives of the study were to compare the performance of line probe assay (GenoType MTBDRplus with solid culture method for an early diagnosis of multidrug resistant tuberculosis (MDR-TB, and to study the mutation patterns associated with rpoB, katG and inhA genes at a tertiary care centre in north India.In this cross-sectional study, 269 previously treated sputum-smear acid-fast bacilli (AFB positive MDR-TB suspects were enrolled from January to September 2012 at the All India Institute of Medical Sciences hospital, New Delhi. Line probe assay (LPA was performed directly on the sputum specimens and the results were compared with that of conventional drug susceptibility testing (DST on solid media [Lowenstein Jensen (LJ method].DST results by LPA and LJ methods were compared in 242 MDR-TB suspects. The LPA detected rifampicin (RIF resistance in 70 of 71 cases, isoniazid (INH resistance in 86 of 93 cases, and MDR-TB in 66 of 68 cases as compared to the conventional method. Overall (rifampicin, isoniazid and MDR-TB concordance of the LPA with the conventional DST was 96%. Sensitivity and specificity were 98% and 99% respectively for detection of RIF resistance; 92% and 99% respectively for detection of INH resistance; 97% and 100% respectively for detection of MDR-TB. Frequencies of katG gene, inhA gene and combined katG and inhA gene mutations conferring all INH resistance were 72/87 (83%, 10/87 (11% and 5/87 (6% respectively. The turnaround time of the LPA test was 48 hours.The LPA test provides an early diagnosis of monoresistance to isoniazid and rifampicin and is highly sensitive and specific for an early diagnosis of MDR-TB. Based on these findings, it is concluded that the LPA test can be useful in early diagnosis of drug resistant TB in high TB burden countries.
Transmission of MDR and XDR tuberculosis in Shanghai, China.
Directory of Open Access Journals (Sweden)
Ming Zhao
Full Text Available Multidrug-resistant (MDR and extensively drug-resistant (XDR tuberculosis (TB are global health problems. We sought to determine the characteristics, prevalence, and relative frequency of transmission of MDR and XDR TB in Shanghai, one of the largest cities in Asia.TB is diagnosed in district TB hospitals in Shanghai, China. Drug susceptibility testing for first-line drugs was performed for all culture positive TB cases, and tests for second-line drugs were performed for MDR cases. VNTR-7 and VNTR-16 were used to genotype the strains, and prior treatment history and treatment outcomes were determined for each patient.There were 4,379 culture positive TB cases diagnosed with drug susceptibility test results available during March 2004 through November 2007. 247 (5.6% were infected with a MDR strain of M. tuberculosis and 11 (6.3% of the 175 MDR patients whose isolate was tested for susceptibility to second-line drugs, were XDR. More than half of the patients with MDR and XDR were newly diagnosed and had no prior history of TB treatment. Nearly 57% of the patients with MDR were successfully treated.Transmission of MDR and XDR strains is a serious problem in Shanghai. While a history of prior anti-TB treatment indicates which individuals may have acquired MDR or XDR TB, it does not accurately predict which TB patients have disease caused by transmission of MDR and XDR strains. Therefore, universal drug susceptibility testing is recommended for new and retreatment TB cases.
Antonissen, Gunther; Devreese, Mathias; De Baere, Siegrid; Martel, An; Van Immerseel, Filip; Croubels, Siska
2017-03-01
Cytochrome P450 (CYP450) drug biotransformation enzymes and multidrug resistance (MDR) proteins may influence drug disposition processes. The first part of the study aimed to evaluate the effect of mycotoxins deoxynivalenol (DON) and/or fumonisins (FBs), at contamination levels approaching European Union guidance levels, on intestinal and hepatic CYP450 enzymes and MDR proteins gene expression in broiler chickens. mRNA expression of genes encoding CYP450 enzymes (CYP3A37, CYP1A4 and CYP1A5) and drug transporters (MDR1/ABCB1 and MRP2/ABCC2) was determined using qRT-PCR. A significant up-regulation of CYP1A4 (P = 0.037) and MDR1 (P = 0.036) was observed in the jejunum of chickens fed a diet contaminated with FBs. The second part of this study aimed to investigate the impact of feeding a FBs contaminated diet on the oral absorption of enrofloxacin (10 mg/kg BW), a MDR1 substrate. A significant (P = 0.045), however small, decreased area under the plasma concentration-time curve (AUC 0-48 h, mean ± SD) was observed for enrofloxacin in chickens fed the FBs contaminated diet compared to the control group, 16.28 ± 1.82 h μg/mL versus 18.27 ± 1.79 h μg/mL. These findings suggest that concurrent administration of drugs with FBs contaminated feed might alter the pharmacokinetic characteristics of CYP1A4 substrate drugs and MDR1 substrates, such as enrofloxacin. Copyright © 2017 Elsevier Ltd. All rights reserved.
Mortality among MDR-TB cases: comparison with drug-susceptible tuberculosis and associated factors.
Directory of Open Access Journals (Sweden)
Kocfa Chung-Delgado
Full Text Available An increase in multidrug-resistant tuberculosis (MDR-TB cases is evident worldwide. Its management implies a complex treatment, high costs, more toxic anti-tuberculosis drug use, longer treatment time and increased treatment failure and mortality. The aims of this study were to compare mortality between MDR and drug-susceptible cases of tuberculosis, and to determine risk factors associated with mortality among MDR-TB cases.A retrospective cohort study was performed using data from clinical records of the National Strategy for Prevention and Control of Tuberculosis in Lima, Peru. In the first objective, MDR-TB, compared to drug-susceptible cases, was the main exposure variable and time to death, censored at 180 days, the outcome of interest. For the second objective, different variables obtained from clinical records were assessed as potential risk factors for death among MDR-TB cases. Cox regression analysis was used to determine hazard ratios (HR and 95% confidence intervals (95%CI. A total of 1,232 patients were analyzed: mean age 30.9 ±14.0 years, 60.0% were males. 61 patients (5.0% died during treatment, whereas the MDR-TB prevalence was 19.2%. MDR-TB increased the risk of death during treatment (HR = 7.5; IC95%: 4.1-13.4 when compared to presumed drug-susceptible cases after controlling for potential confounders. Education level (p = 0.01, previous TB episodes (p<0.001, diabetes history (p<0.001 and HIV infection (p = 0.04 were factors associated with mortality among MDR-TB cases.MDR-TB is associated with an increased risk of death during treatment. Lower education, greater number of previous TB episodes, diabetes history, and HIV infection were independently associated with mortality among MDR-TB cases. New strategies for appropriate MDR-TB detection and management should be implemented, including drug sensitivity tests, diabetes and HIV screening, as well as guarantee for a complete adherence to therapy.
Development of PET and SPECT radiopharmaceuticals to study multi-drug resistance (MDR)
International Nuclear Information System (INIS)
Katsififs, A.; Dikic, B.; Greguric, I.; Knott, R.; Mattner, F.
2002-01-01
Full text: Cellular resistance or Multidrug Resistance (MDR) to cytotoxic agents is the major cause of treatment failure in many human cancers. P-glycoprotein (Pgp), a Mr 17,0000 transmembrane protein and Multi Resistance Protein (MRP) are two proteins that are over expressed and confer resistance to a large number of chemotherapeutic agents by enhancing their extracellular transport. P-glycoprotein is expressed at a relative high level in treated and untreated human malignant tumours, including renal, colonic, adrenal, hepatocellular carcinoma and a considerable percentage of breast carcinomas. 99m Tc-Sestamibi, a lipophilic cationic complex is a transport substrate for Pgp. In clinical studies of human neoplasms it was found that tumour uptake and clearance of this tracer correlate with Pgp expression and may be used for the phenotypic assessment of MDR. However, new tracers with better substrate specificity for Pgp and other drug transporters would greatly assist in optimising chemotherapeutic treatment and improving patient management by predicting tumour response to therapy and to assist in the development of antagonists, which may reverse or halt MDR. The aim of this project is therefore to develop PET and SPECT radiopharmaceuticals with improved affinity and selectivity for Pgp and MRP for the clinical evaluation of MDR in cancer patients. To optimise cellular transport characteristics, a number of chemical families that have been found to be substrates of Pgp and other drug efflux pumps, will be investigated. In the first instance, a series of drugs based on the flavonol natural product, Quercetin will be developed, screened for MDR and radiolabelled with PET and SPECT isotopes. Quercetin and related flavonol derivatives have been selected for this project because of their moderate to good affinity for Pgp. With the assistance of molecular modeling and in vitro studies, structural modification will be undertaken to improve the specificity and affinity for
Soge, Olusegun O; No, David; Michael, Karen E; Dankoff, Jennifer; Lane, Jennifer; Vogel, Keith; Smedley, Jeremy; Roberts, Marilyn C
2016-10-01
MDR MRSA isolates cultured from primates, their facility and primate personnel from the Washington National Primate Research Center were characterized to determine whether they were epidemiologically related to each other and if they represented common local human-associated MRSA strains. Human and primate nasal and composite environmental samples were collected, enriched and selected on medium supplemented with oxacillin and polymyxin B. Isolates were biochemically verified as Staphylococcus aureus and screened for the mecA gene. Selected isolates were characterized using SCCmec typing, MLST and WGS. Nasal cultures were performed on 596 primates and 105 (17.6%) were MRSA positive. Two of 79 (2.5%) personnel and two of 56 (3.6%) composite primate environmental facility samples were MRSA positive. Three MRSA isolates from primates, one MRSA from personnel, two environmental MRSA and one primate MSSA were ST188 and were the same strain type by conventional typing methods. ST188 isolates were related to a 2007 ST188 human isolate from Hong Kong. Both MRSA isolates from out-of-state primates had a novel MLST type, ST3268, and an unrelated group. All isolates carried ≥1 other antibiotic resistance gene(s), including tet(38), the only tet gene identified. ST188 is very rare in North America and has almost exclusively been identified in people from Pan-Asia, while ST3268 is a newly reported MRSA type. The data suggest that the primate MDR MRSA was unlikely to come from primate centre employees. Captive primates are likely to be an unappreciated source of MRSA. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Adachi, Masashi; Reid, Glen; Schuetz, John D
2002-11-18
The energy dependent transport of drugs contributes to cellular resistance and is undoubtedly a prime suspect in chemotherapeutic failure of a variety of disease processes. Early studies focused on a single gene, the multidrug resistance gene, MDR1, as a main contributor to chemotherapeutic failure. However, the multifaceted nature of cellular resistance lead to the discovery of the MRP gene. This pivotal finding and the concurrent rapid development of gene databases lead to the expansion of the MRP gene family. The purpose of this review is to discuss two of the recently described MRP family members that were orphans until their role in drug resistance was discovered. This review will provide an overview of the current state of our understanding of MRP4 and 5.
Genotype frequencies of polymorphic MDR1 variants in the Kazakhstani population
Directory of Open Access Journals (Sweden)
Samat Kozhakhmetov
2014-03-01
Full Text Available Introduction: Statins appear to be handled by an ATP-dependent membrane transporter and three SNPs (C1236T (rs1128503, G2677T (rs2032582, and C3435T (rs1045642, which capture the common genetic variation at this locus. Individuals, who carry the T allele at each SNP (i.e., the T-T-T haplotype, have higher systemic exposure to simvastatin. A triallelic thymine (T - guanine (G - adenine (A, which is a point mutation at nucleotide 2677 in exon 22, leads to ABCB1 in a non-synonymous codons (GCT alanine, TCT serine, threonine ACT at position 893 in a cytoplasmic loop of ATP-dependent membrane transporters. Methods: Blood samples from healthy individuals were collected in the Republican Diagnostic Center, Astana, Kazakhstan. The research samples included 461 healthy people. Genomic DNA was extracted from peripheral blood using the ‘salting out’ procedure. For the MDR1 exon 21, 2677G˃T/A (Ala893Ser/Thr polymorphism was genotyped by PCR sequencing by the use of dye-terminator (ABI 3730xl sequencer. Results: The GG allele appeared in 23% of samples, the GA in 6.7%, the GT in 44%, the non-G heterozygote in 4.5%, and the non-G homozygote in 18%. These results are consistent with previously published data. Importantly, the frequency of 2677T alleles in our group was 15.4%. This represents the lowest frequency of this allele compared to published data in different populations. The frequency of the 2677T allele in Asians and Caucasians varies from 38 to 62%, and is 15% for African Americans. On the other hand, the 2677A allele frequency in the Japanese varies from 15 to 22%, and in Caucasians from 2% and 4%. The 2677A allele frequency has been found in 4.6% of samples. Conclusions: Our study further emphasizes differences between various Asian populations and the importance of repeating this genetic study in different ethnic groups.
International Nuclear Information System (INIS)
Hu, Yamei; Wang, Lingxian; Wang, Lu; Wu, Xuefeng; Wu, Xudong; Gu, Yanhong; Shu, Yongqian; Sun, Yang; Shen, Yan; Xu, Qiang
2015-01-01
Liposarcoma is the most common soft tissue sarcoma with a high risk of relapse. Few therapeutic options are available for the aggressive local or metastatic disease. Here, we report that the clinically used proteasome inhibitor bortezomib exhibits significantly stronger cytotoxicity toward highly malignant human liposarcoma SW872-S cells compared with its parental SW872 cells, which is accompanied by enhanced activation of apoptotic signaling both in vitro and in vivo. Treatment of cells with Jun-N-terminal kinase (JNK) inhibitor SP60015 or the translation inhibitor cycloheximide ameliorated this enhanced apoptosis. Bortezomib inhibited MDR1 expression and function more effectively in SW872-S cells than in SW872 cells, indicating that the increased cytotoxicity relies on the degree of proteasome inhibition. Furthermore, the pharmacological or genetic inhibition of sarco/endoplasmic reticulum calcium-ATPase (SERCA) 2, which is highly expressed in SW872-S cells, resulted in partial reversal of cell growth inhibition and increase of MDR1 expression in bortezomib-treated SW872-S cells. These results show that bortezomib exhibits preferential cytotoxicity toward SW872-S cells possibly via highly expressed SERCA2-associated MDR1 suppression and suggest that bortezomib may serve as a potent agent for treating advanced liposarcoma. - Highlights: • We compare the cytotoxicity of different drugs between SW872-S and SW872 cells. • Highly malignant liposarcoma cells SW872-S show hypersensitivity to bortezomib. • Apoptotic signaling is robustly enhanced in bortezomib-treated SW872-S cells. • Bortezomib has strong suppression on MDR1 expression and function in SW872-S cells. • Inhibition of SERCA2 protects SW872-S cells from bortezomib
Energy Technology Data Exchange (ETDEWEB)
Hu, Yamei; Wang, Lingxian; Wang, Lu; Wu, Xuefeng; Wu, Xudong [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China); Gu, Yanhong; Shu, Yongqian [Department of Clinical Oncology, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210029 (China); Sun, Yang [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China); Shen, Yan, E-mail: shenyan@nju.edu.cn [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China); Xu, Qiang, E-mail: molpharm@163.com [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China)
2015-02-15
Liposarcoma is the most common soft tissue sarcoma with a high risk of relapse. Few therapeutic options are available for the aggressive local or metastatic disease. Here, we report that the clinically used proteasome inhibitor bortezomib exhibits significantly stronger cytotoxicity toward highly malignant human liposarcoma SW872-S cells compared with its parental SW872 cells, which is accompanied by enhanced activation of apoptotic signaling both in vitro and in vivo. Treatment of cells with Jun-N-terminal kinase (JNK) inhibitor SP60015 or the translation inhibitor cycloheximide ameliorated this enhanced apoptosis. Bortezomib inhibited MDR1 expression and function more effectively in SW872-S cells than in SW872 cells, indicating that the increased cytotoxicity relies on the degree of proteasome inhibition. Furthermore, the pharmacological or genetic inhibition of sarco/endoplasmic reticulum calcium-ATPase (SERCA) 2, which is highly expressed in SW872-S cells, resulted in partial reversal of cell growth inhibition and increase of MDR1 expression in bortezomib-treated SW872-S cells. These results show that bortezomib exhibits preferential cytotoxicity toward SW872-S cells possibly via highly expressed SERCA2-associated MDR1 suppression and suggest that bortezomib may serve as a potent agent for treating advanced liposarcoma. - Highlights: • We compare the cytotoxicity of different drugs between SW872-S and SW872 cells. • Highly malignant liposarcoma cells SW872-S show hypersensitivity to bortezomib. • Apoptotic signaling is robustly enhanced in bortezomib-treated SW872-S cells. • Bortezomib has strong suppression on MDR1 expression and function in SW872-S cells. • Inhibition of SERCA2 protects SW872-S cells from bortezomib.
Exploration of Fungal Association From Hard Coral Against Pathogen MDR Staphylococcus haemolyticus
Cristianawati, O.; Radjasa, O. K.; Sabdono, A.; Trianto, A.; Sabdaningsih, A.; Sibero, M. T.; Nuryadi, H.
2017-02-01
Staphylococcus haemolyticus are opportunistic bacteria and as the second leading cause of nosocomial infections. It is a disease causing septicemia, peritonitis, otitis, and urinary tract infections and infections of the eye. It also a phenotype resistant to multiple antibiotics commercial. There is now an urgency to find an alternative antibiotics to combat this bacteria. It has been widely reported that many bioactive marine natural products from marine invertebrate have striking similarities to metabolites of their associated microorganisms including fungi. Hard coral associated microorganisms are among of the most interesting and promising marine natural product sources, which produce with various biological activities. The proposed work focused on the discovery of bioactive compounds and also estimated the phylogenetic diversity from fungal association of hard coral against pathogen MDR Staphylococcus haemolyticus. A total of 32 fungal association, FHP 7 which were isolated from Favia sp. capable of inhibiting the growth MDR. Molecular identification based on 18S rRNA gene sequences revealed that the active fungal association belonged 100% to the members from one of the genera Trichoderma longibrachiatum. Accession Number LC185084.1.
Gellatly, Kyle J; Yoon, Kyong Sup; Doherty, Jeffery J; Sun, Weilin; Pittendrigh, Barry R; Clark, J Marshall
2015-06-01
4,4'-dichlorodiphenyltrichloroethane (DDT) has been re-recommended by the World Health Organization for malaria mosquito control. Previous DDT use has resulted in resistance, and with continued use resistance will increase in terms of level and extent. Drosophila melanogaster is a model dipteran that has many available genetic tools, numerous studies done on insecticide resistance mechanisms, and is related to malaria mosquitoes allowing for extrapolation. The 91-R strain of D. melanogaster is highly resistant to DDT (>1500-fold), however, there is no mechanistic scheme that accounts for this level of resistance. Recently, reduced penetration, increased detoxification, and direct excretion have been identified as resistance mechanisms in the 91-R strain. Their interactions, however, remain unclear. Use of UAS-RNAi transgenic lines of D. melanogaster allowed for the targeted knockdown of genes putatively involved in DDT resistance and has validated the role of several cuticular proteins (Cyp4g1 and Lcp1), cytochrome P450 monooxygenases (Cyp6g1 and Cyp12d1), and ATP binding cassette transporters (Mdr50, Mdr65, and Mrp1) involved in DDT resistance. Further, increased sensitivity to DDT in the 91-R strain after intra-abdominal dsRNA injection for Mdr50, Mdr65, and Mrp1 was determined by a DDT contact bioassay, directly implicating these genes in DDT efflux and resistance. Copyright © 2015 Elsevier Inc. All rights reserved.
Bardbari, Ali Mohammadi; Arabestani, Mohammad Reza; Karami, Manoochehr; Keramat, Fariba; Alikhani, Mohammad Yousef; Bagheri, Kamran Pooshang
2017-07-01
Acinetobacter baumannii potential to form biofilm and exhibit multiple antibiotic resistances may be responsible in its survival in hospital environment. Accordingly, our study was aimed to determine the correlation between ability of biofilm formation and the frequency of biofilm related genes with antibiotic resistance phenotypes, and also the categorization of their patterns in clinical and environmental isolates. A total of 75 clinical and 32 environmental strains of the A. baumannii were collected and identified via API 20NE. Antibiotic susceptibility was evaluated by disk diffusion and microdilution broth methods. Biofilm formation assay was performed by microtiter plate method. OXA types and biofilm related genes including Bla OXA-51 , Bla OXA-23 , Bla OXA-24 , Bla OXA-58 , bap, bla PER-1 , and ompA were amplified by PCR. The rate of MDR A. baumannii in clinical isolates (100%) was higher than environmental (81.2%) isolates (p baumannii isolates was associated with biofilm formation. There was a significant correlation between multiple drug resistance and biofilm formation. The clinical isolates had a higher ability to form strong biofilms compared to the environmental samples. Copyright © 2017 Elsevier Ltd. All rights reserved.
[Expression and significance of P-gp/mdr1 mRNA, MRP and LRP in non-Hodgkin's lymphoma].
Li, Le; Su, Li-ping; Ma, Li; Zhao, Jin; Zhu, Lei; Zhou, Yong-an
2009-03-01
To explore the expression and clinical significance of P-glycoprotein (P-gp)/mdr1mRNA, multidrug resistance-associated protein (MRP) and lung resistance protein (LRP) in newly diagnosed non-Hodgkin's lymphoma. mdr1 mRNA of in 41 patients with non-Hodgkin's lymphoma was assayed by semi-quantitative RT-PCR. The expressions of P-gp, MRP and LRP proteins in lymph node viable blasts were identified by flow cytometry. The results were compared with those obtained from control cases, and the correlation of the changes with clinical outcomes was analyzed. (1) Among the 41 cases, the positive expression of P-gp protein was detected in 8 cases, MRP in 7 cases, LRP in 15 cases, and mdr 1 mRNA in 11 cases. (2) The P-gp and LRP levels in NHL were significantly higher than those in control group, but MRP wasn't. The P-gp over-expression was significantly associated with mdr1mRNA (r = 0.396, P = 0.01). No correlation was showed among the expressions of P-gp, MRP and LRP. (3) Patients with P-gp expression had a poorer outcome of chemotherapy than those with P-gp-negative (P = 0.005). P-gp expression was significantly associated with higher clinical stage (P = 0.046) and elevated serum lactate dehydrogenase level (P = 0.032), but not associated with malignant degree (P = 0.298). MRP had no impact on the outcome of chemotherapy (P = 0.212), and wasn't significantly associated with higher clinical stage (P = 0.369), elevated LDH (P = 0.762) and higher malignant degree (P = 0.451). Patients with LRP expression had a poorer outcome of chemotherapy than those LRP-negative (P = 0.012). LRP expression was significantly associated with higher clinical stage (P = 0.0019), elevated LDH (P = 0.02) and higher malignant degree (P = 0.01). The data of this study indicate that P-gp and LRP expressions but not MRP expression are important in the mechanism of drug resistance associated with a poor clinical outcome in previously untreated NHL.
Wai, Pyae Phyo; Shewade, Hemant Deepak; Kyaw, Nang Thu Thu; Thein, Saw; Si Thu, Aung; Kyaw, Khine Wut Yee; Aye, Nyein Nyein; Phyo, Aye Mon; Maung, Htet Myet Win; Soe, Kyaw Thu; Aung, Si Thu
2018-01-01
The Union in collaboration with national TB programme (NTP) started the community-based MDR-TB care (CBMDR-TBC) project in 33 townships of upper Myanmar to improve treatment initiation and treatment adherence. Patients with MDR-TB diagnosed/registered under NTP received support through the project staff, in addition to the routine domiciliary care provided by NTP staff. Each township had a project nurse exclusively for MDR-TB and 30 USD per month (max. for 4 months) were provided to the patient as a pre-treatment support. To assess whether CBMDR-TBC project's support improved treatment initiation. In this cohort study (involving record review) of all diagnosed MDR-TB between January 2015 and June 2016 in project townships, CBMDR-TBC status was categorized as "receiving support" if date of project initiation in patient's township was before the date of diagnosis and "not receiving support", if otherwise. Cox proportional hazards regression (censored on 31 Dec 2016) was done to identify predictors of treatment initiation. Of 456 patients, 57% initiated treatment: 64% and 56% among patients "receiving support (n = 208)" and "not receiving support (n = 228)" respectively (CBMDR-TBC status was not known in 20 (4%) patients due to missing diagnosis dates). Among those initiated on treatment (n = 261), median (IQR) time to initiate treatment was 38 (20, 76) days: 31 (18, 50) among patients "receiving support" and 50 (26,101) among patients "not receiving support". After adjusting other potential confounders (age, sex, region, HIV, past history of TB treatment), patients "receiving support" had 80% higher chance of initiating treatment [aHR (0.95 CI): 1.8 (1.3, 2.3)] when compared to patients "not receiving support". In addition, age 15-54 years, previous history of TB and being HIV negative were independent predictors of treatment initiation. Receiving support under CBMDR-TBC project improved treatment initiation: it not only improved the proportion initiated but also
Haghvirdizadeh, Polin; Ramachandran, Vasudevan; Etemad, Ali; Heidari, Farzad; Ghodsian, Nooshin; Bin Ismail, Norzian; Ismail, Patimah
2015-01-01
Background. Type 2 diabetes mellitus (T2DM) is a complex polygenic disorder characterized by impaired insulin resistance, insulin secretion, and dysregulation of lipid and protein metabolism with environmental and genetic factors. ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms are reported as the one of the genetic risk factors for T2DM in various populations with conflicting results. This study was conducted based on PCR-HRM to determine the frequency of ABCA1 gene by rs22308...
Flavonoids as modulators of metabolic enzymes and drug transporters.
Miron, Anca; Aprotosoaie, Ana Clara; Trifan, Adriana; Xiao, Jianbo
2017-06-01
Flavonoids, natural compounds found in plants and in plant-derived foods and beverages, have been extensively studied with regard to their capacity to modulate metabolic enzymes and drug transporters. In vitro, flavonoids predominantly inhibit the major phase I drug-metabolizing enzyme CYP450 3A4 and the enzymes responsible for the bioactivation of procarcinogens (CYP1 enzymes) and upregulate the enzymes involved in carcinogen detoxification (UDP-glucuronosyltransferases, glutathione S-transferases (GSTs)). Flavonoids have been reported to inhibit ATP-binding cassette (ABC) transporters (multidrug resistance (MDR)-associated proteins, breast cancer-resistance protein) that contribute to the development of MDR. P-glycoprotein, an ABC transporter that limits drug bioavailability and also induces MDR, was differently modulated by flavonoids. Flavonoids and their phase II metabolites (sulfates, glucuronides) inhibit organic anion transporters involved in the tubular uptake of nephrotoxic compounds. In vivo studies have partially confirmed in vitro findings, suggesting that the mechanisms underlying the modulatory effects of flavonoids are complex and difficult to predict in vivo. Data summarized in this review strongly support the view that flavonoids are promising candidates for the enhancement of oral drug bioavailability, chemoprevention, and reversal of MDR. © 2017 New York Academy of Sciences.
Multimodal transfer of MDR by exosomes in human osteosarcoma.
Torreggiani, Elena; Roncuzzi, Laura; Perut, Francesca; Zini, Nicoletta; Baldini, Nicola
2016-07-01
Exosomes are extracellular vesicles released by both normal and tumour cells which are involved in a new intercellular communication pathway by delivering cargo (e.g., proteins, microRNAs, mRNAs) to recipient cells. Tumour-derived exosomes have been shown to play critical roles in different stages of tumour growth and progression. In this study, we investigated the potential role of exosomes to transfer the multidrug resistance (MDR) phenotype in human osteosarcoma cells. Exosomes were isolated by differential centrifugation of culture media from multidrug resistant human osteosarcoma MG-63DXR30 (Exo/DXR) and MG-63 parental cells (Exo/S). Exosome purity was examined by transmission electron microscopy and confirmed by immunoblot analysis for the expression of specific exosomal markers. Our data showed that exosomes derived from doxorubicin-resistant osteosarcoma cells could be taken up into secondary cells and induce a doxorubicin-resistant phenotype. The incubation of osteosarcoma cells with Exo/DXR decreased the sensitivity of parental cells to doxorubicin, while exposure with Exo/S was ineffective. In addition, we demonstrated that Exo/DXR expressed higher levels of MDR-1 mRNA and P-glycoprotein compared to Exo/S (p=0.03). Interestingly, both MDR-1 mRNA and P-gp increased in MG-63 cells after incubation with Exo/DXR, suggesting this as the main mechanism of exosome-mediated transfer of drug resistance. Our findings suggest that multidrug resistant osteosarcoma cells are able to spread their ability to resist the effects of doxorubicin treatment on sensitive cells by transferring exosomes carrying MDR-1 mRNA and its product P-glycoprotein.
Kundu, Debashish; Sharma, Nandini; Chadha, Sarabjit; Laokri, Samia; Awungafac, George; Jiang, Lai; Asaria, Miqdad
2018-01-27
There are significant financial barriers to access treatment for multi drug resistant tuberculosis (MDR-TB) in India. To address these challenges, Chhattisgarh state in India has established a MDR-TB financial protection policy by creating MDR-TB benefit packages as part of the universal health insurance scheme that the state has rolled out in their effort towards attaining Universal Health Coverage for all its residents. In these schemes the state purchases health insurance against set packages of services from third party health insurance agencies on behalf of all its residents. Provider payment reform by strategic purchasing through output based payments (lump sum fee is reimbursed as per the MDR-TB benefit package rates) to the providers - both public and private health facilities empanelled under the insurance scheme was the key intervention. To understand the implementation gap between policy and practice of the benefit packages with respect to equity in utilization of package claims by the poor patients in public and private sector. Data from primary health insurance claims from January 2013 to December 2015, were analysed using an extension of 'Kingdon's multiple streams for policy implementation framework' to explain the implementation gap between policy and practice of the MDR-TB benefit packages. The total number of claims for MDR-TB benefit packages increased over the study period mainly from poor patients treated in public facilities, particularly for the pre-treatment evaluation and hospital stay packages. Variations and inequities in utilizing the packages were observed between poor and non-poor beneficiaries in public and private sector. Private providers participation in the new MDR-TB financial protection mechanism through the universal health insurance scheme was observed to be much lower than might be expected given their share of healthcare provision overall in India. Our findings suggest that there may be an implementation gap due to weak
Heightened vulnerability to MDR-TB epidemics after controlling drug-susceptible TB.
Directory of Open Access Journals (Sweden)
Jason D Bishai
2010-09-01
Full Text Available Prior infection with one strain TB has been linked with diminished likelihood of re-infection by a new strain. This paper attempts to determine the role of declining prevalence of drug-susceptible TB in enabling future epidemics of MDR-TB.A computer simulation of MDR-TB epidemics was developed using an agent-based model platform programmed in NetLogo (See http://mdr.tbtools.org/. Eighty-one scenarios were created, varying levels of treatment quality, diagnostic accuracy, microbial fitness cost, and the degree of immunogenicity elicited by drug-susceptible TB. Outcome measures were the number of independent MDR-TB cases per trial and the proportion of trials resulting in MDR-TB epidemics for a 500 year period after drug therapy for TB is introduced.MDR-TB epidemics propagated more extensively after TB prevalence had fallen. At a case detection rate of 75%, improving therapeutic compliance from 50% to 75% can reduce the probability of an epidemic from 45% to 15%. Paradoxically, improving the case-detection rate from 50% to 75% when compliance with DOT is constant at 75% increases the probability of MDR-TB epidemics from 3% to 45%.The ability of MDR-TB to spread depends on the prevalence of drug-susceptible TB. Immunologic protection conferred by exposure to drug-susceptible TB can be a crucial factor that prevents MDR-TB epidemics when TB treatment is poor. Any single population that successfully reduces its burden of drug-susceptible TB will have reduced herd immunity to externally or internally introduced strains of MDR-TB and can experience heightened vulnerability to an epidemic. Since countries with good TB control may be more vulnerable, their self interest dictates greater promotion of case detection and DOTS implementation in countries with poor control to control their risk of MDR-TB.
Ghaith, Doaa Mohammad; Zafer, Mai Mahmoud; Al-Agamy, Mohamed Hamed; Alyamani, Essam J; Booq, Rayan Y; Almoazzamy, Omar
2017-05-10
Acinetobacter baumannii is known for nosocomial outbreaks worldwide. In this study, we aimed to investigate the antibiotic susceptibility patterns and the clonal relationship of A. baumannii isolates from the intensive care unit (ICU) of an Egyptian hospital. In the present study, 50 clinical isolates of multidrug resistant (MDR)-A. baumannii were obtained from patients admitted into the ICU from June to December 2015. All isolates were analyzed for antimicrobial susceptibilities. Multiplex PCR was performed to detect genes encoding oxacillinase genes (bla OXA-51 -like, bla OXA-23 -like, bla OXA-24 -like, and bla OXA-58 -like). Multilocus sequence typing (MLST) based on the seven-gene scheme (gltA, gyrB, gdhB, recA, cpn60, gpi, rpoD) was used to examine these isolates. All A. baumannii clinical isolates showed the same resistance pattern, characterized by resistance to most common antibiotics including imipenem (MIC ≥ 8μ/mL), with the only exception being colistin. Most isolates were positive for bla OXA-51 -like and bla OXA-23 -like (100 and 96%, respectively); however, bla OXA-24 -like and bla OXA-58 -like were not detected. MLST analysis identified different sequence types (ST195, ST208, ST231, ST441, ST499, and ST723) and a new sequence type (ST13929) with other sporadic strains. MDR A. baumannii strains harboring bla OXA-23 -like genes were widely circulating in this ICU. MLST was a powerful tool for identifying and epidemiologically typing our strains. Strict infection control measures must be implemented to contain the worldwide spread of MDR A. baumannii in ICUs.
Morris, M D; Quezada, L; Bhat, P; Moser, K; Smith, J; Perez, H; Laniado-Laborin, R; Estrada-Guzman, J; Rodwell, T C
2013-07-01
The State of Baja California, Mexico, had the highest prevalence of multidrug-resistant tuberculosis (MDR-TB) in Mexico in 2009. To understand the socio-economic burden of MDR-TB disease and its treatment on patients in Tijuana and Mexicali, Mexico. From July to November 2009, qualitative interviews were conducted with 12 patients enrolled in a US-Mexico binational MDR-TB treatment program, Puentes de Esperanza (Bridges of Hope), which was designed to support MDR-TB patients. In-depth interviews were coded to identify major themes in patient experiences of MDR-TB diagnosis and care. While some patients were able to maintain their pre-MDR-TB lives to a limited extent, most patients reported losing their sense of identity due to their inability to work, social isolation, and stigmatization from family and friends. The majority of participants expressed appreciation for Puentes' role in 'saving their lives'. Being diagnosed with MDR-TB and undergoing treatment imposes significant psychological, social and economic stress on patients. Strong social support elements within Puentes helped alleviate these burdens. Improvements to the program might include peer-support groups for patients undergoing treatment and transitioning back into the community after treatment.
Directory of Open Access Journals (Sweden)
N. V. Litviakov
2013-01-01
Full Text Available The paper examined 106 patients with breast cancer (BC treated with neoadjuvant chemotherapy (NАС. In the biopsy material, derived from primary tumor before NAC and surgical samples after chemotherapy the expression of 8 multidrug resistance genes (MDR ABCB1, АВСВ2, ABCC1, ABCC2, АВСС5, ABCG1, ABCG2 и MVP was evaluated using quantitative RT-PCR. During the NAC course 75 % of patients manifested gradient phenomenon for gene expression that means a unidirectional change in the expression of all five MDR genes ABCB1, ABCC1, ABCC2, ABCG1 и ABCG2 closely associated with the NAC efficacy: the reduction in MDR gene expression was related to good response to NAC while the expression increase associated with poor response to NAC. In 25% of patients there was no such change in studied gene expression that means the lack of a gradient phenomenon. The objective was to study whether gradient phenomenon for MDR gene expression during NAC is related to disease free survival in breast cancer patients. Five-year metastasis-free survival in patients having a gradient phenomenon was 73 % versus 39 % in patients who lack a gradient phenomenon (log-rank test p=0,0018. So, the presence of a gradient phenomenon in patients is appeared to be associated with a good disease prognosis. It is assumed that the gradiThe paper examined 106 patients with breast cancer (BC treated with neoadjuvant chemotherapy (NАС. In the biopsy material, derived from primary tumor before NAC and surgical samples after chemotherapy the expression of 8 multidrug resistance genes (MDR ABCB1, АВСВ2, ABCC1, ABCC2, АВСС5, ABCG1, ABCG2 и MVP was evaluated using quantitative RT-PCR. During the NAC course 75 % of patients manifested gradient phenomenon for gene expression that means a unidirectional change in the expression of all five MDR genes ABCB1, ABCC1, ABCC2, ABCG1 и ABCG2 closely associated with the NAC efficacy: the reduction in MDR gene expression was related to good
Directory of Open Access Journals (Sweden)
Szilvia Veszelka
2018-05-01
Full Text Available Cell culture-based blood-brain barrier (BBB models are useful tools for screening of CNS drug candidates. Cell sources for BBB models include primary brain endothelial cells or immortalized brain endothelial cell lines. Despite their well-known differences, epithelial cell lines are also used as surrogate models for testing neuropharmaceuticals. The aim of the present study was to compare the expression of selected BBB related genes including tight junction proteins, solute carriers (SLC, ABC transporters, metabolic enzymes and to describe the paracellular properties of nine different culture models. To establish a primary BBB model rat brain capillary endothelial cells were co-cultured with rat pericytes and astrocytes (EPA. As other BBB and surrogate models four brain endothelial cells lines, rat GP8 and RBE4 cells, and human hCMEC/D3 cells with or without lithium treatment (D3 and D3L, and four epithelial cell lines, native human intestinal Caco-2 and high P-glycoprotein expressing vinblastine-selected VB-Caco-2 cells, native MDCK and MDR1 transfected MDCK canine kidney cells were used. To test transporter functionality, the permeability of 12 molecules, glucopyranose, valproate, baclofen, gabapentin, probenecid, salicylate, rosuvastatin, pravastatin, atorvastatin, tacrine, donepezil, was also measured in the EPA and epithelial models. Among the junctional protein genes, the expression level of occludin was high in all models except the GP8 and RBE4 cells, and each model expressed a unique claudin pattern. Major BBB efflux (P-glycoprotein or ABCB1 and influx transporters (GLUT-1, LAT-1 were present in all models at mRNA levels. The transcript of BCRP (ABCG2 was not expressed in MDCK, GP8 and RBE4 cells. The absence of gene expression of important BBB efflux and influx transporters BCRP, MRP6, -9, MCT6, -8, PHT2, OATPs in one or both types of epithelial models suggests that Caco-2 or MDCK models are not suitable to test drug candidates which
Directory of Open Access Journals (Sweden)
Dai Hongying
2013-01-01
Full Text Available Abstract Background Multifactor Dimensionality Reduction (MDR has been widely applied to detect gene-gene (GxG interactions associated with complex diseases. Existing MDR methods summarize disease risk by a dichotomous predisposing model (high-risk/low-risk from one optimal GxG interaction, which does not take the accumulated effects from multiple GxG interactions into account. Results We propose an Aggregated-Multifactor Dimensionality Reduction (A-MDR method that exhaustively searches for and detects significant GxG interactions to generate an epistasis enriched gene network. An aggregated epistasis enriched risk score, which takes into account multiple GxG interactions simultaneously, replaces the dichotomous predisposing risk variable and provides higher resolution in the quantification of disease susceptibility. We evaluate this new A-MDR approach in a broad range of simulations. Also, we present the results of an application of the A-MDR method to a data set derived from Juvenile Idiopathic Arthritis patients treated with methotrexate (MTX that revealed several GxG interactions in the folate pathway that were associated with treatment response. The epistasis enriched risk score that pooled information from 82 significant GxG interactions distinguished MTX responders from non-responders with 82% accuracy. Conclusions The proposed A-MDR is innovative in the MDR framework to investigate aggregated effects among GxG interactions. New measures (pOR, pRR and pChi are proposed to detect multiple GxG interactions.
Directory of Open Access Journals (Sweden)
Tatiana Takahasi Komoto
2015-01-01
Full Text Available Trichophyton rubrum is the most common causative agent of dermatomycoses worldwide, causing infection in the stratum corneum, nails, and hair. Despite the high prevalence of these infections, little is known about the molecular mechanisms involved in the fungal-host interaction, particularly during antifungal treatment. The aim of this work was to evaluate the gene expression of T. rubrum cocultured with keratinocytes and treated with the flavonoid trans-chalcone and the glycoalkaloid α-solanine. Both substances showed a marked antifungal activity against T. rubrum strain CBS (MIC = 1.15 and 17.8 µg/mL, resp.. Cytotoxicity assay against HaCaT cells produced IC50 values of 44.18 to trans-chalcone and 61.60 µM to α-solanine. The interaction of keratinocytes with T. rubrum conidia upregulated the expression of genes involved in the glyoxylate cycle, ergosterol synthesis, and genes encoding proteases but downregulated the ABC transporter TruMDR2 gene. However, both antifungals downregulated the ERG1 and ERG11, metalloprotease 4, serine proteinase, and TruMDR2 genes. Furthermore, the trans-chalcone downregulated the genes involved in the glyoxylate pathway, isocitrate lyase, and citrate synthase. Considering the urgent need for more efficient and safer antifungals, these results contribute to a better understanding of fungal-host interactions and to the discovery of new antifungal targets.
DNA methylation of amino acid transporter genes in the human placenta.
Simner, C; Novakovic, B; Lillycrop, K A; Bell, C G; Harvey, N C; Cooper, C; Saffery, R; Lewis, R M; Cleal, J K
2017-12-01
Placental transfer of amino acids via amino acid transporters is essential for fetal growth. Little is known about the epigenetic regulation of amino acid transporters in placenta. This study investigates the DNA methylation status of amino acid transporters and their expression across gestation in human placenta. BeWo cells were treated with 5-aza-2'-deoxycytidine to inhibit methylation and assess the effects on amino acid transporter gene expression. The DNA methylation levels of amino acid transporter genes in human placenta were determined across gestation using DNA methylation array data. Placental amino acid transporter gene expression across gestation was also analysed using data from publically available Gene Expression Omnibus data sets. The expression levels of these transporters at term were established using RNA sequencing data. Inhibition of DNA methylation in BeWo cells demonstrated that expression of specific amino acid transporters can be inversely associated with DNA methylation. Amino acid transporters expressed in term placenta generally showed low levels of promoter DNA methylation. Transporters with little or no expression in term placenta tended to be more highly methylated at gene promoter regions. The transporter genes SLC1A2, SLC1A3, SLC1A4, SLC7A5, SLC7A11 and SLC7A10 had significant changes in enhancer DNA methylation across gestation, as well as gene expression changes across gestation. This study implicates DNA methylation in the regulation of amino acid transporter gene expression. However, in human placenta, DNA methylation of these genes remains low across gestation and does not always play an obvious role in regulating gene expression, despite clear evidence for differential expression as gestation proceeds. Copyright © 2017. Published by Elsevier Ltd.
Kim, Ronald; Sepulveda-Orengo, Marian T; Healey, Kati L; Williams, Emily A; Reissner, Kathryn J
2018-01-01
Downregulation of the astroglial glutamate transporter GLT-1 is observed in the nucleus accumbens (NAc) following administration of multiple drugs of abuse. The decrease in GLT-1 protein expression following cocaine self-administration is dependent on both the amount of cocaine self-administered and the length of withdrawal, with longer access to cocaine and longer withdrawal periods leading to greater decreases in GLT-1 protein. However, the mechanism(s) by which cocaine downregulates GLT-1 protein remains unknown. We used qRT-PCR to examine gene expression of GLT-1 splice isoforms (GLT-1A, GLT-1B) in the NAc, prelimbic cortex (PL) and basolateral amygdala (BLA) of rats, following two widely used models of cocaine self-administration: short-access (ShA) self-administration, and the long-access (LgA) self-administration/incubation model. While downregulation of GLT-1 protein is observed following ShA cocaine self-administration and extinction, this model did not lead to a change in GLT-1A or GLT-1B gene expression in any brain region examined. Forced abstinence following ShA cocaine self-administration also was without effect. In contrast, LgA cocaine self-administration and prolonged abstinence significantly decreased GLT-1A gene expression in the NAc and BLA, and significantly decreased GLT-1B gene expression in the PL. No change was observed in NAc GLT-1A gene expression one day after LgA cocaine self-administration, indicating withdrawal-induced decreases in GLT-1A mRNA. In addition, LgA cocaine self-administration and withdrawal induced hypermethylation of the GLT-1 gene in the NAc. These results indicate that a decrease in NAc GLT-1 mRNA is only observed after extended access to cocaine combined with protracted abstinence, and that epigenetic mechanisms likely contribute to this effect. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Zahra Tavoosi
2015-01-01
Full Text Available ABCA1 and ABCG1 genes encode the cholesterol transporter proteins that play a key role in cholesterol and phospholipids homeostasis. This study was aimed at evaluating and comparing ABCA1 and ABCG1 genes expression in metabolic syndrome patients and healthy individuals. This case-control study was performed on 36 patients with metabolic syndrome and the same number of healthy individuals in Hamadan (west of Iran during 2013-2014. Total RNA was extracted from mononuclear cells and purified using RNeasy Mini Kit column. The expression of ABCA1 and ABCG1 genes was performed by qRT-PCR. Lipid profile and fasting blood glucose were measured using colorimetric procedures. ABCG1 expression in metabolic syndrome patients was significantly lower (about 75% compared to that of control group, while for ABCA1 expression, there was no significant difference between the two studied groups. Comparison of other parameters such as HDL-C, FBS, BMI, waist circumference, and systolic and diastolic blood pressure between metabolic syndrome patients and healthy individuals showed significant differences (P<0.05. Decrease in ABCG1 expression in metabolic syndrome patients compared to healthy individuals suggests that hyperglycemia, related metabolites, and hyperlipidemia over the transporter capacity resulted in decreased expression of ABCG1. Absence of a significant change in ABCA1 gene expression between two groups can indicate a different regulation mechanism for ABCA1 expression.
Budworth, J; Gant, T W; Gescher, A
1997-01-01
The aim of this study was to investigate the link between protein kinase C (PKC) and multidrug resistance (mdr) phenotype. The expression of both was studied in doxorubicin-resistant MCF-7/Adr cells as they reverted to the wild-type phenotype when cultured in the absence of drug. The following parameters were measured in cells 4, 10, 15, 20 and 24 weeks after removal of doxorubicin; (1) sensitivity of the cells towards doxorubicin; (2) levels of P-glycoprotein (P-gp) and MDR1 mRNA; (3) levels and cellular localization of PKC isoenzyme proteins alpha, theta and epsilon; and (4) gene copy number of PKC-alpha and MDR1 genes. Cells lost their resistance gradually with time, so that by week 24 they had almost completely regained the drug sensitivity seen in wild-type MCF-7 cells. P-gp levels measured by Western blot mirrored the change in doxorubicin sensitivity. By week 20, P-gp had decreased to 18% of P-gp protein levels at the outset, and P-gp was not detectable at week 24. Similarly, MDR1 mRNA levels had disappeared by week 24. MCF-7/Adr cells expressed more PKCs-alpha and -theta than wild-type cells and possessed a different cellular localization of PKC-epsilon. The expression and distribution pattern of these PKCs did not change for up to 20 weeks, but reverted back to that seen in wild-type cells by week 24. MDR1 gene amplification remained unchanged until week 20, but then was lost precipitously between weeks 20 and 24. The PKC-alpha gene was not amplified in MCF-7/Adr cells. The results suggest that MCF-7/Adr cells lose MDR1 gene expression and PKC activity in a co-ordinate fashion, consistent with the existence of a mechanistic link between MDR1 and certain PKC isoenzymes.
Chromosomal localization of the human vesicular amine transporter genes
Energy Technology Data Exchange (ETDEWEB)
Peter, D.; Finn, P.; Liu, Y.; Roghani, A.; Edwards, R.H.; Klisak, I.; Kojis, T.; Heinzmann, C.; Sparkes, R.S. (UCLA School of Medicine, Los Angeles, CA (United States))
1993-12-01
The physiologic and behavioral effects of pharmacologic agents that interfere with the transport of monoamine neurotransmitters into vesicles suggest that vesicular amine transport may contribute to human neuropsychiatric disease. To determine whether an alteration in the genes that encode vesicular amine transport contributes to the inherited component of these disorders, the authors have isolated a human cDNA for the brain transporter and localized the human vesciular amine transporter genes. The human brain synaptic vesicle amine transporter (SVAT) shows unexpected conservation with rat SVAT in the regions that diverge extensively between rat SVAT and the rat adrenal chromaffin granule amine transporter (CGAT). Using the cloned sequences with a panel of mouse-human hybrids and in situ hybridization for regional localization, the adrenal CGAT gene (or VAT1) maps to human chromosome 8p21.3 and the brain SVAT gene (or VAT2) maps to chromosome 10q25. Both of these sites occur very close to if not within previously described deletions that produce severe but viable phenotypes. 26 refs., 3 figs., 1 tab.
Directory of Open Access Journals (Sweden)
Matthias Kretschmer
2009-12-01
Full Text Available The grey mould fungus Botrytis cinerea causes losses of commercially important fruits, vegetables and ornamentals worldwide. Fungicide treatments are effective for disease control, but bear the risk of resistance development. The major resistance mechanism in fungi is target protein modification resulting in reduced drug binding. Multiple drug resistance (MDR caused by increased efflux activity is common in human pathogenic microbes, but rarely described for plant pathogens. Annual monitoring for fungicide resistance in field isolates from fungicide-treated vineyards in France and Germany revealed a rapidly increasing appearance of B. cinerea field populations with three distinct MDR phenotypes. All MDR strains showed increased fungicide efflux activity and overexpression of efflux transporter genes. Similar to clinical MDR isolates of Candida yeasts that are due to transcription factor mutations, all MDR1 strains were shown to harbor activating mutations in a transcription factor (Mrr1 that controls the gene encoding ABC transporter AtrB. MDR2 strains had undergone a unique rearrangement in the promoter region of the major facilitator superfamily transporter gene mfsM2, induced by insertion of a retrotransposon-derived sequence. MDR2 strains carrying the same rearranged mfsM2 allele have probably migrated from French to German wine-growing regions. The roles of atrB, mrr1 and mfsM2 were proven by the phenotypes of knock-out and overexpression mutants. As confirmed by sexual crosses, combinations of mrr1 and mfsM2 mutations lead to MDR3 strains with higher broad-spectrum resistance. An MDR3 strain was shown in field experiments to be selected against sensitive strains by fungicide treatments. Our data document for the first time the rising prevalence, spread and molecular basis of MDR populations in a major plant pathogen in agricultural environments. These populations will increase the risk of grey mould rot and hamper the effectiveness of
Frequent down-regulation of ABC transporter genes in prostate cancer.
Demidenko, Rita; Razanauskas, Deividas; Daniunaite, Kristina; Lazutka, Juozas Rimantas; Jankevicius, Feliksas; Jarmalaite, Sonata
2015-10-12
ATP-binding cassette (ABC) transporters are transmembrane proteins responsible for the efflux of a wide variety of substrates, including steroid metabolites, through the cellular membranes. For better characterization of the role of ABC transporters in prostate cancer (PCa) development, the profile of ABC transporter gene expression was analyzed in PCa and noncancerous prostate tissues (NPT). TaqMan Low Density Array (TLDA) human ABC transporter plates were used for the gene expression profiling in 10 PCa and 6 NPT specimens. ABCB1 transcript level was evaluated in a larger set of PCa cases (N = 78) and NPT (N = 15) by real-time PCR, the same PCa cases were assessed for the gene promoter hypermethylation by methylation-specific PCR. Expression of eight ABC transporter genes (ABCA8, ABCB1, ABCC6, ABCC9, ABCC10, ABCD2, ABCG2, and ABCG4) was significantly down-regulated in PCa as compared to NPT, and only two genes (ABCC4 and ABCG1) were up-regulated. Down-regulation of ABC transporter genes was prevalent in the TMPRSS2-ERG-negative cases. A detailed analysis of ABCB1 expression confirmed TLDA results: a reduced level of the transcript was identified in PCa in comparison to NPT (p = 0.048). Moreover, the TMPRSS2-ERG-negative PCa cases showed significantly lower expression of ABCB1 in comparison to NPT (p = 0.003) or the fusion-positive tumors (p = 0.002). Promoter methylation of ABCB1 predominantly occurred in PCa and was rarely detected in NPT (p ABC transporter genes in PCa, especially in the TMPRSS2-ERG-negative tumors.
DEFF Research Database (Denmark)
Østergaard, Mette; Ernst, Anja; Labouriau, Rodrigo S.
2009-01-01
=0.006) and 1.39 ((0.99-1.92) p=0.054), respectively, and for UC of 2.63 ((1.33-5.26) p=0.005) and 1.28 ((0.96-1.51) p=0.093), respectively, assuming complete dominance. No association was found for BCRP or other MDR1 SNPs, or for selected MDR1 haplotypes. No effect-modification of smoking habit......OBJECTIVE: Crohn's disease (CD) and ulcerative colitis (UC) are characterized by an impaired mucosal defence to normal constituents of the intestinal flora and a dysregulated inflammatory response. The purpose of the study was to investigate whether single nucleotide polymorphisms (SNPs) in genes....../A, C3435T and G-rs3789243-A (intron 3) were assessed in a Danish case-control study comprising 373 CD and 541 UC patients and 796 healthy controls. RESULTS: Carriers of the homozygous COX-2 and MDR1 intron 3 variant had a relatively high risk of CD, odds ratio (95% CI) (OR (95% CI))=2.86 ((1.34-5.88) p...
International Nuclear Information System (INIS)
Saigusa, Susumu; Toiyama, Yuji; Tanaka, Koji; Okugawa, Yoshinaga; Fujikawa, Hiroyuki; Matsushita, Kohei; Uchida, Keiichi; Inoue, Yasuhiro; Kusunoki, Masato
2012-01-01
Most cancer cells exhibit increased glycolysis. The elevated glucose transporter 1 (GLUT1) expression has been reported to be associated with resistance to therapeutic agents and a poor prognosis. We wondered whether GLUT1 expression was associated with the clinical outcome in rectal cancer after preoperative chemoradiotherapy (CRT), and whether glycolysis inhibition could represent a novel anticancer treatment. We obtained total RNA from residual cancer cells using microdissection from a total of 52 rectal cancer specimens from patients who underwent preoperative CRT. We performed transcriptional analyzes, and studied the association of the GLUT1 gene expression levels with the clinical outcomes. In addition, we examined each proliferative response of three selected colorectal cancer cell lines to a glycolysis inhibitor, 3-bromopyruvic acid (3-BrPA), with regard to their expression of the GLUT1 gene. An elevated GLUT1 gene expression was associated with a high postoperative stage, the presence of lymph node metastasis, and distant recurrence. Moreover, elevated GLUT1 gene expression independently predicted both the recurrence-free and overall survival. In the in vitro studies, we observed that 3-BrPA significantly suppressed the proliferation of colon cancer cells with high GLUT1 gene expression, compared with those with low expression. An elevated GLUT1 expression may be a useful predictor of distant recurrence and poor prognosis in rectal cancer patients after preoperative CRT. (author)
Su, Mei-Tsz; Lin, Sheng-Hsiang; Chen, Yi-Chi; Kuo, Pao-Lin
2014-06-01
Both vascular endothelial growth factor A (VEGFA) and endocrine gland-derived vascular endothelial growth factor (EG-VEGF) systems play major roles in angiogenesis. A body of evidence suggests VEGFs regulate critical processes during pregnancy and have been associated with recurrent pregnancy loss (RPL). However, little information is available regarding the interaction of these two major major angiogenesis-related systems in early human pregnancy. This study was conducted to investigate the association of gene polymorphisms and gene-gene interaction among genes in VEGFA and EG-VEGF systems and idiopathic RPL. A total of 98 women with history of idiopathic RPL and 142 controls were included, and 5 functional SNPs selected from VEGFA, KDR, EG-VEGF (PROK1), PROKR1 and PROKR2 were genotyped. We used multifactor dimensionality reduction (MDR) analysis to choose a best model and evaluate gene-gene interactions. Ingenuity pathways analysis (IPA) was introduced to explore possible complex interactions. Two receptor gene polymorphisms [KDR (Q472H) and PROKR2 (V331M)] were significantly associated with idiopathic RPL (P<0.01). The MDR test revealed that the KDR (Q472H) polymorphism was the best loci to be associated with RPL (P=0.02). IPA revealed EG-VEGF and VEGFA systems shared several canonical signaling pathways that may contribute to gene-gene interactions, including the Akt, IL-8, EGFR, MAPK, SRC, VHL, HIF-1A and STAT3 signaling pathways. Two receptor gene polymorphisms [KDR (Q472H) and PROKR2 (V331M)] were significantly associated with idiopathic RPL. EG-VEGF and VEGFA systems shared several canonical signaling pathways that may contribute to gene-gene interactions, including the Akt, IL-8, EGFR, MAPK, SRC, VHL, HIF-1A and STAT3.
Directory of Open Access Journals (Sweden)
Adam Y Ye
Full Text Available Transporters are essential in homeostatic exchange of endogenous and exogenous substances at the systematic, organic, cellular, and subcellular levels. Gene mutations of transporters are often related to pharmacogenetics traits. Recent developments in high throughput technologies on genomics, transcriptomics and proteomics allow in depth studies of transporter genes in normal cellular processes and diverse disease conditions. The flood of high throughput data have resulted in urgent need for an updated knowledgebase with curated, organized, and annotated human transporters in an easily accessible way. Using a pipeline with the combination of automated keywords query, sequence similarity search and manual curation on transporters, we collected 1,555 human non-redundant transporter genes to develop the Human Transporter Database (HTD (http://htd.cbi.pku.edu.cn. Based on the extensive annotations, global properties of the transporter genes were illustrated, such as expression patterns and polymorphisms in relationships with their ligands. We noted that the human transporters were enriched in many fundamental biological processes such as oxidative phosphorylation and cardiac muscle contraction, and significantly associated with Mendelian and complex diseases such as epilepsy and sudden infant death syndrome. Overall, HTD provides a well-organized interface to facilitate research communities to search detailed molecular and genetic information of transporters for development of personalized medicine.
Anglicheau, Dany; Verstuyft, Céline; Laurent-Puig, Pierre; Becquemont, Laurent; Schlageter, Marie-Hélène; Cassinat, Bruno; Beaune, Philippe; Legendre, Christophe; Thervet, Eric
2003-07-01
The immunosuppressive drug tacrolimus, whose pharmacokinetic characteristics display large interindividual variations, is a substrate for P-glycoprotein (P-gp), the product of the multidrug resistance-1 (MDR1) gene. Some of the single nucleotide polymorphisms (SNP) of MDR1 reported correlated with the in vivo activity of P-gp. Because P-gp is known to control tacrolimus intestinal absorption, it was postulated that these polymorphisms are associated with tacrolimus pharmacokinetic variations in renal transplant recipients. The objective of this study was to evaluate in a retrospective study of 81 renal transplant recipients the effect on tacrolimus dosages and concentration/dose ratio of four frequent MDR1 SNP possibly associated with P-gp function (T-129C in exon 1b, 1236C>T in exon 12, 2677G>T,A in exon 21, and 3435C>T in exon 26). As in the general population, the SNP in exons 12, 21, and 26 were frequent (16, 17.3, and 22.2% for the variant homozygous genotype, respectively) and exhibited incomplete linkage disequilibrium. One month after tacrolimus introduction, exon 21 SNP correlated significantly with the daily tacrolimus dose (P < or = 0.05) and the concentration/dose ratio (P < or = 0.02). Tacrolimus dose requirements were 40% higher in homozygous than wild-type patients for this SNP. The concentration/dose ratio was 36% lower in the wild-type patients, suggesting that, for a given dose, their tacrolimus blood concentration is lower. Haplotype analysis substantiated these results and suggested that exons 26 and 21 SNP may be associated with tacrolimus dose requirements. Genotype monitoring of the MDR1 gene reliably predicts the optimal dose of tacrolimus in renal transplant recipients and may predict the initial daily dose needed by individual patients to obtain adequate immunosuppression.
Directory of Open Access Journals (Sweden)
Dietzel Kevin L
2012-12-01
Full Text Available Abstract Background The SNF3 gene in the yeast Saccharomyces cerevisiae encodes a low glucose sensor that regulates expression of an important subset of the hexose transporter (HXT superfamily. Null mutations of snf3 result in a defect in growth on low glucose concentrations due to the inability to relieve repression of a subset of the HXT genes. The snf3 null mutation phenotype is suppressed by the loss of either one of the downstream co-repressor proteins Rgt1p or Mth1p. The relief of repression allows expression of HXT transporter proteins, the resumption of glucose uptake and therefore of growth in the absence of a functional Snf3 sensor. Results Strains heterozygous for both the RGT1 and MTH1 genes (RGT1/rgt1Δ MTH1/mth1Δ snf3Δ/snf3Δ but homozygous for the snf3∆ were found to grow on low glucose. Since null alleles in the heterozygous state lead to suppression, MTH1 and RGT1 display the phenomenon of combined haploinsufficiency. This observed haploinsufficiency is consistent with the finding of repressor titration as a mechanism of suppression of snf3. Mutants of the STD1 homolog of MTH1 did not display haploinsufficiency singly or in combination with mutations in RGT1. HXT gene reporter fusion assays indicated that the presence of heterozygosity at the MTH1 and RGT1 alleles leads to increased expression of the HXT2 gene. Deletion of the HXT2 gene in a heterozygous diploid, RGT1/rgt1Δ MTH1/mth1Δ snf3Δ/snf3Δ hxt2Δ/hxt2Δ, prevented the suppression of snf3Δ. Conclusions These findings support the model of relief of repression as the mechanism of restoration of growth on low glucose concentrations in the absence of functional Snf3p. Further, the observation that HXT2 is the gene responsible for restoration of growth under these conditions suggests that the numbers of repressor binding domains found in the regulatory regions of members of the HXT family may have biological relevance and enable differential regulation.
Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression
International Nuclear Information System (INIS)
Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng
2008-01-01
Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression
Demile, Biresaw; Zenebu, Amare; Shewaye, Haile; Xia, Siqing; Guadie, Awoke
2018-05-31
Ethiopia is one of the world health organization defined higher tuberculosis (TB) burden countries where the disease remains a massive public health threat. This study aimed to identify the prevalence and associated factors of multidrug-resistant tuberculosis (MDR-TB) using all armed force and civilian TB attendants in a tertiary level armed force hospital, where data for MDR-TB are previously unpublished. Cross-sectional study was conducted from September 2014 to August 2015 in a tertiary level Armed Force Referral and Teaching Hospital (AFRTH), Ethiopia. Armed force members (n = 251) and civilians (n = 130) which has been undergone TB diagnosis at AFRTH were included. All the specimens collected were subjected to microscopic smear observation, culture growth and drug susceptibility testing. Data were analyzed using statistical package for social sciences following binary logistic regression and Chi-square. P-values < 0.05 were considered statistically significant. Among 381 TB patients, 355 (93.2%) new and 26 (6.8%) retreatment cases were identified. Culture and smear positive TB cases were identified in 297 (77.9%) and 252 (66.1%) patients, respectively. The overall prevalence of MDR-TB in AFRTH was found 1.8% (1.3% for armed force members and 0.5% for civilian patients) all of which were previously TB treated cases. The entire treatment success rates were 92.6% achieved highest in the armed force (active and pension) than the civilian patients. The failure and dead cases were also found 2.5 and 4.6%, respectively. Using bivariate analysis, category of attendants and TB contact history were strong predictors of MDR-TB in armed force and civilian patients. Moreover, human immunodeficiency virus (HIV) infection also identified a significant (OR = 14.6; 95% CI = 2.3-92.1; p = 0.004) predicting factor for MDR-TB in armed force members. However, sex, age and body mass index were not associated factor for MDR-TB. In AFRTH, lower prevalence of
Frequent down-regulation of ABC transporter genes in prostate cancer
International Nuclear Information System (INIS)
Demidenko, Rita; Razanauskas, Deividas; Daniunaite, Kristina; Lazutka, Juozas Rimantas; Jankevicius, Feliksas; Jarmalaite, Sonata
2015-01-01
ATP-binding cassette (ABC) transporters are transmembrane proteins responsible for the efflux of a wide variety of substrates, including steroid metabolites, through the cellular membranes. For better characterization of the role of ABC transporters in prostate cancer (PCa) development, the profile of ABC transporter gene expression was analyzed in PCa and noncancerous prostate tissues (NPT). TaqMan Low Density Array (TLDA) human ABC transporter plates were used for the gene expression profiling in 10 PCa and 6 NPT specimens. ABCB1 transcript level was evaluated in a larger set of PCa cases (N = 78) and NPT (N = 15) by real-time PCR, the same PCa cases were assessed for the gene promoter hypermethylation by methylation-specific PCR. Expression of eight ABC transporter genes (ABCA8, ABCB1, ABCC6, ABCC9, ABCC10, ABCD2, ABCG2, and ABCG4) was significantly down-regulated in PCa as compared to NPT, and only two genes (ABCC4 and ABCG1) were up-regulated. Down-regulation of ABC transporter genes was prevalent in the TMPRSS2-ERG-negative cases. A detailed analysis of ABCB1 expression confirmed TLDA results: a reduced level of the transcript was identified in PCa in comparison to NPT (p = 0.048). Moreover, the TMPRSS2-ERG-negative PCa cases showed significantly lower expression of ABCB1 in comparison to NPT (p = 0.003) or the fusion-positive tumors (p = 0.002). Promoter methylation of ABCB1 predominantly occurred in PCa and was rarely detected in NPT (p < 0.001). The study suggests frequent down-regulation of the ABC transporter genes in PCa, especially in the TMPRSS2-ERG-negative tumors. The online version of this article (doi:10.1186/s12885-015-1689-8) contains supplementary material, which is available to authorized users
Pappas, Jane J; Petropoulos, Sophie; Suderman, Matthew; Iqbal, Majid; Moisiadis, Vasilis; Turecki, Gustavo; Matthews, Stephen G; Szyf, Moshe
2014-01-01
The Multidrug Resistance 1 (MDR1; alternatively ABCB1) gene product P-glycoprotein (P-gp), an ATP binding cassette transporter, extrudes multiple endogenous and exogenous substrates from the cell, playing an important role in normal physiology and xenobiotic distribution and bioavailability. To date, the predominant animal models used to investigate the role of P-gp have been the mouse and rat, which have two distinct genes, Abcb1a and Abcb1b. In contrast, the human has a single gene, ABCB1, for which only a single isoform has been validated. We and others have previously shown important differences between Abcb1a and Abcb1b, limiting the extrapolation from rodent findings to the human. Since the guinea pig has a relatively long gestation, hemomonochorial placentation and neuroanatomically mature offspring, it is more similar to the human, and may provide a more comparable model for investigating the regulation of P-gp in the brain and placenta, however, to date, the Abcb1 gene in the guinea pig remains to be characterized. The placenta and fetal brain are barrier sites that express P-gp and that play a critical role of protection of the fetus and the fetal brain from maternally administered drugs and other xenobiotics. Using RNA sequencing (RNA-seq), reverse transcription-polymerase chain reaction (RT-PCR) and quantitative PCR (QPCR) to sequence the expressed isoforms of guinea pig Abcb1, we demonstrate that like the human, the guinea pig genome contains one gene for Abcb1 but that it is expressed as at least three different isoforms via alternative splicing and alternate exon usage. Further, we demonstrate that these isoforms are more closely related to human than to rat or mouse isoforms. This striking, overall similarity and evolutionary relatedness between guinea pig Abcb1 and human ABCB1 indicate that the guinea pig represents a relevant animal model for investigating the function and regulation of P-gp in the placenta and brain.
International Nuclear Information System (INIS)
Kinuya, S.; Yokoyama, K; Fukuoka, M.; Michigishi, T.; Tonami, N.; Shiba, K.; Mori, H.; Watanabe, N.; Shuke, N.
2006-01-01
We examined the feasibility of Tc-99m sestamibi to monitor changes of mRNA expression of MDRl/P-glycoprotein (Pgp) following antisense oligodeoxynucleotide (AS-ODN) treatment in vivo. Three days after the intraperitoneal inoculation of murine leukaemia P388/R cells expressing MDR1/P-gp in CDFI mice, 15-mer phosphorothioate ASODN to the initiation codon of mouse mdr1 mRNA was administered intraperitoneally at 10 mg/kg daily for 3 or 4 days. Cells collected from ascites were suspended in medium for Tc-99m sestamibi uptake studies. To know the duration of antisense effects, cells were harvested 2 days later after the 3-day treatment. AS-ODN treatment increased Tc-99m sestamibi uptake. Effects of 3-day treatment and 4-day treatment were the same. Treatment effects were not detected when uptake was observed 2 days after 3-day treatment. Based on the results it was concluded that in vivo treatment with AS-ODN specific to the coding portion of mdr1 mRNA increased Tc-99m sestamibi uptake in leukaemia cells possessing MDR function. (author)
Rapid Screening of MDR-TB in Cases of Extra Pulmonary Tuberculosis Using Geno Type MTBDRplus.
Directory of Open Access Journals (Sweden)
Richa Kumari
Full Text Available Drug resistance in tuberculosis is a major public health challenge in developing countries. The limited data available on drug resistance in extra pulmonary tuberculosis stimulated us to design our study on anti-tuberculosis drug resistance pattern in cases of extra pulmonary tuberculosis in a tertiary referral hospital of North India. We performed Geno Type MTBDRplus assay in comparison with conventional drug susceptibility testing by proportion method to study the mutation patterns in rpoB, katG and inhA genes.A total of 510 extra pulmonary samples were included in this study. After the smear microscopy, all the specimens were subjected for culture on Lowenstein Jensen (LJ media. Phenotypic drug susceptibility testing (DST was performed on LJ media for all the MTB isolates and compared with the results of Geno Type MTBDRplus assay which was performed with the DNA isolated from the culture by conventional method.Of 510 specimens cultured, the total culture positivity obtained was 11.8% (60 encompassing 54 (10.6% Mycobacterium tuberculosis and 6 (1.2% non-tubercular mycobacteria (NTM. DST results by Geno Type MTBDRplus assay and solid culture methods were compared in 51 MTB isolates excluding the two Rif indeterminate and one invalid test. Geno Type MTBDRplus accurately identified 13 of 14 rifampicin-resistant strains, 14 of 15 isoniazid-resistant strains and 13 of 14 as multi drug resistant tuberculosis (MDR-TB in comparison with conventional method. Sensitivity and specificity were 92.86% and 97.30% respectively for detection of RIF resistance, 93.33% and 94.44% respectively for detection of INH resistance, 92.86% and 97.30% respectively for detection of MDR-TB, while the overall concordance of Geno Type MTBDRplus assay with conventional DST was 94.11%. The turn-around time for performing Geno Type MTBDRplus assay test was 48 hours.The problem of MDR in extra pulmonary tuberculosis (EPTB cannot be overlooked and due attention on patients
Valdez, Benigno C; Li, Yang; Murray, David; Brammer, Jonathan E; Liu, Yan; Hosing, Chitra; Nieto, Yago; Champlin, Richard E; Andersson, Borje S
2016-09-27
HDAC inhibitors, DNA alkylators and nucleoside analogs are effective components of combination chemotherapy. To determine a possible mechanism of their synergism, we analyzed the effects of HDAC inhibitors on the expression of drug transporters which export DNA alkylators. Exposure of PEER lymphoma T-cells to 15 nM romidepsin (Rom) resulted in 40%-50% reduction in mRNA for the drug transporter MRP1 and up to ~500-fold increase in the MDR1 mRNA within 32-48 hrs. MRP1 protein levels concomitantly decreased while MDR1 increased. Other HDAC inhibitors - panobinostat, belinostat and suberoylanilide hydroxamic acid (SAHA) - had similar effects on these transporters. The protein level of MRP1 correlated with cellular resistance to busulfan and chlorambucil, and Rom exposure sensitized cells to these DNA alkylators. The decrease in MRP1 correlated with decreased cellular drug export activity, and increased level of MDR1 correlated with increased export of daunorubicin. A similar decrease in the level of MRP1 protein, and increase in MDR1, were observed when mononuclear cells derived from patients with T-cell malignancies were exposed to Rom. Decreased MRP1 and increased MDR1 expressions were also observed in blood mononuclear cells from lymphoma patients who received SAHA-containing chemotherapy in a clinical trial. This inhibitory effect of HDAC inhibitors on the expression of MRP1 suggests that their synergism with DNA alkylating agents is partly due to decreased efflux of these alkylators. Our results further imply the possibility of antagonistic effects when HDAC inhibitors are combined with anthracyclines and other MDR1 drug ligands in chemotherapy.
Directory of Open Access Journals (Sweden)
Luk Ketut Budi Maitriani
2015-10-01
Full Text Available ABSTRAK : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb. ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is
Network Graph Analysis of Gene-Gene Interactions in Genome-Wide Association Study Data
Directory of Open Access Journals (Sweden)
Sungyoung Lee
2012-12-01
Full Text Available Most common complex traits, such as obesity, hypertension, diabetes, and cancers, are known to be associated with multiple genes, environmental factors, and their epistasis. Recently, the development of advanced genotyping technologies has allowed us to perform genome-wide association studies (GWASs. For detecting the effects of multiple genes on complex traits, many approaches have been proposed for GWASs. Multifactor dimensionality reduction (MDR is one of the powerful and efficient methods for detecting high-order gene-gene (GxG interactions. However, the biological interpretation of GxG interactions identified by MDR analysis is not easy. In order to aid the interpretation of MDR results, we propose a network graph analysis to elucidate the meaning of identified GxG interactions. The proposed network graph analysis consists of three steps. The first step is for performing GxG interaction analysis using MDR analysis. The second step is to draw the network graph using the MDR result. The third step is to provide biological evidence of the identified GxG interaction using external biological databases. The proposed method was applied to Korean Association Resource (KARE data, containing 8838 individuals with 327,632 single-nucleotide polymorphisms, in order to perform GxG interaction analysis of body mass index (BMI. Our network graph analysis successfully showed that many identified GxG interactions have known biological evidence related to BMI. We expect that our network graph analysis will be helpful to interpret the biological meaning of GxG interactions.
Network graph analysis of gene-gene interactions in genome-wide association study data.
Lee, Sungyoung; Kwon, Min-Seok; Park, Taesung
2012-12-01
Most common complex traits, such as obesity, hypertension, diabetes, and cancers, are known to be associated with multiple genes, environmental factors, and their epistasis. Recently, the development of advanced genotyping technologies has allowed us to perform genome-wide association studies (GWASs). For detecting the effects of multiple genes on complex traits, many approaches have been proposed for GWASs. Multifactor dimensionality reduction (MDR) is one of the powerful and efficient methods for detecting high-order gene-gene (GxG) interactions. However, the biological interpretation of GxG interactions identified by MDR analysis is not easy. In order to aid the interpretation of MDR results, we propose a network graph analysis to elucidate the meaning of identified GxG interactions. The proposed network graph analysis consists of three steps. The first step is for performing GxG interaction analysis using MDR analysis. The second step is to draw the network graph using the MDR result. The third step is to provide biological evidence of the identified GxG interaction using external biological databases. The proposed method was applied to Korean Association Resource (KARE) data, containing 8838 individuals with 327,632 single-nucleotide polymorphisms, in order to perform GxG interaction analysis of body mass index (BMI). Our network graph analysis successfully showed that many identified GxG interactions have known biological evidence related to BMI. We expect that our network graph analysis will be helpful to interpret the biological meaning of GxG interactions.
Directory of Open Access Journals (Sweden)
Mette L Schousboe
2015-11-01
Full Text Available Chloroquine combined with primaquine has been the recommended antimalarial treatment of Plasmodium vivax malaria infections for six decades but the efficacy of this treatment regimen is threatened by chloroquine resistance (CQR. Single nucleotide polymorphisms (SNPs in the multidrug resistance gene, Pvmdr1 are putative determinants of CQR but the extent of their emergence at population level remains to be explored.In this study we describe the prevalence of SNPs in the Pvmdr1 among samples collected in seven P. vivax endemic countries and we looked for molecular evidence of drug selection by characterising polymorphism at microsatellite (MS loci flanking the Pvmdr1 gene.We examined the prevalence of SNPs in the Pvmdr1 gene among 267 samples collected from Pakistan, Afghanistan, Sri Lanka, Nepal, Sudan, São Tomé and Ecuador. We measured and diversity in four microsatellite (MS markers flanking the Pvmdr1 gene to look evidence of selection on mutant alleles.SNP polymorphism in the Pvmdr1 gene was largely confined to codons T958M, Y976F and F1076L. Only 2.4% of samples were wildtype at all three codons (TYF, n = 5, 13.3% (n = 28 of the samples were single mutant MYF, 63.0% of samples (n = 133 were double mutant MYL, and 21.3% (n = 45 were triple mutant MFL. Clear geographic differences in the prevalence of these Pvmdr mutation combinations were observed. Significant linkage disequilibrium (LD between Pvmdr1 and MS alleles was found in populations sampled in Ecuador, Nepal and Sri Lanka, while significant LD between Pvmdr1 and the combined 4 MS locus haplotype was only seen in Ecuador and Sri Lanka. When combining the 5 loci, high level diversity, measured as expected heterozygosity (He, was seen in the complete sample set (He = 0.99, while He estimates for individual loci ranged from 0.00-0.93. Although Pvmdr1 haplotypes were not consistently associated with specific flanking MS alleles, there was significant differentiation between geographic
Lebedeva, Irina V; Pande, Praveen; Patton, Wayne F
2011-01-01
An underlying mechanism for multi drug resistance (MDR) is up-regulation of the transmembrane ATP-binding cassette (ABC) transporter proteins. ABC transporters also determine the general fate and effect of pharmaceutical agents in the body. The three major types of ABC transporters are MDR1 (P-gp, P-glycoprotein, ABCB1), MRP1/2 (ABCC1/2) and BCRP/MXR (ABCG2) proteins. Flow cytometry (FCM) allows determination of the functional expression levels of ABC transporters in live cells, but most dyes used as indicators (rhodamine 123, DiOC(2)(3), calcein-AM) have limited applicability as they do not detect all three major types of ABC transporters. Dyes with broad coverage (such as doxorubicin, daunorubicin and mitoxantrone) lack sensitivity due to overall dimness and thus may yield a significant percentage of false negative results. We describe two novel fluorescent probes that are substrates for all three common types of ABC transporters and can serve as indicators of MDR in flow cytometry assays using live cells. The probes exhibit fast internalization, favorable uptake/efflux kinetics and high sensitivity of MDR detection, as established by multidrug resistance activity factor (MAF) values and Kolmogorov-Smirnov statistical analysis. Used in combination with general or specific inhibitors of ABC transporters, both dyes readily identify functional efflux and are capable of detecting small levels of efflux as well as defining the type of multidrug resistance. The assay can be applied to the screening of putative modulators of ABC transporters, facilitating rapid, reproducible, specific and relatively simple functional detection of ABC transporter activity, and ready implementation on widely available instruments.
Directory of Open Access Journals (Sweden)
Delianis Pringgenies
2014-03-01
The bacteria resistant to some antibiotics are known as multi drug resistant (MDR. To overcome the problem, it is needed to search for a new antibiotic compounds more effectively and efficiently. This study aims to identify potential from symbionts of Pleuroploca trapezium as a source of antibacteria MDR and identifying the bacteria that were active against the MDR. Samples were collected from Ternate, Maluku. Isolation of symbiotic bacteria, screening for bacteria which producing secondary metabolites as anti-MDR bacteria, antibacterial test, isolation of clinical pathogenic bacteria of MDR. Conducting anti-bacterial sensitivity test, sensitivity test for antibacterial, DNA exctraction, DNA amplification based on PCR method, DNA sequencing. Result of 16S r-DNA sequence was then analyzed and edited using GENETYX program and followed by 16S rDNA sequence analysis. Screening of bacteria associated with P. trapezium resulted in 19 isolates with 5 active bacteria. Based on the size of the zone forming and the consistency of zone, so the best isolate is TPT 4.7. The identification shows that TPT 4.7 has a close relationship with the Paracoccus sp. MBIC4019 with homologi of 95%, which shows the relationship at the genus level. Its suggest that these results are very promising as a new antibacterial material. Keywords: antibacterial, symbiotic bacteria, Pleuroploca trapezium, multi drugs resistant
International Nuclear Information System (INIS)
Kobayashi, Masato; Nakanishi, Takeo; Nishi, Kodai; Higaki, Yusuke; Okudaira, Hiroyuki; Ono, Masahiro; Tsujiuchi, Takafumi; Mizutani, Asuka; Nishii, Ryuichi; Tamai, Ikumi; Arano, Yasushi; Kawai, Keiichi
2014-01-01
by OATP1B1 and OATP1B3, and excretion into bile canaliculi via MDR1 and MRP2. 99m Tc-PMT hepatobiliary scintigraphy may be a useful ligand as a noninvasive method of visualizing and quantifying hepatobiliary transporter functionality, which could predict drug pharmacokinetics
Dodge, Matthew A; Waller, Ross F; Chow, Larry M C; Zaman, Muhammad M; Cotton, Leanne M; McConville, Malcolm J; Wirth, Dyann F
2004-03-01
Upregulation of the multidrug resistance protein 1 (LeMDR1) in the protozoan parasite, Leishmania enriettii, confers resistance to hydrophobic drugs such as vinblastine, but increases the sensitivity of these parasites to the mitochondrial drug, rhodamine 123. In order to investigate the mechanism of action of LeMDR1, the subcellular localization of green fluorescent protein (GFP)-tagged versions of LeMDR1 and the fate of the traceable-fluorescent LeMDR1 substrate calcein AM were examined in both Leishmania mexicana and L. enriettii LeMDR1 -/- and overexpressing cell lines. The LeMDR1-GFP chimera was localized by fluorescence microscopy to a number of secretory and endocytic compartments, including the Golgi apparatus, endoplasmic reticulum (ER) and a multivesicular tubule (MVT)-lysosome. Pulse-chase labelling experiments with calcein AM suggested that the Golgi and ER pools, but not the MVT-lysosome pool, of LeMDR1 were active in pumping calcein AM out of the cell. Cells labelled with calcein AM under conditions that slow vesicular transport (low temperature and stationary growth) inhibited export and resulted in the accumulation of fluorescent calcein in both the Golgi and the mitochondria. We propose that LeMDR1 substrates are pumped into secretory compartments and exported from the parasite by exocytosis. Accumulation of MDR substrates in the ER can result in alternative transport to the mitochondrion, explaining the reciprocal sensitivity of drug-resistant Leishmania to vinblastine and rhodamine 123.
Stein, Ulrike; Bergmann, Stephan; Scheffer, George L; Scheper, Rik J; Royer, Hans-Dieter; Schlag, Peter M; Walther, Wolfgang
2005-05-19
Vaults have been suggested to play a direct role in multidrug resistance (MDR) to anticancer drugs. The human major vault protein (MVP) also known as lung resistance-related protein (LRP) represents the predominant component of vaults that may be involved in the defense against xenobiotics. Here, we demonstrate that besides MDR-related cytostatics, also the non-MDR-related drug 5-fluorouracil (5-FU) was able to induce MVP mRNA and protein expression. Treatment with 5-FU amplified the binding activity and interaction of the transcription factor Y-box binding protein-1 (YB-1) with the Y-box of the human MVP gene promoter in a time-dependent manner. 5-FU also induced reporter expressions driven by a panel of newly generated MVP promoter deletion mutants. Interestingly, stably YB-1 overexpressing cell clones showed enhanced binding of YB-1 to the Y-box motif, associated with enhanced basal as well as 5-FU-inducible MVP promoter-driven reporter expressions. Moreover, transduction of YB-1 cDNA led to increased expression of endogenous MVP protein. Under physiological conditions, we observed a strong coexpression of MVP and YB-1 in human colon carcinoma specimen. In summary, our data demonstrate a direct involvement of YB-1 in controlling basal and 5-FU-induced MVP promoter activity. Therefore, YB-1 is directly linked to MVP-mediated drug resistance.
Directory of Open Access Journals (Sweden)
Maleki
2016-09-01
Full Text Available Background Urinary tract infection (UTI is one of the most common infectious diseases and nosocomial infections worldwide, and uropathogenic Escherichia coli is the primary cause of UTI. Due to increased antibiotic resistance and the emergence of multidrug resistant (MDR UPEC clones, the treatment of UTI is difficult. The occurrence of MDR in E. coli has been attributed to the AcrAB-TolC complex of efflux pumps. Objectives The aim of this study was to complete a frequency evaluation of acrA and acrB genes among UPEC MDR strains isolated from patients with UTI who were admitted to Milad hospital in Tehran. Methods For 123 UPEC strains that were isolated and diagnosed from the urine samples of patients using biochemical tests, antibiotic susceptibility was carried out using the disc diffusion method according to CLSI guidelines. Isolates that were resistant to at least one antimicrobial agent in three or more of the categories were considered to be MDR. The presence and frequency of acrA and acrB genes was determined using PCR. Results The rates of antibiotic resistance to ampicillin, cefalotin, tetracycline, cefazolin, ceftriaxone, ceftizoxime, ceftazidime, ciprofloxacin, and cotrimoxazole were 82.9%, 78.1%, 61.1%, 49.5%, 38.2%, 30.2%, 26.1%, 42.2%, and 60.1%, respectively. The isolates were most sensitive to nitrofurantoin (95.9%, gentamicin (77.2%, and amikacin (71.5%. A total of 78% of the isolates were MDR. The frequency of the acrA gene was 82.90%, the acrB gene was 95.90% and acrA + acrB was 95.90%. There was no significant difference between acrA and acrB frequency relating to bacterial antibiotic resistance. Conclusions Our results showed that ways to control the treatment of UTI for the prevention of MDR occurrence should be sought. For a better study of efflux pumps, a comprehensive and detailed study regarding the presence of efflux pumps gees is required.
Directory of Open Access Journals (Sweden)
Shiro Ueda
2010-09-01
Full Text Available This study investigated gene expression of drug resistance factors in biopsy tissue samples from hepatocellular carcinoma (HCC patients undergoing chemotherapy by platinum complex. Liver biopsy was performed to collect tissue from the tumor site (T and the non-tumor site (NT prior to the start of treatment. For drug-resistant factors, drug excretion transporters cMOAT and MDR-1, intracellular metal binding protein MT2, DNA repair enzyme ERCC-l and inter-nucleic cell transport protein MVP, were investigated. The comparison of the expression between T and NT indicated a significant decrease of MT2 and MDR-1 in T while a significant increase in ERCC-1 was noted in T. Further, expression was compared between the response cases and non-response cases using the ratios of expression in T to those in NT. The response rate was significantly low in the high expression group when the cutoff value of cMOAT and MT2 was set at 1.5 and 1.0, respectively. Furthermore, when the patients were classified into A group (cMOAT ≧ 1.5 or MT2 ≧ 1.0 and B group (cMOAT < 1.5 and MT2 < 1.0, the response rate of A group was significantly lower than B group when we combined the cutoff values of cMOAT and MT2. It is considered possible to estimate the therapeutic effect of platinum complex at a high probability by combining the expression condition of these two genes.
Baum, C; Peinert, S; Carpinteiro, A; Eckert, H G; Fairbairn, L J
2000-05-01
Genetic transfer and expression of drug-resistance functions into haematopoietic stem and progenitor cells is a promising means to overcome both the acute and longterm side-effects of cytotoxic drugs in bone marrow. Here, we describe a functional analysis of a retroviral vector that co-expresses human cDNAs for multidrug resistance 1/P-glycoprotein (MDR1) and a double mutant of O(6)-alkylguanine-alkyltransferase (hATPA/GA) to high levels. The hATPA/GA protein contains two amino acid substitutions that render it resistant to compounds such as O(6)-benzylguanine that inhibit the wild-type protein which is often overexpressed in resistant tumour cells. Evidence for simultaneous drug resistance of genetically modified primary murine progenitor cells to colchicine or the podophyllotoxin etoposide, both covered by MDR1-mediated efflux activity, and the nitrosourea BCNU, which is counteracted by hATPA/GA, is presented using in vitro colony assays.
DEFF Research Database (Denmark)
Venkatesan, Meera; Gadalla, Nahla B; Stepniewska, Kasia
2014-01-01
Adequate clinical and parasitologic cure by artemisinin combination therapies relies on the artemisinin component and the partner drug. Polymorphisms in the Plasmodium falciparum chloroquine resistance transporter (pfcrt) and P. falciparum multidrug resistance 1 (pfmdr1) genes are associated...... with decreased sensitivity to amodiaquine and lumefantrine, but effects of these polymorphisms on therapeutic responses to artesunate-amodiaquine (ASAQ) and artemether-lumefantrine (AL) have not been clearly defined. Individual patient data from 31 clinical trials were harmonized and pooled by using standardized...
Directory of Open Access Journals (Sweden)
Jessica A. Simpkins
2016-06-01
Full Text Available Cystine and cysteine are important molecules for pathways such as redox signaling and regulation, and thus identifying cellular deficits upon deletion of the Saccharomyces cerevisiae cystine transporter Ers1p allows for a further understanding of cystine homeostasis. Previous complementation studies using the human ortholog suggest yeast Ers1p is a cystine transporter. Human CTNS encodes the protein Cystinosin, a cystine transporter that is embedded in the lysosomal membrane and facilitates the export of cystine from the lysosome. When CTNS is mutated, cystine transport is disrupted, leading to cystine accumulation, the diagnostic hallmark of the lysosomal storage disorder cystinosis. Here, we provide biochemical evidence for Ers1p-dependent cystine transport. However, the accumulation of intracellular cystine is not observed when the ERS1 gene is deleted from ers1-Δ yeast, supporting the existence of modifier genes that provide a mechanism in ers1-Δ yeast that prevents or corrects cystine accumulation. Upon comparison of the transcriptomes of isogenic ERS1+ and ers1-Δ strains of S. cerevisiae by DNA microarray followed by targeted qPCR, sixteen genes were identified as being differentially expressed between the two genotypes. Genes that encode proteins functioning in sulfur regulation, cellular respiration, and general transport were enriched in our screen, demonstrating pleiotropic effects of ers1-Δ. These results give insight into yeast cystine regulation and the multiple, seemingly distal, pathways that involve proper cystine recycling.
A genetic ensemble approach for gene-gene interaction identification
Directory of Open Access Journals (Sweden)
Ho Joshua WK
2010-10-01
Full Text Available Abstract Background It has now become clear that gene-gene interactions and gene-environment interactions are ubiquitous and fundamental mechanisms for the development of complex diseases. Though a considerable effort has been put into developing statistical models and algorithmic strategies for identifying such interactions, the accurate identification of those genetic interactions has been proven to be very challenging. Methods In this paper, we propose a new approach for identifying such gene-gene and gene-environment interactions underlying complex diseases. This is a hybrid algorithm and it combines genetic algorithm (GA and an ensemble of classifiers (called genetic ensemble. Using this approach, the original problem of SNP interaction identification is converted into a data mining problem of combinatorial feature selection. By collecting various single nucleotide polymorphisms (SNP subsets as well as environmental factors generated in multiple GA runs, patterns of gene-gene and gene-environment interactions can be extracted using a simple combinatorial ranking method. Also considered in this study is the idea of combining identification results obtained from multiple algorithms. A novel formula based on pairwise double fault is designed to quantify the degree of complementarity. Conclusions Our simulation study demonstrates that the proposed genetic ensemble algorithm has comparable identification power to Multifactor Dimensionality Reduction (MDR and is slightly better than Polymorphism Interaction Analysis (PIA, which are the two most popular methods for gene-gene interaction identification. More importantly, the identification results generated by using our genetic ensemble algorithm are highly complementary to those obtained by PIA and MDR. Experimental results from our simulation studies and real world data application also confirm the effectiveness of the proposed genetic ensemble algorithm, as well as the potential benefits of
Multi drug resistance to cancer chemotherapy: Genes involved and blockers
International Nuclear Information System (INIS)
Sayed-Ahmed, Mohamed M.
2007-01-01
During the last three decades, important and considerable research efforts had been performed to investigate the mechanism through which cancer cells overcome the cytotoxic effects of a variety of chemotherapeutic drugs. Most of the previously published work has been focused on the resistance of tumor cells to those anticancer drugs of natural source. Multidrug resistance (MDR) is a cellular cross-resistance to a broad spectrum of natural products used in cancer chemotherapy and is believed to be the major cause of the therapeutic failures of the drugs belonging to different naturally obtained or semisynthetic groups including vinca alkaloids, taxans, epipodophyllotoxins and certain antibiotics. This phenomenon results from overexpression of four MDR genes and their corresponding proteins that act as membrane-bound ATP consuming pumps. These proteins mediate the efflux of many structurally and functionally unrelated anticancer drugs of natural source. MDR may be intrinsic or acquired following exposure to chemotherapy. The existence of intrinsically resistant tumor cell clone before and following chemotherapeutic treatment has been associated with a worse final outcome because of increased incidence of distant metasis. In view of irreplaceability of natural product anticancer drugs as effective chemotherapeutic agents, and in view of MDR as a major obstacle to successful chemotherapy, this review is aimed to highlight the genes involved in MDR, classical MDR blockers and gene therapy approaches to overcome MDR. (author)
Happi, C. T.; Gbotosho, G. O.; Folarin, O. A.; Sowunmi, A.; Hudson, T.; O'Neil, M.; Milhous, W.; Wirth, D. F.; Oduola, A. M. J.
2008-01-01
We assessed Plasmodium falciparum mdr1 (Pfmdr1) gene polymorphisms and copy numbers as well as P. falciparum Ca2+ ATPase (PfATPase6) gene polymorphisms in 90 Nigerian children presenting with uncomplicated falciparum malaria and enrolled in a study of the efficacy of artemether-lumefantrine (AL). The nested PCR-restriction fragment length polymorphism and the quantitative real-time PCR methodologies were used to determine the alleles of the Pfmdr1 and PfATPase6 genes and the Pfmdr1 copy numbe...
bmr3, a third multidrug transporter gene of Bacillus subtilis.
Ohki, R; Murata, M
1997-01-01
A third multidrug transporter gene named bmr3 was cloned from Bacillus subtilis. Although Bmr3 shows relatively low homology to Bmr and Blt, the substrate specificities of these three transporters overlap. Northern hybridization analysis showed that expression of the bmr3 gene was dependent on the growth phase.
Directory of Open Access Journals (Sweden)
Polin Haghvirdizadeh
2015-01-01
Full Text Available Background. Type 2 diabetes mellitus (T2DM is a complex polygenic disorder characterized by impaired insulin resistance, insulin secretion, and dysregulation of lipid and protein metabolism with environmental and genetic factors. ATP-binding cassette transporter A1 (ABCA1 gene polymorphisms are reported as the one of the genetic risk factors for T2DM in various populations with conflicting results. This study was conducted based on PCR-HRM to determine the frequency of ABCA1 gene by rs2230806 (R219K, rs1800977 (C69T, and rs9282541 (R230C polymorphisms Malaysian subjects. Methods. A total of 164 T2DM and 165 controls were recruited and their genotypes for ABCA1 gene polymorphisms were determined based on the real time high resolution melting analysis. Results. There was a significant difference between the subjects in terms of age, BMI, FPG, HbA1c, HDL, LDL, and TG P<0.05. There was a significant association between HOM of R219K P=0.005, among Malaysian subjects; moreover, allele frequency revealed the significant difference in A allele of R219K P=0.003. But, there was no significant difference in genotypic and allelic frequencies of C69T and R230C polymorphism. Conclusion. R219K polymorphism of ABCA1 gene can be considered as a genetic risk factor for T2DM subjects among Malaysians.
Directory of Open Access Journals (Sweden)
Thomas Lettner
Full Text Available BACKGROUND: Hyphal growth and multidrug resistance of C. albicans are important features for virulence and antifungal therapy of this pathogenic fungus. METHODOLOGY/PRINCIPAL FINDINGS: Here we show by phenotypic complementation analysis that the C. albicans gene AGE3 is the functional ortholog of the yeast ARF-GAP-encoding gene GCS1. The finding that the gene is required for efficient endocytosis points to an important functional role of Age3p in endosomal compartments. Most C. albicans age3Delta mutant cells which grew as cell clusters under yeast growth conditions showed defects in filamentation under different hyphal growth conditions and were almost completely disabled for invasive filamentous growth. Under hyphal growth conditions only a fraction of age3Delta cells shows a wild-type-like polarization pattern of the actin cytoskeleton and lipid rafts. Moreover, age3Delta cells were highly susceptible to several unrelated toxic compounds including antifungal azole drugs. Irrespective of the AGE3 genotype, C-terminal fusions of GFP to the drug efflux pumps Cdr1p and Mdr1p were predominantly localized in the plasma membrane. Moreover, the plasma membranes of wild-type and age3Delta mutant cells contained similar amounts of Cdr1p, Cdr2p and Mdr1p. CONCLUSIONS/SIGNIFICANCE: The results indicate that the defect in sustaining filament elongation is probably caused by the failure of age3Delta cells to polarize the actin cytoskeleton and possibly of inefficient endocytosis. The high susceptibility of age3Delta cells to azoles is not caused by inefficient transport of efflux pumps to the cell membrane. A possible role of a vacuolar defect of age3Delta cells in drug susceptibility is proposed and discussed. In conclusion, our study shows that the ARF-GAP Age3p is required for hyphal growth which is an important virulence factor of C. albicans and essential for detoxification of azole drugs which are routinely used for antifungal therapy. Thus, it
Directory of Open Access Journals (Sweden)
Atanassova Rossitza
2010-11-01
Full Text Available Abstract Background In higher plants, sugars are not only nutrients but also important signal molecules. They are distributed through the plant via sugar transporters, which are involved not only in sugar long-distance transport via the loading and the unloading of the conducting complex, but also in sugar allocation into source and sink cells. The availability of the recently released grapevine genome sequence offers the opportunity to identify sucrose and monosaccharide transporter gene families in a woody species and to compare them with those of the herbaceous Arabidopsis thaliana using a phylogenetic analysis. Results In grapevine, one of the most economically important fruit crop in the world, it appeared that sucrose and monosaccharide transporter genes are present in 4 and 59 loci, respectively and that the monosaccharide transporter family can be divided into 7 subfamilies. Phylogenetic analysis of protein sequences has indicated that orthologs exist between Vitis and Arabidospis. A search for cis-regulatory elements in the promoter sequences of the most characterized transporter gene families (sucrose, hexoses and polyols transporters, has revealed that some of them might probably be regulated by sugars. To profile several genes simultaneously, we created a macroarray bearing cDNA fragments specific to 20 sugar transporter genes. This macroarray analysis has revealed that two hexose (VvHT1, VvHT3, one polyol (VvPMT5 and one sucrose (VvSUC27 transporter genes, are highly expressed in most vegetative organs. The expression of one hexose transporter (VvHT2 and two tonoplastic monosaccharide transporter (VvTMT1, VvTMT2 genes are regulated during berry development. Finally, three putative hexose transporter genes show a preferential organ specificity being highly expressed in seeds (VvHT3, VvHT5, in roots (VvHT2 or in mature leaves (VvHT5. Conclusions This study provides an exhaustive survey of sugar transporter genes in Vitis vinifera and
Tamburro, Manuela; Ripabelli, Giancarlo; Vitullo, Monia; Dallman, Timothy James; Pontello, Mirella; Amar, Corinne Francoise Laurence; Sammarco, Michela Lucia
2015-06-01
In this study, tolerance at sublethal concentration of benzalkonium chloride and transcription levels of mdrL, ladR, lde, sigB and bcrABC genes in Listeria monocytogenes strains were evaluated. Viable cells reduction occurred in 45% of strains and clinical isolates showed lower sensitivity than isolates from foods. An increased transcription of an efflux system encoding gene was found in 60% of strains, and simultaneous mdrL overexpression and ladR underexpression occurred in 30% of isolates. A significant association between reduced benzalkonium chloride activity and both mdrL and sigB overexpression was observed; sigB expression also correlated with both mdrL and ladR genes. The bcrABC gene was only found in six strains, all isolated from foods and sensitive to benzalkonium chloride, and in four strains an underexpression was observed. Disinfection at sublethal concentration was less effective in clinical isolates, and mdrL and sigB expression was significantly affected by disinfection. Further insights are needed to understand the adaptation to benzalkonium chloride and to evaluate whether changes in gene expression could affect the L. monocytogenes virulence traits and persistence in the environment. Copyright © 2015 Elsevier Ltd. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Mandíková, J.; Volková, M.; Pávek, P.; Česnek, Michal; Janeba, Zlatko; Kubíček, V.; Trejtnar, F.
2013-01-01
Roč. 311, č. 3 (2013), s. 135-146 ISSN 0300-483X Institutional support: RVO:61388963 Keywords : hOAT1 * hCNTs * MDR1 * BCRP * nephrotoxicity * transmembrane transport Subject RIV: FR - Pharmacology ; Medidal Chemistry Impact factor: 3.745, year: 2013
Molecular approaches for detection of the multi-drug resistant tuberculosis (MDR-TB in Bangladesh.
Directory of Open Access Journals (Sweden)
Tafsina Haque Aurin
Full Text Available The principal obstacles in the treatment of tuberculosis (TB are delayed and inaccurate diagnosis which often leads to the onset of the drug resistant TB cases. To avail the appropriate treatment of the patients and to hinder the transmission of drug-resistant TB, accurate and rapid detection of resistant isolates is critical. Present study was designed to demonstrate the efficacy of molecular techniques inclusive of line probe assay (LPA and GeneXpert MTB/RIF methods for the detection of multi-drug resistant (MDR TB. Sputum samples from 300 different categories of treated and new TB cases were tested for the detection of possible mutation in the resistance specific genes (rpoB, inhA and katG through Genotype MTBDRplus assay or LPA and GeneXpert MTB/RIF tests. Culture based conventional drug susceptibility test (DST was also carried out to measure the efficacy of the molecular methods employed. Among 300 samples, 191 (63.7% and 193 (64.3% cases were found to be resistant against rifampicin in LPA and GeneXpert methods, respectively; while 189 (63% cases of rifampicin resistance were detected by conventional DST methods. On the other hand, 196 (65.3% and 191 (63.7% isolates showed isoniazid resistance as detected by LPA and conventional drug susceptibility test (DST, respectively. Among the drug resistant isolates (collectively 198 in LPA and 193 in conventional DST, 189 (95.6% and 187 (96.9% were considered to be MDR as examined by LPA and conventional DST, respectively. Category-II and -IV patients encountered higher frequency of drug resistance compared to those from category-I and new cases. Considering the higher sensitivity, specificity and accuracy along with the required time to results significantly shorter, our study supports the adoption of LPA and GeneXpert assay as efficient tools in detecting drug resistant TB in Bangladesh.
Directory of Open Access Journals (Sweden)
Balvinder S. Vig
2012-06-01
Full Text Available The expression levels of genes involved in drug and nutrient absorption were evaluated in the Madin-Darby Canine Kidney (MDCK in vitro drug absorption model. MDCK cells were grown on plastic surfaces (for 3 days or on Transwell® membranes (for 3, 5, 7, and 9 days. The expression profile of genes including ABC transporters, SLC transporters, and cytochrome P450 (CYP enzymes was determined using the Affymetrix® Canine GeneChip®. Expression of genes whose probe sets passed a stringent confirmation process was examined. Expression of a few transporter (MDR1, PEPT1 and PEPT2 genes in MDCK cells was confirmed by RT-PCR. The overall gene expression profile was strongly influenced by the type of support the cells were grown on. After 3 days of growth, expression of 28% of the genes was statistically different (1.5-fold cutoff, p < 0.05 between the cells grown on plastic and Transwell® membranes. When cells were differentiated on Transwell® membranes, large changes in gene expression profile were observed during the early stages, which then stabilized after 5–7 days. Only a small number of genes encoding drug absorption related SLC, ABC, and CYP were detected in MDCK cells, and most of them exhibited low hybridization signals. Results from this study provide valuable reference information on endogenous gene expression in MDCK cells that could assist in design of drug-transporter and/or drug-enzyme interaction studies, and help interpret the contributions of various transporters and metabolic enzymes in studies with MDCK cells.
Up-regulation of P-glycoprotein expression by catalase via JNK activation in HepG2 cells.
Li, Lin; Xu, Jianfeng; Min, Taishan; Huang, Weida
2006-01-01
Overexpression of the MDR1 gene is one of the reasons for multidrug resistance (MDR). Some studies suggested that antioxidants could down-regulate MDR1 expression as a possible cancer treatment. In this report, we try to determine the effects of antioxidants (catalase or N-acetylcysteine [NAC]) on the regulation of intrinsic MDR1 overexpression in HepG2 cells. Adding catalase or N-acetylcysteine to the HepG2 culture led to a significant increase of MDR1 mRNA and P-glycoprotein drug transporter activity. After catalase or NAC treatment, a reduced intracellular reactive oxygen species (ROS) was observed. The JNK inhibitor SP600125 abolished the positive effects of catalase on drug transporter activity in a dose-dependent manner. Furthermore, the up-regulation of P-glycoprotein functions by catalase was only observed in HepG2 cells but not in other cell lines tested (MCF-7, A549, A431). These data suggested that catalase can up-regulate P-glycoprotein expression in HepG2 cells via reducing intracellular ROS, and JNK may mediate this process.
Energy Technology Data Exchange (ETDEWEB)
Wang, Yue-Ming; Lin, Wenwei; Chai, Sergio C.; Wu, Jing; Ong, Su Sien [Department of Chemical Biology and Therapeutics, St. Jude Children' s Research Hospital, 262 Danny Thomas Place, Memphis, TN 38105 (United States); Schuetz, Erin G. [Department of Pharmaceutical Sciences, St. Jude Children' s Research Hospital, 262 Danny Thomas Place, Memphis, TN 38105 (United States); Chen, Taosheng, E-mail: taosheng.chen@stjude.org [Department of Chemical Biology and Therapeutics, St. Jude Children' s Research Hospital, 262 Danny Thomas Place, Memphis, TN 38105 (United States)
2013-10-01
Activation of the pregnane X receptor (PXR) and subsequently its target genes, including those encoding drug transporters and metabolizing enzymes, while playing substantial roles in xenobiotic detoxification, might cause undesired drug-drug interactions. Recently, an increased awareness has been given to dietary components for potential induction of diet–drug interactions through activation of PXR. Here, we studied, whether piperine (PIP), a major component extracted from the widely-used daily spice black pepper, could induce PXR-mediated expression of cytochrome P450 3A4 (CYP3A4) and multidrug resistance protein 1 (MDR1). Our results showed that PIP activated human PXR (hPXR)-mediated CYP3A4 and MDR1 expression in human hepatocytes, intestine cells, and a mouse model; PIP activated hPXR by recruiting its coactivator SRC-1 in both cellular and cell-free systems; PIP bound to the hPXR ligand binding domain in a competitive ligand binding assay in vitro. The dichotomous effects of PIP on induction of CYP3A4 and MDR1 expression observed here and inhibition of their activity reported elsewhere challenges the potential use of PIP as a bioavailability enhancer and suggests that caution should be taken in PIP consumption during drug treatment in patients, particularly those who favor daily pepper spice or rely on certain pepper remedies. - Highlights: • Piperine induces PXR-mediated CYP3A4 and MDR1 expression. • Piperine activates PXR by binding to PXR and recruiting coactivator SRC-1. • Piperine induces PXR activation in vivo. • Caution should be taken in piperine consumption during drug treatment.
MDR-TB Outbreak among HIV-Negative Tunisian Patients followed during 11 Years.
Directory of Open Access Journals (Sweden)
Naira Dekhil
Full Text Available Multidrug-resistant tuberculosis (MDR-TB outbreaks that evolve, from the outset, in a context strictly negative for HIV infection deserve special consideration since they reflect the true intrinsic epidemic potential of the causative strain. To our knowledge, the long-term evolution of such exceptional outbreaks and the treatment outcomes for the involved patients has never been reported hitherto. Here we provide a thorough description, over an 11-year period, of an MDR-TB outbreak that emerged and expanded in an HIV-negative context, Northern Tunisia.From October 2001 to June 2011, the MDR-TB outbreak involved 48 HIV-negative individuals that are mainly young (mean age 31.09 yrs; 89.6% male and noninstitutionalized. Drug susceptibility testing coupled to mutational analysis revealed that initial transmission involved an isolate that was simultaneously resistant to isoniazid, rifampicin, ethambutol, and streptomycin. The causative Haarlem3-ST50 outbreak strain expanded mainly as an 11-banded IS6110 RFLP profile (77.1%, from which a 12-banded subclone evolved. After undergoing a 2-year treatment with second-line drugs, 22 (45.8% patients were cured and 3 (6.2% completed treatment, thus yielding an overall treatment success rate of 52.1%. Among the patients that experienced unfavorable treatment outcomes, 10 (20.8% failed treatment, 3 (6.2% were lost to follow-up, 5 (10.4% died, and 5 (10.4% could not be evaluated. Poor adherence to treatment was found to be the main independent predictor of unfavorable outcomes (HR: 9.15; 95% CI 1.72-48.73; P = 0.014. Intriguingly, the evolved 12-banded subclone proved significantly associated with unfavorable outcomes (HR: 4.90; 95% CI 1.04-23.04, P = 0.044. High rate of fatality and relapse was further demonstrated at the long-term, since 70% of those whose treatment failed have died, and 24% among those deemed successfully treated have relapsed.Taken together, the data obtained in this study indicate that MDR
Osman, K M; Hassan, W M M; Mohamed, R A H
2014-08-01
The present study was undertaken to identify and characterise integrons and integrated resistance gene cassettes among eight multidrug-resistant (MDR) Salmonella serovars isolated from humans in Egypt. Virulotyping by polymerase chain reaction (PCR) was used for the detection of the presence of virulence genes. Integron PCR was used to detect the presence of class 1 in the MDR strains. The associated individual resistance gene cassettes were identified using specific PCRs. The isolated serovars were Salmonella Grampian (C1; 2/5), Larose (C1; 1/5), Hato (B; 1/5) and Texas (B; 1/5). Among the Salmonella serovars, five Salmonella isolates showed the highest resistance to amoxicillin, ampicillin, chloramphenicol, lincomycin, gentamicin, nalidixic acid, streptomycin and trimethoprim (100%), followed by neomycin, norfloxacin and tetracycline (80%), while the lowest resistance was recorded to colistin sulphate and ciprofloxacin in percentages of 20 and 40%, respectively. The invA, avrA, ssaQ, mgtC, siiD and sopB genes were detected in all isolates (100%), while the spvC and gipA genes were totally (100%) absent from all isolates. The remaining three virulence genes were diversely distributed as follows: the bcfC gene was detected in all isolates except Salmonella Hato (80%); the sodC1 gene was detected only in Salmonella Grampian and Salmonella Texas (60%); and the sopE1 gene was detected only in Salmonella Grampian, Hato and Texas (60%). Class 1 integrons were detected in 90% of the MDR isolates, comprising serovars Muenster, Florian, Noya, Grampian, Larose, Hato and Texas. Of the class 1 integron-positive isolates, 45% harboured Salmonella genomic island 1 (SGI1) either right junction or right and left junction having an A-C-S-T phenotype. Of the class 1 integron-positive isolates, 44% harboured integron gene cassette aadA2, while 11% harboured the floR gene present in multidrug resistance flanked by two integrons of SGI1. The results of the present study indicate that
Masami, NAKAJIMA; Junko, SUZUKI; Takehiko, HOSAKA; Tadaaki, HIBI; Katsumi, AKUTSU; School of Agriculture, Ibaraki University; School of Agriculture, Ibaraki University; School of Agriculture, Ibaraki University; Department of Agriculture and Environmental Biology, The University of Tokyo; School of Agriculture, Ibaraki University
2001-01-01
The BMR1 gene encoding an ABC transporter was cloned from Botrytis cinerea. To examine the function of BMR1 in B.cinerea, we isolated BMR1-deficient mutants after gene disruption. Disruption vector pBcDF4 was constructed by replacing the BMR1-coding region with a hygromycin B phosphotransferase gene(hph)cassette. The BMR1 disruptants had an increased sensitivity to polyoxin and iprobenfos. Polyoxin and iprobenfos, structurally unrelated compounds, may therefore be substrates of BMR1.
Directory of Open Access Journals (Sweden)
Irwan Supriyanto
2017-08-01
Full Text Available Introduction: Tuberculosis has become a chronic debilitating disease in developing countries, particularly after the emergence of multidrug resistant tuberculosis (MDR-TB. Second line treatments for the disease which were subsequently developed were associated with psychiatric disorders among patients. Psychiatric disorder can either be induced by treatment regiments or psychosocial factors. Cycloserine administration is frequently reported to be associated with psychiatric disorders. In this study, we examined the prevalence and characteristics of psychiatric disorders among MDR-TB patients in Sardjito Hospital, Yogyakarta, Indonesia. Methods: In this descriptive study, we studied medical records of MDR-TB patients admitted for MDR-TB treatments to Sardjito Hospital from January 2014 to July 2016 and screened for psychiatric disorders. Results: We found that 32.8% of the patients had psychiatric disorders, some of which had multiple psychiatric diagnoses (14.1%. The diagnoses were medication induced delirium, substance/medication induced psychotic disorder, substance/medication use depressive disorder, depressive type schizoaffective disorder, bipolar I disorder current episode severe manic with psychotic features, mild depression, moderate depression, major depression without psychotic features, major depression with psychotic features, adjustment disorders with mixed anxiety and depressed mood, adjustment disorder with anxiety, acute stress disorder, and insomnia. Psychiatric disorders were significantly associated with cycloserine dose and sex. Psychotic symptoms were significantly associated with sex and level of education. Conclusion: The presence of psychiatric disorders might disturb MDR-TB treatment resulting in poor outcomes. Precaution and prompt managements are required for psychiatric disorders in patients receiving MDR-TB treatment regiments.
International Nuclear Information System (INIS)
Zhang, Wentao; Du, Bojing; Liu, Di; Qi, Xiaoting
2014-01-01
Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd 2+ uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance
Energy Technology Data Exchange (ETDEWEB)
Zhang, Wentao; Du, Bojing; Liu, Di; Qi, Xiaoting, E-mail: qixiaoting@cnu.edu.cn
2014-12-12
Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd{sup 2+} uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance.
A preliminary characterisation of recovered uranium produced by MDR
International Nuclear Information System (INIS)
Kwon, Hyuk Il; Davison, J.; Marsh, G.
1997-10-01
The CANFLEX-RU fuel to be developed for the future should be verified if it has any major problems in RU handling techniques and related technology development. For this purpose, a preliminary R and D efforts on the RU handling characteristics were executed by joint effort with BNFL in following area. 1) preparation of RU powder by the MDR process 2) Compaction and sintering characteristics of RU powder 3) required special process for the production of CANFLEX-RU fuel 4) characterization of fission product residue composition in the RU powder 5) radiological characterization of RU powder and sintered pellets. Physical characterization of RU UO 2 powder and pellet produced by the MDR process were similar with those of NU UO 2 powder and pellet. The density of RU pellets, however, were higher than those of NU pellets and RU pellets showed little higher values in pore size distributions. RU contained only negligibly low concentrations of fission products and actinides. Especially, the Cs-137 content in the powder (before sintering) were undetectable and therefore would not contaminate the sintering furnace. RU pellet showed higher impurity levels, especially in the Ni content. Radioactivity on the RU powder showed about twice higher value at the surface than those of NU, but showed drastic reduction by distance and became similar at the 1 meter distance. RU pellets showed close coincidence between NU and RU at any distance. This result could be used close coincidence between NU and RU at any distance. This result could be used as a basis of the feasibility assessment on the development of CANFLEX-RU. Through basic research works on the improvement of CANFLEX-RU fabrication processes, compatibility with CANFLEX-NU fabrication process will be evaluated and analysed. (author). 4 refs
A preliminary characterisation of recovered uranium produced by MDR
Energy Technology Data Exchange (ETDEWEB)
Kwon, Hyuk Il [Korea Atomic Energy Research Inst., Daeduk (Korea, Republic of); Davison, J.; Marsh, G. [British Nuclear Forum, London (United Kingdom)
1997-10-01
The CANFLEX-RU fuel to be developed for the future should be verified if it has any major problems in RU handling techniques and related technology development. For this purpose, a preliminary R and D efforts on the RU handling characteristics were executed by joint effort with BNFL in following area. 1) preparation of RU powder by the MDR process 2) Compaction and sintering characteristics of RU powder 3) required special process for the production of CANFLEX-RU fuel 4) characterization of fission product residue composition in the RU powder 5) radiological characterization of RU powder and sintered pellets. Physical characterization of RU UO{sub 2} powder and pellet produced by the MDR process were similar with those of NU UO{sub 2} powder and pellet. The density of RU pellets, however, were higher than those of NU pellets and RU pellets showed little higher values in pore size distributions. RU contained only negligibly low concentrations of fission products and actinides. Especially, the Cs-137 content in the powder (before sintering) were undetectable and therefore would not contaminate the sintering furnace. RU pellet showed higher impurity levels, especially in the Ni content. Radioactivity on the RU powder showed about twice higher value at the surface than those of NU, but showed drastic reduction by distance and became similar at the 1 meter distance. RU pellets showed close coincidence between NU and RU at any distance. This result could be used close coincidence between NU and RU at any distance. This result could be used as a basis of the feasibility assessment on the development of CANFLEX-RU. Through basic research works on the improvement of CANFLEX-RU fabrication processes, compatibility with CANFLEX-NU fabrication process will be evaluated and analysed. (author). 4 refs.
Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.
Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu
2017-09-01
Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.
Herbivory-induced glucose transporter gene expression in the brown planthopper, Nilaparvata lugens.
Kikuta, Shingo; Nakamura, Yuki; Hattori, Makoto; Sato, Ryoichi; Kikawada, Takahiro; Noda, Hiroaki
2015-09-01
Nilaparvata lugens, the brown planthopper (BPH) feeds on rice phloem sap, containing high amounts of sucrose as a carbon source. Nutrients such as sugars in the digestive tract are incorporated into the body cavity via transporters with substrate selectivity. Eighteen sugar transporter genes of BPH (Nlst) were reported and three transporters have been functionally characterized. However, individual characteristics of NlST members associated with sugar transport remain poorly understood. Comparative gene expression analyses using oligo-microarray and quantitative RT-PCR revealed that the sugar transporter gene Nlst16 was markedly up-regulated during BPH feeding. Expression of Nlst16 was induced 2 h after BPH feeding on rice plants. Nlst16, mainly expressed in the midgut, appears to be involved in carbohydrate incorporation from the gut cavity into the hemolymph. Nlst1 (NlHT1), the most highly expressed sugar transporter gene in the midgut was not up-regulated during BPH feeding. The biochemical function of NlST16 was shown as facilitative glucose transport along gradients. Glucose uptake activity by NlST16 was higher than that of NlST1 in the Xenopus oocyte expression system. At least two NlST members are responsible for glucose uptake in the BPH midgut, suggesting that the midgut of BPH is equipped with various types of transporters having diversified manner for sugar uptake. Copyright © 2015 Elsevier Ltd. All rights reserved.
Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter
2017-09-01
Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.
Directory of Open Access Journals (Sweden)
Clifford Jacobs
2014-06-01
Full Text Available Human organic cation transporter 1 is primarily expressed in hepatocytes and mediates the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for human organic cation transporter 1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response to clinical drugs, which are substrates for this transporter. The genotypic and allelic distributions of 19 nonsynonymous and one intronic SLC22A1 single nucleotide polymorphisms were determined in 148 healthy Xhosa participants from South Africa, using a SNAPshot® multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F (rs34447885, P341L (rs2282143, V519F (rs78899680, and the intronic variant rs622342 were 1.7%, 8.4%, 3.0%, and 21.6%, respectively. None of the participants carried the variant allele for R61C (rs12208357, C88R (rs55918055, S189L (rs34104736, G220V (rs36103319, P283L (rs4646277, R287G (rs4646278, G401S (rs34130495, M440I (rs35956182, or G465R (rs34059508. In addition, no variant alleles were observed for A306T (COSM164365, A413V (rs144322387, M420V (rs142448543, I421F (rs139512541, C436F (rs139512541, V501E (rs143175763, or I542V (rs137928512 in the population. Eight haplotypes were inferred from the genotypic data. This study reports important genetic data that could be useful for future pharmacogenetic studies of drug transporters in the indigenous Sub-Saharan African populations.
Screening and Expression of a Silicon Transporter Gene (Lsi1) in Wild-Type Indica Rice Cultivars
Abiri, Rambod; Kalhori, Nahid; Atabaki, Narges
2017-01-01
Silicon (Si) is one of the most prevalent elements in the soil. It is beneficial for plant growth and development, and it contributes to plant defense against different stresses. The Lsi1 gene encodes a Si transporter that was identified in a mutant Japonica rice variety. This gene was not identified in fourteen Malaysian rice varieties during screening. Then, a mutant version of Lsi1 was substituted for the native version in the three most common Malaysian rice varieties, MR219, MR220, and MR276, to evaluate the function of the transgene. Real-time PCR was used to explore the differential expression of Lsi1 in the three transgenic rice varieties. Silicon concentrations in the roots and leaves of transgenic plants were significantly higher than in wild-type plants. Transgenic varieties showed significant increases in the activities of the enzymes SOD, POD, APX, and CAT; photosynthesis; and chlorophyll content; however, the highest chlorophyll A and B levels were observed in transgenic MR276. Transgenic varieties have shown a stronger root and leaf structure, as well as hairier roots, compared to the wild-type plants. This suggests that Lsi1 plays a key role in rice, increasing the absorption and accumulation of Si, then alters antioxidant activities, and improves morphological properties. PMID:28191468
Screening and Expression of a Silicon Transporter Gene (Lsi1 in Wild-Type Indica Rice Cultivars
Directory of Open Access Journals (Sweden)
Mahbod Sahebi
2017-01-01
Full Text Available Silicon (Si is one of the most prevalent elements in the soil. It is beneficial for plant growth and development, and it contributes to plant defense against different stresses. The Lsi1 gene encodes a Si transporter that was identified in a mutant Japonica rice variety. This gene was not identified in fourteen Malaysian rice varieties during screening. Then, a mutant version of Lsi1 was substituted for the native version in the three most common Malaysian rice varieties, MR219, MR220, and MR276, to evaluate the function of the transgene. Real-time PCR was used to explore the differential expression of Lsi1 in the three transgenic rice varieties. Silicon concentrations in the roots and leaves of transgenic plants were significantly higher than in wild-type plants. Transgenic varieties showed significant increases in the activities of the enzymes SOD, POD, APX, and CAT; photosynthesis; and chlorophyll content; however, the highest chlorophyll A and B levels were observed in transgenic MR276. Transgenic varieties have shown a stronger root and leaf structure, as well as hairier roots, compared to the wild-type plants. This suggests that Lsi1 plays a key role in rice, increasing the absorption and accumulation of Si, then alters antioxidant activities, and improves morphological properties.
Screening and Expression of a Silicon Transporter Gene (Lsi1) in Wild-Type Indica Rice Cultivars.
Sahebi, Mahbod; Hanafi, Mohamed M; Rafii, M Y; Azizi, Parisa; Abiri, Rambod; Kalhori, Nahid; Atabaki, Narges
2017-01-01
Silicon (Si) is one of the most prevalent elements in the soil. It is beneficial for plant growth and development, and it contributes to plant defense against different stresses. The Lsi1 gene encodes a Si transporter that was identified in a mutant Japonica rice variety. This gene was not identified in fourteen Malaysian rice varieties during screening. Then, a mutant version of Lsi1 was substituted for the native version in the three most common Malaysian rice varieties, MR219, MR220, and MR276, to evaluate the function of the transgene. Real-time PCR was used to explore the differential expression of Lsi1 in the three transgenic rice varieties. Silicon concentrations in the roots and leaves of transgenic plants were significantly higher than in wild-type plants. Transgenic varieties showed significant increases in the activities of the enzymes SOD, POD, APX, and CAT; photosynthesis; and chlorophyll content; however, the highest chlorophyll A and B levels were observed in transgenic MR276. Transgenic varieties have shown a stronger root and leaf structure, as well as hairier roots, compared to the wild-type plants. This suggests that Lsi1 plays a key role in rice, increasing the absorption and accumulation of Si, then alters antioxidant activities, and improves morphological properties.
Transport of Magnesium by a Bacterial Nramp-Related Gene
Rodionov, Dmitry A.; Freedman, Benjamin G.; Senger, Ryan S.; Winkler, Wade C.
2014-01-01
Magnesium is an essential divalent metal that serves many cellular functions. While most divalent cations are maintained at relatively low intracellular concentrations, magnesium is maintained at a higher level (∼0.5–2.0 mM). Three families of transport proteins were previously identified for magnesium import: CorA, MgtE, and MgtA/MgtB P-type ATPases. In the current study, we find that expression of a bacterial protein unrelated to these transporters can fully restore growth to a bacterial mutant that lacks known magnesium transporters, suggesting it is a new importer for magnesium. We demonstrate that this transport activity is likely to be specific rather than resulting from substrate promiscuity because the proteins are incapable of manganese import. This magnesium transport protein is distantly related to the Nramp family of proteins, which have been shown to transport divalent cations but have never been shown to recognize magnesium. We also find gene expression of the new magnesium transporter to be controlled by a magnesium-sensing riboswitch. Importantly, we find additional examples of riboswitch-regulated homologues, suggesting that they are a frequent occurrence in bacteria. Therefore, our aggregate data discover a new and perhaps broadly important path for magnesium import and highlight how identification of riboswitch RNAs can help shed light on new, and sometimes unexpected, functions of their downstream genes. PMID:24968120
Directory of Open Access Journals (Sweden)
Gicquel Brigitte
2007-05-01
Full Text Available Abstract Background Previous studies have suggested that variations in DNA repair genes of W-Beijing strains may have led to transient mutator phenotypes which in turn may have contributed to host adaptation of this strain family. Single nucleotide polymorphism (SNP in the DNA repair gene mutT1 was identified in MDR-prone strains from the Central African Republic. A Mycobacteriumtuberculosis H37Rv mutant inactivated in two DNA repair genes, namely ada/alkA and ogt, was shown to display a hypermutator phenotype. We then looked for polymorphisms in these genes in Central African Republic strains (CAR. Results In this study, 55 MDR and 194 non-MDR strains were analyzed. Variations in DNA repair genes ada/alkA and ogt were identified. Among them, by comparison to M. tuberculosis published sequences, we found a non-sense variation in ada/alkA gene which was also observed in M. bovis AF2122 strain. SNPs that are present in the adjacent regions to the amber variation are different in M. bovis and in M. tuberculosis strain. Conclusion An Amber codon was found in the ada/alkA locus of clustered M. tuberculosis isolates and in M. bovis strain AF2122. This is likely due to convergent evolution because SNP differences between strains are incompatible with horizontal transfer of an entire gene. This suggests that such a variation may confer a selective advantage and be implicated in hypermutator phenotype expression, which in turn contributes to adaptation to environmental changes.
