31 CFR 203.6 - Obligations of TT&L depositaries.

Science.gov (United States)

2010-07-01

... TREASURY TAX AND LOAN PROGRAM General Information § 203.6 Obligations of TT&L depositaries. A TT&L depositary must: (a) Administer a TIP main account balance, SDI account balance, or TIO account balance, as...

Trash to Supply Gas (TtSG) Project Overview

Science.gov (United States)

Hintze, Paul; Santiago-Maldonado, Edgardo; Kulis, Michael J.; Lytle, John K.; Fisher, John W.; Vaccaro, Helen; Ewert, Michael K.; Broyan, James L.

2012-01-01

Technologies that reduce logistical needs are a key to long term space missions. Currently, trash and waste generated during a mission is carried during the entire roundtrip mission or stored inside a logistic module which is de-orbited into Earth's atmosphere for destruction. The goal of the Trash to Supply Gas (TtSG) project is to develop space technology alternatives for converting trash and other waste materials from human spaceflight into high-value products that might include propellants or power system fuels in addition to life support oxygen and water. In addition to producing a useful product from waste, TtSG will decrease the volume needed to store waste on long term space missions. This paper presents an overview of the TtSG technologies and future plans for the project.

ttH multilepton: background estimation

CERN Document Server

Angelidakis, Stylianos; The ATLAS collaboration

2018-01-01

The slides present the background encountered in the ttH->Multilepton search and describe the data-driven techniques used for the determination of the dominant non-prompt-lepton contamination as well as the contribution of electron charge mis-identification.

NLO QCD predictions for off-shell tt̄ and tt̄H production and decay at a linear collider

Energy Technology Data Exchange (ETDEWEB)

Nejad, Bijan Chokoufé [Theory Group, DESY,Notkestr. 85, D-22607 Hamburg (Germany); Kilian, Wolfgang [Emmy-Noether-Campus,Walter-Flex-Str. 3, 57068 Siegen (Germany); Lindert, Jonas M.; Pozzorini, Stefano [Physik-Institut, Universität Zürich,Winterthurerstrasse 190, CH-8057 Zürich (Switzerland); Reuter, Jürgen [Theory Group, DESY,Notkestr. 85, D-22607 Hamburg (Germany); Weiss, Christian [Theory Group, DESY,Notkestr. 85, D-22607 Hamburg (Germany); Emmy-Noether-Campus,Walter-Flex-Str. 3, 57068 Siegen (Germany)

2016-12-15

We present predictions for tt̄ and tt̄H production and decay at future lepton colliders including non-resonant and interference contributions up to next-to-leading order (NLO) in perturbative QCD. The obtained precision predictions are necessary for a future precise determination of the top-quark Yukawa coupling, and allow for top-quark phenomenology in the continuum at an unprecedented level of accuracy. Simulations are performed with the automated NLO Monte-Carlo framework Whizard interfaced to the OpenLoops matrix element generator.

Up in the cloud: reflections on teaching translation technology using a cloud-based platform

DEFF Research Database (Denmark)

Flanagan, Marian

to teaching TT in the classroom. The approach was inspired by Pym (2006) and Doherty and Moorkens (2013), and it takes advantage of using cloud-based software. The aim was to evaluate the students’ experience in the TT workshops. Moreover, I wanted to investigate particular aspects of teaching that were...... with teaching translation technology in the classroom (e.g. Doherty et al. 2012, Kenny and Way 2001, O’Brien and Kenny 2001,2006), several unanswered questions still remain. Up until recently, the translation software often restricted the teaching approach. This paper reports on a new approach I took...... data via online questionnaires: pre-workshop (43 responses) and post-workshop (30 responses). The questionnaires consisted mainly of closed questions but both provided the students with the opportunity to discuss their expectations (pre-workshop) and reflections (post-workshop). Following...

CULTURAL TRANSFER IN THE TRANSLATIONS OF MEDIA ORGANIZATION WEBSITES: A DESCRIPTIVE ANALYSIS OF ARTICLES AND THEIR TURKISH TRANSLATIONS ON THE BBC WEBSITE

Directory of Open Access Journals (Sweden)

Özge Aksoy

2017-04-01

Full Text Available The websites of media organizations address to readers from many different languages and cultures. Each culture has its own specific values, habits and norms. Translators employ some translation strategies in order to transfer these culture specific items (hereinafter; CSIs from a source text (hereinafter; ST to a target text (hereinafter; TT. They are supposed to establish translations that are completely comprehensible for the target readers. In this study, the articles of the British Broadcast Company (hereinafter; the BBC that are translated by BBC Turkish Service translator and published in the link ‘Dergi’ are analysed based on Toury’s translational norms and Aixela’s classification for CSIs. It is designed with a qualitative method and supported with an interview to triangulate the data. The findings show that the translations are generally ‘acceptable’, that is, the translator has the tendency towards target culture according to Toury’ s translational norms. She mostly employs constitution strategies of Aixela to transfer CSIs and this indicates the general tendency of the translations to ‘be a representation of a source text’. However, the translator specifies the target readers of the link as ‘educated young population’ and this does not complicate the comprehensibility of the CSIs by the target readers.

tt: Treelet transform with Stata

DEFF Research Database (Denmark)

Gorst-Rasmussen, Anders

2012-01-01

for much of the variation in the original data. However, in contrast to principal component analysis, the treelet transform produces sparse components. This can greatly simplify interpretation. I describe the tt Stata add-on for performing the treelet transform. The add-on includes a Mata implementation...

PAVE PAWS Early Warning Radar Operation Cape Cod Air Force Station, MA. Record of Decision

Science.gov (United States)

2009-06-01

Effects of Electromagnetic Super-high Frequency Fields]. Moscow, Medicina (In Russian) (English Translation in NASA Rep. TT-F-633). Guy, A.W...Baselines. Ann. New York Acad. Sci., 247: 425-432. Tjagin, N.W., 1971. [Clinical Aspects of Super-high Frequency Irradiation]. Leningrad, Medicina , pp

On the direct quantification of celecoxib in commercial solid drugs using the TT-PIXE and TT-PIGE techniques

International Nuclear Information System (INIS)

Nsouli, B.; Zahraman, K.; Bejjani, A.; Assi, S.; El-Yazbi, F.; Roumie, M.

2006-01-01

The quantification of the active ingredient (AI) in drugs is a crucial and important step in the drug quality control process. This is usually performed by using wet chemical techniques like LC-MS, UV spectrophotometry and other appropriate organic analytical methods. In the case of an active ingredient contains specific heteroatoms (F, S, Cl, etc.,), elemental IBA technique can be explored for molecular quantification. IBA techniques permit the analysis of the sample under solid form, without any laborious sample preparation. This is an advantage when the number of sample is relatively large. In this work, we demonstrate the ability of the thick target PIXE (TT-PIXE) and the TT-PIGE techniques for rapid and accurate quantification of celecoxib in commercial drugs. The experimental aspects related to the quantification validity are presented and discussed

Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bHLH transcription factor MtTT8.

Science.gov (United States)

Li, Penghui; Chen, Beibei; Zhang, Gaoyang; Chen, Longxiang; Dong, Qiang; Wen, Jiangqi; Mysore, Kirankumar S; Zhao, Jian

2016-05-01

The MYB- basic helix-loop-helix (bHLH)-WD40 complexes regulating anthocyanin and proanthocyanidin (PA) biosynthesis in plants are not fully understood. Here Medicago truncatula bHLH MtTT8 was characterized as a central component of these ternary complexes that control anthocyanin and PA biosynthesis. Mttt8 mutant seeds have a transparent testa phenotype with reduced PAs and anthocyanins. MtTT8 restores PA and anthocyanin productions in Arabidopsis tt8 mutant. Ectopic expression of MtTT8 restores anthocyanins and PAs in mttt8 plant and hairy roots and further enhances both productions in wild-type hairy roots. Transcriptomic analyses and metabolite profiling of mttt8 mutant seeds and M. truncatula hairy roots (mttt8 mutant, mttt8 mutant complemented with MtTT8, or MtTT8 overexpression lines) indicate that MtTT8 regulates a subset of genes involved in PA and anthocyanin biosynthesis. MtTT8 is genetically regulated by MtLAP1, MtPAR and MtWD40-1. Combinations of MtPAR, MtLAP1, MtTT8 and MtWD40-1 activate MtTT8 promoter in yeast assay. MtTT8 interacts with these transcription factors to form regulatory complexes. MtTT8, MtWD40-1 and an MYB factor, MtPAR or MtLAP1, interacted and activated promoters of anthocyanidin reductase and anthocyanidin synthase to regulate PA and anthocyanin biosynthesis, respectively. Our results provide new insights into the complex regulation of PA and anthocyanin biosynthesis in M. truncatula. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Developing a SAR TT-OSL protocol for volcanically-heated aeolian quartz from Datong (China)

DEFF Research Database (Denmark)

Liu, Jinfeng; Murray, Andrew S.; Jain, Mayank

2012-01-01

The thermally-transferred optically stimulated luminescence (TT-OSL) responses of chemically-purified fine-grained quartz from a lava-baked aeolian sediment from Datong (China) are presented. Our main focus is to examine the suitability of the test dose TT-OSL and OSL response to monitor sensitiv......The thermally-transferred optically stimulated luminescence (TT-OSL) responses of chemically-purified fine-grained quartz from a lava-baked aeolian sediment from Datong (China) are presented. Our main focus is to examine the suitability of the test dose TT-OSL and OSL response to monitor...

9th Transgenic Technology Meeting (TT2010) in Berlin, Germany: a meeting report.

Science.gov (United States)

Saunders, Thomas L; Sobieszczuk, Peter

2010-12-01

The first Transgenic Technology (TT) Meeting was organized in 1999 by Johannes Wilbertz, Karolinska Institute, Stockholm, Sweden as a regional meeting. The TT Meetings continued in this way, constantly gathering additional practitioners of transgenic methodologies until the breakthrough in 2005 when the 6th TT Meeting in Barcelona, Spain, hosted by Lluis Montoliu (Centro Nacional de Biotecnologia, Madrid, Spain), generated the momentum to establish the International Society for Transgenic Technologies (ISTT). Since 2006, the ISTT has continued to promote the TT Meetings and provide its membership with a forum to discuss best practices and new methods in the field. The TT2010 Meeting was held at the Max Delbrück Center for Molecular Medicine (Berlin, Germany). Participation at the TT2010 Meeting exceeded the registration capacity and set a new attendance record. Session topics included methods for the generation of rat and mouse models of human disease, fundamental and advanced topics in rodent embryonic stem cells, and the newest transgenic technologies. Short presentations from selected abstracts were of especial interest. Roundtable discussions on transgenic facility establishment and cryoarchiving of mouse lines were favorably received. Students, technical staff, and professors participated in numerous discussions and came away with practical methods and new ideas for research.

ttH Coupling Measurement with the ATLAS Detector at the LHC

CERN Document Server

Hadef, Asma; The ATLAS collaboration

2017-01-01

The Higgs boson is discovered on the 4th of July 2012 with a mass around 125 $\\text{GeV}/c^2$ by ATLAS and CMS experiments at LHC. Determining the Higgs properties (production and decay modes, couplings,...) is an important part of the high-energy physics programme in this decade. A search for the Higgs boson production in association with a top quark pair (ttH) at ATLAS is presented in this talk at an unexplored center-of-mass energy of 13 TeV, which could allow a first direct measurement of the top quark Yukawa coupling and could reveal new physics. The ttH analysis in ATLAS is divided into 3 channels according to the Higgs decay modes: $H \\rightarrow$ Hadrons, $H \\rightarrow$ Leptons and $H \\rightarrow$ Photons. The best-fit value of the ratio of observed and Standard Model cross sections of ttH production process, using 2015-2016 data and combining all ttH final states, is 1.8 $\\pm$ 0.7, corresponds to 2.8 $\\sigma$ (1.8 $\\sigma$) observed (expected) significance.

Poster - Thurs Eve-16: Just-in-time tomography (JiTT).

Science.gov (United States)

Pang, G; Rowlands, J A

2008-07-01

Soft-tissue target motion is one of the main concerns in high-precision radiation therapy. Cone beam computed tomography (CBCT) has been developed recently to image soft-tissue targets in the treatment room for image-guided radiation therapy. However, due to its relatively long image acquisition time the CBCT approach cannot provide images of the target at the instant of the treatment and thus is not adequate for imaging targets with intrafraction motion. In this work, a new concept for image-guided radiation therapy- just-in-time tomography (JiTT) - is introduced. Differing from CBCT, JiTT takes much less time to generate the needed tomographical, beam's-eye-view images of the treatment target at the right moment to guide the radiation therapy treatment. A system to achieve JiTT is proposed and its feasibility is investigated. Research supported by Siemens. © 2008 American Association of Physicists in Medicine.

Composite Higgs Models and the tt-bar H Channel

International Nuclear Information System (INIS)

Carmona, A.; Chala, M.; Santiago, J.

2012-01-01

Despite its suppressed couplings to Standard Model particles, a composite Higgs with mass m H = 125 GeV and a moderate degree of compositeness can be consistent with current Higgs searches, including a sizable enhancement in the H → γγ channel. Heavy resonances common to many composite Higgs models can mediate new Higgs production mechanisms. In particular, the tt-bar H channel can be accessible at the LHC in these models through the exchange of colored vector and fermion resonances. In this case, the tt-bar H channel is not a direct measure of the top Yukawa coupling. (authors)

Study and Performance Analysis of TT- FPS Based on CAN Bus%基于CAN总线的TT-FPS调度算法研究及其性能分析

Institute of Scientific and Technical Information of China (English)

吕伟杰; 刘鲁源; 王毅新

2006-01-01

针对CAN总线中消息在固定优先级调度(FPS)算法下传输不可预知、低优先级消息容易被阻塞的问题,提出了一种基于时间触发机制的固定优先级调度(TT-FPS)算法,给出了最糟糕响应时间的计算方法.然后以纯电动汽车消息系统为例进行了TT-FPS的性能分析,验证了TT-FPS较FPS有更好的性能.

Human Factor Investigation of Waste Processing System During the HI-SEAS 4-month Mars Analog Mission in Support of NASA's Logistic Reduction and Repurposing Project: Trash to Gas

Science.gov (United States)

Caraccio, Anne; Hintze, Paul E.; Miles, John D.

2014-01-01

NASA's Logistics Reduction and Repurposing (LRR) project is a collaborative effort in which NASA is tasked with reducing total logistical mass through reduction, reuse and recycling of various wastes and components of long duration space missions and habitats. Trash to Gas (TtG) is a sub task to LRR with efforts focused on development of a technology that converts wastes generated during long duration space missions into high-value products such as methane, water for life support, raw material production feedstocks, and other energy sources. The reuse of discarded materials is a critical component to reducing overall mission mass. The 120 day Hawaii Space Exploration and Analog Simulation provides a unique opportunity to answer questions regarding crew interface and system analysis for designing and developing future flight-like versions of a TtG system. This paper will discuss the human factors that would affect the design of a TtG or other waste processing systems. An overview of the habitat, utility usage, and waste storage and generation is given. Crew time spent preparing trash for TtG processing was recorded. Gas concentrations were measured near the waste storage locations and at other locations in the habitat. In parallel with the analog mission, experimental processing of waste materials in a TtG reactor was performed in order to evaluate performance with realistic waste materials.

Human Factor Investigation of Waste Processing System During the HI-SEAS 4 Month Mars Analog Mission in Support of NASA's Logistic Reduction and Repurposing Project: Trash to Gas

Science.gov (United States)

Caraccio, Anne; Hintze, Paul; Miles, John D.

2014-01-01

NASAs Logistics Reduction and Repurposing (LRR) project is a collaborative effort in which NASA is tasked with reducing total logistical mass through reduction, reuse and recycling of various wastes and components of long duration space missions and habitats. Trash to Gas (TtG) is a sub task to LRR with efforts focused on development of a technology that converts wastes generated during long duration space missions into high-value products such as methane, water for life support, raw material production feedstocks, and other energy sources. The reuse of discarded materials is a critical component to reducing overall mission mass. The 120 day Hawaii Space Exploration and Analog Simulation provides a unique opportunity to answer questions regarding crew interface and system analysis for designing and developing future flight-like versions of a TtG system. This paper will discuss the human factors that would affect the design of a TtG or other waste processing systems. An overview of the habitat, utility usage, and waste storage and generation is given. Crew time spent preparing trash for TtG processing was recorded. Gas concentrations were measured near the waste storage locations and at other locations in the habitat. In parallel with the analog mission, experimental processing of waste materials in a TtG reactor was performed in order to evaluate performance with realistic waste materials.

Randomized Trial to Compare the Immunogenicity and Safety of a CRM or TT Conjugated Quadrivalent Meningococcal Vaccine in Teenagers who Received a CRM or TT Conjugated Serogroup C Vaccine at Preschool Age.

Science.gov (United States)

Ishola, David A; Andrews, Nick; Waight, Pauline; Yung, Chee-Fu; Southern, Jo; Bai, Xilian; Findlow, Helen; Matheson, Mary; England, Anna; Hallis, Bassam; Findlow, Jamie; Borrow, Ray; Miller, Elizabeth

2015-08-01

Protection after meningococcal C (MenC) conjugate (MCC) vaccination in early childhood is short-lived. Boosting with a quadrivalent vaccine in teenage years, a high-risk period for MenC disease, should protect against additional serogroups but might compromise MenC response. The carrier protein in the primary MCC vaccine determines the response to MCC booster in toddlers, but the relationship between primary vaccine and booster given later is unclear. This study compared responses to a CRM-conjugated or tetanus toxoid (TT)-conjugated MenACWY vaccine in teenagers primed with different MCC vaccines at preschool age. Ninety-three teenagers (16-19 years), who were previously randomized at age 3-6 years to receive single-dose MCC-CRM or MCC-TT, were randomized to receive either MenACWY-CRM or MenACWY-TT booster. Serum bactericidal antibodies (SBA, protective titer ≥ 8) were measured before, 1 month and 6 or 9 months after boosting. Preboosting, MCC-TT-primed teenagers had significantly higher MenC SBA titers than those MCC-CRM-primed (P = 0.02). Postboosting, both MenACWY vaccines induced protective SBA titers to all 4 serogroups in most participants (≥ 98% at 1 month and ≥ 90% by 9 months postboost). The highest MenC SBA titers were seen in those MCC-TT-primed and MenACWY-TT-boosted [geometric mean titer (GMT) ~ 22,000] followed by those boosted with MenACWY-CRM irrespective of priming (GMT ~ 12,000) and then those MCC-CRM-primed and MenACWY-TT-boosted (GMT ~ 5500). The estimated postbooster MenC SBA decline beyond 1 month was ~40% as time since booster doubles. Both vaccines were well tolerated with no attributable serious adverse events. Both MenACWY vaccines safely induced protective sustained antibody responses against all targeted serogroups in MCC-primed teenagers.

Tensor-Train Split-Operator Fourier Transform (TT-SOFT) Method: Multidimensional Nonadiabatic Quantum Dynamics.

Science.gov (United States)

Greene, Samuel M; Batista, Victor S

2017-09-12

We introduce the "tensor-train split-operator Fourier transform" (TT-SOFT) method for simulations of multidimensional nonadiabatic quantum dynamics. TT-SOFT is essentially the grid-based SOFT method implemented in dynamically adaptive tensor-train representations. In the same spirit of all matrix product states, the tensor-train format enables the representation, propagation, and computation of observables of multidimensional wave functions in terms of the grid-based wavepacket tensor components, bypassing the need of actually computing the wave function in its full-rank tensor product grid space. We demonstrate the accuracy and efficiency of the TT-SOFT method as applied to propagation of 24-dimensional wave packets, describing the S 1 /S 2 interconversion dynamics of pyrazine after UV photoexcitation to the S 2 state. Our results show that the TT-SOFT method is a powerful computational approach for simulations of quantum dynamics of polyatomic systems since it avoids the exponential scaling problem of full-rank grid-based representations.

Preliminary PCA/TT Results on MRO CRISM Multispectral Images

Science.gov (United States)

Klassen, David R.; Smith, M. D.

2010-10-01

Mars Reconnaissance Orbiter arrived at Mars in March 2006 and by September had achieved its science-phase orbit with the Compact Reconnaissance Imaging Spectrometer for Mars (CRISM) beginning its visible to near-infrared (VIS/NIR) spectral imaging shortly thereafter. One goal of CRISM is to fill in the spatial gaps between the various targeted observations, eventually mapping the entire surface. Due to the large volume of data this would create, the instrument works in a reduced spectral sampling mode creating "multispectral” images. From these data we can create image cubes using 64 wavelengths from 0.410 to 3.923 µm. We present here our analysis of these multispectral mode data products using Principal Components Analysis (PCA) and Target Transformation (TT) [1]. Previous work with ground-based images [2-5] has shown that over an entire visible hemisphere, there are only three to four meaningful components using 32-105 wavelengths over 1.5-4.1 µm the first two are consistent over all temporal scales. The TT retrieved spectral endmembers show nearly the same level of consistency [5]. The preliminary work on the CRISM images cubes implies similar results; three to four significant principal components that are fairly consistent over time. These components are then used in TT to find spectral endmembers which can be used to characterize the surface reflectance for future use in radiative transfer cloud optical depth retrievals. We present here the PCA/TT results comparing the principal components and recovered endmembers from six reconstructed CRISM multi-spectral image cubes. References: [1] Bandfield, J. L., et al. (2000) JGR, 105, 9573. [2] Klassen, D. R. and Bell III, J. F. (2001) BAAS 33, 1069. [3] Klassen, D. R. and Bell III, J. F. (2003) BAAS, 35, 936. [4] Klassen, D. R., Wark, T. J., Cugliotta, C. G. (2005) BAAS, 37, 693. [5] Klassen, D. R. (2009) Icarus, 204, 32.

Stress corrosion cracking growth rate of TT alloy 690 and its weld joint in simulated PWR primary water

International Nuclear Information System (INIS)

Yonezawa, T.

2015-01-01

Recently, some researchers reported that the SCC growth rate (SCCGR) of cold worked thermally treated (TT) Alloy 690 was significantly different in heat by heat. But, author has hypothesized that these high SCCGRs in cold worked TT Alloy 690 could be due to the metallurgical characteristics of these heats. In order to confirm this hypothesis, this study has been started in the author's laboratory, and the following 4 new evidences were obtained. First, microcracks of carbides and voids were observed in eutectic M 23 C 6 GB carbides (primary carbides) for cold rolled laboratory heat after as cast or lightly forged condition or for chemical composition simulated Bettis'TT Alloy 690 heat, after cold rolling, before SCC test. However, microcracks in primary carbides along grain boundaries and voids were rarely detected in the cold rolled commercial heat of TT Alloy 690 used for CRDM penetrations. Secondly, the SCCGR observed in TT Alloy 690 was different in each hot working process and each heat. Comparing the SCCGRs for all heats of cold worked TT Alloy 690, the SCCGR decreased with increasing of Vickers hardness. However, in same heats of cold worked TT Alloy 690, the SCCGR increased with increasing of Vickers hardness. Thirdly, the SCCGR in cold rolled TT Alloy 690 should be integrated by the effect of hardness or cold working ratio and by the effect of existing ratio of primary M23C6 carbides with cracks and Voids due to chemical composition and the fabrication process of TT Alloy 690. Fourthly, it is argued that the high SCCGRs in highly cold rolled TT Alloy 690 are not representative of the practical situation with TT Alloy 690 in service for CRDM adapter nozzles etc. The high SCCGR of highly cold rolled TT Alloy 690 is not thought to be an accurate tool in predicting the possibility of cracking of TT Alloy 690 for CRDM adapter nozzles. (author)

31 CFR 203.3 - TT&L depositaries.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false TT&L depositaries. 203.3 Section 203.3 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE PAYMENT OF FEDERAL TAXES AND THE TREASURY TAX AND...

TtMCO: A highly thermostable laccase-like multicopper oxidase from the thermophilic Thermobaculum terrenum

DEFF Research Database (Denmark)

Brander, Søren; Mikkelsen, Jørn Dalgaard; Kepp, Kasper Planeta

2015-01-01

This paper reports the identification, heterologous expression in Escherichia coli and characterization of TtMCO from the thermophilic bacterium Thermobaculum terrenum, the first laccase-like multi-copper oxidase (LMCO) from the distinct Phylum Chloroflexi. TtMCO has only 39% identity to its...... closest characterized homologue, CotA from Bacillus subtilis, but sequence and spectrophotometry confirmed copper coordination similar to that of LMCOs. TtMCO is extremely thermophilic with a half-time of inactivation of 2.24 days at 70 degrees C and 350 min at 80°C and pH 7, consistent...

Characterization of Biosurfactant Produced by Bacillus licheniformis TT42 Having Potential for Enhanced Oil Recovery.

Science.gov (United States)

Suthar, Harish; Nerurkar, Anuradha

2016-09-01

Bacillus licheniformis TT42 produced a low-molecular weight anionic biosurfactant that reduced the surface tension of water from 72 to 27 mN/m and the interfacial tension from 12 to 0.05 mN/m against crude oil. We have earlier reported significant enhancement in oil recovery in laboratory sand pack columns and core flood studies, by biosurfactant-TT42 compared to standard strain, Bacillus mojavensis JF2. In the context of this application of the biosurfactant-TT42, its characterization was deemed important. In the preliminary studies, the biosurfactant-TT42 was found to be functionally stable at under conditions of temperature, pH, and salinity generally prevalent in oil reservoirs. Furthermore, the purified biosurfactant-TT42 was found to have a CMC of 22 mg/l. A newly developed activity staining TLC method was used for the purification of biosurfactant-TT42. Structural characterization of biosurfactant-TT42 using TLC, Fourier transform infrared spectroscopy (FTIR), GC-MS, and matrix-assisted laser desorption ionization time of flight (MALDI-TOF)/TOF suggested that it was a mixture of lipopeptide species, all having a common hydrophilic cyclic heptapeptide head with the sequence, Gln-Leu/Ileu-Leu/Ileu-Val-Asp-Leu/Ileu-Leu/Ileu linked to hydrophobic tails of different lengths of 3β-OH-fatty acids bearing 1043, 1057 and 1071 Da molecular weight, where 3β-OH-C19 fatty acid was predominant. This is the longest chain length of fatty acids reported in a lipopeptide.

TRANSLATORS’ CENSORSHIP IN ENGLISH-INDONESIAN TRANSLATION OF DONALD DUCK COMICS

Directory of Open Access Journals (Sweden)

Issy Yuliasri

2017-05-01

Full Text Available Not all aspects of Western culture, reflected in the language used in Walt Disney’s Donald Duck comics, are acceptable in Indonesia. So, in translating the comics, the translators have to manipulate the text for it to be acceptable by the target readers and parents. This research aims at finding out censorship through the translation techniques used by the translators in translating the English humorous texts in the Walt Disney’s Donald Duck comics into Indonesian and the reasons underlying the translators’ choice of the translation techniques. It also aims at analysing whether or not the choice of the translation techniques affects the rendering of meaning, maintenance of humour, and acceptability of the translation. For these purposes a qualitative method was employed with content analysis technique and reader response analysis. Content analysis was used in comparing the source text (ST and target text (TT to find out the translation techniques used as a means of censorship and to find out the translators’ reasons for choosing the techniques. Reader-response analysis was done to find out the readers’ response to the rendering of meaning and maintenance of humour in the translation. The research findings discovered that the translators performed censorship through the dominant use of reduction and generalisation techniques so as to reduce sarcasm and insults. The interview with the publisher’s Senior Editor also revealed that “decency” was the first priority in the translation decision making, followed by clarity of meaning and maintenance of humour.  Further research to investigate other elements censored, and compared with other translated comics is recommended.

A Radish Basic Helix-Loop-Helix Transcription Factor, RsTT8 Acts a Positive Regulator for Anthocyanin Biosynthesis

Directory of Open Access Journals (Sweden)

Sun-Hyung Lim

2017-11-01

Full Text Available The MYB-bHLH-WDR (MBW complex activates anthocyanin biosynthesis through the transcriptional regulation. RsMYB1 has been identified as a key player in anthocyanin biosynthesis in red radish (Raphanus sativus L., but its partner bHLH transcription factor (TF remains to be determined. In this study, we isolated a bHLH TF gene from red radish. Phylogenetic analysis indicated that this gene belongs to the TT8 clade of the IIIF subgroup of bHLH TFs, and we thus designated this gene RsTT8. Subcellular localization analysis showed that RsTT8-sGFP was localized to the nuclei of Arabidopsis thaliana protoplasts harboring the RsTT8-sGFP construct. We evaluated anthocyanin biosynthesis and RsTT8 expression levels in three radish varieties (N, C, and D that display different red phenotypes in the leaves, root flesh, and root skins. The root flesh of the C variety and the leaves and skins of the D variety exhibit intense red pigmentation; in these tissues, RsTT8 expression showed totally positive association with the expression of RsMYB1 TF and of five of eight tested anthocyanin biosynthesis genes (i.e., RsCHS, RsCHI, RsF3H, RsDFR, and RsANS. Heterologous co-expression of both RsTT8 and RsMYB1 in tobacco leaves dramatically increased the expression of endogenous anthocyanin biosynthesis genes and anthocyanin accumulation. Furthermore, a yeast two-hybrid assay showed that RsTT8 interacts with RsMYB1 at the MYB-interacting region (MIR, and a transient transactivation assay indicated that RsTT8 activates the RsCHS and RsDFR promoters when co-expressed with RsMYB1. Complementation of the Arabidopsis tt8-1 mutant, which lacks red pigmentation in the leaves and seeds, with RsTT8 restored red pigmentation, and resulted in high anthocyanin and proanthocyanidin contents in the leaves and seeds, respectively. Together, these results show that RsTT8 functions as a regulatory partner with RsMYB1 during anthocyanin biosynthesis.

TT detector description and implementation of the survey measurements

CERN Document Server

Salzmann, C

2008-01-01

The TT geometry in the software has been updated to comply with the latest technical drawings. The main difference is in the description of the beam pipe insulation, where the amount of material has increased from $7.5\\%$ to $15.4\\%$ of $X_0$. Mother volumes are added to decrease the CPU consumption and finally several scans are made to compare the material budget between the DC06 geometry and the new 2008 geometry. In addition, the survey measurements of the TT detector have been analysed. These measurements can be subdivided into surveys of the detector box, photogrammetry of the balconies and metrology of the half-modules. The offsets with the nominal geometry are implemented in the alignment condition database.

Effect of fatigue on hamstring reflex responses and posterior-anterior tibial translation in men and women.

Directory of Open Access Journals (Sweden)

Martin Behrens

Full Text Available Anterior cruciate ligament (ACL rupture ranks among the most common injuries in sports. The incidence of ACL injuries is considerably higher in females than in males and the underlying mechanisms are still under debate. Furthermore, it has been suggested that muscle fatigue can be a risk factor for ACL injuries. We investigated gender differences in hamstring reflex responses and posterior-anterior tibial translation (TT before and after fatiguing exercise. We assessed the isolated movement of the tibia relative to the femur in the sagittal plane as a consequence of mechanically induced TT in standing subjects. The muscle activity of the hamstrings was evaluated. Furthermore, isometric maximum voluntary torque (iMVT and rate of torque development (RTD of the hamstrings (H and quadriceps (Q were measured and the MVT H/Q as well as the RTD H/Q ratios were calculated. After fatigue, reflex onset latencies were enhanced in women. A reduction of reflex responses associated with an increased TT was observed in females. Men showed no differences in these parameters. Correlation analysis revealed no significant associations between parameters for TT and MVT H/Q as well as RTD H/Q. The results of the present study revealed that the fatigue protocol used in this study altered the latency and magnitude of reflex responses of the hamstrings as well as TT in women. These changes were not found in men. Based on our results, it is conceivable that the fatigue-induced decrease in neuromuscular function with a corresponding increase in TT probably contributes to the higher incidence of ACL injuries in women.

A Novel Interference Detection Method of STAP Based on Simplified TT Transform

Directory of Open Access Journals (Sweden)

Qiang Wang

2017-01-01

Full Text Available Training samples contaminated by target-like signals is one of the major reasons for inhomogeneous clutter environment. In such environment, clutter covariance matrix in STAP (space-time adaptive processing is estimated inaccurately, which finally leads to detection performance reduction. In terms of this problem, a STAP interference detection method based on simplified TT (time-time transform is proposed in this letter. Considering the sparse physical property of clutter in the space-time plane, data on each range cell is first converted into a discrete slow time series. Then, the expression of simplified TT transform about sample data is derived step by step. Thirdly, the energy of each training sample is focalized and extracted by simplified TT transform from energy-variant difference between the unpolluted and polluted stage, and the physical significance of discarding the contaminated samples is analyzed. Lastly, the contaminated samples are picked out in light of the simplified TT transform-spectrum difference. The result on Monte Carlo simulation indicates that when training samples are contaminated by large power target-like signals, the proposed method is more effective in getting rid of the contaminated samples, reduces the computational complexity significantly, and promotes the target detection performance compared with the method of GIP (generalized inner product.