Energy Technology Data Exchange (ETDEWEB)
Kayaaltı, Zeliha, E-mail: kayaalti@ankara.edu.tr; Akyüzlü, Dilek Kaya; Söylemezoğlu, Tülin
2015-02-15
Divalent metal transporter 1 (DMT1), a member of the proton-coupled metal ion transporter family, mediates transport of ferrous iron from the lumen of the intestine into the enterocyte and export of iron from endocytic vesicles. It has an affinity not only for iron but also for other divalent cations including manganese, cobalt, nickel, cadmium, lead, copper, and zinc. DMT1 is encoded by the SLC11a2 gene that is located on chromosome 12q13 in humans and express four major mammalian isoforms (1A/+IRE, 1A/-IRE, 2/+IRE and 2/-IRE). Mutations or polymorphisms of DMT1 gene may have an impact on human health by disturbing metal trafficking. To study the possible association of DMT1 gene with the blood levels of some divalent cations such as iron, lead and cadmium, a single nucleotide polymorphism (SNP) (IVS4+44C/A) in DMT1 gene was investigated in 486 unrelated and healthy individuals in a Turkish population by method of polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP). The genotype frequencies were found as 49.8% homozygote typical (CC), 38.3% heterozygote (CA) and 11.9% homozygote atypical (AA). Metal levels were analyzed by dual atomic absorption spectrometer system and the average levels of iron, lead and cadmium in the blood samples were 446.01±81.87 ppm, 35.59±17.72 ppb and 1.25±0.87 ppb, respectively. Individuals with the CC genotype had higher blood iron, lead and cadmium levels than those with AA and CA genotypes. Highly statistically significant associations were detected between IVS4+44 C/A polymorphism in the DMT1 gene and iron and lead levels (p=0.001 and p=0.036, respectively), but no association was found with cadmium level (p=0.344). This study suggested that DMT1 IVS4+44 C/A polymorphism is associated with inter-individual variations in blood iron, lead and cadmium levels. - Highlights: • DMT1 IVS4+44 C/A polymorphism is associated with inter-individual variations in blood iron, cadmium and lead levels.
International Nuclear Information System (INIS)
Kayaaltı, Zeliha; Akyüzlü, Dilek Kaya; Söylemezoğlu, Tülin
2015-01-01
Divalent metal transporter 1 (DMT1), a member of the proton-coupled metal ion transporter family, mediates transport of ferrous iron from the lumen of the intestine into the enterocyte and export of iron from endocytic vesicles. It has an affinity not only for iron but also for other divalent cations including manganese, cobalt, nickel, cadmium, lead, copper, and zinc. DMT1 is encoded by the SLC11a2 gene that is located on chromosome 12q13 in humans and express four major mammalian isoforms (1A/+IRE, 1A/-IRE, 2/+IRE and 2/-IRE). Mutations or polymorphisms of DMT1 gene may have an impact on human health by disturbing metal trafficking. To study the possible association of DMT1 gene with the blood levels of some divalent cations such as iron, lead and cadmium, a single nucleotide polymorphism (SNP) (IVS4+44C/A) in DMT1 gene was investigated in 486 unrelated and healthy individuals in a Turkish population by method of polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP). The genotype frequencies were found as 49.8% homozygote typical (CC), 38.3% heterozygote (CA) and 11.9% homozygote atypical (AA). Metal levels were analyzed by dual atomic absorption spectrometer system and the average levels of iron, lead and cadmium in the blood samples were 446.01±81.87 ppm, 35.59±17.72 ppb and 1.25±0.87 ppb, respectively. Individuals with the CC genotype had higher blood iron, lead and cadmium levels than those with AA and CA genotypes. Highly statistically significant associations were detected between IVS4+44 C/A polymorphism in the DMT1 gene and iron and lead levels (p=0.001 and p=0.036, respectively), but no association was found with cadmium level (p=0.344). This study suggested that DMT1 IVS4+44 C/A polymorphism is associated with inter-individual variations in blood iron, lead and cadmium levels. - Highlights: • DMT1 IVS4+44 C/A polymorphism is associated with inter-individual variations in blood iron, cadmium and lead levels.
Leen, Wilhelmina G.; Klepper, Joerg; Verbeek, Marcel M.; Leferink, Maike; Hofste, Tom; van Engelen, Baziel G.; Wevers, Ron A.; Arthur, Todd; Bahi-Buisson, Nadia; Ballhausen, Diana; Bekhof, Jolita; van Bogaert, Patrick; Carrilho, Ines; Chabrol, Brigitte; Champion, Michael P.; Coldwell, James; Clayton, Peter; Donner, Elizabeth; Evangeliou, Athanasios; Ebinger, Friedrich; Farrell, Kevin; Forsyth, Rob J.; de Goede, Christian G. E. L.; Gross, Stephanie; Grunewald, Stephanie; Holthausen, Hans; Jayawant, Sandeep; Lachlan, Katherine; Laugel, Vincent; Leppig, Kathy; Lim, Ming J.; Mancini, Grazia; Della Marina, Adela; Martorell, Loreto; McMenamin, Joe; Meuwissen, Marije E. C.; Mundy, Helen; Nilsson, Nils O.; Panzer, Axel; Poll-The, Bwee T.; Rauscher, Christian; Rouselle, Christophe M. R.; Sandvig, Inger; Scheffner, Thomas; Sheridan, Eamonn; Simpson, Neil; Sykora, Parol; Tomlinson, Richard; Trounce, John; Webb, David; Weschke, Bernhard; Scheffer, Hans; Willemsen, Michel A.
Glucose transporter-1 deficiency syndrome is caused by mutations in the SLC2A1 gene in the majority of patients and results in impaired glucose transport into the brain. From 2004-2008, 132 requests for mutational analysis of the SLC2A1 gene were studied by automated Sanger sequencing and multiplex
W.G. Leen (Wilhelmina); J. Klepper (Joerg); M.M. Verbeek (Marcel); M. Leferink (Maike); T. Hofste (Tom); B.G.M. van Engelen (Baziel); R.A. Wevers (Ron); T. Arthur (Todd); N. Bahi-Buisson (Nadia); D. Ballhausen (Diana); J. Bekhof (Jolita); P. van Bogaert (Patrick); I. Carrilho (Inês); B. Chabrol (Brigitte); M.P. Champion (Michael); J. Coldwell (James); P. Clayton (Peter); E. Donner (Elizabeth); A. Evangeliou (Athanasios); F. Ebinger (Friedrich); K. Farrell (Kevin); R.J. Forsyth (Rob); C.G.E.L. de Goede (Christian); S. Gross (Stephanie); S. Grünewald (Sonja); H. Holthausen (Hans); S. Jayawant (Sandeep); K. Lachlan (Katherine); V. Laugel (Vincent); K. Leppig (Kathy); M.J. Lim (Ming); G.M.S. Mancini (Grazia); A.D. Marina; L. Martorell (Loreto); J. McMenamin (Joe); M.E.C. Meuwissen (Marije); H. Mundy (Helen); N.O. Nilsson (Nils); A. Panzer (Axel); B.T. Poll-The; C. Rauscher (Christian); C.M.R. Rouselle (Christophe); I. Sandvig (Inger); T. Scheffner (Thomas); E. Sheridan (Eamonn); N. Simpson (Neil); P. Sykora (Parol); R. Tomlinson (Richard); J. Trounce (John); D.W.M. Webb (David); B. Weschke (Bernhard); H. Scheffer (Hans); M.A. Willemsen (Michél)
2010-01-01
textabstractGlucose transporter-1 deficiency syndrome is caused by mutations in the SLC2A1 gene in the majority of patients and results in impaired glucose transport into the brain. From 2004-2008, 132 requests for mutational analysis of the SLC2A1 gene were studied by automated Sanger sequencing
Leen, Wilhelmina G.; Klepper, Joerg; Verbeek, Marcel M.; Leferink, Maike; Hofste, Tom; van Engelen, Baziel G.; Wevers, Ron A.; Arthur, Todd; Bahi-Buisson, Nadia; Ballhausen, Diana; Bekhof, Jolita; van Bogaert, Patrick; Carrilho, Inês; Chabrol, Brigitte; Champion, Michael P.; Coldwell, James; Clayton, Peter; Donner, Elizabeth; Evangeliou, Athanasios; Ebinger, Friedrich; Farrell, Kevin; Forsyth, Rob J.; de Goede, Christian G. E. L.; Gross, Stephanie; Grunewald, Stephanie; Holthausen, Hans; Jayawant, Sandeep; Lachlan, Katherine; Laugel, Vincent; Leppig, Kathy; Lim, Ming J.; Mancini, Grazia; Marina, Adela Della; Martorell, Loreto; McMenamin, Joe; Meuwissen, Marije E. C.; Mundy, Helen; Nilsson, Nils O.; Panzer, Axel; Poll-The, Bwee T.; Rauscher, Christian; Rouselle, Christophe M. R.; Sandvig, Inger; Scheffner, Thomas; Sheridan, Eamonn; Simpson, Neil; Sykora, Parol; Tomlinson, Richard; Trounce, John; Webb, David; Weschke, Bernhard; Scheffer, Hans; Willemsen, Michél A.
2010-01-01
Glucose transporter-1 deficiency syndrome is caused by mutations in the SLC2A1 gene in the majority of patients and results in impaired glucose transport into the brain. From 2004-2008, 132 requests for mutational analysis of the SLC2A1 gene were studied by automated Sanger sequencing and multiplex
Leen, W.G.; Klepper, J.; Verbeek, M.M.; Leferink, M.; Hofste, T.; Engelen, B.G.M. van; Wevers, R.A.; Arthur, T.; Bahi-Buisson, N.; Ballhausen, D.; Bekhof, J.; Bogaert, P. van; Carrilho, I.; Chabrol, B.; Champion, M.P.; Coldwell, J.; Clayton, P.; Donner, E.; Evangeliou, A.; Ebinger, F.; Farrell, K.; Forsyth, R.J.; Goede, C.G. de; Gross, S.; Grunewald, S.; Holthausen, H.; Jayawant, S.; Lachlan, K.; Laugel, V.; Leppig, K.; Lim, M.J.; Mancini, G.; Marina, A.D.; Martorell, L.; McMenamin, J.; Meuwissen, M.E.; Mundy, H.; Nilsson, N.O.; Panzer, A.; Poll-The, B.T.; Rauscher, C.; Rouselle, C.M.; Sandvig, I.; Scheffner, T.; Sheridan, E.; Simpson, N.; Sykora, P.; Tomlinson, R.; Trounce, J.; Webb, D.; Weschke, B.; Scheffer, H.; Willemsen, M.A.A.P.
2010-01-01
Glucose transporter-1 deficiency syndrome is caused by mutations in the SLC2A1 gene in the majority of patients and results in impaired glucose transport into the brain. From 2004-2008, 132 requests for mutational analysis of the SLC2A1 gene were studied by automated Sanger sequencing and multiplex
Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh
2016-04-01
Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.
Kuriakose, Jerrin
2014-01-01
Multidrug resistance (MDR) is the condition where cancer cells or microorganisms cease to respond to multiple drugs. MDR conferred by efflux transporters, that deprive the bioavailability of drugs at their site of action, are a threat to cancer and malarial chemotherapy. Specifically, the mammalian ABC transporter Pglycoprotein (P-gp) has undermined many drugs in treatment of cancer and other disease states. Mutations in the parasitic transporter Plasmodium falciparum chloroquine resistance t...
Bosch, T M; Doodeman, V D; Smits, P H M; Meijerman, I; Schellens, J H M; Beijnen, J H
2006-01-01
A possible explanation for the wide interindividual variability in toxicity and efficacy of drug therapy is variation in genes encoding drug-metabolizing enzymes and drug transporters. The allelic frequency of these genetic variants, linkage disequilibrium (LD), and haplotype of these polymorphisms are important parameters in determining the genetic differences between patients. The aim of this study was to explore the frequencies of polymorphisms in drug-metabolizing enzymes (CYP1A1, CYP2C9, CYP2C19, CYP3A4, CYP2D6, CYP3A5, DPYD, UGT1A1, GSTM1, GSTP1, GSTT1) and drug transporters (ABCB1[MDR1] and ABCC2[MRP2]), and to investigate the LD and perform haplotype analysis of these polymorphisms in a Dutch population. Blood samples were obtained from 100 healthy volunteers and genomic DNA was isolated and amplified by PCR. The amplification products were sequenced and analyzed for the presence of polymorphisms by sequence alignment. In the study population, we identified 13 new single nucleotide polymorphisms (SNPs) in Caucasians and three new SNPs in non-Caucasians, in addition to previously recognized SNPs. Three of the new SNPs were found within exons, of which two resulted in amino acid changes (A428T in CYP2C9 resulting in the amino acid substitution D143V; and C4461T in ABCC2 in a non-Caucasian producing the amino acid change T1476M). Several LDs and haplotypes were found in the Caucasian individuals. In this Dutch population, the frequencies of 16 new SNPs and those of previously recognized SNPs were determined in genes coding for drug-metabolizing enzymes and drug transporters. Several LDs and haplotypes were also inferred. These data are important for further research to help explain the interindividual pharmacokinetic and pharmacodynamic variability in response to drug therapy.
The nitrate transporter (NRT gene family in poplar.
Directory of Open Access Journals (Sweden)
Hua Bai
Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.
Triandala Sibero, Mada; Sabdaningsih, Aninditia; Cristianawati, Olvi; Nuryadi, Handung; Karna Radjasa, Ocky; Sabdono, Agus; Trianto, Agus
2017-02-01
Irrational used of antibiotic in several decades ago causing resistant in bacteria and decreasing the cure rate of infectious diseases. Multidrug-resistant (MDR) Escherichia coli is known to cause various of infectious diseases such as urinary tract infection, nosocomial bloodstream infection, meningitis, bacteraemia, and gastrointestinal disease. Marine sponge-associated fungi have potential as source of new compound to combat MDR E. coli. The aims of this research were to isolate marine sponge-assosiated fungi, to screen potential fungi against MDR E. coli, to identify the potential fungi and its host sponge. There were 29 marine sponge-associated fungi successfully isolated from 9 sponges. Among 29 sponge-associated fungi screened, there were 7 isolates showed antibacterial activity against MDR E. coli. The best inhibition zone produced by MPS 14.1/MT 02 and MPS 14.3/MT 04 from sponge PP.SP.16.14. According to fungi identification result fungus MPS 14.1/MT 02 was identified as Trichoderma asperellum while MPS 14.3/MT 04 was identified as Trichoderma reesei. Sponge identification leaded the PP.SP.16.14 as Cinachyrella sp.
Candidate genes for performance in horses, including monocarboxylate transporters
Directory of Open Access Journals (Sweden)
Inaê Cristina Regatieri
Full Text Available ABSTRACT: Some horse breeds are highly selected for athletic activities. The athletic potential of each animal can be measured by its performance in sports. High athletic performance depends on the animal capacity to produce energy through aerobic and anaerobic metabolic pathways, among other factors. Transmembrane proteins called monocarboxylate transporters, mainly the isoform 1 (MCT1 and its ancillary protein CD147, can help the organism to adapt to physiological stress caused by physical exercise, transporting lactate and H+ ions. Horse breeds are selected for different purposes so we might expect differences in the amount of those proteins and in the genotypic frequencies for genes that play a significant role in the performance of the animals. The study of MCT1 and CD147 gene polymorphisms, which can affect the formation of the proteins and transport of lactate and H+, can provide enough information to be used for selection of athletic horses increasingly resistant to intense exercise. Two other candidate genes, the PDK4 and DMRT3, have been associated with athletic potential and indicated as possible markers for performance in horses. The oxidation of fatty acids is highly effective in generating ATP and is controlled by the expression of PDK4 (pyruvate dehydrogenase kinase, isozyme 4 in skeletal muscle during and after exercise. The doublesex and mab-3 related transcription factor 3 (DMRT3 gene encodes an important transcription factor in the setting of spinal cord circuits controlling movement in vertebrates and may be associated with gait performance in horses. This review describes how the monocarboxylate transporters work during physical exercise in athletic horses and the influence of polymorphisms in candidate genes for athletic performance in horses.
Taurine Transporter Gene Expression in Mononuclear Blood Cells of Type 1 Diabetes Patients.
Napoli, Zaleida; Seghieri, Giuseppe; Bianchi, Loria; Anichini, Roberto; De Bellis, Alessandra; Campesi, Ilaria; Carru, Ciriaco; Occhioni, Stefano; Zinellu, Angelo; Franconi, Flavia
2016-01-01
Taurine transporter gene expression (RNA-TauT) has a role in retinal cell function and is modulated in vitro and in vivo by hyperglycemia and/or oxidative stress. This study was aimed at testing whether RNA-TauT gene expression is modified in blood mononuclear peripheral cells (MPCs) of type 1 diabetic patients, is related to plasma markers of oxidative stress or endothelial dysfunction, or, finally, is related to presence of retinopathy. RNA-TauT was measured in MPCs by real-time PCR-analysis in 35 type 1 diabetic patients and in 33 age- and sex-matched controls, additionally measuring plasma and cell taurine and markers of oxidative stress and endothelial dysfunction. RNA-TauT, expressed as 2(-ΔΔCt), was significantly higher in MPCs of type 1 diabetic patients than in controls [median (interquartile range): 1.32(0.31) versus 1.00(0.15); P = 0.01]. In diabetic patients RNA-TauT was related to HbA1c (r = 0.42; P = 0.01) and inversely to plasma homocysteine (r = -0.39; P = 0.02) being additionally significantly higher in MPCs of patients without retinopathy [(n = 22); 1.36(0.34)] compared to those with retinopathy [(n = 13); 1.16(0.20)], independently from HbA1c or diabetes duration. RNA-TauT gene expression is significantly upregulated in MPCs of type 1 diabetes patients and is related to HbA1c levels and inversely to plasma homocysteine. Finally, in diabetes patients, RNA-TauT upregulation seems to be blunted in patients with retinopathy independently of their metabolic control or longer diabetes duration.
Larsson, R; Nygren, P
1990-07-15
A novel fluorometric microculture cytotoxicity assay (FMCA), based on measurements of fluorescein diacetate (FDA) hydrolysis and DNA staining by Hoechst 33342, was used for drug sensitivity testing and detection of resistance reversal in acute lymphoblastic leukemia (ALL) cell lines. The 72-hr assay was found to be sensitive, reproducible and linearly related to the number of viable cells within a broad range of cell concentrations. At clinically achievable drug concentrations, the calcium channel blocker Verapamil (ver) and the immunosuppressant Cyclosporin A (csA) were found to partly reverse acquired Vincristine (vcr) resistance in multi-drug resistant (MDR) T-ALL L100 cells with little or no effect on the drug-sensitive parental L0 cell line. By combining the fluorometric indices, we found that low concentrations of csA were growth-inhibitory, whereas higher concentrations (greater than 10 micrograms/ml) were progressively cytotoxic for drug-sensitive L0 cells. In MDR L100 cells, on the other hand, csA produced significant cell kill even at low drug concentrations. Ver had no effects on sensitive L0 cells but showed considerable cytotoxic action towards MDR L100 cells. There was no apparent relationship between drug reversal of vcr resistance and the cytotoxic actions of the drug per se since the calcium channel blocker diltiazem (dil) significantly potentiated the actions of vcr on MDR L100 cells without being more toxic to these cells (compared to vcr-sensitive L0 cells).
Schultz, Eliette; Haenni, Marisa; Mereghetti, Laurent; Siebor, Eliane; Neuwirth, Catherine; Madec, Jean-Yves; Cloeckaert, Axel; Doublet, Benoît
2015-09-01
To characterize MDR genomic islands related to Salmonella genomic island 1 (SGI1) and Proteus genomic island 1 (PGI1) in Proteus mirabilis from human and animal sources in France in light of the previously reported cases. A total of 52 and 46 P. mirabilis clinical strains from human and animal sources, respectively, were studied for the period 2010-13. MDR was assessed by antimicrobial susceptibility testing, PCR detection of SGI1 and PGI1 and PCR mapping of the MDR regions. The diversity of the SGI1/PGI1-positive P. mirabilis strains was assessed by PFGE. Twelve P. mirabilis strains (5 humans and 7 dogs) were found to harbour an MDR island related to SGI1 or PGI1. Among them, several SGI1 variants were identified in diverse P. mirabilis genetic backgrounds. The variant SGI1-V, which harbours the ESBL bla VEB-6 gene, was found in closely genetically related human and dog P. mirabilis strains. The recently described PGI1 element was also identified in human and dog strains. Finally, one strain harboured a novel SGI genomic island closely related to SGI1 and SGI2 without an insertion of the MDR region. This study reports for the first time, to our knowledge, SGI1-positive and PGI1-positive P. mirabilis strains from dogs in France. The genetic diversity of the strains suggests several independent horizontal acquisitions of these MDR elements. The potential transmission of SGI1/PGI1-positive P. mirabilis strains between animals and humans is of public health concern, notably with regard to the spread of ESBL and carbapenemase genes, i.e. bla VEB-6 and bla NDM-1. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Yaya Kassogue
2015-10-01
Full Text Available Background: Despite the impressive results obtained with imatinib, inadequate response or resistance are observed in certain patients. It is known that imatinib is a substrate of a multidrug resistance gene (MDR1. Thus, interindividual genetic differences linked to single nucleotide polymorphisms in MDR1 may influence the metabolism of imatinib. The present study has aimed to examine the impact of MDR1 polymorphisms on the hematologic and cytogenetic responses in 70 chronic myeloid leukemia patients who received imatinib. Methods: We used a polymerase chain reaction followed by restriction fragment length polymorphism to identify different profiles of 1236C>T, 2677G>T and 3435C>T in MDR1. Results: The distribution of the three SNPs in responders and poor responders did not show any particular trend (P>0.05. The T allele was slightly higher in responders, but not significantly regardless of the type of SNP (40.3% vs. 33.8% for 1236C>T; 25% vs. 14.7% for 2677G>T and 33.3% vs. 22% for 3435C>T. The dominant model showed a similar trend (P>0.05. Diplotypes composed by the T allele in different exons were frequent in responders. Haplotype analysis showed that 1236C-2677G-3435C was slightly higher in poor responders (60.02% compared to responders (50.42%. However, 1236T-2677T-3435T was frequent in responders (16.98% compared to poor responders (13.1%. Overall, none of the haplotypes were associated with IM response in our cohort (global haplotype association test, P=0.39. Conclusion: The identification of 1236C>T, 2677G>T and 3435C>T polymorphisms may not be advantageous to predict imatinib response for our chronic myeloid leukemia patients.
Tanegashima, Kosuke; Sato-Miyata, Yukiko; Funakoshi, Masabumi; Nishito, Yasumasa; Aigaki, Toshiro; Hara, Takahiko
2017-01-01
We carried out liquid chromatography-tandem mass spectrometry analysis of metabolites in mice. Those metabolome data showed that hepatic glucose content is reduced, but that brain glucose content is unaffected, during fasting, consistent with the priority given to brain glucose consumption during fasting. The molecular mechanisms for this preferential glucose supply to the brain are not fully understood. We also showed that the fasting-induced production of the ketone body β-hydroxybutyrate (β-OHB) enhances expression of the glucose transporter gene Slc2a1 (Glut1) via histone modification. Upon β-OHB treatment, Slc2a1 expression was up-regulated, with a concomitant increase in H3K9 acetylation at the critical cis-regulatory region of the Slc2a1 gene in brain microvascular endothelial cells and NB2a neuronal cells, shown by quantitative PCR analysis and chromatin immunoprecipitation assay. CRISPR/Cas9-mediated disruption of the Hdac2 gene increased Slc2a1 expression, suggesting that it is one of the responsible histone deacetylases (HDACs). These results confirm that β-OHB is a HDAC inhibitor and show that β-OHB plays an important role in fasting-induced epigenetic activation of a glucose transporter gene in the brain. © 2016 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.
Dharmapuri, Gangappa; Doneti, Ravinder; Philip, Gundala Harold; Kalle, Arunasree M
2015-07-01
Imatinib mesylate, a tyrosine kinase inhibitor, is very effective in the treatment of chronic myeloid leukemia (CML). However, development of resistance to imatinib therapy is also a very common mechanism observed with long-term administration of the drug. Our previous studies have highlighted the role of cyclooxygenase-2 (COX-2) in regulating the expression of multidrug resistant protein-1 (MDR1), P-gp, in imatinib-resistant K562 cells (IR-K562) via PGE2-cAMP-PKC-NF-κB pathway and inhibition of COX-2 by celecoxib, a COX-2 specific inhibitor, inhibits this pathway and reverses the drug resistance. Studies have identified that not only MDR1 but other ATP-binding cassette transport proteins (ABC transporters) are involved in the development of imatinib resistance. Here, we tried to study the role of COX-2 in the regulation of other ABC transporters such as MRP1, MRP2, MRP3, ABCA2 and ABCG2 that have been already implicated in imatinib resistance development. The results of the study clearly indicated that overexpression of COX-2 lead to upregulation of MRP family proteins in IR-K562 cells and celecoxib down-regulated the ABC transporters through Wnt and MEK signaling pathways. The study signifies that celecoxib in combination with the imatinib can be a good alternate treatment strategy for the reversal of imatinib resistance. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Yuanyuan Liu
2017-06-01
Full Text Available In higher plants, sugars (mainly sucrose are produced by photosynthetically assimilated carbon in mesophyll cells of leaves and translocated to heterotrophic organs to ensure plant growth and development. Sucrose transporters, or sucrose carriers (SUCs, play an important role in the long-distance transportation of sucrose from source organs to sink organs, thereby affecting crop yield and quality. The identification, characterization, and molecular function analysis of sucrose transporter genes have been reported for monocot and dicot plants. However, no relevant study has been reported on sucrose transporter genes in Brassica rapa var. rapa, a cruciferous root crop used mainly as vegetables and fodder. We identified and cloned 12 sucrose transporter genes from turnips, named BrrSUC1.1 to BrrSUC6.2 according to the SUC gene sequences of B. rapa pekinensis. We constructed a phylogenetic tree and analyzed conserved motifs for all 12 sucrose transporter genes identified. Real-time quantitative polymerase chain reaction was conducted to understand the expression levels of SUC genes in different tissues and developmental phases of the turnip. These findings add to our understanding of the genetics and physiology of sugar transport during taproot formation in turnips.
Kengkla, Kirati; Kongpakwattana, Khachen; Saokaew, Surasak; Apisarnthanarak, Anucha; Chaiyakunapruk, Nathorn
2018-01-01
To comprehensively compare and rank the efficacy and safety of available treatment options for patients with MDR and XDR Acinetobacter baumannii (AB) infection. We searched PubMed, Embase and the Cochrane register of trials systematically for studies that examined treatment options for patients with MDR- and XDR-AB infections until April 2016. Network meta-analysis (NMA) was performed to estimate the risk ratio (RR) and 95% CI from both direct and indirect evidence. Primary outcomes were clinical cure and microbiological cure. Secondary outcomes were all-cause mortality and nephrotoxic and non-nephrotoxic adverse events. A total of 29 studies with 2529 patients (median age 60 years; 65% male; median APACHE II score 19.0) were included. Although there were no statistically significant differences between treatment options, triple therapy with colistin, sulbactam and tigecycline had the highest clinical cure rate. Colistin in combination with sulbactam was associated with a significantly higher microbiological cure rate compared with colistin in combination with tigecycline (RR 1.23; 95% CI 1.03-1.47) and colistin monotherapy (RR 1.21; 95% CI 1.06-1.38). No significant differences in all-cause mortality were noted between treatment options. Tigecycline-based therapy also appeared less effective for achieving a microbiological cure and is not appropriate for treating bloodstream MDR- and XDR-AB infections. Combination therapy of colistin with sulbactam demonstrates superiority in terms of microbiological cure with a safety profile similar to that of colistin monotherapy. Thus, our findings support the use of this combination as a treatment for MDR- and XDR-AB infections. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Bao, Wei-Guo; Guiard, Bernard; Fang, Zi-An; Donnini, Claudia; Gervais, Michel; Passos, Flavia M. Lopes; Ferrero, Iliana; Fukuhara, Hiroshi; Bolotin-Fukuhara, Monique
2008-01-01
The HAP1 (CYP1) gene product of Saccharomyces cerevisiae is known to regulate the transcription of many genes in response to oxygen availability. This response varies according to yeast species, probably reflecting the specific nature of their oxidative metabolism. It is suspected that a difference in the interaction of Hap1p with its target genes may explain some of the species-related variation in oxygen responses. As opposed to the fermentative S. cerevisiae, Kluyveromyces lactis is an aerobic yeast species which shows different oxygen responses. We examined the role of the HAP1-equivalent gene (KlHAP1) in K. lactis. KlHap1p showed a number of sequence features and some gene targets (such as KlCYC1) in common with its S. cerevisiae counterpart, and KlHAP1 was capable of complementing the hap1 mutation. However, the KlHAP1 disruptant showed temperature-sensitive growth on glucose, especially at low glucose concentrations. At normal temperature, 28°C, the mutant grew well, the colony size being even greater than that of the wild type. The most striking observation was that KlHap1p repressed the expression of the major glucose transporter gene RAG1 and reduced the glucose uptake rate. This suggested an involvement of KlHap1p in the regulation of glycolytic flux through the glucose transport system. The ΔKlhap1 mutant showed an increased ability to produce ethanol during aerobic growth, indicating a possible transformation of its physiological property to Crabtree positivity or partial Crabtree positivity. Dual roles of KlHap1p in activating respiration and repressing fermentation may be seen as a basis of the Crabtree-negative physiology of K. lactis. PMID:18806211
Should all suspected tuberculosis cases in high income countries be tested with GeneXpert?
Vella, Venanzio; Broda, Agnieszka; Drobniewski, Francis
2018-05-01
In countries with a low incidence of multidrug-resistant tuberculosis (MDR-TB), universal testing with GeneXpert might not be always cost-effective. This study provides hospital managers in low MDR-TB incidence countries with criteria on when decentralised universal GeneXpert testing would make sense. The alternatives taken into consideration include: universal microbiological culture and drug susceptibility testing (DST) only (comparator); as above but with concurrent centralized GeneXpert in a referral laboratory vs a decentralized GeneXpert system in every hospital to test smear-positive cases only; as above but testing all samples with GeneXpert regardless of smear status. The parameters were from the national TB statistics for England and from a systematic review. Decentralised GeneXpert to test any suspected TB case was the most cost-effective option when 6% or more TB patients belonged to the high-risk group, defined as previous TB diagnosis and or being born in countries with a high MDR-TB incidence. Hospital managers in England and other low MDR-TB incidence countries could use these findings to decide when to invest in GeneXpert or other molecular diagnostics with similar performance criteria for TB diagnostics. Copyright © 2017 Elsevier Ltd. All rights reserved.
Cao, Guojie; Allard, Marc; Hoffmann, Maria; Muruvanda, Tim; Luo, Yan; Payne, Justin; Meng, Kevin; Zhao, Shaohua; McDermott, Patrick; Brown, Eric; Meng, Jianghong
2018-04-05
Multidrug-resistant (MDR) plasmids play an important role in disseminating antimicrobial resistance genes. To elucidate the antimicrobial resistance gene compositions in A/C incompatibility complex (IncA/C) plasmids carried by animal-derived MDR Salmonella Newport, and to investigate the spread mechanism of IncA/C plasmids, this study characterizes the complete nucleotide sequences of IncA/C plasmids by comparative analysis. Complete nucleotide sequencing of plasmids and chromosomes of six MDR Salmonella Newport strains was performed using PacBio RSII. Open reading frames were assigned using prokaryotic genome annotation pipeline (PGAP). To understand genomic diversity and evolutionary relationships among Salmonella Newport IncA/C plasmids, we included three complete IncA/C plasmid sequences with similar backbones from Salmonella Newport and Escherichia coli: pSN254, pAM04528, and peH4H, and additional 200 draft chromosomes. With the exception of canine isolate CVM22462, which contained an additional IncI1 plasmid, each of the six MDR Salmonella Newport strains contained only the IncA/C plasmid. These IncA/C plasmids (including references) ranged in size from 80.1 (pCVM21538) to 176.5 kb (pSN254) and carried various resistance genes. Resistance genes floR, tetA, tetR, strA, strB, sul, and mer were identified in all IncA/C plasmids. Additionally, bla CMY-2 and sugE were present in all IncA/C plasmids, excepting pCVM21538. Plasmid pCVM22462 was capable of being transferred by conjugation. The IncI1 plasmid pCVM22462b in CVM22462 carried bla CMY-2 and sugE. Our data showed that MDR Salmonella Newport strains carrying similar IncA/C plasmids clustered together in the phylogenetic tree using chromosome sequences and the IncA/C plasmids from animal-derived Salmonella Newport contained diverse resistance genes. In the current study, we analyzed genomic diversities and phylogenetic relationships among MDR Salmonella Newport using complete plasmids and chromosome
Liu, Shikai; Li, Qi; Liu, Zhanjiang
2013-01-01
Although a large set of full-length transcripts was recently assembled in catfish, annotation of large gene families, especially those with duplications, is still a great challenge. Most often, complexities in annotation cause mis-identification and thereby much confusion in the scientific literature. As such, detailed phylogenetic analysis and/or orthology analysis are required for annotation of genes involved in gene families. The ATP-binding cassette (ABC) transporter gene superfamily is a large gene family that encodes membrane proteins that transport a diverse set of substrates across membranes, playing important roles in protecting organisms from diverse environment. In this work, we identified a set of 50 ABC transporters in catfish genome. Phylogenetic analysis allowed their identification and annotation into seven subfamilies, including 9 ABCA genes, 12 ABCB genes, 12 ABCC genes, 5 ABCD genes, 2 ABCE genes, 4 ABCF genes and 6 ABCG genes. Most ABC transporters are conserved among vertebrates, though cases of recent gene duplications and gene losses do exist. Gene duplications in catfish were found for ABCA1, ABCB3, ABCB6, ABCC5, ABCD3, ABCE1, ABCF2 and ABCG2. The whole set of catfish ABC transporters provide the essential genomic resources for future biochemical, toxicological and physiological studies of ABC drug efflux transporters. The establishment of orthologies should allow functional inferences with the information from model species, though the function of lineage-specific genes can be distinct because of specific living environment with different selection pressure.
Directory of Open Access Journals (Sweden)
Sudeepa Khanal
Full Text Available Multi-drug-resistant tuberculosis (MDR-TB poses a major threat to public health worldwide, particularly in low-income countries. The current long (20 month and arduous treatment regime uses powerful drugs with side-effects that include mental ill-health. It has a high loss-to-follow-up (25% and higher case fatality and lower cure-rates than those with drug sensitive tuberculosis (TB. While some national TB programmes provide small financial allowances to patients, other aspects of psychosocial ill-health, including iatrogenic ones, are not routinely assessed or addressed. We aimed to develop an intervention to improve psycho-social well-being for MDR-TB patients in Nepal. To do this we conducted qualitative work with MDR-TB patients, health professionals and the National TB programme (NTP in Nepal. We conducted semi-structured interviews (SSIs with 15 patients (10 men and 5 women, aged 21 to 68, four family members and three frontline health workers. In addition, three focus groups were held with MDR-TB patients and three with their family members. We conducted a series of meetings and workshops with key stakeholders to design the intervention, working closely with the NTP to enable government ownership. Our findings highlight the negative impacts of MDR-TB treatment on mental health, with greater impacts felt among those with limited social and financial support, predominantly married women. Michie et al's (2011 framework for behaviour change proved helpful in identifying corresponding practice- and policy-level changes. The findings from this study emphasise the need for tailored psycho-social support. Recent work on simple psychological support packages for the general population can usefully be adapted for use with people with MDR-TB.
Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Doublet, Benoît
2010-12-20
The Salmonella genomic island 1 (SGI1) is a Salmonella enterica-derived integrative mobilizable element (IME) containing various complex multiple resistance integrons identified in several S. enterica serovars and in Proteus mirabilis. Previous studies have shown that SGI1 transfers horizontally by in trans mobilization in the presence of the IncA/C conjugative helper plasmid pR55. Here, we report the ability of different prevalent multidrug resistance (MDR) plasmids including extended-spectrum β-lactamase (ESBL) gene-carrying plasmids to mobilize the multidrug resistance genomic island SGI1. Through conjugation experiments, none of the 24 conjugative plasmids tested of the IncFI, FII, HI2, I1, L/M, N, P incompatibility groups were able to mobilize SGI1 at a detectable level (transfer frequency IncA/C incompatibility group. Several conjugative IncA/C MDR plasmids as well as the sequenced IncA/C reference plasmid pRA1 of 143,963 bp were shown to mobilize in trans SGI1 from a S. enterica donor to the Escherichia coli recipient strain. Depending on the IncA/C plasmid used, the conjugative transfer of SGI1 occurred at frequencies ranging from 10(-3) to 10(-6) transconjugants per donor. Of particular concern, some large IncA/C MDR plasmids carrying the extended-spectrum cephalosporinase bla(CMY-2) gene were shown to mobilize in trans SGI1. The ability of the IncA/C MDR plasmid family to mobilize SGI1 could contribute to its spread by horizontal transfer among enteric pathogens. Moreover, the increasing prevalence of IncA/C plasmids in MDR S. enterica isolates worldwide has potential implications for the epidemic success of the antibiotic resistance genomic island SGI1 and its close derivatives.
DEFF Research Database (Denmark)
Andersen, Vibeke; Vogel, Lotte K.; Kopp, Tine Iskov
2015-01-01
Development of colorectal cancer (CRC) may result from a dysfunctional interplay between diet, gut microbes and the immune system. The ABC transport proteins ABCB1 (P-glycoprotein, Multidrug resistance protein 1, MDR1), ABCC2 (MRP2) and ABCG2 (BCRP) are involved in transport of various compounds...
Orozco, Zenith Gaye A; Soma, Satoshi; Kaneko, Toyoji; Watanabe, Soichi
2017-01-01
The tissue distribution of slc15a1a, a gene that encodes an oligopeptide transporter, PepT1, and its response to fasting and refeeding were investigated in the intestinal epithelium of Mozambique tilapia for a better understanding of its role on nutrient absorption. The slc15a1a was predominantly expressed in the absorptive epithelia of the anterior part of the intestine, suggesting that digested oligopeptides are primarily absorbed in the anterior intestine. The response of slc15a1a to fasting was evaluated at 1, 2, 4, 7 and 14days after the last feeding. Fasting revealed a biphasic effect, where short-term fasting significantly upregulated slc15a1a expression and long-term fasting resulted in downregulation. The expression level continued to decrease and fell below the pre-fasted level from day 4 to 14. Proximal (the hepatic loop, HL) and distal parts (the proximal major coil, PMC) of the anterior intestine showed different magnitudes of responses to fasting; slc15a1a expression in the PMC showed greater upregulation and downregulation than that in the HL. Refeeding significantly stimulated slc15a1a expression at day 3, although the expression did not exceed the pre-fasted level. Observed responses of slc15a1a to fasting and refeeding suggest that the expression level of this gene can serve as a sensitive indicator of the changes that may occur in altering nutritional conditions. These findings contribute to a better understanding of the role of PepT1 in nutrition and of the complex mechanisms underlying the absorption of oligopeptides and amino acids in the intestine, and may lead to development of possible means to manipulate the absorption processes for the improvement of growth and other metabolic and physiological conditions in fish. Copyright © 2016. Published by Elsevier Inc.
Guo, Zhaojiang; Kang, Shi; Zhu, Xun; Xia, Jixing; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhang, Youjun
2015-04-01
Biopesticides or transgenic crops based on Cry toxins from the soil bacterium Bacillus thuringiensis (Bt) effectively control agricultural insect pests. The sustainable use of Bt biopesticides and Bt crops is threatened, however, by the development of Cry resistance in the target pests. The diamondback moth, Plutella xylostella (L.), is the first pest that developed resistance to a Bt biopesticide in the field, and a recent study has shown that the resistance of P. xylostella to Cry1Ac is caused by a mutation in an ATP-binding cassette (ABC) transporter gene (ABCC2). In this study, we report that down-regulation of a novel ABC transporter gene from ABCG subfamily (Pxwhite) is associated with Cry1Ac resistance in P. xylostella. The full-length cDNA sequence of Pxwhite was cloned and analyzed. Spatial-temporal expression detection revealed that Pxwhite was expressed in all tissues and developmental stages, and highest expressed in Malpighian tubule tissue and in egg stage. Sequence variation analysis of Pxwhite indicated the absence of constant non-synonymous mutations between susceptible and resistant strains, whereas midgut transcript analysis showed that Pxwhite was remarkably reduced in all resistant strains and further reduced when larvae of the moderately resistant SZ-R strain were subjected to selection with Cry1Ac toxin. Furthermore, RNA interference (RNAi)-mediated suppression of Pxwhite gene expression significantly reduced larval susceptibility to Cry1Ac toxin, and genetic linkage analysis confirmed that down-regulation of Pxwhite gene is tightly linked to Cry1Ac resistance in P. xylostella. To our knowledge, this is the first report indicating that Pxwhite gene is involved in Cry1Ac resistance in P. xylostella. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Kavitha Matam
2015-04-01
Full Text Available Coronary artery disease (CAD also known as coronary heart disease is one of the leading causes of death and disability worldwide. Genetic and environmental factors play an important role in the pathogenesis and progression of CAD. The aim of this study was to evaluate the combined contribution of 3 gene polymorphisms to the risk of CAD and gene–gene interaction in the south Indian population. In this case-control study, 200 cases of CAD and 200 healthy controls were recruited. We studied 3 well known genetic polymorphisms of MTHFR (C677T; rs1801133, PON1 (Q192R; rs662 and ACE (I/D: rs4646994 in relation to CAD in South Indian population. Polymerase chain reaction (PCR was carried out and followed by the restriction fragment length polymorphism and agarose gel electrophoresis. Genotypes of MTHFR C677T, CT and CT+TT, and PON1 Q192R QR were associated with the risk of CAD (C677T CT+TT vs CC: odds ratio [OR] = 3.3, 95% confidence intervals [CI] = 1.8–6.2; p = 0.00001, (CT vs CC: OR = 3.2, 95%CI = 1.8–5.6; p = 0.00003, and (Q192R QQ vs QR: OR = 2.1, 95%CI = 1.1–3.9; p = 0.03. The allele frequencies for T vs C: OR = 3.1, 95%CI = 1.8–5.3; p = 0.00001 and R vs Q: OR = 1.3, 95% CI = 1.0–1.7 p = 0.03. Multifactor dimensionality reduction (MDR analysis was carried out with the combination of three genes and the results indicate that MDR analysis showed that, PON1 gene polymorphism formed a significant model in predicting the CAD risk in south Indian population.
Directory of Open Access Journals (Sweden)
Shiv Kumar
2015-06-01
Full Text Available CONTEXT : Tuberculosis is a contagious disease with social stigma attached to it. Various problems which are social and economic in nature are faced by TB patient. Therefore , it is essential to explore the overall effect of MDR - TB/TB on health and patients perception of Well - being. AIMS : To Document the effect of MDR - TB/TB on social , functional and economic well - being of patients. SETTINGS AND DESIGN : A Cross - sectional study , Conveniently Recruited 68 MDR - TB Patients and 136 non - MDR - TB Patients (from Rural as well as urban Area of Surat District diagnosed by CBNAAT were interviewed for investigating the effect of Tuberculosis. METHODS AND MATERIAL : A pre - tested standardized semi - structured questionnaire was used. Data was collected about socio - demographic profile of patients and interpreted in table. Data about effect of MDR - TB/TB was collected on Likert Scale and Frequency was calculated and Data wa s plotted on multiple bar charts. RESULTS : As compared to healthy status in the past , 93% MDR - TB and 82% TB patients have decreased ability to do work , about half of MDR - TB Patients and TB Patients have detiorated relations with family members , 67% of stud y participants have developed disharmonious relations with neighbor’s , 55% of Study participants have decreased income , 88% of study participants have decreased performance in day to day activities and 78% of study participants have faced discordial and di srespectful behavior from co - workers. CONCLUSION : Working ability more detiorated in MDR - TB patients while rest of the effect on social , functional and economic well - being is same in both TB and Multi Drug Resistant TB patients. This study emphasizes very clearly that social stigma still persist in community about Tuberculosis which needs to be eliminated in community by behavior change communication by health workers at all levels of health care.
Institute of Scientific and Technical Information of China (English)
Ping Yang; Guoqiang Cai; Youqing Cai; Jian Fei; Guoxiang Liu
2013-01-01
Attention deficit/hyperactivity disorder (ADHD) is characterized by hyperactivity,impaired sustained attention,impulsivity,and is usually accompanied by varying degrees of learning difficulties and lack of motor coordination.However,the pathophysiology and etiology of ADHD remain inconclusive so far.Our previous studies have demonstrated that the gamma aminobutyric acid transporter subtype 1 (GAT1) gene knockout (ko) mouse (gat1-/-)is hyperactive and exhibited impaired memory performance in the Morris water maze.In the current study,we found that the gat1-/-mice showed low levels of attentional focusing and increased impulsivity.In addition,the gat1-/-mice displayed ataxia characterized by defects in motor coordination and balance skills.The hyperactivity in the ko mice was reduced by both methylphenidate and amphetamine.Collectively,these results suggest that GAT1 ko mouse is a new animal model for ADHD studying and GAT1 may be a new target to treat ADHD.
Directory of Open Access Journals (Sweden)
Persson Bengt
2010-10-01
Full Text Available Abstract Background The Medium-chain Dehydrogenases/Reductases (MDR form a protein superfamily whose size and complexity defeats traditional means of subclassification; it currently has over 15000 members in the databases, the pairwise sequence identity is typically around 25%, there are members from all kingdoms of life, the chain-lengths vary as does the oligomericity, and the members are partaking in a multitude of biological processes. There are profile hidden Markov models (HMMs available for detecting MDR superfamily members, but none for determining which MDR family each protein belongs to. The current torrential influx of new sequence data enables elucidation of more and more protein families, and at an increasingly fine granularity. However, gathering good quality training data usually requires manual attention by experts and has therefore been the rate limiting step for expanding the number of available models. Results We have developed an automated algorithm for HMM refinement that produces stable and reliable models for protein families. This algorithm uses relationships found in data to generate confident seed sets. Using this algorithm we have produced HMMs for 86 distinct MDR families and 34 of their subfamilies which can be used in automated annotation of new sequences. We find that MDR forms with 2 Zn2+ ions in general are dehydrogenases, while MDR forms with no Zn2+ in general are reductases. Furthermore, in Bacteria MDRs without Zn2+ are more frequent than those with Zn2+, while the opposite is true for eukaryotic MDRs, indicating that Zn2+ has been recruited into the MDR superfamily after the initial life kingdom separations. We have also developed a web site http://mdr-enzymes.org that provides textual and numeric search against various characterised MDR family properties, as well as sequence scan functions for reliable classification of novel MDR sequences. Conclusions Our method of refinement can be readily applied to
Hoekenga, Owen A.; Maron, Lyza G.; Piñeros, Miguel A.; Cançado, Geraldo M. A.; Shaff, Jon; Kobayashi, Yuriko; Ryan, Peter R.; Dong, Bei; Delhaize, Emmanuel; Sasaki, Takayuki; Matsumoto, Hideaki; Yamamoto, Yoko; Koyama, Hiroyuki; Kochian, Leon V.
2006-01-01
Aluminum (Al) tolerance in Arabidopsis is a genetically complex trait, yet it is mediated by a single physiological mechanism based on Al-activated root malate efflux. We investigated a possible molecular determinant for Al tolerance involving a homolog of the wheat Al-activated malate transporter, ALMT1. This gene, named AtALMT1 (At1g08430), was the best candidate from the 14-memberAtALMT family to be involved with Al tolerance based on expression patterns and genomic location. Physiological...
Velaei, Kobra; Samadi, Nasser; Soltani, Sina; Barazvan, Balal; Soleimani Rad, Jafar
2017-07-01
Shedding light on chemoresistance biology of breast cancer could contribute to enhance the clinical outcome. Intrinsic or acquired resistance to chemotherapy is a major problem in breast cancer treatment. The NFκB pathway by siRNAP65 and JSH-23 as a translocational inhibitor of NFκBP65 in the doxorubicin-resistant MCF-7 (MCF-7/Dox) and MCF-7 cells was blocked. Then, the ABC transporter expression and function were assessed by real-time qRT-PCR and flow cytometry, respectively. Induction of apoptosis was evaluated after inhibition of the NFΚB pathway as well. Our study underlined the upregulation of NFκBP65 and anti-apoptotic Bcl-2 and downregulation of pro-apoptotic Bax in the MCF-7/Dox cells compared with control MCF-7 cells. Here, we showed that interplay between nuclear factor kappa B P65 (NFkBP65) as a transcriptional regulator and ABC transporters in the MCF-7/Dox cancer cells. We found that inhibition of the elevated expression of NFκBP65 in the resistant breast cancer, whether translocational inhibition or silencing by siRNA, decreased the expression and function of MDR1 and MRP1 efflux pumps. Furthermore, the blockade of NFκBP65 promoted apoptosis via modulating Bcl-2 and BAX expression. After inhibition of the NFκBP65 signaling pathway, elevated baseline expression of survival Bcl-2 gene in the resistant breast cells significantly decreased. Suppression of the NFκB pathway has a profound dual impact on promoting the intrinsic apoptotic pathway and reducing ABC transporter function and expression, which are some of the chemoresistance features. It was speculated that the NFκB pathway directly acts on doxorubicin-induced MDR1 and MRP1 expression in MCF-7/Dox cells.
The Interaction of TXNIP and AFq1 Genes Increases the Susceptibility of Schizophrenia.
Su, Yousong; Ding, Wenhua; Xing, Mengjuan; Qi, Dake; Li, Zezhi; Cui, Donghong
2017-08-01
Although previous studies showed the reduced risk of cancer in patients with schizophrenia, whether patients with schizophrenia possess genetic factors that also contribute to tumor suppressor is still unknown. In the present study, based on our previous microarray data, we focused on the tumor suppressor genes TXNIP and AF1q, which differentially expressed in patients with schizophrenia. A total of 413 patients and 578 healthy controls were recruited. We found no significant differences in genotype, allele, or haplotype frequencies at the selected five single nucleotide polymorphisms (SNPs) (rs2236566 and rs7211 in TXNIP gene; rs10749659, rs2140709, and rs3738481 in AF1q gene) between patients with schizophrenia and controls. However, we found the association between the interaction of TXNIP and AF1q with schizophrenia by using the MDR method followed by traditional statistical analysis. The best gene-gene interaction model identified was a three-locus model TXNIP (rs2236566, rs7211)-AF1q (rs2140709). After traditional statistical analysis, we found the high-risk genotype combination was rs2236566 (GG)-rs7211(CC)-rs2140709(CC) (OR = 1.35 [1.03-1.76]). The low-risk genotype combination was rs2236566 (GT)-rs7211(CC)-rs2140709(CC) (OR = 0.67 [0.49-0.91]). Our finding suggested statistically significant role of interaction of TXNIP and AF1q polymorphisms (TXNIP-rs2236566, TXNIP-rs7211, and AF1q-rs2769605) in schizophrenia susceptibility.
Isolation, Characterization and Anti-Multiple Drug Resistant (MDR ...
African Journals Online (AJOL)
(MDR) Bacterial Activity of Endophytic Fungi Isolated from ... Institute of Protection & Development of Beibu Wan Ocean Resources, Qinzhou University, Qinzhou, Guangxi Province, ..... isolated from secondary metabolites of the mangrove.
Elmeliegy, Mohamed A; Carcaboso, Angel M; Tagen, Michael; Bai, Feng; Stewart, Clinton F
2011-01-01
To study the role of drug transporters in central nervous system (CNS) penetration and cellular accumulation of erlotinib and its metabolite, OSI-420. After oral erlotinib administration to wild-type and ATP-binding cassette (ABC) transporter-knockout mice (Mdr1a/b(-/-), Abcg2(-/-), Mdr1a/b(-/-)Abcg2(-/-), and Abcc4(-/-)), plasma was collected and brain extracellular fluid (ECF) was sampled using intracerebral microdialysis. A pharmacokinetic model was fit to erlotinib and OSI-420 concentration-time data, and brain penetration (P(Brain)) was estimated by the ratio of ECF-to-unbound plasma area under concentration-time curves. Intracellular accumulation of erlotinib was assessed in cells overexpressing human ABC transporters or SLC22A solute carriers. P(Brain) in wild-type mice was 0.27 ± 0.11 and 0.07 ± 0.02 (mean ± SD) for erlotinib and OSI-420, respectively. Erlotinib and OSI-420 P(Brain) in Abcg2(-/-) and Mdr1a/b(-/-)Abcg2(-/-) mice were significantly higher than in wild-type mice. Mdr1a/b(-/-) mice showed similar brain ECF penetration as wild-type mice (0.49 ± 0.37 and 0.04 ± 0.02 for erlotinib and OSI-420, respectively). In vitro, erlotinib and OSI-420 accumulation was significantly lower in cells overexpressing breast cancer resistance protein (BCRP) than in control cells. Only OSI-420, not erlotinib, showed lower accumulation in cells overexpressing P-glycoprotein (P-gp) than in control cells. The P-gp/BCRP inhibitor elacridar increased erlotinib and OSI-420 accumulation in BCRP-overexpressing cells. Erlotinib uptake was higher in OAT3- and OCT2-transfected cells than in empty vector control cells. Abcg2 is the main efflux transporter preventing erlotinib and OSI-420 penetration in mouse brain. Erlotinib and OSI-420 are substrates for SLC22A family members OAT3 and OCT2. Our findings provide a mechanistic basis for erlotinib CNS penetration, cellular uptake, and efflux mechanisms. ©2010 AACR.
Vasudevan, Gayatri; Ullman, Buddy; Landfear, Scott M.
2001-01-01
Leishmania parasites lack a purine biosynthetic pathway and depend on surface nucleoside and nucleobase transporters to provide them with host purines. Leishmania donovani possess two closely related genes that encode high affinity adenosine-pyrimidine nucleoside transporters LdNT1.1 and LdNT1.2 and that transport the toxic adenosine analog tubercidin in addition to the natural substrates. In this study, we have characterized a drug-resistant clonal mutant of L. do...
Kwon, Minseok; Leem, Sangseob; Yoon, Joon; Park, Taesung
2018-03-19
With the rapid advancement of array-based genotyping techniques, genome-wide association studies (GWAS) have successfully identified common genetic variants associated with common complex diseases. However, it has been shown that only a small proportion of the genetic etiology of complex diseases could be explained by the genetic factors identified from GWAS. This missing heritability could possibly be explained by gene-gene interaction (epistasis) and rare variants. There has been an exponential growth of gene-gene interaction analysis for common variants in terms of methodological developments and practical applications. Also, the recent advancement of high-throughput sequencing technologies makes it possible to conduct rare variant analysis. However, little progress has been made in gene-gene interaction analysis for rare variants. Here, we propose GxGrare which is a new gene-gene interaction method for the rare variants in the framework of the multifactor dimensionality reduction (MDR) analysis. The proposed method consists of three steps; 1) collapsing the rare variants, 2) MDR analysis for the collapsed rare variants, and 3) detect top candidate interaction pairs. GxGrare can be used for the detection of not only gene-gene interactions, but also interactions within a single gene. The proposed method is illustrated with 1080 whole exome sequencing data of the Korean population in order to identify causal gene-gene interaction for rare variants for type 2 diabetes. The proposed GxGrare performs well for gene-gene interaction detection with collapsing of rare variants. GxGrare is available at http://bibs.snu.ac.kr/software/gxgrare which contains simulation data and documentation. Supported operating systems include Linux and OS X.
de Jong, Femke; Thodey, Kate; Lejay, Laurence V.; Bevan, Michael W.
2014-01-01
Mineral nutrient uptake and assimilation is closely coordinated with the production of photosynthate to supply nutrients for growth. In Arabidopsis (Arabidopsis thaliana), nitrate uptake from the soil is mediated by genes encoding high- and low-affinity transporters that are transcriptionally regulated by both nitrate and photosynthate availability. In this study, we have studied the interactions of nitrate and glucose (Glc) on gene expression, nitrate transport, and growth using glucose-insensitive2-1 (gin2-1), which is defective in sugar responses. We confirm and extend previous work by showing that HEXOKINASE1-mediated oxidative pentose phosphate pathway (OPPP) metabolism is required for Glc-mediated NITRATE TRANSPORTER2.1 (NRT2.1) expression. Treatment with pyruvate and shikimate, two products derived from intermediates of the OPPP that are destined for amino acid production, restores wild-type levels of NRT2.1 expression, suggesting that metabolites derived from OPPP metabolism can, together with Glc, directly stimulate high levels of NRT2.1 expression. Nitrate-mediated NRT2.1 expression is not influenced by gin2-1, showing that Glc does not influence NRT2.1 expression through nitrate-mediated mechanisms. We also show that Glc stimulates NRT2.1 protein levels and transport activity independently of its HEXOKINASE1-mediated stimulation of NRT2.1 expression, demonstrating another possible posttranscriptional mechanism influencing nitrate uptake. In gin2-1 plants, nitrate-responsive biomass growth was strongly reduced, showing that the supply of OPPP metabolites is essential for assimilating nitrate for growth. PMID:24272701
Moiseeva, N I; Susova, O Yu; Mitrofanov, A A; Panteleev, D Yu; Pavlova, G V; Pustogarov, N A; Stavrovskaya, A A; Rybalkina, E Yu
2016-06-01
Glioblastomas (GBL) are the most common and aggressive brain tumors. They are distinguished by high resistance to radiation and chemotherapy. To find novel approaches for GBL classification, we obtained 16 primary GBL cell cultures and tested them with real-time PCR for mRNA expression of several genes (YB-1, MGMT, MELK, MVP, MDR1, BCRP) involved in controlling cell proliferation and drug resistance. The primary GBL cultures differed in terms of proliferation rate, wherein a group of GBL cell cultures with low proliferation rate demonstrated higher resistance to temozolomide. We found that GBL primary cell cultures characterized by high proliferation rate and lower resistance to temozolomide expressed higher mRNA level of the YB-1 and MDR1 genes, whereas upregulated expression of MVP/LRP mRNA was a marker in the group of GBL with low proliferation rate and high resistance. A moderate correlation between expression of YB-1 and MELK as well as YB-1 and MDR1 was found. In the case of YB-1 and MGMT expression, no correlation was found. A significant negative correlation was revealed between mRNA expression of MVP/LRP and MELK, MDR1, and BCRP. No correlation in expression of YB-1 and MVP/LRP genes was observed. It seems that mRNA expression of YB-1 and MVP/LRP may serve as a marker for GBL cell cultures belonging to distinct groups, each of which is characterized by a unique pattern of gene activity.
Fuchs, Claudia Daniela; Paumgartner, Gustav; Mlitz, Veronika; Kunczer, Victoria; Halilbasic, Emina; Leditznig, Nadja; Wahlström, Annika; Ståhlman, Marcus; Thüringer, Andrea; Kashofer, Karl; Stojakovic, Tatjana; Marschall, Hanns-Ulrich; Trauner, Michael
2018-04-10
Interruption of the enterohepatic circulation of bile acids (BAs) may protect against BA-mediated cholestatic liver and bile duct injury. BA sequestrants are established to treat cholestatic pruritus, but their impact on the underlying cholestasis is still unclear. We aimed to explore the therapeutic effects and mechanisms of the BA sequestrant colesevelam in a mouse model of sclerosing cholangitis. Mdr2 -/- mice received colesevelam for 8 weeks. Gene expression profiles of BA homeostasis, inflammation and fibrosis were explored in liver, intestine and colon. Hepatic and faecal BA profiles and gut microbiome were analysed. Glucagon-like peptide 1 (GLP-1) levels in portal blood were measured by ELISA. Furthermore, Mdr2 -/- mice as well as wild-type 3,5-diethoxy-carbonyl-1,4-dihydrocollidine-fed mice were treated with GLP-1-receptor agonist exendin-4 for 2 weeks prior to analysis. Colesevelam reduced serum liver enzymes, BAs and expression of proinflammatory and profibrogenic markers. Faecal BA profiling revealed increased levels of secondary BAs after resin treatment, while hepatic and biliary BA composition showed a shift towards more hydrophilic BAs. Colonic GLP-1 secretion, portal venous GLP-1 levels and intestinal messenger RNA expression of gut hormone Proglucagon were increased, while ileal Fgf15 expression was abolished by colesevelam. Exendin-4 treatment increased bile duct mass without promoting a reactive cholangiocyte phenotype in mouse models of sclerosing cholangitis. Microbiota analysis showed an increase of the phylum δ-Proteobacteria after colesevelam treatment and a shift within the phyla Firmicutes from Clostridiales to Lactobacillus . Colesevelam increases faecal BA excretion and enhances BA conversion towards secondary BAs, thereby stimulating secretion of GLP-1 from enteroendocrine L-cells and attenuates liver and bile duct injury in Mdr2 -/- mice. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article
A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein
Wang, W.; Takezawa, D.; Poovaiah, B. W.
1996-01-01
A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.
Directory of Open Access Journals (Sweden)
Laura Coninx
2017-11-01
Full Text Available Zinc (Zn is an essential micronutrient but may become toxic when present in excess. In Zn-contaminated environments, trees can be protected from Zn toxicity by their root-associated micro-organisms, in particular ectomycorrhizal fungi. The mechanisms of cellular Zn homeostasis in ectomycorrhizal fungi and their contribution to the host tree’s Zn status are however not yet fully understood. The aim of this study was to identify and characterize transporters involved in Zn uptake in the ectomycorrhizal fungus Suillus luteus, a cosmopolitan pine mycobiont. Zn uptake in fungi is known to be predominantly governed by members of the ZIP (Zrt/IrtT-like protein family of Zn transporters. Four ZIP transporter encoding genes were identified in the S. luteus genome. By in silico and phylogenetic analysis, one of these proteins, SlZRT1, was predicted to be a plasma membrane located Zn importer. Heterologous expression in yeast confirmed the predicted function and localization of the protein. A gene expression analysis via RT-qPCR was performed in S. luteus to establish whether SlZRT1 expression is affected by external Zn concentrations. SlZRT1 transcripts accumulated almost immediately, though transiently upon growth in the absence of Zn. Exposure to elevated concentrations of Zn resulted in a significant reduction of SlZRT1 transcripts within the first hour after initiation of the exposure. Altogether, the data support a role as cellular Zn importer for SlZRT1 and indicate a key role in cellular Zn uptake of S. luteus. Further research is needed to understand the eventual contribution of SlZRT1 to the Zn status of the host plant.
Coninx, Laura; Thoonen, Anneleen; Slenders, Eli; Morin, Emmanuelle; Arnauts, Natascha; Op De Beeck, Michiel; Kohler, Annegret; Ruytinx, Joske; Colpaert, Jan V
2017-01-01
Zinc (Zn) is an essential micronutrient but may become toxic when present in excess. In Zn-contaminated environments, trees can be protected from Zn toxicity by their root-associated micro-organisms, in particular ectomycorrhizal fungi. The mechanisms of cellular Zn homeostasis in ectomycorrhizal fungi and their contribution to the host tree's Zn status are however not yet fully understood. The aim of this study was to identify and characterize transporters involved in Zn uptake in the ectomycorrhizal fungus Suillus luteus , a cosmopolitan pine mycobiont. Zn uptake in fungi is known to be predominantly governed by members of the ZIP (Zrt/IrtT-like protein) family of Zn transporters. Four ZIP transporter encoding genes were identified in the S. luteus genome. By in silico and phylogenetic analysis, one of these proteins, SlZRT1, was predicted to be a plasma membrane located Zn importer. Heterologous expression in yeast confirmed the predicted function and localization of the protein. A gene expression analysis via RT-qPCR was performed in S. luteus to establish whether SlZRT1 expression is affected by external Zn concentrations. SlZRT1 transcripts accumulated almost immediately, though transiently upon growth in the absence of Zn. Exposure to elevated concentrations of Zn resulted in a significant reduction of SlZRT1 transcripts within the first hour after initiation of the exposure. Altogether, the data support a role as cellular Zn importer for SlZRT1 and indicate a key role in cellular Zn uptake of S. luteus . Further research is needed to understand the eventual contribution of SlZRT1 to the Zn status of the host plant.