Tobacco randomly inserted tt8 differenly enhance light signals and flavonoid accumulation

International Nuclear Information System (INIS)

Sompornpailin, K.; Kanthang, S.

2015-01-01

The individual lines of tobacco over-expressing TT8, a bHLH gene, were constructed and cultured under tissue culture condition radiating with photosynthetically activation radiation (PAR) or PAR+UVA. They were compared to wild type (WT). Leaf of treated plants was extracted and analyzed for flavonoid accumulations using a spectrophotometer. The extract of TT8 plants significantly contained flavone, flavonol and anthocyanin level, higher than the WT extract did. The petal extracts of mature transgenic under PAR had a similar absorbance profile of each substance, but these extracts had higher flavonoid contents than the leaf extracts did. All flavonoid subgroups and p-coumaric acid biosynthesis were significantly enhanced after the additional UVA radiation to plant. This UVA condition slightly stimulated an accumulation of these substances in normal plant. Some transgenic greatly increased flavonoid accumulation in responding to PAR+UVA, but the others were slightly different compared to WT. The distinct insertion site is directly affected TT8 gene expression. Transgenic seeds had a dark brown color more than WT seed, which indicated high content of polymer flavonoids (proanthocyanins). This over-expressing TT8 in transgenic tobacco may directly or indirectly enhance the signal transductions of PAR and UVA and raise up flavonoid accumulation. (author)

Development of certified matrix-based reference material of genetically modified rice event TT51-1 for real-time PCR quantification.

Science.gov (United States)

Jiang, Yu; Yang, Hui; Quan, Sheng; Liu, Yinan; Shen, Ping; Yang, Litao

2015-09-01

In 2009, the genetically modified (GM) rice event TT51-1 with an engineered insect resistance trait became the first GM rice event to be granted certification for safe production in China, and its derivative lines Bt 63 and Huahui No.1 are expected to be commercialized soon. The development of certified reference material (CRM) for TT51-1 is necessary to monitor and inspect the TT51-1 event and its derivates. In this work, we developed four matrix-based TT51-1 rice CRMs (TT51-1a, TT51-1b, TT51-1c, and TT51-1d) with different TT51-1 mass fraction ratios by blending seed powders of homozygous TT51-1 and its recipient cultivar Minghui 63. The between-bottle homogeneity and the within-bottle homogeneity were tested, and good results were obtained. The potential degradation during transportation and shelf life were evaluated, and demonstrated an expiration period of at least 36 months. The characterization values of the four TT51-1 CRMs based on the mass fraction ratio were 1000.000 ± 51.430 g/kg, 49.940 ± 4.620 g/kg, 9.990 ± 1.110 g/kg, and 4.990 ± 0.620 g/kg, respectively. The characterization values based on the copy number ratio were certified by digital PCR analysis as 97.442 ± 5.253 %, 4.851 ± 0.486 %, 1.042 ± 0.135 %, and 0.556 ± 0.073 %, respectively. These results suggested that the TT51-1 matrix-based CRMs developed are of high quality and can be used as potential calibrators for TT51-1 GM rice inspection and monitoring.

Evaluation of SAMe-TT2R2 Score on Predicting Success With Extended-Interval Warfarin Monitoring.

Science.gov (United States)

Hwang, Andrew Y; Carris, Nicholas W; Dietrich, Eric A; Gums, John G; Smith, Steven M

2018-06-01

In patients with stable international normalized ratios, 12-week extended-interval warfarin monitoring can be considered; however, predictors of success with this strategy are unknown. The previously validated SAMe-TT 2 R 2 score (considering sex, age, medical history, treatment, tobacco, and race) predicts anticoagulation control during standard follow-up (every 4 weeks), with lower scores associated with greater time in therapeutic range. To evaluate the ability of the SAMe-TT 2 R 2 score in predicting success with extended-interval warfarin follow-up in patients with previously stable warfarin doses. In this post hoc analysis of a single-arm feasibility study, baseline SAMe-TT 2 R 2 scores were calculated for patients with ≥1 extended-interval follow-up visit. The primary analysis assessed achieved weeks of extended-interval follow-up according to baseline SAMe-TT 2 R 2 scores. A total of 47 patients receiving chronic anticoagulation completed a median of 36 weeks of extended-interval follow-up. The median baseline SAMe-TT 2 R 2 score was 1 (range 0-5). Lower SAMe-TT 2 R 2 scores appeared to be associated with greater duration of extended-interval follow-up achieved, though the differences between scores were not statistically significant. No individual variable of the SAMe-TT 2 R 2 score was associated with achieved weeks of extended-interval follow-up. Analysis of additional patient factors found that longer duration (≥24 weeks) of prior stable treatment was significantly associated with greater weeks of extended-interval follow-up completed ( P = 0.04). Conclusion and Relevance: This pilot study provides limited evidence that the SAMe-TT 2 R 2 score predicts success with extended-interval warfarin follow-up but requires confirmation in a larger study. Further research is also necessary to establish additional predictors of successful extended-interval warfarin follow-up.

Food for Thought: The Translation of Culinary References in Animation

Directory of Open Access Journals (Sweden)

Pilar González-Vera

2015-08-01

Full Text Available Food has traditionally been a cultural symbol reflecting historical roots in every country. It is precisely those cultural bonds that have made the translation of culinary references so difficult. The translation of food-related terms requires translators to consider, on the one hand, the cultural associations embedded in these terms, their meaning and function in the ST and, on the other hand, the translatability of the terms in the TT. As a socio-cultural phenomenon, food plays a fundamental role in the process of globalization in which we are immersed. We cannot disregard the fact that cultures are merging and that the introduction of new food terminology in our lexicon provides irrefutable evidence of globalization and acculturation. This paper focuses on the analysis of the role of food and its translation in the process of globalization. It analyses the relationship between food and culture in animated films like the Shrek saga, The princess and the frog, or Brave -films where food is not the focal point, but where it serves different purposes, such as acculturation, recreation of cultural identities and stereotypes, or humour. The analysis includes a study of the translation techniques applied in the dubbed versions of these films and their relationship to the process of domestication and foreignization in order to assess the social implications in texts aimed at a young audience.

THE TRANSLATION OF NEGATIVE POLITENESS IN GARCÍA MÁRQUEZ'S NOVEL CIEN AÑOS DE SOLEDAD

Directory of Open Access Journals (Sweden)

Germán Mira Álvarez

2014-06-01

Full Text Available This paper presents an empirical contrastive corpus-based analysis of the translation of negative politeness from Spanish into English of the direct verbal interactions in Garcia Marquez's novel Cien años de soledad, which are strongly determined by their cultural, social and situational context. This study assesses, both qualitatively and quantitatively, the extent to which these strategies are maintained, adapted or eliminated in the conversational interactions translated from a positive politeness-oriented culture (Colombia into a negative politeness-oriented culture (English language readers. It could be concluded that in the translation, the pragmatic meaning of the speech acts involved was maintained for the most part, by rendering into the TT a similar type and amount of negative politeness strategies and substrategies.

Coupling of tt̄ and γγ with a strongly interacting Electroweak Symmetry Breaking Sector

Directory of Open Access Journals (Sweden)

Delgado Rafael L.

2017-01-01

Full Text Available We report the coupling of an external γγ or tt̄ state to a strongly interacting EWSBS satisfying unitarity. We exploit perturbation theory for those coupling of the external state, whereas the EWSBS is taken as strongly interacting. We use a modified version of the IAM unitarization procedure to model such a strongly interacting regime. The matrix elements VLVL → VLVL, VLVL ↔ hh, hh → hh, VLVL ↔ {γγ, tt̄}, hh ↔ {γγ, tt̄} are all computed to NLO in perturbation theory with the Nonlinear Effective Field Theory of the EWSBS, within the Equivalence Theorem. This allows us to describe resonances of the electroweak sector that may be found at the LHC and their effect on other channels such as γγ or tt̄ where they may be discovered.

NLO QCD corrections to tt-barbb-bar production at the LHC: 1. quark-antiquark annihilation

International Nuclear Information System (INIS)

Bredenstein, A.; Denner, A.; Dittmaier, S.; Pozzorini, S.

2008-01-01

The process pp → tt-barbb-bar + X represents a very important background reaction to searches at the LHC, in particular to tt-barH production where the Higgs boson decays into a bb-bar pair. A successful analysis of tt-barH at the LHC requires the knowledge of direct tt-barbb-bar production at next-to-leading order in QCD. We take the first step in this direction upon calculating the next-to-leading-order QCD corrections to the subprocess initiated by q q-bar annihilation. We devote an appendix to the general issue of rational terms resulting from ultraviolet or infrared (soft or collinear) singularities within dimensional regularization. There we show that, for arbitrary processes, in the Feynman gauge, rational terms of infrared origin cancel in truncated one-loop diagrams and result only from trivial self-energy corrections.

Selective alkylation of T-T mismatched DNA using vinyldiaminotriazine-acridine conjugate.

Science.gov (United States)

Onizuka, Kazumitsu; Usami, Akira; Yamaoki, Yudai; Kobayashi, Tomohito; Hazemi, Madoka E; Chikuni, Tomoko; Sato, Norihiro; Sasaki, Kaname; Katahira, Masato; Nagatsugi, Fumi

2018-02-16

The alkylation of the specific higher-order nucleic acid structures is of great significance in order to control its function and gene expression. In this report, we have described the T-T mismatch selective alkylation with a vinyldiaminotriazine (VDAT)-acridine conjugate. The alkylation selectively proceeded at the N3 position of thymidine on the T-T mismatch. Interestingly, the alkylated thymidine induced base flipping of the complementary base in the duplex. In a model experiment for the alkylation of the CTG repeats DNA which causes myotonic dystrophy type 1 (DM1), the observed reaction rate for one alkylation increased in proportion to the number of T-T mismatches. In addition, we showed that primer extension reactions with DNA polymerase and transcription with RNA polymerase were stopped by the alkylation. The alkylation of the repeat DNA will efficiently work for the inhibition of replication and transcription reactions. These functions of the VDAT-acridine conjugate would be useful as a new biochemical tool for the study of CTG repeats and may provide a new strategy for the molecular therapy of DM1.

Observations of TT Ari requested in support of MOST observations

Science.gov (United States)

Waagen, Elizabeth O.

2012-08-01

Dr. Nikolaus Vogt (Universidad de Valparaiso, Chile) requested simultaneous photometry and spectroscopy of the novalike (VY Scl subtype) cataclysmic variable TT Ari in support of upcoming observations with the Canadian Microvariability and Oscillations of Stars (MOST) satellite 2012 September 13 through October 20. The Departamento de Fisica y Astronomia of the Valparaiso University will carry out photometry with small telescopes in central Chile but the assistance of other observers, particularly in other latitudes and longitudes, is requested. The observations are being carried out to study superhump behavior, which is still not well understood despite the amount of research done in all classes of cataclysmic variables. TT Ari exibits superhumps - both positive (the superhump period is longer than the orbital period) and negative (the superhump period is shorter than the orbital period). While positive superhumps are thought probably to be the result of an eccentric configuration in the accretion disk, the mechanism for negative superhumps is not yet understood except that it may be related to the disk's being warped out of the orbital plane, leading to complex torque phenomena. TT Ari, one of the brightest cataclysmic variables, exhibits occasional fadings of several magnitudes, from its usual high-state (maximum) magnitude of ~10.5V to a low-state magnitude as faint as 16V. These fadings occur every 20-25 years, and last between 500 and 1000 days. According to observations in the AAVSO International Database, TT Ari is currently magnitude 10.5V. Finder charts with sequence may be created using the AAVSO Variable Star Plotter (http://www.aavso.org/vsp). Observations should be submitted to the AAVSO International Database. See full Alert Notice for more details, particularly regarding goals of the campaign, and observing instructions.

Novel Atlantic bottlenose dolphin parainfluenza virus TtPIV-1 clusters with bovine PIV-3 genotype B strains.

Science.gov (United States)

Eberle, Kirsten C; Neill, John D; Venn-Watson, Stephanie K; McGill, Jodi L; Sacco, Randy E

2015-10-01

Parainfluenza virus 3 (PIV-3) is a common viral infection not only in humans, but also in many other species. Serological evidence suggests that nearly 100 % of children in the United States have been infected with PIV-3 by 5 years of age. Similarly, in cattle, PIV-3 is commonly associated with bovine respiratory disease complex. A novel dolphin PIV-3 (TtPIV-1) was described by Nollens et al. in 2008 from a dolphin that was diagnosed with an unknown respiratory illness. At that time, TtPIV-1 was found to be most similar to, but distinct from, bovine PIV-3 (BPIV-3). In the present study, similar viral growth kinetics and pro-inflammatory cytokine (IL-1β, IL-6, and CXCL8) production were seen between BPIV-3 and TtPIV-1 in BEAS-2B, MDBK, and Vero cell lines. Initial nomenclature of TtPIV-1 was based on partial sequence of the fusion and RNA polymerase genes. Based on the similarities we saw with the in vitro work, it was important to examine the TtPIV-1 genome in more detail. Full genome sequencing and subsequent phylogenetic analysis revealed that all six viral genes of TtPIV-1 clustered within the recently described BPIV-3 genotype B strains, and it is proposed that TtPIV-1 be re-classified with BPIV-3 genotype B strains.

Translational, rotational, vibrational and electron temperatures of a gliding arc discharge

DEFF Research Database (Denmark)

Zhu, Jiajian; Ehn, Andreas; Gao, Jinlong

2017-01-01

, 0) band was used to simulate the rotational temperature (Tr) of the gliding arc discharge whereas the NO A–X (1, 0) and (0, 1) bands were used to determine its vibrational temperature (Tv). The instantaneous reduced electric field strength E/N was obtained by simultaneously measuring......Translational, rotational, vibrational and electron temperatures of a gliding arc discharge in atmospheric pressure air were experimentally investigated using in situ, non-intrusive optical diagnostic techniques. The gliding arc discharge was driven by a 35 kHz alternating current (AC) power source...... and operated in a glow-type regime. The two-dimensional distribution of the translational temperature (Tt) of the gliding arc discharge was determined using planar laser-induced Rayleigh scattering. The rotational and vibrational temperatures were obtained by simulating the experimental spectra. The OH A–X (0...

A comparison of single and multiple aliquot TT-OSL data sets for sand-sized quartz from the Arabian Peninsula

International Nuclear Information System (INIS)

Rosenberg, T.M.; Preusser, F.; Wintle, A.G.

2011-01-01

The quartz OSL signal from dune sands from Saudi Arabia and Oman start to saturate at doses of about 100 Gy. In order to try to date dune sands with greater expected doses, a previously published, single-aliquot, regenerative-dose protocol (SAR) for thermally-transferred optically stimulated luminescence (TT-OSL) was tested. Dose recovery tests, recycling and recuperation ratios showed robust functioning and dose response curves demonstrated the potential to extend the dose range to beyond 600 Gy. Multiple aliquot additive dose (MAAD) TT-OSL protocols were used to test for sensitivity changes in the SAR TT-OSL protocol up to doses of 1200 Gy. A strong dose dependent deviation of the SAR TT-OSL relative to the MAAD TT-OSL dose response is observed. Comparison of the TT-OSL and OSL sensitivity data obtained from the MAAD and SAR data sets shows a lack of proportionality between TT-OSL and OSL for the SAR data which will result in a problem when SAR dose response curves are constructed using many regeneration points with doses above 300 Gy.

ttH coupling measurements in ATLAS and combined results of 8 TeV data

Energy Technology Data Exchange (ETDEWEB)

Sopczak, Andre; Ali, Babar; Seifert, Frank [IEAP CTU in Prague (Czech Republic); Gentile, Simonetta; Kuna, Marine; Monzani, Simone [La Sapienza Universita, Roma (Italy); INFN, Roma (Italy)

2016-07-01

After the discovery of a Higgs boson, the measurements of its properties are now at the forefront of research. The measurement of the associated production of a Higgs boson and a pair of top quarks is of particular importance as the ttH Yukawa coupling is large, and thus a probe for physics beyond the Standard Model. For the first time the ttH production was analysed in the final state with two same-sign light leptions (electrons or muons) and a hadronically decaying tau lepton: ttH → 2l+1 τ{sub had}. The analysis was based on data taken by the ATLAS experiment recorded from 8 TeV proton-proton collisions. It contributed significantly to the combined ATLAS results of the five multi-lepton final states. These results were further combined with other ATLAS ttH analyses where H → γγ and H → b anti b. The combined results are consistent with the Standard Model (SM) expectation allowing models beyond the SM to be constrained.

Tunteettomuudesta tunteeseen : Apatian ilmaisu ja tunteen herättäminen maalausprosessissa

OpenAIRE

Gellman, Karin

2014-01-01

Miten teos ilmaisee tunnetta? Miltä apatia näyttää? Mikä merkitys tunteen herättämisellä on taiteen tekemisen ulkopuolella? Teoreettisena lähtökohtana toimiva R. G. Collingwoodin psykodynaaminen ilmaisuteoria valaisee tietoisuuden suhdetta tunteen herättämisen mekanismeihin maalausprosessin näkökulmasta. How does a work of art express emotion? What does apathy look like? What significance does the craft of arousing emotion have outside the context of artmaking? Psychodynamic perspective i...

Determining the CP nature of spin-0 mediators in associated production of dark matter and tt̄ pairs

Energy Technology Data Exchange (ETDEWEB)

Haisch, Ulrich [Rudolf Peierls Centre for Theoretical Physics, University of Oxford,OX1 3NP Oxford (United Kingdom); CERN, Theoretical Physics Department,CH-1211 Geneva 23 (Switzerland); Pani, Priscilla [Department of Physics, Stockholm University,AlbaNova University Center, 106 91 Stockholm (Sweden); CERN, Experimental Physics Department,CH-1211 Geneva 23 (Switzerland); Polesello, Giacomo [INFN, Sezione di Pavia,Via Bassi 6, 27100 Pavia (Italy); CERN, Experimental Physics Department,CH-1211 Geneva 23 (Switzerland)

2017-02-27

In the framework of spin-0 s-channel simplified models, we explore the possibility of assessing the structure of dark matter interactions through the associate production of dark matter and tt̄ pairs. To this purpose, final states with two leptons are considered and the kinematic properties of the dilepton system is studied. We develop a realistic analysis strategy and provide a detailed evaluation of the achievable sensitivity for the dark matter signal assuming integrated luminosities of 300 fb{sup −1} and 3 ab{sup −1} at the 14 TeV LHC. Furthermore, upper limits on the mediator masses for which the two different CP hypotheses can be distinguished are derived. The obtained limits on the signal strengths are finally translated into constraints on the parameter space of two spin-0 simplified models including a scenario with an extended Higgs sector.

Aspectos patológicos, imunológicos e propriedades moleculares do TT vírus Pathological and immunological aspects and molecular properties of TT virus

Directory of Open Access Journals (Sweden)

Maria Angelica Ehara Watanabe

2005-08-01

Full Text Available O TT vírus (TTV foi primeiramente descrito no Japão, em 1997, por T. Nishizawa, no soro de pacientes com hepatite, pós-transfusão, não-A-G. Tem sido intensivamente investigado, desde então, como uma possível adição à lista dos vírus indutores de hepatite. O TTV é um vírus DNA não-envelopado, de fita simples. Uma considerável variabilidade genética tem sido demonstrada por parte do TTV, o que tem levado pesquisadores a agrupar isolados do vírus em inúmeros genótipos e subtipos. No entanto a significância clínica da infecção por TTV permanece desconhecida. Ele é freqüentemente detectado em fluidos corporais e seu componente mais bem elucidado atualmente é o genoma. Conhecimentos relacionados ao TTV têm aumentado constantemente, porém vários aspectos fundamentais permanecem obscuros. Esta revisão apresenta algumas das propriedades moleculares do TT vírus.TT virus (TTV was first reported in Japan in 1997 by T. Nishizawa in sera from non-A to non-G post-transfusion hepatitis patients. It has been intensively investigated, ever since, as a possible addition to the list of hepatitis-inducing viruses. The TTV is an unenveloped, single-stranded DNA virus. Considerable genetic variability of TTV has been demonstrated and has led investigators to group its isolates into numerous genotypes and subtypes. However, the clinical significance of TTV infection remains unknown. It is frequently detected in the serum and in other body fluids of humans. The component of TTV currently best understood is its genome. Knowledge related to TTV has increased rapidly, but many fundamental aspects remain unclear. This review shows some of the molecular properties of TT virus.

THE IMPACT OF TRANSLATION TECHNIQUES AND SUBTITLING RULES TO THE EQUIVALENCE OF MEANING OF CULINARY TERMS IN THE FRESH WITH ANNA OLSON SEASON 1 SUBTITLE

Directory of Open Access Journals (Sweden)

Hetty Hartati Novita

2017-12-01

Full Text Available The emergence of cable TV in Indonesia has made this author interested in focusing on the topic of culinary terms translation in the subtitle of Fresh with Anna Olson Season 1 program broadcasted on Asian Food Channel station. In this paper, this author analyzes the translation techniques suggested by Molina and Albir used by the translators to create the more accurate, natural, and communicative subtitle even though there are subtitling rules to follow. The result is, most of the translated terms have equivalence in meaning between the ST and the TT, while the ones which are not equivalent are due to the application of two particular techniques, Discursive Creation and Adaptation.

The Double Contact Nature of TT Herculis

OpenAIRE

Terrell, Dirk; Nelson, Robert H.

2014-01-01

We present new radial velocities and photometry of the short-period Algol TT Herculis. Previous attempts to model the light curves of the system have met with limited success, primarily because of the lack of a reliable mass ratio. Our spectroscopic observations are the first to result in radial velocities for the secondary star, and thus provide a spectroscopic mass ratio. Simultaneous analysis of the radial velocities and new photometry shows that the system is a double contact binary, with...

Universal Reconfigurable Translator Module (URTM) Final Report

Science.gov (United States)

Leventhal, Edward; Machan, Roman; Jones, Rob

2009-01-01

This report describes the Universal Reconfigurable Translation Module, or URTM. The URTM was developed by Sigma Space Corporation for NASA in order to translate specific serial protocols, both logically and physically. At present, the prototype configuration has targeted MIL-STD-1553B (RT and BC), IEEE 1394b (Firewire), and ECSS-E-50-12A (SpaceWire). The objectives of this program were to study the feasibility of a configurable URTM to translate serial link data as might be used in a space-flight mission and to design, develop, document, and deliver an engineering prototype model of the URTM with a path to spaceflight. By simply connecting two of the three Physical Interface Modules (PIM) on either end of the RPTM (Reconfigurable Protocol Translator Module), the URTM then self configures via a library of interface translation functions, thereby allowing the two data links to communicate seamlessly.

Immunogenicity and reactogenicity of Infanrix™ when co-administered with meningococcal MenACWY-TT conjugate vaccine in toddlers primed with MenHibrix™ and Pediarix™.

Science.gov (United States)

Leonardi, Michael; Latiolais, Thomas; Sarpong, Kwabena; Simon, Michael; Twiggs, Jerry; Lei, Paul; Rinderknecht, Stephen; Blatter, Mark; Bianco, Veronique; Baine, Yaela; Friedland, Leonard R; Baccarini, Carmen; Miller, Jacqueline M

2015-02-11

Co-administration of an investigational quadrivalent meningococcal serogroups A, C, W and Y tetanus toxoid conjugate vaccine (MenACWY-TT) with the fourth dose of diphtheria-tetanus-acellular pertussis vaccine (DTaP) at age 15-18 months was investigated in 3-dose Haemophilus influenzae type b-meningococcal serogroups C/Y conjugate vaccine (HibMenCY-TT)-primed toddlers. Infants were randomized (5:1) and primed at 2, 4 and 6 months of age with HibMenCY-TT and DTaP-hepatitis B-inactivated poliovirus (DTaP-HBV-IPV) vaccine, or Hib-TT and DTaP-HBV-IPV (Control). HibMenCY-TT+ DTaP-HBV-IPV vaccinees were re-randomized (2:2:1) to receive MenACWY-TT at 12-15 months and DTaP at 15-18 months (MenACWY-TT group); MenACWY-TT co-administered with DTaP at 15-18 months (Coad group); or HibMenCY-TT at 12-15 months and DTaP at 15-18 months (HibMenCY-TT group). Controls received DTaP at 15-18 months. Only children in the HibMenCY-TT group received a fourth dose of Hib conjugate vaccine due to Hib conjugate vaccine shortage at the time of the study. DTaP immunogenicity and reactogenicity were assessed one month post-vaccination. Pre-defined statistical non-inferiority criteria between Coad and Control groups were met for diphtheria, tetanus and filamentous haemagglutinin but not pertussis toxoid and pertactin. Following vaccination ≥99% of children had anti-diphtheria/anti-tetanus concentrations ≥1.0 IU/ml. Pertussis GMCs were lower in all investigational groups versus Control. In post hoc analyses, pertussis antibody concentrations were above those in infants following 3-dose DTaP primary vaccination in whom efficacy against pertussis was demonstrated (Schmitt, von König, et al., 1996; Schmitt, Schuind, et al., 1996). The reactogenicity profile of the Coad group was similar to DTaP administered alone. Routine booster DTaP was immunogenic with an acceptable safety profile when co-administered with MenACWY-TT vaccine in HibMenCY-TT-primed toddlers. These data support the

TT-C-490 -Implementing Alternatives Through Specifications (Briefing Charts)

Science.gov (United States)

2014-11-18

coating or wash primer conforming to DOD-P-15328 or MIL-C-8514 – Wash primers contain hexavalent chromium • Also high in VOCs and contain HAPs...memo (April 8, 2009) mandating reduction in chrome has led to elimination of TT-C-490 Type III (DoD-P-15328) on most new contracts – Impending

Spin-spin correlations in the tt'-Hubbard model

International Nuclear Information System (INIS)

Husslein, T.; Newns, D.M.; Mattutis, H.G.; Pattnaik, P.C.; Morgenstern, I.; Singer, J.M.; Fettes, W.; Baur, C.

1994-01-01

We present calculations of the tt'-Hubbard model using Quantum Monte Carlo techniques. The parameters are chosen so that the van Hove Singularity in the density of states and the Fermi level coincide. We study the behaviour of the system with increasing Hubbard interaction U. Special emphasis is on the spin-spin correlation (SSC). Unusual behaviour for large U is observed there and in the momentum distribution function (n(q)). (orig.)

Abnormal differentiation, hyperplasia and embryonic/perinatal lethality in BK5-T/t transgenic mice

Science.gov (United States)

Chen, Xin; Schneider-Broussard, Robin; Hollowell, Debra; McArthur, Mark; Jeter, Collene R.; Benavides, Fernando; DiGiovanni, John; Tang, Dean G.

2009-01-01

The cell-of-origin has a great impact on the types of tumors that develop and the stem/progenitor cells have long been considered main targets of malignant transformation. The SV40 large T and small t antigens (T/t), have been targeted to multiple differentiated cellular compartments in transgenic mice. In most of these studies, transgenic animals develop tumors without apparent defects in animal development. In this study, we used the bovine keratin 5 (BK5) promoter to target the T/t antigens to stem/progenitor cell-containing cytokeratin 5 (CK5) cellular compartment. A transgene construct, BK5-T/t, was made and microinjected into the male pronucleus of FVB/N mouse oocytes. After implanting ∼1700 embryos, only 7 transgenics were obtained, including 4 embryos (E9.5, E13, E15, and E20) and 3 postnatal animals, which died at P1, P2, and P18, respectively. Immunohistological analysis revealed aberrant differentiation and prominent hyperplasia in several transgenic CK5 tissues, especially the upper digestive organs (tongue, oral mucosa, esophagus, and forestomach) and epidermis, the latter of which also showed focal dysplasia. Altogether, these results indicate that constitutive expression of the T/t antigens in CK5 cellular compartment results in abnormal epithelial differentiation and leads to embryonic/perinatal animal lethality. PMID:19272531

Sagittal tibiotalar translation and clinical outcomes in mobile and fixed-bearing total ankle replacement.

Science.gov (United States)

Usuelli, Federico G; Manzi, Luigi; Brusaferri, Giovanni; Neher, Robert E; Guelfi, Matteo; Maccario, Camilla

2017-06-01

Sagittal implant malalignment after total ankle replacement (TAR) has been considered to be a possible cause for premature implant failure. In a prior study, the change over time of the tibiotalar ratio (T-T ratio), which is the ratio between the posterior longitudinal talar length and the full longitudinal talar length, was assessed in 66 TARs where an unconstrained, mobile-bearing implant was implanted. The analysis documented an increase in the T-T ratio between 2 and 6 months post-surgery (on average from 34.6% to 37.2%). We hypothesized that this change might have been related to the presence of a mobile-bearing insert. In order to test our hypothesis, we designed a study to compare the translation of the talus in TARs performed with an unconstrained, mobile-bearing implant (designated the "Mobile ankle") and those performed with a semi-constrained, fixed-bearing implant (designated the "Fixed ankle"). The study included 71 consecutive patients (71 ankles) who underwent TAR with the Mobile ankle and 24 consecutive patients (24 ankles) who received the Fixed ankle from May 2011 to December 2014. Patients were assessed clinically and radiologically preoperatively (T 0 ), at 6 months (T 2 ) and 12 months (T 3 ) post-surgery. There was also a radiological assessment at 2 months post-surgery (T 1 ). The comparison of the T-T ratio between the two implant groups and over time indicated an interaction between time and group, therefore the changes of the T-T ratio over time were affected by the implant type factor (Pbearing interface. Copyright © 2016 European Foot and Ankle Society. Published by Elsevier Ltd. All rights reserved.

Developmental immunotoxicity is not associated with the consumption of transgenic Bt rice TT51 in rats.

Science.gov (United States)

Hu, Jing; Liang, Chunlai; Zhang, Xiaopeng; Zhang, Qiannan; Cui, Wenming; Yu, Zhou

2018-04-01

TT51 is a transgenic strain of Bt rice generated by fusing a synthetic CryAb/Ac gene into MingHui rice. In this study, rats from F0, F1, and F2 generations were fed a diet with 60% TT51 rice, MingHui rice, or nominal-origin rice. The study focused on developmental immunotoxicity in F1 and F2 offspring after long-term consumption of TT51. A wide range of immunological parameters was monitored in this two-generation study on reproductive toxicity. The experiments were performed on F1 and F2 offspring at postnatal days 21 and 42. No adverse clinical effects were observed in any of the experimental groups. In addition, histopathology observations and immunotoxicity tests, including hematological indicators, spleen lymphocyte subsets, natural killer cell activity, lymphoproliferative response, and plaque-forming cell assay, revealed no significant difference between the groups. These results indicated that developmental immunotoxicity was not associated with a diet of transgenic Bt rice TT51, compared to the parental MingHui rice. Copyright © 2018 Elsevier Inc. All rights reserved.

Positive cooperativity of the specific binding between Hg2+ ion and T:T mismatched base pairs in duplex DNA

International Nuclear Information System (INIS)

Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

2012-01-01

Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.

The Double Contact Nature of TT Herculis

Science.gov (United States)

Terrell, Dirk; Nelson, Robert H.

2014-03-01

We present new radial velocities and photometry of the short-period Algol TT Herculis. Previous attempts to model the light curves of the system have met with limited success, primarily because of the lack of a reliable mass ratio. Our spectroscopic observations are the first to result in radial velocities for the secondary star, and thus provide a spectroscopic mass ratio. Simultaneous analysis of the radial velocities and new photometry shows that the system is a double contact binary, with a rapidly rotating primary that fills its limiting lobe.

Algebraic Structure of tt * Equations for Calabi-Yau Sigma Models

Science.gov (United States)

Alim, Murad

2017-08-01

The tt * equations define a flat connection on the moduli spaces of {2d, \\mathcal{N}=2} quantum field theories. For conformal theories with c = 3 d, which can be realized as nonlinear sigma models into Calabi-Yau d-folds, this flat connection is equivalent to special geometry for threefolds and to its analogs in other dimensions. We show that the non-holomorphic content of the tt * equations, restricted to the conformal directions, in the cases d = 1, 2, 3 is captured in terms of finitely many generators of special functions, which close under derivatives. The generators are understood as coordinates on a larger moduli space. This space parameterizes a freedom in choosing representatives of the chiral ring while preserving a constant topological metric. Geometrically, the freedom corresponds to a choice of forms on the target space respecting the Hodge filtration and having a constant pairing. Linear combinations of vector fields on that space are identified with the generators of a Lie algebra. This Lie algebra replaces the non-holomorphic derivatives of tt * and provides these with a finer and algebraic meaning. For sigma models into lattice polarized K3 manifolds, the differential ring of special functions on the moduli space is constructed, extending known structures for d = 1 and 3. The generators of the differential rings of special functions are given by quasi-modular forms for d = 1 and their generalizations in d = 2, 3. Some explicit examples are worked out including the case of the mirror of the quartic in {\\mathbbm{P}^3}, where due to further algebraic constraints, the differential ring coincides with quasi modular forms.

Possible first occurrence of external corrosion on alloy 600TT tubes in France

International Nuclear Information System (INIS)

Boccanfuso, M.; Thebault, Y.; Massini, B.; Bigne, L.

2015-01-01

During the last decade, in different countries, several occurrences of external corrosion have been identified on steam generator (SG) tube bundles equipped with thermally treated 600 alloy. In France, this feedback leads EDF to enhance the SG inspection program. Nevertheless, until now, no damage of this type was reported. Recently, during in-service inspection at the Cattenom plant on a SG equipped with alloy 600TT tubes, Eddy current tests have highlighted a signal that could be related to external corrosion. The tube was removed and sent to the EDF hot laboratory for destructive examinations. Various exams were performed at different scales to characterize the causes of this NDT signal, the material properties and the residual stresses. The assessments carried out on the tube conclude that the source of the damage is external intergranular stress corrosion cracking, also called ODSCC (Outside Diameter Stress Corrosion Cracking) making it the first occurrence on the tube bundles made of alloy 600TT in the French fleet. This first case of 600 TT ODSCC in France is an unexpected and particular one, because of its altitude in the full mechanical rolling area. This is reinforced by the low number of occurrences noted to date (only one after nearly 30 years of operation of alloy 600TT tube bundles). International (Biblis) OPEX had identified recent IGSCC with cracks initiated and propagated in the tubesheet. For this case, the scenario considered requires highly restrictive conditions (tube in the sludge zone and on the periphery of the tube bundle, including the tube lane) and may explain the singular nature of the Cattenom tube

NASA Airborne Astronomy Ambassadors (AAA) Professional Development and NASA Connections

Science.gov (United States)

Backman, D. E.; Clark, C.; Harman, P. K.

2017-12-01

NASA's Airborne Astronomy Ambassadors (AAA) program is a three-part professional development (PD) experience for high school physics, astronomy, and earth science teachers. AAA PD consists of: (1) blended learning via webinars, asynchronous content learning, and in-person workshops, (2) a STEM immersion experience at NASA Armstrong's B703 science research aircraft facility in Palmdale, California, and (3) ongoing opportunities for connection with NASA astrophysics and planetary science Subject Matter Experts (SMEs). AAA implementation in 2016-18 involves partnerships between the SETI Institute and seven school districts in northern and southern California. AAAs in the current cohort were selected by the school districts based on criteria developed by AAA program staff working with WestEd evaluation consultants. The selected teachers were then randomly assigned by WestEd to a Group A or B to support controlled testing of student learning. Group A completed their PD during January - August 2017, then participated in NASA SOFIA science flights during fall 2017. Group B will act as a control during the 2017-18 school year, then will complete their professional development and SOFIA flights during 2018. A two-week AAA electromagnetic spectrum and multi-wavelength astronomy curriculum aligned with the Science Framework for California Public Schools and Next Generation Science Standards was developed by program staff for classroom delivery. The curriculum (as well as the AAA's pre-flight PD) capitalizes on NASA content by using "science snapshot" case studies regarding astronomy research conducted by SOFIA. AAAs also interact with NASA SMEs during flight weeks and will translate that interaction into classroom content. The AAA program will make controlled measurements of student gains in standards-based learning plus changes in student attitudes towards STEM, and observe & record the AAAs' implementation of curricular changes. Funded by NASA: NNX16AC51

SPS transfer line TT60 towards W-Area

CERN Multimedia

CERN PhotoLab

1978-01-01

Tranfer line TT60 from SPS LSS6 towards the W-Area. View in the direction of the beam. After the magnet, there is a secondary-emission profile monitor, followed by a secondary-emission split-foil (for centering the beam). A TV camera (sticking up prominently) looks at a scintillator screen. The huge tank (with a person standing behind it) houses a beam dump (allowing setting- up of extraction without sending a beam to the W-Area).

Charge mis-identification determination in the 2 leptons same sign channel of ttH$\\rightarrow$leptons and combination of all ttH$\\rightarrow$leptons channels with ATLAS

CERN Document Server

Chomont, Arthur Rene; The ATLAS collaboration

2017-01-01

Description of the charge misidentification estimation in the channels with 2 same-sign lepton in the ttH multilepton channel. The description of the combined fit of the different multilepton channels is also presented as well as results.

Effect of tt-farnesol and myricetin on in vitro biofilm formed by Streptococcus mutans and Candida albicans.

Science.gov (United States)

Rocha, Guilherme Roncari; Florez Salamanca, Elkin Jahir; de Barros, Ana Letícia; Lobo, Carmélia Isabel Vitorino; Klein, Marlise Inêz

2018-02-14

Dental caries is considered a multifactorial disease, in which microorganisms play an important role. The diet is decisive in the biofilm formation because it provides the necessary resources for cellular growth and exopolysaccharides synthesis. Exopolysaccharides are the main components of the extracellular matrix (ECM). The ECM provides a 3D structure, support for the microorganisms and form diffusion-limited environments (acidic niches) that cause demineralization of the dental enamel. Streptococcus mutans is the main producer of exopolysaccharides. Candida albicans is detected together with S. mutans in biofilms associated with severe caries lesions. Thus, this study aimed to determine the effect of tt-farnesol and myricetin topical treatments on cariogenic biofilms formed by Streptococcus mutans and Candida albicans. In vitro dual-species biofilms were grown on saliva-coated hydroxyapatite discs, using tryptone-yeast extract broth with 1% sucrose (37 °C, 5% CO 2 ). Twice-daily topical treatments were performed with: vehicle (ethanol 15%, negative control), 2 mM myricetin, 4 mM tt-farnesol, myricetin + tt-farnesol, myricetin + tt-farnesol + fluoride (250 ppm), fluoride, and chlorhexidine digluconate (0.12%; positive control). After 67 h, biofilms were evaluated to determine biofilm biomass, microbial population, and water-soluble and -insoluble exopolysaccharides in the ECM. Only the positive control yielded a reduced quantity of biomass and microbial population, while tt-farnesol treatment was the least efficient in reducing C. albicans population. The combination therapy myricetin + farnesol + fluoride significantly reduced water-soluble exopolysaccharides in the ECM (vs. negative control; p < 0.05; ANOVA one-way, followed by Tukey's test), similarly to the positive control. Therefore, the combination therapy negatively influenced an important virulence trait of cariogenic biofilms. However, the concentrations of both myricetin and tt

Effect of surface cold work on corrosion of Alloy 690TT in high temperature high pressure water

International Nuclear Information System (INIS)

Wang, J.; Zhang, Z.; Han, E.-H.; Ke, W.

2009-01-01

This paper aims to investigate the effect of surface cold work on corrosion of Alloy 690TT. The Alloy 690TT was mechanical ground and electro polished respectively and immersed in primary water at DO = 2 ppm and DH = 2.5ppm respectively. The microstructure of surface and the compositions and morphology of the surface film on Alloy 690TT after immersion test were studied using scanning electron microscopy (SEM), transmission electron microscopy (TEM), Auger electron spectroscopy (AES) and focused ion beam (FIB). The results showed that feather-like oxide with decorated polyhedral oxide formed on ground surface and needle-like oxide with decorated polyhedral oxide formed on electro-polished surface. (author)

First ATLAS results on ttH at 13 TeV

CERN Document Server

Nektarijevic, Snezana; The ATLAS collaboration

2017-01-01

To understand the nature of the Higgs boson discovered with the LHC experiments ATLAS and CMS in 2012, it is important to search for the yet unobserved Higgs production and decay modes predicted by the Standard Model (SM) of particle physics. Associated production of the Higgs boson and a top-antitop quark pair (ttH production) is one of the yet unobserved processes, with a unique property that it offers a tree-level access to measuring the Higgs-top Yukawa coupling. With a predicted numerical value close to unity, this coupling plays a pivotal role in the stability of the Higgs potential at high energy scales, and also represents the most promising portal to searches for New Physics through fine deviations from the SM predictions. To maximise the chance to observe the SM ttH production, that makes only 1% of the total Higgs boson production cross-section in proton-proton (pp) collisions at the centre of mass energy of 13 TeV, it is necessary to exploit all accessible and sensitive final states. Due to the ri...

IGA resistance of TT Alloy 690 and concentration behavior of Broached Egg Crate tube support configuration

International Nuclear Information System (INIS)

Suzuki, S.; Kusakabe, T.; Yamamoto, H.; Arioka, K.; Ochi, T.

1992-01-01

In order to improve the reliability of the Steam Generator (SG), TT Alloy 690 and BEC (Broached Egg Crate) type tube support plate has been developed. Some tests are carried out to heighten the reliability for these improvements all the more and the following results are obtained. (1) SERT test (Slow Extension Rate Test) made clear that TT690 has less IGA susceptibility in comparison with MA600. (2) The alkaline susceptibility on the occurrence of IGA/SCC on TT690 and MA600 obtained by SERT corresponds to that obtained by Model Boiler test. (3) By model boiler test, superior concentration behaviors for BEC type tube support plate configuration have been recognized in comparison with Drill type. This result is obtained by the joint research of the five utilities (Kansai Epco, Hokkaido Epco, Shikoku Epco, Kyushu Epco, JAPCO) and MHI

Effects of 90-day feeding of transgenic Bt rice TT51 on the reproductive system in male rats.

Science.gov (United States)

Wang, Er Hui; Yu, Zhou; Hu, Jing; Xu, Hai Bin

2013-12-01

Rice is a staple food crop; however, the threat of pests leads to a serious decline in its output and quality. The CryAb/CryAc gene, encodes a synthetic fusion Bacillus thuringiensis (Bt) crystal protein, was introduced into rice MingHui63 to produce insect-resistant rice TT51. This study was undertaken to investigate potential unintended effects of TT51 on the reproductive system in male rats. Male rats were treated with diets containing 60% of either TT51 or MingHui63 by weight, nutritionally balanced to an AIN93G diet, for 90days. An additional negative control group of rats were fed with a rice-based AIN93G diet. Body weights, food intake, hematology, serum chemistry, serum hormone levels, sperm parameters and relative organ/body weights were measured, and gross as well as microscopic pathology were examined. No diet-related significant differences in the values of response variables were observed between rats that were fed with diet containing transgenic TT51, MingHui63 and the control in this 90-day feeding study. In addition, necropsy and histopathology examination indicated no treatment-related changes. The results from the present study indicated that TT51 does not appear to exert any effect on the reproductive system in male rats compared with MingHui63 or the control. Copyright © 2013 Elsevier Ltd. All rights reserved.

Analytical TEM of service-induced SCC in alloy 600TT steam generator tubing

International Nuclear Information System (INIS)

Wolfe, R.; Legras, L.; Boccanfuso; Martin, A.

2015-01-01

In 2008, Vogtle Electric Generating Plant Unit 1 performed tube pulls to confirm outside diameter stress corrosion cracking (ODSCC) in a steam generator with thermally treated Alloy 600TT tubing. Subsequent metallographic and other laboratory work attributed the cracking to the non-optimal microstructure of the tubing and the elevated residual stresses at the expansion transition. In the current work, analytical transmission electron microscopy was performed to gain a better understanding of this in-service cracking through a detailed characterization of the oxides and crack tips. These examinations, which are the first of this kind for U.S. Alloy 600TT tubing service cracks, detected lead (Pb) in the region of the top-of-tube sheet crevice, in oxides at the crack tips, and at degraded grain boundaries. In addition, sulfur was observed in oxides on the outside surface of the tube in the free span area. The presence of Pb at the crack tip and the lack of plasticity on the observed failure surfaces suggest that the environment played a predominant role in the cracking of this tubing with a non-optimal microstructure. The significance of the degradation will be discussed in the context of overall corrosion indications in Alloy 600TT steam generators in the United States. (authors)

31 CFR 203.5 - Designation of financial institutions as TT&L depositaries.

Science.gov (United States)

2010-07-01

... PAYMENT OF FEDERAL TAXES AND THE TREASURY TAX AND LOAN PROGRAM General Information § 203.5 Designation of... authorized to maintain a TT&L account, TIP main account balance, SDI account balance, or TIO account balance...

Top associated Higgs production in the ttH into multileptons channel with one tau lepton in ATLAS

CERN Document Server

Seifert, Frank

2015-01-01

The measurement of the Higgs boson and its cross-section in top associated production allows a direct measurement of the top quark Yukawa coupling at tree level. This can be compared with the indirect one in gluon-gluon-fusion production. The decay channel of the ttH system in the multilepton final state gives one of the largest sensitivities. The sub-channel focused on here is that with two same-charged light leptons (electrons or muons) and one $\\tau_{\\rm{had}}$: ttH$\\rightarrow$2l+1$\\tau_{\\rm{had}}$. An overview over the ttH to multileptons analysis is given and the selection and data-driven background estimation of the 2l+1$\\tau_{\\rm{had}}$ channel is described in more detail. The analysis includes a dataset of 20.3fb$^{-1}$ which has been recorded in LHC Run1 at a center-of-mass energy of $\\sqrt{s}=8$TeV with the ATLAS detector. With the recorded data set of Run1 no significant excess of events above the background expectation could be observed and the best fit for the ttH production cross section combin...

Simulating Porous Magnetite Layer Deposited on Alloy 690TT Steam Generator Tubes.

Science.gov (United States)

Jeon, Soon-Hyeok; Son, Yeong-Ho; Choi, Won-Ik; Song, Geun Dong; Hur, Do Haeng

2018-01-02

In nuclear power plants, the main corrosion product that is deposited on the outside of steam generator tubes is porous magnetite. The objective of this study was to simulate porous magnetite that is deposited on thermally treated (TT) Alloy 690 steam generator tubes. A magnetite layer was electrodeposited on an Alloy 690TT substrate in an Fe(III)-triethanolamine solution. After electrodeposition, the dense magnetite layer was immersed to simulate porous magnetite deposits in alkaline solution for 50 days at room temperature. The dense morphology of the magnetite layer was changed to a porous structure by reductive dissolution reaction. The simulated porous magnetite layer was compared with flakes of steam generator tubes, which were collected from the secondary water system of a real nuclear power plant during sludge lancing. Possible nuclear research applications using simulated porous magnetite specimens are also proposed.

Meningococcal groups C and Y and haemophilus B tetanus toxoid conjugate vaccine (HibMenCY-TT; MenHibrix(®)): a review.

Science.gov (United States)

Perry, Caroline M

2013-05-01

The meningococcal groups C and Y and Haemophilus b (Hib) tetanus toxoid conjugate vaccine (HibMenCY-TT) contains Neisseria meningitidis serogroup C and Y capsular polysaccharide antigens, and Hib capsular polysaccharide [polyribosyl-ribitol-phosphate (PRP)]. The HibMenCY-TT vaccine is available in the USA for use as active immunization to prevent invasive disease caused by N. meningitidis serogroups C (MenC) and Y (MenY), and Hib in children 6 weeks-18 months of age. HibMenCY-TT is the first meningococcal vaccine available for use in the USA that can be administered to infants as young as 6 weeks of age. In a randomized, controlled, phase III clinical trial, the HibMenCY-TT vaccine, administered to infants at 2, 4, 6 and 12-15 months of age, was immunogenic against MenC and MenY, and met the prespecified criteria for immunogenicity. Anti-PRP antibodies, which have been shown to correlate with protection against Hib invasive disease, were also induced in the infants who received the HibMenCY-TT vaccine, with induced levels of this antibody noninferior to those occurring in the control group of infants who received a Hib tetanus toxoid conjugate vaccine at 2, 4, and 6 months and a single dose of Hib conjugated to N. meningitidis outer membrane protein at 12-15 months. In several randomized, controlled clinical trials, HibMenCY-TT was coadministered with vaccines that are routinely administered to infants and toddlers in the USA. These vaccines included: diphtheria and tetanus toxoids and acellular pertussis adsorbed, hepatitis B (recombinant) and inactivated poliovirus vaccine combined; 7-valent Streptococcus pneumoniae polysaccharide conjugate vaccine; measles, mumps and rubella vaccine; and varicella vaccine. Coadministration of these vaccines did not interfere with the immunogenicity of the HibMenCY-TT vaccine. Similarly, immune responses to the coadministered vaccines were not affected by the HibMenCY-TT vaccine. The tolerability profile of the HibMenCY-TT

Usable Translational Hand Controllers for NASA's Habitability Design Center

Science.gov (United States)

Westbrook, Kimberly

2016-01-01

This summer I was given the opportunity to work at the Habitability Design Center (HDC). NASA Johnson Space Center's HDC is currently developing Cislunar and Mars spacecraft mockups. I contributed to this effort by designing from scratch low cost, functional translational hand controllers (THCs) that will be used in spacecraft mission simulation in low to medium fidelity exploration spacecraft mockups. This project fell under the category of mechatronics, a combination of mechanical, electrical, and computer engineering. Being an aerospace engineering student, I was out of my comfort zone. And that was a wonderful thing. The autonomy that my mentor, Dr. Robert Howard, allowed me gave me the opportunity to learn by trying, failing, and trying again. This project was not only a professional success for me, but a significant learning experience. I appreciated the freedom that I had to take the time to learn new things for myself rather than blindly follow instructions. I was the sole person working on this project, and was required to work independently to solve the many hardware and software challenges that the project entailed. I researched THCs that have been used on the ISS, the Space Shuttle, and the Orion MPVC and based my design off of these. I worked through many redesigns before finding an optimal configuration of the necessary mechanisms and electrical components for the THC. Once I had a functional hardware design, I dove into the challenge of getting an Arduino Uno, an extremely low cost and easily programmable microcontroller, to behave as a human interface device. The THCs I built needed to be able to integrate to a mission simulation designed by NASA's Graphics and Visualization Lab. This proved to be the most challenging aspect of the project. To accomplish this I learned how to change the firmware of the USB serial converter microcontroller. The process was very complicated as it involved multiple software programs and manual flashing of pins on the

Safety and immunogenicity of a CRM or TT conjugated meningococcal vaccine in healthy toddlers.

Science.gov (United States)

Bona, Gianni; Castiglia, Paolo; Zoppi, Giorgio; de Martino, Maurizio; Tasciotti, Annaelisa; D'Agostino, Diego; Han, Linda; Smolenov, Igor

2016-06-17

MenACWY-CRM (Menveo(®); GlaxoSmithKline) and MenACWY-TT (Nimenrix(®); Pfizer) are two meningococcal vaccines licensed in the European Union for use in both children and adults. While both vaccines target meningococcal serogroups A, C, W and Y, immunogenicity and reactogenicity of these quadrivalent meningococcal conjugate vaccines may differ due to differences in formulation processes and chemical structure. Yet data on the comparability of these two vaccines are limited. The reactogenicity and immunogenicity of one dose of either MenACWY-CRM or MenACWY-TT were evaluated in healthy toddlers aged 12-15 months. Immunogenicity was assessed using serum bactericidal antibody assays (SBA) with human (hSBA) and rabbit (rSBA) complement. A total of 202 children aged 12-15 months were enrolled to receive one dose of MenACWY-CRM or MenACWY-TT. Similar numbers of subjects reported solicited reactions within 7 days following either vaccination. Tenderness at the injection site was the most common local reaction. Systemic reactions reported were similar for both vaccines and mostly mild to moderate in severity: irritability, sleepiness and change in eating habits were most commonly reported. Immunogenicity at 1 month post-vaccination was generally comparable for both vaccines across serogroups. At 6 months post-vaccination antibody persistence against serogroups C, W, and Y was substantial for both vaccines, as measured by both assay methodologies. For serogroup A, hSBA titers declined in both groups, while rSBA titers remained high. Despite differences in composition, the MenACWY-CRM and MenACWY-TT vaccines have comparable reactogenicity and immunogenicity profiles. Immediate immune responses and short-term antibody persistence were largely similar between groups. Both vaccines were well-tolerated and no safety concerns were identified. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Küsimus ja vastus / Kalmer Hütt, Mercedes Merimaa, Igor Jallai, Toomas Takkis

Index Scriptorium Estoniae

2007-01-01

Kandideerite riigikokku. Miks? Vastavad: Kalmer Hütt (Häädemeeste Keskkooli matemaatikaõpetaja), Mercedes Merimaa (Audru Keskkooli arvuti- ja bioloogiaõpetaja), Igor Jallai (Valga Vene Gümnaasiumi arvutiõpetaja), Toomas Takkis (Kuressaare Gümnaasiumi direktor)

Search for Dileptonic ttH(H->bb) with the ATLAS Detector

CERN Document Server

AUTHOR|(INSPIRE)INSPIRE-00403960

A search for the Higgs boson produced in association with a pair of top quarks ttH is presented. The analysis uses 13.2 fb$^{-1}$ of proton-proton collision data with a centre of mass energy of 13 TeV, collected by the ATLAS experiment at the LHC in 2015 and 2016. The search is optimised for events in which the top quarks decay into electrons or muons and the Higgs boson decays into bottom quarks. The analysis proceeds by separating the events into categories determined by the number of jets present in the event, and the number of those jets which are identified as originating from bottom hadrons. Multivariate techniques are used in the most signal rich regions to provide optimal separation between the signal and background processes. Finally, a template likelihood fit is performed simultaneously across all the regions, constraining the uncertainties on the analysis and determining the most likely value for the production cross section of ttH. The search found the best fit production cross section to be $4.6^...

Experiment-specific cosmic microwave background calculations made easier - Approximation formula for smoothed delta T/T windows

Science.gov (United States)

Gorski, Krzysztof M.

1993-01-01

Simple and easy to implement elementary function approximations are introduced to the spectral window functions needed in calculations of model predictions of the cosmic microwave backgrond (CMB) anisotropy. These approximations allow the investigator to obtain model delta T/T predictions in terms of single integrals over the power spectrum of cosmological perturbations and to avoid the necessity of performing the additional integrations. The high accuracy of these approximations is demonstrated here for the CDM theory-based calculations of the expected delta T/T signal in several experiments searching for the CMB anisotropy.

Just-in-time tomography (JiTT): a new concept for image-guided radiation therapy

International Nuclear Information System (INIS)

Pang, G; Rowlands, J A

2005-01-01

Soft-tissue target motion is one of the main concerns in high-precision radiation therapy. Cone beam computed tomography (CBCT) has been developed recently to image soft-tissue targets in the treatment room and guide the radiation therapy treatment. However, due to its relatively long image acquisition time the CBCT approach cannot provide images of the target at the instant of the treatment and thus it is not adequate for imaging targets with intrafraction motion. In this note, a new approach for image-guided radiation therapy-just-in-time tomography (JiTT)-is proposed. Differing from CBCT, JiTT takes much less time to generate the needed tomographical, beam's-eye-view images of the treatment target at the right moment to guide the radiation therapy treatment. (note)

Die vrou in T.T. Cloete se 'toepasslngs van dante'

Directory of Open Access Journals (Sweden)

R. Ward

1998-04-01

Full Text Available Woman in T.T. Cloete’s 'toepasslngs van dante' In T.T. Cloete's fourth collection of poems, Idiolek (1986, several references are made to the poetry of Dante Alighieri. At the core of this collection are three poems under the heading "toepassings van dante". The first, "Silhoeët van Beatrice", is a description of the outline of Beatrice's naked body. The second poem, "mooi marilyn monroe foto in rooi", is based on a pin-up of Marilyn Monroe posing naked against a backdrop of red velvet. Although these two women are almost exact opposites - Beatrice possessing a divine beauty and an almost Christ-like nature, whereas Marilyn Monroe is portrayed as a dumb blonde and sex symbol of the fifties - the two poems are suspiciously similar in style and content. Both women are portrayed as being fundamentally perfect ("fundamenteel perfek". In symbolizing the same virtues, they lose their unique and contrasting characteristics, and merge into a symbol of female perfection. Although the third poem, "columbae", does not have the Beatrice/Marilyn Monroe-figure as subject matter, it can be read as dealing with the issue of individuality and uniqueness, thus commenting on the previous two poems.

Categorization of the processes contributing to ttH(H→bb) using deep neural networks with the CMS experiment

Energy Technology Data Exchange (ETDEWEB)

Rath, Yannik; Erdmann, Martin; Fischer, Benjamin; Fischer, Robert; Heidemann, Fabian; Quast, Thorben; Rieger, Marcel [III. Physikalisches Institut A, RWTH Aachen University (Germany)

2016-07-01

In ttH(H→bb) analyses, event categorization is introduced to simultaneously constrain signal and background processes. A common procedure is to categorize events according to both their jet and b-tag multiplicities. The separation power of this approach is limited by the b-tagging efficiency. Especially ttH(H→bb) events with their high b-tag multiplicities suffer from migrations to background categories. In this presentation, we explore deep neural networks (DNNs) as a method of categorizing events according to their jet multiplicity and a DNN event class hypothesis. DNNs have the advantage of being able to learn discriminating features from low level variables, e.g. kinematic properties, and are naturally suited for multiclass classification problems. We compare the ttH signal separation achieved with the DNN method with that of a common categorization approach.

Predictive uncertainty reduction in coupled neutron-kinetics/thermal hydraulics modeling of the BWR-TT2 benchmark

Energy Technology Data Exchange (ETDEWEB)

Badea, Aurelian F., E-mail: aurelian.badea@kit.edu [Karlsruhe Institute of Technology, Vincenz-Prießnitz-Str. 3, 76131 Karlsruhe (Germany); Cacuci, Dan G. [Center for Nuclear Science and Energy/Dept. of ME, University of South Carolina, 300 Main Street, Columbia, SC 29208 (United States)

2017-03-15

Highlights: • BWR Turbine Trip 2 (BWR-TT2) benchmark. • Substantial (up to 50%) reduction of uncertainties in the predicted transient power. • 6660 uncertain model parameters were calibrated. - Abstract: By applying a comprehensive predictive modeling methodology, this work demonstrates a substantial (up to 50%) reduction of uncertainties in the predicted total transient power in the BWR Turbine Trip 2 (BWR-TT2) benchmark while calibrating the numerical simulation of this benchmark, comprising 6090 macroscopic cross sections, and 570 thermal-hydraulics parameters involved in modeling the phase-slip correlation, transient outlet pressure, and total mass flow. The BWR-TT2 benchmark is based on an experiment that was carried out in 1977 in the NPP Peach Bottom 2, involving the closure of the turbine stop valve which caused a pressure wave that propagated with attenuation into the reactor core. The condensation of the steam in the reactor core caused by the pressure increase led to a positive reactivity insertion. The subsequent rise of power was limited by the feedback and the insertion of the control rods. The BWR-TT2 benchmark was modeled with the three-dimensional reactor physics code system DYN3D, by coupling neutron kinetics with two-phase thermal-hydraulics. All 6660 DYN3D model parameters were calibrated by applying a predictive modeling methodology that combines experimental and computational information to produce optimally predicted best-estimate results with reduced predicted uncertainties. Simultaneously, the predictive modeling methodology yields optimally predicted values for the BWR total transient power while reducing significantly the accompanying predicted standard deviations.

Predictive uncertainty reduction in coupled neutron-kinetics/thermal hydraulics modeling of the BWR-TT2 benchmark

International Nuclear Information System (INIS)

Badea, Aurelian F.; Cacuci, Dan G.

2017-01-01

Highlights: • BWR Turbine Trip 2 (BWR-TT2) benchmark. • Substantial (up to 50%) reduction of uncertainties in the predicted transient power. • 6660 uncertain model parameters were calibrated. - Abstract: By applying a comprehensive predictive modeling methodology, this work demonstrates a substantial (up to 50%) reduction of uncertainties in the predicted total transient power in the BWR Turbine Trip 2 (BWR-TT2) benchmark while calibrating the numerical simulation of this benchmark, comprising 6090 macroscopic cross sections, and 570 thermal-hydraulics parameters involved in modeling the phase-slip correlation, transient outlet pressure, and total mass flow. The BWR-TT2 benchmark is based on an experiment that was carried out in 1977 in the NPP Peach Bottom 2, involving the closure of the turbine stop valve which caused a pressure wave that propagated with attenuation into the reactor core. The condensation of the steam in the reactor core caused by the pressure increase led to a positive reactivity insertion. The subsequent rise of power was limited by the feedback and the insertion of the control rods. The BWR-TT2 benchmark was modeled with the three-dimensional reactor physics code system DYN3D, by coupling neutron kinetics with two-phase thermal-hydraulics. All 6660 DYN3D model parameters were calibrated by applying a predictive modeling methodology that combines experimental and computational information to produce optimally predicted best-estimate results with reduced predicted uncertainties. Simultaneously, the predictive modeling methodology yields optimally predicted values for the BWR total transient power while reducing significantly the accompanying predicted standard deviations.

Die taal as katedraal: Driepas van T.T. Cloete

Directory of Open Access Journals (Sweden)

A. van Jaarsveld

1995-05-01

In the compilation of Driepas the poet T.T. Cloete intended to build a cathedral in language. In this article the structural characteristics of the Gothic cathedral, specifically those of the Chartres cathedral, are examined to determine possible structural correlations between the edifice and the poetic artefact. The structural links between the cathedral of Chartres and the poems in Driepas were mainly ascertained by implementing the analogy of Cloete’s bountiful usage of enumeration and his meticulous attention to detailed arrangement. This aspect has previously been overlooked by most critics of Driepas.

Just-in-time tomography (JiTT): a new concept for image-guided radiation therapy

Energy Technology Data Exchange (ETDEWEB)

Pang, G; Rowlands, J A [Toronto-Sunnybrook Regional Cancer Centre, 2075 Bayview Avenue, Toronto M4N 3M5 (Canada); Imaging Research, Sunnybrook and Women' s College Health Sciences Centre, Departments of Radiation Oncology and Medical Biophysics, University of Toronto, Toronto (Canada)

2005-11-07

Soft-tissue target motion is one of the main concerns in high-precision radiation therapy. Cone beam computed tomography (CBCT) has been developed recently to image soft-tissue targets in the treatment room and guide the radiation therapy treatment. However, due to its relatively long image acquisition time the CBCT approach cannot provide images of the target at the instant of the treatment and thus it is not adequate for imaging targets with intrafraction motion. In this note, a new approach for image-guided radiation therapy-just-in-time tomography (JiTT)-is proposed. Differing from CBCT, JiTT takes much less time to generate the needed tomographical, beam's-eye-view images of the treatment target at the right moment to guide the radiation therapy treatment. (note)

The TT, TB, EB and BB correlations in anisotropic inflation

Energy Technology Data Exchange (ETDEWEB)

Chen, Xingang [Department of Physics, The University of Texas at Dallas, Richardson, TX 75083 (United States); Emami, Razieh [School of Physics, Institute for Research in Fundamental Sciences (IPM), P. O. Box 19395-5531, Tehran (Iran, Islamic Republic of); Firouzjahi, Hassan [School of Astronomy, Institute for Research in Fundamental Sciences (IPM), P. O. Box 19395-5531, Tehran (Iran, Islamic Republic of); Wang, Yi, E-mail: Xingang.Chen@utdallas.edu, E-mail: emami@ipm.ir, E-mail: firouz@ipm.ir, E-mail: yw366@cam.ac.uk [Centre for Theoretical Cosmology, DAMTP, University of Cambridge, Cambridge CB3 0WA (United Kingdom)

2014-08-01

The ongoing and future experiments will measure the B-mode from different sky coverage and frequency bands, with the potential to reveal non-trivial features in polarization map. In this work we study the TT, TB, EB and BB correlations associated with the B-mode polarization of CMB map in models of charged anisotropic inflation. The model contains a chaotic-type large field complex inflaton which is charged under the U(1) gauge field. We calculate the statistical anisotropies generated in the power spectra of the curvature perturbation, the tensor perturbation and their cross-correlation. It is shown that the asymmetry in tensor power spectrum is a very sensitive probe of the gauge coupling. While the level of statistical anisotropy in temperature power spectrum can be small and satisfy the observational bounds, the interactions from the gauge coupling can induce large directional dependence in tensor modes. This will leave interesting anisotropic fingerprints in various correlations involving the B-mode polarization such as the TB cross-correlation which may be detected in upcoming Planck polarization data. In addition, the TT correlation receives an anisotropic contribution from the tensor sector which naturally decays after l ∼> 100. We expect that the mechanism of using tensor sector to induce asymmetry at low l to be generic which can also be applied to address other low l CMB anomalies.