Commercial grade item (CGI) dedication of MDR relays for nuclear safety related applications
Das, Ranjit K.; Julka, Anil; Modi, Govind
1994-08-01
MDR relays manufactured by Potter & Brumfield (P&B) have been used in various safety related applications in commercial nuclear power plants. These include emergency safety features (ESF) actuation systems, emergency core cooling systems (ECCS) actuation, and reactor protection systems. The MDR relays manufactured prior to May 1990 showed signs of generic failure due to corrosion and outgassing of coil varnish. P&B has made design changes to correct these problems in relays manufactured after May 1990. However, P&B does not manufacture the relays under any 10CFR50 Appendix B quality assurance (QA) program. They manufacture the relays under their commercial QA program and supply these as commercial grade items. This necessitates CGI Dedication of these relays for use in nuclear-safety-related applications. This paper presents a CGI dedication program that has been used to dedicate the MDR relays manufactured after been used to dedicate the MDR relays manufactured after May 1990. The program is in compliance with current Nuclear Regulatory Commission (NRC) and Electric Power Research Institute (EPRI) guidelines and applicable industry standards; it specifies the critical characteristics of the relays, provides the tests and analysis required to verify the critical characteristics, the acceptance criteria for the test results, performs source verification to quality P&B for its control of the critical characteristics, and provides documentation. The program provides reasonable assurance that the new MDR relays will perform their intended safety functions.
Muñoz-Martínez, Francisco; Reyes, Carolina P; Pérez-Lomas, Antonio L; Jiménez, Ignacio A; Gamarro, Francisco; Castanys, Santiago
2006-01-01
Dihydro-beta-agarofuran sesquiterpenes from Celastraceae have been recently shown to bind to human P-glycoprotein (Pgp), functioning as specific, mixed-type inhibitors of its drug transport activity, as well as multidrug resistance (MDR) modulators in vitro. However, nothing is known about whether such compounds are themselves transported by Pgp, or whether they affect Pgp expression as well as its activity, or about the location of their binding site within the protein. We performed transport experiments with a newly synthesized fluorescent sesquiterpene derivative, which retains the anti-Pgp activity of its natural precursor. This probe was poorly transported by Pgp, MRP1, MRP2 and BCRP transporters, compared with classical MDR substrates. Moreover, Pgp did not confer cross-resistance to the most potent dihydro-beta-agarofurans, which did not affect Pgp expression levels in several MDR cell lines. Finally, we observed competitive and non-competitive interactions between one of such dihydro-beta-agarofurans (Mama12) and classical Pgp modulators such as cyclosporin A, verapamil, progesterone, vinblastine and GF120918. These findings suggest that multidrug ABC transporters do not confer resistance to dihydro-beta-agarofurans and could not affect their absorption and biodistribution in the body. Moreover, we mapped their binding site(s) within Pgp, which may prove useful for the rational design of improved modulators based on the structure of dihydro-beta-agarofurans.
Shrestha, Shovita; Tada, Tatsuya; Miyoshi-Akiyama, Tohru; Ohara, Hiroshi; Shimada, Kayo; Satou, Kazuhito; Teruya, Kuniko; Nakano, Kazuma; Shiroma, Akino; Sherchand, Jeevan Bdr; Rijal, Basista Psd; Hirano, Takashi; Kirikae, Teruo; Pokhrel, Bharat Mani
2015-11-01
The emergence of multidrug-resistant (MDR) Acinetobacter baumannii has become a serious medical problem worldwide. To clarify the genetic and epidemiological properties of MDR A. baumannii strains isolated from a medical setting in Nepal, 246 Acinetobacter spp. isolates obtained from different patients were screened for MDR A. baumannii by antimicrobial disk susceptibility testing. Whole genomes of the MDR A. baumannii isolates were sequenced by MiSeq™ (Illumina), and the complete genome of one isolate (IOMTU433) was sequenced by PacBio RS II. Phylogenetic trees were constructed from single nucleotide polymorphism concatemers. Multilocus sequence types were deduced and drug resistance genes were identified. Of the 246 Acinetobacter spp. isolates, 122 (49.6%) were MDR A. baumannii, with the majority being resistant to aminoglycosides, carbapenems and fluoroquinolones but not to colistin and tigecycline. These isolates harboured the 16S rRNA methylase gene armA as well as bla(NDM-1), bla(OXA-23) or bla(OXA-58). MDR A. baumannii isolates belonging to clonal complex 1 (CC1) and CC2 as well as a novel clonal complex (CC149) have spread throughout a medical setting in Nepal. The MDR isolates harboured genes encoding carbapenemases (OXA and NDM-1) and a 16S rRNA methylase (ArmA). Copyright © 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
Miyazaki, Haruko; Miyazaki, Yoshitsugu; Geber, Antonia; Parkinson, Tanya; Hitchcock, Christopher; Falconer, Derek J.; Ward, Douglas J.; Marsden, Katherine; Bennett, John E.
1998-01-01
Sequential Candida glabrata isolates were obtained from the mouth of a patient infected with human immunodeficiency virus type 1 who was receiving high doses of fluconazole for oropharyngeal thrush. Fluconazole-susceptible colonies were replaced by resistant colonies that exhibited both increased fluconazole efflux and increased transcripts of a gene which codes for a protein with 72.5% identity to Pdr5p, an ABC multidrug transporter in Saccharomyces cerevisiae. The deduced protein had a molecular mass of 175 kDa and was composed of two homologous halves, each with six putative transmembrane domains and highly conserved sequences of ATP-binding domains. When the earliest and most azole-susceptible isolate of C. glabrata from this patient was exposed to fluconazole, increased transcripts of the PDR5 homolog appeared, linking azole exposure to regulation of this gene. PMID:9661006
ABCA Transporter Gene Expression and Poor Outcome in Epithelial Ovarian Cancer
DEFF Research Database (Denmark)
Hedditch, Ellen L; Gao, Bo; Russell, Amanda J
2014-01-01
-wide association study. Impact of short interfering RNA-mediated gene suppression was determined by colony forming and migration assays. Association with survival was assessed with Kaplan-Meier analysis and log-rank tests. All statistical tests were two-sided. RESULTS: Associations with outcome were observed...... with ABC transporters of the "A" subfamily, but not with multidrug transporters. High-level expression of ABCA1, ABCA6, ABCA8, and ABCA9 in primary tumors was statistically significantly associated with reduced survival in serous ovarian cancer patients. Low levels of ABCA5 and the C-allele of rs536009...... ABCA1, ABCA5 and ABCA9 gene expression = 33.2 months, 95% CI = 26.4 to 40.1; vs 55.3 months in the group with favorable ABCA gene expression, 95% CI = 49.8 to 60.8; P = .001), independently of tumor stage or surgical debulking status. Suppression of cholesterol transporter ABCA1 inhibited ovarian...
Rijpma, S.R.; Velden, M. van der; Annoura, T.; Matz, J.M.; Kenthirapalan, S.; Kooij, T.W.; Matuschewski, K.; Gemert, G.J.A. van; Vegte-Bolmer, M.G. van de; Siebelink-Stoter, R.; Graumans, W.; Ramesar, J.; Klop, O.; Russel, F.G.; Sauerwein, R.W.; Janse, C.J.; Franke-Fayard, B.M.; Koenderink, J.B.
2016-01-01
Multidrug resistance (MDR) proteins belong to the B subfamily of the ATP Binding Cassette (ABC) transporters, which export a wide range of compounds including pharmaceuticals. In this study, we used reverse genetics to study the role of all seven Plasmodium MDR proteins during the life cycle of
Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC) Risk.
Chornokur, Ganna; Lin, Hui-Yi; Tyrer, Jonathan P; Lawrenson, Kate; Dennis, Joe; Amankwah, Ernest K; Qu, Xiaotao; Tsai, Ya-Yu; Jim, Heather S L; Chen, Zhihua; Chen, Ann Y; Permuth-Wey, Jennifer; Aben, Katja K H; Anton-Culver, Hoda; Antonenkova, Natalia; Bruinsma, Fiona; Bandera, Elisa V; Bean, Yukie T; Beckmann, Matthias W; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A; Brooks-Wilson, Angela; Bunker, Clareann H; Butzow, Ralf; Campbell, Ian G; Carty, Karen; Chang-Claude, Jenny; Cook, Linda S; Cramer, Daniel W; Cunningham, Julie M; Cybulski, Cezary; Dansonka-Mieszkowska, Agnieszka; du Bois, Andreas; Despierre, Evelyn; Dicks, Ed; Doherty, Jennifer A; Dörk, Thilo; Dürst, Matthias; Easton, Douglas F; Eccles, Diana M; Edwards, Robert P; Ekici, Arif B; Fasching, Peter A; Fridley, Brooke L; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G; Glasspool, Rosalind; Goodman, Marc T; Gronwald, Jacek; Harrington, Patricia; Harter, Philipp; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A T; Hillemanns, Peter; Hogdall, Claus K; Hogdall, Estrid; Hosono, Satoyo; Jakubowska, Anna; Jensen, Allan; Ji, Bu-Tian; Karlan, Beth Y; Kelemen, Linda E; Kellar, Mellissa; Kiemeney, Lambertus A; Krakstad, Camilla; Kjaer, Susanne K; Kupryjanczyk, Jolanta; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D; Lee, Alice W; Lele, Shashi; Leminen, Arto; Lester, Jenny; Levine, Douglas A; Liang, Dong; Lim, Boon Kiong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F A G; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R; McNeish, Iain; Menon, Usha; Milne, Roger L; Modugno, Francesmary; Moysich, Kirsten B; Ness, Roberta B; Nevanlinna, Heli; Eilber, Ursula; Odunsi, Kunle; Olson, Sara H; Orlow, Irene; Orsulic, Sandra; Weber, Rachel Palmieri; Paul, James; Pearce, Celeste L; Pejovic, Tanja; Pelttari, Liisa M; Pike, Malcolm C; Poole, Elizabeth M; Risch, Harvey A; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H; Rudolph, Anja; Runnebaum, Ingo B; Rzepecka, Iwona K; Salvesen, Helga B; Schernhammer, Eva; Schwaab, Ira; Shu, Xiao-Ou; Shvetsov, Yurii B; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa C; Spiewankiewicz, Beata; Sucheston, Lara; Teo, Soo-Hwang; Terry, Kathryn L; Thompson, Pamela J; Thomsen, Lotte; Tangen, Ingvild L; Tworoger, Shelley S; van Altena, Anne M; Vierkant, Robert A; Vergote, Ignace; Walsh, Christine S; Wang-Gohrke, Shan; Wentzensen, Nicolas; Whittemore, Alice S; Wicklund, Kristine G; Wilkens, Lynne R; Wu, Anna H; Wu, Xifeng; Woo, Yin-Ling; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Hasmad, Hanis N; Berchuck, Andrew; Iversen, Edwin S; Schildkraut, Joellen M; Ramus, Susan J; Goode, Ellen L; Monteiro, Alvaro N A; Gayther, Simon A; Narod, Steven A; Pharoah, Paul D P; Sellers, Thomas A; Phelan, Catherine M
2015-01-01
Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC), we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk. In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC). Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS). SNP analyses were conducted using unconditional logistic regression under a log-additive model, and the FDR q<0.2 was applied to adjust for multiple comparisons. The most significant evidence of an association for all invasive cancers combined and for the serous subtype was observed for SNP rs17216603 in the iron transporter gene HEPH (invasive: OR = 0.85, P = 0.00026; serous: OR = 0.81, P = 0.00020); this SNP was also associated with the borderline/low malignant potential (LMP) tumors (P = 0.021). Other genes significantly associated with EOC histological subtypes (p<0.05) included the UGT1A (endometrioid), SLC25A45 (mucinous), SLC39A11 (low malignant potential), and SERPINA7 (clear cell carcinoma). In addition, 1785 SNPs in six genes (HEPH, MGST1, SERPINA, SLC25A45, SLC39A11 and UGT1A) were imputed from the 1000 Genomes Project and examined for association with INV EOC in white-European subjects. The most significant imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4). These results, generated on a large cohort of women, revealed associations between inherited cellular transport
Mukherjee, J S; Joseph, J K; Rich, M L; Shin, S S; Furin, J J; Seung, K J; Sloutsky, A; Socci, A R; Vanderwarker, C; Vasquez, L; Palacios, E; Guerra, D; Viru, F A; Farmer, P; Del Castillo, H E
2003-07-01
Since 2000, the directly observed treatment, short-course (DOTS) strategy has been expanded in several countries to include treatment of multidrug-resistant tuberculosis (MDR-TB). This strategy is known as DOTS-Plus. Tuberculosis is a common cause of morbidity and mortality for children throughout the developing world. Children may also be infected with MDR-TB, yet most developing countries do not specifically address pediatric MDR-TB. To present the intermediate outcomes of the first 16 children enrolled in the Peruvian DOTS-Plus program and to demonstrate the tolerability of second-line anti-tuberculosis drugs. Three children completed therapy and are cured, one child had bacteriologic and clinical failure after 12 months of therapy and died of respiratory insufficiency, and 12 have intermediate outcomes demonstrating favorable clinical, bacteriologic, and radiographic evidence of improvement after 9-19 months of therapy. Of the 16 pediatric DOTS-Plus patients, 15 have tolerated therapy well and have had favorable clinical evolution. However, the diagnosis of pediatric MDR-TB is often extremely delayed due to reliance on the adult case definition and should be changed to prevent progressive, chronic illness in such children. Programmatic changes could facilitate earlier diagnosis and treatment of pediatric MDR-TB in Peru and in other DOTS-Plus programs.
Directory of Open Access Journals (Sweden)
van der Meijde Jolanda
2007-08-01
Full Text Available Abstract Background Fasting has dramatic effects on small intestinal transport function. However, little is known on expression of intestinal transport and phase I/II metabolism genes during fasting and the role the fatty acid-activated transcription factor PPARα may play herein. We therefore investigated the effects of fasting on expression of these genes using Affymetrix GeneChip MOE430A arrays and quantitative RT-PCR. Results After 24 hours of fasting, expression levels of 33 of the 253 analyzed transporter and phase I/II metabolism genes were changed. Upregulated genes were involved in transport of energy-yielding molecules in processes such as glycogenolysis (G6pt1 and mitochondrial and peroxisomal oxidation of fatty acids (Cact, Mrs3/4, Fatp2, Cyp4a10, Cyp4b1. Other induced genes were responsible for the inactivation of the neurotransmitter serotonin (Sert, Sult1d1, Dtd, Papst2, formation of eicosanoids (Cyp2j6, Cyp4a10, Cyp4b1, or for secretion of cholesterol (Abca1 and Abcg8. Cyp3a11, typically known because of its drug metabolizing capacity, was also increased. Fasting had no pronounced effect on expression of phase II metabolic enzymes, except for glutathione S-transferases which were down-regulated. Time course studies revealed that some genes were acutely regulated, whereas expression of other genes was only affected after prolonged fasting. Finally, we identified 8 genes that were PPARα-dependently upregulated upon fasting. Conclusion We have characterized the response to fasting on expression of transporters and phase I/II metabolic enzymes in murine small intestine. Differentially expressed genes are involved in a variety of processes, which functionally can be summarized as a increased oxidation of fat and xenobiotics, b increased cholesterol secretion, c increased susceptibility to electrophilic stressors, and d reduced intestinal motility. This knowledge increases our understanding of gut physiology, and may be of relevance
Directory of Open Access Journals (Sweden)
U D Gupta
2015-01-01
Full Text Available Background & objectives: Studies have shown the bactericidal potential of econazole and clotrimazole against Mycobacterium tuberculosis under in vitro and ex vivo conditions along with their synergism with conventional antituberculosis drugs. These molecules were also found to be effective against different multidrug resistant (MDR M. tuberculosis isolates in vitro. Hence the present study was designed to evaluate the in vivo antimycobacterial potential of moxifloxacin and econazole alone and in combination against multidrug resistant tuberculosis (MDR-TB in a mice model. Methods: Mice were infected with 2.5×10 [7] bacilli of MDR strain of M. tuberculosis by aerosol route of infection. After four weeks of infection, chemotherapy was started orally by moxifloxacin 8.0 mg/kg body wt and econazole 3.3 mg/kg alone and in combination, as well as with four first line anti-tuberculosis drugs as a positive control. The animals were sacrificed and the lungs and spleen were excised under aspetic conditions. The tissues were homogenized with sterile normal saline, an aliquot of the homogenate was plated on Middlebrook 7H11 agar supplemented with oleate albumin dextrose catalase (OADC and incubated at 37°C for four weeks. The number of visible and individual colonies were counted. Results: The first line anti-tuberculosis drugs (RIF+INH+EMB+PZA after eight weeks of therapy had no impact as the bacillary load in lungs and spleens remained unchanged. However, econazole, moxifloxacin alone as well as in combination significantly reduced the bacillary load in lungs as well as in spleens of MDR-TB bacilli infected mice. Interpretation & conclusions: Co-administration of the two drugs (econazole and moxifloxacin to MDR-TB strain JAL-7782 infected mice exhibited additive effect, the efficacy of the drugs in combination being higher as compared with ECZ or MOX alone. These results were substantiated by histopathological studies. This study suggests the utility of
Association of attention-deficit disorder and the dopamine transporter gene
Energy Technology Data Exchange (ETDEWEB)
Cook, E.H. Jr.; Stein, M.A.; Krasowski, M.D.; Cox, N.J.; Olkon, D.M.; Kieffer, J.E.; Leventhal, B.L. [Univ. of Chicago, IL (United States)
1995-04-01
Attention-deficit hyperactivity disorder (ADHD) has been shown to be familial and heritable, in previous studies. As with most psychiatric disorders, examination of pedigrees has not revealed a consistent Mendelian mode of transmission. The response of ADHD patients to medications that inhibit the dopamine transporter, including methylphenidate, amphetamine, pemoline, and bupropion, led us to consider the dopamine transporter as a primary candidate gene for ADHD. To avoid effects of population stratification and to avoid the problem of classification of relatives with other psychiatric disorders as affected or unaffected, we used the haplotype-based haplotype relative risk (HHRR) method to test for association between a VNTR polymorphism at the dopamine transporter locus (DAT1) and DSM-III-R-diagnosed ADHD (N = 49) and undifferentiated attention-deficit disorder (UADD) (N = 8) in trios composed of father, mother, and affected offspring. HHRR analysis revealed significant association between ADHS/UADD and the 480-bp DAT1 allele (X{sup 2} 7.51, 1 df, P = .006). When cases of UADD were dropped from the analysis, similar results were found (X{sup 2} 7.29, 1 df, P = .007). If these findings are replicated, molecular analysis of the dopamine transporter gene may identify mutations that increase susceptibility to ADHD/UADD. Biochemical analysis of such mutations may lead to development of more effective therapeutic interventions. 36 refs., 4 tabs.
Directory of Open Access Journals (Sweden)
Graner Andreas
2008-10-01
Full Text Available Abstract Background Barley has one of the largest and most complex genomes of all economically important food crops. The rise of new short read sequencing technologies such as Illumina/Solexa permits such large genomes to be effectively sampled at relatively low cost. Based on the corresponding sequence reads a Mathematically Defined Repeat (MDR index can be generated to map repetitive regions in genomic sequences. Results We have generated 574 Mbp of Illumina/Solexa sequences from barley total genomic DNA, representing about 10% of a genome equivalent. From these sequences we generated an MDR index which was then used to identify and mark repetitive regions in the barley genome. Comparison of the MDR plots with expert repeat annotation drawing on the information already available for known repetitive elements revealed a significant correspondence between the two methods. MDR-based annotation allowed for the identification of dozens of novel repeat sequences, though, which were not recognised by hand-annotation. The MDR data was also used to identify gene-containing regions by masking of repetitive sequences in eight de-novo sequenced bacterial artificial chromosome (BAC clones. For half of the identified candidate gene islands indeed gene sequences could be identified. MDR data were only of limited use, when mapped on genomic sequences from the closely related species Triticum monococcum as only a fraction of the repetitive sequences was recognised. Conclusion An MDR index for barley, which was obtained by whole-genome Illumina/Solexa sequencing, proved as efficient in repeat identification as manual expert annotation. Circumventing the labour-intensive step of producing a specific repeat library for expert annotation, an MDR index provides an elegant and efficient resource for the identification of repetitive and low-copy (i.e. potentially gene-containing sequences regions in uncharacterised genomic sequences. The restriction that a particular
Investigation of associations between NR1D1, RORA and RORB genes and bipolar disorder.
Directory of Open Access Journals (Sweden)
Yin-Chieh Lai
Full Text Available Several genes that are involved in the regulation of circadian rhythms are implicated in the susceptibility to bipolar disorder (BD. The current study aimed to investigate the relationships between genetic variants in NR1D1 RORA, and RORB genes and BD in the Han Chinese population. We conducted a case-control genetic association study with two samples of BD patients and healthy controls. Sample I consisted of 280 BD patients and 200 controls. Sample II consisted of 448 BD patients and 1770 healthy controls. 27 single nucleotide polymorphisms in the NR1D1, RORA, and RORB genes were genotyped using GoldenGate VeraCode assays in sample I, and 492 markers in the three genes were genotyped using Affymetrix Genome-Wide CHB Array in sample II. Single marker and gene-based association analyses were performed using PLINK. A combined p-value for the joining effects of all markers within a gene was calculated using the rank truncated product method. Multifactor dimensionality reduction (MDR method was also applied to test gene-gene interactions in sample I. All markers were in Hardy-Weinberg equilibrium (P>0.001. In sample I, the associations with BD were observed for rs4774388 in RORA (OR = 1.53, empirical p-value, P = 0.024, and rs1327836 in RORB (OR = 1.75, P = 0.003. In Sample II, there were 45 SNPs showed associations with BD, and the most significant marker in RORA was rs11639084 (OR = 0.69, P = 0.002, and in RORB was rs17611535 (OR = 3.15, P = 0.027. A combined p-value of 1.6×10-6, 0.7, and 1.0 was obtained for RORA, RORB and NR1D1, respectively, indicting a strong association for RORA with the risk of developing BD. A four way interaction was found among markers in NR1D1, RORA, and RORB with the testing accuracy 53.25% and a cross-validation consistency of 8 out of 10. In sample II, 45 markers had empirical p-values less than 0.05. The most significant markers in RORA and RORB genes were rs11639084 (OR = 0.69, P = 0.002, and rs17611535 (OR = 3
Differentially expressed genes in embryonic cardiac tissues of mice lacking Folr1 gene activity
Directory of Open Access Journals (Sweden)
Schwartz Robert J
2007-11-01
Full Text Available Abstract Background Heart anomalies are the most frequently observed among all human congenital defects. As with the situation for neural tube defects (NTDs, it has been demonstrated that women who use multivitamins containing folic acid peri-conceptionally have a reduced risk for delivering offspring with conotruncal heart defects 123. Cellular folate transport is mediated by a receptor or binding protein and by an anionic transporter protein system. Defective function of the Folr1 (also known as Folbp1; homologue of human FRα gene in mice results in inadequate transport, accumulation, or metabolism of folate during cardiovascular morphogenesis. Results We have observed cardiovascular abnormalities including outflow tract and aortic arch arterial defects in genetically compromised Folr1 knockout mice. In order to investigate the molecular mechanisms underlying the failure to complete development of outflow tract and aortic arch arteries in the Folr1 knockout mouse model, we examined tissue-specific gene expression difference between Folr1 nullizygous embryos and morphologically normal heterozygous embryos during early cardiac development (14-somite stage, heart tube looping (28-somite stage, and outflow track septation (38-somite stage. Microarray analysis was performed as a primary screening, followed by investigation using quantitative real-time PCR assays. Gene ontology analysis highlighted the following ontology groups: cell migration, cell motility and localization of cells, structural constituent of cytoskeleton, cell-cell adhesion, oxidoreductase, protein folding and mRNA processing. This study provided preliminary data and suggested potential candidate genes for further description and investigation. Conclusion The results suggested that Folr1 gene ablation and abnormal folate homeostasis altered gene expression in developing heart and conotruncal tissues. These changes affected normal cytoskeleton structures, cell migration and
International Nuclear Information System (INIS)
Del Vecchio, S.; Ciarmiello, A.; Potena, M.I.; Carriero, M.V.; Mainolfi, C.; Botti, G.; Thomas, R.; Cerra, M.; D'Aiuto, G.; Tsuruo, T.; Salvatore, M.
1997-01-01
Technetium-99m sestamibi is a transport substrate recognised by the multidrug-resistant P-glycoprotein (Pgp). To test whether 99m Tc-sestamibi efflux is enhanced in breast carcinomas overexpressing Pgp, we determined the efflux rates of 99m Tc-sestamibi and Pgp levels in tumours from 30 patients with untreated breast carcinoma. Patients were intravenously injected with 740 MBq of 99m Tc-sestamibi and underwent a 15-min dynamic study followed by the acquisition of static planar images at 0.5, 1, 2 and 4 h. Tumour specimens were obtained from each patient 24 h after 99m Tc-sestamibi scan and Pgp levels were determined using 125 I-MRK16 monoclonal antibody and in vitro quantitative autoradiography. All breast carcinomas showed high uptake of 99m Tc-sestamibi and data from region of interest analysis on sequential images were fitted with a monoexponential function. The efflux rates of 99m Tc-sestamibi, calculated from decay-corrected time-activity curves, ranged between 0.00121 and 0.01690 min -1 and were directly correlated with Pgp levels measured in the same tumours (r=0.62; P 99m Tc-sestamibi efflux from tumours of group A was 2.7 times higher than that observed in tumours of group B (0.00686 ±0.00390 min -1 vs 0.00250 ±0.00090 min -1 , P 99m Tc-sestamibi showed a sensitivity and a specificity of 80% and 95%, respectively. In conclusion, the efflux rate of 99m Tc-sestamibi may be used for the in vivo identification of the multidrug resistant (MDR1) phenotype in untreated breast cancer patients. (orig.). With 7 figs., 3 tabs
Wang, Tzu-Yun; Lee, Sheng-Yu; Chen, Shiou-Lan; Chang, Yun-Hsuan; Chen, Shih-Heng; Chu, Chun-Hsien; Huang, San-Yuan; Tzeng, Nian-Sheng; Wang, Chen-Lin; Lee, I Hui; Yeh, Tzung Lieh; Yang, Yen Kuang; Lu, Ru-Band
2012-07-11
Several studies have hypothesized that genes regulating the components of the serotonin system, including serotonin transporter (5-HTTLPR) and serotonin 1 B receptor (5-HT1B), may be associated with alcoholism, but their results are contradictory because of alcoholism's heterogeneity. Therefore, we examined whether the 5-HTTLPR gene and 5-HT1B gene G861C polymorphism are susceptibility factors for a specific subtype of alcoholism, antisocial alcoholism in Han Chinese in Taiwan. We recruited 273 Han Chinese male inmates with antisocial personality disorder (ASPD) [antisocial alcoholism (AS-ALC) group (n=120) and antisocial non-alcoholism (AS-N-ALC) group (n=153)] and 191 healthy male controls from the community. Genotyping was done using PCR-RFLP. There were no significant differences in the genotypic frequency of the 5-HT1B G861C polymorphism between the 3 groups. Although AS-ALC group members more frequently carried the 5-HTTLPR S/S, S/LG, and LG/LG genotypes than controls, the difference became non-significant after controlling for the covarying effects of age. However, the 5-HTTLPR S/S, S/LG, and LG/LG genotypes may have interacted with the 5-HT1B G861C C/C polymorphism and increased the risk of becoming antisocial alcoholism. Our study suggests that neither the 5-HTTLPR gene nor the 5-HT1B G861C polymorphism alone is a risk factor for antisocial alcoholism in Taiwan's Han Chinese population, but that the interaction between both genes may increase susceptibility to antisocial alcoholism.
Directory of Open Access Journals (Sweden)
M. Muñoz-Torrico
2017-01-01
Full Text Available Diabetes mellitus (DM is a well-known risk factor for tuberculosis (TB. However, it is not known to what extent DM affects the outcome in patients with multidrug-resistant (MDR-TB and extensively drug-resistant TB (XDR-TB treated with second-line anti-TB drugs.The objective of this study was to compare the microbiological evolution (sputum smear and culture conversion and final outcomes of MDR/XDR-TB patients with and without DM, managed at the national TB reference centre in Mexico City. Results: Ninety patients were enrolled between 2010 and 2015: 73 with MDR-TB (81.1%, 11 with pre-XDR-TB (e.g. MDR-TB with additional resistance to one injectable drug or a fluoroquinolone, 12.2% and 6 (6.7% with XDR-TB. Out of these, 49 (54.4% had DM and 42 (86% were undergoing insulin treatment.No statistically significant differences were found in treatment outcomes comparing DM vs. non-DM MDR-TB cases: 18/32 (56.3% of DM cases and 19/24 (79.2% non DM patients achieved treatment success (p = 0.07. The time to sputum smear and culture conversion was longer (although not statistically in patients without DM, as follows: the mean (±SD time to sputum smear conversion was 53.9 (±31.4 days in DM patients and 65.2 (±34.8 days in non-DM ones (p = 0.15, while the time to culture conversion was 66.2 (±27.6 days for DM and 81.4 (±37.7 days for non-DM MDR-TB cases (p = 0.06. Conclusions: The study results support the Mexican National TB programme to strengthen its collaboration with the DM programme, as an entry point for TB (and latent TB infection screening and management. Keywords: Diabetes mellitus, Delay, Sputum and culture conversion, MDR-TB, High treatment adherence
Risk factors for MDR and XDR-TB in a tertiary referral hospital in India.
Directory of Open Access Journals (Sweden)
V Balaji
Full Text Available BACKGROUND: India has a high burden of drug resistant TB, although there are few data on XDR-TB. Although XDR-TB has existed previously in India, the definition has not been widely applied, and surveillance using second line drug susceptibility testing has not been performed. Our objective was to analyze clinical and demographic risk factors associated with isolation of MDR and XDR TB as compared to susceptible controls, at a tertiary center. METHODOLOGY/FINDINGS: Retrospective chart review based on positive cultures isolated in a high volume mycobacteriology laboratory between 2002 and 2007. 47 XDR, 30 MDR and 117 susceptible controls were examined. Drug resistant cases were less likely to be extrapulmonary, and had received more previous treatment regimens. Significant risk factors for XDR-TB included residence outside the local state (OR 7.43, 3.07-18.0 and care costs subsidized (OR 0.23, 0.097-0.54 in bivariate analysis and previous use of a fluoroquinolone and injectable agent (other than streptomycin (OR 7.00, 95% C.I. 1.14-43.03 and an initial treatment regimen which did not follow national guidelines (OR 5.68, 1.24-25.96 in multivariate analysis. Cavitation and HIV did not influence drug resistance. CONCLUSIONS/SIGNIFICANCE: There is significant selection bias in the sample available. Selection pressure from previous treatment and an inadequate initial regimen increases risk of drug resistance. Local patients and those requiring financial subsidies may be at lower risk of XDR-TB.
DEFF Research Database (Denmark)
Yang, Shu-Yi; Grønlund, Mette; Jakobsen, Iver
2012-01-01
Pi acquisition of crops via arbuscular mycorrhizal (AM) symbiosis is becoming increasingly important due to limited highgrade rock Pi reserves and a demand for environmentally sustainable agriculture. Here, we show that 70% of the overall Pi acquired by rice (Oryza sativa) is delivered via...... or PT13 affected the development of the symbiosis, demonstrating that both genes are important for AM symbiosis. For symbiotic Pi uptake, however, only PT11 is necessary and sufficient. Consequently, our results demonstrate that mycorrhizal rice depends on the AM symbiosis to satisfy its Pi demands...... the symbiotic route. To better understand this pathway, we combined genetic, molecular, and physiological approaches to determine the specific functions of two symbiosis-specific members of the PHOSPHATE TRANSPORTER1 (PHT1) gene family from rice, ORYsa;PHT1;11 (PT11) and ORYsa;PHT1;13 (PT13). The PT11 lineage...
Increased expression of electron transport chain genes in uterine leiomyoma.
Tuncal, Akile; Aydin, Hikmet Hakan; Askar, Niyazi; Ozkaya, Ali Burak; Ergenoglu, Ahmet Mete; Yeniel, Ahmet Ozgur; Akdemir, Ali; Ak, Handan
2014-01-01
The etiology and pathophysiology of uterine leiomyomas, benign smooth muscle tumors of the uterus, are not well understood. To evaluate the role of mitochondria in uterine leiomyoma, we compared electron transport gene expressions of uterine leiomyoma tissue with myometrium tissue in six uterine leiomyoma patients by RT-PCR array. Our results showed an average of 1.562 (±0.445) fold increase in nuclear-encoded electron transport genes. These results might suggest an increase in size, number, or activity of mitochondria in uterine leiomyoma that, to our knowledge, has not been previously reported. © 2014 by the Association of Clinical Scientists, Inc.
Directory of Open Access Journals (Sweden)
Khoeruddin Wittriansyah
2016-12-01
Full Text Available Marine sponge-associated fungi are the sources of bioactive compounds with various pharmacologicals potency. This study aimed to isolate the sponge-associated fungi as the producer of the MDR anti-bacterial compounds. The associated fungi were isolated from the sponges collected from Riung water, Nusa Tenggara Timur. Five of the best isolates were cultured on MEA to obtain the methanolic extract for further studies. The antagonistic test was conducted using overlay method towards the MDR Staphylococcus aureus and Escherichia coli. A total of 33 fungi were isolated from 19 sponge specimens. The antagonistic test showed that 19 isolates were active against both S. aureus and E. coli, and 13 of them were merely active against one of the bacteria. However, only five isolates have strong activity against one or both of the bacteria. The KN-15-3 had the strongest activity against S. aureus (18.75±0.777mm and E. coli (15.10±0.141mm at the concentration of 400 μg.disc-1 so it can be developed further as a source of drug candicate. Keywords: Fungi symbiont, Sponges, MDR Antibacterial, Staphylococcus aureus, Escherichia coli.
Zhang, Hui; Patel, Atish; Ma, Shao-Lin; Li, Xiao Jie; Zhang, Yun-Kai; Yang, Pei-Qi; Kathawala, Rishil J; Wang, Yi-Jun; Anreddy, Nagaraju; Fu, Li-Wu; Chen, Zhe-Sheng
2014-01-01
Background and Purpose The transporter, multidrug resistance protein 1 (MRP1, ABCC1), plays a critical role in the development of multidrug resistance (MDR). Ibrutinib is an inhibitor of Bruton's tyrosine kinase. Here we investigated the reversal effect of ibrutinib on MRP1-mediated MDR. Experimental Approach Cytotoxicity was determined by MTT assay. The expression of protein was detected by Western blot. RT-PCR and Q-PCR were performed to detect the expression of MRP1 mRNA. The intracellular accumulation and efflux of substrates for MRP1 were measured by scintillation counter and flow cytometry. HEK293/MRP1 cell xenografts in nude mice were established to study the effects of ibrutinib in vivo. Key Results Ibrutinib significantly enhanced the cytotoxicity of MRP1 substrates in HEK293/MRP1 and HL60/Adr cells overexpressing MRP1. Furthermore, ibrutinib increased the accumulation of substrates in these MRP1-overexpressing cells by inhibiting the drug efflux function of MRP1. However, mRNA and protein expression of MRP1 remained unaltered after treatment with ibrutinib in MRP1-overexpressing cells. In vivo, ibrutinib enhanced the efficacy of vincristine to inhibit the growth of HEK293/MRP1 tumour xenografts in nude mice. Importantly, ibrutinib also enhances the cytotoxicity of vincristine in primary cultures of leukaemia blasts, derived from patients. Conclusions and Implications Our results indicated that ibrutinib significantly increased the efficacy of the chemotherapeutic agents which were MRP1 substrates, in MRP1-overexpressing cells, in vitro, in vivo and ex vivo. These findings will lead to further studies on the effects of a combination of ibrutinib with chemotherapeutic agents in cancer patients overexpressing MRP1. PMID:25164592
Happi, C T; Gbotosho, G O; Folarin, O A; Sowunmi, A; Hudson, T; O'Neil, M; Milhous, W; Wirth, D F; Oduola, A M J
2009-03-01
We assessed Plasmodium falciparum mdr1 (Pfmdr1) gene polymorphisms and copy numbers as well as P. falciparum Ca(2+) ATPase (PfATPase6) gene polymorphisms in 90 Nigerian children presenting with uncomplicated falciparum malaria and enrolled in a study of the efficacy of artemether-lumefantrine (AL). The nested PCR-restriction fragment length polymorphism and the quantitative real-time PCR methodologies were used to determine the alleles of the Pfmdr1 and PfATPase6 genes and the Pfmdr1 copy number variation, respectively, in patients samples collected prior to treatment and at the reoccurrence of parasites during a 42-day follow-up. The Pfmdr1 haplotype 86N-184F-1246D was significantly associated (P copy of the Pfmdr1 gene and the wild-type allele (L89) at codon 89 of the PfATPase6 gene. These findings suggest that polymorphisms in the Pfmdr1 gene are under AL selection pressure. Pfmdr1 polymorphisms may result in reduction in the therapeutic efficacy of this newly adopted combination treatment for uncomplicated falciparum malaria in Saharan countries of Africa.
International Nuclear Information System (INIS)
Yamada, Kiyoshi; Brink, I.; Engelhardt, R.
2005-01-01
In order to specify the influence of multidrug-resistance (MDR) on the accumulation of the PET tracer, F-18 FDG ([Fluorine-18]2-fluoro-2-deoxy-D-glucose, in melanoma cells, both the MDR function and expression of two human melanoma cell lines SK-MEL 23 and 24, were evaluated. The effects of MDR modulators on FDG accumulation and efflux were also investigated. A functional analysis using representative MDR fluorescent substrates and inhibitors clarified the following characteristics: SK-MEL 23 possesses a highly active function of multidrug resistance-associated protein (MRP), but not P-gp. SK-MEL 24 possesses weak functions of both MRP and P-gp. Western blot analysis using monoclonal antibodies for MDR expression demonstrated an exceedingly high MRP expression of SK-MEL 23 and only slight P-gp and MRP expression of SK-MEL 24, corresponding to the functional data. The efflux inhibition assay using F-18 FDG revealed a considerable retention of FDG in SK-MEL 23 in the presence of the MRP inhibitor probenecid. It was also found that the P-gp inhibitor verapamil depressed the FDG efflux of SK-MEL 24. Our present in vitro study suggests that FDG may be a substrate of MDR in some melanoma cells and further MDR may be one of the important factors affecting FDG-PET melanoma imaging. (author)
Cloning and expression analysis of a novel ammonium transporter gene from eichhornia
International Nuclear Information System (INIS)
Li, Y.; Yan, G.; Zheng, L.
2014-01-01
In order to explore the molecular mechanism for Eichhornia crassipes to transport ammonium from outside, we cloned a novel ammonium transporter (EcAMT) gene from E. crassipes and identified its function by using yeast complementation experiment. The full-length cDNA of EcAMT contains a 1506 nucletide-long open reading frame which encodes a protein of 501 amino acids. Bioinformatics analysis predicted that EcAMT had 8 transmembrane regions. The expressions of EcAMT gene under three different nitrogen conditions were evaluated by quantitative reverse transcriptase PCR (qRT-PCR) and the results showed that the expression of EcAMT gene was up-regulated under nitrogen starvation. Our study results revealed some molecular mechanism of E. crassipes to absorb the ammonium in eutrophic water. (author)
Directory of Open Access Journals (Sweden)
Li Yang
Full Text Available Endometrial cancer (EC is a complex disease involving multiple gene-gene and gene-environment interactions. TGF-β signaling plays pivotal roles in EC development. This study aimed to investigate whether the genetic polymorphisms of TGF-β signaling related genes TGFB1, TGFBR1, SNAI1 and TWIST1 contribute to EC susceptibility. Using the TaqMan Genotyping Assay, 19 tagging-SNPs of these four genes were genotyped in 516 EC cases and 707 controls among Chinese Han women. Logistic regression (LR showed that the genetic variants of TGFB1 rs1800469, TGFBR1 rs6478974 and rs10733710, TWIST1 rs4721745 were associated with decreased EC risk, and these four loci showed a dose-dependent effect (Ptrend < 0.0001. Classification and regression tree (CART demonstrated that women carrying both the genotypes of TGFBR1 rs6478974 TT and rs10512263 TC/CC had the highest risk of EC (aOR = 7.86, 95% CI = 3.42-18.07, P<0.0001. Multifactor dimensionality reduction (MDR revealed that TGFB1 rs1800469 plus TGFBR1 rs6478974 was the best interactional model to detect EC risk. LR, CART and MDR all revealed that TGFBR1 rs6478974 was the most important protective locus for EC. In haplotype association study, TGFBR1 haplotype CACGA carrier showed the lowest EC risk among women with longer menarche-first full term pregnancy intervals (˃11 years and BMI˂24 (aOR = 0.39, 95% CI = 0.17-0.90, P = 0.0275. These results suggest that polymorphisms in TGFB1, TGFBR1, SNAI1 and TWIST1 may modulate EC susceptibility, both separately and corporately.
Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC Risk.
Directory of Open Access Journals (Sweden)
Ganna Chornokur
Full Text Available Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC, we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk.In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC. Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS. SNP analyses were conducted using unconditional logistic regression under a log-additive model, and the FDR q<0.2 was applied to adjust for multiple comparisons.The most significant evidence of an association for all invasive cancers combined and for the serous subtype was observed for SNP rs17216603 in the iron transporter gene HEPH (invasive: OR = 0.85, P = 0.00026; serous: OR = 0.81, P = 0.00020; this SNP was also associated with the borderline/low malignant potential (LMP tumors (P = 0.021. Other genes significantly associated with EOC histological subtypes (p<0.05 included the UGT1A (endometrioid, SLC25A45 (mucinous, SLC39A11 (low malignant potential, and SERPINA7 (clear cell carcinoma. In addition, 1785 SNPs in six genes (HEPH, MGST1, SERPINA, SLC25A45, SLC39A11 and UGT1A were imputed from the 1000 Genomes Project and examined for association with INV EOC in white-European subjects. The most significant imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4.These results, generated on a large cohort of women, revealed associations between inherited cellular
Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC) Risk
Chornokur, Ganna; Lin, Hui-Yi; Tyrer, Jonathan P.; Lawrenson, Kate; Dennis, Joe; Amankwah, Ernest K.; Qu, Xiaotao; Tsai, Ya-Yu; Jim, Heather S. L.; Chen, Zhihua; Chen, Ann Y.; Permuth-Wey, Jennifer; Aben, Katja KH.; Anton-Culver, Hoda; Antonenkova, Natalia; Bruinsma, Fiona; Bandera, Elisa V.; Bean, Yukie T.; Beckmann, Matthias W.; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A.; Brooks-Wilson, Angela; Bunker, Clareann H.; Butzow, Ralf; Campbell, Ian G.; Carty, Karen; Chang-Claude, Jenny; Cook, Linda S.; Cramer, Daniel W.; Cunningham, Julie M.; Cybulski, Cezary; Dansonka-Mieszkowska, Agnieszka; du Bois, Andreas; Despierre, Evelyn; Dicks, Ed; Doherty, Jennifer A.; Dörk, Thilo; Dürst, Matthias; Easton, Douglas F.; Eccles, Diana M.; Edwards, Robert P.; Ekici, Arif B.; Fasching, Peter A.; Fridley, Brooke L.; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G.; Glasspool, Rosalind; Goodman, Marc T.; Gronwald, Jacek; Harrington, Patricia; Harter, Philipp; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A. T.; Hillemanns, Peter; Hogdall, Claus K.; Hogdall, Estrid; Hosono, Satoyo; Jakubowska, Anna; Jensen, Allan; Ji, Bu-Tian; Karlan, Beth Y.; Kelemen, Linda E.; Kellar, Mellissa; Kiemeney, Lambertus A.; Krakstad, Camilla; Kjaer, Susanne K.; Kupryjanczyk, Jolanta; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D.; Lee, Alice W.; Lele, Shashi; Leminen, Arto; Lester, Jenny; Levine, Douglas A.; Liang, Dong; Lim, Boon Kiong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F. A. G.; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R.; McNeish, Iain; Menon, Usha; Milne, Roger L.; Modugno, Francesmary; Moysich, Kirsten B.; Ness, Roberta B.; Nevanlinna, Heli; Eilber, Ursula; Odunsi, Kunle; Olson, Sara H.; Orlow, Irene; Orsulic, Sandra; Weber, Rachel Palmieri; Paul, James; Pearce, Celeste L.; Pejovic, Tanja; Pelttari, Liisa M.; Pike, Malcolm C.; Poole, Elizabeth M.; Risch, Harvey A.; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H.; Rudolph, Anja; Runnebaum, Ingo B.; Rzepecka, Iwona K.; Salvesen, Helga B.; Schernhammer, Eva; Schwaab, Ira; Shu, Xiao-Ou; Shvetsov, Yurii B.; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa C.; Spiewankiewicz, Beata; Sucheston, Lara; Teo, Soo-Hwang; Terry, Kathryn L.; Thompson, Pamela J.; Thomsen, Lotte; Tangen, Ingvild L.; Tworoger, Shelley S.; van Altena, Anne M.; Vierkant, Robert A.; Vergote, Ignace; Walsh, Christine S.; Wang-Gohrke, Shan; Wentzensen, Nicolas; Whittemore, Alice S.; Wicklund, Kristine G.; Wilkens, Lynne R.; Wu, Anna H.; Wu, Xifeng; Woo, Yin-Ling; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Hasmad, Hanis N.; Berchuck, Andrew; Iversen, Edwin S.; Schildkraut, Joellen M.; Ramus, Susan J.; Goode, Ellen L.; Monteiro, Alvaro N. A.; Gayther, Simon A.; Narod, Steven A.; Pharoah, Paul D. P.; Sellers, Thomas A.; Phelan, Catherine M.
2015-01-01
Background Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC), we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk. Methods In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC). Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS). SNP analyses were conducted using unconditional logistic regression under a log-additive model, and the FDR q<0.2 was applied to adjust for multiple comparisons. Results The most significant evidence of an association for all invasive cancers combined and for the serous subtype was observed for SNP rs17216603 in the iron transporter gene HEPH (invasive: OR = 0.85, P = 0.00026; serous: OR = 0.81, P = 0.00020); this SNP was also associated with the borderline/low malignant potential (LMP) tumors (P = 0.021). Other genes significantly associated with EOC histological subtypes (p<0.05) included the UGT1A (endometrioid), SLC25A45 (mucinous), SLC39A11 (low malignant potential), and SERPINA7 (clear cell carcinoma). In addition, 1785 SNPs in six genes (HEPH, MGST1, SERPINA, SLC25A45, SLC39A11 and UGT1A) were imputed from the 1000 Genomes Project and examined for association with INV EOC in white-European subjects. The most significant imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4). Conclusion These results, generated on a large cohort of women, revealed associations
Isolation and Characterization of the Colletotrichum acutatum ABC Transporter CaABC1
Directory of Open Access Journals (Sweden)
Suyoung Kim
2014-12-01
Full Text Available Fungi tolerate exposure to various abiotic stresses, including cytotoxic compounds and fungicides, via their ATP-driven efflux pumps belonging to ATP-binding cassette (ABC transporters. To clarify the molecular basis of interaction between the fungus and various abiotic stresses including fungicides, we constructed a cDNA library from germinated conidia of Colletotrichum acutatum, a major anthracnose pathogen of pepper (Capsicum annum L.. Over 1,000 cDNA clones were sequenced, of which single clone exhibited significant nucleotide sequence homology to ABC transporter genes. We isolated three fosmid clones containing the C. acutatum ABC1 (CaABC1 gene in full-length from genomic DNA library screening. The CaABC1 gene consists of 4,059 bp transcript, predicting a 1,353-aa protein. The gene contains the typical ABC signature and Walker A and B motifs. The 5′-flanking region contains a CAAT motif, a TATA box, and a Kozak region. Phylogenetic and structural analysis suggested that the CaABC1 is a typical ABC transporter gene highly conserved in various fungal species, as well as in Chromista, Metazoans, and Viridiplantae. We also found that CaABC1 was up-regulated during conidiation and a minimal medium condition. Moreover, CaABC1 was induced in iprobenfos, kresoxim-methyl, thiophanate-methyl, and hygromycin B. These results demonstrate that CaABC1 is necessary for conidiation, abiotic stress, and various fungicide resistances. These results will provide the basis for further study on the function of ABC transporter genes in C. acutatum.
Diverse expression of sucrose transporter gene family in Zea mays
Indian Academy of Sciences (India)
2015-03-04
Mar 4, 2015 ... In this study, we identified four sucrose transporter genes. (ZmSUT1 .... strand synthesis was done with forward and reverse primers designed at .... Qazi H. A., Paranjpe S. and Bhargava S. 2012 Stem sugar accu- mulation in ...
A novel nonsense mutation in the WFS1 gene causes the Wolfram syndrome.
Noorian, Shahab; Savad, Shahram; Mohammadi, Davood Shah
2016-05-01
Wolfram syndrome is a rare autosomal recessive neurodegenerative disorder, which is mostly caused by mutations in the WFS1 gene. The WFS1 gene product, which is called wolframin, is thought to regulate the function of endoplasmic reticulum. The endoplasmic reticulum has a critical role in protein folding and material transportation within the cell or to the surface of the cell. Identification of new mutations in WFS1 gene will unravel the molecular pathology of WS. The aim of this case report study is to describe a novel mutation in exon 4 of the WFS1 gene (c.330C>A) in a 9-year-old boy with WS.
Schoonbeek, H.; Nistelrooy, van J.G.M.; Waard, de M.A.
2003-01-01
The role of multiple ATP-binding cassette (ABC) and major facilitator superfamily (MFS) transporter genes from the plant pathogenic fungus Botrytis cinerea in protection against natural fungitoxic compounds was studied by expression analysis and phenotyping of gene-replacement mutants. The
Revalde, Jezrael L; Li, Yan; Hawkins, Bill C; Rosengren, Rhonda J; Paxton, James W
2015-02-01
Curcumin (CUR) is a phytochemical that inhibits the xenobiotic ABC efflux transporters implicated in cancer multidrug resistance (MDR), such as P-glycoprotein (P-gp), breast cancer resistance protein (BCRP) and multidrug resistance-associated proteins 1 and 5 (MRP1 and MRP5). The use of CUR in the clinic however, is complicated by its instability and poor pharmacokinetic profile. Monocarbonyl analogs of CUR (MACs) are compounds without CUR's unstable β-diketone moiety and were reported to have improved stability and in vivo disposition. Whether the MACs can be used as MDR reversal agents is less clear, as the absence of a β-diketone may negatively impact transporter inhibition. In this study, we investigated 23 heterocyclic cyclohexanone MACs for inhibitory effects against P-gp, BCRP, MRP1 and MRP5. Using flow cytometry and resistance reversal assays, we found that many of these compounds inhibited the transport activity of the ABC transporters investigated, often with much greater potency than CUR. Overall the analogs were most effective at inhibiting BCRP and we identified three compounds, A12 (2,6-bis((E)-2,5-dimethoxy-benzylidene)cyclohexanone), A13 (2,6-bis((E)-4-hydroxyl-3-methoxybenzylidene)-cyclohexanone) and B11 (3,5-bis((E)-2-fluoro-4,5-dimethoxybenzylidene)-1-methylpiperidin-4-one), as the most promising BCRP inhibitors. These compounds inhibited BCRP activity in a non-cell line, non-substrate-specific manner. Their inhibition occurred by direct transporter interaction rather than modulating protein or cell surface expression. From these results, we concluded that MACs, such as the heterocyclic cyclohexanone analogs in this study, also have potential as MDR reversal agents and may be superior alternatives to the unstable parent compound, CUR. Copyright © 2014 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Wang Tzu-Yun
2012-07-01
Full Text Available Abstract Background Several studies have hypothesized that genes regulating the components of the serotonin system, including serotonin transporter (5-HTTLPR and serotonin 1 B receptor (5-HT1B, may be associated with alcoholism, but their results are contradictory because of alcoholism’s heterogeneity. Therefore, we examined whether the 5-HTTLPR gene and 5-HT1B gene G861C polymorphism are susceptibility factors for a specific subtype of alcoholism, antisocial alcoholism in Han Chinese in Taiwan. Methods We recruited 273 Han Chinese male inmates with antisocial personality disorder (ASPD [antisocial alcoholism (AS-ALC group (n = 120 and antisocial non-alcoholism (AS-N-ALC group (n = 153] and 191 healthy male controls from the community. Genotyping was done using PCR-RFLP. Results There were no significant differences in the genotypic frequency of the 5-HT1B G861C polymorphism between the 3 groups. Although AS-ALC group members more frequently carried the 5-HTTLPR S/S, S/LG, and LG/LG genotypes than controls, the difference became non-significant after controlling for the covarying effects of age. However, the 5-HTTLPR S/S, S/LG, and LG/LG genotypes may have interacted with the 5-HT1B G861C C/C polymorphism and increased the risk of becoming antisocial alcoholism. Conclusion Our study suggests that neither the 5-HTTLPR gene nor the 5-HT1B G861C polymorphism alone is a risk factor for antisocial alcoholism in Taiwan’s Han Chinese population, but that the interaction between both genes may increase susceptibility to antisocial alcoholism.
Happi, C. T.; Gbotosho, G. O.; Folarin, O. A.; Sowunmi, A.; Hudson, T.; O'Neil, M.; Milhous, W.; Wirth, D. F.; Oduola, A. M. J.
2009-01-01
We assessed Plasmodium falciparum mdr1 (Pfmdr1) gene polymorphisms and copy numbers as well as P. falciparum Ca2+ ATPase (PfATPase6) gene polymorphisms in 90 Nigerian children presenting with uncomplicated falciparum malaria and enrolled in a study of the efficacy of artemether-lumefantrine (AL). The nested PCR-restriction fragment length polymorphism and the quantitative real-time PCR methodologies were used to determine the alleles of the Pfmdr1 and PfATPase6 genes and the Pfmdr1 copy number variation, respectively, in patients samples collected prior to treatment and at the reoccurrence of parasites during a 42-day follow-up. The Pfmdr1 haplotype 86N-184F-1246D was significantly associated (P copy of the Pfmdr1 gene and the wild-type allele (L89) at codon 89 of the PfATPase6 gene. These findings suggest that polymorphisms in the Pfmdr1 gene are under AL selection pressure. Pfmdr1 polymorphisms may result in reduction in the therapeutic efficacy of this newly adopted combination treatment for uncomplicated falciparum malaria in Saharan countries of Africa. PMID:19075074
Hindle, Samantha J; Munji, Roeben N; Dolghih, Elena; Gaskins, Garrett; Orng, Souvinh; Ishimoto, Hiroshi; Soung, Allison; DeSalvo, Michael; Kitamoto, Toshihiro; Keiser, Michael J; Jacobson, Matthew P; Daneman, Richard; Bainton, Roland J
2017-10-31
Central nervous system (CNS) chemical protection depends upon discrete control of small-molecule access by the blood-brain barrier (BBB). Curiously, some drugs cause CNS side-effects despite negligible transit past the BBB. To investigate this phenomenon, we asked whether the highly BBB-enriched drug efflux transporter MDR1 has dual functions in controlling drug and endogenous molecule CNS homeostasis. If this is true, then brain-impermeable drugs could induce behavioral changes by affecting brain levels of endogenous molecules. Using computational, genetic, and pharmacologic approaches across diverse organisms, we demonstrate that BBB-localized efflux transporters are critical for regulating brain levels of endogenous steroids and steroid-regulated behaviors (sleep in Drosophila and anxiety in mice). Furthermore, we show that MDR1-interacting drugs are associated with anxiety-related behaviors in humans. We propose a general mechanism for common behavioral side effects of prescription drugs: pharmacologically challenging BBB efflux transporters disrupts brain levels of endogenous substrates and implicates the BBB in behavioral regulation. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang
2017-01-01
Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.
Chen, Bryan Wei; Chen, Wei; Liang, Hui; Liu, Hao; Liang, Chao; Zhi, Xiao; Hu, Li-Qiang; Yu, Xia-Zhen; Wei, Tao; Ma, Tao; Xue, Fei; Zheng, Lei; Zhao, Bin; Feng, Xin-Hua; Bai, Xue-Li; Liang, Ting-Bo
2015-08-01
mTOR is aberrantly activated in hepatocellular carcinoma (HCC) and plays pivotal roles in tumorigenesis and chemoresistance. Rapamycin has been reported to exert antitumor activity in HCC and sensitizes HCC cells to cytotoxic agents. However, due to feedback activation of AKT after mTOR complex 1 (mTORC1) inhibition, simultaneous targeting of mTORC1/2 may be more effective. In this study, we examined the interaction between the dual mTORC1/2 inhibitor OSI-027 and doxorubicin in vitro and in vivo. OSI-027 was found to reduce phosphorylation of both mTORC1 and mTORC2 substrates, including 4E-BP1, p70S6K, and AKT (Ser473), and inhibit HCC cell proliferation. Similar to OSI-027 treatment, knockdown of mTORC2 induced G0-G1 phase cell-cycle arrest. In contrast, rapamycin or knockdown of mTORC1 increased phosphorylation of AKT (Ser473), yet had little antiproliferative effect. Notably, OSI-027 synergized with doxorubicin for the antiproliferative efficacy in a manner dependent of MDR1 expression in HCC cells. The synergistic antitumor effect of OSI-027 and doxorubicin was also observed in a HCC xenograft mouse model. Moreover, AKT was required for OSI-027-induced cell-cycle arrest and downregulation of MDR1. Our findings provide a rationale for dual mTORC1/mTORC2 inhibitors, such as OSI-027, as monotherapy or in combination with cytotoxic agents to treat HCC. Mol Cancer Ther; 14(8); 1805-15. ©2015 AACR. ©2015 American Association for Cancer Research.
Abc1: a new ABC transporter from the fission yeast Schizosaccharomyces pombe
DEFF Research Database (Denmark)
Christensen, P U; Davis, K; Nielsen, O
1997-01-01
We have isolated the abc1 gene from the fission yeast Schizosaccharomyces pombe. Sequence analysis suggests that the Abc1 protein is a member of the ABC superfamily of transporters and is composed of two structurally homologous halves, each consisting of a hydrophobic region of six transmembrane...
Management and treatment outcomes of patients enrolled in MDR-TB treatment in Viet Nam.
Phuong, N T M; Nhung, N V; Hoa, N B; Thuy, H T; Takarinda, K C; Tayler-Smith, K; Harries, A D
2016-03-21
The programmatic management of drug-resistant tuberculosis (TB) in Viet Nam has been rapidly scaled up since 2009. To document the annual numbers of patients enrolled for multidrug-resistant tuberculosis (MDR-TB) treatment during 2010-2014 and to determine characteristics and treatment outcomes of patients initiating treatment during 2010-2012. A retrospective cohort study using national reports and data from the national electronic data system for drug-resistant TB. The number of patients enrolled annually for MDR-TB treatment increased from 97 in 2010 to 1522 in 2014. The majority of patients were middle-aged men who had pulmonary disease and had failed a retreatment regimen; 77% had received ⩾2 courses of TB treatment. Favourable outcomes (cured and treatment completed) were attained in 73% of patients. Unfavourable outcomes included loss to follow-up (12.5%), death (8%) and failure (6.3%). Having had ⩾2 previous treatment courses and being human immunodeficiency virus-positive were associated with unfavourable outcomes. Increasing numbers of patients are being treated for MDR-TB each year with good treatment outcomes under national programme management in Viet Nam. However, there is a need to increase case detection-currently at 30% of the estimated 5100 MDR-TB cases per year, reduce adverse outcomes and improve monitoring and evaluation.
Directory of Open Access Journals (Sweden)
Rajani Rai
2015-11-01
Full Text Available Gallbladder cancer is the most common and a highly aggressive biliary tract malignancy with a dismal outcome. The pathogenesis of the disease is multifactorial, comprising the combined effect of multiple genetic variations of mild consequence along with numerous dietary and environmental risk factors. Previously, we demonstrated the association of several candidate gene variations with GBC risk. In this study, we aimed to identify the combination of gene variants and their possible interactions contributing towards genetic susceptibility of GBC. Here, we performed Multifactor-Dimensionality Reduction (MDR and Classification and Regression Tree Analysis (CRT to investigate the gene–gene interactions and the combined effect of 14 SNPs in nine genes (DR4 (rs20576, rs6557634; FAS (rs2234767; FASL (rs763110; DCC (rs2229080, rs4078288, rs7504990, rs714; PSCA (rs2294008, rs2978974; ADRA2A (rs1801253; ADRB1 (rs1800544; ADRB3 (rs4994; CYP17 (rs2486758 involved in various signaling pathways. Genotyping was accomplished by PCR-RFLP or Taqman allelic discrimination assays. SPSS software version 16.0 and MDR software version 2.0 were used for all the statistical analysis. Single locus investigation demonstrated significant association of DR4 (rs20576, rs6557634, DCC (rs714, rs2229080, rs4078288 and ADRB3 (rs4994 polymorphisms with GBC risk. MDR analysis revealed ADRB3 (rs4994 to be crucial candidate in GBC susceptibility that may act either alone (p < 0.0001, CVC = 10/10 or in combination with DCC (rs714 and rs2229080, p < 0.0001, CVC = 9/10. Our CRT results are in agreement with the above findings. Further, in-silico results of studied SNPs advocated their role in splicing, transcriptional and/or protein coding regulation. Overall, our result suggested complex interactions amongst the studied SNPs and ADRB3 rs4994 as candidate influencing GBC susceptibility.
DEFF Research Database (Denmark)
Thomsen, Thomas T; Madsen, Laura B; Hansson, Helle H
2013-01-01
Chloroquine (CQ) use in Mozambique was stopped in 2002 and artemether-lumefantrine (AL) was implemented in 2008. In light of no use of CQ and extensive use of AL, we determined the frequency of molecular markers of Plasmodium falciparum drug resistance/tolerance to CQ and AL in persons living...... in Linga-Linga, an isolated peninsula and in Furvela village, which is located 8 km inland. The P. falciparum chloroquine resistance transporter gene CVMNK wild type increased in frequency from 43.9% in 2009 to 66.4% in 2010 (P = 0.001), and combined P. falciparum multidrug resistance gene 1 N86-184F-D1246...... haplotype increased significantly between years (P = 0.039). The combination of P. falciparum chloroquine resistance transporter gene CVMNK and P. falciparum multidrug resistance gene NFD increased from 24.3% (2009) to 45.3% in (2010, P = 0.017). The rapid changes observed may largely be caused by decreased...