Ambiguous Tilt and Translation Motion Cues in Astronauts after Space Flight

Science.gov (United States)

Clement, G.; Harm, D. L.; Rupert, A. H.; Beaton, K. H.; Wood, S. J.

2008-01-01

Adaptive changes during space flight in how the brain integrates vestibular cues with visual, proprioceptive, and somatosensory information can lead to impaired movement coordination, vertigo, spatial disorientation, and perceptual illusions following transitions between gravity levels. This joint ESA-NASA pre- and post-flight experiment is designed to examine both the physiological basis and operational implications for disorientation and tilt-translation disturbances in astronauts following short-duration space flights. The first specific aim is to examine the effects of stimulus frequency on adaptive changes in eye movements and motion perception during independent tilt and translation motion profiles. Roll motion is provided by a variable radius centrifuge. Pitch motion is provided by NASA's Tilt-Translation Sled in which the resultant gravitoinertial vector remains aligned with the body longitudinal axis during tilt motion (referred to as the Z-axis gravitoinertial or ZAG paradigm). We hypothesize that the adaptation of otolith-mediated responses to these stimuli will have specific frequency characteristics, being greatest in the mid-frequency range where there is a crossover of tilt and translation. The second specific aim is to employ a closed-loop nulling task in which subjects are tasked to use a joystick to null-out tilt motion disturbances on these two devices. The stimuli consist of random steps or sum-of-sinusoids stimuli, including the ZAG profiles on the Tilt-Translation Sled. We hypothesize that the ability to control tilt orientation will be compromised following space flight, with increased control errors corresponding to changes in self-motion perception. The third specific aim is to evaluate how sensory substitution aids can be used to improve manual control performance. During the closed-loop nulling task on both devices, small tactors placed around the torso vibrate according to the actual body tilt angle relative to gravity. We hypothesize

Corrosion fatigue cracking behavior of Inconel 690 (TT) in secondary water of pressurized water reactors

International Nuclear Information System (INIS)

Xiao Jun; Chen Luyao; Qiu Shaoyu; Chen Yong; Lin Zhenxia; Fu Zhenghong

2015-01-01

Inconel 690 (TT) is one of the key materials for tubes of steam generators for pressurized water reactors, where it is susceptible to corrosion fatigue cracking. In this paper, the corrosion fatigue cracking behavior of Inconel 690 (TT) was investigated under small scale yielding conditions, in the simulated secondary water of pressurized water reactor. It was observed that the fatigue crack growth rate was accelerated by a maximum factor up to 3 in the simulated secondary water, comparing to that in room temperature air. In addition, it was found that the accelerating effect was influenced by out-of-plane cracking of corrosion fatigue cracks and also correlated with stress intensity factor range, maximum stress intensity factor and stress ratio. (authors)

Efficient Translation of LTL Formulae into Buchi Automata

Science.gov (United States)

Giannakopoulou, Dimitra; Lerda, Flavio

2001-01-01

Model checking is a fully automated technique for checking that a system satisfies a set of required properties. With explicit-state model checkers, properties are typically defined in linear-time temporal logic (LTL), and are translated into B chi automata in order to be checked. This report presents how we have combined and improved existing techniques to obtain an efficient LTL to B chi automata translator. In particular, we optimize the core of existing tableau-based approaches to generate significantly smaller automata. Our approach has been implemented and is being released as part of the Java PathFinder software (JPF), an explicit state model checker under development at the NASA Ames Research Center.

Yhdessä kierrättämään : Raaseporin kaupungin työllisyysosaston työpajatoiminnan kehittämishanke

OpenAIRE

Westerholm, Leena

2016-01-01

Aktiivisen sosiaali- ja työvoimapolitiikan myötä ovat kuntien vastuut pitkäaikaistyöttömien palveluista lisääntyneet. Työllisyyskysymykset ovat muodostuneet luontevaksi osaksi sosiaalityötä. Kuntien lakisääteiset tehtävät sisältävät ikääntyvien työllistämisvelvoitteen, työmarkkinatuen rahoitusvastuun, työttömien terveyden edistämisen ja kuntouttavan työtoiminnan järjestämisen. Sosiaalihuoltolain alainen kuntouttava työtoiminta on kunnan järjestämää toimintaa, joka tähtää pitkäaikaistyöttömän ...

Structural and thermodynamic similarities of phases in the Li-Tt (Tt = Si, Ge) systems: redetermination of the lithium-rich side of the Li-Ge phase diagram and crystal structures of Li17Si4.0-xGex for x = 2.3, 3.1, 3.5, and 4 as well as Li4.1Ge.

Science.gov (United States)

Zeilinger, Michael; Fässler, Thomas F

2014-10-28

A reinvestigation of the lithium-rich section of the Li-Ge phase diagram reveals the existence of two new phases, Li17Ge4 and Li4.10Ge (Li16.38Ge4). Their structures are determined by X-ray diffraction experiments of large single crystals obtained from equilibrated melts with compositions Li95Ge5 and Li85Ge15. Excess melt is subsequently removed through isothermal centrifugation at 400 °C and 530 °C, respectively. Li17Ge4 crystallizes in the space group F4[combining macron]3m (a = 18.8521(3) Å, V = 6700.1(2) Å(3), Z = 20, T = 298 K) and Li4.10Ge (Li16.38Ge4) in Cmcm (a = 4.5511(2) Å, b = 22.0862(7) Å, c = 13.2751(4) Å, V = 1334.37(8) Å(3), Z = 16, T = 123 K). Both phases are isotypic with their Si counterparts and are further representative of the Li17Pb4 and Li4.11Si structure types. Additionally, the solid solutions Li17Si4-xGex follows Vegard's law. A comparison of the GeLin coordination polyhedra shows that isolated Ge atoms are 13- and 14-coordinated in Li17Ge4, whereas in Li16.38Ge4 the Ge atoms possess coordination numbers 12 and 13. Regarding the thermodynamic stability, Li16.38Ge4 is assigned a high-temperature phase existing between ∼400 °C and 627 °C, whereas Li17Ge4 decomposes peritectically at 520-522 °C. Additionally, the decomposition of Li16.38Ge4 below ∼400 °C was found to be very sluggish. These findings are manifested by differential scanning calorimetry, long-term annealing experiments and the results from melt equilibration experiments. Interestingly, the thermodynamic properties of the lithium-rich tetrelides Li17Tt4 and Li4.1Tt (Li16.4Tt4) are very similar (Tt = Si, Ge). Besides Li15Tt4, Li14Tt6, Li12Tt7, and LiTt, the title compounds are further examples of isotypic tetrelides in the systems Li-Tt.

The Impact of Machine Translation and Computer-aided Translation on Translators

Science.gov (United States)

Peng, Hao

2018-03-01

Under the context of globalization, communications between countries and cultures are becoming increasingly frequent, which make it imperative to use some techniques to help translate. This paper is to explore the influence of computer-aided translation on translators, which is derived from the field of the computer-aided translation (CAT) and machine translation (MT). Followed by an introduction to the development of machine and computer-aided translation, it then depicts the technologies practicable to translators, which are trying to analyze the demand of designing the computer-aided translation so far in translation practice, and optimize the designation of computer-aided translation techniques, and analyze its operability in translation. The findings underline the advantages and disadvantages of MT and CAT tools, and the serviceability and future development of MT and CAT technologies. Finally, this thesis probes into the impact of these new technologies on translators in hope that more translators and translation researchers can learn to use such tools to improve their productivity.

Human Infant Memory B Cell and CD4+ T Cell Responses to HibMenCY-TT Glyco-Conjugate Vaccine.

Directory of Open Access Journals (Sweden)

Angela Fuery

Full Text Available Carrier-specific T cell and polysaccharide-specific B cell memory responses are not well characterised in infants following glyco-conjugate vaccination. We aimed to determine if the number of Meningococcal (Men C- and Y- specific memory B cells and; number and quality of Tetanus Toxoid (TT carrier-specific memory CD4+ T cells are associated with polysaccharide-specific IgG post HibMenCY-TT vaccination. Healthy infants received HibMenCY-TT vaccine at 2, 4 and 6 months with a booster at 12 months. Peripheral blood mononuclear cells were isolated and polysaccharide-specific memory B cells enumerated using ELISpot. TT-specific memory CD4+ T cells were detected and phenotyped based on CD154 expression and intracellular TNF-α, IL-2 and IFN-γ expression following stimulation. Functional polysaccharide-specific IgG titres were measured using the serum bactericidal activity (SBA assay. Polysaccharide-specific Men C- but not Men Y- specific memory B cell frequencies pre-boost (12 months were significantly associated with post-boost (13 months SBA titres. Regression analysis showed no association between memory B cell frequencies post-priming (at 6 or 7 months and SBA at 12 months or 13 months. TT-specific CD4+ T cells were detected at frequencies between 0.001 and 0.112 as a percentage of CD3+ T cells, but their numbers were not associated with SBA titres. There were significant negative associations between SBA titres at M13 and cytokine expression at M7 and M12.Induction of persistent polysaccharide-specific memory B cells prior to boosting is an important determinant of secondary IgG responses in infants. However, polysaccharide-specific functional IgG responses appear to be independent of the number and quality of circulating carrier-specific CD4+ T cells after priming.

NDAS Hardware Translation Layer Development

Science.gov (United States)

Nazaretian, Ryan N.; Holladay, Wendy T.

2011-01-01

The NASA Data Acquisition System (NDAS) project is aimed to replace all DAS software for NASA s Rocket Testing Facilities. There must be a software-hardware translation layer so the software can properly talk to the hardware. Since the hardware from each test stand varies, drivers for each stand have to be made. These drivers will act more like plugins for the software. If the software is being used in E3, then the software should point to the E3 driver package. If the software is being used at B2, then the software should point to the B2 driver package. The driver packages should also be filled with hardware drivers that are universal to the DAS system. For example, since A1, A2, and B2 all use the Preston 8300AU signal conditioners, then the driver for those three stands should be the same and updated collectively.

Measurements of the top-quark mass and the tt cross section in the hadronic τ+jets decay channel at sqrt[s] = 1.96 TeV.

Science.gov (United States)

Aaltonen, T; Álvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Appel, J A; Arisawa, T; Artikov, A; Asaadi, J; Ashmanskas, W; Auerbach, B; Aurisano, A; Azfar, F; Badgett, W; Bae, T; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Barria, P; Bartos, P; Bauce, M; Bedeschi, F; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A; Bisello, D; Bizjak, I; Bland, K R; Blumenfeld, B; Bocci, A; Bodek, A; Bortoletto, D; Boudreau, J; Boveia, A; Brigliadori, L; Bromberg, C; Brucken, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Calamba, A; Calancha, C; Camarda, S; Campanelli, M; Campbell, M; Canelli, F; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chung, W H; Chung, Y S; Ciocci, M A; Clark, A; Clarke, C; Compostella, G; Convery, M E; Conway, J; Corbo, M; Cordelli, M; Cox, C A; Cox, D J; Crescioli, F; Cuevas, J; Culbertson, R; Dagenhart, D; d'Ascenzo, N; Datta, M; de Barbaro, P; Dell'orso, M; Demortier, L; Deninno, M; Devoto, F; d'Errico, M; Di Canto, A; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Dorigo, M; Dorigo, T; Ebina, K; Elagin, A; Eppig, A; Erbacher, R; Errede, S; Ershaidat, N; Eusebi, R; Farrington, S; Feindt, M; Fernandez, J P; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Funakoshi, Y; Furic, I; Gallinaro, M; Garcia, J E; Garfinkel, A F; Garosi, P; Gerberich, H; Gerchtein, E; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Ginsburg, C M; Giokaris, N; Giromini, P; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldin, D; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Grinstein, S; Grosso-Pilcher, C; Group, R C; Guimaraes da Costa, J; Hahn, S R; Halkiadakis, E; Hamaguchi, A; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harr, R F; Hatakeyama, K; Hays, C; Heck, M; Heinrich, J; Herndon, M; Hewamanage, S; Hocker, A; Hopkins, W; Horn, D; Hou, S; Hughes, R E; Hurwitz, M; Husemann, U; Hussain, N; Hussein, M; Huston, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Karchin, P E; Kasmi, A; Kato, Y; Ketchum, W; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kim, Y J; Kimura, N; Kirby, M; Klimenko, S; Knoepfel, K; Kondo, K; Kong, D J; Konigsberg, J; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Kruse, M; Krutelyov, V; Kuhr, T; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lecompte, T; Lee, E; Lee, H S; Lee, J S; Lee, S W; Leo, S; Leone, S; Lewis, J D; Limosani, A; Lin, C-J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, H; Liu, Q; Liu, T; Lockwitz, S; Loginov, A; Lucchesi, D; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lys, J; Lysak, R; Madrak, R; Maeshima, K; Maestro, P; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Martínez, M; Mastrandrea, P; Matera, K; Mattson, M E; Mazzacane, A; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Mesropian, C; Miao, T; Mietlicki, D; Mitra, A; Miyake, H; Moed, S; Moggi, N; Mondragon, M N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mukherjee, A; Muller, Th; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Naganoma, J; Nakano, I; Napier, A; Nett, J; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Noh, S Y; Norniella, O; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Ortolan, L; Pagan Griso, S; Pagliarone, C; Palencia, E; Papadimitriou, V; Paramonov, A A; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Pianori, E; Pilot, J; Pitts, K; Plager, C; Pondrom, L; Poprocki, S; Potamianos, K; Prokoshin, F; Pranko, A; Ptohos, F; Punzi, G; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Renton, P; Rescigno, M; Riddick, T; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rodriguez, T; Rogers, E; Rolli, S; Roser, R; Ruffini, F; Ruiz, A; Russ, J; Rusu, V; Safonov, A; Sakumoto, W K; Sakurai, Y; Santi, L; Sato, K; Saveliev, V; Savoy-Navarro, A; Schlabach, P; Schmidt, A; Schmidt, E E; Schwarz, T; Scodellaro, L; Scribano, A; Scuri, F; Seidel, S; Seiya, Y; Semenov, A; Sforza, F; Shalhout, S Z; Shears, T; Shepard, P F; Shimojima, M; Shochet, M; Shreyber-Tecker, I; Simonenko, A; Sinervo, P; Sliwa, K; Smith, J R; Snider, F D; Soha, A; Sorin, V; Song, H; Squillacioti, P; Stancari, M; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Strycker, G L; Sudo, Y; Sukhanov, A; Suslov, I; Takemasa, K; Takeuchi, Y; Tang, J; Tecchio, M; Teng, P K; Thom, J; Thome, J; Thompson, G A; Thomson, E; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Trovato, M; Ukegawa, F; Uozumi, S; Varganov, A; Vázquez, F; Velev, G; Vellidis, C; Vidal, M; Vila, I; Vilar, R; Vizán, J; Vogel, M; Volpi, G; Wagner, P; Wagner, R L; Wakisaka, T; Wallny, R; Wang, S M; Warburton, A; Waters, D; Wester, W C; Whiteson, D; Wicklund, A B; Wicklund, E; Wilbur, S; Wick, F; Williams, H H; Wilson, J S; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, H; Wright, T; Wu, X; Wu, Z; Yamamoto, K; Yamato, D; Yang, T; Yang, U K; Yang, Y C; Yao, W-M; Yeh, G P; Yi, K; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanetti, A; Zeng, Y; Zhou, C; Zucchelli, S

2012-11-09

We present the first direct measurement of the top-quark mass using tt events decaying in the hadronic τ+jets decay channel. Using data corresponding to an integrated luminosity of 2.2 fb(-1) collected by the CDF II detector in pp collisions at sqrt[s] = 1.96 TeV at the Fermilab Tevatron, we measure the tt cross section, σ(tt), and the top-quark mass, M(top). We extract M(top) from a likelihood based on per-event probabilities calculated with leading-order signal and background matrix elements. We measure σ(tt) = 8.8 ± 3.3(stat) ± 2.2(syst) pb and M(top) = 172.7 ± 9.3(stat) ± 3.7(syst) GeV/c(2).

Translation Theory 'Translated'

DEFF Research Database (Denmark)

Wæraas, Arild; Nielsen, Jeppe

2016-01-01

Translation theory has proved to be a versatile analytical lens used by scholars working from different traditions. On the basis of a systematic literature review, this study adds to our understanding of the ‘translations’ of translation theory by identifying the distinguishing features of the most...... common theoretical approaches to translation within the organization and management discipline: actor-network theory, knowledge-based theory, and Scandinavian institutionalism. Although each of these approaches already has borne much fruit in research, the literature is diverse and somewhat fragmented......, but also overlapping. We discuss the ways in which the three versions of translation theory may be combined and enrich each other so as to inform future research, thereby offering a more complete understanding of translation in and across organizational settings....

Binary translation using peephole translation rules

Science.gov (United States)

Bansal, Sorav; Aiken, Alex

2010-05-04

An efficient binary translator uses peephole translation rules to directly translate executable code from one instruction set to another. In a preferred embodiment, the translation rules are generated using superoptimization techniques that enable the translator to automatically learn translation rules for translating code from the source to target instruction set architecture.

Boosted Decision Tree Optimization for the ATLAS search of ttH production in the 2l same-sign channel

CERN Document Server

Rojas Huamani, Jairo Martin

2017-01-01

The main goal is to have a direct measurement of the Yukawa coupling of the Higgs boson to the top quark which is only possible in the production process → ttH + . In this analysis, final states with 2 same sign leptons (neutrinos not counted) have been used in order to estimate the expected significance of the ttH process. A study using Boosted Decision Trees was done using Monte Carlo simulation equivalent to a luminosity of 36.5 fb-1 at √s=13 TeV, characteristics of the years 2015 and 2016 of Run-2 at LHC. The focus of my summer student program was to investigate the performance of the BDT, mainly: To avoid building of a rigid and possible overtrained BTD (Boosted Decision Tree) in charge of identifying pp→ttH+X process by removing systematically the number of variables used in the analysis. Look the expected sensitivity’s dependence on different parameters that takes in account the BDT.

Measurement of the top-Yukawa coupling and the search for ttH production

CERN Document Server

Vasquez, Jared; The ATLAS collaboration

2015-01-01

To test whether the observed Higgs boson follows the predictions of the SM, careful study and measurement of its properties are necessary. Due to the top quark's large mass, a measurement of the top-Yukawa coupling (Y_t) is paramount to an understanding of EWSB and could provide a viable probe for new physics. While most production processes provide only an indirect measurement of Y_t via loop effects, the ttH and tH production allow for a direct tree-level measurement of the coupling strength (which could differ due to new physics contamination). The ttH process is probed through various Higgs decay channels with several advantages. The H->bb channel allows for a coupling measurement of both 3rd generation quarks while profiting from the largest Higgs branching ratio. The h->γγ channel has a much smaller branching ratio but benefits from a fine diphoton mass resolution. The process is also probed in the multilepton channel, which is targeted at the off-shell Higgs coupling of H->WW* and H->ZZ* as well as t...

A new topical hemostatic agent TT-173 reduces blood loss in a sheep model of total knee arthroplasty.

Science.gov (United States)

Centeno, Alberto; Rojas, Santiago; Arias, Belén; Miquel, Ignasi; Sánchez, Pilar; Ureta, Claudia; Rincón, Esther; López, Ramón; Murat, Jesús

2017-12-01

Total knee arthroplasty is associated with blood loss during the intervention and may require allogenic blood transfusion. Treatments such as tranexamic acid and fibrin sealants improved the bleeding control in several clinical trials, but the hemorrhage associated with the intervention is still significant. Thus far, very few studies have evaluated hemostatic treatments in animal models of total knee arthroplasty. This work describes a sheep model of bleeding associated with total knee arthroplasty and investigates a new class of hemostatic treatment based on recombinant tissue factor. Sheep were treated with the anticoagulant heparin, and the joint was accessed by a paramedial incision. Ligaments and menisci were eliminated and femoral condyles and tibia plateau were sectioned exposing the trabecular bone. An intra-articular drain was used to recover and quantify the blood loss during the 90-min period after treatment. The efficacy of one milligram and three milligrams of TT-173 was evaluated and compared with tranexamic acid. The occurrence of analytical alterations and systemic absorption was also investigated. Treatment with TT-173 reduced the blood loss in comparison with control or tranexamic acid. No significant differences were observed between the two doses evaluated. Moreover, a dose of six milligrams of TT-173 did not induce any clinical or analytical alteration, and significant systemic absorption was not observed. Data obtained strongly suggest that TT-173 could be useful in reducing the blood loss associated with total knee arthroplasty and without safety concerns derived from the systemic absorption of the product. Copyright © 2017 Elsevier B.V. All rights reserved.

Evidensgraderingssystemet GRADE : Ett sätt att granska vetenskaplig kunskap om metoder och arbetssätt i hälso- och sjukvården

OpenAIRE

Roback, Kerstin; Carlsson, Per

2009-01-01

Beslut om införande av nya behandlingsmetoder och arbetssätt i sjukvården präglas alltid av en viss grad av osäkerhet. De studier som gjorts av metodens för- och nackdelar kan vara av olika god kvalitet och därmed ge mer eller mindre säkra resultat. Efter att användningen av systematiska litteraturstudier vid medicinsk teknologiutvärdering tog fart på 1980-talet började man efterfråga ett beslutsunderlag som även tar hänsyn till olika studiers kvalitet. Detta initierade utvecklingen av flera ...

Machine Translation and Other Translation Technologies.

Science.gov (United States)

Melby, Alan

1996-01-01

Examines the application of linguistic theory to machine translation and translator tools, discusses the use of machine translation and translator tools in the real world of translation, and addresses the impact of translation technology on conceptions of language and other issues. Findings indicate that the human mind is flexible and linguistic…

Boiling water reactor turbine trip (TT) benchmark. Volume II: Summary Results of Exercise 1

International Nuclear Information System (INIS)

Akdeniz, Bedirhan; Ivanov, Kostadin N.; Olson, Andy M.

2005-06-01

The OECD Nuclear Energy Agency (NEA) completed under US Nuclear Regulatory Commission (NRC) sponsorship a PWR main steam line break (MSLB) benchmark against coupled system three-dimensional (3-D) neutron kinetics and thermal-hydraulic codes. Another OECD/NRC coupled-code benchmark was recently completed for a BWR turbine trip (TT) transient and is the object of the present report. Turbine trip transients in a BWR are pressurisation events in which the coupling between core space-dependent neutronic phenomena and system dynamics plays an important role. The data made available from actual experiments carried out at the Peach Bottom 2 plant make the present benchmark particularly valuable. While defining and coordinating the BWR TT benchmark, a systematic approach and level methodology not only allowed for a consistent and comprehensive validation process, but also contributed to the study of key parameters of pressurisation transients. The benchmark consists of three separate exercises, two initial states and five transient scenarios. The BWR TT Benchmark will be published in four volumes as NEA reports. CD-ROMs will also be prepared and will include the four reports and the transient boundary conditions, decay heat values as a function of time, cross-section libraries and supplementary tables and graphs not published in the paper version. BWR TT Benchmark - Volume I: Final Specifications was issued in 2001 [NEA/NSC/DOC(2001)]. The benchmark team [Pennsylvania State University (PSU) in co-operation with Exelon Nuclear and the NEA] has been responsible for coordinating benchmark activities, answering participant questions and assisting them in developing their models, as well as analysing submitted solutions and providing reports summarising the results for each phase. The benchmark team has also been involved in the technical aspects of the benchmark, including sensitivity studies for the different exercises. Volume II summarises the results for Exercise 1 of the

Raster Metafile and Raster Metafile Translator

Science.gov (United States)

Taylor, Nancy L.; Everton, Eric L.; Randall, Donald P.; Gates, Raymond L.; Skeens, Kristi M.

1989-01-01

The intent is to present an effort undertaken at NASA Langley Research Center to design a generic raster image format and to develop tools for processing images prepared in this format. Both the Raster Metafile (RM) format and the Raster Metafile Translator (RMT) are addressed. This document is intended to serve a varied audience including: users wishing to display and manipulate raster image data, programmers responsible for either interfacing the RM format with other raster formats or for developing new RMT device drivers, and programmers charged with installing the software on a host platform.

Harvesting NASA's Common Metadata Repository

Science.gov (United States)

Shum, D.; Mitchell, A. E.; Durbin, C.; Norton, J.

2017-12-01

As part of NASA's Earth Observing System Data and Information System (EOSDIS), the Common Metadata Repository (CMR) stores metadata for over 30,000 datasets from both NASA and international providers along with over 300M granules. This metadata enables sub-second discovery and facilitates data access. While the CMR offers a robust temporal, spatial and keyword search functionality to the general public and international community, it is sometimes more desirable for international partners to harvest the CMR metadata and merge the CMR metadata into a partner's existing metadata repository. This poster will focus on best practices to follow when harvesting CMR metadata to ensure that any changes made to the CMR can also be updated in a partner's own repository. Additionally, since each partner has distinct metadata formats they are able to consume, the best practices will also include guidance on retrieving the metadata in the desired metadata format using CMR's Unified Metadata Model translation software.

Influence of the Co-Administration of Heptavalent Conjugate Vaccine PCV7-TT on the Immunological Response Elicited by VA-MENGOC-BC® and Heberpenta®-L in Rabbits.

Science.gov (United States)

Espinosa-Viñals, Carlos; García-Rivera, Dagmar; Rodríguez Noda, Laura; Amador Gómez, Aylín; Nicot, Milagros; Valle, Orialys; Núñez, Juan F; Martin, Yanet; Santana, Darielys; Valdés, Yury; Vérez Bencomo, Vicente

2017-05-01

Finlay Vaccine Institute is developing a new heptavalent conjugate vaccine against Streptococcus pneumoniae. As infants are the target population, PCV7-TT will be necessarily co-administered with other vaccines, and then, the interactions represent a concern. The aim of this work is to evaluate the possible immunological interferences in rabbits as animal experimental model. Rabbits were immunized with Heberpenta®-L, VA-MENGOC-BC®, and PCV7-TT. Blood samples were taken fourteen days after final immunization for obtaining sera. Antibody responses to all antigens were evaluated by indirect ELISA. Functional responses against diphtheria and tetanus toxoid were done by in vivo seroneutralization assay. No interference was observed by PCV7-TT over the humoral response against diphtheria toxoid and meningococcal antigens (p > 0.05). A nonstatistically significant reduction (p > 0.05) was observed in the case of the humoral response against Haemophilus influenzae type b oligosaccharide. Concomitant administration of Heberpenta®-L and PCV7-TT increased twice the antibody titers as well as the protective activity against tetanus toxoid, but no statistical differences were found. The co-administration did not induce a reduction in the percent of responders against pneumococcal polysaccharides contained in PCV7-TT vaccine. Concomitant administration of PCV7-TT did not induce interferences over the evaluated antigens of Heberpenta®-L and VA-MENGOC-BC®. Also, no interference was observed on the immune response elicited by PCV7-TT. These preclinical results suggest that PCV7-TT will not result in a serious problem over the immune response elicited by the licensed vaccines Heberpenta®-L and VA-MENGOC-BC®. However, the clinical interference could be strictly studied during clinical trials in infants.

Development of Head Injury Assessment Reference Values Based on NASA Injury Modeling

Science.gov (United States)

Somers, Jeffrey T.; Melvin, John W.; Tabiei, Ala; Lawrence, Charles; Ploutz-Snyder, Robert; Granderson, Bradley; Feiveson, Alan; Gernhardt, Michael; Patalak, John

2011-01-01

NASA is developing a new capsule-based, crewed vehicle that will land in the ocean, and the space agency desires to reduce the risk of injury from impact during these landings. Because landing impact occurs for each flight and the crew might need to perform egress tasks, current injury assessment reference values (IARV) were deemed insufficient. Because NASCAR occupant restraint systems are more effective than the systems used to determine the current IARVs and are similar to NASA s proposed restraint system, an analysis of NASCAR impacts was performed to develop new IARVs that may be more relevant to NASA s context of vehicle landing operations. Head IARVs associated with race car impacts were investigated by completing a detailed analysis of all of the 2002-2008 NASCAR impact data. Specific inclusion and exclusion criteria were used to select 4071 impacts from the 4015 recorder files provided (each file could contain multiple impact events). Of the 4071 accepted impacts, 274 were selected for numerical simulation using a custom NASCAR restraint system and Humanetics Hybrid-III 50th percentile numerical dummy model in LS-DYNA. Injury had occurred in 32 of the 274 selected impacts, and 27 of those injuries involved the head. A majority of the head injuries were mild concussions with or without brief loss of consciousness. The 242 non-injury impacts were randomly selected and representative of the range of crash dynamics present in the total set of 4071 impacts. Head dynamics data (head translational acceleration, translational change in velocity, rotational acceleration, rotational velocity, HIC-15, HIC-36, and the Head 3ms clip) were filtered according to SAE J211 specifications and then transformed to a log scale. The probability of head injury was estimated using a separate logistic regression analysis for each log-transformed predictor candidate. Using the log transformation constrains the estimated probability of injury to become negligible as IARVs approach

Boiling water reactor turbine trip (TT) benchmark

International Nuclear Information System (INIS)

2001-06-01

In the field of coupled neutronics/thermal-hydraulics computation there is a need to enhance scientific knowledge in order to develop advanced modelling techniques for new nuclear technologies and concepts, as well as for current nuclear applications Recently developed 'best-estimate' computer code systems for modelling 3-D coupled neutronics/thermal-hydraulics transients in nuclear cores and for the coupling of core phenomena and system dynamics (PWR, BWR, VVER) need to be compared against each other and validated against results from experiments. International benchmark studies have been set up for the purpose. The present volume describes the specification of such a benchmark. The transient addressed is a turbine trip (TT) in a BWR involving pressurization events in which the coupling between core phenomena and system dynamics plays an important role. In addition, the data made available from experiments carried out at the plant make the present benchmark very valuable. The data used are from events at the Peach Bottom 2 reactor (a GE-designed BWR/4). (authors)

Multivariate Identification of Background Contributions for the H ! tt

CERN Document Server

Andrejkovic, Janik Walter

2016-01-01

Within the H ! tt analysis it is very important to understand the background contamination in the signal region coming from events where a jet is misidentified as a hadronic tau (fake events). Currently, the fake rate method is used to estimate the number and distributions of fake events in the signal region. This method relies on the correct identification of different background types. The study presented in this report focuses on the use of boosted decision trees in order to identify different background types. It is shown how the addition of more input variables, leading to a multi-dimensional multi-classification task, improves the overall identification accuracy of the different background types.

31 CFR 203.4 - Financial institution eligibility for designation as a TT&L depositary.

Science.gov (United States)

2010-07-01

... PAYMENT OF FEDERAL TAXES AND THE TREASURY TAX AND LOAN PROGRAM General Information § 203.4 Financial... secure TT&L account balances, a TIP main account balance, an SDI account balance, or a no account balance... Federal tax deposits through PATAX, a financial institution must possess under its charter either general...

Mechanical and Thermal Characterisation of a TT Half-Module Prototype

CERN Document Server

Lehner, F; Pangilinan, M; Siegler, M

2005-01-01

This note describes the mechanical effects of thermal cycles on a TT half-module, to demonstrate that the detectors can withstand the expected thermal gradients without damage. The stress transferred by the carbon fiber rails and the ceramic to the silicon sensors was investigated, and the deformation that occurred during these tests was measured by strain gauges that were attached to sensors on a test half-module. In addition, heat transfer through the carbon fiber rails was studied. Furthermore, we present a comparison of different materials proposed to build the carbon fiber rails of the modules.

NASA technology investments: building America's future

Science.gov (United States)

Peck, Mason

2013-03-01

Investments in technology and innovation enable new space missions, stimulate the economy, contribute to the nation's global competitiveness, and inspire America's next generation of scientists, engineers and astronauts. Chief Technologist Mason Peck will provide an overview of NASA's ambitious program of space exploration that builds on new technologies, as well as proven capabilities, as it expands humanity's reach into the solar system while providing broadly-applicable benefits here on Earth. Peck also will discuss efforts of the Office of the Chief Technologist to coordinate the agency's overall technology portfolio, identifying development needs, ensuring synergy and reducing duplication, while furthering the national initiatives as outlined by President Obama's Office of Science and Technology Policy. By coordinating technology programs within NASA, Peck's office facilitates integration of available and new technology into operational systems that support specific human-exploration missions, science missions, and aeronautics. The office also engages other government agencies and the larger aerospace community to develop partnerships in areas of mutual interest that could lead to new breakthrough capabilities. NASA technology transfer translates our air and space missions into societal benefits for people everywhere. Peck will highlight NASA's use of technology transfer and commercialization to help American entrepreneurs and innovators develop technological solutions that stimulate the growth of the innovation economy by creating new products and services, new business and industries and high quality, sustainable jobs.

MTHFR 677TT genotype and disease risk: is there a modulating role for B-vitamins?

Science.gov (United States)

Reilly, R; McNulty, H; Pentieva, K; Strain, J J; Ward, M

2014-02-01

Methylenetetrahydrofolate reductase (MTHFR) is a critical folate-metabolising enzyme which requires riboflavin as its co-factor. A common polymorphism (677C→T) in the MTHFR gene results in reduced MTHFR activity in vivo which in turn leads to impaired folate metabolism and elevated homocysteine concentrations. Homozygosity for this polymorphism (TT genotype) is associated with an increased risk of a number of conditions including heart disease and stroke, but there is considerable variability in the extent of excess risk in various reports. The present review will explore the evidence which supports a role for this polymorphism as a risk factor for a number of adverse health outcomes, and the potential modulating roles for B-vitamins in alleviating disease risk. The evidence is convincing in the case which links this polymorphism with hypertension and hypertensive disorders of pregnancy, particularly preeclampsia. Furthermore, elevated blood pressure was found to be highly responsive to riboflavin intervention specifically in individuals with the MTHFR 677TT genotype. Future intervention studies targeted at these genetically predisposed individuals are required to further investigate this novel gene-nutrient interaction. This polymorphism has also been associated with an increased risk of neural tube defects (NTD) and other adverse pregnancy outcomes; however, the evidence in this area has been inconsistent. Preliminary evidence has suggested that there may be a much greater need for women with the MTHFR 677TT genotype to adhere to the specific recommendation of commencing folic acid prior to conception for the prevention of NTD, but this requires further investigation.

ttH, H → WW(*) analysis at Atlas, LHC and Very Low Energy electron studies of 2004 combined test beam

International Nuclear Information System (INIS)

Zhang, H.

2008-06-01

The Large Hadron Collider(LHC) at CERN is a proton-proton collider with a designed center of mass energy of 14 TeV. ATLAS is a general purpose particle detector located at one of the colliding point of the LHC. Using ATLAS Computing System Commissioning (CSC) Monte Carlo full simulation data of the tt-bar H, H → WW * channel, this thesis studies the feasibility of measuring top-quark Yukawa Coupling up to 30 fb -1 integrated luminosity, within the intermediate Higgs mass range from 120 to 200 GeV. For the first time, trigger, pileup effects as well as all possible systematic uncertainties are extensively studied. For a Higgs mass of 160 GeV, with the detailed systematics uncertainties studied, the signal significance is shown to exceed 2σ by combining 2 leptons and 3 leptons final states together. The combined branching ratio of σ tt -bar H *BR H→WW (*) can reach an accuracy of 47%, and gives important information on the top quark Yukawa Coupling. This is the first study of the tt-bar H, H → WW * channel based on full simulation data, including a complete and detailed study of the systematic uncertainties. The most difficult part of the tt-bar H, H → WW * analysis is to extract signal from an abundant background since the total cross section of signal is only 0.1% of the main background. Moreover, signals have a complex final state of at least 4 jets, 2 leptons, 2 neutrinos, making the Higgs mass reconstruction very difficult. Lepton isolation is one of the most powerful method to suppress reducible backgrounds. This thesis develops a special Cone Isolation procedure, which suppress by a factor 5 the main tt-bar background. Lepton energy scale uncertainty is one of the important systematics for the tt-bar H, H → WW * analysis. A good linearity of Very Low Energy (VLE) electrons can improve the performance of estimating electron energy scale. The second part of this thesis presents a study of the linearity of VLE electron from 2004 ATLAS Combined Test

Engaging Students, Teachers, and the Public with NASA Astromaterials Research and Exploration Science (ARES) Assets

Science.gov (United States)

Graff, P. V.; Foxworth, S.; Kascak, A.; Luckey, M. K.; Mcinturff, B.; Runco, S.; Willis, K. J.

2016-01-01

Engaging students, teachers, and the public with NASA Astromaterials Research and Exploration Science (ARES) assets, including Science, Technology, Engineering and Mathematics (STEM) experts and NASA curation astromaterial samples, provides an extraordinary opportunity to connect citizens with authentic aspects unique to our nation's space program. Effective engagement can occur through both virtual connections such as webcasts and in-person connections at educator workshops and public outreach events. Access to NASA ARES assets combined with adaptable resources and techniques that engage and promote scientific thinking helps translate the science and research being facilitated through NASA exploration, elicits a curiosity that aims to carry over even after a given engagement, and prepares our next generation of scientific explorers.

Rare processes with top quarks: FCNCs, tt+X, tttt, t+X

CERN Document Server

Li, Yichen; The ATLAS collaboration

2018-01-01

The latest ATLAS and CMS searches or measurements of rare processes with top quarks, including FCNCs, tt+X, tttt, and t+X, are presented. FCNC branching ratio limits are pushed to new low, with some of them even reaching the expected limits for some BSMs. Associated production of W/Z/photon with a pair of top quarks are established and their cross sections are measured. The evidence of associated production of Z boson with a top quark is found. While there is no evidence for the four top quark production yet.

Mapping Translation Technology Research in Translation Studies

DEFF Research Database (Denmark)

Schjoldager, Anne; Christensen, Tina Paulsen; Flanagan, Marian

2017-01-01

section aims to improve this situation by presenting new and innovative research papers that reflect on recent technological advances and their impact on the translation profession and translators from a diversity of perspectives and using a variety of methods. In Section 2, we present translation......Due to the growing uptake of translation technology in the language industry and its documented impact on the translation profession, translation students and scholars need in-depth and empirically founded knowledge of the nature and influences of translation technology (e.g. Christensen....../Schjoldager 2010, 2011; Christensen 2011). Unfortunately, the increasing professional use of translation technology has not been mirrored within translation studies (TS) by a similar increase in research projects on translation technology (Munday 2009: 15; O’Hagan 2013; Doherty 2016: 952). The current thematic...

Coordinate independent expression for transverse trace-free tensors

International Nuclear Information System (INIS)

Conboye, Rory

2016-01-01

The transverse and trace-free (TT) part of the extrinsic curvature represents half of the dynamical degrees of freedom of the gravitational field in the 3 + 1 formalism. As such, it is part of the freely specifiable initial data for numerical relativity. Though TT tensors in three-space possess only two component degrees of freedom, they cannot ordinarily be given solely by two scalar potentials. Such expressions have been derived, however, in coordinate form, for all TT tensors in flat space which are also translationally or axially symmetric (Conboye and Murchadha 2014 Class. Quantum Grav. 31 085019). Since TT tensors are conformally covariant, these also give TT tensors in conformally flat space. In this article, the work above has been extended by giving a coordinate-independent expression for these TT tensors. The translational and axial symmetry conditions have also been generalized to invariance along any hypersurface orthogonal Killing vector. (paper)

Search for the Higgs boson in the tt-bar H(H→bb-bar) channel and the identification of jets containing 2 B hadrons with the ATLAS experiment

International Nuclear Information System (INIS)

Ticse Torres, R.E.

2016-01-01

In July 2012, CERN announced the discovery of the Higgs boson, the last missing piece of the Standard Model (SM). The Higgs boson has been observed coupling directly to W and Z bosons and tau leptons, and indirectly to top quarks. Observing the Higgs boson production in association with a pair of top quarks (tt-bar H) would allow a direct measurement of the top quark Yukawa coupling and provides an important test of the Higgs mechanism within the SM. This thesis presents a search for the Higgs boson in the tt-bar H(H→ bb-bar) channel using proton-proton collisions at √s=13 TeV, collected with the ATLAS detector in 2015 and 2016. The Higgs boson decays to two b quarks and top quark pair decays with one lepton, the tt-bar H → (lνb)(jjb)(bb-bar) single lepton channel, are considered. This document details in particular the contributions made by the author in this search: the full reconstruction of the tt-bar H(H → bb-bar) single lepton system and the final discrimination between signal and the main background, tt-bar+jets. A new method was developed to solve the large combinatorial background by fully reconstructing the tt-bar H(H → bb-bar) final state using a multivariate technique to uniquely associate each reconstructed jets to the initial quarks. A multivariate technique was also used to discriminate between the signal and the main tt-bar+jets background further increasing the sensitivity of the search compared to the Run 1 analysis. Finally, the first result at √s=13 TeV shown. The signal strength (the ratio between the measured and predicted cross sections) is found to be 1.6 ± 1.1. No significant excess of events above the background expectation is found and an observed (expected) limit of 3.6 (2.2) is set at 95% confidence level. The tt-bar bb-bar is one of the main backgrounds for the tt-bar H(bb-bar) search. Recent studies with Monte Carlo events generators show that there is a large fraction of tt-bar bb-bar events with jets containing two b

Measurement of the top quark mass in the tt¯→dilepton channel from s=8 TeV ATLAS data

Directory of Open Access Journals (Sweden)

M. Aaboud

2016-10-01

Full Text Available The top quark mass is measured in the tt¯→dilepton channel (lepton=e,μ using ATLAS data recorded in the year 2012 at the LHC. The data were taken at a proton–proton centre-of-mass energy of s=8 TeV and correspond to an integrated luminosity of about 20.2 fb−1. Exploiting the template method, and using the distribution of invariant masses of lepton–b-jet pairs, the top quark mass is measured to be mtop=172.99±0.41 (stat±0.74 (syst GeV, with a total uncertainty of 0.84 GeV. Finally, a combination with previous ATLAS mtop measurements from s=7 TeV data in the tt¯→dilepton and tt¯→lepton+jets channels results in mtop=172.84±0.34 (stat±0.61 (syst GeV, with a total uncertainty of 0.70 GeV.

Transformation with TT8 and HB12 RNAi Constructs in Model Forage (Medicago sativa, Alfalfa) Affects Carbohydrate Structure and Metabolic Characteristics in Ruminant Livestock Systems.

Science.gov (United States)

Li, Xinxin; Zhang, Yonggen; Hannoufa, Abdelali; Yu, Peiqiang

2015-11-04

Lignin, a phenylpropanoid polymer present in secondary cell walls, has a negative impact on feed digestibility. TT8 and HB12 genes were shown to have low expression levels in low-lignin tissues of alfalfa, but to date, there has been no study on the effect of down-regulation of these two genes in alfalfa on nutrient chemical profiles and availability in ruminant livestock systems. The objectives of this study were to investigate the effect of transformation of alfalfa with TT8 and HB12 RNAi constructs on carbohydrate (CHO) structure and CHO nutritive value in ruminant livestock systems. The results showed that transformation with TT8 and HB12 RNAi constructs reduced rumen, rapidly degraded CHO fractions (RDCA4, P = 0.06; RDCB1, P alfalfa with TT8 and HB12 RNAi constructs induced molecular structure changes. Different CHO functional groups had different sensitivities and different responses to the transformation. The CHO molecular structure changes induced by the transformation were associated with predicted CHO availability. Compared with HB12 RNAi, transformation with TT8 RNAi could improve forage quality by increasing the availability of both NDF and DM. Further study is needed on the relationship between the transformation-induced structure changes at a molecular level and nutrient utilization in ruminant livestock systems when lignification is much higher.

Sulfation diffusion model for SO{sub 2} capture on the T-T sorbent at moderate temperatures

Energy Technology Data Exchange (ETDEWEB)

Li, Y.R.; Yang, L.Z.; You, C.F.; Qi, H.Y. [Tsinghua University, Beijing (China)

2009-07-15

A sulfation model was developed for dry flue gas desulfurization (FGD) at moderate temperatures to describe the reaction characteristics of the T-T sorbent clusters and the fine CaO particles that fall off the sorbent grains in a circulating fluidized bed (CFB) reactor. The cluster model describes the calcium conversion and reaction rate for various size sorbent clusters. The sulfation reaction is first order with respect to the SO{sub 2} concentration above 973 K. The calcium conversion and reaction rate for the CaO particles were obtained by extrapolation. In the model for CaO particle, the reaction rate is linearly related to the calcium conversion and the SO{sub 2} concentration in the rapid reaction stage and linearly related only with the calcium conversion after the product layer forms. The sulfation model accurately describes the sulfation of the T-T sorbent flowing through a CFB reactor.

TT Mutant Homozygote of Is a Key Factor for Increasing Basal Metabolic Rate and Resting Metabolic Rate in Korean Elementary School Children

Directory of Open Access Journals (Sweden)

Jung Ran Choi

2013-12-01

Full Text Available We investigated the contribution of genetic variations of KLF5 to basal metabolic rate (BMR and resting metabolic rate (RMR and the inhibition of obesity in Korean children. A variation of KLF5 (rs3782933 was genotyped in 62 Korean children. Using multiple linear regression analysis, we developed a model to predict BMR in children. We divided them into several groups; normal versus overweight by body mass index (BMI and low BMR versus high BMR by BMR. There were no differences in the distributions of alleles and genotypes between each group. The genetic variation of KLF5 gene showed a significant correlation with several clinical factors, such as BMR, muscle, low-density lipoprotein cholesterol, and insulin. Children with the TT had significantly higher BMR than those with CC (p = 0.030. The highest muscle was observed in the children with TT compared with CC (p = 0.032. The insulin and C-peptide values were higher in children with TT than those with CC (p= 0.029 vs. p = 0.004, respectively. In linear regression analysis, BMI and muscle mass were correlated with BMR, whereas insulin and C-peptide were not associated with BMR. In the high-BMR group, we observed that higher muscle, fat mass, and C-peptide affect the increase of BMR in children with TT (p < 0.001, p < 0.001, and p = 0.018, respectively, while Rohrer's index could explain the usual decrease in BMR (adjust r2 = 1.000, p < 0.001, respectively. We identified a novel association between TT of KLF5 rs3782933 and BMR in Korean children. We could make better use of the variation within KLF5 in a future clinical intervention study of obesity.

Carriers of the TCF7L2 rs7903146 TT genotype have elevated levels of plasma glucose, serum proinsulin and plasma gastric inhibitory polypeptide (GIP) during a meal test

DEFF Research Database (Denmark)

Gjesing, A P; Kjems, L L; Vestmar, M A

2011-01-01

, proinsulin, insulin, C-peptide, glucagon, glucagon-like peptide-1 (GLP-1), glucagon-like peptide-2 (GLP-2) and gastric inhibitory polypeptide (GIP) among individuals carrying the high-risk rs7903146 TT genotype and low-risk CC genotype following a meal test. Methods A meal challenge was performed in 31......, 45, 60, 75, 90, 105, 120, 135, 150, 180, 210, and 240 min after ingestion of a standardised breakfast meal. Results An elevated incremental AUC for plasma glucose was observed among TT genotype carriers (CC carriers 21.8¿±¿101.9 mmol/l¿×¿min vs TT carriers 97.9¿±¿89.2 mmol/l¿×¿min, p¿=¿0.001). TT...

Understanding Translation

DEFF Research Database (Denmark)

Schjoldager, Anne Gram; Gottlieb, Henrik; Klitgård, Ida

Understanding Translation is designed as a textbook for courses on the theory and practice of translation in general and of particular types of translation - such as interpreting, screen translation and literary translation. The aim of the book is to help you gain an in-depth understanding...... of the phenomenon of translation and to provide you with a conceptual framework for the analysis of various aspects of professional translation. Intended readers are students of translation and languages, but the book will also be relevant for others who are interested in the theory and practice of translation...... - translators, language teachers, translation users and literary, TV and film critics, for instance. Discussions focus on translation between Danish and English....

Top associated Higgs production in the ttH to multileptons channel with one hadronic tau in ATLAS

CERN Document Server

Seifert, Frank; The ATLAS collaboration

2015-01-01

The measurement of the Higgs Boson and its cross-section in top associated production allows a direct measurement of the top quark Yukawa coupling at tree level. This can be compared with the indirect one in gluon-gluon-fusion production. The decay channel of the ttH system in the multilepton final state gives one of the largest sensitivities. The considered sub-channel is one with two same-charged light leptons (electrons or muons) and one hadronically decaying tau-lepton: ttH into 2l+1tau. This poster gives an overview of the analysis and explains in detail the data-driven background estimation of the non-reducible background processes. The analysis includes a dataset of 20.3 inverse fb which has been recorded in LHC Run I at a center-of-mass energy of 8 TeV with the ATLAS detector.

Site-targeted complement inhibition by a complement receptor 2-conjugated inhibitor (mTT30) ameliorates post-injury neuropathology in mouse brains.

Science.gov (United States)

Rich, Megan C; Keene, Chesleigh N; Neher, Miriam D; Johnson, Krista; Yu, Zhao-Xue; Ganivet, Antoine; Holers, V Michael; Stahel, Philip F

2016-03-23

Intracerebral complement activation after severe traumatic brain injury (TBI) leads to a cascade of neuroinflammatory pathological sequelae that propagate host-mediated secondary brain injury and adverse outcomes. There are currently no specific pharmacological agents on the market to prevent or mitigate the development of secondary cerebral insults after TBI. A novel chimeric CR2-fH compound (mTT30) provides targeted inhibition of the alternative complement pathway at the site of tissue injury. This experimental study was designed to test the neuroprotective effects of mTT30 in a mouse model of closed head injury. The administration of 500 μg mTT30 i.v. at 1 h, 4 h and 24 h after head injury attenuated complement C3 deposition in injured brains, reduced the extent of neuronal cell death, and decreased post-injury microglial activation, compared to vehicle-injected placebo controls. These data imply that site-targeted alternative pathway complement inhibition may represent a new promising therapeutic avenue for the future management of severe TBI. Copyright © 2016. Published by Elsevier Ireland Ltd.

The mycobiota of the production environments of traditional Norwegian salted and dried mutton (pinnekjøtt).

Science.gov (United States)

Schirmer, Bjørn C T; Wiik-Nielsen, Jannicke; Skaar, Ida

2018-07-02

In 2013, mould growth on Norwegian ready-to-sell pinnekjøtt (dried and cured lamb ribs) lead to the withdrawal of 200 tons of the product. The aim of this study was to identify the mycobiota at two Norwegian production sites and determine which species present the highest risk for reduced product quality and safety. A total of 485 samples from 2014, 2015 and 2016 were analysed for Penicillium and Aspergillus species. Both production sites showed a persistent mycobiota that remained stable over three seasons. Samples from site A were dominated by P. solitum while samples from site B were equally dominated by P. solitum, P. brevicompactum/bialowiezense and P. nordicum. The presence of P. nordicum was concentrated in one area of the production site where long-time stored hams were produced, but P. nordicum was also found sporadically in other parts of the site. Product samples taken from products with visible mould growth were at both sites dominated by P. solitum, highlighting its importance for product quality. P. nordicum was found frequently in the long-time stored hams, indicating a food safety risk of these products. However, P. nordicum was rarely isolated from pinnekjøtt. Aspergillus spp. were isolated from both sites at all samplings; however, there were no Aspergillus isolated from products, and no sites were repeatedly tested positive for identical species, indicating that Aspergillus is not a part of the persistent mycobiota, but enters the site sporadically. In conclusion, the study showed that a stable mycobiota consisting of few Penicillium species dominated the products and production environments of pinnekjøtt. Copyright © 2018 Elsevier B.V. All rights reserved.

Multi-proxy approach for palaeoclimate reconstruction using a loess-palaeosol sequence from Süttő , Hungary

Science.gov (United States)

Thiel, Christine; Königer, Paul; Ostertag-Henning, Christian; Scheeder, Georg; Novothny, Ágnes; Horváth, Erzsébet; Wacha, Lara; Techmer, Astrid; Frechen, Manfred

2010-05-01

The loess-palaeosol sequence at Süttő , Hungary contains a high-resolution terrestrial archive of palaeoenvironmental changes. The sequence is about 20 m thick and overlies travertine which was dated using Uranium-series to 235-314 ka (Sierralta et al., in press). Imbedded with the loess are two greyish stratified horizons, three brownish steppe-like soils and a pedocomplex composed of a reddish-brown palaeosol covered by a chernozem. Detailed dating studies were carried out (Novothny et al, 2009, Novothny et al., in press) revealing more or less continuous sedimentation from marine isotope stage (MIS) 6 to MIS 2. High-resolution grain size and magnetic susceptibility data exist (Novothny et al., in prep.) which allow for palaeoenvironmental reconstructions. In addition to those data sets we analysed the carbon and oxygen isotopic composition of bulk carbonate, carbonate nodules, and organic material in order to get further insight into palaeoprecipitation and palaeoclimatic conditions. To strengthen the interpretation based on isotopic data, we examined biomarkers derived from land plants (long-chain n-alkanes) for both loess and palaeosols to add information on the vegetation changes. We will discuss the new results in comparison with the published data sets and highlight inherent problems of the individual approaches. Novothny, A., Frechen, M., Horváth, E., Wacha, L., Rolf, C., in prep. High resolution grain size and magnetic susceptibility record of the last glacial cycles in the Süttő loess section, Hungary. Quaternary International. Novothny, A., Frechen, M., Horváth, E., Krbetschek, M., Tsukamoto, S., in press. Infrared stimulated luminescence and radiofluorescence dating of aeolian sediments from Hungary. Quaternary Geochronology, doi:10.1016/j.quageo.2009.05.002. Novothny, A., Frechen, M., Horváth, E., Bradák, B., Oches, E. A., McCoy, W. D., Stevens, T., 2009a. Luminescence and amino acid racemisation chronology of the loess-paleosol sequence

Mapping Translation Technology Research in Translation Studies

DEFF Research Database (Denmark)

Schjoldager, Anne; Christensen, Tina Paulsen; Flanagan, Marian

2017-01-01

/Schjoldager 2010, 2011; Christensen 2011). Unfortunately, the increasing professional use of translation technology has not been mirrored within translation studies (TS) by a similar increase in research projects on translation technology (Munday 2009: 15; O’Hagan 2013; Doherty 2016: 952). The current thematic...... section aims to improve this situation by presenting new and innovative research papers that reflect on recent technological advances and their impact on the translation profession and translators from a diversity of perspectives and using a variety of methods. In Section 2, we present translation...... technology research as a subdiscipline of TS, and we define and discuss some basic concepts and models of the field that we use in the rest of the paper. Based on a small-scale study of papers published in TS journals between 2006 and 2016, Section 3 attempts to map relevant developments of translation...

Search for anomalous kinematics in tt dilepton events at CDF II.

Science.gov (United States)

Acosta, D; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arisawa, T; Arguin, J-F; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barker, G J; Barnes, V E; Barnett, B A; Baroiant, S; Barone, M; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Ben-Haim, E; Benjamin, D; Beretvas, A; Bhatti, A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Bolla, G; Bolshov, A; Booth, P S L; Bortoletto, D; Boudreau, J; Bourov, S; Brau, B; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canepa, A; Casarsa, M; Carlsmith, D; Carron, S; Carosi, R; Cavalli-Sforza, M; Castro, A; Catastini, P; Cauz, D; Cerri, A; Cerrito, L; Chapman, J; Chen, C; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Chu, M L; Chuang, S; Chung, J Y; Chung, W-H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A G; Clark, D; Coca, M; Connolly, A; Convery, M; Conway, J; Cooper, B; Cordelli, M; Cortiana, G; Cranshaw, J; Cuevas, J; Culbertson, R; Currat, C; Cyr, D; Dagenhart, D; Da Ronco, S; D'Auria, S; de Barbaro, P; De Cecco, S; De Lentdecker, G; Dell'Agnello, S; Dell'Orso, M; Demers, S; Demortier, L; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J R; Dörr, C; Doksus, P; Dominguez, A; Donati, S; Donega, M; Donini, J; D'Onofrio, M; Dorigo, T; Drollinger, V; Ebina, K; Eddy, N; Ehlers, J; Ely, R; Erbacher, R; Erdmann, M; Errede, D; Errede, S; Eusebi, R; Fang, H-C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferretti, C; Field, R D; Flanagan, G; Flaugher, B; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Fujii, Y; Furic, I; Gajjar, A; Gallas, A; Galyardt, J; Gallinaro, M; Garcia-Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D W; Gerchtein, E; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giolo, K; Giordani, M; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, D; Goldstein, J; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Y; Goulianos, K; Gresele, A; Griffiths, M; Grosso-Pilcher, C; Grundler, U; Guenther, M; Guimaraes da Costa, J; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B-Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harr, R F; Harris, R M; Hartmann, F; Hatakeyama, K; Hauser, J; Hays, C; Hayward, H; Heider, E; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Hill, C; Hirschhbuehl, D; Hocker, A; Hoffman, K D; Holloway, A; Hou, S; Houlden, M A; Huffman, B T; Huang, Y; Hughes, R E; Huston, J; Ikado, K; Incandela, J; Introzzi, G; Iori, M; Ishizawa, Y; Issever, C; Ivanov, A; Iwata, Y; Iyutin, B; James, E; Jang, D; Jarrell, J; Jeans, D; Jensen, H; Jeon, E J; Jones, M; Joo, K K; Jun, S Y; Junk, T; Kamon, T; Kang, J; Karagoz Unel, M; Karchin, P E; Kartal, S; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, T H; Kim, Y K; King, B T; Kirby, M; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kobayashi, H; Koehn, P; Kong, D J; Kondo, K; Konigsberg, J; Kordas, K; Korn, A; Korytov, A; Kotelnikov, K; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreymer, A; Kroll, J; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, J; Lancaster, M; Lander, R; Lannon, K; Lath, A; Latino, G; Lauhakangas, R; Lazzizzera, I; Le, Y; Lecci, C; LeCompte, T; Lee, J; Lee, J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Li, K; Lin, C; Lin, C S; Lindgren, M; Liss, T M; Lister, A; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P; Lu, R-S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; MacQueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Malferrari, L; Manca, G; Marginean, R; Marino, C; Martin, A; Martin, M; Martin, V; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P M; McNamara, P; NcNulty, R; Mehta, A; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miller, L; Miller, R; Miller, J S; Miquel, R; Miscetti, S; Mitselmakher, G; Miyamoto, A; Miyazaki, Y; Moggi, N; Mohr, B; Moore, R; Morello, M; Movilla Fernandez, P A; Mukherjee, A; Mulhearn, M; Muller, T; Mumford, R; Munar, A; Murat, P; Nachtman, J; Nahn, S; Nakamura, I; Nakano, I; Napier, A; Napora, R; Naumov, D; Necula, V; Niell, F; Nielsen, J; Nelson, C; Nelson, T; Neu, C; Neubauer, M S; Newman-Holmes, C; Nigmanov, T; Nodulman, L; Norniella, O; Oesterberg, K; Ogawa, T; Oh, S H; Oh, Y D; Ohsugi, T; Okusawa, T; Oldeman, R; Orava, R; Orejudos, W; Pagliarone, C; Palencia, E; Paoletti, R; Papadimitriou, V; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Pauly, T; Paus, C; Pellett, D; Penzo, A; Phillips, T J; Piacentino, G; Piedra, J; Pitts, K T; Plager, C; Pompos, A; Pondrom, L; Pope, G; Portell, X; Poukhov, O; Prakoshyn, F; Pratt, T; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Rademachker, J; Rahaman, M A; Rakitine, A; Rappoccio, S; Ratnikov, F; Ray, H; Reisert, B; Rekovic, V; Renton, P; Rescigno, M; Rimondi, F; Rinnert, K; Ristori, L; Robertson, W J; Robson, A; Rodrigo, T; Rolli, S; Rosenson, L; Roser, R; Rossin, R; Rott, C; Russ, J; Rusu, V; Ruiz, A; Ryan, D; Saarikko, H; Sabik, S; Safonov, A; St Denis, R; Sakumoto, W K; Salamanna, G; Saltzberg, D; Sanchez, C; Sansoni, A; Santi, L; Sarkar, S; Sato, K; Savard, P; Savoy-Navarro, A; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Scodellaro, L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semeria, F; Sexton-Kennedy, L; Sfiligoi, I; Shapiro, M D; Shears, T; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Siegrist, J; Siket, M; Sill, A; Sinervo, P; Sisakyan, A; Skiba, A; Slaughter, A J; Sliwa, K; Smirnov, D; Smith, J R; Snider, F D; Snihur, R; Soha, A; Somalwar, S V; Spalding, J; Spezziga, M; Spiegel, L; Spinella, F; Spiropulu, M; Squillacioti, P; Stadie, H; Stelzer, B; Stelzer-Chilton, O; Strologas, J; Stuart, D; Sukhanov, A; Sumorok, K; Sun, H; Suzuki, T; Taffard, A; Tafirout, R; Takach, S F; Takano, H; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tanimoto, N; Tapprogge, S; Tecchio, M; Teng, P K; Terashi, K; Tesarek, R J; Tether, S; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Trkaczyk, S; Toback, D; Tollefson, K; Tomura, T; Tonelli, D; Tönnesmann, M; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tseng, J; Tsuchiya, R; Tsuno, S; Tsybychev, D; Turini, N; Turner, M; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vacavant, L; Vaiciulis, A; Varganov, A; Vataga, E; Vejcik, S; Velev, G; Veszpremi, V; Veramendi, G; Vickey, T; Vidal, R; Vila, I; Vilar, R; Vollrath, I; Volobouev, I; von der Mey, M; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wallny, R; Walter, T; Yamashita, T; Yamamoto, K; Wan, Z; Wang, M J; Wang, S M; Warburton, A; Ward, B; Waschke, S; Waters, D; Watts, T; Weber, M; Wester, W C; Whitehouse, B; Wicklund, A B; Wicklund, E; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolter, M; Worcester, M; Worm, S; Wright, T; Wu, X; Würthwein, F; Wyatt, A; Yagil, A; Yang, C; Yang, U K; Yao, W; Yeh, G P; Yi, K; Yoh, J; Yoon, P; Yorita, K; Yoshida, T; Yu, I; Yu, S; Yu, Z; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zetti, F; Zhou, J; Zsenei, A; Zucchelli, S

2005-07-08

We report on a search for anomalous kinematics of tt dilepton events in pp collisions at square root of s=1.96 TeV using 193 pb(-1) of data collected with the CDF II detector. We developed a new a priori technique designed to isolate the subset in a data sample revealing the largest deviation from standard model (SM) expectations and to quantify the significance of this departure. In the four-variable space considered, no particular subset shows a significant discrepancy, and we find that the probability of obtaining a data sample less consistent with the SM than what is observed is 1.0%-4.5%.

AGU testifies on NASA Budget

Science.gov (United States)

Simarski, Lynn Teo

Witnesses from outside the U.S. government—including Frank Eden, representing AGU—testified about the National Aeronautics and Space Administration's budget on March 12 before the House Science Committee's subcommittee on space. One major topic of the hearing was familiar: what should NASA's top priority be, space science or human exploration of space.“Obviously this committee has a huge job of trying to set priorities—consistent with the budget restraints—that will end up giving the American taxpayer the most bang for his buck, as well as providing direction for our space program,” said F. James Sensenbrenner, Jr. (R-Wis.), the subcommittee's ranking Republican. Another recurring topic, cited by the subcommittee's new chairman, Ralph M. Hall (D-Tex.), as well as by other committee members, was how to translate NASA-developed technologies into commercial gain for the U.S. in the global marketplace. Hall and others also posed a number of questions on a topic the chairman called a special concern of his: whether it would be economically and scientifically plausible for the U.S. to use the Soviet space station Mir for certain activities, such as medical applications.

Tc-MYBPA an Arabidopsis TT2-like transcription factor and functions in the regulation of proanthocyanidin synthesis in Theobroma cacao.

Science.gov (United States)

Liu, Yi; Shi, Zi; Maximova, Siela N; Payne, Mark J; Guiltinan, Mark J

2015-06-25

The flavan-3-ols catechin and epicatechin, and their polymerized oligomers, the proanthocyanidins (PAs, also called condensed tannins), accumulate to levels of up to 15 % of the total weight of dry seeds of Theobroma cacao L. These compounds have been associated with several health benefits in humans. They also play important roles in pest and disease defense throughout the plant. In Arabidopsis, the R2R3 type MYB transcription factor TT2 regulates the major genes leading to the synthesis of PA. To explore the transcriptional regulation of the PA synthesis pathway in cacao, we isolated and characterized an R2R3 type MYB transcription factor MYBPA from cacao. We examined the spatial and temporal gene expression patterns of the Tc-MYBPA gene and found it to be developmentally expressed in a manner consistent with its involvement in PAs and anthocyanin synthesis. Functional complementation of an Arabidopsis tt2 mutant with Tc-MYBPA suggested that it can functionally substitute the Arabidopsis TT2 gene. Interestingly, in addition to PA accumulation in seeds of the Tc-MYBPA expressing plants, we also observed an obvious increase of anthocyanidin accumulation in hypocotyls. We observed that overexpression of the Tc-MYBPA gene resulted in increased expression of several key genes encoding the major structural enzymes of the PA and anthocyanidin pathway, including DFR (dihydroflavanol reductase), LDOX (leucoanthocyanidin dioxygenase) and BAN (ANR, anthocyanidin reductase). We conclude that the Tc-MYBPA gene that encodes an R2R3 type MYB transcription factor is an Arabidopsis TT2 like transcription factor, and may be involved in the regulation of both anthocyanin and PA synthesis in cacao. This research may provide molecular tools for breeding of cacao varieties with improved disease resistance and enhanced flavonoid profiles for nutritional and pharmaceutical applications.