Vigna subterranea ammonium transporter gene (VsAMT1: Some bioinformatics insights
Directory of Open Access Journals (Sweden)
Adewole T. Adetunji
2015-12-01
Full Text Available Ammonium transporters (AMTs play a role in the uptake of ammonium, the form in which nitrogen is preferentially absorbed by plants. Vigna subterranea (VsAMT1 and Solanum tuberosum (StAMT1 AMT1s were characterized using molecular biology and bioinformatics methods. AMT1-specific primers were designed and used to amplify the AMT1 internal regions. Nucleotide sequencing, alignment and phylogenetic analysis assigned VsAMT1 and StAMT1 to the AMT1 family. The deduced amino acid sequences showed that VsAMT1 is 92% and 89% similar to Phaseolus vulgaris PvAMT1.1 and Glycine max AMT1 respectively, while StAMT1 is 92% similar to Solanum lycopersicum LeAMT1.1, and correspond to the 5th–10th trans-membrane domains. Residues VsAMT1 D23 and StAMT1 D15 are predicted to be essential for ammonium transport, while mutations of VsAMT1 W1A-L and S87A and StAMT1 S76A may further enhance ammonium transport. In addition to nitrogen uptake from the roots, VsAMT1 may also contribute to interactions with rhizobia.
Bahry, Muhammad Syaifudien; Pringgenies, Delianis; Trianto, Agus
2017-01-01
The resistance of pathogenic bacteria may occur to many types of antibiotics, especially in cases of non-compliance use of antibiotics, which likely to allow the evolution of Multi-Drug Resistant (MDR) bacteria. Gastropods seas are marine invertebrates informed capable of production of secondary metabolites as antibacterial MDR. The purpose of the study was the isolation and identification of gastropod symbiont bacteria found in the waters of Krakal, Gunung Kidul, Yogyakarta, which has the ability to produce antibacterial compounds against MDR(Escherichia coli, Enterobacter cloacae, Klebsiella pneumoniae, MRSA (methicillin-Resistant Staphylococcus aureus), Staphylococcus aureus, and Staphylococcus homunis) molecular. Stages of this research began with the isolation of bacteria, bacteria screening for anti-MDR compound, mass culture, and extraction, antibacterial activity test, DNA extraction, amplification by PCR 16S rDNA and sequencing. The results of the study showed that 19 isolates of bacteria were isolated from three species of gastropods namely Littorina scabra, Cypraea moneta and Conus ebraeus. Among them, 4 isolates showed activity against MDR test bacteria (E. coli, E. cloacae, K. pneumoniae, S. aureus and S. homunis). The highest activity was displayed by code LS.G1.8 isolate with the largest inhibition zone 15.47±0.45mm on S. humonis at 250 µg/disk concentration. Isolate CM.G2.1 showed largest inhibition zone, with 21.5±0.07mm on MRSA at 1000 µg/disk concentration and isolate the largest inhibition zone CM.G2.5 14.37±0.81mm on MRSA 14.37±0.81mm at concentrations 1000 µg/disk. The molecular identification of isolates LS.G1.8 has 99% homology with Bacillus subtilis and isolates CM.G2.1 has 99% homology with Bacillus pumillus.
Directory of Open Access Journals (Sweden)
Akihiko Nakamura
Full Text Available BACKGROUND/OBJECTIVE: Gene-gene interactions in the reverse cholesterol transport system for high-density lipoprotein-cholesterol (HDL-C are poorly understood. The present study observed gene-gene combination effect and interactions between single nucleotide polymorphisms (SNPs in ABCA1, APOA1, SR-B1, and CETP in serum HDL-C from a cross-sectional study in the Japanese population. METHODS: The study population comprised 1,535 men and 1,515 women aged 35-69 years who were enrolled in the Japan Multi-Institutional Collaborative Cohort (J-MICC Study. We selected 13 SNPs in the ABCA1, APOA1, CETP, and SR-B1 genes in the reverse cholesterol transport system. The effects of genetic and environmental factors were assessed using general linear and logistic regression models after adjusting for age, sex, and region. PRINCIPAL FINDINGS: Alcohol consumption and daily activity were positively associated with HDL-C levels, whereas smoking had a negative relationship. The T allele of CETP, rs3764261, was correlated with higher HDL-C levels and had the highest coefficient (2.93 mg/dL/allele among the 13 SNPs, which was statistically significant after applying the Bonferroni correction (p<0.001. Gene-gene combination analysis revealed that CETP rs3764261 was associated with high HDL-C levels with any combination of SNPs from ABCA1, APOA1, and SR-B1, although no gene-gene interaction was apparent. An increasing trend for serum HDL-C was also observed with an increasing number of alleles (p<0.001. CONCLUSIONS: The present study identified a multiplier effect from a polymorphism in CETP with ABCA1, APOA1, and SR-B1, as well as a dose-dependence according to the number of alleles present.
Knowlton, Wendy M; Hubert, Thomas; Wu, Zilu; Chisholm, Andrew D; Jin, Yishi
2017-01-01
The role of mitochondria within injured neurons is an area of active interest since these organelles are vital for the production of cellular energy in the form of ATP. Using mechanosensory neurons of the nematode Caenorhabditis elegans to test regeneration after neuronal injury in vivo , we surveyed genes related to mitochondrial function for effects on axon regrowth after laser axotomy. Genes involved in mitochondrial transport, calcium uptake, mitophagy, or fission and fusion were largely dispensable for axon regrowth, with the exception of eat-3/Opa1 . Surprisingly, many genes encoding components of the electron transport chain were dispensable for regrowth, except for the iron-sulfur proteins gas-1, nduf-2.2, nduf-7 , and isp-1 , and the putative oxidoreductase rad-8 . In these mutants, axonal development was essentially normal and axons responded normally to injury by forming regenerative growth cones, but were impaired in subsequent axon extension. Overexpression of nduf-2.2 or isp-1 was sufficient to enhance regrowth, suggesting that mitochondrial function is rate-limiting in axon regeneration. Moreover, loss of function in isp-1 reduced the enhanced regeneration caused by either a gain-of-function mutation in the calcium channel EGL-19 or overexpression of the MAP kinase DLK-1. While the cellular function of RAD-8 remains unclear, our genetic analyses place rad-8 in the same pathway as other electron transport genes in axon regeneration. Unexpectedly, rad-8 regrowth defects were suppressed by altered function in the ubiquinone biosynthesis gene clk-1 . Furthermore, we found that inhibition of the mitochondrial unfolded protein response via deletion of atfs-1 suppressed the defective regrowth in nduf-2.2 mutants. Together, our data indicate that while axon regeneration is not significantly affected by general dysfunction of cellular respiration, it is sensitive to the proper functioning of a select subset of electron transport chain genes, or to the
Fraser, Hamish S F; Habib, Ali; Goodrich, Mark; Thomas, David; Blaya, Joaquin A; Fils-Aime, Joseph Reginald; Jazayeri, Darius; Seaton, Michael; Khan, Aamir J; Choi, Sharon S; Kerrison, Foster; Falzon, Dennis; Becerra, Mercedes C
2013-01-01
Multi-drug resistant TB (MDR-TB) is a complex infectious disease that is a growing threat to global health. It requires lengthy treatment with multiple drugs and specialized laboratory testing. To effectively scale up treatment to thousands of patients requires good information systems to support clinical care, reporting, drug forecasting, supply chain management and monitoring. Over the last decade we have developed the PIH-EMR electronic medical record system, and subsequently OpenMRS-TB, to support the treatment of MDR-TB in Peru, Haiti, Pakistan, and other resource-poor environments. We describe here the experience with implementing these systems and evaluating many aspects of their performance, and review other systems for MDR-TB management. We recommend a new approach to information systems to address the barriers to scale up MDR-TB treatment, particularly access to the appropriate drugs and lab data. We propose moving away from fragmented, vertical systems to focus on common platforms, addressing all stages of TB care, support for open data standards and interoperability, care for a wide range of diseases including HIV, integration with mHealth applications, and ability to function in resource-poor environments.
Directory of Open Access Journals (Sweden)
Onay Venus
2007-08-01
Full Text Available Abstract Background There is growing evidence that gene-gene interactions are ubiquitous in determining the susceptibility to common human diseases. The investigation of such gene-gene interactions presents new statistical challenges for studies with relatively small sample sizes as the number of potential interactions in the genome can be large. Breast cancer provides a useful paradigm to study genetically complex diseases because commonly occurring single nucleotide polymorphisms (SNPs may additively or synergistically disturb the system-wide communication of the cellular processes leading to cancer development. Methods In this study, we systematically studied SNP-SNP interactions among 19 SNPs from 18 key genes involved in major cancer pathways in a sample of 398 breast cancer cases and 372 controls from Ontario. We discuss the methodological issues associated with the detection of SNP-SNP interactions in this dataset by applying and comparing three commonly used methods: the logistic regression model, classification and regression trees (CART, and the multifactor dimensionality reduction (MDR method. Results Our analyses show evidence for several simple (two-way and complex (multi-way SNP-SNP interactions associated with breast cancer. For example, all three methods identified XPD-[Lys751Gln]*IL10-[G(-1082A] as the most significant two-way interaction. CART and MDR identified the same critical SNPs participating in complex interactions. Our results suggest that the use of multiple statistical approaches (or an integrated approach rather than a single methodology could be the best strategy to elucidate complex gene interactions that have generally very different patterns. Conclusion The strategy used here has the potential to identify complex biological relationships among breast cancer genes and processes. This will lead to the discovery of novel biological information, which will improve breast cancer risk management.
Zhu, Yuanting; Lai, Haimei; Zou, Likou; Yin, Sheng; Wang, Chengtao; Han, Xinfeng; Xia, Xiaolong; Hu, Kaidi; He, Li; Zhou, Kang; Chen, Shujuan; Ao, Xiaolin; Liu, Shuliang
2017-10-16
A total of 189 Salmonella isolates were recovered from 627 samples which were collected from cecal contents of broilers, chicken carcasses, chicken meat after cutting step and frozen broiler chicken products along the slaughtering process at a slaughterhouse in Sichuan province of China. The Salmonella isolates were subjected to antimicrobial susceptibility testing to 10 categories of antimicrobial agents using the Kirby-Bauer disk diffusion method. Those antibiotics-resistant isolates were further investigated for the occurrence of resistance genes, the presence of class 1 integron as well as the associated gene cassettes, and the mutations within the gyrA and parC genes. Consequently, the prevalence of Salmonella was 30.14% (47.96% for cecal content, 18.78% for chicken carcasses, 31.33% for cutting meat and 14.00% for frozen meat, respectively). The predominant serotypes were S. Typhimurium (15.34%) and S. Enteritidis (69.84%). High resistance rates to the following drugs were observed: nalidixic acid (99.5%), ampicillin (87.8%), tetracycline (51.9%), ciprofloxacin (48.7%), trimethoprim/sulfamethoxazole (48.1%), and spectinomycin (34.4%). Antimicrobial resistance profiling showed that 60.8% of isolates were multidrug resistant (MDR), and MDR strains increased from 44.7% to 78.6% along the slaughtering line. 94.6% (n=157) of beta-lactam-resistant isolates harbored at least one resistance gene of bla TEM or bla CTX-M . The relatively low prevalence of aminoglycoside resistance genes (aac(3)-II, aac(3)-IV, and ant(2″)-I) was found in 49 (66.2%) of antibiotic-resistant isolates. The tetracycline resistance genes (tet(A), tet(B), tet(C), and tet(G) and sulfonamide resistance genes (sul1, sul2, and sul3) were identified in 84 (85.7%) and 89 (97.8%) antibiotic-resistant isolates respectively. floR was identified in 44 (97.8%) florfenicol-resistant isolates. Class 1 integron was detected in 37.4% (n=43) of the MDR isolates. Two different gene cassettes, bla OXA-30 -aadA
DEFF Research Database (Denmark)
Binderup, Tina; Knigge, Ulrich; Federspiel, Birgitte Hartnack
2013-01-01
-associated genes and to compare this with FDG-PET imaging as well as with the cellular proliferation index in two cancer entities with different malignant potential. Using real-time PCR, gene expression of GLUT1, HK1 and HK2 were studied in 34 neuroendocrine tumors (NETs) in comparison with 14 colorectal...... adenocarcinomas (CRAs). The Ki67 proliferation index and, when available, FDG-PET imaging was compared with gene expression. Overexpression of GLUT1 gene expression was less frequent in NETs (38%) compared to CRAs (86%), P = 0.004. HK1 was overexpressed in 41% and 71% of NETs and CRAs, respectively (P = 0.......111) and HK2 was overexpressed in 50% and 64% of NETs and CRAs, respectively (P = 0.53). There was a significant correlation between the Ki67 proliferation index and GLUT1 gene expression for the NETs (R = 0.34, P = 0.047), but no correlation with the hexokinases. FDG-PET identified foci in significantly...
ABCB1 (MDR1) polymorphisms and ovarian cancer progression and survival
DEFF Research Database (Denmark)
Johnatty, Sharon E; Beesley, Jonathan; Gao, Bo
2013-01-01
ABCB1 encodes the multi-drug efflux pump P-glycoprotein (P-gp) and has been implicated in multi-drug resistance. We comprehensively evaluated this gene and flanking regions for an association with clinical outcome in epithelial ovarian cancer (EOC)....
Expression of a human gene for polyamine transport in Chinese-hamster ovary cells.
Byers, T L; Wechter, R; Nuttall, M E; Pegg, A E
1989-01-01
A molecular-genetic approach towards isolating mammalian polyamine-transport genes and their encoded proteins was devised involving the production of Chinese-hamster ovary (CHO) cells expressing a human polyamine-transport protein. CHO cells and a polyamine-transport-deficient CHO mutant cell line (CHOMG) were equally sensitive to the antiproliferative effects of alpha-difluoromethylornithine (DFMO), which blocked endogenous polyamine synthesis. Exposure to exogenous polyamines increased intracellular polyamine levels and reversed this DFMO-induced cytostasis in the CHO cells, but not in the CHOMG cells. CHOMG cells were therefore transfected with human DNA (isolated from HT-29 colon carcinoma cells) and cells expressing the human polyamine-transport system were identified by the ability of these cells to grow in a medium containing DFMO and polyamines. A number of different positive clones were identified and shown to have the capacity for polyamine uptake and an increased sensitivity to the toxic effects of the polyamine analogue methylglyoxal bis(guanylhydrazone). Differences in these properties between the clones are consistent with a multiplicity of polyamine-transport systems. Some clones also showed a change in growth characteristics, which may indicate a relationship between genes involved in the polyamine-transport system and in cell proliferation. PMID:2512913
Directory of Open Access Journals (Sweden)
Andreas Kjaer
2013-10-01
Full Text Available Neoplastic tissue exhibits high glucose utilization and over-expression of glucose transporters (GLUTs and hexokinases (HKs, which can be imaged by 18F-Fluorodeoxyglucose-positron emission tomography (FDG-PET. The aim of the present study was to investigate the expression of glycolysis-associated genes and to compare this with FDG-PET imaging as well as with the cellular proliferation index in two cancer entities with different malignant potential. Using real-time PCR, gene expression of GLUT1, HK1 and HK2 were studied in 34 neuroendocrine tumors (NETs in comparison with 14 colorectal adenocarcinomas (CRAs. The Ki67 proliferation index and, when available, FDG-PET imaging was compared with gene expression. Overexpression of GLUT1 gene expression was less frequent in NETs (38% compared to CRAs (86%, P = 0.004. HK1 was overexpressed in 41% and 71% of NETs and CRAs, respectively (P = 0.111 and HK2 was overexpressed in 50% and 64% of NETs and CRAs, respectively (P = 0.53. There was a significant correlation between the Ki67 proliferation index and GLUT1 gene expression for the NETs (R = 0.34, P = 0.047, but no correlation with the hexokinases. FDG-PET identified foci in significantly fewer NETs (36% than CRAs (86%, (P = 0.04. The gene expression results, with less frequent GLUT1 and HK1 upregulation in NETs, confirmed the lower metabolic activity of NETs compared to the more aggressive CRAs. In accordance with this, fewer NETs were FDG-PET positive compared to CRA tumors and FDG uptake correlated with GLUT1 gene expression.
International Nuclear Information System (INIS)
Al-Salman, Fadheela; Plant, Nick
2012-01-01
The polychlorinated biphenyl group possesses high environmental persistence, leading to bioaccumulation and a number of adverse effects in mammals. Whilst coplanar PCBs elicit their toxic effects through agonism of the aryl hydrocarbon receptor; however, non-coplanar PCBs are not ligands for AhR, but may be ligands for members of the nuclear receptor family of proteins. To better understand the biological actions of non-coplanar PCBs, we have undertaken a systematic analysis of their ability to activate PXR and CAR-mediated effects. Cells were exposed to a range of non-coplanar PCBs (99, 138, 153, 180 and 194), or the coplanar PCB77: Direct activation of PXR and CAR was measured using a mammalian receptor activation assay in human liver cells, with rifampicin and CITCO used as positive controls ligands for PXR and CAR, respectively; activation of target gene expression was examined using reporter gene plasmids for CYP3A4 and MDR1 transfected into liver, intestine and lung cell lines. Several of the non-coplanar PCBs directly activated PXR and CAR, whilst the coplanar PCB77 did not. Non-coplanar PCBs were also able to activate PXR/CAR target gene expression in a substitution- and tissue-specific manner. Non-coplanar PCBs act as direct activators for the nuclear receptors PXR and CAR, and are able to elicit transcriptional activation of target genes in a substitution- and tissue-dependent manner. Chronic activation of PXR/CAR is linked to adverse effects and must be included in any risk assessment of PCBs. -- Highlights: ► Several Non-coplanar PCBs are able to directly activate both PXR and CAR in vitro. ► PCB153 is the most potent direct activator of PXR and CAR nuclear receptors. ► Non-coplanar PCB activation of CYP3A4/MDR1 reporter genes is structure-dependent. ► Non-coplanar PCB activate CYP3A4/MDR1 reporter genes in a tissue-dependent. ► PCB153 is the most potent activator of PXR/CAR target gene in all tissues.
Hicks, R M; Padayatchi, N; Shah, N S; Wolf, A; Werner, L; Sunkari, V B; O'Donnell, M R
2014-09-01
Pediatric multidrug-resistant tuberculosis (MDR-TB) is complicated by difficult diagnosis, complex treatment, and high mortality. In South Africa, these challenges are amplified by human immunodeficiency virus (HIV) co-infection; however, evidence on treatment outcomes among co-infected children is limited. Using conventional and new pediatric definitions, to describe treatment outcomes and identify risk factors for unfavorable outcome and mortality in children aged children (median age 8 years, IQR 4-12) with MDR-TB (n = 78) or XDR-TB (n = 6) initiated treatment. Sixty-four (77%) were HIV-positive and 62 (97%) received antiretroviral therapy. Sixty-six (79%) achieved favorable treatment outcomes. Overall mortality was 11% (n = 9) at 18 months after initiation of treatment. Malnutrition (aOR 27.4, 95%CI 2.7-278.7) and severe radiographic findings (aOR 4.68, 95%CI 1.01-21.9) were associated with unfavorable outcome. New pediatric outcome definitions increased the proportion classified as cured. It is possible to successfully treat pediatric MDR-TB-HIV even in resource-poor settings. Malnutrition is a marker for severe TB-HIV disease, and is a potential target for future interventions in these patients.
Lubelski, Jacek; Konings, Wil N.; Driessen, Arnold J. M.
Membrane proteins responsible for the active efflux of structurally and functionally unrelated drugs were first characterized in higher eukalyotes. To date, a vast number of transporters contributing to multidrug resistance (MDR transporters) have been reported for a large variety of organisms.
Energy Technology Data Exchange (ETDEWEB)
Meng, Qiang; Chen, Xin-li; Wang, Chang-yuan; Liu, Qi; Sun, Hui-jun; Sun, Peng-yuan; Huo, Xiao-kui; Liu, Zhi-hao; Yao, Ji-hong; Liu, Ke-xin, E-mail: kexinliu@dlmedu.edu.cn
2015-03-15
Intrahepatic cholestasis is a clinical syndrome with systemic and intrahepatic accumulation of excessive toxic bile acids that ultimately cause hepatobiliary injury. Appropriate regulation of bile acids in hepatocytes is critically important for protection against liver injury. In the present study, we characterized the protective effect of alisol B 23-acetate (AB23A), a natural triterpenoid, on alpha-naphthylisothiocyanate (ANIT)-induced liver injury and intrahepatic cholestasis in mice and further elucidated the mechanisms in vivo and in vitro. AB23A treatment dose-dependently protected against liver injury induced by ANIT through reducing hepatic uptake and increasing efflux of bile acid via down-regulation of hepatic uptake transporters (Ntcp) and up-regulation of efflux transporter (Bsep, Mrp2 and Mdr2) expression. Furthermore, AB23A reduced bile acid synthesis through repressing Cyp7a1 and Cyp8b1, increased bile acid conjugation through inducing Bal, Baat and bile acid metabolism through an induction in gene expression of Sult2a1. We further demonstrate the involvement of farnesoid X receptor (FXR) in the hepatoprotective effect of AB23A. The changes in transporters and enzymes, as well as ameliorative liver histology in AB23A-treated mice were abrogated by FXR antagonist guggulsterone in vivo. In vitro evidences also directly demonstrated the effect of AB23A on FXR activation in a dose-dependent manner using luciferase reporter assay in HepG2 cells. In conclusion, AB23A produces protective effect against ANIT-induced hepatotoxity and cholestasis, due to FXR-mediated regulation of transporters and enzymes. - Highlights: • AB23A has at least three roles in protection against ANIT-induced liver injury. • AB23A decreases Ntcp, and increases Bsep, Mrp2 and Mdr2 expression. • AB23A represses Cyp7a1 and Cyp8b1 through inducing Shp and Fgf15 expression. • AB23A increases bile acid metabolism through inducing Sult2a1 expression. • FXR activation is involved
International Nuclear Information System (INIS)
Meng, Qiang; Chen, Xin-li; Wang, Chang-yuan; Liu, Qi; Sun, Hui-jun; Sun, Peng-yuan; Huo, Xiao-kui; Liu, Zhi-hao; Yao, Ji-hong; Liu, Ke-xin
2015-01-01
Intrahepatic cholestasis is a clinical syndrome with systemic and intrahepatic accumulation of excessive toxic bile acids that ultimately cause hepatobiliary injury. Appropriate regulation of bile acids in hepatocytes is critically important for protection against liver injury. In the present study, we characterized the protective effect of alisol B 23-acetate (AB23A), a natural triterpenoid, on alpha-naphthylisothiocyanate (ANIT)-induced liver injury and intrahepatic cholestasis in mice and further elucidated the mechanisms in vivo and in vitro. AB23A treatment dose-dependently protected against liver injury induced by ANIT through reducing hepatic uptake and increasing efflux of bile acid via down-regulation of hepatic uptake transporters (Ntcp) and up-regulation of efflux transporter (Bsep, Mrp2 and Mdr2) expression. Furthermore, AB23A reduced bile acid synthesis through repressing Cyp7a1 and Cyp8b1, increased bile acid conjugation through inducing Bal, Baat and bile acid metabolism through an induction in gene expression of Sult2a1. We further demonstrate the involvement of farnesoid X receptor (FXR) in the hepatoprotective effect of AB23A. The changes in transporters and enzymes, as well as ameliorative liver histology in AB23A-treated mice were abrogated by FXR antagonist guggulsterone in vivo. In vitro evidences also directly demonstrated the effect of AB23A on FXR activation in a dose-dependent manner using luciferase reporter assay in HepG2 cells. In conclusion, AB23A produces protective effect against ANIT-induced hepatotoxity and cholestasis, due to FXR-mediated regulation of transporters and enzymes. - Highlights: • AB23A has at least three roles in protection against ANIT-induced liver injury. • AB23A decreases Ntcp, and increases Bsep, Mrp2 and Mdr2 expression. • AB23A represses Cyp7a1 and Cyp8b1 through inducing Shp and Fgf15 expression. • AB23A increases bile acid metabolism through inducing Sult2a1 expression. • FXR activation is involved
Ribera, Alba; Benavent, Eva; Lora-Tamayo, Jaime; Tubau, Fe; Pedrero, Salvador; Cabo, Xavier; Ariza, Javier; Murillo, Oscar
2015-12-01
In the era of emergence of MDR Pseudomonas aeruginosa, osteoarticular infections (OIs) add more difficulties to its treatment. The role of β-lactams (BLs) is questioned and older drugs need to be reconsidered. The objective of this study was to describe our experience in the management of OIs caused by MDR P. aeruginosa and evaluate different therapeutic options. This was a retrospective analysis of a prospectively collected cohort (2004-13) of patients with OI caused by MDR P. aeruginosa. We created two groups: (i) Group A (more difficult to treat), prosthetic joint infections (PJIs) and osteoarthritis (OA) managed with device retention; and (ii) Group B (less difficult to treat), OA managed without device retention. Antibiotic treatment was administered according to clinician criteria: monotherapy/combined therapy; and BL used by intermittent bolus (IB)/continuous infusion. Of 34 patients, 15 (44.1%) had PJI and 19 (55.9%) had OA (8 related to an orthopaedic device). Twenty-three cases (68%) were caused by XDR P. aeruginosa. The initial management included removal of an orthopaedic device in 14 cases, together with antibiotic [alone, 19 (55.9%; 4 colistin, 14 BL-IB and 1 BL continuous infusion); and in combination, 15 (44.1%; 5 BL-IB and 10 BL continuous infusion)]. The overall cure rate was 50% (39% and 63% in Groups A and B, respectively), ranging from 31.6% with monotherapy to 73.3% with combined therapy (P = 0.016), with special interest within Group A (cure rate with combined therapy 71.4%, P = 0.049). After rescue therapy, which included removal of remaining devices, the cure rate reached 85.3%. We suggest that the BL/colistin combination is an optimized therapy for OI caused by MDR P. aeruginosa, together with an appropriate surgical treatment. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Positive selection in the SLC11A1 gene in the family Equidae
DEFF Research Database (Denmark)
Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan
2016-01-01
Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...
Directory of Open Access Journals (Sweden)
Aberuyi N
2017-07-01
Full Text Available Narges Aberuyi,1 Soheila Rahgozar,1 Zohreh Khosravi Dehaghi,1 Alireza Moafi,2 Andrea Masotti,3,* Alessandro Paolini3,* 1Department of Biology, Faculty of Science, University of Isfahan, 2Department of Pediatric-Hematology-Oncology, Sayed-ol-Shohada Hospital, Isfahan University of Medical Sciences, Isfahan, Iran; 3Gene Expression – Microarrays Laboratory, Bambino Gesù Children’s Hospital-Istituto di Ricovero e Cura a Carattere Scientifico (IRCCS, Rome, Italy *These authors contributed equally to the manuscript Purpose: The aim of this work was to study the correlation between the expressions of the ABCA2 and ABCA3 genes at the mRNA and protein levels in children with acute lymphoblastic leukemia (ALL and the effects of this association on multidrug resistance (MDR.Materials and methods: Sixty-nine children with de novo ALL and 25 controls were enrolled in the study. Mononuclear cells were isolated from the bone marrow. The mRNA levels of ABCA2 and ABCA3 were measured by real-time polymerase chain reaction (PCR. Samples with high mRNA levels were assessed for respective protein levels by Western blotting. Following the first year of treatment, persistent monoclonality of T-cell gamma receptors or immunoglobulin H (IgH gene rearrangement was assessed and considered as the MDR. The tertiary structure of ABCA2 was predicted using Phyre2 and I-TASSER web systems and compared to that of ABCA3, which has been previously reported. Molecular docking was performed using DOCK 6.7.Results: Real-time quantitative PCR (qRT-PCR showed high levels of ABCA2 and ABCA3 mRNAs in 13 and 17 samples, respectively. Among them, five and eight individuals demonstrated high levels of ABCA2 and ABCA3, respectively. Response to chemotherapy was significantly decreased (P=0.001 when the mRNA and protein of both genes were overexpressed compared to individuals with high transcriptional levels of either ABCA2 or ABCA3 alone. Close similarity between ABCA2 and ABCA3
Directory of Open Access Journals (Sweden)
Grace E. Richmond
2016-04-01
Full Text Available The opportunistic pathogen Acinetobacter baumannii is able to persist in the environment and is often multidrug resistant (MDR, causing difficulties in the treatment of infections. Here, we show that the two-component system AdeRS, which regulates the production of the AdeABC multidrug resistance efflux pump, is required for the formation of a protective biofilm in an ex vivo porcine mucosal model, which mimics a natural infection of the human epithelium. Interestingly, deletion of adeB impacted only on the ability of strain AYE to form a biofilm on plastic and only on the virulence of strain Singapore 1 for Galleria mellonella. RNA-Seq revealed that loss of AdeRS or AdeB significantly altered the transcriptional landscape, resulting in the changed expression of many genes, notably those associated with antimicrobial resistance and virulence interactions. For example, A. baumannii lacking AdeRS displayed decreased expression of adeABC, pil genes, com genes, and a pgaC-like gene, whereas loss of AdeB resulted in increased expression of pil and com genes and decreased expression of ferric acinetobactin transport system genes. These data define the scope of AdeRS-mediated regulation, show that changes in the production of AdeABC mediate important phenotypes controlled by AdeRS, and suggest that AdeABC is a viable target for antimicrobial drug and antibiofilm discovery.
Effects of Transport and Storage Conditions on Gene Expression in Blood Samples.
Malentacchi, Francesca; Pizzamiglio, Sara; Wyrich, Ralf; Verderio, Paolo; Ciniselli, Chiara; Pazzagli, Mario; Gelmini, Stefania
2016-04-01
Inappropriate handling of blood samples might induce or repress gene expression and/or lead to RNA degradation affecting downstream analysis. In particular, sample transport is a critical step for biobanking or multicenter studies because of uncontrolled variables (i.e., unstable temperature). We report the results of a pilot study implemented within the EC funded SPIDIA project, aimed to investigate the role of transport and storage of blood samples containing and not containing an RNA stabilizer. Blood was collected from a single donor both in EDTA and in PAXgene Blood RNA tubes. Half of the samples were sent to a second laboratory both at room temperature and at 4°C, whereas the remaining samples were stored at room temperature and at 4°C. Gene expression of selected genes (c-FOS, IL-1β, IL-8, and GAPDH) known to be induced or repressed by ex vivo blood handling and of blood-mRNA quality biomarkers identified and validated within the SPIDIA project, which allow for monitoring changes in unstabilized blood samples after collection and during transport and storage, were analyzed by RT-qPCR. If the shipment of blood in tubes not containing RNA stabilizer is not performed under a stable condition, gene profile studies can be affected by the effects of transport. Moreover, also controlled temperature shipment (4°C) can influence the expression of specific genes if blood is collected in tubes not containing a stabilizer. The use of dedicated biomarkers or time course experiments should be performed in order to verify potential bias on gene expression analysis due to sample shipment and storage conditions. Alternatively, the use of RNA stabilizer containing tubes can represent a reliable option to avoid ex vivo RNA changes.
Research progress in machine learning methods for gene-gene interaction detection.
Peng, Zhe-Ye; Tang, Zi-Jun; Xie, Min-Zhu
2018-03-20
Complex diseases are results of gene-gene and gene-environment interactions. However, the detection of high-dimensional gene-gene interactions is computationally challenging. In the last two decades, machine-learning approaches have been developed to detect gene-gene interactions with some successes. In this review, we summarize the progress in research on machine learning methods, as applied to gene-gene interaction detection. It systematically examines the principles and limitations of the current machine learning methods used in genome wide association studies (GWAS) to detect gene-gene interactions, such as neural networks (NN), random forest (RF), support vector machines (SVM) and multifactor dimensionality reduction (MDR), and provides some insights on the future research directions in the field.
Ham, Byung-Joo; Choi, Myoung-Jin; Lee, Heon-Jeong; Kang, Rhee-Hun; Lee, Min-Soo
2005-06-01
It is well established that approximately 50% of the variance in personality traits is genetic. The goal of this study was to investigate a relationship between personality traits and the T-182C polymorphism in the norepinephrine transporter gene. The participants included 115 healthy adults with no history of psychiatric disorders and other physical illness during the past 6 months. All participants were tested with the Temperament and Character Inventory and genotyped norepinephrine transporter gene polymorphism. Differences on the Temperament and Character Inventory dimensions among three groups were examined with one-way analysis of variance. Our study suggests that the norepinephrine transporter T-182C gene polymorphism is associated with reward dependence in Koreans, but the small number of study participants and their sex and age heterogeneity limits generalization of our results. Further studies are necessary with a larger number of homogeneous participants to confirm whether the norepinephrine transporter gene is related to personality traits.
Passive larval transport explains recent gene flow in a Mediterranean gorgonian
Padrón, Mariana; Costantini, Federica; Baksay, Sandra; Bramanti, Lorenzo; Guizien, Katell
2018-06-01
Understanding the patterns of connectivity is required by the Strategic Plan for Biodiversity 2011-2020 and will be used to guide the extension of marine protection measures. Despite the increasing accuracy of ocean circulation modelling, the capacity to model the population connectivity of sessile benthic species with dispersal larval stages can be limited due to the potential effect of filters acting before or after dispersal, which modulates offspring release or settlement, respectively. We applied an interdisciplinary approach that combined demographic surveys, genetic methods (assignment tests and coalescent-based analyses) and larval transport simulations to test the relative importance of demographics and ocean currents in shaping the recent patterns of gene flow among populations of a Mediterranean gorgonian ( Eunicella singularis) in a fragmented rocky habitat (Gulf of Lion, NW Mediterranean Sea). We show that larval transport is a dominant driver of recent gene flow among the populations, and significant correlations were found between recent gene flow and larval transport during an average single dispersal event when the pelagic larval durations (PLDs) ranged from 7 to 14 d. Our results suggest that PLDs that efficiently connect populations distributed over a fragmented habitat are filtered by the habitat layout within the species competency period. Moreover, a PLD ranging from 7 to 14 d is sufficient to connect the fragmented rocky substrate of the Gulf of Lion. The rocky areas located in the centre of the Gulf of Lion, which are currently not protected, were identified as essential hubs for the distribution of migrants in the region. We encourage the use of a range of PLDs instead of a single value when estimating larval transport with biophysical models to identify potential connectivity patterns among a network of Marine Protected Areas or even solely a seascape.
Ma, Tiangang; Qu, Danhua; Yan, Bingdi; Zhang, Qinghua; Ren, Jin; Hu, Yanbing
2018-01-01
A mutation in the IIb sodium phosphate transporter SLC34A2 gene has recently been described in pulmonary alveolar microlithiasis (PAM) patients. Experiments in this study were aimed at confirming the role of the gene product in PAM by comparing phosphorylated products in extracellular fluid of alveolar epithelial cells overexpressing the SLC34A2 gene or its mutated version. Eukaryotic expression vectors were constructed and transfected into A549 human alveolar epithelial cells. There were three groups of cells including those transfected with empty vector plasmid pcDNA3.1(+) (plasmid control group), those transfected with normal SLC34A2 gene expressed from pcDNA3.1 (normal control group), and those transfected with a version of the PAM SLC34A2 gene linked to the pcDNA3.1(+) (PAM group). Transfection efficiencies were detected by reverse transcription-polymerase chain reaction (RT-PCR). At 48 h after transfection, the concentration of inorganic phosphorus in the culture medium was detected using an automatic biochemical analyzer. Our results showed the concentration of inorganic phosphorus in the supernatant of the normal control group was significantly lower than that in the plasmid control and PAM groups (PPAM group was significantly lower than that in the plasmid control group (PPAM patients, given that the function of the phosphate transporter seems to be affected and it is conceivable that it would lead to extracellular fluid alterations in vivo .
Directory of Open Access Journals (Sweden)
Yan Li
2016-07-01
Full Text Available Klotho (KL, originally discovered as an aging suppressor, is a membrane protein that shares sequence similarity with the β-glucosidase enzymes. Recent reports showed Klotho might play a role in adipocyte maturation and systemic glucose metabolism. However, little is known about the transcription factors involved in regulating the expression of porcine KL gene. Deletion fragment analysis identified KL-D2 (−418 bp to −3 bp as the porcine KL core promoter. MARC0022311SNP (A or G in KL intron 1 was detected in Landrace × DIV pigs using the Porcine SNP60 BeadChip. The pGL-D2-A and pGL-D2-G were constructed with KL-D2 and the intron fragment of different alleles and relative luciferase activity of pGL3-D2-G was significantly higher than that of pGL3-D2-A in the PK cells and ST cells. This was possibly the result of a change in KL binding ability with transcription factor organic cation transporter 1 (OCT-1, which was confirmed using electrophoretic mobility shift assays (EMSA and chromatin immune-precipitation (ChIP. Moreover, OCT-1 regulated endogenous KL expression by RNA interference experiments. Our study indicates SNP MARC0022311 affects porcine KL expression by regulating its promoter activity via OCT-1.
Comprehensive analysis of the soybean (Glycine max GmLAX auxin transporter gene family
Directory of Open Access Journals (Sweden)
Chenglin eChai
2016-03-01
Full Text Available The phytohormone auxin plays a critical role in regulation of plant growth and development as well as plant responses to abiotic stresses. This is mainly achieved through its uneven distribution in plants via a polar auxin transport process. Auxin transporters are major players in polar auxin transport. The AUXIN RESISTANT 1 ⁄ LIKE AUX1 (AUX⁄LAX auxin influx carriers belong to the amino acid permease family of proton-driven transporters and function in the uptake of indole-3-acetic acid (IAA. In this study, genome-wide comprehensive analysis of the soybean AUX⁄LAX (GmLAX gene family, including phylogenic relationships, chromosome localization, and gene structure, were carried out. A total of 15 GmLAX genes, including seven duplicated gene pairs, were identified in the soybean genome. They were distributed on 10 chromosomes. Despite their higher percentage identities at the protein level, GmLAXs exhibited versatile tissue-specific expression patterns, indicating coordinated functioning during plant growth and development. Most GmLAXs were responsive to drought and dehydration stresses and auxin and abscisic acid (ABA stimuli, in a tissue- and/or time point- sensitive mode. Several GmLAX members were involved in responding to salt stress. Sequence analysis revealed that promoters of GmLAXs contained different combinations of stress-related cis-regulatory elements. These studies suggest that the soybean GmLAXs were under control of a very complex regulatory network, responding to various internal and external signals. This study helps to identity candidate GmLAXs for further analysis of their roles in soybean development and adaption to adverse environments.
Singh, Uma M; Metwal, Mamta; Singh, Manoj; Taj, Gohar; Kumar, Anil
2015-07-15
Calcium (Ca) is an essential mineral for proper growth and development of plants as well as animals. In plants including cereals, calcium is deposited in seed during its development which is mediated by specialized Ca transporters. Common cereal seeds contain very low amounts of Ca while the finger millet (Eleusine coracana) contains exceptionally high amounts of Ca in seed. In order to understand the role of Ca transporters in grain Ca accumulation, developing seed transcriptome of two finger millet genotypes (GP-1, low Ca and GP-45 high Ca) differing in seed Ca content was sequenced using Illumina paired-end sequencing technology and members of Ca transporter gene family were identified. Out of 109,218 and 120,130 contigs, 86 and 81 contigs encoding Ca transporters were identified in GP-1 and GP-45, respectively. After removal of redundant sequences, a total of 19 sequences were confirmed as Ca transporter genes, which includes 11 Ca(2+) ATPases, 07 Ca(2+)/cation exchangers and 01 Ca(2+) channel. The differential expressions of all genes were analyzed from transcriptome data and it was observed that 9 and 3 genes were highly expressed in GP-45 and GP-1 genotypes respectively. Validation of transcriptome expression data of selected Ca transporter genes was performed on different stages of developing spikes of both genotypes grown under different concentrations of exogenous Ca. In both genotypes, significant correlation was observed between the expression of these genes, especially EcCaX3, and on the amount of Ca accumulated in seed. The positive correlation of seed mass with the amount of Ca concentration was also observed. The efficient Ca transport property and responsiveness of EcCAX3 towards exogenous Ca could be utilized in future biofortification program. Copyright © 2015 Elsevier B.V. All rights reserved.
Imaging and Targeted Therapy of Multidrug Resistance. Final Report
International Nuclear Information System (INIS)
Piwnica-Worms, David
2009-01-01
One focus area of DOE Office of Science was the Imaging of Gene Expression in Health and Disease in real time in tissue culture, whole animals and ultimately patients. Investigators of the Molecular Imaging Group, Washington University Medical School, ascribed to this objective and a major focus of this group directly tied into the DOE program through their efforts targeting the multidrug resistance gene (MDR1). Our plans for continuation of the program were to extend and build on this line of investigation, incorporating new molecular tools into our methodology to selectively inhibit MDR1 gene expression with novel modulation strategies. Two approaches were to be pursued: (1) high throughput screening of compounds that disrupted mutant p53 transactivation of the MDR1 promoter, and (2) knockdown of MDR1 messenger RNA with retroviral-mediated delivery of small interfering RNA constructs. These would be combined with our continuing effort to synthesize ligands and examine structure-activity relationships of bis-salicylaldehydes labeled with gallium-68 to generate PET agents for imaging MDR1 P-glycoprotein function. We would be uniquely positioned to correlate therapeutic modulation of MDR1 gene expression and protein function in the same systems in vivo using PET and bioluminescence reporters. Use of animal models such as the mdr1a/1b(-/-) gene deleted mice would also have enabled refined analysis of modulation and tracer pharmacokinetics in vivo. Overall, this DOE program and resultant tools would enable direct monitoring of novel therapeutic strategies and the MDR phenotype in relation to gene expression and protein function in vivo.
Siebor, Eliane; Neuwirth, Catherine
2014-12-01
To analyse the genetic environment of the antibiotic resistance genes in two clinical Proteus mirabilis isolates resistant to multiple antibiotics. PCR, gene walking and whole-genome sequencing were used to determine the sequence of the resistance regions, the surrounding genetic structure and the flanking chromosomal regions. A genomic island of 81.1 kb named Proteus genomic island 1 (PGI1) located at the 3'-end of trmE (formerly known as thdF) was characterized. The large MDR region of PGI1 (55.4 kb) included a class 1 integron (aadB and aadA2) and regions deriving from several transposons: Tn2 (blaTEM-135), Tn21, Tn6020-like transposon (aphA1b), a hybrid Tn502/Tn5053 transposon, Tn501, a hybrid Tn1696/Tn1721 transposon [tetA(A)] carrying a class 1 integron (aadA1) and Tn5393 (strA and strB). Several ISs were also present (IS4321, IS1R and IS26). The PGI1 backbone (25.7 kb) was identical to that identified in Salmonella Heidelberg SL476 and shared some identity with the Salmonella genomic island 1 (SGI1) backbone. An IS26-mediated recombination event caused the division of the MDR region into two parts separated by a large chromosomal DNA fragment of 197 kb, the right end of PGI1 and this chromosomal sequence being in inverse orientation. PGI1 is a new resistance genomic island from P. mirabilis belonging to the same island family as SGI1. The role of PGI1 in the spread of antimicrobial resistance genes among Enterobacteriaceae of medical importance needs to be evaluated. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
van den Hoofdakker, Barbara J.; Dijck-Brouwer, D. A. Janneke; Nauta, Maaike H.; van der Veen-Mulders, Lianne; Sytema, Sjoerd; Emmelkamp, Paul M. G.; Minderaa, Ruud B.; Hoekstra, Pieter J.
There is great variability in the degree to which children with attention deficit/hyperactivity disorder (ADHD) improve through behavioral treatments. This study investigates the influence of the dopamine transporter gene (SCL6A3/DAT1) on outcome of behavioral parent training (BPT). Study subjects
van den Hoofdakker, B.J.; Nauta, M.H.; Dijck-Brouwer, D.A.J.; van der Veen-Mulders, L.; Sytema, S.; Emmelkamp, P.M.G.; Minderaa, R.B.; Hoekstra, P.J.
2012-01-01
There is great variability in the degree to which children with attention deficit/hyperactivity disorder (ADHD) improve through behavioral treatments. This study investigates the influence of the dopamine transporter gene (SCL6A3/DAT1) on outcome of behavioral parent training (BPT). Study subjects
Bernhardt, Gerwin A; Zollner, Gernot; Cerwenka, Herwig; Kornprat, Peter; Fickert, Peter; Bacher, Heinz; Werkgartner, Georg; Müller, Gabriele; Zatloukal, Kurt; Mischinger, Hans-Jörg; Trauner, Michael
2012-01-01
Post-operative hyperbilirubinaemia in patients undergoing liver resections is associated with high morbidity and mortality. Apart from different known factors responsible for the development of post-operative jaundice, little is known about the role of hepatobiliary transport systems in the pathogenesis of post-operative jaundice in humans after liver resection. Two liver tissue samples were taken from 14 patients undergoing liver resection before and after Pringle manoeuvre. Patients were retrospectively divided into two groups according to post-operative bilirubin serum levels. The two groups were analysed comparing the results of hepatobiliary transporter [Na-taurocholate cotransporter (NTCP); multidrug resistance gene/phospholipid export pump(MDR3); bile salt export pump (BSEP); canalicular bile salt export pump (MRP2)], heat shock protein 70 (HSP70) expression as well as the results of routinely taken post-operative liver chemistry tests. Patients with low post-operative bilirubin had lower levels of NTCP, MDR3 and BSEP mRNA compared to those with high bilirubin after Pringle manoeuvre. HSP70 levels were significantly higher after ischaemia-reperfusion (IR) injury in both groups resulting in 4.5-fold median increase. Baseline median mRNA expression of all four transporters prior to Pringle manoeuvre tended to be lower in the low bilirubin group whereas expression of HSP70 was higher in the low bilirubin group compared to the high bilirubin group. Higher mRNA levels of HSP70 in the low bilirubin group could indicate a possible protective effect of high HSP70 levels against IR injury. Although the exact role of hepatobiliary transport systems in the development of post-operative hyper bilirubinemia is not yet completely understood, this study provides new insights into the molecular aspects of post-operative jaundice after liver surgery. © 2011 John Wiley & Sons A/S.
Directory of Open Access Journals (Sweden)
Xiao-Zhe Huang
Full Text Available BACKGROUND: Gram-negative multidrug-resistant (MDR bacteria are major causes of nosocomial infections, and antibiotic resistance in these organisms is often plasmid mediated. Data are scarce pertaining to molecular mechanisms of antibiotic resistance in resource constrained areas such as Iraq. METHODOLOGY/PRINCIPAL FINDINGS: In this study, all MDR Enterobacteriaceae (n = 38 and randomly selected non-MDR counterparts (n = 41 isolated from patients, healthcare workers and environmental surfaces in a newly opened hospital in Iraq were investigated to characterize plasmids found in these isolates and determine their contribution to antibiotic resistance. Our results demonstrated that MDR E. coli and K. pneumoniae isolates harbored significantly more (≥ 3 plasmids compared to their non-MDR counterparts, which carried ≤ 2 plasmids (p<0.01. Various large plasmids (~52 to 100 kb from representative isolates were confirmed to contain multiple resistance genes by DNA microarray analysis. Aminoglycoside (acc, aadA, aph, strA/B, and ksgA, β-lactam (bla(TEM1, bla(AMPC, bla(CTX-M-15, bla(OXA-1, bla(VIM-2 and bla(SHV, sulfamethoxazole/trimethoprim (sul/dfr, tetracycline (tet and chloramphenicol (cat resistance genes were detected on these plasmids. Additionally, multiple plasmids carrying multiple antibiotic resistance genes were found in the same host strain. Genetic transfer-associated genes were identified on the plasmids from both MDR and non-MDR isolates. Seven plasmid replicon types (FII, FIA, FIB, B/O, K, I1 and N were detected in the isolates, while globally disseminated IncA/C and IncHI1 plasmids were not detected in these isolates. CONCLUSIONS/SIGNIFICANCE: This is the first report of the characteristics of the plasmids found in Enterobacteriaceae isolated following the opening of a new hospital in Iraq. The information provided here furthers our understanding of the mechanisms of drug resistance in this specific region and their evolutionary
Wang, Yi-Jun; Zhang, Yun-Kai; Zhang, Guan-Nan; Al Rihani, Sweilem B; Wei, Meng-Ning; Gupta, Pranav; Zhang, Xiao-Yu; Shukla, Suneet; Ambudkar, Suresh V; Kaddoumi, Amal; Shi, Zhi; Chen, Zhe-Sheng
2017-06-28
Chemotherapeutic multidrug resistance (MDR) is a significant challenge to overcome in clinic practice. Several mechanisms contribute to MDR, one of which is the augmented drug efflux induced by the upregulation of ABCB1 in cancer cells. Regorafenib, a multikinase inhibitor targeting the RAS/RAF/MEK/ERK pathway, was approved by the FDA to treat metastatic colorectal cancer and gastrointestinal stromal tumors. We investigated whether and how regorafenib overcame MDR mediated by ABCB1. The results showed that regorafenib reversed the ABCB1-mediated MDR and increased the accumulation of [ 3 H]-paclitaxel in ABCB1-overexpressing cells by suppressing efflux activity of ABCB1, but not altering expression level and localization of ABCB1. Regorafenib inhibited ATPase activity of ABCB1. In mice bearing resistant colorectal tumors, regorafenib raised the intratumoral concentration of paclitaxel and suppressed the growth of resistant colorectal tumors. But regorafenib did not induce cardiotoxicity/myelosuppression of paclitaxel in mice. Strategy to reposition one FDA-approved anticancer drug regorafenib to overcome the resistance of another FDA-approved, widely used chemotherapeutic paclitaxel, may be a promising direction for the field of adjuvant chemotherapy. This study provides clinical rationale for combination of conventional chemotherapy and targeted anticancer agents. Copyright © 2017 Elsevier B.V. All rights reserved.
Serotonin transporter (SERT gene polymorphism in Parkinson’s disease
Directory of Open Access Journals (Sweden)
Mahmut Özkaya
2004-06-01
Full Text Available Background: Parkinson disease (PD is the second most common neurodegenerative disorder with a prevalence of about 2% in persons older than 65 years of age. Neurodegenerative process in PD is not restricted to the dopaminergic neurons of the substantia nigra but also affects serotoninergic neurons. It has been shown that PD brains with Lewy bodies in the substantia nigra also had Lewy bodies in the raphe nuclei. The re-uptake of 5HT released into the synaptic cleft is mediated by the 5HT transporter (SERT. The SERT gene has been mapped to the chromosome of 17q11.1-q12 and has two main polymorphisms: intron two VNTR polymorphism and promoter region 44 bp insertion/deletion polymorphism. Objective: In this study we investigated whether two polymorphic regions in the serotonin transporter gene are associated with PD. Material and Method: After obtaining informed consent, blood samples were collected from 76 patients and 54 healthy volunteers. Genomic DNA was extracted from peripheral leucocytes using standard methods. The SERT gene genotypes were determined using polymerase chain reaction (PCR method. Results: Based on the intron 2 VNTR polymorphism of SERT gene, the distribution of 12/12, 12/10 and 10/10 genotypes were found as, 56.6 %, 35.5 %, 7.9 % in patients whereas this genotype distribution in control group was 40.7 %, 46.3 % and 13 %, respectively. According to 5-HTTLPR polymorphism, the distribution of L/L, L/S and S/S genotypes were found as 27.6 % 51.3 % and 21.1 % in patients whereas this genotype distribution in control group was 33.4 %, 50.0 % and 16.6 %, respectively. Despite the fact that the genotype distribution of SERT gene polymorphism in patients and control group seemed to be different from each other, this difference was not found to be statistically significant. Conclusion: This finding suggests that polymorphisms within the SERT gene do not play a major role in PD susceptibility in the Turkish population.
Directory of Open Access Journals (Sweden)
Kari N W Deininger
Full Text Available BACKGROUND: The TolC outer membrane channel is a key component of several multidrug resistance (MDR efflux pumps driven by H(+ transport in Escherichia coli. While tolC expression is under the regulation of the EvgA-Gad acid resistance regulon, the role of TolC in growth at low pH and extreme-acid survival is unknown. METHODS AND PRINCIPAL FINDINGS: TolC was required for extreme-acid survival (pH 2 of strain W3110 grown aerobically to stationary phase. A tolC deletion decreased extreme-acid survival (acid resistance of aerated pH 7.0-grown cells by 10(5-fold and of pH 5.5-grown cells by 10-fold. The requirement was specific for acid resistance since a tolC defect had no effect on aerobic survival in extreme base (pH 10. TolC was required for expression of glutamate decarboxylase (GadA, GadB, a key component of glutamate-dependent acid resistance (Gad. TolC was also required for maximal exponential growth of E. coli K-12 W3110, in LBK medium buffered at pH 4.5-6.0, but not at pH 6.5-8.5. The TolC growth requirement in moderate acid was independent of Gad. TolC-associated pump components EmrB and MdtB contributed to survival in extreme acid (pH 2, but were not required for growth at pH 5. A mutant lacking the known TolC-associated efflux pumps (acrB, acrD, emrB, emrY, macB, mdtC, mdtF, acrEF showed no growth defect at acidic pH and a relatively small decrease in extreme-acid survival when pre-grown at pH 5.5. CONCLUSIONS: TolC and proton-driven MDR efflux pump components EmrB and MdtB contribute to E. coli survival in extreme acid and TolC is required for maximal growth rates below pH 6.5. The TolC enhancement of extreme-acid survival includes Gad induction, but TolC-dependent growth rates below pH 6.5 do not involve Gad. That MDR resistance can enhance growth and survival in acid is an important consideration for enteric organisms passing through the acidic stomach.
Thapa, Rupak; Bhagat, Chintan; Shrestha, Pragya; Awal, Suvash; Dudhagara, Pravin
2017-05-16
Silver nanoparticles (AgNPs) are believed to be emerging tool against various infectious diseases including multi-drug resistant (MDR) bacteria. In the present study, in vitro synthesis of AgNPs was optimized using 1:50 ratio of macerozyme (25 μg/μl) and 1 mM AgNO 3 incubated at 80 °C for 8 h. AgNPs were characterized by UV-Visible spectroscopy, dynamic light scattering (DLS), scanning electron microscopy, energy-dispersive X-ray spectroscopy, transmission electron microscopy (TEM) and X-ray diffraction (XRD). Characterization studies suggest the synthesis of elliptical, stable and crystalline AgNPs with an average size of 38.26 ± 0.4 nm calculated using TEM. The XRD pattern revealed the face-centered-cubic (fcc) form of metallic silver. Good shape integrity and dispersion of AgNPs after 1 year of incubation confirmed their stability. AgNPs were exibited the antimicrobial property against ten pathogenic bacteria, three molds and one yeast. The AgNPs also revealed remarkable antimicrobial activity against three MDR strains i.e. Extended spectrum beta-lactamase positive Escherichia coli, Staphylococcus aureus (MRSA) and Teicoplanin resistant Streptococcus Pneumoniae. The AgNPs coated surgical threads (suture) were revealed the remarkble antibacterial activity against three MDR strains. This is the first report to synthesize antimicrobial elliptical AgNPs using enzymes. The results suggest the possibilities to develop the nanoparticles coated antimicrobial medical fabric to combat against MDR infection.
The renal urate transporter SLC17A1 locus: confirmation of association with gout.
Hollis-Moffatt, Jade E; Phipps-Green, Amanda J; Chapman, Brett; Jones, Gregory T; van Rij, Andre; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B; Montgomery, Grant W; Stamp, Lisa K; Dalbeth, Nicola; Merriman, Tony R
2012-04-27
Two major gout-causing genes have been identified, the urate transport genes SLC2A9 and ABCG2. Variation within the SLC17A1 locus, which encodes sodium-dependent phosphate transporter 1, a renal transporter of uric acid, has also been associated with serum urate concentration. However, evidence for association with gout is equivocal. We investigated the association of the SLC17A1 locus with gout in New Zealand sample sets. Five variants (rs1165196, rs1183201, rs9358890, rs3799344, rs12664474) were genotyped across a New Zealand sample set totaling 971 cases and 1,742 controls. Cases were ascertained according to American Rheumatism Association criteria. Two population groups were studied: Caucasian and Polynesian. At rs1183201 (SLC17A1), evidence for association with gout was observed in both the Caucasian (odds ratio (OR) = 0.67, P = 3.0 × 10-6) and Polynesian (OR = 0.74, P = 3.0 × 10-3) groups. Meta-analysis confirmed association of rs1183201 with gout at a genome-wide level of significance (OR = 0.70, P = 3.0 × 10-8). Haplotype analysis suggested the presence of a common protective haplotype. We confirm the SLC17A1 locus as the third associated with gout at a genome-wide level of significance.
vPARP Adjusts MVP Expression in Drug-resistant Cell Lines in Conjunction with MDR Proteins.
Wojtowicz, Karolina; Januchowski, Radoslaw; Nowicki, Michal; Zabel, Maciej
2017-06-01
The definition of vault (ribonucleoprotein particles) function remains highly complex. Vaults may cooperate with multidrug resistance (MDR) proteins, supporting their role in drug resistance. This topic is the main theme of this publication. The cell viability was determined by an MTT assay. The protein expression was detected by western blot analysis. The proteins were knocked-down using siRNA. No major vault protein (MVP) in the LoVo/Dx and W1PR cell lines after tunicamycin treatment was shown. In W1PR cells with knocked-down MVP, a statistically significant decrease in cell viability was noted. In LoVo/Dx, W1TR and A2780TR cells were vault poly-ADP-ribose polymerase (vPARP) was knockdown, a decrease in cell viability was shown. Also, MVP silencing induced an increase in glycoprotein P (Pgp) expression in LoVo/Dx cells. MVP is important for the drug resistance of cancer cells, but it probably requires the presence of vPARP for full activation. Some correlations between MDR proteins and vaults exist. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Sodium-coupled neutral amino acid (System N/A) transporters of the SLC38 gene family.
Mackenzie, Bryan; Erickson, Jeffrey D
2004-02-01
The sodium-coupled neutral amino acid transporters (SNAT) of the SLC38 gene family resemble the classically-described System A and System N transport activities in terms of their functional properties and patterns of regulation. Transport of small, aliphatic amino acids by System A subtypes (SNAT1, SNAT2, and SNAT4) is rheogenic and pH sensitive. The System N subtypes SNAT3 and SNAT5 also countertransport H(+), which may be key to their operation in reverse, and have narrower substrate profiles than do the System A subtypes. Glutamine emerges as a favored substrate throughout the family, except for SNAT4. The SLC38 transporters undoubtedly play many physiological roles including the transfer of glutamine from astrocyte to neuron in the CNS, ammonia detoxification and gluconeogenesis in the liver, and the renal response to acidosis. Probing their regulation has revealed additional roles, and recent work has considered SLC38 transporters as therapeutic targets in neoplasia.
Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore.
Lean, Choo Bee; Lee, Edmund Jon Deoon
2009-01-01
MCT1(SLC16A1) is the first member of the monocarboxylate transporter (MCT) and its family is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study identifies genetic variations in SLC16A1 in the ethnic Chinese group of the Singaporean population (n=95). The promoter, coding region and exon-intron junctions of the SLC16A1 gene encoding the MCT1 transporter were screened for genetic variation in the study population by DNA sequencing. Seven genetic variations of SLC16A1, including 4 novel ones, were found: 2 in the promoter region, 2 in the coding exons (both nonsynonymous variations), 2 in the 3' untranslated region (3'UTR) and 1 in the intron. Of the two mutations detected in the promoter region, the -363-855T>C is a novel mutation. The 1282G>A (Val(428)Ile) is a novel SNP and was found as heterozygotic in 4 subjects. The 1470T>A (Asp(490)Glu) was found to be a common polymorphism in this study. Lastly, IVS3-17A>C in intron 3 and 2258 (755)A>G in 3'UTR are novel mutations found to be common polymorphisms in the local Chinese population. To our knowledge, this is the first report of a comprehensive analysis on the MCT1 gene in any population.
DEFF Research Database (Denmark)
Saaby, Lasse; Tfelt-Hansen, Peer; Brodin, Birger
2015-01-01
monolayers with a permeability of 5.7 × 10−5 cm sec−1 compared to an apical to basolateral permeability of 1.3 × 10−5 cm sec-1. The efflux could be inhibited with the P-gp inhibitor zosuquidar. Zosuquidar (0.4 μmol/L) reduced the efflux ratio (PB-A/PA-B) for verapamil 4.6–1.6. The presence of telmisartan......Verapamil is used in high doses for the treatment of cluster headache. Verapamil has been described as a P-glycoprotein (P-gp, ABCB1) substrate. We wished to evaluate in vitro whether co administration of a P-gp inhibitor with verapamil could be a feasible strategy for increasing CNS uptake...... of verapamil. Fluxes of radiolabelled verapamil across MDCK II MDR1 monolayers were measured in the absence and presence of the putative P-gp inhibitor telmisartan (a clinically approved drug compound). Verapamil displayed a vectorial basolateral-to-apical transepithelial efflux across the MDCK II MDR1...
Zhang, Gang; Li, Yi-Min; Li, Biao; Zhang, Da-Wei; Guo, Shun-Xing
2015-01-01
The zinc-regulated transporters (ZRT), iron-regulated transporter (IRT)-like protein (ZIP) plays an important role in the growth and development of plant. In this study, a full length cDNA of ZIP encoding gene, designed as DoZIP1 (GenBank accession KJ946203), was identified from Dendrobium officinale using RT-PCR and RACE. Bioinformatics analysis showed that DoZIP1 consisted of a 1,056 bp open reading frame (ORF) encoded a 351-aa protein with a molecular weight of 37.57 kDa and an isoelectric point (pI) of 6.09. The deduced DoZIP1 protein contained the conserved ZIP domain, and its secondary structure was composed of 50.71% alpha helix, 11.11% extended strand, 36.18% random coil, and beta turn 1.99%. DoZIP1 protein exhibited a signal peptide and eight transmembrane domains, presumably locating in cell membrane. The amino acid sequence had high homology with ZIP proteins from Arabidopsis, alfalfa and rice. A phylogenetic tree analysis demonstrated that DoZIP1 was closely related to AtZIP10 and OsZIP3, and they were clustered into one clade. Real time quantitative PCR analysis demonstrated that the transcription level of DoZIP1 in D. officinale roots was the highest (4.19 fold higher than that of stems), followed by that of leaves (1.12 fold). Molecular characters of DoZIP1 will be useful for further functional determination of the gene involving in the growth and development of D. officinale.
Logeman, Brandon L; Wood, L Kent; Lee, Jaekwon; Thiele, Dennis J
2017-07-07
Copper is an essential element for proper organismal development and is involved in a range of processes, including oxidative phosphorylation, neuropeptide biogenesis, and connective tissue maturation. The copper transporter (Ctr) family of integral membrane proteins is ubiquitously found in eukaryotes and mediates the high-affinity transport of Cu + across both the plasma membrane and endomembranes. Although mammalian Ctr1 functions as a Cu + transporter for Cu acquisition and is essential for embryonic development, a homologous protein, Ctr2, has been proposed to function as a low-affinity Cu transporter, a lysosomal Cu exporter, or a regulator of Ctr1 activity, but its functional and evolutionary relationship to Ctr1 is unclear. Here we report a biochemical, genetic, and phylogenetic comparison of metazoan Ctr1 and Ctr2, suggesting that Ctr2 arose over 550 million years ago as a result of a gene duplication event followed by loss of Cu + transport activity. Using a random mutagenesis and growth selection approach, we identified amino acid substitutions in human and mouse Ctr2 proteins that support copper-dependent growth in yeast and enhance copper accumulation in Ctr1 -/- mouse embryonic fibroblasts. These mutations revert Ctr2 to a more ancestral Ctr1-like state while maintaining endogenous functions, such as stimulating Ctr1 cleavage. We suggest key structural aspects of metazoan Ctr1 and Ctr2 that discriminate between their biological roles, providing mechanistic insights into the evolutionary, biochemical, and functional relationships between these two related proteins. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Hsieh, Yi-Chen; Jeng, Jiann-Shing; Lin, Huey-Juan; Hu, Chaur-Jong; Yu, Chia-Chen; Lien, Li-Ming; Peng, Giia-Sheun; Chen, Chin-I; Tang, Sung-Chun; Chi, Nai-Fang; Tseng, Hung-Pin; Chern, Chang-Ming; Hsieh, Fang-I; Bai, Chyi-Huey; Chen, Yi-Rhu; Chiou, Hung-Yi; Jeng, Jiann-Shing; Tang, Sung-Chun; Yeh, Shin-Joe; Tsai, Li-Kai; Kong, Shin; Lien, Li-Ming; Chiu, Hou-Chang; Chen, Wei-Hung; Bai, Chyi-Huey; Huang, Tzu-Hsuan; Chi-Ieong, Lau; Wu, Ya-Ying; Yuan, Rey-Yue; Hu, Chaur-Jong; Sheu, Jau- Jiuan; Yu, Jia-Ming; Ho, Chun-Sum; Chen, Chin-I; Sung, Jia-Ying; Weng, Hsing-Yu; Han, Yu-Hsuan; Huang, Chun-Ping; Chung, Wen-Ting; Ke, Der-Shin; Lin, Huey-Juan; Chang, Chia-Yu; Yeh, Poh-Shiow; Lin, Kao-Chang; Cheng, Tain-Junn; Chou, Chih-Ho; Yang, Chun-Ming; Peng, Giia-Sheun; Lin, Jiann-Chyun; Hsu, Yaw-Don; Denq, Jong-Chyou; Lee, Jiunn-Tay; Hsu, Chang-Hung; Lin, Chun-Chieh; Yen, Che-Hung; Cheng, Chun-An; Sung, Yueh-Feng; Chen, Yuan-Liang; Lien, Ming-Tung; Chou, Chung-Hsing; Liu, Chia-Chen; Yang, Fu-Chi; Wu, Yi-Chung; Tso, An-Chen; Lai, Yu- Hua; Chiang, Chun-I; Tsai, Chia-Kuang; Liu, Meng-Ta; Lin, Ying-Che; Hsu, Yu-Chuan; Chen, Chih-Hung; Sung, Pi-Shan; Chern, Chang-Ming; Hu, Han-Hwa; Wong, Wen-Jang; Luk, Yun-On; Hsu, Li-Chi; Chung, Chih-Ping; Tseng, Hung-Pin; Liu, Chin-Hsiung; Lin, Chun-Liang; Lin, Hung-Chih; Hu, Chaur-Jong
2012-01-01
Background Endogenous estrogens play an important role in the overall cardiocirculatory system. However, there are no studies exploring the hormone metabolism and signaling pathway genes together on ischemic stroke, including sulfotransferase family 1E (SULT1E1), catechol-O-methyl-transferase (COMT), and estrogen receptor α (ESR1). Methods A case-control study was conducted on 305 young ischemic stroke subjects aged ≦ 50 years and 309 age-matched healthy controls. SULT1E1 -64G/A, COMT Val158Met, ESR1 c.454−397 T/C and c.454−351 A/G genes were genotyped and compared between cases and controls to identify single nucleotide polymorphisms associated with ischemic stroke susceptibility. Gene-gene interaction effects were analyzed using entropy-based multifactor dimensionality reduction (MDR), classification and regression tree (CART), and traditional multiple regression models. Results COMT Val158Met polymorphism showed a significant association with susceptibility of young ischemic stroke among females. There was a two-way interaction between SULT1E1 -64G/A and COMT Val158Met in both MDR and CART analysis. The logistic regression model also showed there was a significant interaction effect between SULT1E1 -64G/A and COMT Val158Met on ischemic stroke of the young (P for interaction = 0.0171). We further found that lower estradiol level could increase the risk of young ischemic stroke for those who carry either SULT1E1 or COMT risk genotypes, showing a significant interaction effect (P for interaction = 0.0174). Conclusions Our findings support that a significant epistasis effect exists among estrogen metabolic and signaling pathway genes and gene-environment interactions on young ischemic stroke subjects. PMID:23112845
Atilano-Roque, Amandla; Joy, Melanie S
2017-12-01
Human organic anion transporting polypeptide 3A1 (OATP3A1) is predominately expressed in the heart. The ability of OATP3A1 to transport statins into cardiomyocytes is unknown, although other OATPs are known to mediate the uptake of statin drugs in liver. The pleiotropic effects and uptake of simvastatin acid were analyzed in primary human cardiomyocytes and HEK293 cells transfected with the OATP3A1 gene. Treatment with simvastatin acid reduced indoxyl sulfate-mediated reactive oxygen species and modulated OATP3A1 expression in cardiomyocytes and HEK293 cells transfected with the OATP3A1 gene. We observed a pH-dependent effect on OATP3A1 uptake, with more efficient simvastatin acid uptake at pH5.5 in HEK293 cells transfected with the OATP3A1 gene. The Michaelis-Menten constant (K m ) for simvastatin acid uptake by OATP3A1 was 0.017±0.002μM and the V max was 0.995±0.027fmol/min/10 5 cells. Uptake of simvastatin acid was significantly increased by known (benzylpenicillin and estrone-3-sulfate) and potential (indoxyl sulfate and cyclosporine) substrates of OATP3A1. In conclusion, the presence of OATP3A1 in cardiomyocytes suggests that this transporter may modulate the exposure of cardiac tissue to simvastatin acid due to its enrichment in cardiomyocytes. Increases in uptake of simvastatin acid by OATP3A1 when combined with OATP substrates suggest the potential for drug-drug interactions that could influence clinical outcomes. Copyright © 2017 Elsevier Ltd. All rights reserved.
Hasibu, Ibrahim; Patoine, Dany; Pilote, Sylvie; Drolet, Benoit; Simard, Chantale
2015-04-01
The guinea-pig is an excellent animal model for studying cardiopulmonary physiology/pharmacology. Interestingly, it also possesses a number of drug-metabolizing enzymes found in humans, such as CYP1A, CYP2D and CYP3A. To evaluate the hypothesis that the guinea-pig also expresses a functional CYP2C drug-metabolizing enzyme and the P-glycoprotein (P-gp) drug transporter in various tissues. cDNAs encoding CYP2C and P-gp were obtained from guinea-pig liver or small intestine and sequenced. Western blotting was performed to confirm the expression of CYP2C and P-gp. The functional enzymatic activity of guinea-pig CYP2C was evaluated with microsomal preparations using diclofenac and tolbutamide as specific drug substrates in HPLC analyses. To further study both P-gp and CYP2C functional activities, the guinea-pig ABCB1/MDR1 and CYP2C genes were cloned. The recombinant plasmids were then transfected in HEK293 (human embryonic kidney) cells and either calcein-acetoxymethyl ester (AM) accumulation assays or 14,15-EET/DHET formation experiments were performed to evaluate either P-gp transport activity or CYP2C epoxygenase activity, respectively. The guinea-pig tissue distribution of P-gp was studied by Western blotting. Functional expression of CYP2C was demonstrated in guinea-pig liver microsomal preparations. CYP2C-mediated biotransformation of diclofenac and tolbutamide were shown. Expression of P-gp protein was detected in guinea-pig liver and small intestine. Functional activity of guinea-pig P-gp was demonstrated in ABCB1/MDR1-transfected cells. GP-CYP2C-transfected cells also showed functional epoxygenase activity. The guinea-pig expresses functional CYP2C and P-gp, thus suggesting its usefulness for further validating data obtained with other animal models in drug biotransformation/transport studies. Copyright © 2015 John Wiley & Sons, Ltd.
Krawczenko, Agnieszka; Bielawska-Pohl, Aleksandra; Wojtowicz, Karolina; Jura, Roksana; Paprocka, Maria; Wojdat, Elżbieta; Kozłowska, Urszula; Klimczak, Aleksandra; Grillon, Catherine; Kieda, Claudine; Duś, Danuta
2017-01-01
Active cellular transporters of harmful agents-multidrug resistance (mdr) proteins-are present in tumor, stem and endothelial cells, among others. While mdr proteins are broadly studied in tumor cells, their role in non-tumor cells and the significance of their action not connected with removal of harmful xenobiotics is less extensively documented. Proper assessment of mdr proteins expression is difficult. Mdr mRNA presence is most often evaluated but that does not necessarily correlate with the protein level. The protein expression itself is difficult to determine; usually cells with mdr overexpression are studied, not cells under physiological conditions, in which a low expression level of mdr protein is often insufficient for detection in vitro. Various methods are used to identify mdr mRNA and protein expression, together with functional tests demonstrating their biological drug transporting activities. Data comparing different methods of investigating expression of mdr mRNAs and their corresponding proteins are still scarce. In this article we present the results of a study concerning mdr mRNA and protein expression. Our goal was to search for the best method to investigate the expression level and functional activity of five selected mdr proteins-MDR1, BCRP, MRP1, MRP4 and MRP5-in established in vitro cell lines of human endothelial cells (ECs) and their progenitors. Endothelial cells demonstrated mdr presence at the mRNA level, which was not always confirmed at the protein level or in functional tests. Therefore, several different assays had to be applied for evaluation of mdr proteins expression and functions in endothelial cells. Among them functional tests seemed to be the most conclusive, although not very specific.
Sugar regulation of SUGAR TRANSPORTER PROTEIN 1 (STP1) expression in Arabidopsis thaliana
Cordoba, Elizabeth; Aceves-Zamudio, Denise Lizeth; Hernández-Bernal, Alma Fabiola; Ramos-Vega, Maricela; León, Patricia
2015-01-01
Sugars regulate the expression of many genes at the transcriptional level. In Arabidopsis thaliana, sugars induce or repress the expression of >1800 genes, including the STP1 (SUGAR TRANSPORTER PROTEIN 1) gene, which encodes an H+/monosaccharide cotransporter. STP1 transcript levels decrease more rapidly after the addition of low concentrations of sugars than the levels of other repressed genes, such as DIN6 (DARK-INDUCED 6). We found that this regulation is exerted at the transcriptional level and is initiated by phosphorylatable sugars. Interestingly, the sugar signal that modulates STP1 expression is transmitted through a HEXOKINASE 1-independent signalling pathway. Finally, analysis of the STP1 5′ regulatory region allowed us to delimit a region of 309bp that contains the cis elements implicated in the glucose regulation of STP1 expression. Putative cis-acting elements involved in this response were identified. PMID:25281700
De Grandis, Elisa; Stagnaro, Michela; Biancheri, Roberta; Giannotta, Melania; Gobbi, Giuseppe; Traverso, Monica; Veneselli, Edvige; Zara, Federico
2013-07-01
Alternating hemiplegia of childhood is a rare, predominantly sporadic disorder. Diagnosis is clinical, and little is known about genetics. Glucose transporter 1 deficiency syndrome shares with alternating hemiplegia of childhood paroxysmal and nonparoxysmal symptoms. The aim of the study was to investigate glucose transporter 1 mutations in 30 Italian patients. Genetic material was analyzed by DNA amplification and glucose transporter 1 region sequencing. Mutational analysis findings of the SLC2A1 gene were negative in all patients. The pattern of movement disorders was reviewed. Interictal dystonia and multiple paroxysmal events were typical of alternating hemiplegia of childhood. In conclusion, alternating hemiplegia of childhood is a heterogeneous clinical condition, and although glucose transporter 1 deficiency can represent an undiagnosed cause of this disorder, mutational analysis is not routinely recommended. Alternatively, a careful clinical analysis and the 3-O-methyl-D-glucose uptake test can allow prompt identification of a subgroup of patients with alternating hemiplegia of childhood treatable with a ketogenic diet.
Management of MDR-TB in HIV co-infected patients in Eastern Europe
DEFF Research Database (Denmark)
Efsen, A M W; Schultze, A; Miller, R F
2018-01-01
below the target of 90%, reflecting the challenging patient population and the environment in which health care is provided. Urgent improvement of management of patients with TB/HIV in EE, in particular for those with MDR-TB, is needed and includes widespread access to rapid TB diagnostics, better......OBJECTIVES: Mortality among HIV patients with tuberculosis (TB) remains high in Eastern Europe (EE), but details of TB and HIV management remain scarce. METHODS: In this prospective study, we describe the TB treatment regimens of patients with multi-drug resistant (MDR) TB and use of antiretroviral...... access to and use of second-line TB drugs, timely ART initiation with viral load monitoring, and integration of TB/HIV care....
Recovery, modernization and computerization of the monochromator MDR-23
International Nuclear Information System (INIS)
Miranda, L. J.
2012-01-01
For use in the Optics Laboratory, newly created in the CEADEN, one of the necessary equipment is the Monochromator MDR-23, which was necessary for recovery, modernization (replacing the power supply and control) and computerization by designing a VI (virtual instrument) to control stepper motor through a PC using Lab VIEW 7.1 that allows users to select the address mode, the number of steps and the engine speed and give the initial value of the position and limits the range of the monochromator to start working with it. The principle of operation of the program is done in detail to facilitate understanding of how to operate and use the graphical programming designed and achieve efficient use of equipment. (Author)
The Creatine Transporter Gene Paralogous at 16p11.2 Is Expressed in Human Brain
Directory of Open Access Journals (Sweden)
Nadia Bayou
2008-01-01
We report on the clinical, cytogenetic, and molecular findings in a boy with autism carrying a de novo translocation t(7;16(p22.1;p11.2. The chromosome 16 breakpoint disrupts the paralogous SLC6A8 gene also called SLC6A10 or CT2. Predicted translation of exons and RT-PCR analysis reveal specific expression of the creatine transporter paralogous in testis and brain. Several studies reported on the role of X-linked creatine transporter mutations in individuals with mental retardation, with or without autism. The existence of disruption in SLC6A8 paralogous gene associated with idiopathic autism suggests that this gene may be involved in the autistic phenotype in our patient.
Sagor, G H M; Berberich, Thomas; Kojima, Seiji; Niitsu, Masaru; Kusano, Tomonobu
2016-06-01
Two genes, LAT1 and OCT1 , are likely to be involved in polyamine transport in Arabidopsis. Endogenous spermine levels modulate their expression and determine the sensitivity to cadaverine. Arabidopsis spermine (Spm) synthase (SPMS) gene-deficient mutant was previously shown to be rather resistant to the diamine cadaverine (Cad). Furthermore, a mutant deficient in polyamine oxidase 4 gene, accumulating about twofold more of Spm than wild type plants, showed increased sensitivity to Cad. It suggests that endogenous Spm content determines growth responses to Cad in Arabidopsis thaliana. Here, we showed that Arabidopsis seedlings pretreated with Spm absorbs more Cad and has shorter root growth, and that the transgenic Arabidopsis plants overexpressing the SPMS gene are hypersensitive to Cad, further supporting the above idea. The transgenic Arabidopsis overexpressing L-Amino acid Transporter 1 (LAT1) absorbed more Cad and showed increased Cad sensitivity, suggesting that LAT1 functions as a Cad importer. Recently, other research group reported that Organic Cation Transporter 1 (OCT1) is a causal gene which determines the Cad sensitivity of various Arabidopsis accessions. Furthermore, their results suggested that OCT1 is involved in Cad efflux. Thus we monitored the expression of OCT1 and LAT1 during the above experiments. Based on the results, we proposed a model in which the level of Spm content modulates the expression of OCT1 and LAT1, and determines Cad sensitivity of Arabidopsis.
Directory of Open Access Journals (Sweden)
Samantha J. Hindle
2017-10-01
Full Text Available Summary: Central nervous system (CNS chemical protection depends upon discrete control of small-molecule access by the blood-brain barrier (BBB. Curiously, some drugs cause CNS side-effects despite negligible transit past the BBB. To investigate this phenomenon, we asked whether the highly BBB-enriched drug efflux transporter MDR1 has dual functions in controlling drug and endogenous molecule CNS homeostasis. If this is true, then brain-impermeable drugs could induce behavioral changes by affecting brain levels of endogenous molecules. Using computational, genetic, and pharmacologic approaches across diverse organisms, we demonstrate that BBB-localized efflux transporters are critical for regulating brain levels of endogenous steroids and steroid-regulated behaviors (sleep in Drosophila and anxiety in mice. Furthermore, we show that MDR1-interacting drugs are associated with anxiety-related behaviors in humans. We propose a general mechanism for common behavioral side effects of prescription drugs: pharmacologically challenging BBB efflux transporters disrupts brain levels of endogenous substrates and implicates the BBB in behavioral regulation. : Hindle et al. shed light on the curious finding that some drugs cause behavioral side-effects despite negligible access into the brain. These authors propose a unifying hypothesis that links blood-brain barrier drug transporter function and brain access of circulating steroids to common CNS adverse drug responses. Keywords: drug side effect mechanisms, central nervous system, blood brain barrier, behavior, toxicology, drug transporters, endobiotics, steroid hormones
A neurotransmitter transporter encoded by the Drosophila inebriated gene
Soehnge, Holly; Huang, Xi; Becker, Marie; Whitley, Penn; Conover, Diana; Stern, Michael
1996-01-01
Behavioral and electrophysiological studies on mutants defective in the Drosophila inebriated (ine) gene demonstrated increased excitability of the motor neuron. In this paper, we describe the cloning and sequence analysis of ine. Mutations in ine were localized on cloned DNA by restriction mapping and restriction fragment length polymorphism (RFLP) mapping of ine mutants. DNA from the ine region was then used to isolate an ine cDNA. In situ hybridization of ine transcripts to developing embryos revealed expression of this gene in several cell types, including the posterior hindgut, Malpighian tubules, anal plate, garland cells, and a subset of cells in the central nervous system. The ine cDNA contains an open reading frame of 658 amino acids with a high degree of sequence similarity to members of the Na+/Cl−-dependent neurotransmitter transporter family. Members of this family catalyze the rapid reuptake of neurotransmitters released into the synapse and thereby play key roles in controlling neuronal function. We conclude that ine mutations cause increased excitability of the Drosophila motor neuron by causing the defective reuptake of the substrate neurotransmitter of the ine transporter and thus overstimulation of the motor neuron by this neurotransmitter. From this observation comes a unique opportunity to perform a genetic dissection of the regulation of excitability of the Drosophila motor neuron. PMID:8917579
ABC transporters in fish species: a review
Directory of Open Access Journals (Sweden)
Marta eFerreira
2014-07-01
Full Text Available ATP-binding cassette (ABC proteins were first recognized for their role in multidrug resistance (MDR in chemotherapeutic treatments, which is a major impediment for the successful treatment of many forms of malignant tumors in humans. These proteins, highly conserved throughout vertebrate species, were later related to cellular detoxification and accounted as responsible for protecting aquatic organisms from xenobiotic insults in the so-called multixenobiotic resistance mechanism (MXR. In recent years, research on these proteins in aquatic species has highlighted their importance in the detoxification mechanisms in fish thus it is of extreme added value to continue these studies. Several transporters have been pointed out as relevant in the ecotoxicological context associated to the transport of xenobiotics, such as P-glycoproteins (Pgps, multidrug-resistance-associated proteins (MRPs 1-5 and breast resistance associated protein (BCRP. In mammals, several nuclear receptors have been identified as mediators of phase I and II metabolizing enzymes and ABC transporters. In aquatic species, knowledge on co-regulation of detoxification mechanism is scarce and needs to be addressed. The interaction of emergent contaminants, with chemosensitizer potential, with ABC transporters in aquatic organisms can compromise detoxification processes and have population effects and should be studied in more detail. This review intends to summarize the recent advances in research on MXR mechanisms in fish species, focusing in 1 regulation and functioning of ABC proteins; 2 cooperation with phase I and II biotransformation enzymes; and 3 ecotoxicological relevance and information on emergent pollutants with ability to modulate ABC transporters expression and activity. Several lines of evidence are clear suggesting the important role of these transporters in detoxification mechanisms and must be further investigated in fish.
Varmanen, P; Rantanen, T; Palva, A
1996-12-01
A proline iminopeptidase gene (pepI) of an industrial Lactobacillus helveticus strain was cloned and found to be organized in an operon-like structure of three open reading frames (ORF1, ORF2 and ORF3). ORF1 was preceded by a typical prokaryotic promoter region, and a putative transcription terminator was found downstream of ORF3, identified as the pepI gene. Using primer-extension analyses, only one transcription start site, upstream of ORF1, was identifiable in the predicted operon. Although the size of mRNA could not be judged by Northern analysis either with ORF1-, ORF2- or pepI-specific probes, reverse transcription-PCR analyses further supported the operon structure of the three genes. ORF1, ORF2 and ORF3 had coding capacities for 50.7, 24.5 and 33.8 kDa proteins, respectively. The ORF3-encoded PepI protein showed 65% identity with the PepI proteins from Lactobacillus delbrueckii subsp. bulgaricus and Lactobacillus delbrueckii subsp. lactis. The ORF1-encoded protein had significant homology with several members of the ABC transporter family but, with two distinct putative ATP-binding sites, it would represent an unusual type among the bacterial ABC transporters. ORF2 encoded a putative integral membrane protein also characteristic of the ABC transporter family. The pepI gene was overexpressed in Escherichia coli. Purified PepI hydrolysed only di and tripeptides with proline in the first position. Optimum PepI activity was observed at pH 7.5 and 40 degrees C. A gel filtration analysis indicated that PepI is a dimer of M(r) 53,000. PepI was shown to be a metal-independent serine peptidase having thiol groups at or near the active site. Kinetic studies with proline-p-nitroanilide as substrate revealed Km and Vmax values of 0.8 mM and 350 mmol min-1 mg-1, respectively, and a very high turnover number of 135,000 s-1.
Soliman, Ahmed M; Ahmed, Ashraf M; Shimamoto, Toshi; El-Domany, Ramadan A; Nariya, Hirofumi; Shimamoto, Tadashi
2017-07-01
Two Proteus mirabilis strains, designated PmTAN59 and PmKAF126, were isolated from two different Egyptian cities in 2014 and 2015, respectively. PmTAN59 was isolated from a sputum swab from a pneumonia patient in Tanta University Teaching Hospital. PmKAF126 was isolated from a patient with a diabetic foot infection in a hospital in the city of Kafr El-Sheikh. The two isolates were identified with bacterial small ribosomal RNA (16S rRNA) gene amplification and sequencing and tested for antimicrobial sensitivity with a Kirby-Bauer disk diffusion assay. The two strains were resistant to amoxicillin/clavulante, ampicillin, cefotaxime, cefoxitin, ceftriaxone, chloramphenicol, ciprofloxacin, colistin, gentamicin, kanamycin, nalidixic acid, spectinomycin, streptomycin, sulfamethoxazole/trimethoprime, and tetracycline, but sensitive to aztreonam, imipenem, and meropenem. Molecular characterization was used to map the entire backbone, including the multiple antibiotic resistance (MDR) region, of Salmonella genomic island 1 (SGI1). Both isolates carried a structure similar to SGI1, with two different MDR regions corresponding to SGI1-PmABB in PmTAN59 and SGI1-W in PmKAF126. SGI1-PmABB carried an integron of ~1.5kb with a two-gene cassette, aacCA5-aadA7, which confers resistance to gentamicin, streptomycin, and spectinomycin, whereas SGI1-W carried an integron of ~1.9kb containing aadA2-lnuF, which confers resistance to spectinomycin, streptomycin, and lincosamides. PmKAF126 carried the entire SGI1 sequence, however PmTAN59 carried a SGI1 structure with a deletion in the region from ORF S005 to ORF S009 and accompanied by insertion of IS1359 (1258bp). Furthermore, PmTAN59 carried class 2 integron of ~2.2kb containing dfrA1-sat2-aadA1. An ERIC-PCR analysis detected no clonal relationship between the two strains. Molecular screening for other antimicrobial resistance genes and a plasmid analysis indicated that PmTAN59 carried an IncFIB plasmid type. This strain also carried bla
Energy Technology Data Exchange (ETDEWEB)
De Bruyne, Sylvie; Wyffels, Leonie [Laboratory for Radiopharmacy, Ghent University, 9000 Ghent (Belgium); Boos, Terrence L. [Chemical Biology Research Branch, National Institute on Drug Abuse and National Institute on Alcohol Abuse and Alcoholism, National Institutes of Health, Bethesda, MD (United States); Staelens, Steven; Deleye, Steven [IBITECH-Medisip, Ghent University-IBBT, 9000 Ghent (Belgium); Rice, Kenner C. [Chemical Biology Research Branch, National Institute on Drug Abuse and National Institute on Alcohol Abuse and Alcoholism, National Institutes of Health, Bethesda, MD (United States); De Vos, Filip [Laboratory for Radiopharmacy, Ghent University, 9000 Ghent (Belgium)], E-mail: filipx.devos@ugent.be
2010-05-15
Introduction: P-glycoprotein (P-gp) is an energy-dependent transporter that contributes to the efflux of a wide range of xenobiotics at the blood-brain barrier playing a role in drug-resistance or therapy failure. In this study, we evaluated [{sup 123}I]-4-(2-(bis(4-fluorophenyl)methoxy)ethyl)-1-(4-iodobenzyl)piperidine ([{sup 123}I]-FMIP) as a novel single photon emission computed tomography (SPECT) tracer for imaging P-gp at the brain in vivo. Methods: The tissue distribution and brain uptake as well as the metabolic profile of [{sup 123}I]-FMIP in wild-type and mdr1a (-/-) mice after pretreatment with physiological saline or cyclosporin A (CsA) (50 mg/kg) was investigated. The influence of increasing doses CsA on brain uptake of [{sup 123}I]-FMIP was explored. {mu}SPECT images of mice brain after injection of 11.1 MBq [{sup 123}I]-FMIP were obtained for different treatment strategies thereby using the Milabs U-SPECT-II. Results: Modulation of P-gp with CsA (50 mg/kg) as well as mdr1a gene depletion resulted in significant increase in cerebral uptake of [{sup 123}I]-FMIP with only minor effect on blood activity. [{sup 123}I]-FMIP is relative stable in vivo with >80% intact [{sup 123}I]-FMIP in brain at 60 min p.i. in the different treatment regiments. A dose-dependent sigmoidal increase in brain uptake of [{sup 123}I]-FMIP with increasing doses of CsA was observed. In vivo region of interest-based SPECT measurements correlated well with the observations of the biodistribution studies. Conclusions: These findings indicate that [{sup 123}I]-FMIP can be applied to assess the efficacy of newly developed P-gp modulators. It is also suggested that [{sup 123}I]-FMIP is a promising SPECT tracer for imaging P-gp at the blood-brain barrier.
Remy, Estelle; Niño-González, María; Godinho, Cláudia P; Cabrito, Tânia R; Teixeira, Miguel C; Sá-Correia, Isabel; Duque, Paula
2017-07-03
Soil contamination is a major hindrance for plant growth and development. The lack of effective strategies to remove chemicals released into the environment has raised the need to increase plant resilience to soil pollutants. Here, we investigated the ability of two Saccharomyces cerevisiae plasma-membrane transporters, the Major Facilitator Superfamily (MFS) member Tpo1p and the ATP-Binding Cassette (ABC) protein Pdr5p, to confer Multiple Drug Resistance (MDR) in Arabidopsis thaliana. Transgenic plants expressing either of the yeast transporters were undistinguishable from the wild type under control conditions, but displayed tolerance when challenged with the herbicides 2,4-D and barban. Plants expressing ScTPO1 were also more resistant to the herbicides alachlor and metolachlor as well as to the fungicide mancozeb and the Co 2+ , Cu 2+ , Ni 2+ , Al 3+ and Cd 2+ cations, while ScPDR5-expressing plants exhibited tolerance to cycloheximide. Yeast mutants lacking Tpo1p or Pdr5p showed increased sensitivity to most of the agents tested in plants. Our results demonstrate that the S. cerevisiae Tpo1p and Pdr5p transporters are able to mediate resistance to a broad range of compounds of agricultural interest in yeast as well as in Arabidopsis, underscoring their potential in future biotechnological applications.
Khoeruddin Wittriansyah; Agus Trianto; Sekar Widyaningsih; Ocky Karna Radjasa; Rudhi Pribadi
2016-01-01
Marine sponge-associated fungi are the sources of bioactive compounds with various pharmacologicals potency. This study aimed to isolate the sponge-associated fungi as the producer of the MDR anti-bacterial compounds. The associated fungi were isolated from the sponges collected from Riung water, Nusa Tenggara Timur. Five of the best isolates were cultured on MEA to obtain the methanolic extract for further studies. The antagonistic test was conducted using overlay method towards the MDR St...
Moderation of antidepressant response by the serotonin transporter gene
DEFF Research Database (Denmark)
Huezo-Diaz, Patricia; Uher, Rudolf; Smith, Rebecca
2009-01-01
Background: There have been conflicting reports on whether the length polymorphism in the promoter of the serotonin transporter gene (5-HTTLPR) moderates the antidepressant effects of selective serotonin reuptake inhibitors (SSRIs). We hypothesised that the pharmacogenetic effect of 5-HTTLPR...... the serotonin transporter gene were genotyped in 795 adults with moderate-to-severe depression treated with escitalopram or nortriptyline in the Genome Based Therapeutic Drugs for Depression (GENDEP) project. Results: The 5-HTTLPR moderated the response to escitalopram, with long-allele carriers improving more...
Glucose metabolism transporters and epilepsy: only GLUT1 has an established role.
Hildebrand, Michael S; Damiano, John A; Mullen, Saul A; Bellows, Susannah T; Oliver, Karen L; Dahl, Hans-Henrik M; Scheffer, Ingrid E; Berkovic, Samuel F
2014-02-01
The availability of glucose, and its glycolytic product lactate, for cerebral energy metabolism is regulated by specific brain transporters. Inadequate energy delivery leads to neurologic impairment. Haploinsufficiency of the glucose transporter GLUT1 causes a characteristic early onset encephalopathy, and has recently emerged as an important cause of a variety of childhood or later-onset generalized epilepsies and paroxysmal exercise-induced dyskinesia. We explored whether mutations in the genes encoding the other major glucose (GLUT3) or lactate (MCT1/2/3/4) transporters involved in cerebral energy metabolism also cause generalized epilepsies. A cohort of 119 cases with myoclonic astatic epilepsy or early onset absence epilepsy was screened for nucleotide variants in these five candidate genes. No epilepsy-causing mutations were identified, indicating that of the major energetic fuel transporters in the brain, only GLUT1 is clearly associated with generalized epilepsy. Wiley Periodicals, Inc. © 2014 International League Against Epilepsy.
Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong
2017-03-01
Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.
Achard-Joris, M; van Saparoea, HBV; Driessen, AJM; Bourdineaud, JP; Bourdineaud, Jean-Paul
2005-01-01
The human MDR1 gene is induced by cadmium exposure although no resistance to this metal is observed in human cells overexpressing hMDR1. To access the role of MDR proteins in cadmium resistance, human MDR1, Lactococcus lactis lmrA, and Oenococcus oeni omrA were expressed in an Escherichia coli tolC
75 FR 59176 - DoD Mandatory Declassification Review (MDR) Program
2010-09-27
..., VA 22060-6201. (13) Missile Defense Agency. Missile Defense Agency, Attention: MDA/DS, 7100 Defense... DEPARTMENT OF DEFENSE Office of the Secretary 32 CFR Part 222 [DoD-2010-OS-0043; RIN 0790-AI62] DoD Mandatory Declassification Review (MDR) Program AGENCY: Department of Defense. ACTION: Proposed...
Sun, Xiaoyu; Liu, Bin; Chen, Yan; Huang, Honglan; Wang, Guoqing; Li, Fan; Ni, Zhaohui
2016-12-01
The prevalence of various Ambler class A to D β-lactamases, ISAba1, and class 1 and 2 integrons as well as the clonal relatedness in 105 Acinetobacter spp. isolates found in northeastern China was investigated. All 105 Acinetobacter spp. isolates were determined to be multidrug resistant (MDR), and the resistance rates to carbapenem agents were approximately 50%. PER, IMP, AmpC, and OXA-23 were found to be dominant β-lactamases belonging to different classes, respectively. This is the first report of the coexistence of bla PER , bla IMP , bla AmpC , and bla OXA-23-like genes in Acinetobacter spp. isolates from northeastern China. ISAba1 was found upstream of the bla OXA-23-like gene in 87.8% (36/41) strains and upstream of the bla OXA-51-like gene in 26.5% (13/49) strains. ISAba3-like element was found upstream of the bla OXA-58-like gene in one bla OXA-58-like -positive strain. The presence of IntI1 was detected in 63.8% (67/105) of the isolates and the most prevalent gene cassettes were aacA4, aadA1, and catB8. The highly prevalent isolates belong to international clonal lineage (ICL)-II. These results indicate that the wide horizontal and clonal spread of MDR Acinetobacter spp. isolates harbouring multiple β-lactamase genes has become a serious problem in northeastern China.
A new in vivo method to study P-glycoprotein transport in tumors and the blood-brain barrier
Hendrikse, NH; de Vries, EGE; Eriks-Fluks, L; van der Graaf, WTA; Hospers, GAP; Willemsen, ATM; Vaalburg, W; Franssen, EJF
1999-01-01
Drug resistance is a major cause of chemotherapy failure in cancer treatment, One reason is the overexpression of the drug efflux pump P-glycoprotein (P-gp), involved in multidrug resistance (MDR), In vivo pharmacokinetic analysis of P-gp transport might identify the capacity of modulation by P-gp
Zhang, Zhengyu; Tachikawa, Masanori; Uchida, Yasuo; Terasaki, Tetsuya
2018-03-05
Although arachnoid mater epithelial cells form the blood-arachnoid barrier (BAB), acting as a blood-CSF interface, it has been generally considered that the BAB is impermeable to water-soluble substances and plays a largely passive role. Here, we aimed to clarify the function of transporters at the BAB in regulating CSF clearance of water-soluble organic anion drugs based on quantitative targeted absolute proteomics (QTAP) and in vivo analyses. Protein expression levels of 61 molecules, including 19 ATP-binding-cassette (ABC) transporters and 32 solute-carrier (SLC) transporters, were measured in plasma membrane fraction of rat leptomeninges using QTAP. Thirty-three proteins were detected; others were under the quantification limits. Expression levels of multidrug resistance protein 1 (Mdr1a/P-gp/Abcb1a) and breast cancer resistance protein (Bcrp/Abcg2) were 16.6 and 3.27 fmol/μg protein (51.9- and 9.82-fold greater than in choroid plexus, respectively). Among those organic anion transporters detected only at leptomeninges, not choroid plexus, organic anion transporter 1 (oat1/Slc22a6) showed the greatest expression (2.73 fmol/μg protein). On the other hand, the protein expression level of oat3 at leptomeninges was 6.65 fmol/μg protein, and the difference from choroid plexus was within two-fold. To investigate oat1's role, we injected para-aminohippuric acid (PAH) with or without oat1 inhibitors into cisterna magna (to minimize the contribution of choroid plexus function) of rats. A bulk flow marker, FITC-inulin, was not taken up from CSF up to 15 min, whereas uptake clearance of PAH was 26.5 μL/min. PAH uptake was completely blocked by 3 mM cephalothin (inhibits both oat1 and oat3), while 17% of PAH uptake was inhibited by 0.2 mM cephalothin (selectively inhibits oat3). These results indicate that oat1 and oat3 at the BAB provide a distinct clearance pathway of organic anion drugs from CSF independently of choroid plexus.
Lin, Shan-Hua; Kuo, Hui-Fen; Canivenc, Geneviève; Lin, Choun-Sea; Lepetit, Marc; Hsu, Po-Kai; Tillard, Pascal; Lin, Huey-Ling; Wang, Ya-Yun; Tsai, Chyn-Bey; Gojon, Alain; Tsay, Yi-Fang
2008-09-01
Little is known about the molecular and regulatory mechanisms of long-distance nitrate transport in higher plants. NRT1.5 is one of the 53 Arabidopsis thaliana nitrate transporter NRT1 (Peptide Transporter PTR) genes, of which two members, NRT1.1 (CHL1 for Chlorate resistant 1) and NRT1.2, have been shown to be involved in nitrate uptake. Functional analysis of cRNA-injected Xenopus laevis oocytes showed that NRT1.5 is a low-affinity, pH-dependent bidirectional nitrate transporter. Subcellular localization in plant protoplasts and in planta promoter-beta-glucuronidase analysis, as well as in situ hybridization, showed that NRT1.5 is located in the plasma membrane and is expressed in root pericycle cells close to the xylem. Knockdown or knockout mutations of NRT1.5 reduced the amount of nitrate transported from the root to the shoot, suggesting that NRT1.5 participates in root xylem loading of nitrate. However, root-to-shoot nitrate transport was not completely eliminated in the NRT1.5 knockout mutant, and reduction of NRT1.5 in the nrt1.1 background did not affect root-to-shoot nitrate transport. These data suggest that, in addition to that involving NRT1.5, another mechanism is responsible for xylem loading of nitrate. Further analyses of the nrt1.5 mutants revealed a regulatory loop between nitrate and potassium at the xylem transport step.
Energy Technology Data Exchange (ETDEWEB)
Wang, Zhaojing [Department of Pharmacology, School of Pharmacy, Tongji Medical College, Huazhong University of Science and Technology, 430030 Wuhan (China); Xu, Yonghong [Institute of Ophthalmological Research, Department of Ophthalmology, Renmin Hospital of Wuhan University, 430060 Wuhan (China); Meng, Xiangning [School of Materials and Metallurgy, Northeastern University, Shenyang 110819 (China); Watari, Fumio [Department of Biomedical, Dental Materials and Engineering, Graduate School of Dental Medicine, Hokkaido University, Sapporo 060-8586 (Japan); Liu, Hudan, E-mail: hudanliu@hust.edu.cn [Department of Pharmacology, School of Pharmacy, Tongji Medical College, Huazhong University of Science and Technology, 430030 Wuhan (China); Chen, Xiao, E-mail: mornsmile@yahoo.com [Department of Pharmacology, School of Pharmacy, Tongji Medical College, Huazhong University of Science and Technology, 430030 Wuhan (China)
2015-01-01
Over-expression of ATP-binding cassette (ABC) transporters, a large family of integral membrane proteins that decrease cellular drug uptake and accumulation by active extrusion, is one of the major causes of cancer multi-drug resistance (MDR) that frequently leads to failure of chemotherapy. Carbon nanotubes (CNTs)-based drug delivery devices hold great promise in enhancing the efficacy of cancer chemotherapy. However, CNTs' effects on the ABC transporters remain under-investigated. In this study, we found that multiwalled carbon nanotubes (MWCNTs) reduced transport activity and expression of ABC transporters including ABCB1/Pgp and ABCC4/MRP4 in human colon adenocarcinoma Caco-2 cells. Proto-oncogene c-Myc, which directly regulates ABC gene expression, was concurrently decreased in MWCNT-treated cells and forced over-expression of c-Myc reversed MWCNTs' inhibitory effects on ABCB1 and ABCC4 expression. MWCNT-cell membrane interaction and cell membrane oxidative damage were observed. However, antioxidants such as vitamin C, β-mecaptoethanol and dimethylthiourea failed to antagonize MWCNTs' down-regulation of ABC transporters. These data suggest that MWCNTs may act on c-Myc, but not through oxidative stress, to down-regulate ABC transporter expression. Our findings thus shed light on CNTs' novel cellular effects that may be utilized to develop CNTs-based drug delivery devices to overcome ABC transporter-mediated cancer chemoresistance.
Expression of biomineralization-related ion transport genes in Emiliania huxleyi.
Mackinder, Luke; Wheeler, Glen; Schroeder, Declan; von Dassow, Peter; Riebesell, Ulf; Brownlee, Colin
2011-12-01
Biomineralization in the marine phytoplankton Emiliania huxleyi is a stringently controlled intracellular process. The molecular basis of coccolith production is still relatively unknown although its importance in global biogeochemical cycles and varying sensitivity to increased pCO₂ levels has been well documented. This study looks into the role of several candidate Ca²⁺, H⁺ and inorganic carbon transport genes in E. huxleyi, using quantitative reverse transcriptase PCR. Differential gene expression analysis was investigated in two isogenic pairs of calcifying and non-calcifying strains of E. huxleyi and cultures grown at various Ca²⁺ concentrations to alter calcite production. We show that calcification correlated to the consistent upregulation of a putative HCO₃⁻ transporter belonging to the solute carrier 4 (SLC4) family, a Ca²⁺/H⁺ exchanger belonging to the CAX family of exchangers and a vacuolar H⁺-ATPase. We also show that the coccolith-associated protein, GPA is downregulated in calcifying cells. The data provide strong evidence that these genes play key roles in E. huxleyi biomineralization. Based on the gene expression data and the current literature a working model for biomineralization-related ion transport in coccolithophores is presented. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.
OCD candidate gene SLC1A1/EAAT3 impacts basal ganglia-mediated activity and stereotypic behavior.
Zike, Isaac D; Chohan, Muhammad O; Kopelman, Jared M; Krasnow, Emily N; Flicker, Daniel; Nautiyal, Katherine M; Bubser, Michael; Kellendonk, Christoph; Jones, Carrie K; Stanwood, Gregg; Tanaka, Kenji Fransis; Moore, Holly; Ahmari, Susanne E; Veenstra-VanderWeele, Jeremy
2017-05-30
Obsessive-compulsive disorder (OCD) is a chronic, disabling condition with inadequate treatment options that leave most patients with substantial residual symptoms. Structural, neurochemical, and behavioral findings point to a significant role for basal ganglia circuits and for the glutamate system in OCD. Genetic linkage and association studies in OCD point to SLC1A1 , which encodes the neuronal glutamate/aspartate/cysteine transporter excitatory amino acid transporter 3 (EAAT3)/excitatory amino acid transporter 1 (EAAC1). However, no previous studies have investigated EAAT3 in basal ganglia circuits or in relation to OCD-related behavior. Here, we report a model of Slc1a1 loss based on an excisable STOP cassette that yields successful ablation of EAAT3 expression and function. Using amphetamine as a probe, we found that EAAT3 loss prevents expected increases in ( i ) locomotor activity, ( ii ) stereotypy, and ( iii ) immediate early gene induction in the dorsal striatum following amphetamine administration. Further, Slc1a1 -STOP mice showed diminished grooming in an SKF-38393 challenge experiment, a pharmacologic model of OCD-like grooming behavior. This reduced grooming is accompanied by reduced dopamine D 1 receptor binding in the dorsal striatum of Slc1a1 -STOP mice. Slc1a1 -STOP mice also exhibit reduced extracellular dopamine concentrations in the dorsal striatum both at baseline and following amphetamine challenge. Viral-mediated restoration of Slc1a1 /EAAT3 expression in the midbrain but not in the striatum results in partial rescue of amphetamine-induced locomotion and stereotypy in Slc1a1 -STOP mice, consistent with an impact of EAAT3 loss on presynaptic dopaminergic function. Collectively, these findings indicate that the most consistently associated OCD candidate gene impacts basal ganglia-dependent repetitive behaviors.
The Role of Adjunctive Therapies in Septic Shock by Gram Negative MDR/XDR Infections.
Busani, Stefano; Roat, Erika; Serafini, Giulia; Mantovani, Elena; Biagioni, Emanuela; Girardis, Massimo
2017-01-01
Patients with septic shock by multidrug resistant microorganisms (MDR) are a specific sepsis population with a high mortality risk. The exposure to an initial inappropriate empiric antibiotic therapy has been considered responsible for the increased mortality, although other factors such as immune-paralysis seem to play a pivotal role. Therefore, beyond conventional early antibiotic therapy and fluid resuscitation, this population may benefit from the use of alternative strategies aimed at supporting the immune system. In this review we present an overview of the relationship between MDR infections and immune response and focus on the rationale and the clinical data available on the possible adjunctive immunotherapies, including blood purification techniques and different pharmacological approaches.
The Role of Adjunctive Therapies in Septic Shock by Gram Negative MDR/XDR Infections
Directory of Open Access Journals (Sweden)
Stefano Busani
2017-01-01
Full Text Available Patients with septic shock by multidrug resistant microorganisms (MDR are a specific sepsis population with a high mortality risk. The exposure to an initial inappropriate empiric antibiotic therapy has been considered responsible for the increased mortality, although other factors such as immune-paralysis seem to play a pivotal role. Therefore, beyond conventional early antibiotic therapy and fluid resuscitation, this population may benefit from the use of alternative strategies aimed at supporting the immune system. In this review we present an overview of the relationship between MDR infections and immune response and focus on the rationale and the clinical data available on the possible adjunctive immunotherapies, including blood purification techniques and different pharmacological approaches.
Energy Technology Data Exchange (ETDEWEB)
Ohkawa, Mayumi [Molecular Cell Biology Laboratory, Graduate School of Pharmaceutical Sciences, Tohoku University, Aoba Aramaki, Aoba-ku, Sendai 980-8578 (Japan); Ohno, Yoshiya [Laboratory of Immunobiology, Department of Pharmacy, School of Pharmacy, Hyogo University of Health Sciences, Kobe-shi, Hyogo 650-8530 (Japan); Masuko, Kazue; Takeuchi, Akiko; Suda, Kentaro; Kubo, Akihiro; Kawahara, Rieko; Okazaki, Shogo [Cell Biology Laboratory, Department of Pharmaceutical Sciences, School of Pharmacy, Kinki University, 4-1 Kowakae 3-chome, Higashiosaka-shi, Osaka 577-8502 (Japan); Tanaka, Toshiyuki [Laboratory of Immunobiology, Department of Pharmacy, School of Pharmacy, Hyogo University of Health Sciences, Kobe-shi, Hyogo 650-8530 (Japan); Saya, Hideyuki [Division of Gene Regulation, Institute for Advanced Medical Research, School of Medicine, Keio University, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8502 (Japan); Seki, Masayuki; Enomoto, Takemi [Molecular Cell Biology Laboratory, Graduate School of Pharmaceutical Sciences, Tohoku University, Aoba Aramaki, Aoba-ku, Sendai 980-8578 (Japan); Yagi, Hideki [Cell Biology Laboratory, Department of Pharmaceutical Sciences, School of Pharmacy, Kinki University, 4-1 Kowakae 3-chome, Higashiosaka-shi, Osaka 577-8502 (Japan); Hashimoto, Yoshiyuki [Tohoku University, Sendai (Japan); Masuko, Takashi, E-mail: masuko@phar.kindai.ac.jp [Cell Biology Laboratory, Department of Pharmaceutical Sciences, School of Pharmacy, Kinki University, 4-1 Kowakae 3-chome, Higashiosaka-shi, Osaka 577-8502 (Japan)
2011-03-25
Highlights: {yields} We established LAT1 amino-acid transporter-disrupted DT40 cells. {yields} LAT1-disrupted cells showed slow growth and lost the oncogenicity. {yields} siRNA and mAb inhibited human tumor growth in vitro and in vivo. {yields} LAT1 is a promising target molecule for cancer therapy. -- Abstract: L-type amino-acid transporter 1 (LAT1) is the first identified light chain of CD98 molecule, disulfide-linked to a heavy chain of CD98. Following cDNA cloning of chicken full-length LAT1, we have constructed targeting vectors for the disruption of chicken LAT1 gene from genomic DNA of chicken LAT1 consisting of 5.4 kb. We established five homozygous LAT1-disrupted (LAT1{sup -/-}) cell clones, derived from a heterozygous LAT1{sup +/-} clone of DT40 chicken B cell line. Reactivity of anti-chicken CD98hc monoclonal antibody (mAb) with LAT1{sup -/-} DT40 cells was markedly decreased compared with that of wild-type DT40 cells. All LAT1{sup -/-} cells were deficient in L-type amino-acid transporting activity, although alternative-splice variant but not full-length mRNA of LAT1 was detected in these cells. LAT1{sup -/-} DT40 clones showed outstandingly slow growth in liquid culture and decreased colony-formation capacity in soft agar compared with wild-type DT40 cells. Cell-cycle analyses indicated that LAT1{sup -/-} DT40 clones have prolonged cell-cycle phases compared with wild-type or LAT1{sup +/-} DT40 cells. Knockdown of human LAT1 by small interfering RNAs resulted in marked in vitro cell-growth inhibition of human cancer cells, and in vivo tumor growth of HeLa cells in athymic mice was significantly inhibited by anti-human LAT1 mAb. All these results indicate essential roles of LAT1 in the cell proliferation and occurrence of malignant phenotypes and that LAT1 is a promising candidate as a molecular target of human cancer therapy.
International Nuclear Information System (INIS)
Ohkawa, Mayumi; Ohno, Yoshiya; Masuko, Kazue; Takeuchi, Akiko; Suda, Kentaro; Kubo, Akihiro; Kawahara, Rieko; Okazaki, Shogo; Tanaka, Toshiyuki; Saya, Hideyuki; Seki, Masayuki; Enomoto, Takemi; Yagi, Hideki; Hashimoto, Yoshiyuki; Masuko, Takashi
2011-01-01
Highlights: → We established LAT1 amino-acid transporter-disrupted DT40 cells. → LAT1-disrupted cells showed slow growth and lost the oncogenicity. → siRNA and mAb inhibited human tumor growth in vitro and in vivo. → LAT1 is a promising target molecule for cancer therapy. -- Abstract: L-type amino-acid transporter 1 (LAT1) is the first identified light chain of CD98 molecule, disulfide-linked to a heavy chain of CD98. Following cDNA cloning of chicken full-length LAT1, we have constructed targeting vectors for the disruption of chicken LAT1 gene from genomic DNA of chicken LAT1 consisting of 5.4 kb. We established five homozygous LAT1-disrupted (LAT1 -/- ) cell clones, derived from a heterozygous LAT1 +/- clone of DT40 chicken B cell line. Reactivity of anti-chicken CD98hc monoclonal antibody (mAb) with LAT1 -/- DT40 cells was markedly decreased compared with that of wild-type DT40 cells. All LAT1 -/- cells were deficient in L-type amino-acid transporting activity, although alternative-splice variant but not full-length mRNA of LAT1 was detected in these cells. LAT1 -/- DT40 clones showed outstandingly slow growth in liquid culture and decreased colony-formation capacity in soft agar compared with wild-type DT40 cells. Cell-cycle analyses indicated that LAT1 -/- DT40 clones have prolonged cell-cycle phases compared with wild-type or LAT1 +/- DT40 cells. Knockdown of human LAT1 by small interfering RNAs resulted in marked in vitro cell-growth inhibition of human cancer cells, and in vivo tumor growth of HeLa cells in athymic mice was significantly inhibited by anti-human LAT1 mAb. All these results indicate essential roles of LAT1 in the cell proliferation and occurrence of malignant phenotypes and that LAT1 is a promising candidate as a molecular target of human cancer therapy.
Schelz, Zsuzsanna; Molnár, Joseph; Fogliano, Vincenzo; Ferracane, Rosalia; Pernice, Rita; Shirataki, Yoshiaki; Motohashi, Noboru
2006-01-01
In earlier experiments, the MDR (multidrug resistance)-reversal activities of Anastasia Black (Russian black sweet pepper) extracts had been analysed. Recently, the most effective MDR reversing extracts and fractions have been separated by HPLC (high-performance liquid chromatography, for carotenoids) and LC-MS-MS (HPLC combined with mass spectrometry, for phenolic compounds) methods. As a result of the analytical studies, the following flavonoids had been identified: feruloyl glucopyranoside, quercetin rhamnopyranoside glucopyranoside, luteolin glucopyranoside arabinopyranoside, apigenin glucopyranoside arabinopyranoside, quercetin rhamnopyranoside, luteolin arabinopyranoside diglucopy-ranoside, hesperidine and luteolin glucuronide. According to the literature, the aglycones of these phenolic compounds exhibit MDR-reversal activity in vitro, and the connection between the phenolic content of Anastasia Black and MDR-reversal action was therefore studied by different analytical methods. The results of this study revealed that the identified flavonoids of Anastasia Black may be only partially responsible for the modulation of the MDR of mouse lymphoma cells. Other lipophilic compounds, most probably carotenoids, present in Russian black sweet pepper may act as inhibitors of MDR reversal.
Directory of Open Access Journals (Sweden)
Anirvan Chatterjee
Full Text Available The identification of multidrug resistant (MDR, extensively and totally drug resistant Mycobacterium tuberculosis (Mtb, in vulnerable sites such as Mumbai, is a grave threat to the control of tuberculosis. The current study aimed at explaining the rapid expression of MDR in Directly Observed Treatment Short Course (DOTS compliant patients, represents the first study comparing global transcriptional profiles of 3 pairs of clinical Mtb isolates, collected longitudinally at initiation and completion of DOTS. While the isolates were drug susceptible (DS at onset and MDR at completion of DOTS, they exhibited identical DNA fingerprints at both points of collection. The whole genome transcriptional analysis was performed using total RNA from H37Rv and 3 locally predominant spoligotypes viz. MANU1, CAS and Beijing, hybridized on MTBv3 (BuG@S microarray, and yielded 36, 98 and 45 differentially expressed genes respectively. Genes encoding transcription factors (sig, rpoB, cell wall biosynthesis (emb genes, protein synthesis (rpl and additional central metabolic pathways (ppdK, pknH, pfkB were found to be down regulated in the MDR isolates as compared to the DS isolate of the same genotype. Up regulation of drug efflux pumps, ABC transporters, trans-membrane proteins and stress response transcriptional factors (whiB in the MDR isolates was observed. The data indicated that Mtb, without specific mutations in drug target genes may persist in the host due to additional mechanisms like drug efflux pumps and lowered rate of metabolism. Furthermore this population of Mtb, which also showed reduced DNA repair activity, would result in selection and stabilization of spontaneous mutations in drug target genes, causing selection of a MDR strain in the presence of drug pressures. Efflux pump such as drrA may play a significant role in increasing fitness of low level drug resistant cells and assist in survival of Mtb till acquisition of drug resistant mutations with
Looking on the bright side of serotonin transporter gene variation.
Homberg, J.R.; Lesch, K.P.
2011-01-01
Converging evidence indicates an association of the short (s), low-expressing variant of the repeat length polymorphism, serotonin transporter-linked polymorphic region (5-HTTLPR), in the human serotonin transporter gene (5-HTT, SERT, SLC6A4) with anxiety-related traits and increased risk for
Cancer chemotherapy: Challenges for the future
International Nuclear Information System (INIS)
Kimura, Kiyoji; Saito, H.; Carter, S.K.; Bast, R.C. Jr
1992-01-01
At this symposium the main topics were new strategies for cancer therapy based on biology and pharmacology. Presentations on the biology of tumor progression and regression covered the molecular basis of cancer suppression by human tumor suppressor genes, mutation of the p53 gene and accumulation of the p53 protein, tumor suppressor genes involved in the pathogenesis of lung cancer, and lessons learned from studies on tumor suppression by chromosome transfer. Many new reports on oncogenes provided the highlights for these chemotherapists present. For cancer therapy based on pharmacology, papers were presented on drug resistance such as P-glycoprotein (p170) multidrug resistance (MDR) transporter limitations on successful therapy for childhood tumors: possible circumvention of MDR by cyclosporin A, regulation of the MDR gene in response to environmental stimuli, and dose-intensive chemotherapies. On the subject of cancer therapy, lung cancer was the focus of attention, and the efficacy of combined modalities was reported and discussed
Lelong-Rebel, Isabelle; Brisson, Christine; Fabre, Michel; Bergerat, Jean-Pierre; Rebel, Gérard
2008-01-01
Two chemosensitive cell lines, LoVo-fusoid (LoVo-f) and LoVo-small cells (LoVo-sc) were derived from the original LoVo cell line. These two variants and the multidrug-resistant (MDR) cell line LoVo-Dox were screened for various properties. In non-permeabilized cells, only LoVo-sc showed mucin-2 staining whereas labelling was positive in all permeabilized cell lines. As shown by electron microscopy screening and by relative resistance to trypsin detachment, only LoVo-sc cells showed strong mucus secretion. All three cell lines displayed strong staining for P-glycoprotein (P-gp), multidrug resistance-associated protein (MRP) and lung-resistance-related protein (LRP) in different locations according to the drug resistance state. The three cell lines showed intracellular labelling of LRP and MRP. The sensitive cells showed P-gp in a large perinuclear ring and in the cytoplasm, but little (LoVo-sc cells) or no staining (LoVo-f cells) was shown at the plasma membrane level. For the Lovo-Dox cells, P-gp was located in the plasma membrane, in cellular anchorages and in the cytoplasm as well. Cell resistance against antineoplastic agents often results from mobilization of various factors, the modulation of which is linked to the culture conditions. As most of the protocols utilize cells growing in (air + 5-10% CO2) atmosphere e.g. 20% O2, balance of the respective participants in the MDR multi-modal mechanism may not be representative of the in vivo situation and may lead to erratic pharmacological response. Indeed, cells within solid tumours were exposed to low pO2, most of them being under hypoxic condition (0.1-5% O2). In the absence of anticancer drugs, all LoVo cell lines grew notably faster at 20% O2 than at 5% O2. Moreover, respective sensitivities of both non-MDR variants to doxorubicin were altered according the pO2. Whatever the pO2 was, virtually none of the antioxidants tested affected the cytotoxic activity of doxorubicin for the three cell lines. By contrast
Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A
2015-11-01
The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.
Directory of Open Access Journals (Sweden)
Yi-Nan Zhang
2017-11-01
Full Text Available Uncariae Ramulus Cum Uncis (URCU is a widely used traditional Chinese medicine, and is reported to have various central nervous system effects. Alkaloids have been demonstrated to be the predominant pharmacological active components of URCU. In order to evaluate the blood-brain barrier (BBB permeability and transport mechanism of six typical indole alkaloids from URCU, the MDCK-pHaMDR cell monolayer model was used as an in vitro surrogate model for BBB. The samples were analyzed by high-performance liquid chromatography, and the apparent permeability coefficients (Papp were calculated. Among the six alkaloids, isorhynchophylline (2, isocorynoxeine (4, hirsutine (5 and hirsuteine (6 showed high permeability, with Papp values at 10−5 cm/s level in bidirectional transport. For rhynchophylline (1 and corynoxeine (3, they showed moderate permeability, with Papp values from the apical (AP side to the basolateral (BL side at 10−6 cm/s level and efflux ratio (Papp BL→AP/Papp AP→BL above 2. The time- and concentration-dependency experiments indicated that the main mechanism for 2, 4, 5 and 6 through BBB was passive diffusion. The efflux mechanism involved in the transports of compounds 1 and 3 could be reduced significantly by verapamil, and molecular docking screening also showed that 1 and 3 had strong bindings to P-glycoprotein. This study provides useful information for predicting the BBB permeability for 1–6, as well as better understanding of their central nervous system pharmacological activities.
Low heritability in pharmacokinetics of talinolol
DEFF Research Database (Denmark)
Matthaei, Johannes; Tzvetkov, Mladen V; Gal, Valerie
2016-01-01
BACKGROUND: Efflux transporters like MDR1 and MRP2 may modulate the pharmacokinetics of about 50 % of all drugs. It is currently unknown how much of the variation in the activities of important drug membrane transporters like MDR1 or MRP2 is determined by genetic or by environmental factors...... of talinolol was predefined as the primary parameter. Heritability was analyzed by structural equation modeling and by within- and between-subject variance and talinolol clearance was correlated with polymorphisms in MDR1, MRP2, BCRP, MDR5, OATP1B1, and OCT1. RESULTS: Talinolol clearance varied approximately...