Nueva escuela elemental, en Eichstätt

Directory of Open Access Journals (Sweden)

HaindlEditorial, Friederich F.

1963-02-01

Full Text Available A modem elementary school has been built over part of the old moat at Eichstätt. The diferences in level of the ground have been exploited in order to achieve a more interesting distribution of the school buildings. The main building is L shaped. It contains 11 classrooms, workshops and a large recreation hall, which are located within the ground floor of one of the wings. The other wing includes the management's staircase, special classrooms, the hall porter's quarters and heating installations. Near the main building there is another block housing four classrooms, and both buildings are separated by a recreation ground, and connected by a roofed path. A further block, nearby, contains the gymnasium. There is direct access from the street to this building. The foundations consist of concrete piles, supported laterally by means of reinforced concrete beams. The floor and staircase structure is also made of reinforced concrete, and the roof is covered with fibrocement sheeting. The clever distribution of the inner courtyards, which are to be decorated with small gardens, the emplacement of the building in the moat, and the powerful contrast between the old city wall and the new buildings give the project a charming quality within the urban background, which also helps to emphasize even more the interest of the historical monuments.Una moderna escuela elemental ha sido construida sobre parte del viejo foso de la ciudad de Eichstätt, aprovechando para disponer los diversos bloques, las posibilidades que ofrecen los desniveles del terreno. La construcción principal —con planta en forma de L — contiene 11 clases, talleres y una gran nave para el recreo, situada en el piso inferior en uno de los brazos. En el otro están: la escalera de dirección, clases especiales, conserjería y vivienda del conserje e instalación de calefacción. Junto al edificio principal hay un bloque de cuatro clases, separado por un patio de recreo y enlazado por

Translational Creativity

DEFF Research Database (Denmark)

Nielsen, Sandro

2010-01-01

A long-established approach to legal translation focuses on terminological equivalence making translators strictly follow the words of source texts. Recent research suggests that there is room for some creativity allowing translators to deviate from the source texts. However, little attention...... is given to genre conventions in source texts and the ways in which they can best be translated. I propose that translators of statutes with an informative function in expert-to-expert communication may be allowed limited translational creativity when translating specific types of genre convention....... This creativity is a result of translators adopting either a source-language or a target-language oriented strategy and is limited by the pragmatic principle of co-operation. Examples of translation options are provided illustrating the different results in target texts. The use of a target-language oriented...

Topical Review: Translating Translational Research in Behavioral Science.

Science.gov (United States)

Hommel, Kevin A; Modi, Avani C; Piazza-Waggoner, Carrie; Myers, James D

2015-01-01

To present a model of translational research for behavioral science that communicates the role of behavioral research at each phase of translation. A task force identified gaps in knowledge regarding behavioral translational research processes and made recommendations regarding advancement of knowledge. A comprehensive model of translational behavioral research was developed. This model represents T1, T2, and T3 research activities, as well as Phase 1, 2, 3, and 4 clinical trials. Clinical illustrations of translational processes are also offered as support for the model. Behavioral science has struggled with defining a translational research model that effectively articulates each stage of translation and complements biomedical research. Our model defines key activities at each phase of translation from basic discovery to dissemination/implementation. This should be a starting point for communicating the role of behavioral science in translational research and a catalyst for better integration of biomedical and behavioral research. © The Author 2015. Published by Oxford University Press on behalf of the Society of Pediatric Psychology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Finite translation surfaces with maximal number of translations

OpenAIRE

Schlage-Puchta, Jan-Christoph; Weitze-Schmithuesen, Gabriela

2013-01-01

The natural automorphism group of a translation surface is its group of translations. For finite translation surfaces of genus g > 1 the order of this group is naturally bounded in terms of g due to a Riemann-Hurwitz formula argument. In analogy with classical Hurwitz surfaces, we call surfaces which achieve the maximal bound Hurwitz translation surfaces. We study for which g there exist Hurwitz translation surfaces of genus g.

Machine Translation Tools - Tools of The Translator's Trade

DEFF Research Database (Denmark)

Kastberg, Peter

2012-01-01

In this article three of the more common types of translation tools are presented, discussed and critically evaluated. The types of translation tools dealt with in this article are: Fully Automated Machine Translation (or FAMT), Human Aided Machine Translation (or HAMT) and Machine Aided Human...... Translation (or MAHT). The strengths and weaknesses of the different types of tools are discussed and evaluated by means of a number of examples. The article aims at two things: at presenting a sort of state of the art of what is commonly referred to as “machine translation” as well as at providing the reader...... with a sound basis for considering what translation tool (if any) is the most appropriate in order to meet his or her specific translation needs....

Comprehensive sulfation model verified for T-T sorbent clusters during flue gas desulfurization at moderate temperatures

Energy Technology Data Exchange (ETDEWEB)

Yuran Li; Haiying Qi; Changfu You; Lizhai Yang [Tsinghua University, Beijing (China). Key Laboratory for Thermal Science and Power Engineering of Ministry of Education

2010-08-15

An empirical sulfation model for T-T sorbent clusters was developed based on amassed experimental results under moderate temperatures (300-800{sup o}C). In the model, the reaction rate is a function of clusters mass, SO{sub 2} concentration, CO{sub 2} concentration, calcium conversion and temperature. The smaller pore volume partly results in a lower reaction rate at lower temperatures. The exponent on SO{sub 2} concentration is 0.88 in the rapid reaction stage and then decreases gradually as reaction progresses. The exponent on the fraction of the unreacted calcium is 1/3 in the first stage and then increases significantly in the second stage. The CO{sub 2} concentration has a negative influence on SO{sub 2} removal, especially for the temperature range of 400-650{sup o}C, which should be avoided to achieve a high effective calcium conversion. The sulfation model has been verified for the T-T sorbent clusters and has also been applied to CaO particles. Over extensive reaction conditions, the predictions agree well with experimental data. 17 refs., 10 figs., 2 tabs.

PolyWaTT: A polynomial water travel time estimator based on Derivative Dynamic Time Warping and Perceptually Important Points

Science.gov (United States)

Claure, Yuri Navarro; Matsubara, Edson Takashi; Padovani, Carlos; Prati, Ronaldo Cristiano

2018-03-01

Traditional methods for estimating timing parameters in hydrological science require a rigorous study of the relations of flow resistance, slope, flow regime, watershed size, water velocity, and other local variables. These studies are mostly based on empirical observations, where the timing parameter is estimated using empirically derived formulas. The application of these studies to other locations is not always direct. The locations in which equations are used should have comparable characteristics to the locations from which such equations have been derived. To overcome this barrier, in this work, we developed a data-driven approach to estimate timing parameters such as travel time. Our proposal estimates timing parameters using historical data of the location without the need of adapting or using empirical formulas from other locations. The proposal only uses one variable measured at two different locations on the same river (for instance, two river-level measurements, one upstream and the other downstream on the same river). The recorded data from each location generates two time series. Our method aligns these two time series using derivative dynamic time warping (DDTW) and perceptually important points (PIP). Using data from timing parameters, a polynomial function generalizes the data by inducing a polynomial water travel time estimator, called PolyWaTT. To evaluate the potential of our proposal, we applied PolyWaTT to three different watersheds: a floodplain ecosystem located in the part of Brazil known as Pantanal, the world's largest tropical wetland area; and the Missouri River and the Pearl River, in United States of America. We compared our proposal with empirical formulas and a data-driven state-of-the-art method. The experimental results demonstrate that PolyWaTT showed a lower mean absolute error than all other methods tested in this study, and for longer distances the mean absolute error achieved by PolyWaTT is three times smaller than empirical

LHC vector resonance searches in the tt̄Z final state

Energy Technology Data Exchange (ETDEWEB)

Backović, Mihailo [Center for Cosmology, Particle Physics and Phenomenology - CP3,Universite Catholique de Louvain,Louvain-la-neuve (Belgium); Flacke, Thomas [Center for Theoretical Physics of the Universe, Institute for Basic Science (IBS),Daejeon (Korea, Republic of); Department of Physics, Korea University,Seoul 02841 (Korea, Republic of); Jain, Bithika [School of Physics, Korea Institute for Advanced Study,Seoul 02455 (Korea, Republic of); Lee, Seung J. [Department of Physics, Korea University,Seoul 02841 (Korea, Republic of); School of Physics, Korea Institute for Advanced Study,Seoul 02455 (Korea, Republic of)

2017-03-23

LHC searches for BSM resonances in l{sup +}l{sup −}, jj, tt̄,γγ and VV final states have so far not resulted in discovery of new physics. Current results set lower limits on mass scales of new physics resonances well into the O(1) TeV range, assuming that the new resonance decays dominantly to a pair of Standard Model particles. While the SM pair searches are a vital probe of possible new physics, it is important to re-examine the scope of new physics scenarios probed with such final states. Scenarios where new resonances decay dominantly to final states other than SM pairs, even though well theoretically motivated, lie beyond the scope of SM pair searches. In this paper we argue that LHC searches for (vector) resonances beyond two particle final states would be useful complementary probes of new physics scenarios. As an example, we consider a class of composite Higgs models, and identify specific model parameter points where the color singlet, electrically neutral vector resonance ρ{sub 0} decays dominantly not to a pair of SM particles, but to a fermionic top partner T{sub f1} and a top quark, with T{sub f1}→tZ. We show that dominant decays of ρ{sub 0}→T{sub f1}t in the context of Composite Higgs models are possible even when the decay channel to a pair of T{sub f1} is kinematically open. Our analysis deals with scenarios where both m{sub ρ} and m{sub T{sub f{sub 1}}} are of O(1) TeV, leading to highly boosted tt̄Z final state topologies. We show that the particular composite Higgs scenario we consider is discoverable at the LHC13 with as little as 30 fb{sup −1}, while being allowed by other existing experimental constraints.

Test beam measurement of the first prototype of the fast silicon pixel monolithic detector for the TT-PET project

Science.gov (United States)

Paolozzi, L.; Bandi, Y.; Benoit, M.; Cardarelli, R.; Débieux, S.; Forshaw, D.; Hayakawa, D.; Iacobucci, G.; Kaynak, M.; Miucci, A.; Nessi, M.; Ratib, O.; Ripiccini, E.; Rücker, H.; Valerio, P.; Weber, M.

2018-04-01

The TT-PET collaboration is developing a PET scanner for small animals with 30 ps time-of-flight resolution and sub-millimetre 3D detection granularity. The sensitive element of the scanner is a monolithic silicon pixel detector based on state-of-the-art SiGe BiCMOS technology. The first ASIC prototype for the TT-PET was produced and tested in the laboratory and with minimum ionizing particles. The electronics exhibit an equivalent noise charge below 600 e‑ RMS and a pulse rise time of less than 2 ns , in accordance with the simulations. The pixels with a capacitance of 0.8 pF were measured to have a detection efficiency greater than 99% and, although in the absence of the post-processing, a time resolution of approximately 200 ps .

Translation Techniques

OpenAIRE

Marcia Pinheiro

2015-01-01

In this paper, we discuss three translation techniques: literal, cultural, and artistic. Literal translation is a well-known technique, which means that it is quite easy to find sources on the topic. Cultural and artistic translation may be new terms. Whilst cultural translation focuses on matching contexts, artistic translation focuses on matching reactions. Because literal translation matches only words, it is not hard to find situations in which we should not use this technique.  Because a...

Academic software development tools and techniques (Report on the 1st Workshop WASDeTT at ECOOP 2008)

NARCIS (Netherlands)

Wuyts, R.; Kienle, H.M.; Mens, K.; Brand, van den M.G.J.; Kuhn, A.; Eugster, P.

2009-01-01

The objective of the 1st International Workshop on Advanced Software Development Tools and Techniques (WASDeTT-1) was to provide interested researchers with a forum to share their tool building experiences and to explore how tools can be built more effectively and efficiently. The theme for this

Comparing Monte Carlo acceptance/efficiency for tt-bar single lepton events with central and plug electrons

International Nuclear Information System (INIS)

Rotaru, M.

2005-01-01

The tt-bar production using MC events with one charged lepton (electron), neutrino and jets from pp-bar collisions at a center-of-mass energy of 1.96 TeV was investigated. The aim of this work was to compare the rate of events in central (|η|<1.1) and plug (1.1<|η|<2.8) region. (author)

Translation Ambiguity but Not Word Class Predicts Translation Performance

Science.gov (United States)

Prior, Anat; Kroll, Judith F.; Macwhinney, Brian

2013-01-01

We investigated the influence of word class and translation ambiguity on cross-linguistic representation and processing. Bilingual speakers of English and Spanish performed translation production and translation recognition tasks on nouns and verbs in both languages. Words either had a single translation or more than one translation. Translation…

Examining English-German Translation Ambiguity Using Primed Translation Recognition

Science.gov (United States)

Eddington, Chelsea M.; Tokowicz, Natasha

2013-01-01

Many words have more than one translation across languages. Such "translation-ambiguous" words are translated more slowly and less accurately than their unambiguous counterparts. We examine the extent to which word context and translation dominance influence the processing of translation-ambiguous words. We further examine how these factors…

A GRAMMATICAL ADJUSTMENT ANALYSIS OF STATISTICAL MACHINE TRANSLATION METHOD USED BY GOOGLE TRANSLATE COMPARED TO HUMAN TRANSLATION IN TRANSLATING ENGLISH TEXT TO INDONESIAN

Directory of Open Access Journals (Sweden)

Eko Pujianto

2017-04-01

Full Text Available Google translate is a program which provides fast, free and effortless translating service. This service uses a unique method to translate. The system is called ―Statistical Machine Translation‖, the newest method in automatic translation. Machine translation (MT is an area of many kinds of different subjects of study and technique from linguistics, computers science, artificial intelligent (AI, translation theory, and statistics. SMT works by using statistical methods and mathematics to process the training data. The training data is corpus-based. It is a compilation of sentences and words of the languages (SL and TL from translation done by human. By using this method, Google let their machine discovers the rules for themselves. They do this by analyzing millions of documents that have already been translated by human translators and then generate the result based on the corpus/training data. However, questions arise when the results of the automatic translation prove to be unreliable in some extent. This paper questions the dependability of Google translate in comparison with grammatical adjustment that naturally characterizes human translators' specific advantage. The attempt is manifested through the analysis of the TL of some texts translated by the SMT. It is expected that by using the sample of TL produced by SMT we can learn the potential flaws of the translation. If such exists, the partial of more substantial undependability of SMT may open more windows to the debates of whether this service may suffice the users‘ need.

Calibration of the b-tagging algorithms of the jets issued from b quarks and measurement of the differential cross-section for the production of tt-bar pairs in relation to the mass and rapidity of the tt-bar system in p-p collisions at √(s) = 7 TeV in the ATLAS experiment at LHC

International Nuclear Information System (INIS)

Tannoury, N.

2012-01-01

During the first part of my thesis, I worked on commissioning and developing the System8 method, a data driven method which is used to calibrate the b-tagging algorithms with data. The b-tagging efficiency is a key ingredient to all physics analysis that involve b-jet signature, hence its importance. System8 consists of a non-linear system of 8 equations, where no general analytic solution is known. The system is solved using a minimization of a χ2 using MINUIT. The correlation factors for b and c jets are determined from simulation while the ones for the light-jets are determined from data. The full covariance matrix of the correlation factors is computed and used in the fit to allow a proper propagation of the statistical errors on these correlation factors. During the second half of my thesis, I had the opportunity to analyze a larger sample of data, almost 5 fb -1 , to perform the measurement of the tt-bar differential cross section as function of the tt-bar mass and the tt-bar rapidity. I carried out this measurement by selecting tt-bar event candidates with exactly one lepton, electron or muon, at least four jets with high energy and a large missing transverse energy. This selection gave me the opportunity to familiarize with the different reconstructed physics objects using the ATLAS detector. I estimated the different backgrounds using the standard recommendation of the ATLAS experiment and also reconstructed the tt-bar system using the KLFitter algorithm, which is widely used within the ATLAS collaboration. I applied the unfolding using the inverted matrix method and performed closure tests on simulations which ended with a very good agreement with the Monte Carlo truth. The measurement on data was done with the full estimation of the different systematic uncertainties. The results agree with NLO predictions and approximately NNLO predictions. No significant deviation from the SM expectations are observed. No resonance nor a distortion in the tt

Search for CP violation in tt̄ production and decay in proton-proton collisions at √s=8 TeV

Energy Technology Data Exchange (ETDEWEB)

Khachatryan, V.; Sirunyan, A.M.; Tumasyan, A. [Yerevan Physics Institute, Yerevan (Armenia); Adam, W. [Institut für Hochenergiephysik, Wien (Austria); Collaboration: The CMS collaboration; and others

2017-03-20

The results of a first search for CP violation in the production and decay of top quark-antiquark (tt̄) pairs are presented. The search is based on asymmetries in T-odd, triple-product correlation observables, where T is the time-reversal operator. The analysis uses a sample of proton-proton collisions at √s=8 TeV collected by the CMS experiment, corresponding to an integrated luminosity of 19.7 fb{sup −1}. Events are selected having one electron or muon and at least four jets. The T-odd observables are measured using four-momentum vectors associated with tt̄ production and decay. The measured asymmetries exhibit no evidence for CP-violating effects, consistent with the expectation from the standard model.

Translation-coupling systems

Science.gov (United States)

Pfleger, Brian; Mendez-Perez, Daniel

2013-11-05

Disclosed are systems and methods for coupling translation of a target gene to a detectable response gene. A version of the invention includes a translation-coupling cassette. The translation-coupling cassette includes a target gene, a response gene, a response-gene translation control element, and a secondary structure-forming sequence that reversibly forms a secondary structure masking the response-gene translation control element. Masking of the response-gene translation control element inhibits translation of the response gene. Full translation of the target gene results in unfolding of the secondary structure and consequent translation of the response gene. Translation of the target gene is determined by detecting presence of the response-gene protein product. The invention further includes RNA transcripts of the translation-coupling cassettes, vectors comprising the translation-coupling cassettes, hosts comprising the translation-coupling cassettes, methods of using the translation-coupling cassettes, and gene products produced with the translation-coupling cassettes.

The Role of Semantics in Translation Recognition: Effects of Number of Translations, Dominance of Translations and Semantic Relatedness of Multiple Translations

Science.gov (United States)

Laxen, Jannika; Lavaur, Jean-Marc

2010-01-01

This study aims to examine the influence of multiple translations of a word on bilingual processing in three translation recognition experiments during which French-English bilinguals had to decide whether two words were translations of each other or not. In the first experiment, words with only one translation were recognized as translations…

PERSONALITY TYPE AND TRANSLATION PERFORMANCE OF PERSIAN TRANSLATOR TRAINEES

Directory of Open Access Journals (Sweden)

Reza Shaki

2017-09-01

Full Text Available The study investigated the relationship between the personality typology of a sample of Iranian translation students and their translation quality in terms of expressive, appellative, and informative text types. The study also attempted to identify the personality types that can perform better in English to Persian translation of the three text types. For that purpose, the personality type and the translation quality of the participants was assessed using Myers-Briggs Type Indicator (MBTI personality test and translation quality assessment (TQA, respectively. The analysis of the data revealed that the personality type of the participants seemed relevant to the translation quality of all the text types. The translation quality of the participants with intuitive and thinking types was significantly better than the sensing type counterparts in translating expressive texts. The participants with intuitive and feeling types also performed better than their counterparts with sensing type in translation of the informative text. Moreover, the participants with intuitive, feeling, and thinking personality types performed more successfully than the participants with sensing type in translation of the appellative text. The findings of the study are discussed in light of the existing research literature.

Top-quark mass measurement in the tt-bar-dilepton channel using the full CDF Run II data set

International Nuclear Information System (INIS)

Budagov, J.; Glagolev, V.; Suslov, I.; Velev, G.

2014-01-01

We present a measurement of the top-quark mass with tt-bar-dilepton events using the full CDF Run II data set, which corresponds to an integrated luminosity of 9.1 fb -1 collected from √s = 1.96 TeV pp-bar collisions at the Fermilab Tevatron. A sample of 520 events is obtained after all selection requirements. The top-quark mass is estimated by a fit of the distribution of some variable to a sum of signal and background contributions. This variable is defined using special approach to reduce the systematic error due to the jet energy scale uncertainty. Templates are built from simulated tt-bar and background events, and parameterized in order to provide probability distribution functions. A likelihood fit of the data returns the top-quark mass of (170.80∓1.83 (stat.)∓2.69 (syst.)) GeV/c 2 (or (170.80∓3.25) GeV/c 2 ).

Discriminating between Higgs Boson models using e+e- → tt-bar h and Zh at the NLC

International Nuclear Information System (INIS)

Gunion, J. F.; He, X. G.

1997-01-01

In extensions of the Standard Model (SM) there are multiple neutral Higgs bosons. Their masses and couplings are often dependent upon many parameters; CP-violating mixing of CP-even with CP-odd neutral Higgs fields is generally possible. It is demonstrated that the process e + e - → tt-bar h at the NLC provides a powerful tool for extracting the tt-bar (Yukawa) couplings of the h. In combination with the e + e - → Zh process, an accurate determination of the ZZ coupling of the H is also possible. The resulting ability to distinguish different models of the Higgs sector is illustrated by detailed studies for two-Higgs-doublet models, for which the masses and couplings of the three neutral Higgs bosons are all free parameters. It is concluded that it is very possible that the SM is not correct. In this case, and if there is a weakly-coupled Higgs sector, there will certainly be Higgs bosons that do not have SM-like couplings. 3 refs., 3 figs

The Mystro system: A comprehensive translator toolkit

Science.gov (United States)

Collins, W. R.; Noonan, R. E.

1985-01-01

Mystro is a system that facilities the construction of compilers, assemblers, code generators, query interpretors, and similar programs. It provides features to encourage the use of iterative enhancement. Mystro was developed in response to the needs of NASA Langley Research Center (LaRC) and enjoys a number of advantages over similar systems. There are other programs available that can be used in building translators. These typically build parser tables, usually supply the source of a parser and parts of a lexical analyzer, but provide little or no aid for code generation. In general, only the front end of the compiler is addressed. Mystro, on the other hand, emphasizes tools for both ends of a compiler.

Machine translation

Energy Technology Data Exchange (ETDEWEB)

Nagao, M

1982-04-01

Each language has its own structure. In translating one language into another one, language attributes and grammatical interpretation must be defined in an unambiguous form. In order to parse a sentence, it is necessary to recognize its structure. A so-called context-free grammar can help in this respect for machine translation and machine-aided translation. Problems to be solved in studying machine translation are taken up in the paper, which discusses subjects for semantics and for syntactic analysis and translation software. 14 references.

Measurement of the tt production cross section in pp collisions at square root of s = 1.96 TeV.

Science.gov (United States)

Abulencia, A; Acosta, D; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J-F; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Ben Haim, E; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carron, S; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chapman, J; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Chu, P H; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciljak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Cresciolo, F; Cruz, A; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cyr, D; DaRonco, S; D'Auria, S; D'Onofrio, M; Dagenhart, D; de Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; Dell'Orso, M; Delli Paoli, F; Demers, S; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J R; DiTuro, P; Dörr, C; Donati, S; Donega, M; Dong, P; Donini, J; Dorigo, T; Dube, S; Ebina, K; Efron, J; Ehlers, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Field, R; Flanagan, G; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garcia, J E; Garcia Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giokaris, N; Giolo, K; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Y; Goulianos, K; Gresele, A; Griffiths, M; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, S R; Hahn, K; Halkiadakis, E; Hamilton, A; Han, B-Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harper, S; Harr, R F; Harris, R M; Hatakeyama, K; Hauser, J; Hays, C; Heijboer, A; Heinemann, B; Heinrich, J; Herndon, M; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ishizawa, Y; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Kang, J; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kobayashi, H; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kovalev, A; Kraan, A; Kraus, J; Kravchenko, I; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Liss, T M; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P; Lu, R-S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Maki, T; Maksimovic, P; Malde, S; Manca, G; Margaroli, F; Marginean, R; Marino, C; Martin, A; Martin, V; Martínez, M; Maruyama, T; Mastrandrea, P; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McFarlane, M; McIntyre, P; McNulty, R; Mehta, A; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; von der Mey, M; Miao, T; Miladinovic, N; Miles, J; Miller, R; Miller, J S; Mills, C; Milnik, M; Miquel, R; Mitra, A; Mitselmakher, G; Miyamoto, A; Moggi, N; Mohr, B; Moore, R; Morello, M; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Nachtman, J; Naganoma, J; Nahn, S; Nakano, I; Napier, A; Naumov, D; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nigmanov, T; Nodulman, L; Norniella, O; Nurse, E; Ogawa, T; Oh, S H; Oh, Y D; Okusawa, T; Oldeman, R; Orava, R; Osterberg, K; Pagliarone, C; Palencia, E; Paoletti, R; Papadimitriou, V; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Piedra, J; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Portell, X; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Rakitin, A; Rappoccio, S; Ratnikov, F; Reisert, B; Rekovic, V; van Remortel, N; Renton, P; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robertson, W J; Robson, A; Rodrigo, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Rott, C; Ruiz, A; Russ, J; Rusu, V; Saarikko, H; Sabik, S; Safonov, A; Sakumoto, W K; Salamanna, G; Saltó, O; Saltzberg, D; Sanchez, C; Santi, L; Sarkar, S; Sartori, L; Sato, K; Savard, P; Savoy-Navarro, A; Scheidle, T; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sfiligoi, I; Shapiro, M D; Shears, T; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sinervo, P; Sisakyan, A; Sjolin, J; Skiba, A; Slaughter, A J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Soderberg, M; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spezziga, M; Spinella, F; Spreitzer, T; Squillacioti, P; Stanitzki, M; Staveris-Polykalas, A; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Sumorok, K; Sun, H; Suzuki, T; Taffard, A; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tanimoto, N; Tecchio, M; Teng, P K; Terashi, K; Tether, S; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Tönnesmann, M; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tsuchiya, R; Tsuno, S; Turini, N; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vaiciulis, A; Vallecorsa, S; Varganov, A; Vataga, E; Velev, G; Veramendi, G; Veszpremi, V; Vidal, R; Vila, I; Vilar, R; Vine, T; Vollrath, I; Volobouev, I; Volpi, G; Würthwein, F; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wallny, R; Walter, T; Wan, Z; Wang, S M; Warburton, A; Waschke, S; Waters, D; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, G; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wright, T; Wu, X; Wynne, S M; Yagil, A; Yamamoto, K; Yamaoka, J; Yamashita, T; Yang, C; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zetti, F; Zhang, X; Zhou, J; Zucchelli, S

2006-08-25

We present a measurement of the top quark pair production cross section in pp collisions at square root of s = 1.96 TeV using 318 pb(-1) of data collected with the Collider Detector at Fermilab. We select tt[over ] decays into the final states enu+jets and mu nu+ jets, in which at least one b quark from the t-quark decays is identified using a secondary vertex-finding algorithm. Assuming a top quark mass of 178 GeV/c2, we measure a cross section of 8.7 +/- 0.9(stat)(-0.9)+1.1(syst) pb. We also report the first observation of tt[over ] with significance greater than 5sigma in the subsample in which both b quarks are identified, corresponding to a cross section of 10.1(-1.4)+1.6(stat)(-1.3)+2.0(syst) pb.

Translating Inclusion

DEFF Research Database (Denmark)

Fallov, Mia Arp; Birk, Rasmus

2018-01-01

The purpose of this paper is to explore how practices of translation shape particular paths of inclusion for people living in marginalized residential areas in Denmark. Inclusion, we argue, is not an end-state, but rather something which must be constantly performed. Active citizenship, today......, is not merely a question of participation, but of learning to become active in all spheres of life. The paper draws on empirical examples from a multi-sited field work in 6 different sites of local community work in Denmark, to demonstrate how different dimensions of translation are involved in shaping active...... citizenship. We propose the following different dimensions of translation: translating authority, translating language, translating social problems. The paper takes its theoretical point of departure from assemblage urbanism, arguing that cities are heterogeneous assemblages of socio-material interactions...

A novel process control method for a TT-300 E-Beam/X-Ray system

Science.gov (United States)

Mittendorfer, Josef; Gallnböck-Wagner, Bernhard

2018-02-01

This paper presents some aspects of the process control method for a TT-300 E-Beam/X-Ray system at Mediscan, Austria. The novelty of the approach is the seamless integration of routine monitoring dosimetry with process data. This allows to calculate a parametric dose for each production unit and consequently a fine grain and holistic process performance monitoring. Process performance is documented in process control charts for the analysis of individual runs as well as historic trending of runs of specific process categories over a specified time range.

Alignment Compensation for Bending Radius in TT40 and TI 8 Transfer Line Magnets

CERN Document Server

Weterings, W

2003-01-01

The BEATCH file for the TI 8 transfer lines specifies the position of the bending magnets assuming that the beam enters and exits at the centre of the vacuum pipe. In order to distribute the deflected beam evenly inside the vacuum tube, the alignment has to be compensated by moving the magnets half of the beam deflection away from the centre of the bending radius. In this note the saggitas of the various TT40 and TI 8 magnets are calculated and the alignment displacements tabulated for future reference.

Translation and Culture:Translation as a Cross-cultural Mediation

Institute of Scientific and Technical Information of China (English)

叶谋锦

2013-01-01

Translation is a complex activity which involves language competence as well as proficiency in multiculturalism. From the perspective of multiculturalism, translation resembles recreation of source text by grasping essential meanings to produce a sub-tle target text which can be clearly perceived by target readers. Ignoring cultural issues can present serious mistranslations in the field of advertising translation. This paper aims to explore the significance of connotation confined by the framework of culture and point out that verbal translation is a dangerous inclination by illustrating three business examples. This paper argues that cross-cultural mediation plays an important role in translation.

The Effect of Translators' Emotional Intelligence on Their Translation Quality

Science.gov (United States)

Varzande, Mohsen; Jadidi, Esmaeil

2015-01-01

Translators differ from each other in many ways in terms of their knowledge, professional and psychological conditions that may directly influence their translation. The present study aimed at investigating the impact of translators' Emotional Intelligence on their translation quality. Following a "causal-comparative study," a sample of…

Experimental study of the test module of the electromagnetic end-cap calorimeter for the ATLAS experiment. Study of the spin correlation in the production of pairs tt-bar; Etude experimentale des performances du module 0 du calorimetre electromagnetique bouchon d'ATLAS. Etude de la correlation de spin dans la production des paires tt-bar au LHC

Energy Technology Data Exchange (ETDEWEB)

Hinz, L

2001-06-01

LHC, the future CERN proton collider, will start in 2006. It will be devoted to a better understanding of the Standard Model and new physics research. With a 10 {integral}b{sup -1} per year at low luminosity during the first three years, then 100 {integral}b{sup -1} per year, and energy of 14 TeV in the center of mass, the LHC is designed to discover the Standard or SUSY Higgs boson, or probe signature of new physics. ATLAS, one of the four experiments at the LHC, can study a large physics range, as Higgs boson, top and bottom, gauge bosons and new particles expected by SUSY model or other models beyond the Standard Model. The CPPM laboratory is responsible of a part of the electromagnetic end-cap calorimeter for the ATLAS experiment. In 1999, an ATLAS-like prototype of module was stacked in Marseille and intensively tested at CERN. Description of the calorimeter and a part of test-beam results are presented in this PhD manuscript. In parallel, a study about potentiality of the tt-bar spin correlation measurement was done. The high tt-bar statistic produced at the LHC allows to explore the quark top properties in details and being sensitive to new physics phenomena. Signatures of such physics can be extracted from tt-bar decay product angular distributions which are sensitive to tt-bar spin correlation. (authors)

Translational Cellular Research on the International Space Station

Science.gov (United States)

Love, John; Cooley, Vic

2016-01-01

The emerging field of Translational Research aims to coalesce interdisciplinary findings from basic science for biomedical applications. To complement spaceflight research using human subjects, translational studies can be designed to address aspects of space-related human health risks and help develop countermeasures to prevent or mitigate them, with therapeutical benefits for analogous conditions experienced on Earth. Translational research with cells and model organisms is being conducted onboard the International Space Station (ISS) in connection with various human systems impacted by spaceflight, such as the cardiovascular, musculoskeletal, and immune systems. Examples of recent cell-based translational investigations on the ISS include the following. The JAXA investigation Cell Mechanosensing seeks to identify gravity sensors in skeletal muscle cells to develop muscle atrophy countermeasures by analyzing tension fluctuations in the plasma membrane, which changes the expression of key proteins and genes. Earth applications of this study include therapeutic approaches for some forms of muscular dystrophy, which appear to parallel aspects of muscle wasting in space. Spheroids is an ESA investigation examining the system of endothelial cells lining the inner surface of all blood vessels in terms of vessel formation, cellular proliferation, and programmed cell death, because injury to the endothelium has been implicated as underpinning various cardiovascular and musculoskeletal problems arising during spaceflight. Since endothelial cells are involved in the functional integrity of the vascular wall, this research has applications to Earth diseases such as atherosclerosis, diabetes, and hypertension. The goal of the T-Cell Activation in Aging NASA investigation is to understand human immune system depression in microgravity by identifying gene expression patterns of candidate molecular regulators, which will provide further insight into factors that may play a

Translating India

CERN Document Server

Kothari, Rita

2014-01-01

The cultural universe of urban, English-speaking middle class in India shows signs of growing inclusiveness as far as English is concerned. This phenomenon manifests itself in increasing forms of bilingualism (combination of English and one Indian language) in everyday forms of speech - advertisement jingles, bilingual movies, signboards, and of course conversations. It is also evident in the startling prominence of Indian Writing in English and somewhat less visibly, but steadily rising, activity of English translation from Indian languages. Since the eighties this has led to a frenetic activity around English translation in India's academic and literary circles. Kothari makes this very current phenomenon her chief concern in Translating India.   The study covers aspects such as the production, reception and marketability of English translation. Through an unusually multi-disciplinary approach, this study situates English translation in India amidst local and global debates on translation, representation an...