Gagné, F; Smyth, S A; André, C; Douville, M; Gélinas, M; Barclay, K
2013-03-01
The present study sought to examine the performance of six different wastewater treatment processes from 12 wastewater treatment plants using a toxicogenomic approach in rainbow trout hepatocytes. Freshly prepared rainbow trout hepatocytes were exposed to increasing concentrations of influent (untreated wastewaters) and effluent (C(18)) extracts for 48 h at 15 °C. A test battery of eight genes was selected to track changes in xenobiotic biotransformation, estrogenicity, heavy metal detoxification, and oxidative stress. The wastewaters were processed by six different treatment systems: facultative and aerated lagoons, activated sludge, biological aerated filter, biological nutrient removal, chemically assisted primary treated, and trickling filter/solids contact. Based on the chemical characteristics of the effluents, the treatment plants were generally effective in removing total suspended solids and chemical oxygen demand, but less so for ammonia and alkalinity. The 12 influents differed markedly with each other, which makes the comparison among treatment processes difficult. For the influents, both population size and flow rate influenced the increase in the following mRNA levels in exposed hepatocytes: metallothionein (MT), cytochrome P4503A4 (CYP3A4), and vitellogenin (VTG). Gene expression of glutathione S-transferase (GST) and the estrogen receptor (ER), were influenced only by population size in exposed cells to the influent extracts. The remaining genes-superoxide dismutase (SOD) and multidrug resistance transporter (MDR)-were not influenced by either population size or flow rate in exposed cells. It is noteworthy that the changes in MT, ER, and VTG in cells exposed to the effluents were significantly affected by the influents across the 12 cities examined. However, SOD, CYP1A1, CYP3A4, GST, and MDR gene expression were the least influenced by the incoming influents. The data also suggest that wastewater treatments involving biological or aeration
Gangliosides do not affect ABC transporter function in human neuroblastoma cells
Dijkhuis, Anne-Jan; Klappe, Karin; Kamps, Willem; Sietsma, Hannie; Kok, Jan Willem
Previous studies have indicated a role for glucosylceramide synthase (GCS) in multidrug resistance (MDR), either related to turnover of ceramide (Cer) or generation of gangliosides, which modulate apoptosis and/or the activity of ABC transporters. This study challenges the hypothesis that
Kakinuma, Makoto; Nakamoto, Chika; Kishi, Kazuki; Coury, Daniel A; Amano, Hideomi
2017-07-01
Ammonium and nitrate are the primary nitrogen sources in natural environments, and are essential for growth and development in photosynthetic eukaryotes. In this study, we report on the isolation and characterization of an ammonium transporter gene (PyAMT1) which performs a key function in nitrogen (N) metabolism of Pyropia yezoensis thalli. The predicted length of PyAMT1 was 483 amino acids (AAs). The AA sequence included 11 putative transmembrane domains and showed approximately 33-44% identity to algal and plant AMT1 AA sequences. Functional complementation in an AMT-defective yeast mutant indicated that PyAMT1 mediated ammonium transport across the plasma membrane. Expression analysis showed that the PyAMT1 mRNA level was strongly induced by N-deficiency, and was more highly suppressed by resupply of inorganic-N than organic-N. These results suggest that PyAMT1 plays important roles in the ammonium transport system, and is highly regulated in response to external/internal N-status. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Lavender, Nicole A; Benford, Marnita L; VanCleave, Tiva T; Brock, Guy N; Kittles, Rick A; Moore, Jason H; Hein, David W; Kidd, La Creis R
2009-01-01
Polymorphisms in glutathione S-transferase (GST) genes may influence response to oxidative stress and modify prostate cancer (PCA) susceptibility. These enzymes generally detoxify endogenous and exogenous agents, but also participate in the activation and inactivation of oxidative metabolites that may contribute to PCA development. Genetic variations within selected GST genes may influence PCA risk following exposure to carcinogen compounds found in cigarette smoke and decreased the ability to detoxify them. Thus, we evaluated the effects of polymorphic GSTs (M1, T1, and P1) alone and combined with cigarette smoking on PCA susceptibility. In order to evaluate the effects of GST polymorphisms in relation to PCA risk, we used TaqMan allelic discrimination assays along with a multi-faceted statistical strategy involving conventional and advanced statistical methodologies (e.g., Multifactor Dimensionality Reduction and Interaction Graphs). Genetic profiles collected from 873 men of African-descent (208 cases and 665 controls) were utilized to systematically evaluate the single and joint modifying effects of GSTM1 and GSTT1 gene deletions, GSTP1 105 Val and cigarette smoking on PCA risk. We observed a moderately significant association between risk among men possessing at least one variant GSTP1 105 Val allele (OR = 1.56; 95%CI = 0.95-2.58; p = 0.049), which was confirmed by MDR permutation testing (p = 0.001). We did not observe any significant single gene effects among GSTM1 (OR = 1.08; 95%CI = 0.65-1.82; p = 0.718) and GSTT1 (OR = 1.15; 95%CI = 0.66-2.02; p = 0.622) on PCA risk among all subjects. Although the GSTM1-GSTP1 pairwise combination was selected as the best two factor LR and MDR models (p = 0.01), assessment of the hierarchical entropy graph suggested that the observed synergistic effect was primarily driven by the GSTP1 Val marker. Notably, the GSTM1-GSTP1 axis did not provide additional information gain when compared to either loci alone based on a
Hassim, Shaheen; Shaw, Pamela A.; Sangweni, Phumelele; Malan, Lizette; Ntshani, Ella; Mathibedi, Monkwe Jethro; Stubbs, Nomso; Metcalf, Julia A; Eckes, Risa; Masur, Henry; Komati, Stephanus
2010-01-01
Background Tuberculosis (TB) co-infection with HIV is a substantial problem in South Africa. There has been a presumption that drug resistant strains of TB are common in South Africa, but few studies have documented this impression. Methods In Phidisa, a joint observational and randomized HIV treatment study for South African National Defence Force members and dependents, an initiative obtained microbiologic TB testing in subjects who appeared to be at high risk. We report results for HIV-infected subjects. Results TB was identified by culture in 116/584 (19.9%) of patients selected for sputum examination on the basis of suggestive symptoms. Smear was an insensitive technique for confirming the diagnosis: only 33% of culture-positive patients were identified by smear, with a 0.2% false positive rate. Of the 107 culture-positive individuals with susceptibility testing, 22 (20.6%) were identified to be MDR and 4 (3.7%) became extremely drug resistant tuberculosis (XDR) while under observation. Culture-positive cases with a history of TB treatment had more than twice the rate of MDR than those without, 27.1% vs. 11.9% (p=0.05). Conclusions TB is common in this cohort of HIV-infected patients. Smear was not a sensitive technique for identifying culture-positive cases in this health system. Drug susceptibility testing is essential to proper patient management because MDR was present in 20.6% of culture-positive patients. Better management strategies are needed to reduce the development of MDR-TB since so many such patients had received prior antituberculous therapy that was presumably not curative. PMID:20196651
Ge, Lin-Quan; Jiang, Yi-Ping; Xia, Ting; Song, Qi-Sheng; Stanley, David; Kuai, Peng; Lu, Xiu-Li; Yang, Guo-Qing; Wu, Jin-Cai
2015-07-17
The brown planthopper (BPH), Nilaparvata lugens, sugar transporter gene 6 (Nlst6) is a facilitative glucose/fructose transporter (often called a passive carrier) expressed in midgut that mediates sugar transport from the midgut lumen to hemolymph. The influence of down regulating expression of sugar transporter genes on insect growth, development, and fecundity is unknown. Nonetheless, it is reasonable to suspect that transporter-mediated uptake of dietary sugar is essential to the biology of phloem-feeding insects. Based on this reasoning, we posed the hypothesis that silencing, or reducing expression, of a BPH sugar transporter gene would be deleterious to the insects. To test our hypothesis, we examined the effects of Nlst6 knockdown on BPH biology. Reducing expression of Nlst6 led to profound effects on BPHs. It significantly prolonged the pre-oviposition period, shortened the oviposition period, decreased the number of eggs deposited and reduced body weight, compared to controls. Nlst6 knockdown also significantly decreased fat body and ovarian (particularly vitellogenin) protein content as well as vitellogenin gene expression. Experimental BPHs accumulated less fat body glucose compared to controls. We infer that Nlst6 acts in BPH growth and fecundity, and has potential as a novel target gene for control of phloem-feeding pest insects.
Koley, Dipankar; Bard, Allen J
2012-07-17
Oxidative stress induced in live HeLa cells by menadione (2-methyl-1,4-napthaquinone) was studied in real time by scanning electrochemical microscopy (SECM). The hydrophobic molecule menadione diffuses through a living cell membrane where it is toxic to the cell. However, in the cell it is conjugated with glutathione to form thiodione. Thiodione is then recognized and transported across the cell membrane via the ATP-driven MRP1 pump. In the extracellular environment, thiodione was detected by the SECM tip at levels of 140, 70, and 35 µM upon exposure of the cells to menadione concentrations of 500, 250, and 125 µM, respectively. With the aid of finite element modeling, the kinetics of thiodione transport was determined to be 1.6 10(-7) m/s, about 10 times faster than menadione uptake. Selective inhibition of these MRP1 pumps inside live HeLa cells by MK571 produced a lower thiodione concentration of 50 µM in presence of 500 µM menadione and 50 µM MK571. A similar reduced (50% drop) thiodione efflux was observed in the presence of monoclonal antibody QCRL-4, a selective blocking agent of the MRP1 pumps. The reduced thiodione flux confirmed that thiodione was transported by MRP1, and that glutathione is an essential substrate for MRP1-mediated transport. This finding demonstrates the usefulness of SECM in quantitative studies of MRP1 inhibitors and suggests that monoclonal antibodies can be a useful tool in inhibiting the transport of these MDR pumps, and thereby aiding in overcoming multidrug resistance.
Wei, Xiaoyu; Liu, Fengli; Chen, Cheng; Ma, Fengwang; Li, Mingjun
2014-01-01
In plants, sugar transporters are involved not only in long-distance transport, but also in sugar accumulations in sink cells. To identify members of sugar transporter gene families and to analyze their function in fruit sugar accumulation, we conducted a phylogenetic analysis of the Malus domestica genome. Expression profiling was performed with shoot tips, mature leaves, and developed fruit of "Gala" apple. Genes for sugar alcohol [including 17 sorbitol transporters (SOTs)], sucrose, and monosaccharide transporters, plus SWEET genes, were selected as candidates in 31, 9, 50, and 27 loci, respectively, of the genome. The monosaccharide transporter family appears to include five subfamilies (30 MdHTs, 8 MdEDR6s, 5 MdTMTs, 3 MdvGTs, and 4 MdpGLTs). Phylogenetic analysis of the protein sequences indicated that orthologs exist among Malus, Vitis, and Arabidopsis. Investigations of transcripts revealed that 68 candidate transporters are expressed in apple, albeit to different extents. Here, we discuss their possible roles based on the relationship between their levels of expression and sugar concentrations. The high accumulation of fructose in apple fruit is possibly linked to the coordination and cooperation between MdTMT1/2 and MdEDR6. By contrast, these fruits show low MdSWEET4.1 expression and a high flux of fructose produced from sorbitol. Our study provides an exhaustive survey of sugar transporter genes and demonstrates that sugar transporter gene families in M. domestica are comparable to those in other species. Expression profiling of these transporters will likely contribute to improving our understanding of their physiological functions in fruit formation and the development of sweetness properties.
Directory of Open Access Journals (Sweden)
Xiaoyu eWei
2014-11-01
Full Text Available In plants, sugar transporters are involved not only in long-distance transport, but also in sugar accumulations in sink cells. To identify members of sugar transporter gene families and to analyze their function in fruit sugar accumulation, we conducted a phylogenetic analysis of the Malus domestica genome. Expression profiling was performed with shoot tips, mature leaves, and developed fruit of ‘Gala’ apple. Genes for sugar alcohol (including 17 sorbitol transporters, sucrose, and monosaccharide transporters, plus SWEET genes, were selected as candidates in 31, 9, 50, and 27 loci, respectively, of the genome. The monosaccharide transporter family appears to include five subfamilies (30 MdHTs, 8 MdEDR6s, 5 MdTMTs, 3 MdvGTs, and 4 MdpGLTs. Phylogenetic analysis of the protein sequences indicated that orthologs exist among Malus, Vitis, and Arabidopsis. Investigations of transcripts revealed that 68 candidate transporters are expressed in apple, albeit to different extents. Here, we discuss their possible roles based on the relationship between their levels of expression and sugar concentrations. The high accumulation of fructose in apple fruit is possibly linked to the coordination and cooperation between MdTMT1/2 and MdEDR6. By contrast, these fruits show low MdSWEET4.1 expression and a high flux of fructose produced from sorbitol. Our study provides an exhaustive survey of sugar transporter genes and demonstrates that sugar transporter gene families in M. domestica are comparable to those in other species. Expression profiling of these transporters will likely contribute to improving our understanding of their physiological functions in fruit formation and the development of sweetness properties.
Regulation of multidrug resistance by microRNAs in anti-cancer therapy
Directory of Open Access Journals (Sweden)
Xin An
2017-01-01
Full Text Available Multidrug resistance (MDR remains a major clinical obstacle to successful cancer treatment. Although diverse mechanisms of MDR have been well elucidated, such as dysregulation of drugs transporters, defects of apoptosis and autophagy machinery, alterations of drug metabolism and drug targets, disrupti on of redox homeostasis, the exact mechanisms of MDR in a specific cancer patient and the cross-talk among these different mechanisms and how they are regulated are poorly understood. MicroRNAs (miRNAs are a new class of small noncoding RNAs that could control the global activity of the cell by post-transcriptionally regulating a large variety of target genes and proteins expression. Accumulating evidence shows that miRNAs play a key regulatory role in MDR through modulating various drug resistant mechanisms mentioned above, thereby holding much promise for developing novel and more effective individualized therapies for cancer treatment. This review summarizes the various MDR mechanisms and mainly focuses on the role of miRNAs in regulating MDR in cancer treatment.
Li, James J.; Lee, Steve S.
2012-01-01
Background: Although the association of the dopamine transporter (DAT1) gene and attention-deficit/hyperactivity disorder (ADHD) has been widely studied, far less is known about its potential interaction with environmental risk factors. Given that maltreatment is a replicated risk factor for ADHD, we explored the interaction between DAT1 and…
Genome-wide identification of KANADI1 target genes.
Directory of Open Access Journals (Sweden)
Paz Merelo
Full Text Available Plant organ development and polarity establishment is mediated by the action of several transcription factors. Among these, the KANADI (KAN subclade of the GARP protein family plays important roles in polarity-associated processes during embryo, shoot and root patterning. In this study, we have identified a set of potential direct target genes of KAN1 through a combination of chromatin immunoprecipitation/DNA sequencing (ChIP-Seq and genome-wide transcriptional profiling using tiling arrays. Target genes are over-represented for genes involved in the regulation of organ development as well as in the response to auxin. KAN1 affects directly the expression of several genes previously shown to be important in the establishment of polarity during lateral organ and vascular tissue development. We also show that KAN1 controls through its target genes auxin effects on organ development at different levels: transport and its regulation, and signaling. In addition, KAN1 regulates genes involved in the response to abscisic acid, jasmonic acid, brassinosteroids, ethylene, cytokinins and gibberellins. The role of KAN1 in organ polarity is antagonized by HD-ZIPIII transcription factors, including REVOLUTA (REV. A comparison of their target genes reveals that the REV/KAN1 module acts in organ patterning through opposite regulation of shared targets. Evidence of mutual repression between closely related family members is also shown.
ToxCast chemicals were assessed for induction or suppression of xenobiotic metabolizing enzyme and transporter gene expression using primary human hepatocytes. The mRNA levels of 14 target and 2 control genes were measured: ABCB1, ABCB11, ABCG2, SLCO1B1, CYP1A1, CYP1A2, CYP2B6, C...
Aging alters mRNA expression of amyloid transporter genes at the blood-brain barrier.
Osgood, Doreen; Miller, Miles C; Messier, Arthur A; Gonzalez, Liliana; Silverberg, Gerald D
2017-09-01
Decreased clearance of potentially toxic metabolites, due to aging changes, likely plays a significant role in the accumulation of amyloid-beta (Aβ) peptides and other macromolecules in the brain of the elderly and in the patients with Alzheimer's disease (AD). Aging is the single most important risk factor for AD development. Aβ transport receptor proteins expressed at the blood-brain barrier are significantly altered with age: the efflux transporters lipoprotein receptor-related protein 1 and P-glycoprotein are reduced, whereas the influx transporter receptor for advanced glycation end products is increased. These receptors play an important role in maintaining brain biochemical homeostasis. We now report that, in a rat model of aging, gene transcription is altered in aging, as measured by Aβ receptor gene messenger RNA (mRNA) at 3, 6, 9, 12, 15, 20, 30, and 36 months. Gene mRNA expression from isolated cerebral microvessels was measured by quantitative polymerase chain reaction. Lipoprotein receptor-related protein 1 and P-glycoprotein mRNA were significantly reduced in aging, and receptor for advanced glycation end products was increased, in parallel with the changes seen in receptor protein expression. Transcriptional changes appear to play a role in aging alterations in blood-brain barrier receptor expression and Aβ accumulation. Copyright © 2017 Elsevier Inc. All rights reserved.
Increased p38-MAPK is responsible for chemotherapy resistance in human gastric cancer cells
International Nuclear Information System (INIS)
Guo, Xianling; Zhang, Baihe; Wu, Mengchao; Wei, Lixin; Ma, Nannan; Wang, Jin; Song, Jianrui; Bu, Xinxin; Cheng, Yue; Sun, Kai; Xiong, Haiyan; Jiang, Guocheng
2008-01-01
Chemoresistance is one of the main obstacles to successful cancer therapy and is frequently associated with Multidrug resistance (MDR). Many different mechanisms have been suggested to explain the development of an MDR phenotype in cancer cells. One of the most studied mechanisms is the overexpression of P-glycoprotein (P-gp), which is a product of the MDR1 gene. Tumor cells often acquire the drug-resistance phenotype due to upregulation of the MDR1 gene. Overexpression of MDR1 gene has often been reported in primary gastric adenocarcinoma. This study investigated the role of p38-MAPK signal pathway in vincristine-resistant SGC7901/VCR cells. P-gp and MDR1 RNA were detected by Western blot analysis and RT-PCR amplification. Mitgen-activated protein kinases and function of P-gp were demonstrated by Western blot and FACS Aria cytometer analysis. Ap-1 activity and cell apoptosis were detected by Dual-Luciferase Reporter Assay and annexin V-PI dual staining. The vincristine-resistant SGC7901/VCR cells with increased expression of the multidrug-resistance 1 (MDR1) gene were resistant to P-gp-related drug and P-gp-unrelated drugs. Constitutive increases of phosphorylated p38-MAPK and AP-1 activities were also found in the drug-resistant cells. Inhibition of p38-MAPK by SB202190 reduced activator protein-1 (AP-1) activity and MDR1 expression levels and increased the sensitivity of SGC7901/VCR cells to chemotherapy. Activation of the p38-MAPK pathway might be responsible for the modulation of P-glycoprotein-mediated and P-glycoprotein-unmediated multidrug resistance in the SGC7901/VCR cell line
DEFF Research Database (Denmark)
Kopp, Tine Iskov; Andersen, Vibeke; Tjonneland, Anne
2015-01-01
to assess whether polymorphisms in ABCB1, ABCC2 and ABCG2 were associated with risk of colorectal cancer (CRC) and to investigate gene-environment (dietary factors, smoking and use of non-steroidal anti-inflammatory drugs) and gene-gene interactions between previously studied polymorphisms in IL1B and IL10......The ATP-binding cassette (ABC) transporter family transports various molecules across the enterocytes in the gut protecting the intestine against potentially harmful substances. Moreover, ABC transporters are involved in mucosal immune defence through interaction with cytokines. The study aimed...... of the polymorphisms were associated with CRC, but ABCB1 and ABCG2 haplotypes were associated with risk of CRC. ABCB1/rs1045642 interacted with intake of cereals and fiber (p-Value for interaction (Pint) = 0.001 and 0.01, respectively). In a three-way analysis, both ABCB1/rs1045642 and ABCG2/rs2231137 in combination...
Institute of Scientific and Technical Information of China (English)
Zhi Li; Chunping Liu; Yanli He; Jinghui Zhang; Tao Huang
2008-01-01
Objective:To approach the expressions of MDR1 and BCRP in breast cancer stem cells and differentiated cells.Methods:The breast cancer stem calls were separated from human breast cancer primary tissues and MCF-7 by flow cytometry.Then we measured the expressions of MDR1 and BCRP with different subset cells by Realtime-PCR.Results:Contrasted with breast cancer differentiated cells,the expressions of MDR1 and BCRP in breast cancer stem calls were higher (P<0.01),and the proportion of stem cells rose after chemotherapy (P<0.01).Conclusion:Contrasted with breast cancer differentiated cells,breast cancer stem cells have stronger ability of clrug-resistanca with higher level of multi-drug resistance genes,and it is one of key points for chemotherapy failure of breast cancer.
Yu, Xi-Yong; Lin, Shu-Guang; Chen, Xiao; Zhou, Zhi-Wei; Liang, Jun; Duan, Wei; Chowbay, Balram; Wen, Jing-Yuan; Chan, Eli; Cao, Jie; Li, Chun-Guang; Zhou, Shu-Feng
2007-05-01
Cryptotanshinone (CTS), a major constituent from the roots of Salvia miltiorrhiza (Danshen), is widely used in the treatment of coronary heart disease, stroke and less commonly Alzheimer's disease. Our recent study indicates that CTS is a substrate for P-glycoprotein (PgP/MDR1/ABCB1). This study has investigated the nature of the brain distribution of CTS across the brain-blood barrier (BBB) using several in vitro and in vivo rodent models. A polarized transport of CTS was found in rat primary microvascular endothelial cell (RBMVEC) monolayers, with facilitated efflux from the abluminal side to luminal side. Addition of a PgP (e.g. verapamil and quinidine) or multi-drug resistance protein 1/2 (MRP1/2) inhibitor (e.g. probenecid and MK-571) in both luminal and abluminal sides attenuated the polarized transport. In a bilateral in situ brain perfusion model, the uptake of CTS into the cerebrum increased from 0.52 +/- 0.1% at 1 min to 11.13 +/- 2.36 ml/100 g tissue at 30 min and was significantly greater than that of sucrose. Co-perfusion of a PgP/MDR1 (e.g. verapamil) or MRP1/2 inhibitor (e.g. probenecid) significantly increased the brain distribution of CTS by 35.1-163.6%. The brain levels of CTS were only about 21% of those in plasma, and were significantly increased when coadministered with verapamil or probenecid in rats. The brain levels of CTS in rats subjected to middle cerebral artery occlusion and rats treated with quinolinic acid (a neurotoxin) were about 2- to 2.5-fold higher than the control rats. Moreover, the brain levels in mdr1a(-/-) and mrp1(-/-) mice were 10.9- and 1.5-fold higher than those in the wild-type mice, respectively. Taken collectively, these findings indicate that PgP and Mrp1 limit the brain penetration of CTS in rodents, suggesting a possible role of PgP and MRP1 in limiting the brain penetration of CTS in patients and causing drug resistance to Danshen therapy and interactions with conventional drugs that are substrates of PgP and MRP1
A Nostoc punctiforme Sugar Transporter Necessary to Establish a Cyanobacterium-Plant Symbiosis1[C][W
Ekman, Martin; Picossi, Silvia; Campbell, Elsie L.; Meeks, John C.; Flores, Enrique
2013-01-01
In cyanobacteria-plant symbioses, the symbiotic nitrogen-fixing cyanobacterium has low photosynthetic activity and is supplemented by sugars provided by the plant partner. Which sugars and cyanobacterial sugar uptake mechanism(s) are involved in the symbiosis, however, is unknown. Mutants of the symbiotically competent, facultatively heterotrophic cyanobacterium Nostoc punctiforme were constructed bearing a neomycin resistance gene cassette replacing genes in a putative sugar transport gene cluster. Results of transport activity assays using 14C-labeled fructose and glucose and tests of heterotrophic growth with these sugars enabled the identification of an ATP-binding cassette-type transporter for fructose (Frt), a major facilitator permease for glucose (GlcP), and a porin needed for the optimal uptake of both fructose and glucose. Analysis of green fluorescent protein fluorescence in strains of N. punctiforme bearing frt::gfp fusions showed high expression in vegetative cells and akinetes, variable expression in hormogonia, and no expression in heterocysts. The symbiotic efficiency of N. punctiforme sugar transport mutants was investigated by testing their ability to infect a nonvascular plant partner, the hornwort Anthoceros punctatus. Strains that were specifically unable to transport glucose did not infect the plant. These results imply a role for GlcP in establishing symbiosis under the conditions used in this work. PMID:23463784
P-glycoprotein activity and biological response
International Nuclear Information System (INIS)
Vaalburg, W.; Hendrikse, N.H.; Elsinga, P.H.; Bart, J.; Waarde, A. van
2005-01-01
P-glycoprotein (P-gp) is a transmembrane drug efflux pump encoded by the MDR-1 gene in humans. Most likely P-gp protects organs against endogenous and exogenous toxins by extruding toxic compounds such as chemotherapeutics and other drugs. Many drugs are substrates for P-gp. Since P-gp is also expressed in the blood-brain barrier, P-gp substrates reach lower concentrations in the brain than in P-gp-negative tissues. Failure of response to chemotherapy of malignancies can be due to intrinsic or acquired drug resistance. Many tumors are multidrug resistant (MDR); resistant to several structurally unrelated chemotherapeutic agents. Several mechanisms are involved in MDR of which P-gp is studied most extensively. P-gp extrudes drugs out of tumor cells resulting in decreased intracellular drug concentrations, leading to the MDR phenotype. Furthermore, the MDR-1 gene exhibits several single nucleotide polymorphisms, some of which result in different transport capabilities. P-gp functionality and the effect of P-gp modulation on the pharmacokinetics of novel and established drugs can be studied in vivo by positron emission tomography (PET) using carbon-11 and fluorine-18-labeled P-gp substrates and modulators. PET may demonstrate the consequences of genetic differences on tissue pharmacokinetics. Inhibitors such as calcium-channel blockers (verapamil), cyclosporin A, ONT-093, and XR9576 can modulate the P-gp functionality. With PET the effect of P-gp modulation on the bioavailability of drugs can be investigated in humans in vivo. PET also allows the measurement of the efficacy of newly developed P-gp modulators
Directory of Open Access Journals (Sweden)
Rasmus Torbensen
Full Text Available Amino acids can induce yeast cell adhesion but how amino acids are sensed and signal the modulation of the FLO adhesion genes is not clear. We discovered that the budding yeast Saccharomyces cerevisiae CEN.PK evolved invasive growth ability under prolonged nitrogen limitation. Such invasive mutants were used to identify amino acid transporters as regulators of FLO11 and invasive growth. One invasive mutant had elevated levels of FLO11 mRNA and a Q320STOP mutation in the SFL1 gene that encodes a protein kinase A pathway regulated repressor of FLO11. Glutamine-transporter genes DIP5 and GNP1 were essential for FLO11 expression, invasive growth and biofilm formation in this mutant. Invasive growth relied on known regulators of FLO11 and the Ssy1-Ptr3-Ssy5 complex that controls DIP5 and GNP1, suggesting that Dip5 and Gnp1 operates downstream of the Ssy1-Ptr3-Ssy5 complex for regulation of FLO11 expression in a protein kinase A dependent manner. The role of Dip5 and Gnp1 appears to be conserved in the S. cerevisiae strain ∑1278b since the dip5 gnp1 ∑1278b mutant showed no invasive phenotype. Secondly, the amino acid transporter gene GAP1 was found to influence invasive growth through FLO11 as well as other FLO genes. Cells carrying a dominant loss-of-function PTR3(647::CWNKNPLSSIN allele had increased transcription of the adhesion genes FLO1, 5, 9, 10, 11 and the amino acid transporter gene GAP1. Deletion of GAP1 caused loss of FLO11 expression and invasive growth. However, deletions of FLO11 and genes encoding components of the mitogen-activated protein kinase pathway or the protein kinase A pathway were not sufficient to abolish invasive growth, suggesting involvement of other FLO genes and alternative pathways. Increased intracellular amino acid pools in the PTR3(647::CWNKNPLSSIN-containing strain opens the possibility that Gap1 regulates the FLO genes through alteration of the amino acid pool sizes.
Muñoz-Martínez, Francisco; Lu, Peihua; Cortés-Selva, Fernando; Pérez-Victoria, José María; Jiménez, Ignacio A; Ravelo, Angel G; Sharom, Frances J; Gamarro, Francisco; Castanys, Santiago
2004-10-01
Overexpression of ABCB1 (MDR1) P-glycoprotein, a multidrug efflux pump, is one mechanism by which tumor cells may develop multidrug resistance (MDR), preventing the successful chemotherapeutic treatment of cancer. Sesquiterpenes from Celastraceae family are natural compounds shown previously to reverse MDR in several human cancer cell lines and Leishmania strains. However, their molecular mechanism of reversion has not been characterized. In the present work, we have studied the ability of 28 dihydro-beta-agarofuran sesquiterpenes to reverse the P-glycoprotein-dependent MDR phenotype and elucidated their molecular mechanism of action. Cytotoxicity assays using human MDR1-transfected NIH-3T3 cells allowed us to select the most potent sesquiterpenes reversing the in vitro resistance to daunomycin and vinblastine. Flow cytometry experiments showed that the above active compounds specifically inhibited drug transport activity of P-glycoprotein in a saturable, concentration-dependent manner (K(i) down to 0.24 +/- 0.01 micromol/L) but not that of ABCC1 (multidrug resistance protein 1; MRP1), ABCC2 (MRP2), and ABCG2 (breast cancer resistance protein; BCRP) transporters. Moreover, sesquiterpenes inhibited at submicromolar concentrations the P-glycoprotein-mediated transport of [(3)H]colchicine and tetramethylrosamine in plasma membrane from CH(R)B30 cells and P-glycoprotein-enriched proteoliposomes, supporting that P-glycoprotein is their molecular target. Photoaffinity labeling in plasma membrane and fluorescence spectroscopy experiments with purified protein suggested that sesquiterpenes interact with transmembrane domains of P-glycoprotein. Finally, sesquiterpenes modulated P-glycoprotein ATPase-activity in a biphasic, concentration-dependent manner: they stimulated at very low concentrations but inhibited ATPase activity as noncompetitive inhibitors at higher concentrations. Sesquiterpenes from Celastraceae are promising P-glycoprotein modulators with potential
Namgoong, Suhg; Cheong, Hyun Sub; Kim, Ji On; Kim, Lyoung Hyo; Na, Han Sung; Koh, In Song; Chung, Myeon Woo; Shin, Hyoung Doo
2015-11-01
Organic anion-transporting polypeptide (OATP; gene symbol, SLCO) transporters are generally involved in the uptake of multiple drugs and their metabolites at most epithelial barriers. The pattern of single-nucleotide polymorphisms (SNPs) in these transporters may be determinants of interindividual variability in drug disposition and response. The objective of this study was to define the distribution of SNPs of three SLCO genes, SLCO1B1, SLCO1B3, and SLCO2B1, in a Korean population and other ethnic groups. The study was screened using the Illumina GoldenGate assay for genomic DNA from 450 interethnic subjects, including 11 pharmacogenetic core variants and 76 HapMap tagging SNPs. The genotype distribution of the Korean population was similar to East Asian populations, but significantly different from African American and European American cohorts. These interethnic differences will be useful information for prospective studies, including genetic association and pharmacogenetic studies of drug metabolism by SLCO families. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Sughondhabirom Atapol
2007-10-01
Full Text Available Abstract Background GABA transporter-1 (GAT-1; genetic locus SLC6A1 is emerging as a novel target for treatment of neuropsychiatric disorders. To understand how population differences might influence strategies for pharmacogenetic studies, we identified patterns of genetic variation and linkage disequilibrium (LD in SLC6A1 in five populations representing three continental groups. Results We resequenced 12.4 kb of SLC6A1, including the promoters, exons and flanking intronic regions in African-American, Thai, Hmong, Finnish, and European-American subjects (total n = 40. LD in SLC6A1 was examined by genotyping 16 SNPs in larger samples. Sixty-three variants were identified through resequencing. Common population-specific variants were found in African-Americans, including a novel 21-bp promoter region variable number tandem repeat (VNTR, but no such variants were found in any of the other populations studied. Low levels of LD and the absence of major LD blocks were characteristic of all five populations. African-Americans had the highest genetic diversity. European-Americans and Finns did not differ in genetic diversity or LD patterns. Although the Hmong had the highest level of LD, our results suggest that a strategy based on the use of tag SNPs would not translate to a major improvement in genotyping efficiency. Conclusion Owing to the low level of LD and presence of recombination hotspots, SLC6A1 may be an example of a problematic gene for association and haplotype tagging-based genetic studies. The 21-bp promoter region VNTR polymorphism is a putatively functional candidate allele for studies focusing on variation in GAT-1 function in the African-American population.
Tournier, Nicolas; Declèves, Xavier; Saubaméa, Bruno; Scherrmann, Jean-Michel; Cisternino, Salvatore
2011-01-01
Some of the ATP-binding cassette (ABC) transporters like P-glycoprotein (P-gp; ABCB1, MDR1), BCRP (ABCG2) and MRPs (ABCCs) that are present at the blood-brain barrier (BBB) influence the brain pharmacokinetics (PK) of their substrates by restricting their uptake or enhancing their clearance from the brain into the blood, which has consequences for their CNS pharmacodynamics (PD). Opioid drugs have been invaluable tools for understanding the PK-PD relationships of these ABC-transporters. The effects of morphine, methadone and loperamide on the CNS are modulated by P-gp. This review examines the ways in which other opioid drugs and some of their active metabolites interact with ABC transporters and suggests new mechanisms that may be involved in the variability of the response of the CNS to these drugs like carrier-mediated system belonging to the solute carrier (SLC) superfamily. Exposure to opioids may also alter the expression of ABC transporters. P-gp can be overproduced during morphine treatment, suggesting that the drug has a direct or, more likely, an indirect action. Variations in cerebral neurotransmitters during exposure to opioids and the release of cytokines during pain could be new endogenous stimuli affecting transporter synthesis. This review concludes with an analysis of the pharmacotherapeutic and clinical impacts of the interactions between ABC transporters and opioids.
Directory of Open Access Journals (Sweden)
Monali P. Mishra
2017-01-01
Full Text Available Urinary tract infection (UTI has become a more grievous problem today, due to multidrug resistance of infecting Gram-positive (GP and Gram-negative (GN bacteria, sometimes even with multiple infections. This study examines effectivity of 9 tropical flowering plants (Anogeissus acuminata, Azadirachta indica, Bauhinia variegata, Boerhaavia diffusa, Punica granatum, Soymida febrifuga, Terminalia chebula, Tinospora cordifolia and Tribulus terrestris for possible use as source of antimicrobials for multidrug resistant (MDR bacteria, along with main-stream antibiotics. Pathogenic bacteria were isolated from urine samples of patients attending and admitted in the hospital. Antibiograms of 11 isolated bacteria (GPs, Enterococcus faecalis and Staphylococcus aureus; and GNs, Acinetobacter baumannii, Citrobacter freundii, Enterobacter aerogenes, Escherichia coli, Klebsiella oxytoca, Klebsiella pneumoniae, Proteus mirabilis, Proteus vulgaris and Pseudomonas aeruginosa were ascertained by the disc-diffusion method, and antibacterial effectivity of plant extracts was monitored by the agar-well diffusion method. Isolated bacteria were floridly MDR to most antibiotics of the day. Methanol extracts of 9 plants were used, and extracts of 3 plants, A. acuminata, P. granatum and S. febrifuga at least caused 25–29 mm as the maximum size of zone of inhibition on bacterial lawns. Minimum inhibitory concentration (MIC and minimum bactericidal concentration (MBC values of methanol extracts of 9 plants were recorded. The methanol extract of A. acuminata had 0.29 mg/ml as the lowest MIC value and 0.67 mg/ml as the lowest MBC value, against MDR S. aureus, signifying effectivity; but, it had the highest MIC value of 3.41 mg/ml. and the highest MBC value of 4.27 mg/ml for most other MDR bacteria including E. coli. Qualitative phytochemical analysis was done for these 9 plants and information on leading phytochemicals was presented retrieved from PubChem database. Thus
Yuniati, Yuniati; Hasanah, Nurul; Ismail, Sjarif; Anitasari, Silvia; Paramita, Swandari
2018-01-01
Staphylococcus aureus , methicillin-resistant and Escherichia coli , multidrug-resistant included in the list of antibiotic-resistant priority pathogens from WHO. As multidrug-resistant bacteria problem is increasing, it is necessary to probe new sources for identifying antimicrobial compounds. Medicinal plants represent a rich source of antimicrobial agents. One of the potential plants for further examined as antibacterial is Dracontomelon dao (Blanco) Merr. & Rolfe. The present study designed to find the antibacterial activity of D. dao stem bark extracts on Methicillin-resistant S. aureus (MRSA) and E. coli Multiple Drug Resistance (MDR), followed by determined secondary metabolites with antibacterial activity and determined the value of MIC (minimum inhibitory concentration) and MBC (minimum bactericidal concentration). D. dao stem bark extracted using 60% ethanol. Disc diffusion test methods used to find the antibacterial activity, following by microdilution methods to find the value of MIC and MBC. Secondary metabolites with antibacterial activity determined by bioautography using TLC (thin layer chromatography) methods. D. dao stem bark extracts are sensitive to MSSA, MRSA and E.coli MDR bacteria. The inhibition zone is 16.0 mm in MSSA, 11.7 mm in MRSA and 10.7 mm in E. coli MDR. The entire MBC/MIC ratios for MSSA, MRSA and E.coli MDR is lower than 4. The ratio showed bactericidal effects of D. dao stem bark extracts. In TLC results, colorless bands found to be secondary metabolites with antibacterial activity. D. dao stem bark extracts are potential to develop as antibacterial agent especially against MRSA and E. coli MDR strain.
Chu, Chishih; Wei, Yajiun; Chuang, Shih-Te; Yu, Changyou; Changchien, Chih-Hsuan; Su, Yaochi
2013-03-01
A total of 117 mastitis-associated Staphylococcus aureus isolates from cow, goat, and human patients were analyzed for differences in antibiotic susceptibility, virulence genes, and genotypes using accessory gene regulator (agr) typing, pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Multidrug-resistant (MDR) S. aureus were commonly found in all sources, though they were predominantly found in human and goat isolates. Almost 70% of the isolates were resistant to ampicillin and penicillin. Host-associated virulence genes were identified as follows: tst, a gene encoding toxic shock syndrome toxin, was found in goat isolates; lukED and lukM, genes encoding leukocidin, found in cow isolates; lukPV, a gene encoding leukocidin, found in human isolates; and eta, a gene encoding for exfoliative toxin, found in both human and cow isolates. All four types of hemolysin, α, β, γ, and δ, were identified in human isolates, three types (α, γ, and δ), were identified in cow isolates, and two types (α and δ) were identified in goat isolates. Agr-typing determined agr1 to be the main subtype in human and cow isolates. PFGE and MLST analysis revealed the presence of diverse genotypes among the three sources. In conclusion, mastitis-associated, genetically diverse strains of MDR S. aureus differed in virulence genes among human, cow, and goat isolates.
Zhu, Y. G.
2015-12-01
In addition to material and energy flows, the dynamics and functions of the Earth's critical zone are intensively mediated by biological actions performed by diverse organisms. These biological actions are modulated by the expression of functional genes and their translation into enzymes that catalyze geochemical reactions, such as nutrient turnover and pollutant biodegradation. Although geobiology, as an interdisciplinary research area, is playing and vital role in linking biological and geochemical processes at different temporal and spatial scales, the distribution and transport of functional genes have rarely been investigated from the Earth's critical zone perspectives. To illustrate the framework of studies on the transport and transformation of genetic information in the critical zone, antibiotic resistance is taken as an example. Antibiotic resistance genes are considered as a group of emerging contaminants, and their emergence and spread within the critical zone on one hand are induced by anthropogenic activities, and on other hand are threatening human health worldwide. The transport and transformation of antibiotic resistance genes are controlled by both horizontal gene transfer between bacterial cells and the movement of bacteria harboring antibiotic resistance genes. In this paper, the fate and behavior of antibiotic resistance genes will be discussed in the following aspects: 1) general overview of environmental antibiotic resistance; 2) high through quantification of the resistome in various environmental media; 3) pathways of resistance gene flow within the critical zone; and 4) potential strategies in mitigating antibiotic resistance, particularly from the critical zone perspectives.
Kappus, Mojdeh S; Murphy, Andrew J; Abramowicz, Sandra; Ntonga, Vusisizwe; Welch, Carrie L; Tall, Alan R; Westerterp, Marit
2014-02-01
Liver X receptor (LXR) activators decrease atherosclerosis in mice. LXR activators (1) directly upregulate genes involved in reverse cholesterol transport and (2) exert anti-inflammatory effects mediated by transrepression of nuclear factor-κB target genes. We investigated whether myeloid cell deficiency of ATP-binding cassette transporters A1 and G1 (ABCA1/G1), principal targets of LXR that promote macrophage cholesterol efflux and initiate reverse cholesterol transport, would abolish the beneficial effects of LXR activation on atherosclerosis. LXR activator T0901317 substantially reduced inflammatory gene expression in macrophages lacking ABCA1/G1. Ldlr(-/-) mice were transplanted with Abca1(-/-)Abcg1(-/-) or wild-type bone marrow (BM) and fed a Western-type diet for 6 weeks with or without T0901317 supplementation. Abca1/g1 BM deficiency increased atherosclerotic lesion complexity and inflammatory cell infiltration into the adventitia and myocardium. T0901317 markedly decreased lesion area, complexity, and inflammatory cell infiltration in the Abca1(-/-)Abcg1(-/-) BM-transplanted mice. To investigate whether this was because of macrophage Abca1/g1 deficiency, Ldlr(-/-) mice were transplanted with LysmCreAbca1(fl/fl)Abcg1(fl/fl) or Abca1(fl/fl)Abcg1(fl/fl) BM and fed Western-type diet with or without the more specific LXR agonist GW3965 for 12 weeks. GW3965 decreased lesion size in both groups, and the decrease was more prominent in the LysmCreAbca1(fl/fl)Abcg1(fl/fl) group. The results suggest that anti-inflammatory effects of LXR activators are of key importance to their antiatherosclerotic effects in vivo independent of cholesterol efflux pathways mediated by macrophage ABCA1/G1. This has implications for the development of LXR activators that lack adverse effects on lipogenic genes while maintaining the ability to transrepress inflammatory genes.
Directory of Open Access Journals (Sweden)
Yung-Kuo Lee
Full Text Available Multidrug resistance (MDR, an unfavorable factor compromising the treatment efficacy of anticancer drugs, involves the upregulation of ATP binding cassette (ABC transporters and induction of galectin-3 signaling. Galectin-3 plays an anti-apoptotic role in many cancer cells and regulates various pathways to activate MDR. Thus, the inhibition of galectin-3 has the potential to enhance the efficacy of the anticancer drug epirubicin. In this study, we examined the effects and mechanisms of silencing galectin-3 via RNA interference (RNAi on the β-catenin/GSK-3β pathway in human colon adenocarcinoma Caco-2 cells. Galectin-3 knockdown increased the intracellular accumulation of epirubicin in Caco-2 cells; suppressed the mRNA expression of galectin-3, β-catenin, cyclin D1, c-myc, P-glycoprotein (P-gp, MDR-associated protein (MRP 1, and MRP2; and downregulated the protein expression of P-gp, cyclin D1, galectin-3, β-catenin, c-Myc, and Bcl-2. Moreover, galectin-3 RNAi treatment significantly increased the mRNA level of GSK-3β, Bax, caspase-3, and caspase-9; remarkably increased the Bax-to-Bcl-2 ratio; and upregulated the GSK-3β and Bax protein expressions. Apoptosis was induced by galectin-3 RNAi and/or epirubicin as demonstrated by chromatin condensation, a higher sub-G1 phase proportion, and increased caspase-3 and caspase-9 activity, indicating an intrinsic/mitochondrial apoptosis pathway. Epirubicin-mediated resistance was effectively inhibited via galectin-3 RNAi treatment. However, these phenomena could be rescued after galectin-3 overexpression. We show for the first time that the silencing of galectin-3 sensitizes MDR cells to epirubicin by inhibiting ABC transporters and activating the mitochondrial pathway of apoptosis through modulation of the β-catenin/GSK-3β pathway in human colon cancer cells.
Ortiz, Diana; Valdés, Raquel; Sanchez, Marco A.; Hayenga, Johanna; Elya, Carolyn; Detke, Siegfried; Landfear, Scott M.
2010-01-01
Leishmania and other parasitic protozoa are unable to synthesize purines de novo and are reliant upon purine nucleoside and nucleobase transporters to import preformed purines from their hosts. To study the roles of the four purine permeases NT1-NT4 in Leishmania major, null mutants in each transporter gene were prepared and the effect of each gene deletion on purine uptake was monitored. Deletion of the NT3 purine nucleobase transporter gene or both NT3 and the NT2 nucleoside transporter gen...
Dong, X Y; Wang, Y M; Yuan, C; Zou, X T
2012-08-01
To better understand the digestive capacity in domestic pigeons (Columba livia), this study was conducted to evaluate nutrient transporters and digestive enzymes gene expression in small intestine and yolk sac membrane (YSM) during pre- and posthatch development. We investigated the oligopeptide transporter Pept1, sodium glucose transporter SGLT1, glucose transporter GLUT2, aminopeptidase-N (APN), and sucrase-isomaltase (SI). Intestine was collected at embryo d 12, 14, and 16, day of hatch, and d 1, 3, 5, 8, and 14 posthatch. The YSM was collected at embryo d 12, 14, 16, and day of hatch. The cDNA fragments for Pept1, SGLT1, GLUT2, APN, and SI were isolated and cloned using reverse-transcription PCR. The sequences data showed that these genes were highly identical to the gene of chicken. The mRNA expression of each gene was assayed using real-time PCR. Expression of intestinal nutrient transporters increased linearly (Ppigeons and establish a foundation for future research on the nutrients requirements for young pigeons.
Tzeng, Nian-Sheng; Lu, Ru-Band; Yeh, Hui-Wen; Yeh, Yi-Wei; Huang, Chang-Chih; Yen, Che-Hung; Kuo, Shin-Chang; Chen, Chun-Yen; Chang, Hsin-An; Ho, Pei-Shen; Cheng, Serena; Shih, Mei-Chen; Huang, San-Yuan
2015-04-01
A substantial amount of evidence suggests that dysfunction of the dopamine transporter may be involved in the pathophysiology of amphetamine dependence (AD). The aim of this study was to examine whether the dopamine transporter gene (DAT1, SLC6A3) is associated with development of AD and whether this gene influences personality traits in patients with AD. Eighteen polymorphisms of the DAT1 gene were analyzed in a case-control study that included 909 Han Chinese men (568 patients with AD and 341 control subjects). The patients fulfilled the DSM-IV-TR criteria for AD. The Tridimensional Personality Questionnaire (TPQ) was used to assess personality traits and to examine the association between these traits and DAT1 gene variants. A weak association was found between the rs27072 polymorphism and development of AD, but these borderline associations were unconfirmed by logistic regression and haplotype analysis. Although harm avoidance and novelty seeking scores were significantly higher in patients than in controls, DAT1 polymorphisms did not influence these scores. This study suggests that high harm avoidance and novelty seeking personality traits may be a risk factor for the development of AD. However, the DAT1 gene may not contribute to AD susceptibility and specific personality traits observed in AD among Han Chinese men. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Li, Wentao; Zhai, Baoping; Zhi, Hui; Li, Yuhong; Jia, Linjiao; Ding, Chao; Zhang, Bin; You, Wei
2014-09-01
Docetaxel is a first-line chemotherapeutic agent for treating advanced breast cancer. The development of chemoresistance or multidrug resistance (MDR), however, results in breast cancer chemotherapy failure. This study aims to explore the molecular mechanisms underlying docetaxel-resistance in treatment of breast cancer. The docetaxel-resistant subline MCF7/DOC, derived from the parental sensitive breast cancer cell line MCF7, was established by intermittent exposure to moderate concentrations of docetaxel, followed by examination of its phenotypes. The MCF7/DOC subline showed cross resistance against paclitaxel, doxorubicin, methotrexate, and 5-Fu. Compared to the parental MCF7, MCF7/DOC cells were enlarged with heterogeneous sizes and a cobblestone and polygonal appearance. They were arrested at G2/M phase and proliferated slowly. The colony formation potential of MCF7/DOC in soft agar was significantly increased. MCF7/DOC cells showed reduced intracellular accumulation and increased efflux of rhodamine 123. The mRNA expression level of adenosine triphosphate binding cassette (ABC) transporter family, i.e., ABCB1, ABCC1, ABCC2, ABCG2, and β tubulin isotypes were characterized by quantitative PCR. High-level expression of ABCB1, βI, and βIII tubulin mRNA in MCF7/DOC was detected. Downregulation of ABCB1, βI, and βIII tubulin mediated by three combined siRNAs resulted in stronger growth inhibition of MCF7/DOC than inhibition of the expression of individual genes. ABCB1, βI, and βIII tubulin might contribute to the MDR of MCF7/DOC and be potential therapeutic targets for overcoming MDR of breast cancer.
Wonodi, Ikwunga; Hong, L Elliot; Stine, O Colin; Mitchell, Braxton D; Elliott, Amie; Roberts, Rosalinda C; Conley, Robert R; McMahon, Robert P; Thaker, Gunvant K
2009-03-05
Smooth pursuit eye movement (SPEM) deficit is an established schizophrenia endophenotype with a similar neurocognitive construct to working memory. Frontal eye field (FEF) neurons controlling SPEM maintain firing when visual sensory information is removed, and their firing rates directly correlate with SPEM velocity. We previously demonstrated a paradoxical association between a functional polymorphism of dopamine signaling (COMT gene) and SPEM. Recent evidence implicates the dopamine transporter gene (DAT1) in modulating cortical dopamine and associated neurocognitive functions. We hypothesized that DAT1 10/10 genotype, which reduces dopamine transporter expression and increases extracellular dopamine, would affect SPEM. We examined the effects of DAT1 genotype on: Clinical diagnosis in the study sample (n = 418; 190 with schizophrenia), SPEM measures in a subgroup with completed oculomotor measures (n = 200; 87 schizophrenia), and DAT1 gene expression in FEF tissue obtained from postmortem brain samples (n = 32; 16 schizophrenia). DAT1 genotype was not associated with schizophrenia. DAT1 10/10 genotype was associated with better SPEM in healthy controls, intermediate SPEM in unaffected first-degree relatives of schizophrenia subjects, and worse SPEM in schizophrenia subjects. In the gene expression study, DAT1 10/10 genotype was associated with significantly reduced DAT1 mRNA transcript in FEF tissue from healthy control donors (P < 0.05), but higher expression in schizophrenia donors. Findings suggest regulatory effects of another gene(s) or etiological factor in schizophrenia, which modulate DAT1 gene function. 2008 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Kaijie Xu
2016-03-01
Full Text Available Abstract Switchgrass (Panicum virgatum L.; family Poaceae is a warm-season C4 perennial grass. Tillering plays an important role in determining the morphology of aboveground parts and the final biomass yield of switchgrass. Auxin distribution in plants can affect a variety of important growth and developmental processes, including the regulation of shoot and root branching, plant resistance and biological yield. Auxin transport and gradients in plants are mediated by influx and efflux carriers. PvPIN1, a switchgrass PIN1-like gene that is involved in regulating polar transport, is a putative auxin efflux carrier. Neighbor-joining analysis using sequences deposited in NCBI databases showed that the PvPIN1gene belongs to the PIN1 family and is evolutionarily closer to the Oryza sativa japonica group. Tiller emergence and development was significantly promoted in plants subjected toPvPIN1 RNA interference (RNAi, which yielded a phenotype similar to that of wild-type plants treated with the auxin transport inhibitor TIBA (2,3,5-triiodobenzoic acid. A transgenic approach that inducedPvPIN1 gene overexpression or suppression altered tiller number and the shoot/root ratio. These data suggest that PvPIN1plays an important role in auxin-dependent adventitious root emergence and tillering.
Directory of Open Access Journals (Sweden)
Marian Loveday
Full Text Available To improve the treatment of MDR-TB and HIV co-infected patients, we investigated the relationship between health system performance and patient treatment outcomes at 4 decentralised MDR-TB sites.In this mixed methods case study which included prospective comparative data, we measured health system performance using a framework of domains comprising key health service components. Using Pearson Product Moment Correlation coefficients we quantified the direction and magnitude of the association between health system performance and MDR-TB treatment outcomes. Qualitative data from participant observation and interviews analysed using systematic text condensation (STC complemented our quantitative findings.We found significant differences in treatment outcomes across the sites with successful outcomes varying from 72% at Site 1 to 52% at Site 4 (p<0.01. Health systems performance scores also varied considerably across the sites. Our findings suggest there is a correlation between treatment outcomes and overall health system performance which is significant (r = 0.99, p<0.01, with Site 1 having the highest number of successful treatment outcomes and the highest health system performance. Although the 'integration' domain, which measured integration of MDR-TB services into existing services appeared to have the strongest association with successful treatment outcomes (r = 0.99, p<0.01, qualitative data indicated that the 'context' domain influenced the other domains.We suggest that there is an association between treatment outcomes and health system performance. The chance of treatment success is greater if decentralised MDR-TB services are integrated into existing services. To optimise successful treatment outcomes, regular monitoring and support are needed at a district, facility and individual level to ensure the local context is supportive of new programmes and implementation is according to guidelines.
Directory of Open Access Journals (Sweden)
Krisda H Chaiyachati
Full Text Available As the South African province of KwaZulu-Natal addresses a growing multidrug-resistant tuberculosis (MDR-TB epidemic by shifting care and treatment from trained specialty centers to community hospitals, delivering and monitoring MDR-TB therapy has presented new challenges. In particular, tracking and reporting adverse clinical events have been difficult for mobile healthcare workers (HCWs, trained health professionals who travel daily to patient homes to administer and monitor therapy. We designed and piloted a mobile phone application (Mobilize for mobile HCWs that electronically standardized the recording and tracking of MDR-TB patients on low-cost, functional phones.We assess the acceptability and feasibility of using Mobilize to record and submit adverse events forms weekly during the intensive phase of MDR-TB therapy and evaluate mobile HCW perceptions throughout the pilot period.All five mobile HCWs at one site were trained and provided with phones. Utilizing a mixed-methods evaluation, mobile HCWs' usage patterns were tracked electronically for seven months and analyzed. Qualitative focus groups and questionnaires were designed to understand the impact of mobile phone technology on the work environment.Mobile HCWs submitted nine of 33 (27% expected adverse events forms, conflicting with qualitative results in which mobile HCWs stated that Mobilize improved adverse events communication, helped their daily workflow, and could be successfully expanded to other health interventions. When presented with the conflict between their expressed views and actual practice, mobile HCWs cited forgetfulness and believed patients should take more responsibility for their own care.This pilot experience demonstrated poor uptake by HCWs despite positive responses to using mHealth. Though our results should be interpreted cautiously because of the small number of mobile HCWs and MDR-TB patients in this study, we recommend carefully exploring the motivations
Chaiyachati, Krisda H; Loveday, Marian; Lorenz, Stephen; Lesh, Neal; Larkan, Lee-Megan; Cinti, Sandro; Friedland, Gerald H; Haberer, Jessica E
2013-01-01
As the South African province of KwaZulu-Natal addresses a growing multidrug-resistant tuberculosis (MDR-TB) epidemic by shifting care and treatment from trained specialty centers to community hospitals, delivering and monitoring MDR-TB therapy has presented new challenges. In particular, tracking and reporting adverse clinical events have been difficult for mobile healthcare workers (HCWs), trained health professionals who travel daily to patient homes to administer and monitor therapy. We designed and piloted a mobile phone application (Mobilize) for mobile HCWs that electronically standardized the recording and tracking of MDR-TB patients on low-cost, functional phones. We assess the acceptability and feasibility of using Mobilize to record and submit adverse events forms weekly during the intensive phase of MDR-TB therapy and evaluate mobile HCW perceptions throughout the pilot period. All five mobile HCWs at one site were trained and provided with phones. Utilizing a mixed-methods evaluation, mobile HCWs' usage patterns were tracked electronically for seven months and analyzed. Qualitative focus groups and questionnaires were designed to understand the impact of mobile phone technology on the work environment. Mobile HCWs submitted nine of 33 (27%) expected adverse events forms, conflicting with qualitative results in which mobile HCWs stated that Mobilize improved adverse events communication, helped their daily workflow, and could be successfully expanded to other health interventions. When presented with the conflict between their expressed views and actual practice, mobile HCWs cited forgetfulness and believed patients should take more responsibility for their own care. This pilot experience demonstrated poor uptake by HCWs despite positive responses to using mHealth. Though our results should be interpreted cautiously because of the small number of mobile HCWs and MDR-TB patients in this study, we recommend carefully exploring the motivations of HCWs and
Henry, Rebekah; Vithanage, Nuwan; Harrison, Paul; Seemann, Torsten; Coutts, Scott; Moffatt, Jennifer H.; Nation, Roger L.; Li, Jian; Harper, Marina; Adler, Ben
2012-01-01
We recently demonstrated that colistin resistance in Acinetobacter baumannii can result from mutational inactivation of genes essential for lipid A biosynthesis (Moffatt JH, et al., Antimicrob. Agents Chemother. 54:4971–4977). Consequently, strains harboring these mutations are unable to produce the major Gram-negative bacterial surface component, lipopolysaccharide (LPS). To understand how A. baumannii compensates for the lack of LPS, we compared the transcriptional profile of the A. baumannii type strain ATCC 19606 to that of an isogenic, LPS-deficient, lpxA mutant strain. The analysis of the expression profiles indicated that the LPS-deficient strain showed increased expression of many genes involved in cell envelope and membrane biogenesis. In particular, upregulated genes included those involved in the Lol lipoprotein transport system and the Mla-retrograde phospholipid transport system. In addition, genes involved in the synthesis and transport of poly-β-1,6-N-acetylglucosamine (PNAG) also were upregulated, and a corresponding increase in PNAG production was observed. The LPS-deficient strain also exhibited the reduced expression of genes predicted to encode the fimbrial subunit FimA and a type VI secretion system (T6SS). The reduced expression of genes involved in T6SS correlated with the detection of the T6SS-effector protein AssC in culture supernatants of the A. baumannii wild-type strain but not in the LPS-deficient strain. Taken together, these data show that, in response to total LPS loss, A. baumannii alters the expression of critical transport and biosynthesis systems associated with modulating the composition and structure of the bacterial surface. PMID:22024825
Henry, Rebekah; Vithanage, Nuwan; Harrison, Paul; Seemann, Torsten; Coutts, Scott; Moffatt, Jennifer H; Nation, Roger L; Li, Jian; Harper, Marina; Adler, Ben; Boyce, John D
2012-01-01
We recently demonstrated that colistin resistance in Acinetobacter baumannii can result from mutational inactivation of genes essential for lipid A biosynthesis (Moffatt JH, et al., Antimicrob. Agents Chemother. 54:4971-4977). Consequently, strains harboring these mutations are unable to produce the major Gram-negative bacterial surface component, lipopolysaccharide (LPS). To understand how A. baumannii compensates for the lack of LPS, we compared the transcriptional profile of the A. baumannii type strain ATCC 19606 to that of an isogenic, LPS-deficient, lpxA mutant strain. The analysis of the expression profiles indicated that the LPS-deficient strain showed increased expression of many genes involved in cell envelope and membrane biogenesis. In particular, upregulated genes included those involved in the Lol lipoprotein transport system and the Mla-retrograde phospholipid transport system. In addition, genes involved in the synthesis and transport of poly-β-1,6-N-acetylglucosamine (PNAG) also were upregulated, and a corresponding increase in PNAG production was observed. The LPS-deficient strain also exhibited the reduced expression of genes predicted to encode the fimbrial subunit FimA and a type VI secretion system (T6SS). The reduced expression of genes involved in T6SS correlated with the detection of the T6SS-effector protein AssC in culture supernatants of the A. baumannii wild-type strain but not in the LPS-deficient strain. Taken together, these data show that, in response to total LPS loss, A. baumannii alters the expression of critical transport and biosynthesis systems associated with modulating the composition and structure of the bacterial surface.
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Madsen, Majbritt Busk
2018-01-01
The carboxylesterase 1 gene (CES1) encodes a hydrolase that metabolizes commonly used drugs. The CES1-related pseudogene, carboxylesterase 1 pseudogene 1 (CES1P1), has been implicated in gene exchange with CES1 and in the formation of hybrid genes including the carboxylesterase 1A2 gene (CES1A2...
Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S
2014-01-10
Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first
Gromicho, Marta; Dinis, Joana; Magalhães, Marta; Fernandes, Alexandra R; Tavares, Purificação; Laires, António; Rueff, José; Rodrigues, António Sebastião
2011-10-01
About 20% of patients with chronic myeloid leukemia (CML) do not respond to treatment with imatinib either initially or because of acquired resistance. To study the development of CML drug resistance, an in vitro experimental system comprising cell lines with different resistance levels was established by exposing K562 cells to increasing concentrations of imatinib and dasatinib anticancer agents. The mRNA levels of BCR- ABL1 and of genes involved in drug transport or redistribution (ABCB1, ABCC1, ABCC3, ABCG2, MVP, and SLC22A1) were measured and the ABL1 kinase domain sequenced. Results excluded BCR- ABL1 overexpression and mutations as relevant resistance mechanisms. Most studied transporters were overexpressed in the majority of resistant cell lines. Their expression pattern was dynamic: varying with resistance level and chronic drug exposure. Studied efflux transporters may have an important role at the initial stages of resistance, but after prolonged exposure and for higher doses of drugs other mechanisms might take place.
Directory of Open Access Journals (Sweden)
Matsumoto Takayuki
2011-06-01
Full Text Available Abstract Background Although familial clustering of functional dyspepsia (FD has been reported, the role of genetics in the susceptibility to FD is still not well understood. In the present study, the association between serotonin transporter (SERT gene (SLC6A4 polymorphism and FD was explored. Methods Subjects were divided into either a postprandial distress syndrome (PDS group or an epigastric pain syndrome (EPS group according to the Rome III criteria. The healthy controls were those who had visited a hospital for an annual health check-up. The presence of the SLC6A4 promoter polymorphism, 5-hydroxytryptamin transporter gene linked polymorphic region (5-HTTLPR, was then evaluated, and logistic regression analysis was used to test all variables. Results The 5-HTTLPR genotype distribution was 448 SS, 174 SL, and 24 LL in controls and 30 SS, 20 SL, and 3 LL in FD subjects. No significant correlation was found between the 5-HTTLPR genotype and FD. When the genotypes and subtypes of FD were exploratory evaluated, the SL genotype was significantly associated with PDS [odds ratio (OR = 2.24, 95% confidence interval (CI; 1.16-4.32, P = 0.034 after Bonferroni correction] compared to the SS genotype adjusted for sex and age. Comparison of the SS genotype with the SL/LL genotype also showed a significant association of genotype with PDS (OR = 2.32, 95% CI; 1.23-4.37, P = 0.009. Conclusion The present results suggest that 5-HTTLPR L allele may influence the susceptibility to PDS.
Ren, Jianfeng; Chung-Davidson, Yu-Wen; Yeh, Chu-Yin; Scott, Camille; Brown, Titus; Li, Weiming
2015-06-06
Lampreys are extant representatives of the jawless vertebrate lineage that diverged from jawed vertebrates around 500 million years ago. Lamprey genomes contain information crucial for understanding the evolution of gene families in vertebrates. The ATP-binding cassette (ABC) gene family is found from prokaryotes to eukaryotes. The recent availability of two lamprey draft genomes from sea lamprey Petromyzon marinus and Japanese lamprey Lethenteron japonicum presents an opportunity to infer early evolutionary events of ABC genes in vertebrates. We conducted a genome-wide survey of the ABC gene family in two lamprey draft genomes. A total of 37 ABC transporters were identified and classified into seven subfamilies; namely seven ABCA genes, 10 ABCB genes, 10 ABCC genes, three ABCD genes, one ABCE gene, three ABCF genes, and three ABCG genes. The ABCA subfamily has expanded from three genes in sea squirts, seven and nine in lampreys and zebrafish, to 13 and 16 in human and mouse. Conversely, the multiple copies of ABCB1-, ABCG1-, and ABCG2-like genes found in sea squirts have contracted in the other species examined. ABCB2 and ABCB3 seem to be new additions in gnathostomes (not in sea squirts or lampreys), which coincides with the emergence of the gnathostome-specific adaptive immune system. All the genes in the ABCD, ABCE and ABCF subfamilies were conserved and had undergone limited duplication and loss events. In the sea lamprey transcriptomes, the ABCE and ABCF gene subfamilies were ubiquitously and highly expressed in all tissues while the members in other gene subfamilies were differentially expressed. Thirteen more lamprey ABC transporter genes were identified in this study compared with a previous study. By concatenating the same gene sequences from the two lampreys, more full length sequences were obtained, which significantly improved both the assignment of gene names and the phylogenetic trees compared with a previous analysis using partial sequences. The ABC
Ortiz, Diana; Valdés, Raquel; Sanchez, Marco A; Hayenga, Johanna; Elya, Carolyn; Detke, Siegfried; Landfear, Scott M
2010-10-01
Leishmania and other parasitic protozoa are unable to synthesize purines de novo and are reliant upon purine nucleoside and nucleobase transporters to import preformed purines from their hosts. To study the roles of the four purine permeases NT1-NT4 in Leishmania major, null mutants in each transporter gene were prepared and the effect of each gene deletion on purine uptake was monitored. Deletion of the NT3 purine nucleobase transporter gene or both NT3 and the NT2 nucleoside transporter gene resulted in pronounced upregulation of adenosine and uridine uptake mediated by the NT1 permease and also induced up to a 200-fold enhancement in the level of the NT1 protein but not mRNA. A similar level of upregulation of NT1 was achieved in wild-type promastigotes that were transferred to medium deficient in purines. Pulse labelling and treatment of cells with the translation inhibitor cycloheximide revealed that control of NT1 expression occurs primarily at the level of translation and not protein turnover. These observations imply the existence of a translational control mechanism that enhances the ability of Leishmania parasites to import essential purines when they are present at limiting concentrations. © 2010 Blackwell Publishing Ltd.
Saharan Dust, Transport Processes, and Possible Impacts on Hurricane Activities
Lau, William K. M.; Kim, K. M.
2010-01-01
In this paper, we present observational evidence of significant relationships between Saharan dust outbreak, and African Easterly wave activities and hurricane activities. We found two dominant paths of transport of Saharan dust: a northern path, centered at 25degN associated with eastward propagating 6-19 days waves over northern Africa, and a southern path centered at 15degN, associated with the AEW, and the Atlantic ITCZ. Seasons with stronger dust outbreak from the southern path are associated with a drier atmosphere over the Maximum Development Region (MDR) and reduction in tropical cyclone and hurricane activities in the MDR. Seasons with stronger outbreak from the northern path are associated with a cooler N. Atlantic, and suppressed hurricane in the western Atlantic basin.