The Impact of Translators' Academic Experience on Their Translation Quality

Science.gov (United States)

Varzande, Mohsen; Jadidi, Esmaeil

2015-01-01

Translators differ from each other in many ways in terms of their knowledge and professional conditions that may directly influence their translation. The present study aimed at investigating the impact of translators' academic experience on their translation quality. Following a "causal-comparative study", a sample of 100 male and…

Translating Legal Collocations in Contract Agreements by Iraqi EFL Students-Translators

Directory of Open Access Journals (Sweden)

Muntaha A. Abdulwahid

2017-01-01

Full Text Available Legal translation of contract agreements is a challenge to translators as it involves combining the literary translation with the technical terminological precision. In translating legal contract agreements, a legal translator must utilize the lexical or syntactic precision and, more importantly, the pragmatic awareness of the context. This will guarantee an overall communicative process and avoid inconsistency in legal translation. However, the inability of the translator to meet these two functions in translating the contract item not only affects the contractors’ comprehension of the contract item but also affects the parties’ contractual obligations. In light of this, the purpose of this study was to find out how legal collocations used in contract agreements are translated from Arabic into English by student-translators in terms of (1 purely technical, (2 semi-technical, and (3 everyday vocabulary collocations. For the data collection, a multiple-choice collocation test was used to be answered by 35 EFL Iraqi undergraduate translator-students to decide on the aspects of weaknesses and strengths of their translation, thus decide on the aspects of correction. The findings showed that these students had serious problems in translating legal collocations as they lack the linguistic knowledge and pragmatic awareness needed to achieve the legal meaning and effect. They were also unable to make a difference among the three categories of legal collocations, purely technical, semi-technical, and everyday vocabulary collocations. These students should be exposed to more legal translation practices to obtain the required experience needed for their future career.

Translation Analysis on Civil Engineering Text Produced by Machine Translator

Directory of Open Access Journals (Sweden)

Sutopo Anam

2018-01-01

Full Text Available Translation is extremely needed in communication since people have serious problem in the language used. Translation activity is done by the person in charge for translating the material. Translation activity is also able to be done by machine. It is called machine translation, reflected in the programs developed by programmer. One of them is Transtool. Many people used Transtool for helping them in solving the problem related with translation activities. This paper wants to deliver how important is the Transtool program, how effective is Transtool program and how is the function of Transtool for human business. This study applies qualitative research. The sources of data were document and informant. This study used documentation and in dept-interviewing as the techniques for collecting data. The collected data were analyzed by using interactive analysis. The results of the study show that, first; Transtool program is helpful for people in translating the civil engineering text and it functions as the aid or helper, second; the working of Transtool software program is effective enough and third; the result of translation produced by Transtool is good for short and simple sentences and not readable, not understandable and not accurate for long sentences (compound, complex and compound complex thought the result is informative. The translated material must be edited by the professional translator.

Translation Analysis on Civil Engineering Text Produced by Machine Translator

Science.gov (United States)

Sutopo, Anam

2018-02-01

Translation is extremely needed in communication since people have serious problem in the language used. Translation activity is done by the person in charge for translating the material. Translation activity is also able to be done by machine. It is called machine translation, reflected in the programs developed by programmer. One of them is Transtool. Many people used Transtool for helping them in solving the problem related with translation activities. This paper wants to deliver how important is the Transtool program, how effective is Transtool program and how is the function of Transtool for human business. This study applies qualitative research. The sources of data were document and informant. This study used documentation and in dept-interviewing as the techniques for collecting data. The collected data were analyzed by using interactive analysis. The results of the study show that, first; Transtool program is helpful for people in translating the civil engineering text and it functions as the aid or helper, second; the working of Transtool software program is effective enough and third; the result of translation produced by Transtool is good for short and simple sentences and not readable, not understandable and not accurate for long sentences (compound, complex and compound complex) thought the result is informative. The translated material must be edited by the professional translator.

Lap time simulation and design optimisation of a brushed DC electric motorcycle for the Isle of Man TT Zero Challenge

Science.gov (United States)

Dal Bianco, N.; Lot, R.; Matthys, K.

2018-01-01

This works regards the design of an electric motorcycle for the annual Isle of Man TT Zero Challenge. Optimal control theory was used to perform lap time simulation and design optimisation. A bespoked model was developed, featuring 3D road topology, vehicle dynamics and electric power train, composed of a lithium battery pack, brushed DC motors and motor controller. The model runs simulations over the entire ? or ? of the Snaefell Mountain Course. The work is validated using experimental data from the BX chassis of the Brunel Racing team, which ran during the 2009 to 2015 TT Zero races. Optimal control is used to improve drive train and power train configurations. Findings demonstrate computational efficiency, good lap time prediction and design optimisation potential, achieving a 2 minutes reduction of the reference lap time through changes in final drive gear ratio, battery pack size and motor configuration.

Translation: between what can be translated and what must be translated

Directory of Open Access Journals (Sweden)

Magda Jeanrenaud

2016-02-01

Full Text Available Starting from a disconcerting interpretation of Jacques Derrida, our analysis aims at investigating and also tries to explain the blockage which appears in the English, French and Romanian translations (signed by Maurice de Gandillac, Antoine Berman, Laurent Lamy, Alexis Nouss, Harry Zohn, Steven Rendall, Martine Broda, Catrinel Pleșu etc. of a well-known text of Walter Benjamin, Die Aufgabe des Übersetzers, when translators transpose in their target languages the two quotations given by Benjamin: one of Mallarmé, left untranslated in the source text, and another, signed by Pannwitz. The fact is that both quotations have something in common: a discoursive form which results from an unusual syntax, as if they were already, in a certain sense, „translations”. As if the translators feared—a feature of the translator’s psychology?—not to render their text sufficiently accessible, even when the source text is not intended to be accessible. Hence the painful dilemma of the intentional fallacy (not only of the text to be translated.

Integrating Automatic Speech Recognition and Machine Translation for Better Translation Outputs

DEFF Research Database (Denmark)

Liyanapathirana, Jeevanthi

translations, combining machine translation with computer assisted translation has drawn attention in current research. This combines two prospects: the opportunity of ensuring high quality translation along with a significant performance gain. Automatic Speech Recognition (ASR) is another important area......, which caters important functionalities in language processing and natural language understanding tasks. In this work we integrate automatic speech recognition and machine translation in parallel. We aim to avoid manual typing of possible translations as dictating the translation would take less time...... to the n-best list rescoring, we also use word graphs with the expectation of arriving at a tighter integration of ASR and MT models. Integration methods include constraining ASR models using language and translation models of MT, and vice versa. We currently develop and experiment different methods...

The IBA rhodotron TT1000: a very high power E-beam accelerator

International Nuclear Information System (INIS)

Abs, M.; Jongen, Y.; Poncelet, E.; Bol, J.-L.

2004-01-01

Due to the relatively low conversion efficiency of electrons into X-rays, the use of X-rays on an industrial basis requires high-power high-energy electron accelerators. Based on its experience acquired in the development of the Rhodotron (Nucl. Instrum. Methods B 40/41 (1989) 943; Nucl. Instrum. Methods B 79 (1993) 865), IBA has launched a few years ago a vigorous R and D program to develop such high-power electron accelerator devoted to X-ray industrial applications. This research program resulted in the TT1000 Rhodotron aimed at delivering 5 and 7 MeV electron beams with a current intensity of 100 mA. This project is now reaching its final phase with the qualification tests of the first prototype of this new machine

(Con)figuring gender in Bible translation: Cultural, translational and ...

African Journals Online (AJOL)

The gendered intersection of cultural studies and Bible translation is under acknowledged. Accounting for gender criticism in translation work requires, besides responsible theory and practice of translation, also attention to interwoven gender critical aspects. After a brief investigation of the intersections between biblical, ...

Translation and identity: Translation of the Freedom Charter into ...

African Journals Online (AJOL)

A comparative analysis of the Afrikaans translations reveals how the respective translators struggled sporadically through certain ideological constraints in order to provide a satisfactory narrative. Their inability to internalise the principles contained in the Freedom Charter resulted in them presenting a 'framed' translation ...

Word translation entropy in translation

DEFF Research Database (Denmark)

Schaeffer, Moritz; Dragsted, Barbara; Hvelplund, Kristian Tangsgaard

2016-01-01

This study reports on an investigation into the relationship between the number of translation alternatives for a single word and eye movements on the source text. In addition, the effect of word order differences between source and target text on eye movements on the source text is studied....... In particular, the current study investigates the effect of these variables on early and late eye movement measures. Early eye movement measures are indicative of processes that are more automatic while late measures are more indicative of conscious processing. Most studies that found evidence of target...... language activation during source text reading in translation, i.e. co-activation of the two linguistic systems, employed late eye movement measures or reaction times. The current study therefore aims to investigate if and to what extent earlier eye movement measures in reading for translation show...

(Configuring gender in Bible translation: Cultural, translational and gender critical intersections

Directory of Open Access Journals (Sweden)

Jeremy Punt

2014-06-01

Full Text Available The gendered intersection of cultural studies and Bible translation is under acknowledged. Accounting for gender criticism in translation work requires, besides responsible theory and practice of translation, also attention to interwoven gender critical aspects. After a brief investigation of the intersections between biblical, translation and gender studies, translation in a few Pauline texts with bearing on gender and sexuality are investigated.

'Inhabiting' the Translator's Habitus – Antjie Krog as Translator ...

African Journals Online (AJOL)

Drawing on the Bourdieusian concept of habitus and its applicability in the field of translation, this article discusses Antjie Krog's profile in the practice of translation in. South Africa. Bourdieu's conceptualisation of the relationship between the initiating activities of translators and the structures which constrain and enable ...

Effects of TT8 and HB12 Silencing on the Relations between the Molecular Structures of Alfalfa ( Medicago sativa) Plants and Their Nutritional Profiles and In Vitro Gas Production.

Science.gov (United States)

Lei, Yaogeng; Hannoufa, Abdelali; Prates, Luciana Louzada; Shi, Haitao; Wang, Yuxi; Biligetu, Bill; Christensen, David; Yu, Peiqiang

2018-06-06

The objective of this study was to investigate the effects of silencing the TT8 and HB12 genes on the nutritive profiles and in vitro gas production of alfalfa in relation to the spectral molecular structures of alfalfa. TT8-silenced (TT8i, n = 5) and HB12-silenced (HB12i, n = 11) alfalfa were generated by RNA interference (RNAi) and grown with nontransgenic wild type controls (WT, n = 4) in a greenhouse. Alfalfa plants were harvested at early-to-mid vegetative stage. Samples were analyzed for their chemical compositions, CNCPS fractions, and in vitro gas production. Correlations and regressions of the nutritional profiles and in vitro gas production with the molecular spectral structures were also determined. The results showed that the transformed alfalfa had higher digestible fiber and lower crude protein with higher proportions of indigestible protein than WT. HB12 RNAi had lower gas production compared with those of the others. Some chemical, CNCPS, and gas-production profiles were closely correlated with spectral structures and could be well predicted from spectral parameters. In conclusion, the RNAi silencing of TT8 and HB12 in alfalfa altered the chemical, CNCPS and gas-production profiles of alfalfa, and such alterations were closely correlated with the inherent spectral structures of alfalfa.

Literal Translation using Google Translate in Translating the Text from French to English in Digital Tourism Brochure “Bienvenue À Paris”

Directory of Open Access Journals (Sweden)

Rila Hilma

2011-05-01

Full Text Available Translation is basically change of form. The form from which the translation is made will be called the source language and the form into which it is to be changed will be called the receptor language. Translation consists of transferring the meaning of the source language into the receptor language. Translating is not an easy job to do because many things to be considered to do this activity because translation means determining the meaning of a text, then reconstructing this same meaning using the appropriate structure and form in the receptor language. Translation is basically divided by two types of translation, one is literal and the other is idiomatic. Literal translation is really strict to the structure and form then often can not well express the true meaning of source language. Idiomatic translation makes every effort to communicate the meaning of the source language text in the natural forms of the receptor language. Then the most popular translation machine, Google Translate, in this study shows the results of translation which remain odd, unnatural, and nonsensical because the unsuccessful of message delivery, which is notably the typically error of literal translation.

The ICNP BaT - from translation tool to translation web service.

Science.gov (United States)

Schrader, Ulrich

2009-01-01

The ICNP BaT has been developed as a web application to support the collaborative translation of different versions of the ICNP into different languages. A prototype of a web service is described that could reuse the translations in the database of the ICNP BaT to provide automatic translations of nursing content based on the ICNP terminology globally. The translation web service is based on a service-oriented architecture making it easy to interoperate with different applications. Such a global translation server would free individual institutions from the maintenance costs of realizing their own translation services.

Kas õpetajad on teie kaudu tööd otsinud? / Natalija Gansen, Merit Laan, Ilmar Kütt... [jt.

Index Scriptorium Estoniae

2010-01-01

Küsimusele vastavad: Eesti töötukassa Tallinna ja Harjumaa osakonna teenusekonsultant Natalija Gansen, Eesti töötukassa Viljandimaa osakonna juhataja Merit Laan, Viljandi maavalitsuse haridus- ja sotsiaalosakonna juhataja Ilmar Kütt, CV-Online Estonia OÜ värbamisspetsialist Ivika Born, Lääne-Viru maavalitsuse haridus- ja sotsiaalosakonna vanemspetsialist Tiina Halling ja Valga maavalitsuse haridus- ja kultuuritalituse juhataja Kalle Vister

On Various Negative Translations

Directory of Open Access Journals (Sweden)

Gilda Ferreira

2011-01-01

Full Text Available Several proof translations of classical mathematics into intuitionistic mathematics have been proposed in the literature over the past century. These are normally referred to as negative translations or double-negation translations. Among those, the most commonly cited are translations due to Kolmogorov, Godel, Gentzen, Kuroda and Krivine (in chronological order. In this paper we propose a framework for explaining how these different translations are related to each other. More precisely, we define a notion of a (modular simplification starting from Kolmogorov translation, which leads to a partial order between different negative translations. In this derived ordering, Kuroda and Krivine are minimal elements. Two new minimal translations are introduced, with Godel and Gentzen translations sitting in between Kolmogorov and one of these new translations.

Lost in translation?

DEFF Research Database (Denmark)

Granas, Anne Gerd; Nørgaard, Lotte Stig; Sporrong, Sofia Kälvemark

2014-01-01

OBJECTIVE: The "Beliefs about Medicines Questionnaire" (BMQ) assess balance of necessity and concern of medicines. The BMQ has been translated from English to many languages. However, the original meaning of statements, such as "My medicine is a mystery to me", may be lost in translation. The aim...... of this study is to compare three Scandinavian translations of the BMQ. (1) How reliable are the translations? (2) Are they still valid after translation? METHODS: Translated Norwegian, Swedish and Danish versions of the BMQ were scrutinized by three native Scandinavian researchers. Linguistic differences...... and ambiguities in the 5-point Likert scale and the BMQ statements were compared. RESULTS: In the Scandinavian translations, the Likert scale expanded beyond the original version at one endpoint (Swedish) or both endpoints (Danish). In the BMQ statements, discrepancies ranged from smaller inaccuracies toward...

[Population health surveillance of the general population living near Turin (Northern Italy) incinerator (SPoTT): methodology of the study].

Science.gov (United States)

Bena, Antonella; Chiusolo, Monica; Orengia, Manuela; Cadum, Ennio; Farina, Elena; Musmeci, Loredana; Procopio, Enrico; Salamina, Giuseppe

2016-01-01

Si intende qui descrivere il sistema di sorveglianza sugli effetti sulla salute (SpoTT) dell'inquinamento ambientale nelle aree circostanti l'inceneritore di Torino. SPoTT ha 3 linee di attività: 1. monitoraggio epidemiologico degli effetti a breve termine attraverso analisi temporali e misura della correlazione tra livelli giornalieri di emissioni dell'impianto e andamento degli eventi individuati dagli archivi dei dimessi (SDO), di pronto soccorso e di mortalità; sono coinvolti coloro che nel 2013-2018 risiedevano nell'area di ricaduta delle emissioni; 2. sorveglianza epidemiologica degli effetti a lungo termine, stimando tassi standardizzati di mortalità e morbosità; a ogni soggetto è attribuito il valore stimato di esposizione cumulato nel tempo caratteristico della residenza anagrafica; le informazioni sulla salute sono reperite dagli archivi SDO, di mortalità e dai certificati di assistenza al parto; sono studiati due decenni pre-post l'avvio dell'impianto: 2003-2012 e 2013-2022; 3. monitoraggio biologico con misurazione pre-post di metalli, PCDD/F, PCB, OH-IPA; sono coinvolti 196 residenti esposti e 196 di controllo di 35-69 anni, campionati a caso dalle anagrafi comunali; sono effettuate misure di funzionalità endocrina e respiratoria, pressione arteriosa, rischio cardiovascolare; l'esposizione cumulativa sarà stimata per ciascuna persona campionata integrando l'indirizzo di residenza, il tempo di permanenza in ciascun indirizzo e i dati ricavati dai modelli di ricaduta; sarà costituita una biobanca per future indagini di laboratorio; sono coinvolti anche 20 allevatori e i lavoratori dell'impianto. Una quarta linea di attività, non descritta in questo articolo, riguarda il monitoraggio della salute dei lavoratori addetti all'impianto. SPoTT è il primo studio in Italia su inceneritori e salute che adotta un disegno di studio longitudinale di adeguata potenza sia per i residenti sia per i lavoratori. I primi risultati sono attesi nel corso del 2016.

TT Mutant Homozygote of Kruppel-like Factor 5 Is a Key Factor for Increasing Basal Metabolic Rate and Resting Metabolic Rate in Korean Elementary School Children.

Science.gov (United States)

Choi, Jung Ran; Kwon, In-Su; Kwon, Dae Young; Kim, Myung-Sunny; Lee, Myoungsook

2013-12-01

We investigated the contribution of genetic variations of KLF5 to basal metabolic rate (BMR) and resting metabolic rate (RMR) and the inhibition of obesity in Korean children. A variation of KLF5 (rs3782933) was genotyped in 62 Korean children. Using multiple linear regression analysis, we developed a model to predict BMR in children. We divided them into several groups; normal versus overweight by body mass index (BMI) and low BMR versus high BMR by BMR. There were no differences in the distributions of alleles and genotypes between each group. The genetic variation of KLF5 gene showed a significant correlation with several clinical factors, such as BMR, muscle, low-density lipoprotein cholesterol, and insulin. Children with the TT had significantly higher BMR than those with CC (p = 0.030). The highest muscle was observed in the children with TT compared with CC (p = 0.032). The insulin and C-peptide values were higher in children with TT than those with CC (p= 0.029 vs. p = 0.004, respectively). In linear regression analysis, BMI and muscle mass were correlated with BMR, whereas insulin and C-peptide were not associated with BMR. In the high-BMR group, we observed that higher muscle, fat mass, and C-peptide affect the increase of BMR in children with TT (p BMR (adjust r(2) = 1.000, p BMR in Korean children. We could make better use of the variation within KLF5 in a future clinical intervention study of obesity.

An Evergreen Challenge for Translators – The Translation of Idioms

Directory of Open Access Journals (Sweden)

Kovács Gabriella

2016-12-01

Full Text Available Translating idioms has always been a challenging decision-making process for translators mainly because not all idioms have direct equivalents in the target language. Translators usually and ideally have a solid knowledge of the target language and its cultural aspects, but even so they cannot match the ability of a native speaker in deciding when – i.e. in what context and text type – an idiom would or would not be appropriate. This study aims to explore the main characteristics of idioms and the difficulties which might occur when translating them. A needs analysis will also be presented, where the various solutions which a group of translator trainees chose while translating certain idioms from the novel “A Game of Thrones” by George R. R. Martin into Hungarian are examined. Their strategies and the appropriateness of their choices are analysed and compared with the options of the experienced literary translator (Tamás Pétersz. We consider this an important endeavour because, based on our experience, we believe that the topic of the translation of idioms should be included into the curriculum and appropriate materials and tasks should be designed to develop the translator trainees’ knowledge and skills in this domain. Therefore, the aim of this analysis is to obtain a clearer view of the difficulties they are dealing with and bear them in mind when designing teaching materials for them.

Translation in Language Teaching: Insights from Professional Translator Training

Science.gov (United States)

Carreres, Angeles; Noriega-Sanchez, Maria

2011-01-01

The past three decades have seen vast changes in attitudes towards translation, both as an academic discipline and as a profession. The insights we have gained in recent years, in particular in the area of professional translator training, call for a reassessment of the role of translation in language teaching. Drawing on research and practices in…

Lost in translation

DEFF Research Database (Denmark)

Hedegaard, Steffen; Simonsen, Jakob Grue

2011-01-01

of translated texts. Our results suggest (i) that frame-based classifiers are usable for author attribution of both translated and untranslated texts; (ii) that framebased classifiers generally perform worse than the baseline classifiers for untranslated texts, but (iii) perform as well as, or superior...... to the baseline classifiers on translated texts; (iv) that—contrary to current belief—naïve classifiers based on lexical markers may perform tolerably on translated texts if the combination of author and translator is present in the training set of a classifier....

Hydrides of Alkaline Earth–Tetrel (AeTt) Zintl Phases: Covalent Tt–H Bonds from Silicon to Tin

Energy Technology Data Exchange (ETDEWEB)

Auer, Henry; Guehne, Robin; Bertmer, Marko; Weber, Sebastian; Wenderoth, Patrick; Hansen, Thomas Christian; Haase, Jürgen; Kohlmann, Holger (Leipzig); (Saarland-MED); (ILL)

2017-01-18

Zintl phases form hydrides either by incorporating hydride anions (interstitial hydrides) or by covalent bonding of H to the polyanion (polyanionic hydrides), which yields a variety of different compositions and bonding situations. Hydrides (deuterides) of SrGe, BaSi, and BaSn were prepared by hydrogenation (deuteration) of the CrB-type Zintl phases AeTt and characterized by laboratory X-ray, synchrotron, and neutron diffraction, NMR spectroscopy, and quantum-chemical calculations. SrGeD4/3–x and BaSnD4/3–x show condensed boatlike six-membered rings of Tt atoms, formed by joining three of the zigzag chains contained in the Zintl phase. These new polyanionic motifs are terminated by covalently bound H atoms with d(Ge–D) = 1.521(9) Å and d(Sn–D) = 1.858(8) Å. Additional hydride anions are located in Ae4 tetrahedra; thus, the features of both interstitial hydrides and polyanionic hydrides are represented. BaSiD2–x retains the zigzag Si chain as in the parent Zintl phase, but in the hydride (deuteride), it is terminated by H (D) atoms, thus forming a linear (SiD) chain with d(Si–D) = 1.641(5) Å.

arXiv Test beam measurement of the first prototype of the fast silicon pixel monolithic detector for the TT-PET project

CERN Document Server

Paolozzi, L.; Benoit, M.; Cardarelli, R.; Débieux, S.; Forshaw, D.; Hayakawa, D.; Iacobucci, G.; Kaynak, M.; Miucci, A.; Nessi, M.; Ratib, O.; Ripiccini, E.; Rücker, H.; Valerio, P.; Weber, M.

2018-04-12

The TT-PET collaboration is developing a PET scanner for small animals with  30 ps  time-of-flight resolution and sub-millimetre 3D detection granularity. The sensitive element of the scanner is a monolithic silicon pixel detector based on state-of-the-art SiGe BiCMOS technology. The first ASIC prototype for the TT-PET was produced and tested in the laboratory and with minimum ionizing particles. The electronics exhibit an equivalent noise charge below  600 e− RMS  and a pulse rise time of less than  2 ns , in accordance with the simulations. The pixels with a capacitance of  0.8 pF  were measured to have a detection efficiency greater than  99%  and, although in the absence of the post-processing, a time resolution of approximately  200 ps .

Writing Through: Practising Translation

Directory of Open Access Journals (Sweden)

Joel Scott

2010-05-01

Full Text Available This essay exists as a segment in a line of study and writing practice that moves between a critical theory analysis of translation studies conceptions of language, and the practical questions of what those ideas might mean for contemporary translation and writing practice. Although the underlying preoccupation of this essay, and my more general line of inquiry, is translation studies and practice, in many ways translation is merely a way into a discussion on language. For this essay, translation is the threshold of language. But the two trails of the discussion never manage to elude each other, and these concatenations have informed two experimental translation methods, referred to here as Live Translations and Series Translations. Following the essay are a number of poems in translation, all of which come from Blanco Nuclear by the contemporary Spanish poet, Esteban Pujals Gesalí. The first group, the Live Translations consist of transcriptions I made from audio recordings read in a public setting, in which the texts were translated in situ, either off the page of original Spanish-language poems, or through a process very much like that carried out by simultaneous translators, for which readings of the poems were played back to me through headphones at varying speeds to be translated before the audience. The translations collected are imperfect renderings, attesting to a moment in language practice rather than language objects. The second method involves an iterative translation process, by which three versions of any one poem are rendered, with varying levels of fluency, fidelity and servility. All three translations are presented one after the other as a series, with no version asserting itself as the primary translation. These examples, as well as the translation methods themselves, are intended as preliminary experiments within an endlessly divergent continuum of potential methods and translations, and not as a complete representation of

Implementing Toxicity Testing in the 21st Century (TT21C): Making safety decisions using toxicity pathways, and progress in a prototype risk assessment

International Nuclear Information System (INIS)

Adeleye, Yeyejide; Andersen, Melvin; Clewell, Rebecca; Davies, Michael; Dent, Matthew; Edwards, Sue; Fowler, Paul; Malcomber, Sophie; Nicol, Beate; Scott, Andrew; Scott, Sharon; Sun, Bin; Westmoreland, Carl; White, Andrew; Zhang, Qiang; Carmichael, Paul L.

2015-01-01

Risk assessment methodologies in toxicology have remained largely unchanged for decades. The default approach uses high dose animal studies, together with human exposure estimates, and conservative assessment (uncertainty) factors or linear extrapolations to determine whether a specific chemical exposure is ‘safe’ or ‘unsafe’. Although some incremental changes have appeared over the years, results from all new approaches are still judged against this process of extrapolating high-dose effects in animals to low-dose exposures in humans. The US National Research Council blueprint for change, entitled Toxicity Testing in the 21st Century: A Vision and Strategy called for a transformation of toxicity testing from a system based on high-dose studies in laboratory animals to one founded primarily on in vitro methods that evaluate changes in normal cellular signalling pathways using human-relevant cells or tissues. More recently, this concept of pathways-based approaches to risk assessment has been expanded by the description of ‘Adverse Outcome Pathways’ (AOPs). The question, however, has been how to translate this AOP/TT21C vision into the practical tools that will be useful to those expected to make safety decisions. We have sought to provide a practical example of how the TT21C vision can be implemented to facilitate a safety assessment for a commercial chemical without the use of animal testing. To this end, the key elements of the TT21C vision have been broken down to a set of actions that can be brought together to achieve such a safety assessment. Such components of a pathways-based risk assessment have been widely discussed, however to-date, no worked examples of the entire risk assessment process exist. In order to begin to test the process, we have taken the approach of examining a prototype toxicity pathway (DNA damage responses mediated by the p53 network) and constructing a strategy for the development of a pathway based risk assessment for a

Implementing Toxicity Testing in the 21st Century (TT21C): Making safety decisions using toxicity pathways, and progress in a prototype risk assessment.

Science.gov (United States)

Adeleye, Yeyejide; Andersen, Melvin; Clewell, Rebecca; Davies, Michael; Dent, Matthew; Edwards, Sue; Fowler, Paul; Malcomber, Sophie; Nicol, Beate; Scott, Andrew; Scott, Sharon; Sun, Bin; Westmoreland, Carl; White, Andrew; Zhang, Qiang; Carmichael, Paul L

2015-06-05

Risk assessment methodologies in toxicology have remained largely unchanged for decades. The default approach uses high dose animal studies, together with human exposure estimates, and conservative assessment (uncertainty) factors or linear extrapolations to determine whether a specific chemical exposure is 'safe' or 'unsafe'. Although some incremental changes have appeared over the years, results from all new approaches are still judged against this process of extrapolating high-dose effects in animals to low-dose exposures in humans. The US National Research Council blueprint for change, entitled Toxicity Testing in the 21st Century: A Vision and Strategy called for a transformation of toxicity testing from a system based on high-dose studies in laboratory animals to one founded primarily on in vitro methods that evaluate changes in normal cellular signalling pathways using human-relevant cells or tissues. More recently, this concept of pathways-based approaches to risk assessment has been expanded by the description of 'Adverse Outcome Pathways' (AOPs). The question, however, has been how to translate this AOP/TT21C vision into the practical tools that will be useful to those expected to make safety decisions. We have sought to provide a practical example of how the TT21C vision can be implemented to facilitate a safety assessment for a commercial chemical without the use of animal testing. To this end, the key elements of the TT21C vision have been broken down to a set of actions that can be brought together to achieve such a safety assessment. Such components of a pathways-based risk assessment have been widely discussed, however to-date, no worked examples of the entire risk assessment process exist. In order to begin to test the process, we have taken the approach of examining a prototype toxicity pathway (DNA damage responses mediated by the p53 network) and constructing a strategy for the development of a pathway based risk assessment for a specific

Speaking your Translation

DEFF Research Database (Denmark)

Dragsted, Barbara; Mees, Inger M.; Gorm Hansen, Inge

2011-01-01

In this article we discuss the translation processes and products of 14 MA students who produced translations from Danish (L1) into English (L2) under different working conditions: (1) written translation, (2) sight translation, and (3) sight translation with a speech recognition (SR) tool. Audio......, since students were dictating in their L2, we looked into the number and types of error that occurred when using the SR software. Items that were misrecognised by the program could be divided into three categories: homophones, hesitations, and incorrectly pronounced words. Well over fifty per cent...

Struggling with Translations

DEFF Research Database (Denmark)

Obed Madsen, Søren

This paper shows empirical how actors have difficulties with translating strategy texts. The paper uses four cases as different examples of what happens, and what might be difficult, when actors translate organizational texts. In order to explore this, it draws on a translation training method from...... translation theory. The study shows that for those who have produced the text, it is difficult to translate a strategy where they have to change the words so others who don’t understand the language in the text can understand it. It also shows that for those who haven’t been a part of the production, it very...... challenge the notion that actors understand all texts and that managers per se can translate a text....

Effect of a serogroup A meningococcal conjugate vaccine (PsA-TT) on serogroup A meningococcal meningitis and carriage in Chad: a community study [corrected].