Gui, Jiang; Moore, Jason H.; Williams, Scott M.; Andrews, Peter; Hillege, Hans L.; van der Harst, Pim; Navis, Gerjan; Van Gilst, Wiek H.; Asselbergs, Folkert W.; Gilbert-Diamond, Diane
2013-01-01
We present an extension of the two-class multifactor dimensionality reduction (MDR) algorithm that enables detection and characterization of epistatic SNP-SNP interactions in the context of a quantitative trait. The proposed Quantitative MDR (QMDR) method handles continuous data by modifying MDR's constructive induction algorithm to use a T-test. QMDR replaces the balanced accuracy metric with a T-test statistic as the score to determine the best interaction model. We used a simulation to ide...
The Serotonin Transporter Gene Polymorphisms and Risk of Ischemic Stroke
DEFF Research Database (Denmark)
Mortensen, Janne Kærgård; Kraglund, Kristian Lundsgaard; Johnsen, Søren Paaske
2018-01-01
may influence platelet activity, as they result in different levels of transporters and thereby different levels of serotonin in platelets. SERT gene polymorphisms have thus been associated with the risk of myocardial infarction. A similar association may exist between SERT gene polymorphisms...... and stroke. However, to our knowledge, this potential association has not previously been studied. We therefore aimed to investigate the association between polymorphisms in the SERT gene and the risk of ischemic stroke/transitory ischemic attack (TIA). MATERIALS AND METHODS: We conducted a case...
Neurotensin receptor 1 gene (NTSR1 polymorphism is associated with working memory.
Directory of Open Access Journals (Sweden)
Jin Li
Full Text Available BACKGROUND: Recent molecular genetics studies showed significant associations between dopamine-related genes (including genes for dopamine receptors, transporters, and degradation and working memory, but little is known about the role of genes for dopamine modulation, such as those related to neurotensin (NT, in working memory. A recent animal study has suggested that NT antagonist administration impaired working memory in a learning task. The current study examined associations between NT genes and working memory among humans. METHODS: Four hundred and sixty healthy undergraduate students were assessed with a 2-back working memory paradigm. 5 SNPs in the NTSR1 gene were genotyped. 5 ANOVA tests were conducted to examine whether and how working memory differed by NTSR1 genotype, with each SNP variant as the independent variable and the average accuracy on the working memory task as the dependent variable. RESULTS: ANOVA results suggested that two SNPs in the NTSR1 gene (rs4334545 and rs6090453 were significantly associated with working memory. These results survived corrections for multiple comparisons. CONCLUSIONS: Our results demonstrated that NTSR1 SNP polymorphisms were significantly associated with variance in working memory performance among healthy adults. This result extended previous rodent studies showing that the NT deficiency impairs the working memory function. Future research should replicate our findings and extend to an examination of other dopamine modulators.
Directory of Open Access Journals (Sweden)
Luca eTadini
2012-12-01
Full Text Available Perturbations in organellar gene expression (OGE and the thylakoid redox state (TRS activate retrograde signalling pathways that adaptively modify nuclear gene expression (NGE, according to developmental and metabolic needs. The prors1-1 mutation in Arabidopsis down-regulates the expression of the nuclear gene Prolyl-tRNA Synthetase1 (PRORS1 which acts in both plastids and mitochondria, thereby impairing protein synthesis in both organelles and triggering OGE-dependent retrograde signalling. Because the mutation also affects thylakoid electron transport, TRS-dependent signals may likewise have an impact on the changes in NGE observed in this genotype. In this study, we have investigated whether signals related to TRS are actually integrated into the OGE-dependent retrograde signalling pathway. To this end, the chaos mutation (for chlorophyll a/b binding protein harvesting-organelle specific, which shows a partial loss of PSII antennae proteins and thus a reduction in PSII light absorption capability, was introduced into the prors1-1 mutant background. The resulting double mutant displayed a prors1-1-like reduction in plastid translation rate and a chaos-like decrease in PSII antenna size, whereas the hyper-reduction of the thylakoid electron transport chain, caused by the prors1-1 mutation, was alleviated, as determined by monitoring chlorophyll (Chl fluorescence and thylakoid phosphorylation. Interestingly, a substantial fraction of the nucleus-encoded photosynthesis genes down-regulated in the prors1-1 mutant are expressed at nearly wild-type rates in prors1-1 chaos leaves, and this recovery is reflected in the steady-state levels of their protein products in the chloroplast. We therefore conclude that signals related to photosynthetic electron transport and TRS, and indirectly to carbohydrate metabolism and energy balance, are indeed fed into the OGE-dependent retrograde pathway to modulate NGE and adjust the abundance of chloroplast proteins.
UDP-galactose and acetyl-CoA transporters as Plasmodium multidrug resistance genes.
Lim, Michelle Yi-Xiu; LaMonte, Gregory; Lee, Marcus C S; Reimer, Christin; Tan, Bee Huat; Corey, Victoria; Tjahjadi, Bianca F; Chua, Adeline; Nachon, Marie; Wintjens, René; Gedeck, Peter; Malleret, Benoit; Renia, Laurent; Bonamy, Ghislain M C; Ho, Paul Chi-Lui; Yeung, Bryan K S; Chow, Eric D; Lim, Liting; Fidock, David A; Diagana, Thierry T; Winzeler, Elizabeth A; Bifani, Pablo
2016-09-19
A molecular understanding of drug resistance mechanisms enables surveillance of the effectiveness of new antimicrobial therapies during development and deployment in the field. We used conventional drug resistance selection as well as a regime of limiting dilution at early stages of drug treatment to probe two antimalarial imidazolopiperazines, KAF156 and GNF179. The latter approach permits the isolation of low-fitness mutants that might otherwise be out-competed during selection. Whole-genome sequencing of 24 independently derived resistant Plasmodium falciparum clones revealed four parasites with mutations in the known cyclic amine resistance locus (pfcarl) and a further 20 with mutations in two previously unreported P. falciparum drug resistance genes, an acetyl-CoA transporter (pfact) and a UDP-galactose transporter (pfugt). Mutations were validated both in vitro by CRISPR editing in P. falciparum and in vivo by evolution of resistant Plasmodium berghei mutants. Both PfACT and PfUGT were localized to the endoplasmic reticulum by fluorescence microscopy. As mutations in pfact and pfugt conveyed resistance against additional unrelated chemical scaffolds, these genes are probably involved in broad mechanisms of antimalarial drug resistance.
Directory of Open Access Journals (Sweden)
Roja Rani Pallavali
Full Text Available Multi-drug resistance has become a major problem for the treatment of pathogenic bacterial infections. The use of bacteriophages is an attractive approach to overcome the problem of drug resistance in several pathogens that cause fatal diseases. Our study aimed to isolate multi drug resistant bacteria from patients with septic wounds and then isolate and apply bacteriophages in vitro as alternative therapeutic agents. Pus samples were aseptically collected from Rajiv Gandhi Institute of Medical Science (RIMS, Kadapa, A.P., and samples were analyzed by gram staining, evaluating morphological characteristics, and biochemical methods. MDR-bacterial strains were collected using the Kirby-Bauer disk diffusion method against a variety of antibiotics. Bacteriophages were collected and tested in vitro for lytic activity against MDR-bacterial isolates. Analysis of the pus swab samples revealed that the most of the isolates detected had Pseudomonas aeruginosa as the predominant bacterium, followed by Staphylococcus aureus, Klebsiella pneumoniae and Escherichia coli. Our results suggested that gram-negative bacteria were more predominant than gram-positive bacteria in septic wounds; most of these isolates were resistant to ampicillin, amoxicillin, penicillin, vancomycin and tetracycline. All the gram-positive isolates (100% were multi-drug resistant, whereas 86% of the gram-negative isolates had a drug resistant nature. Further bacteriophages isolated from sewage demonstrated perfect lytic activity against the multi-drug resistant bacteria causing septic wounds. In vitro analysis of the isolated bacteriophages demonstrated perfect lysis against the corresponding MDR-bacteria, and these isolated phages may be promising as a first choice for prophylaxis against wound sepsis, Moreover, phage therapy does not enhance multi-drug resistance in bacteria and could work simultaneously on a wide variety of MDR-bacteria when used in a bacteriophage cocktail. Hence
Al-Assil, Bodour; Mahfoud, Maysa; Hamzeh, Abdul Rezzak
2013-01-01
Horizontal gene transfer (HGT) introduces advantageous genetic elements into pathogenic bacteria using tools such as class1 integrons. This study aimed at investigating the distribution of these integrons among uropathogenic E. coli (UPEC) isolated from patients in Aleppo, Syria. It also set to uncover the frequencies of the clinically relevant DfrA1 and DfrA17,7, as well as various associations leading to reduced susceptibility. This study involved 75 Trimethoprim-resistant E. coli isolates from in- and outpatients with urinary tract infections (UTIs) from 3 major hospitals in Aleppo. Bacterial identification, resistance and extended-spectrum-β-lactamase (ESBL) production testing were performed according to Clinical Laboratory Standards Institute guidelines. Detection of integrons and DfrA genes was done using PCR and statistical significance was inferred through χ2 (Fisher’s) test. Class1 integrons were detected in 54.6% of isolates while DfrA1 and DfrA17,7 were found in 16% and 70.6% of tested samples respectively. Furthermore, only DfrA17,7 were strongly associated with class1 integrons, as were reduced susceptibility to the majority of individual antibiotics, multidrug resistance and ESBL production. This study demonstrated the high prevalence of class1 integrons among UPEC strains in Aleppo, Syria, as well as their significant associations with MDR. This data give information for local healthcare provision using antibiotic chemotherapy. PMID:23956949
Directory of Open Access Journals (Sweden)
Shujie Guo
Full Text Available BACKGROUND: The prevalence of lung cancer in China will be the world's highest if allowed to proceed uncurbed. To unravel its genetic underpinnings, we sought to investigate the association of three well-characterized nonsynonymous polymorphisms in XRCC1 (Arg194Trp and Arg399Gln and XRCC3 (Thr241Met genes with lung cancer risk in northeastern Chinese. METHODOLOGY/PRINCIPAL FINDINGS: This study was hospital-based in design, encompassing 684 patients with lung cancer and 604 cancer-free controls. Genotyping was performed using the PCR-LDR (ligase detection reactions method. Data were analyzed by R language and multifactor dimensionality reduction (MDR software. Single-locus analysis identified significance in genotype distributions of polymorphism Arg194Trp (P = 0.002 and Arg399Gln (P = 0.017, and in allele distributions of Thr241Met (P = 0.005. Carriers of 399Gln/Gln genotype conferred a 147% increased risk relative to the non-carriers (odds ratio (OR: 2.47; 95% confidence interval (95% CI: 1.48-4.13; P<0.001. For Thr241Met, significance persisted under allelic (OR = 1.63; 95% CI: 1.14-2.33; P = 0.005, additive (OR = 1.64; 95% CI: 1.16-2.32; P = 0.005 and dominant (OR = 1.67; 95% CI: 1.17-2.38; P = 0.004 models. However, common allele combinations were comparable in frequency between patients and controls. In interaction analysis, the overall best MDR model included Arg399Gln and Thr241Met polymorphisms, with a maximal testing accuracy of 63.18% and a maximal cross-validation consistency of 10 out of 10 (P = 0.0175. CONCLUSIONS: Our study significantly demonstrated an independent and synergistic contribution of XRCC1 Arg399Gln and XRCC3 Thr241Met polymorphisms to lung cancer susceptibility in northeastern Chinese.
Jatau, Bolajoko; Avong, Yohanna; Ogundahunsi, Olumide; Shah, Safieh; Tayler Smith, Katherine; Van den Bergh, Rafael; Zachariah, Rony; van Griensven, Johan; Ekong, Ernest; Dakum, Patrick
2015-01-01
The World Health Organisation (WHO) introduced the twelve early warning indicators for monitoring and evaluating drug Procurement and Supply management (PSM) systems, intended to prevent drug stock-outs and overstocking. Nigeria--one of the high Multi Drug Resistant Tuberculosis (MDR-TB) burden countries, scaled-up treatment in 2012 with the concurrent implementation of a PSM system. We evaluated how well this system functioned using the WHO indicators, including all seven MDR-TB treatment centres in the country that were functional throughout 2013. The quantity of MDR-TB drugs ordered for 2013 matched the annual forecast and all central orders placed during the year were delivered in full and on time. Drug consumption was 81%-106% of the quantity allocated for routine consumption. Timely submission of complete inventory reports ranged from 86-100%, late submissions being 5-15 days late. Forty to 71% of treatment centres placed a drug order when stock was below the minimum level of three months. The proportion of drug orders received at the treatment centres in full and on time ranged from 29-80%, late orders being 1-19 days late. The PSM was found to be performing well in terms of forecasting and procurement of MDR-TB drugs, but there were shortcomings in drug distribution, reporting at treatment centre level and in drug order placements. Despite these gaps, there were no stock outs. These findings indicate that where it matters most, namely ensuring that no drug stock outs affect patient management, the PSM system is effective. Addressing the observed shortcomings will help to strengthen the existing PSM system in anticipation of a growing MDR-TB case burden in the country.
Yue, Grace G.L.; Cheng, Sau-Wan; Yu, Hua; Xu, Zi-Sheng; Lee, Julia K.M.; Hon, Po-Ming; Lee, Mavis Y.H.; Kennelly, Edward J.; Deng, Gary; Yeung, Simon K.; Cassileth, Barrie R.; Fung, Kwok-Pui; Leung, Ping-Chung
2012-01-01
Abstract The rhizome of Curcuma longa (turmeric) is often used in Asia as a spice and as a medicine. Its most well-studied component, curcumin, has been shown to exhibit poor bioavailability in animal studies and clinical trials. We hypothesized that the presence of lipophilic components (e.g., turmerones) in turmeric extract would affect the absorption of curcumin. The effects of turmerones on curcumin transport were evaluated in human intestinal epithelial Caco-2 cells. The roles of turmerones on P-glycoprotein (P-gp) activities and mRNA expression were also evaluated. Results showed that in the presence of α- and aromatic turmerones, the amount of curcumin transported into the Caco-2 cells in 2 hours was significantly increased. α-Turmerone and verapamil (a P-gp inhibitor) significantly inhibited the efflux of rhodamine-123 and digoxin (i.e., inhibited the activity of P-gp). It is interesting that aromatic turmerone significantly increased the rhodamine-123 efflux and P-gp (MDR1 gene) mRNA expression levels. The effects of α- and aromatic turmerones on curcumin transport as well as P-gp activities were shown here for the first time. The presence of turmerones did affect the absorption of curcumin in vitro. These findings suggest the potential use of turmeric extract (including curcumin and turmerones), rather than curcumin alone, for treating diseases. PMID:22181075
Yue, Grace G L; Cheng, Sau-Wan; Yu, Hua; Xu, Zi-Sheng; Lee, Julia K M; Hon, Po-Ming; Lee, Mavis Y H; Kennelly, Edward J; Deng, Gary; Yeung, Simon K; Cassileth, Barrie R; Fung, Kwok-Pui; Leung, Ping-Chung; Lau, Clara B S
2012-03-01
The rhizome of Curcuma longa (turmeric) is often used in Asia as a spice and as a medicine. Its most well-studied component, curcumin, has been shown to exhibit poor bioavailability in animal studies and clinical trials. We hypothesized that the presence of lipophilic components (e.g., turmerones) in turmeric extract would affect the absorption of curcumin. The effects of turmerones on curcumin transport were evaluated in human intestinal epithelial Caco-2 cells. The roles of turmerones on P-glycoprotein (P-gp) activities and mRNA expression were also evaluated. Results showed that in the presence of α- and aromatic turmerones, the amount of curcumin transported into the Caco-2 cells in 2 hours was significantly increased. α-Turmerone and verapamil (a P-gp inhibitor) significantly inhibited the efflux of rhodamine-123 and digoxin (i.e., inhibited the activity of P-gp). It is interesting that aromatic turmerone significantly increased the rhodamine-123 efflux and P-gp (MDR1 gene) mRNA expression levels. The effects of α- and aromatic turmerones on curcumin transport as well as P-gp activities were shown here for the first time. The presence of turmerones did affect the absorption of curcumin in vitro. These findings suggest the potential use of turmeric extract (including curcumin and turmerones), rather than curcumin alone, for treating diseases.
Directory of Open Access Journals (Sweden)
Angeline S Andrew
Full Text Available Bladder cancer is the 4(th most common cancer among men in the U.S. We analyzed variant genotypes hypothesized to modify major biological processes involved in bladder carcinogenesis, including hormone regulation, apoptosis, DNA repair, immune surveillance, metabolism, proliferation, and telomere maintenance. Logistic regression was used to assess the relationship between genetic variation affecting these processes and susceptibility in 563 genotyped urothelial cell carcinoma cases and 863 controls enrolled in a case-control study of incident bladder cancer conducted in New Hampshire, U.S. We evaluated gene-gene interactions using Multifactor Dimensionality Reduction (MDR and Statistical Epistasis Network analysis. The 3'UTR flanking variant form of the hormone regulation gene HSD3B2 was associated with increased bladder cancer risk in the New Hampshire population (adjusted OR 1.85 95%CI 1.31-2.62. This finding was successfully replicated in the Texas Bladder Cancer Study with 957 controls, 497 cases (adjusted OR 3.66 95%CI 1.06-12.63. The effect of this prevalent SNP was stronger among males (OR 2.13 95%CI 1.40-3.25 than females (OR 1.56 95%CI 0.83-2.95, (SNP-gender interaction P = 0.048. We also identified a SNP-SNP interaction between T-cell activation related genes GATA3 and CD81 (interaction P = 0.0003. The fact that bladder cancer incidence is 3-4 times higher in males suggests the involvement of hormone levels. This biologic process-based analysis suggests candidate susceptibility markers and supports the theory that disrupted hormone regulation plays a role in bladder carcinogenesis.
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
MTX appeared to be a better substrate for CaMdr1p among these two tested drugs. Due to severe toxicity of these drugs to insect cells, further characterization of CaMdr1p as a drug transporter could not be done with this system. Therefore, as an alternative, CaMdr1p and Cdr1p, which is an ABC protein (ATP binding ...
Directory of Open Access Journals (Sweden)
Harvey Mario
2010-01-01
Full Text Available Abstract Background UDP-glucuronosyltransferase 1A1 (UGT1A1 is a pivotal enzyme involved in metabolism of SN-38, the active metabolite of irinotecan commonly used to treat metastatic colorectal cancer. We previously demonstrated aberrant methylation of specific CpG dinucleotides in UGT1A1-negative cells, and revealed that methylation state of the UGT1A1 5'-flanking sequence is negatively correlated with gene transcription. Interestingly, one of these CpG dinucleotides (CpG -4 is found close to a HNF1 response element (HRE, known to be involved in activation of UGT1A1 gene expression, and within an upstream stimulating factor (USF binding site. Results Gel retardation assays revealed that methylation of CpG-4 directly affect the interaction of USF1/2 with its cognate sequence without altering the binding for HNF1-alpha. Luciferase assays sustained a role for USF1/2 and HNF1-alpha in UGT1A1 regulation in colon cancer cells. Based on the differential expression profiles of HNF1A gene in colon cell lines, we also assessed whether methylation affects its expression. In agreement with the presence of CpG islands in the HNF1A promoter, treatments of UGT1A1-negative HCT116 colon cancer cells with a DNA methyltransferase inhibitor restore HNF1A gene expression, as observed for UGT1A1. Conclusions This study reveals that basal UGT1A1 expression in colon cells is positively regulated by HNF1-alpha and USF, and negatively regulated by DNA methylation. Besides, DNA methylation of HNF1A could also play an important role in regulating additional cellular drug metabolism and transporter pathways. This process may contribute to determine local inactivation of drugs such as the anticancer agent SN-38 by glucuronidation and define tumoral response.
Beta-Amyloid Downregulates MDR1-P-Glycoprotein (Abcb1 Expression at the Blood-Brain Barrier in Mice
Directory of Open Access Journals (Sweden)
Anja Brenn
2011-01-01
Full Text Available Neurovascular dysfunction is an important component of Alzheimer's disease, leading to reduced clearance across the blood-brain barrier and accumulation of neurotoxic β-amyloid (Aβ peptides in the brain. It has been shown that the ABC transport protein P-glycoprotein (P-gp, ABCB1 is involved in the export of Aβ from the brain into the blood. To determine whether Aβ influences the expression of key Aβ transporters, we studied the effects of 1-day subcutaneous Aβ1-40 and Aβ1-42 administration via Alzet mini-osmotic pumps on P-gp, BCRP, LRP1, and RAGE expression in the brain of 90-day-old male FVB mice. Our results demonstrate significantly reduced P-gp, LRP1, and RAGE mRNA expression in mice treated with Aβ1-42 compared to controls, while BCRP expression was not affected. The expression of the four proteins was unchanged in mice treated with Aβ1-40 or reverse-sequence peptides. These findings indicate that, in addition to the age-related decrease of P-gp expression, Aβ1-42 itself downregulates the expression of P-gp and other Aβ-transporters, which could exacerbate the intracerebral accumulation of Aβ and thereby accelerate neurodegeneration in Alzheimer's disease and cerebral β-amyloid angiopathy.
Energy Technology Data Exchange (ETDEWEB)
Yedidi, Ravikiran S. [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States); Muhuhi, Joseck M. [Department of Chemistry, Wayne State University, Detroit, MI 48202 (United States); Liu, Zhigang [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States); Bencze, Krisztina Z. [Department of Chemistry, Fort Hays State University, Hays, KS 67601 (United States); Koupparis, Kyriacos [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States); Department of Chemistry, Wayne State University, Detroit, MI 48202 (United States); O’Connor, Carrie E.; Kovari, Iulia A. [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States); Spaller, Mark R. [Department of Chemistry, Wayne State University, Detroit, MI 48202 (United States); Kovari, Ladislau C., E-mail: kovari@med.wayne.edu [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States)
2013-09-06
Highlights: •Inhibitors against MDR HIV-1 protease were designed, synthesized and evaluated. •Lead peptide (6a) showed potent inhibition (IC{sub 50}: 4.4 nM) of MDR HIV-1 protease. •(6a) Showed favorable binding isotherms against NL4-3 and MDR proteases. •(6a) Induced perturbations in the {sup 15}N-HSQC spectrum of MDR HIV-1 protease. •Molecular modeling suggested that (6a) may induce total flap closure inMDR protease. -- Abstract: Multidrug-resistant (MDR) clinical isolate-769, human immunodeficiency virus type-1 (HIV-1) protease (PDB ID: (1TW7)), was shown to exhibit wide-open flaps and an expanded active site cavity, causing loss of contacts with protease inhibitors. In the current study, the expanded active site cavity of MDR769 HIV-1 protease was screened with a series of peptide-inhibitors that were designed to mimic the natural substrate cleavage site, capsid/p2. Scanning Ala/Phe chemical mutagenesis approach was incorporated into the design of the peptide series to mimic the substrate co-evolution. Among the peptides synthesized and evaluated, a lead peptide (6a) with potent activity (IC{sub 50}: 4.4 nM) was identified against the MDR769 HIV-1 protease. Isothermal titration calorimetry data showed favorable binding profile for 6aagainst both wild type and MDR769 HIV-1 protease variants. Nuclear magnetic resonance spectrum of {sup 15}N-labeled MDR769 HIV-1 protease in complex with 6a showed some major perturbations in chemical shift, supporting the peptide induced conformational changes in protease. Modeling analysis revealed multiple contacts between 6a and MDR769 HIV-1 protease. The lead peptide-inhibitor, 6a, with high potency and good binding profile can be used as the basis for developing potent small molecule inhibitors against MDR variants of HIV.
International Nuclear Information System (INIS)
Yedidi, Ravikiran S.; Muhuhi, Joseck M.; Liu, Zhigang; Bencze, Krisztina Z.; Koupparis, Kyriacos; O’Connor, Carrie E.; Kovari, Iulia A.; Spaller, Mark R.; Kovari, Ladislau C.
2013-01-01
Highlights: •Inhibitors against MDR HIV-1 protease were designed, synthesized and evaluated. •Lead peptide (6a) showed potent inhibition (IC 50 : 4.4 nM) of MDR HIV-1 protease. •(6a) Showed favorable binding isotherms against NL4-3 and MDR proteases. •(6a) Induced perturbations in the 15 N-HSQC spectrum of MDR HIV-1 protease. •Molecular modeling suggested that (6a) may induce total flap closure inMDR protease. -- Abstract: Multidrug-resistant (MDR) clinical isolate-769, human immunodeficiency virus type-1 (HIV-1) protease (PDB ID: (1TW7)), was shown to exhibit wide-open flaps and an expanded active site cavity, causing loss of contacts with protease inhibitors. In the current study, the expanded active site cavity of MDR769 HIV-1 protease was screened with a series of peptide-inhibitors that were designed to mimic the natural substrate cleavage site, capsid/p2. Scanning Ala/Phe chemical mutagenesis approach was incorporated into the design of the peptide series to mimic the substrate co-evolution. Among the peptides synthesized and evaluated, a lead peptide (6a) with potent activity (IC 50 : 4.4 nM) was identified against the MDR769 HIV-1 protease. Isothermal titration calorimetry data showed favorable binding profile for 6aagainst both wild type and MDR769 HIV-1 protease variants. Nuclear magnetic resonance spectrum of 15 N-labeled MDR769 HIV-1 protease in complex with 6a showed some major perturbations in chemical shift, supporting the peptide induced conformational changes in protease. Modeling analysis revealed multiple contacts between 6a and MDR769 HIV-1 protease. The lead peptide-inhibitor, 6a, with high potency and good binding profile can be used as the basis for developing potent small molecule inhibitors against MDR variants of HIV
Sprowl-Tanio, Stephanie; Habowski, Amber N; Pate, Kira T; McQuade, Miriam M; Wang, Kehui; Edwards, Robert A; Grun, Felix; Lyou, Yung; Waterman, Marian L
2016-01-01
There is increasing evidence that oncogenic Wnt signaling directs metabolic reprogramming of cancer cells to favor aerobic glycolysis or Warburg metabolism. In colon cancer, this reprogramming is due to direct regulation of pyruvate dehydrogenase kinase 1 ( PDK1 ) gene transcription. Additional metabolism genes are sensitive to Wnt signaling and exhibit correlative expression with PDK1. Whether these genes are also regulated at the transcriptional level, and therefore a part of a core metabolic gene program targeted by oncogenic WNT signaling, is not known. Here, we identify monocarboxylate transporter 1 (MCT-1; encoded by SLC16A1 ) as a direct target gene supporting Wnt-driven Warburg metabolism. We identify and validate Wnt response elements (WREs) in the proximal SLC16A1 promoter and show that they mediate sensitivity to Wnt inhibition via dominant-negative LEF-1 (dnLEF-1) expression and the small molecule Wnt inhibitor XAV939. We also show that WREs function in an independent and additive manner with c-Myc, the only other known oncogenic regulator of SLC16A1 transcription. MCT-1 can export lactate, the byproduct of Warburg metabolism, and it is the essential transporter of pyruvate as well as a glycolysis-targeting cancer drug, 3-bromopyruvate (3-BP). Using sulforhodamine B (SRB) assays to follow cell proliferation, we tested a panel of colon cancer cell lines for sensitivity to 3-BP. We observe that all cell lines are highly sensitive and that reduction of Wnt signaling by XAV939 treatment does not synergize with 3-BP, but instead is protective and promotes rapid recovery. We conclude that MCT-1 is part of a core Wnt signaling gene program for glycolysis in colon cancer and that modulation of this program could play an important role in shaping sensitivity to drugs that target cancer metabolism.
Tian, Hui; Yuan, Xiaolei; Duan, Jianfeng; Li, Wenhu; Zhai, Bingnian; Gao, Yajun
2017-01-01
Arbuscular mycorrhizal (AM) colonization of plant roots causes the down-regulation of expression of phosphate (Pi) or nitrogen (N) transporter genes involved in direct nutrient uptake pathways. The mechanism of this effect remains unknown. In the present study, we sought to determine whether the expression of Pi or N transporter genes in roots of winter wheat colonized by AM fungus responded to (1) Pi or N nutrient signals transferred from the AM extra-radical hyphae, or (2) carbon allocation changes in the AM association. A three-compartment culture system, comprising a root compartment (RC), a root and AM hyphae compartment (RHC), and an AM hyphae compartment (HC), was used to test whether the expression of Pi or N transporter genes responded to nutrients (Pi, NH4+ and NO3-) added only to the HC. Different AM inoculation density treatments (roots were inoculated with 0, 20, 50 and 200 g AM inoculum) and light regime treatments (6 hours light and 18 hours light) were established to test the effects of carbon allocation on the expression of Pi or N transporter genes in wheat roots. The expression of two Pi transporter genes (TaPT4 and TaPHT1.2), five nitrate transporter genes (TaNRT1.1, TaNRT1.2, TaNRT2.1, TaNRT2.2, and TaNRT2.3), and an ammonium transporter gene (TaAMT1.2) was quantified using real-time polymerase chain reaction. The expression of TaPT4, TaNRT2.2, and TaAMT1.2 was down-regulated by AM colonization only when roots of host plants received Pi or N nutrient signals. However, the expression of TaPHT1.2, TaNRT2.1, and TaNRT2.3 was down-regulated by AM colonization, regardless of whether there was nutrient transfer from AM hyphae. The expression of TaNRT1.2 was also down-regulated by AM colonization even when there was no nutrient transfer from AM hyphae. The present study showed that an increase in carbon consumption by the AM fungi did not necessarily result in greater down-regulation of expression of Pi or N transporter genes.
Coumpounds affecting cell membrane functions and integrity: MDR pumps and theit exploration
Czech Academy of Sciences Publication Activity Database
Sigler, Karel; Gášková, D.
2002-01-01
Roč. 51, č. 24 (2002), s. 19-22 ISSN 0137-1398. [Uroczyste Seminarium z okazji urodzin Profesora Stanislawa Witka /70./. Wroclaw, 21.07.2002] R&D Projects: GA AV ČR IBS5020202; GA MŠk ME 577 Keywords : xenobioticexporting * multidrug resistance * mdr pumps Subject RIV: EE - Microbiology, Virology
Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando
2014-01-01
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292
Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando
2014-05-09
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.
Masha, Roland T; Houreld, Nicolette N; Abrahamse, Heidi
2013-02-01
Low-intensity laser irradiation (LILI) has been shown to stimulate cellular functions leading to increased adenosine triphosphate (ATP) synthesis. This study was undertaken to evaluate the effect of LILI on genes involved in the mitochondrial electron transport chain (ETC, complexes I-IV) and oxidative phosphorylation (ATP synthase). Four human skin fibroblast cell models were used in this study: normal non-irradiated cells were used as controls while wounded, diabetic wounded, and ischemic cells were irradiated. Cells were irradiated with a 660 nm diode laser with a fluence of 5 J/cm(2) and gene expression determined by quantitative real-time reverse transcription (RT) polymerase chain reaction (PCR). LILI upregulated cytochrome c oxidase subunit VIb polypeptide 2 (COX6B2), cytochrome c oxidase subunit VIc (COX6C), and pyrophosphatase (inorganic) 1 (PPA1) in diabetic wounded cells; COX6C, ATP synthase, H+transporting, mitochondrial Fo complex, subunit B1 (ATP5F1), nicotinamide adenine dinucleotide (NADH) dehydrogenase (ubiquinone) 1 alpha subcomplex, 11 (NDUFA11), and NADH dehydrogenase (ubiquinone) Fe-S protein 7 (NDUFS7) in wounded cells; and ATPase, H+/K+ exchanging, beta polypeptide (ATP4B), and ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) (ATP5G2) in ischemic cells. LILI at 660 nm stimulates the upregulation of genes coding for subunits of enzymes involved in complexes I and IV and ATP synthase.
Prueksaritanont, T; Tatosian, D A; Chu, X; Railkar, R; Evers, R; Chavez-Eng, C; Lutz, R; Zeng, W; Yabut, J; Chan, G H; Cai, X; Latham, A H; Hehman, J; Stypinski, D; Brejda, J; Zhou, C; Thornton, B; Bateman, K P; Fraser, I; Stoch, S A
2017-04-01
A microdose cocktail containing midazolam, dabigatran etexilate, pitavastatin, rosuvastatin, and atorvastatin has been established to allow simultaneous assessment of a perpetrator impact on the most common drug metabolizing enzyme, cytochrome P450 (CYP)3A, and the major transporters organic anion-transporting polypeptides (OATP)1B, breast cancer resistance protein (BCRP), and MDR1 P-glycoprotein (P-gp). The clinical utility of these microdose cocktail probe substrates was qualified by conducting clinical drug interaction studies with three inhibitors with different in vitro inhibitory profiles (rifampin, itraconazole, and clarithromycin). Generally, the pharmacokinetic profiles of the probe substrates, in the absence and presence of the inhibitors, were comparable to their reported corresponding pharmacological doses, and/or in agreement with theoretical expectations. The exception was dabigatran, which resulted in an approximately twofold higher magnitude for microdose compared to conventional dosing, and, thus, can be used to flag a worst-case scenario for P-gp. Broader application of the microdose cocktail will facilitate a more comprehensive understanding of the roles of drug transporters in drug disposition and drug interactions. © 2016 American Society for Clinical Pharmacology and Therapeutics.
Jabir, Rafid Salim; Naidu, Rakesh; Annuar, Muhammad Azrif Bin Ahmad; Ho, Gwo Fuang; Munisamy, Murali; Stanslas, Johnson
2012-12-01
Interindividual variability in drug response and the emergence of adverse drug effects are the main causes of treatment failure in cancer therapy. Functional membrane drug transporters play important roles in altering pharmacokinetic profile, resistance to treatment, toxicity and patient survival. Pharmacogenetic studies of these transporters are expected to provide new approaches for optimizing therapy. Taxanes are approved for the treatment of various cancers. Circulating taxanes are taken up by SLCO1B3 into hepatocytes. The CYP450 enzymes CYP3A4, CYP3A5 and CYP2C8 are responsible for the conversion of taxanes into their metabolites. Ultimately, ABCB1 and ABCC2 will dispose the metabolites into bile canaliculi. Polymorphisms of genes encoding for proteins involved in the transport and clearance of taxanes reduce excretion of the drugs, leading to development of toxicity in patients. This review addresses current knowledge on genetic variations of transporters affecting taxanes pharmacokinetics and toxicity, and provides insights into future direction for personalized medicine.
26 CFR 49.4262(a)-1 - Taxable transportation.
2010-04-01
... 26 Internal Revenue 16 2010-04-01 2010-04-01 true Taxable transportation. 49.4262(a)-1 Section 49...) MISCELLANEOUS EXCISE TAXES FACILITIES AND SERVICES EXCISE TAXES Transportation of Persons § 49.4262(a)-1 Taxable transportation. (a) In general. Unless excluded under section 4262(b) (see § 49.4262(b)-1), taxable...
Characterization of SLCO5A1/OATP5A1, a solute carrier transport protein with non-classical function.
Directory of Open Access Journals (Sweden)
Katrin Sebastian
Full Text Available Organic anion transporting polypeptides (OATP/SLCO have been identified to mediate the uptake of a broad range of mainly amphipathic molecules. Human OATP5A1 was found to be expressed in the epithelium of many cancerous and non-cancerous tissues throughout the body but protein characterization and functional analysis have not yet been performed. This study focused on the biochemical characterization of OATP5A1 using Xenopus laevis oocytes and Flp-In T-REx-HeLa cells providing evidence regarding a possible OATP5A1 function. SLCO5A1 is highly expressed in mature dendritic cells compared to immature dendritic cells (∼6.5-fold and SLCO5A1 expression correlates with the differentiation status of primary blood cells. A core- and complex- N-glycosylated polypeptide monomer of ∼105 kDa and ∼130 kDa could be localized in intracellular membranes and on the plasma membrane, respectively. Inducible expression of SLCO5A1 in HeLa cells led to an inhibitory effect of ∼20% after 96 h on cell proliferation. Gene expression profiling with these cells identified immunologically relevant genes (e.g. CCL20 and genes implicated in developmental processes (e.g. TGM2. A single nucleotide polymorphism leading to the exchange of amino acid 33 (L→F revealed no differences regarding protein expression and function. In conclusion, we provide evidence that OATP5A1 might be a non-classical OATP family member which is involved in biological processes that require the reorganization of the cell shape, such as differentiation and migration.
Directory of Open Access Journals (Sweden)
Jeong HU
2015-01-01
Full Text Available Hyeon-Uk Jeong,1 Mihwa Kwon,2 Yongnam Lee,3 Ji Seok Yoo,3 Dae Hee Shin,3 Im-Sook Song,2 Hye Suk Lee1 1College of Pharmacy, The Catholic University of Korea, Bucheon 420-743, Korea; 2College of Pharmacy and Research Institute of Pharmaceutical Sciences, Kyungpook National University, Daegu 702-701, Korea; 3Central R&D Institute, Yungjin Pharm Co., Ltd., Suwon 443-270, Korea Abstract: We investigated the in vitro transport characteristics of catalposide in HEK293 cells overexpressing organic anion transporter 1 (OAT1, OAT3, organic anion transporting polypeptide 1B1 (OATP1B1, OATP1B3, organic cation transporter 1 (OCT1, OCT2, P-glycoprotein (P-gp, and breast cancer resistance protein (BCRP. The transport mechanism of catalposide was investigated in HEK293 and LLC-PK1 cells overexpressing the relevant transporters. The uptake of catalposide was 319-, 13.6-, and 9.3-fold greater in HEK293 cells overexpressing OAT3, OATP1B1, and OATP1B3 transporters, respectively, than in HEK293 control cells. The increased uptake of catalposide via the OAT3, OATP1B1, and OATP1B3 transporters was decreased to basal levels in the presence of representative inhibitors such as probenecid, furosemide, and cimetidine (for OAT3 and cyclosporin A, gemfibrozil, and rifampin (for OATP1B1 and OATP1B3. The concentration-dependent OAT3-mediated uptake of catalposide revealed the following kinetic parameters: Michaelis constant (Km =41.5 µM, maximum uptake rate (Vmax =46.2 pmol/minute, and intrinsic clearance (CLint =1.11 µL/minute. OATP1B1- and OATP1B3-mediated catalposide uptake also showed concentration dependency, with low CLint values of 0.035 and 0.034 µL/minute, respectively. However, the OCT1, OCT2, OAT1, P-gp, and BCRP transporters were apparently not involved in the uptake of catalposide into cells. In addition, catalposide inhibited the transport activities of OAT3, OATP1B1, and OATP1B3 with half-maximal inhibitory concentration values of 83, 200, and 235 µ
International Nuclear Information System (INIS)
Elsawy, W.H.; Abdel Kader, M.; Abdulla, M.H.
2002-01-01
. Mutations were located in exons 4,6,7,8 and 10 of the p53 gene, including two mutations in the intron region affecting the splice sites. The seven non-responders showed p53 mutations while 6/51 responding patients had p53 mutations. Treatment failure was related to the presence of p53 gene mutations (ρ = 0.0(29). Presence of apoptosis was related to a normal p53 status and treatment response (ρ< 0.00(1). In patients responding to FEC, the mean percentage of apoptotic cells was seven. Of 7 patients with treatment failure, 5 had 0% and two patients had J % apoptotic cells. Twelve patients showed the specific band corresponding to the MDR1 mRNA. All patients with no response to neoadjuvant chemotherapy had MDR1 gene expression. MDR1 expression was significantly correlated with resistance to neoadjuvant chemotherapy ((ρ = 0.0026). The remaining five patients with MDR1 expression had (PR) to neoadjuvant chemotherapy and also had p53 mutations. Conclusion: In conclusion, the results of the present study compare favorably with previous studies in patients with locally advanced breast cancer (LABC). Our results suggest that breast conservation was feasible and safe for patients with LABC, with careful selection based on response to chemotherapy. We have demonstrated that p53 plays a distinct drug-specific role in chemoresistance. The response to a combination of FEC was directly related to normal p53 and tumor cell apoptosis in breast cancer patients. These results provide clinical evidence of a p53 dependent cytotoxic effect of these DNA-damaging agents. It seems that resistance to chemotherapy is a multifactorial phenomenon, in which many genes are involved
Directory of Open Access Journals (Sweden)
Karen M Vernau
Full Text Available Alaskan Husky Encephalopathy (AHE has been previously proposed as a mitochondrial encephalopathy based on neuropathological similarities with human Leigh Syndrome (LS. We studied 11 Alaskan Husky dogs with AHE, but found no abnormalities in respiratory chain enzyme activities in muscle and liver, or mutations in mitochondrial or nuclear genes that cause LS in people. A genome wide association study was performed using eight of the affected dogs and 20 related but unaffected control AHs using the Illumina canine HD array. SLC19A3 was identified as a positional candidate gene. This gene controls the uptake of thiamine in the CNS via expression of the thiamine transporter protein THTR2. Dogs have two copies of this gene located within the candidate interval (SLC19A3.2 - 43.36-43.38 Mb and SLC19A3.1 - 43.411-43.419 Mb on chromosome 25. Expression analysis in a normal dog revealed that one of the paralogs, SLC19A3.1, was expressed in the brain and spinal cord while the other was not. Subsequent exon sequencing of SLC19A3.1 revealed a 4bp insertion and SNP in the second exon that is predicted to result in a functional protein truncation of 279 amino acids (c.624 insTTGC, c.625 C>A. All dogs with AHE were homozygous for this mutation, 15/41 healthy AH control dogs were heterozygous carriers while 26/41 normal healthy AH dogs were wild type. Furthermore, this mutation was not detected in another 187 dogs of different breeds. These results suggest that this mutation in SLC19A3.1, encoding a thiamine transporter protein, plays a critical role in the pathogenesis of AHE.
Kappus, Mojdeh S.; Murphy, Andrew J.; Abramowicz, Sandra; Ntonga, Vusisizwe; Welch, Carrie L.; Tall, Alan R.; Westerterp, Marit
2014-01-01
Liver X receptor (LXR) activators decrease atherosclerosis in mice. LXR activators (1) directly upregulate genes involved in reverse cholesterol transport and (2) exert anti-inflammatory effects mediated by transrepression of nuclear factor-κB target genes. We investigated whether myeloid cell
Acuña-Alonzo, Víctor; Flores-Dorantes, Teresa; Kruit, Janine K; Villarreal-Molina, Teresa; Arellano-Campos, Olimpia; Hünemeier, Tábita; Moreno-Estrada, Andrés; Ortiz-López, Ma Guadalupe; Villamil-Ramírez, Hugo; León-Mimila, Paola; Villalobos-Comparan, Marisela; Jacobo-Albavera, Leonor; Ramírez-Jiménez, Salvador; Sikora, Martin; Zhang, Lin-Hua; Pape, Terry D; Granados-Silvestre, Ma de Angeles; Montufar-Robles, Isela; Tito-Alvarez, Ana M; Zurita-Salinas, Camilo; Bustos-Arriaga, José; Cedillo-Barrón, Leticia; Gómez-Trejo, Celta; Barquera-Lozano, Rodrigo; Vieira-Filho, Joao P; Granados, Julio; Romero-Hidalgo, Sandra; Huertas-Vázquez, Adriana; González-Martín, Antonio; Gorostiza, Amaya; Bonatto, Sandro L; Rodríguez-Cruz, Maricela; Wang, Li; Tusié-Luna, Teresa; Aguilar-Salinas, Carlos A; Lisker, Ruben; Moises, Regina S; Menjivar, Marta; Salzano, Francisco M; Knowler, William C; Bortolini, M Cátira; Hayden, Michael R; Baier, Leslie J; Canizales-Quinteros, Samuel
2010-01-01
It has been suggested that the higher susceptibility of Hispanics to metabolic disease is related to their Native American heritage. A frequent cholesterol transporter ABCA1 (ATP-binding cassette transporter A1) gene variant (R230C, rs9282541) apparently exclusive to Native American individuals was
Torres, Rosa J; de Miguel, Eugenio; Bailén, Rebeca; Banegas, José R; Puig, Juan G
2014-09-01
Primary gout has been associated with single-nucleotide polymorphisms (SNP) in several tubular urate transporter genes. No study has assessed the association of reabsorption and secretion urate transporter gene SNP with gout in a single cohort of documented primary patients with gout carefully subclassified as normoexcretors or underexcretors. Three reabsorption SNP (SLC22A12/URAT1, SLC2A9/GLUT9, and SLC22A11/OAT4) and 2 secretion transporter SNP (SLC17A1/NPT1 and ABCG2/BRCP) were studied in 104 patients with primary gout and in 300 control subjects. The patients were subclassified into normoexcretors and underexcretors according to their serum and 24-h urinary uric acid levels under strict conditions of dietary control. Compared with control subjects, patients with gout showed different allele distributions of the 5 SNP analyzed. However, the diagnosis of underexcretor was only positively associated with the presence of the T allele of URAT1 rs11231825, the G allele of GLUT9 rs16890979, and the A allele of ABCG2 rs2231142. The association of the A allele of ABCG2 rs2231142 in normoexcretors was 10 times higher than in underexcretors. The C allele of NPT1 rs1165196 was only significantly associated with gout in patients with normal uric acid excretion. Gout with uric acid underexcretion is associated with transporter gene SNP related mainly to tubular reabsorption, whereas uric acid normoexcretion is associated only with tubular secretion SNP. This finding supports the concept of distinctive mechanisms to account for hyperuricemia in patients with gout with reduced or normal uric acid excretion.
Positive selection in the SLC11A1 gene in the family Equidae.
Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr
2016-05-01
Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.
Singh, L C; Chakraborty, Anurupa; Mishra, Ashwani K; Devi, Thoudam Regina; Sugandhi, Nidhi; Chintamani, Chintamani; Bhatnagar, Dinesh; Kapur, Sujala; Saxena, Sunita
2012-06-01
Locally advanced breast cancer (LABC) remains a clinical challenge as the majority of patients with this diagnosis develop distant metastases despite appropriate therapy. We analyzed expression of steroid and growth hormone receptor genes as well as gene associated with metabolism of chemotherapeutic drugs in locally advanced breast cancer before and after neoadjuvant chemotherapy (NACT) to study whether there is a change in gene expression induced by chemotherapy and whether such changes are associated with tumor response or non-response. Fifty patients were included with locally advanced breast cancer treated with cyclophosphamide, adriamycin, 5-fluorouracil (CAF)-based neoadjuvant chemotherapy before surgery. Total RNA was extracted from 50 match samples of pre- and post-NACT tumor tissues. RNA expression levels of epidermal growth factor receptor family genes including EGFR, ERBB2, ERBB3, androgen receptor (AR), and multidrug-resistance gene 1 (MDR1) were determined by quantitative real-time reverse transcriptase-polymerase chain reaction. Responders show significantly high levels of pre-NACT AR gene expression (P = 0.016), which reduces following NACT (P = 0.008), and hence can serve as a useful tool for the prediction of the success of neoadjuvant chemotherapy in individual cancer patients with locally advanced breast carcinoma. Moreover, a significant post-therapeutic increase in the expression levels of EGFR and MDR1 gene in responders (P = 0.026 and P < 0.001) as well as in non-responders (P = 0.055, P = 0.001) suggests that expression of these genes changes during therapy but they do not have any impact on tumor response, whereas a post-therapeutic reduction was observed in AR in responders. This indicates an independent predictive role of AR with response to NACT.
Field distribution and DNA transport in solid tumors during electric field-mediated gene delivery.
Henshaw, Joshua W; Yuan, Fan
2008-02-01
Gene therapy has a great potential in cancer treatment. However, the efficacy of cancer gene therapy is currently limited by the lack of a safe and efficient means to deliver therapeutic genes into the nucleus of tumor cells. One method under investigation for improving local gene delivery is based on the use of pulsed electric field. Despite repeated demonstration of its effectiveness in vivo, the underlying mechanisms behind electric field-mediated gene delivery remain largely unknown. Without a thorough understanding of these mechanisms, it will be difficult to further advance the gene delivery. In this review, the electric field-mediated gene delivery in solid tumors will be examined by following individual transport processes that must occur in vivo for a successful gene transfer. The topics of examination include: (i) major barriers for gene delivery in the body, (ii) distribution of electric fields at both cell and tissue levels during the application of external fields, and (iii) electric field-induced transport of genes across each of the barriers. Through this approach, the review summarizes what is known about the mechanisms behind electric field-mediated gene delivery and what require further investigations in future studies.
International Nuclear Information System (INIS)
Mikamo, Eriko; Harada, Shingo; Nishikawa, Jun-ichi; Nishihara, Tsutomu
2003-01-01
Pregnane X receptor (PXR) is a nuclear receptor that regulates the expression of genes for cytochrome P450 3A (CYP3A), multidrug resistance 1 (MDR1), and organic anion-transporting peptide 2 (OATP2). These genes control the metabolism (CYP3A subfamily) and aspects of the pharmacokinetics (MDR1 and OATP2) of both endogenous and xenobiotic compounds. Since PXR is important in understanding the actions of endocrine disruptors (EDs), we determined the ability of suspected EDs to interact with PXR. In our study, 7 of 54 xenobiotics compounds interacted with PXR, including methoxychlor and benzophenone. All of the chemicals activated PXR in vitro and induced CYP3A mRNA in the male rat liver. In addition, CYP2C11 was also induced by some PXR agonists and converted methoxychlor into xenoestrogen. These findings suggest that some EDs affect sex hormone receptor indirectly by induction of metabolic enzyme via PXR, to produce rapidly higher concentrations of effective metabolites, leading to disturbance of the endocrine system
Mudgil, Yashwanti; Uhrig, Joachm F; Zhou, Jiping; Temple, Brenda; Jiang, Kun; Jones, Alan M
2009-11-01
Root architecture results from coordinated cell division and expansion in spatially distinct cells of the root and is established and maintained by gradients of auxin and nutrients such as sugars. Auxin is transported acropetally through the root within the central stele and then, upon reaching the root apex, auxin is transported basipetally through the outer cortical and epidermal cells. The two Gbetagamma dimers of the Arabidopsis thaliana heterotrimeric G protein complex are differentially localized to the central and cortical tissues of the Arabidopsis roots. A null mutation in either the single beta (AGB1) or the two gamma (AGG1 and AGG2) subunits confers phenotypes that disrupt the proper architecture of Arabidopsis roots and are consistent with altered auxin transport. Here, we describe an evolutionarily conserved interaction between AGB1/AGG dimers and a protein designated N-MYC DOWNREGULATED-LIKE1 (NDL1). The Arabidopsis genome encodes two homologs of NDL1 (NDL2 and NDL3), which also interact with AGB1/AGG1 and AGB1/AGG2 dimers. We show that NDL proteins act in a signaling pathway that modulates root auxin transport and auxin gradients in part by affecting the levels of at least two auxin transport facilitators. Reduction of NDL family gene expression and overexpression of NDL1 alter root architecture, auxin transport, and auxin maxima. AGB1, auxin, and sugars are required for NDL1 protein stability in regions of the root where auxin gradients are established; thus, the signaling mechanism contains feedback loops.
Directory of Open Access Journals (Sweden)
Debasish Kar
2016-10-01
Full Text Available Objective: To evaluate the antibacterial property of silver nanoparticles (AgNPs and capsaicin against multidrug resistant (MDR and extended spectrum beta-lactamase (ESBL producing Escherichia coli of bovine and poultry origin. Methods: Antibacterial efficacy of AgNPs and capsaicin was measured using broth dilution method. Five MDR-ESBL producing E. coli isolates of poultry (PEC4, PEC6, PEC15 and PEC16 and cattle mastitis origin (MEC2 were taken to evaluate the antibacterial effect of AgNPs and capsaicin. Results: At 50 mmol/L AgNPs, the viability of MDR of bacterial pathogens was reduced to almost 80%–90% and at 1000 mmol/L, the viability went down to 0%–3%. The minimum inhibitory concentration (MIC50 of AgNPs against these MDR-ESBL producing isolates was found to vary between 172–218 mmol/L whereas the MIC80 varied between 450–640 mmol/L. Capsaicin showed more prominent bactericidal effect and only at 2.5 mmol/L concentration, the viability was shown to be reduced by 20%–35% whereas at 7.5 mmol/L concentration, there was approximately 60% reduction in viability. Further at 25 mmol/L concentration, the viability was reduced to 0%–8%. The MIC50 and MIC80 of capsaicin against these MDRESBL producing isolates were found to vary between 4.6–7.5 mmol/L and 10.9–16.9 mmol/L, respectively. Conclusions: The results point out that capsaicin and AgNPs could be of use in treating ESBL infection.
Day, Pricilla E.; Ntani, Georgia; Crozier, Sarah R.; Mahon, Pam A.; Inskip, Hazel M.; Cooper, Cyrus; Harvey, Nicholas C.; Godfrey, Keith M.; Hanson, Mark A.; Lewis, Rohan M.; Cleal, Jane K.
2015-01-01
Introduction Maternal environment and lifestyle factors may modify placental function to match the mother’s capacity to support the demands of fetal growth. Much remains to be understood about maternal influences on placental metabolic and amino acid transporter gene expression. We investigated the influences of maternal lifestyle and body composition (e.g. fat and muscle content) on a selection of metabolic and amino acid transporter genes and their associations with fetal growth. Methods RNA was extracted from 102 term Southampton Women’s Survey placental samples. Expression of nine metabolic, seven exchange, eight accumulative and three facilitated transporter genes was analyzed using quantitative real-time PCR. Results Increased placental LAT2 (p = 0.01), y + LAT2 (p = 0.03), aspartate aminotransferase 2 (p = 0.02) and decreased aspartate aminotransferase 1 (p = 0.04) mRNA expression associated with pre-pregnancy maternal smoking. Placental mRNA expression of TAT1 (p = 0.01), ASCT1 (p = 0.03), mitochondrial branched chain aminotransferase (p = 0.02) and glutamine synthetase (p = 0.05) was positively associated with maternal strenuous exercise. Increased glutamine synthetase mRNA expression (r = 0.20, p = 0.05) associated with higher maternal diet quality (prudent dietary pattern) pre-pregnancy. Lower LAT4 (r = -0.25, p = 0.05) and aspartate aminotransferase 2 mRNA expression (r = -0.28, p = 0.01) associated with higher early pregnancy diet quality. Lower placental ASCT1 mRNA expression associated with measures of increased maternal fat mass, including pre-pregnancy BMI (r = -0.26, p = 0.01). Lower placental mRNA expression of alanine aminotransferase 2 associated with greater neonatal adiposity, for example neonatal subscapular skinfold thickness (r = -0.33, p = 0.001). Conclusion A number of maternal influences have been linked with outcomes in childhood, independently of neonatal size; our finding of associations between placental expression of
Directory of Open Access Journals (Sweden)
Pricilla E Day
Full Text Available Maternal environment and lifestyle factors may modify placental function to match the mother's capacity to support the demands of fetal growth. Much remains to be understood about maternal influences on placental metabolic and amino acid transporter gene expression. We investigated the influences of maternal lifestyle and body composition (e.g. fat and muscle content on a selection of metabolic and amino acid transporter genes and their associations with fetal growth.RNA was extracted from 102 term Southampton Women's Survey placental samples. Expression of nine metabolic, seven exchange, eight accumulative and three facilitated transporter genes was analyzed using quantitative real-time PCR.Increased placental LAT2 (p = 0.01, y+LAT2 (p = 0.03, aspartate aminotransferase 2 (p = 0.02 and decreased aspartate aminotransferase 1 (p = 0.04 mRNA expression associated with pre-pregnancy maternal smoking. Placental mRNA expression of TAT1 (p = 0.01, ASCT1 (p = 0.03, mitochondrial branched chain aminotransferase (p = 0.02 and glutamine synthetase (p = 0.05 was positively associated with maternal strenuous exercise. Increased glutamine synthetase mRNA expression (r = 0.20, p = 0.05 associated with higher maternal diet quality (prudent dietary pattern pre-pregnancy. Lower LAT4 (r = -0.25, p = 0.05 and aspartate aminotransferase 2 mRNA expression (r = -0.28, p = 0.01 associated with higher early pregnancy diet quality. Lower placental ASCT1 mRNA expression associated with measures of increased maternal fat mass, including pre-pregnancy BMI (r = -0.26, p = 0.01. Lower placental mRNA expression of alanine aminotransferase 2 associated with greater neonatal adiposity, for example neonatal subscapular skinfold thickness (r = -0.33, p = 0.001.A number of maternal influences have been linked with outcomes in childhood, independently of neonatal size; our finding of associations between placental expression of transporter and metabolic genes and maternal smoking
Directory of Open Access Journals (Sweden)
David J Hawthorne
Full Text Available BACKGROUND: Honey bees (Apis mellifera have recently experienced higher than normal overwintering colony losses. Many factors have been evoked to explain the losses, among which are the presence of residues of pesticides and veterinary products in hives. Multiple residues are present at the same time, though most often in low concentrations so that no single product has yet been associated with losses. Involvement of a combination of residues to losses may however not be excluded. To understand the impact of an exposure to combined residues on honey bees, we propose a mechanism-based strategy, focusing here on Multi-Drug Resistance (MDR transporters as mediators of those interactions. METHODOLOGY/PRINCIPAL FINDINGS: Using whole-animal bioassays, we demonstrate through inhibition by verapamil that the widely used organophosphate and pyrethroid acaricides coumaphos and τ-fluvalinate, and three neonicotinoid insecticides: imidacloprid, acetamiprid and thiacloprid are substrates of one or more MDR transporters. Among the candidate inhibitors of honey bee MDR transporters is the in-hive antibiotic oxytetracycline. Bees prefed oxytetracycline were significantly sensitized to the acaricides coumaphos and τ-fluvalinate, suggesting that the antibiotic may interfere with the normal excretion or metabolism of these pesticides. CONCLUSIONS/SIGNIFICANCE: Many bee hives receive regular treatments of oxytetracycline and acaricides for prevention and treatment of disease and parasites. Our results suggest that seasonal co-application of these medicines to bee hives could increase the adverse effects of these and perhaps other pesticides. Our results also demonstrate the utility of a mechanism-based strategy. By identifying pesticides and apicultural medicines that are substrates and inhibitors of xenobiotic transporters we prioritize the testing of those chemical combinations most likely to result in adverse interactions.
Herpes simplex virus type 1 strain KOS carries a defective US9 and a mutated US8A gene.
Negatsch, Alexandra; Mettenleiter, Thomas C; Fuchs, Walter
2011-01-01
The membrane protein encoded by the US9 gene of alphaherpesviruses plays an important role during virion assembly and transport in neurons. Here, we demonstrate that in herpes simplex virus type 1 (HSV-1) strain KOS, due to base substitutions, the predicted TATA-box of US9 is mutated, and a premature stop is present at codon 58 of US9, which contains 91 codons in other HSV-1 strains. The TATA-box mutation also removes the native stop codon of the adjacent US8A gene, leading to extension of the coding region from 160 to 191 codons. Northern blot analyses revealed reduced transcription of US9 in cells infected with HSV-1 KOS. Moreover, a US9-specific antiserum did not detect any gene products in Western blot and immunofluorescence analyses of KOS-infected cells, indicating that the truncated protein is not stable. In contrast, Western blot reactions of a pUS8A-specific antiserum confirmed enlargement of this protein in HSV-1 KOS.
Transporter taxonomy - a comparison of different transport protein classification schemes.
Viereck, Michael; Gaulton, Anna; Digles, Daniela; Ecker, Gerhard F
2014-06-01
Currently, there are more than 800 well characterized human membrane transport proteins (including channels and transporters) and there are estimates that about 10% (approx. 2000) of all human genes are related to transport. Membrane transport proteins are of interest as potential drug targets, for drug delivery, and as a cause of side effects and drug–drug interactions. In light of the development of Open PHACTS, which provides an open pharmacological space, we analyzed selected membrane transport protein classification schemes (Transporter Classification Database, ChEMBL, IUPHAR/BPS Guide to Pharmacology, and Gene Ontology) for their ability to serve as a basis for pharmacology driven protein classification. A comparison of these membrane transport protein classification schemes by using a set of clinically relevant transporters as use-case reveals the strengths and weaknesses of the different taxonomy approaches.
Cao, Heping; Graves, Donald J; Anderson, Richard A
2010-11-01
Cinnamon extracts (CE) are reported to have beneficial effects on people with normal and impaired glucose tolerance, the metabolic syndrome, type 2 diabetes, and insulin resistance. However, clinical results are controversial. Molecular characterization of CE effects is limited. This study investigated the effects of CE on gene expression in cultured mouse adipocytes. Water-soluble CE was prepared from ground cinnamon (Cinnamomum burmannii). Quantitative real-time PCR was used to investigate CE effects on the expression of genes coding for adipokines, glucose transporter (GLUT) family, and insulin-signaling components in mouse 3T3-L1 adipocytes. CE (100 μg/ml) increased GLUT1 mRNA levels 1.91±0.15, 4.39±0.78, and 6.98±2.18-fold of the control after 2-, 4-, and 16-h treatments, respectively. CE decreased the expression of further genes encoding insulin-signaling pathway proteins including GSK3B, IGF1R, IGF2R, and PIK3R1. This study indicates that CE regulates the expression of multiple genes in adipocytes and this regulation could contribute to the potential health benefits of CE. Published by Elsevier GmbH.
Effect of DGAT1 gene mutation in sows of dam-line on the ...
African Journals Online (AJOL)
Diacylglycerol acyltransferase 1 gene (DGAT1) involved in the synthesis and transport of triglycerides is located on chromosome 4 in pigs, in the region with about 200 QTLs responsible among other things for: fat thickness, daily gains, fat content and composition of fatty acids. It is thus probable that the gene polymorphism ...
Bone Marrow Cell Therapy on 1,2-Dimethylhydrazine (DMH)-Induced Colon Cancer in Rats.
El-Khadragy, Manal F; Nabil, Heba M; Hassan, Basmaa N; Tohamy, Amany A; Waaer, Hanaa F; Yehia, Hany M; Alharbi, Afra M; Moneim, Ahmed Esmat Abdel
2018-01-01
Stem cell based therapies are being under focus due to their possible role in treatment of various tumors. Bone marrow stem cells believed to have anticancer potential and are preferred for their activities by stimulating the immune system, migration to the site of tumor and ability for inducting apoptosis in cancer cells. The current study was aimed to investigate the tumor suppressive effects of bone marrow cells (BMCs) in 1,2-dimethylhydrazine (DMH)-induced colon cancer in rats. The rats were randomly allocated into four groups: control, BMCs alone, DMH alone and BMCs with DMH. BMCs were injected intrarectally while DMH was injected subcutaneously at 20 mg/kg body weight once a week for 15 weeks. Histopathological examination and gene expression of survivin, β-catenin and multidrug resistance-1 (MDR-1) by real-time reverse transcription-polymerase chain reaction (RT-PCR) in rat colon tissues. This is in addition to oxidative stress markers in colon were performed across all groups. The presence of aberrant crypt foci was reordered once histopathological examination of colon tissue from rats which received DMH alone. Administration of BMCs into rats starting from zero-day of DMH injection improved the histopathological picture which showed a clear improvement in mucosal layer, few inflammatory cells infiltration periglandular and in the lamina propria. Gene expression in rat colon tissue demonstrated that BMCs down-regulated survivin, β-catenin, MDR-1 and cytokeratin 20 genes expression in colon tissues after colon cancer induction. Amelioration of the colon status after administration of MSCs has been evidenced by a major reduction of lipid peroxidation, nitric oxide, and increasing of glutathione content and superoxide dismutase along with catalase activities. Our findings demonstrated that BMCs have tumor suppressive effects in DMH-induced colon cancer as evidenced by down-regulation of survivin, β-catenin, and MDR-1 genes and enhancing the antioxidant