Science.gov (United States)

Daugla, D M; Gami, J P; Gamougam, K; Naibei, N; Mbainadji, L; Narbé, M; Toralta, J; Kodbesse, B; Ngadoua, C; Coldiron, M E; Fermon, F; Page, A-L; Djingarey, M H; Hugonnet, S; Harrison, O B; Rebbetts, L S; Tekletsion, Y; Watkins, E R; Hill, D; Caugant, D A; Chandramohan, D; Hassan-King, M; Manigart, O; Nascimento, M; Woukeu, A; Trotter, C; Stuart, J M; Maiden, McJ; Greenwood, B M

2014-01-04

A serogroup A meningococcal polysaccharide-tetanus toxoid conjugate vaccine (PsA-TT, MenAfriVac) was licensed in India in 2009, and pre-qualified by WHO in 2010, on the basis of its safety and immunogenicity. This vaccine is now being deployed across the African meningitis belt. We studied the effect of PsA-TT on meningococcal meningitis and carriage in Chad during a serogroup A meningococcal meningitis epidemic. We obtained data for the incidence of meningitis before and after vaccination from national records between January, 2009, and June, 2012. In 2012, surveillance was enhanced in regions where vaccination with PsA-TT had been undertaken in 2011, and in one district where a reactive vaccination campaign in response to an outbreak of meningitis was undertaken. Meningococcal carriage was studied in an age-stratified sample of residents aged 1-29 years of a rural area roughly 13-15 and 2-4 months before and 4-6 months after vaccination. Meningococci obtained from cerebrospinal fluid or oropharyngeal swabs were characterised by conventional microbiological and molecular methods. Roughly 1·8 million individuals aged 1-29 years received one dose of PsA-TT during a vaccination campaign in three regions of Chad in and around the capital N'Djamena during 10 days in December, 2011. The incidence of meningitis during the 2012 meningitis season in these three regions was 2·48 per 100,000 (57 cases in the 2·3 million population), whereas in regions without mass vaccination, incidence was 43·8 per 100,000 (3809 cases per 8·7 million population), a 94% difference in crude incidence (pvaccinated regions. 32 serogroup A carriers were identified in 4278 age-stratified individuals (0·75%) living in a rural area near the capital 2-4 months before vaccination, whereas only one serogroup A meningococcus was isolated in 5001 people living in the same community 4-6 months after vaccination (adjusted odds ratio 0·019, 95% CI 0·002-0·138; p<0·0001). PSA-TT was highly

Background noise levels measured in the NASA Lewis 9- by 15-foot low-speed wind tunnel

Science.gov (United States)

Woodward, Richard P.; Dittmar, James H.; Hall, David G.; Kee-Bowling, Bonnie

1994-01-01

The acoustic capability of the NASA Lewis 9 by 15 Foot Low Speed Wind Tunnel has been significantly improved by reducing the background noise levels measured by in-flow microphones. This was accomplished by incorporating streamlined microphone holders having a profile developed by researchers at the NASA Ames Research Center. These new holders were fabricated for fixed mounting on the tunnel wall and for an axially traversing microphone probe which was mounted to the tunnel floor. Measured in-flow noise levels in the tunnel test section were reduced by about 10 dB with the new microphone holders compared with those measured with the older, less refined microphone holders. Wake interference patterns between fixed wall microphones were measured and resulted in preferred placement patterns for these microphones to minimize these effects. Acoustic data from a model turbofan operating in the tunnel test section showed that results for the fixed and translating microphones were equivalent for common azimuthal angles, suggesting that the translating microphone probe, with its significantly greater angular resolution, is preferred for sideline noise measurements. Fixed microphones can provide a local check on the traversing microphone data quality, and record acoustic performance at other azimuthal angles.

A Comparative Study of "Google Translate" Translations: An Error Analysis of English-to-Persian and Persian-to-English Translations

Science.gov (United States)

Ghasemi, Hadis; Hashemian, Mahmood

2016-01-01

Both lack of time and the need to translate texts for numerous reasons brought about an increase in studying machine translation with a history spanning over 65 years. During the last decades, Google Translate, as a statistical machine translation (SMT), was in the center of attention for supporting 90 languages. Although there are many studies on…

Bean Soup Translation: Flexible, Linguistically-Motivated Syntax for Machine Translation

Science.gov (United States)

Mehay, Dennis Nolan

2012-01-01

Machine translation (MT) systems attempt to translate texts from one language into another by translating words from a "source language" and rearranging them into fluent utterances in a "target language." When the two languages organize concepts in very different ways, knowledge of their general sentence structure, or…

W boson helicity measurement in tt̄ di-electron channel with the CMS detector at the LHC and the CMS outer tracker upgrade for the HL-LHC

CERN Document Server

AUTHOR|(INSPIRE)INSPIRE-00346024

This thesis presents a measurement of the W boson helicity fractions in the tt̄ di-electron final state. The top pair events are produced in proton-proton collisions at a center-of-mass energy of 8 TeV, collected by the CMS experiment at the Large Hadron Collider (LHC), corresponding to an integrated luminosity of 19.7 fb −1 . Only events with two energetic opposite-sign electrons, at least two b-tagged jets and large missing transverse energy in the final state, are considered as di-electron tt̄ signal. The tt̄ event is fully reconstructed using the Analytical Matrix Weighting Technique (AMWT). The helicity fractions of the W boson are estimated from the cos θl∗ distribution using an event-by-event re-weighting technique. Within the quoted statistic and systematic uncertainties, the results are in good agreement with the Standard Model prediction at the 95% confidence level. The results are also consistent with other W boson polarization measurements in the CMS and the ATLAS experiments. While the W ...

On the Translation of Semantic Relations: an empirical study

Directory of Open Access Journals (Sweden)

Louise Denver

2002-01-01

Full Text Available In this article, the transfer of semantic relations between propositions is discussed based on a pilot study carried out for didactic purposes at the Copenhagen Business School. The relations studied were unmarked in the source text (ST and the research aimed at investigating to what extent the translation of textual cohesion is the object of mental processing by semi-professional opt for a strategy involving the explicitation in the target text (TT of semantic relations which can be deduced from the ST by means of inferences.Neste artigo, discute-se a transferência de relações semânticas entre proposições com base em um estudo piloto com objetivos didáticos realizado na Copenhagen Business School. As relações analisadas eram não marcadas no texto de partida (TP. Procura-se investigar até que ponto a tradução da coesão textual é objeto de processamento mental por tradutores quase profissionais durante o processo de tradução e até que ponto os tradutores quase profissionais optam por uma estratégia envolvendo explicitação no texto de chegada (TC das relações semânticas que podem ser deduzidas a partir do TP através de inferências.

NASA Thesaurus

Data.gov (United States)

National Aeronautics and Space Administration — The NASA Thesaurus contains the authorized NASA subject terms used to index and retrieve materials in the NASA Technical Reports Server (NTRS) and the NTRS...

Promised Land No More: Dynamic Shifts in Slovene Translation Market and Translator Education

Directory of Open Access Journals (Sweden)

Nike K. Pokorn

2016-12-01

Full Text Available The article outlines the changes of the translation market, the development of Higher Education (HE translator training and of the profession of translator in Slovenia. First, three HE translator-training programmes in Slovenia are briefly described. Second, through an analysis of the public database containing information on all business entities in Slovenia, a description of the translation market in 2014 is made and the findings are compared to those of a similar study carried out in 2007. Then two surveys of translation graduates of University of Ljubljana are presented, focusing in particular on graduate employment statistics and average earnings of junior translators. The results show that despite the fact that the Slovene translation market is thriving, this growth is not reflected in the average earnings of individual translators. Finally, in view of the fact that translation rates are constantly falling, it is argued that the role of professional associations becomes vital.

CP violating asymmetries of b quarks and leptons in e+e-→tt-bar and supersymmetry

International Nuclear Information System (INIS)

Christova, E.

1998-09-01

The distributions of the single decay b-quarks and leptons from e + e - →tt-bar assuming CP violation are reviewed. Different asymmetries, sensitive independently to CP violation in the production and in the decay, and sensitive to the real and imaginary parts of d γ and d Z are defined. The analytic expressions are general and independent on the model of CP violation. In most of them all phase space integrations are fulfilled analytically. Numerical results in the MSSM with complex couplings are presented. (author)

Translation in ESL Classes

Directory of Open Access Journals (Sweden)

Nagy Imola Katalin

2015-12-01

Full Text Available The problem of translation in foreign language classes cannot be dealt with unless we attempt to make an overview of what translation meant for language teaching in different periods of language pedagogy. From the translation-oriented grammar-translation method through the complete ban on translation and mother tongue during the times of the audio-lingual approaches, we have come today to reconsider the role and status of translation in ESL classes. This article attempts to advocate for translation as a useful ESL class activity, which can completely fulfil the requirements of communicativeness. We also attempt to identify some activities and games, which rely on translation in some books published in the 1990s and the 2000s.

A Writer's Thoughts on Translation and Always Living in Translation.

Science.gov (United States)

Agosin, Marjorie; Jones, Robin

2000-01-01

Discusses how it feels to be a poet who writes in Spanish and has her work translated, examining the author's immigration experiences and noting the translator's contributions in making her work accessible across languages, borders, and cultures. Explains that writing in Spanish is a gesture of survival, and translation allows her memories to…

Measurement of the tt¯ production cross section in pp¯ collisions at s=1.96TeV using kinematic characteristics of lepton+jets events

Science.gov (United States)

Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Aguilo, E.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Ancu, L. S.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Arthaud, M.; Askew, A.; Åsman, B.; Assis Jesus, A. C. S.; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, S.; Banerjee, P.; Barberis, E.; Barfuss, A.-F.; Bargassa, P.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Berntzon, L.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Biscarat, C.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Boehnlein, A.; Boline, D.; Bolton, T. A.; Borissov, G.; Bos, K.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Caron, S.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chan, K.; Chandra, A.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Christoudias, T.; Cihangir, S.; Claes, D.; Clément, C.; Clément, B.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M.-C.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Davies, G.; de, K.; de Jong, S. J.; de Jong, P.; de La Cruz-Burelo, E.; de Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duggan, D.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elvira, V. D.; Enari, Y.; Eno, S.; Ermolov, P.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geist, W.; Gelé, D.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grohsjean, A.; Grünendahl, S.; Grünewald, M. W.; Guo, J.; Guo, F.; Gutierrez, P.; Gutierrez, G.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Hansson, P.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hooper, R.; Hossain, S.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kahn, S.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. R.; Kalk, J. M.; Kappler, S.; Karmanov, D.; Kasper, J.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kaushik, V.; Kehoe, R.; Kermiche, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Kirsch, M.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kothari, B.; Kozelov, A. V.; Krop, D.; Kryemadhi, A.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lacroix, F.; Lam, D.; Lammers, S.; Landsberg, G.; Lazoflores, J.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lellouch, J.; Lesne, V.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Li, L.; Lietti, S. M.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Y.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Lounis, A.; Love, P.; Lubatti, H. J.; Lyon, A. L.; Maciel, A. K. A.; Mackin, D.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Makovec, N.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martin, B.; McCarthy, R.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Mercadante, P. G.; Merkin, M.; Merritt, K. W.; Meyer, J.; Meyer, A.; Michaut, M.; Millet, T.; Mitrevski, J.; Molina, J.; Mommsen, R. K.; Mondal, N. K.; Moore, R. W.; Moulik, T.; Muanza, G. S.; Mulders, M.; Mulhearn, M.; Mundal, O.; Mundim, L.; Nagy, E.; Naimuddin, M.; Narain, M.; Naumann, N. A.; Neal, H. A.; Negret, J. P.; Neustroev, P.; Nilsen, H.; Nomerotski, A.; Novaes, S. F.; Nunnemann, T.; O'Dell, V.; O'Neil, D. C.; Obrant, G.; Ochando, C.; Onoprienko, D.; Oshima, N.; Osta, J.; Otec, R.; Otero Y Garzón, G. J.; Owen, M.; Padley, P.; Pangilinan, M.; Parashar, N.; Park, S.-J.; Park, S. K.; Parsons, J.; Partridge, R.; Parua, N.; Patwa, A.; Pawloski, G.; Penning, B.; Perea, P. M.; Peters, K.; Peters, Y.; Pétroff, P.; Petteni, M.; Piegaia, R.; Piper, J.; Pleier, M.-A.; Podesta-Lerma, P. L. M.; Podstavkov, V. M.; Pogorelov, Y.; Pol, M.-E.; Polozov, P.; Pompo, A.; Pope, B. G.; Popov, A. V.; Potter, C.; Prado da Silva, W. L.; Prosper, H. B.; Protopopescu, S.; Qian, J.; Quadt, A.; Quinn, B.; Rakitine, A.; Rangel, M. S.; Rani, K. J.; Ranjan, K.; Ratoff, P. N.; Renkel, P.; Reucroft, S.; Rich, P.; Rijssenbeek, M.; Ripp-Baudot, I.; Rizatdinova, F.; Robinson, S.; Rodrigues, R. F.; Royon, C.; Rubinov, P.; Ruchti, R.; Safronov, G.; Sajot, G.; Sánchez-Hernández, A.; Sanders, M. P.; Santoro, A.; Savage, G.; Sawyer, L.; Scanlon, T.; Schaile, D.; Schamberger, R. D.; Scheglov, Y.; Schellman, H.; Schieferdecker, P.; Schliephake, T.; Schmitt, C.; Schwanenberger, C.; Schwartzman, A.; Schwienhorst, R.; Sekaric, J.; Sengupta, S.; Severini, H.; Shabalina, E.; Shamim, M.; Shary, V.; Shchukin, A. A.; Shivpuri, R. K.; Shpakov, D.; Siccardi, V.; Simak, V.; Sirotenko, V.; Skubic, P.; Slattery, P.; Smirnov, D.; Smith, R. P.; Snow, J.; Snow, G. R.; Snyder, S.; Söldner-Rembold, S.; Sonnenschein, L.; Sopczak, A.; Sosebee, M.; Soustruznik, K.; Souza, M.; Spurlock, B.; Stark, J.; Steele, J.; Stolin, V.; Stone, A.; Stoyanova, D. A.; Strandberg, J.; Strandberg, S.; Strang, M. A.; Strauss, M.; Strauss, E.; Ströhmer, R.; Strom, D.; Strovink, M.; Stutte, L.; Sumowidagdo, S.; Svoisky, P.; Sznajder, A.; Talby, M.; Tamburello, P.; Tanasijczuk, A.; Taylor, W.; Telford, P.; Temple, J.; Tiller, B.; Tissandier, F.; Titov, M.; Tokmenin, V. V.; Tomoto, M.; Toole, T.; Torchiani, I.; Trefzger, T.; Tsybychev, D.; Tuchming, B.; Tully, C.; Tuts, P. M.; Unalan, R.; Uvarov, S.; Uvarov, L.; Uzunyan, S.; Vachon, B.; van den Berg, P. J.; van Eijk, B.; van Kooten, R.; van Leeuwen, W. M.; Varelas, N.; Varnes, E. W.; Vartapetian, A.; Vasilyev, I. A.; Vaupel, M.; Verdier, P.; Vertogradov, L. S.; Verzocchi, M.; Villeneuve-Seguier, F.; Vint, P.; Vlimant, J.-R.; Vokac, P.; von Toerne, E.; Voutilainen, M.; Vreeswijk, M.; Wagner, R.; Wahl, H. D.; Wang, L.; Wang, M. H. L. S.; Warchol, J.; Watts, G.; Wayne, M.; Weber, M.; Weber, G.; Weerts, H.; Wenger, A.; Wermes, N.; Wetstein, M.; White, A.; Wicke, D.; Wilson, G. W.; Wimpenny, S. J.; Wobisch, M.; Wood, D. R.; Wyatt, T. R.; Xie, Y.; Yacoob, S.; Yamada, R.; Yan, M.; Yasuda, T.; Yatsunenko, Y. A.; Yip, K.; Yoo, H. D.; Youn, S. W.; Yu, J.; Yu, C.; Yurkewicz, A.; Zatserklyaniy, A.; Zeitnitz, C.; Zhang, D.; Zhao, T.; Zhou, B.; Zhu, J.; Zielinski, M.; Zieminska, D.; Zieminski, A.; Zivkovic, L.; Zutshi, V.; Zverev, E. G.

2007-11-01

We present a measurement of the top quark pair production cross section in pp¯ collisions at s=1.96TeV utilizing 425pb-1 of data collected with the D0 detector at the Fermilab Tevatron Collider. We consider the final state of the top quark pair containing one high-pT electron or muon and at least four jets. We exploit specific kinematic features of tt¯ events to extract the cross section. For a top quark mass of 175 GeV, we measure σtt¯=6.4-1.2+1.3(stat)±0.7(syst)±0.4(lum)pb, in good agreement with the standard model prediction.

Presence and significance of TT virus in Danish patients on maintenance hemodialysis

DEFF Research Database (Denmark)

Boysen, T.; Christensen, J. K.; Madsen, C. D.

2003-01-01

-positive patients were significantly older than TTV-negative patients (p = 0.011). No relations were found between TTV infection and elevated levels of alanine aminotransferase (ALT) or CRP or hypo-response to EPO treatment. The mean hemoglobin concentration was 11.24 +/- 1.48 g/dl. Patients with a high TTV viral...... load had a lower level of hemoglobin (10.86 +/- 1.47 g/dl) than the others (p = 0.01). This trend suggested a positive relation between TTV infection and the number of blood transfusions. A restriction fragment length polymorphism assay suggested that patients were infected with different TTV strains......Objectives: To determine the prevalence of TT virus (TTV) in a population of Danish hemodialysis patients and evaluate possible relations between TTV infection and elevated levels of C-reactive protein (CRP) and hypo-response to treatment with erythropoietin (EPO). Material and Methods: Patients...

Presence and significance of TT virus in Danish patients on maintenance hemodialysis

DEFF Research Database (Denmark)

Boysen, Trine; Christensen, Jens K; Madsen, Chris D

2003-01-01

OBJECTIVES: To determine the prevalence of TT virus (TTV) in a population of Danish hemodialysis patients and evaluate possible relations between TTV infection and elevated levels of C-reactive protein (CRP) and hypo-response to treatment with erythropoietin (EPO). MATERIAL AND METHODS: Patients......-positive patients were significantly older than TTV-negative patients (p = 0.011). No relations were found between TTV infection and elevated levels of alanine aminotransferase (ALT) or CRP or hypo-response to EPO treatment. The mean hemoglobin concentration was 11.24 +/- 1.48 g/dl. Patients with a high TTV viral...... load had a lower level of hemoglobin (10.86 +/- 1.47 g/dl) than the others (p = 0.01). This trend suggested a positive relation between TTV infection and the number of blood transfusions. A restriction fragment length polymorphism assay suggested that patients were infected with different TTV strains...

Lost in translation?: Comparing three Scandinavian translations of the Beliefs about Medicines Questionnaire.

Science.gov (United States)

Granas, Anne Gerd; Nørgaard, Lotte Stig; Sporrong, Sofia Kälvemark

2014-08-01

The "Beliefs about Medicines Questionnaire" (BMQ) assess balance of necessity and concern of medicines. The BMQ has been translated from English to many languages. However, the original meaning of statements, such as "My medicine is a mystery to me", may be lost in translation. The aim of this study is to compare three Scandinavian translations of the BMQ. (1) How reliable are the translations? (2) Are they still valid after translation? Translated Norwegian, Swedish and Danish versions of the BMQ were scrutinized by three native Scandinavian researchers. Linguistic differences and ambiguities in the 5-point Likert scale and the BMQ statements were compared. In the Scandinavian translations, the Likert scale expanded beyond the original version at one endpoint (Swedish) or both endpoints (Danish). In the BMQ statements, discrepancies ranged from smaller inaccuracies toward completely different meaning. Some dissimilarities reflect different cultural beliefs about medicines. When translating questionnaires, bilingual researchers should scrutinize translations across similar languages to address content validity across different countries and languages. Our findings are of relevance to other BMQ translations in non-English countries, as direct comparisons between different translations might not be reliable or valid. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

[Valitsusliidus olevad Reformierakond ning Isamaa ja Res Publica Liit on kavandatava koolireformi suhtes eri meelt] / Mailis Reps, Tiiu Kuurme, Karin Kütt

Index Scriptorium Estoniae

Reps, Mailis, 1975-

2010-01-01

Reformierakonna ettepaneku kohta jätta omavalitsustele õiguse otsustada, kas gümnaasium ja põhikool lahutatakse või jätkatakse ühendkooliga avaldavad arvamust riigikogu liige Mailis Reps, Tallinna Ülikooli dotsent Tiiu Kuurme ja Rannu keskkooli direktor Karin Kütt

Translation Methods Applied in Translating Quotations in “the Secret” by Rhonda

OpenAIRE

FEBRIANTI, VICKY

2014-01-01

Keywords: Translation Methods, The Secret, Quotations.Translation helps human to get information written in any language evenwhen it is written in foreign languages. Therefore translation happens in printed media. Books have been popular printed media. The Secret written by Rhonda Byrne is a popular self-help book which has been translated into 50 languages including Indonesian (“The Secret”, n.d., para.5-6).This study is meant to find out the translation methods applied in The Secret. The wr...

Measurements of fiducial cross-sections for tt{sup -bar} production with one or two additional b-jets in pp collisions at √s=8 TeV using the ATLAS detector

Energy Technology Data Exchange (ETDEWEB)

Aad, G. [CPPM, Aix-Marseille Université and CNRS/IN2P3, Marseille (France); Abbott, B. [Homer L. Dodge Department of Physics and Astronomy, University of Oklahoma, Norman, OK (United States); Abdallah, J. [Institute of Physics, Academia Sinica, Taipei, Taiwan (China); Abdinov, O. [Institute of Physics, Azerbaijan Academy of Sciences, Baku (Azerbaijan); Aben, R. [Nikhef National Institute for Subatomic Physics and University of Amsterdam, Amsterdam (Netherlands); and others

2016-01-07

Fiducial cross-sections for tt{sup -bar} production with one or two additional b-jets are reported, using an integrated luminosity of 20.3 fb{sup -1} of proton–proton collisions at a centre-of-mass energy of 8 TeV at the Large Hadron Collider, collected with the ATLAS detector. The cross-section times branching ratio for tt{sup -bar} events with at least one additional b-jet is measured to be 950 ± 70 (stat.) {sub -190}{sup +240} (syst.) fb in the lepton-plus-jets channel and 50 ± 10 (stat.) {sub -10}{sup +15} (syst.) fb in the eμ channel. The cross-section times branching ratio for events with at least two additional b-jets is measured to be 19.3 ± 3.5 (stat.) ± 5.7 (syst.) fb in the dilepton channel (eμ, μμ, and ee) using a method based on tight selection criteria, and 13.5 ± 3.3 (stat.) ± 3.6 (syst.) fb using a looser selection that allows the background normalisation to be extracted from data. The latter method also measures a value of 1.30 ± 0.33 (stat.) ± 0.28 (syst.)% for the ratio of tt{sup -bar} production with two additional b-jets to tt{sup -bar} production with any two additional jets. All measurements are in good agreement with recent theory predictions.

Why Translation Is Difficult

DEFF Research Database (Denmark)

Carl, Michael; Schaeffer, Moritz Jonas

2017-01-01

The paper develops a definition of translation literality that is based on the syntactic and semantic similarity of the source and the target texts. We provide theoretical and empirical evidence that absolute literal translations are easy to produce. Based on a multilingual corpus of alternative...... translations we investigate the effects of cross-lingual syntactic and semantic distance on translation production times and find that non-literality makes from-scratch translation and post-editing difficult. We show that statistical machine translation systems encounter even more difficulties with non-literality....

Cultural Context and Translation

Institute of Scientific and Technical Information of China (English)

张敏

2009-01-01

cultural context plays an important role in translation. Because translation is a cross-culture activity, the culture context that influ-ences translating is consisted of both the culture contexts of source language and target language. This article firstly analyzes the concept of context and cultural context, then according to the procedure of translating classifies cultural context into two stages and talks about how they respectively influence translating.

Gender issues in translation

OpenAIRE

ERGASHEVA G.I.

2015-01-01

The following research is done regarding gender in translation dealing specifically with the issue of the translators’ gender identity and its effect on their translations, as well as on how gender itself is translated and produced. We will try to clarify what gender is, how gender manifests itself in the system of language, and what problems translators encounter when translating or producing gender-related materials

Advancing Translational Space Research Through Biospecimen Sharing: Amplified Impact of Studies Utilizing Analogue Space Platforms

Science.gov (United States)

Staten, B.; Moyer, E.; Vizir, V.; Gompf, H.; Hoban-Higgins, T.; Lewis, L.; Ronca, A.; Fuller, C. A.

2016-01-01

Biospecimen Sharing Programs (BSPs) have been organized by NASA Ames Research Center since the 1960s with the goal of maximizing utilization and scientific return from rare, complex and costly spaceflight experiments. BSPs involve acquiring otherwise unused biological specimens from primary space research experiments for distribution to secondary experiments. Here we describe a collaboration leveraging Ames expertise in biospecimen sharing to magnify the scientific impact of research informing astronaut health funded by the NASA Human Research Program (HRP) Human Health Countermeasures (HHC) Element. The concept expands biospecimen sharing to one-off ground-based studies utilizing analogue space platforms (e.g., Hindlimb Unloading (HLU), Artificial Gravity) for rodent experiments, thereby significantly broadening the range of research opportunities with translational relevance for protecting human health in space and on Earth.

ABB Oy Motors and Generators -yksikön energiansyöttöjen erotus- ja lukitusohjeet

OpenAIRE

Chi, Henri

2017-01-01

Tämä insinöörityö toteutettiin Quant Finland Oy:lle, joka vastaa Helsingin Pitäjänmäen ABB Motors and Generators -tehtaan kunnossapidosta. Insinöörityön tavoitteena oli luoda energiansyöttöjen lukitus- ja erotusohjeet tehtaan koneistoille, laitteille ja järjestelmille. Tehtaalla on isoja koneita ja laitteita, jonka erotus- ja lukitustoimenpiteitä kaikki eivät osaa. Näin ollen on haluttu mahdollistaa turvallinen työskentely tarjoamalla selkeät erotus- ja lukitusohjeet. ABB Motors and Gene...

Machine Translation

Indian Academy of Sciences (India)

Research Mt System Example: The 'Janus' Translating Phone Project. The Janus ... based on laptops, and simultaneous translation of two speakers in a dialogue. For more ..... The current focus in MT research is on using machine learning.

Translating Proper Nouns: A Case Study on English Translation of Hafez's Lyrics

Science.gov (United States)

Shirinzadeh, Seyed Alireza; Mahadi, Tengku Sepora Tengku

2014-01-01

Proper nouns are regarded so simple that they might be taken for granted in translation explorations. Some may believe that they should not be translated in transmitting source texts to target texts. But, it is not the case; if one looks at present translations, he will notice that different strategies might be applied for translating proper…

Translation and Quality Management

DEFF Research Database (Denmark)

Petersen, Margrethe

1996-01-01

theory which would seem likely to be of interest in this connection and section 2. gives a linguist's introduction to the part of the area of quality management which I consider relevant for present purposes. Section 3. is devoted to the case study of a small translation firm which has been certified......The aim of this article is to consider the issue of quality in translation. Specifically, the question under consideration is whether quality assurance in relation to translation is feasible and, if so, what some of the implications for translation theory, translation practice and the teaching...... of translation would be. To provide a backdrop against which the issue may be discussed, I present an overview of the two areas which seem most likely to hold potential answers, viz., that of translation theory and that of quality management. Section 1. gives a brief outline of some contributions to translation...

Translation-Memory (TM) Research

DEFF Research Database (Denmark)

Schjoldager, Anne Gram; Christensen, Tina Paulsen

2010-01-01

to be representative of the research field as a whole. Our analysis suggests that, while considerable knowledge is available about the technical side of TMs, more research is needed to understand how translators interact with TM technology and how TMs influence translators' cognitive translation processes.......  It is no exaggeration to say that the advent of translation-memory (TM) systems in the translation profession has led to drastic changes in translators' processes and workflow, and yet, though many professional translators nowadays depend on some form of TM system, this has not been the object...... of much research. Our paper attempts to find out what we know about the nature, applications and influences of TM technology, including translators' interaction with TMs, and also how we know it. An essential part of the analysis is based on a selection of empirical TM studies, which we assume...

Translation modalities: an investigation of the translated short story “Dez de dezembro”

Directory of Open Access Journals (Sweden)

Clara Peron da Silva Guedes

2017-05-01

Full Text Available During the translation process translators adopt linguistic strategies in order to make decisions that help to render a translated text suitable to the target language and culture. The translation modalities proposed by Aubert (105-10 constitute a tool that enables one to identify some of these strategies. In addition, they permit to measure the level of linguistic differentiation between a source text and a target text verifying the distance or the proximity of the target text to the linguistic and cultural issues of the source text. Thus, this paper aims to investigate the translation modalities in the short story “Dez de dezembro” (Saunders 204-38, a translation of the short story “Tenth of December” (Saunders 215-51. For quantifying the translation modalities in the translated text the noun phrases from the source text were selected and their counterparts in the target text were classified and annotated within Notepad++ software. The most recurrent translation modalities in the corpus were Literal Translation and Transposition, categories considered intermediate ones in the rank proposed by Aubert (105-10. Therefore, a relation of equivalence can be established between the target and the source texts.

Discourse Analysis in Translator Training

OpenAIRE

Gülfidan Ayvaz

2015-01-01

Translator training enables students to gain experience in both linguistic parameters and translation practice. Discourse Analysis is one of the strategies that lead to a better translation process and quality in translation. In that regard, this study aims to present DA as a translation strategy for translation practice and a useful tool for translator training. The relationship between DA and Translator Training is not widely studied. Therefore this study aims to define DA and how it can be...

Translation Competence and Translation Performance: Lexical, Syntactic and Textual Patterns in Student Translations of a Specialized EU Genre

Science.gov (United States)

Karoly, Adrienn

2012-01-01

This paper reports the findings of a study aiming to reveal the recurring patterns of lexical, syntactic and textual errors in student translations of a specialized EU genre from English into Hungarian. By comparing the student translations to the official translation of the text, this article uncovers the most frequent errors that students made…

How Italian dialect poets translate themselves and how they translate other poets

Directory of Open Access Journals (Sweden)

Edoardo Zuccato

2017-07-01

Full Text Available Part one of this essay discusses the way most contemporary Italian dialect poets translate themselves into Italian. Part two of the essay examines examples of poetry translation into dialect made by some of the same contemporary authors. A comparison between the style of the self-translations, which is mainly lyrical, and the variety of styles of the translations from other poets, shows that each choice is an intentional strategy rather than a missed opportunity for a more creative self-translation, as some scholars have argued.

NASA Astrophysics Technology Needs

Science.gov (United States)

Stahl, H. Philip

2012-01-01

July 2010, NASA Office of Chief Technologist (OCT) initiated an activity to create and maintain a NASA integrated roadmap for 15 key technology areas which recommend an overall technology investment strategy and prioritize NASA?s technology programs to meet NASA?s strategic goals. Science Instruments, Observatories and Sensor Systems(SIOSS) roadmap addresses technology needs to achieve NASA?s highest priority objectives -- not only for the Science Mission Directorate (SMD), but for all of NASA.

Translation Memory and Computer Assisted Translation Tool for Medieval Texts

Directory of Open Access Journals (Sweden)

Törcsvári Attila

2013-05-01

Full Text Available Translation memories (TMs, as part of Computer Assisted Translation (CAT tools, support translators reusing portions of formerly translated text. Fencing books are good candidates for using TMs due to the high number of repeated terms. Medieval texts suffer a number of drawbacks that make hard even “simple” rewording to the modern version of the same language. The analyzed difficulties are: lack of systematic spelling, unusual word orders and typos in the original. A hypothesis is made and verified that even simple modernization increases legibility and it is feasible, also it is worthwhile to apply translation memories due to the numerous and even extremely long repeated terms. Therefore, methods and algorithms are presented 1. for automated transcription of medieval texts (when a limited training set is available, and 2. collection of repeated patterns. The efficiency of the algorithms is analyzed for recall and precision.

Who translates the translation? (Retraduire les héros marginaux d'Alan Moore

Directory of Open Access Journals (Sweden)

Alice RAY

2016-11-01

Full Text Available The retranslation phenomenon is essential to the translation process. It is considered as the logical progression of this process which allows the translated literary work to regenerate in a restless cultural and language space. To a lesser extent, we can observe the same phenomenon in the translation of comics. However, this specific translation requires other competencies and a translating approach somehow different from the ones required to translate fiction literature, especially because of the presence of the visual system of drawings which is strongly bound to its own culture and the endless mutations it goes through. The comic book Watchmen (Les Gardiens, in the first French translation by Alan Moore and Dave Gibbons, is known in the whole world as the comic which had not only remodeled the vision we had of super-heroes, but had also given the comic books another voice. Watchmen was published between 1986 and 1987 in the United States and translated in French from 1987 to 1988. Fifteen years after this first translation by Jean-Patrick Manchette, Panini publishing decided to retranslate this famous comic in 2007. However, if the reviews of the first translation were laudatory, the retranslation did not enjoy a great reception from the readers or from the reviewers. This paper proposes a comparative analysis of both these translations and of their original version as well as an experiment on the readers, comic books readers or not, in order to establish why the first translation was a success and the retranslation a failure. Thus, we could withdraw the elements which allow us to understand the reception of comic translation.

Translator for Optimizing Fluid-Handling Components

Science.gov (United States)

Landon, Mark; Perry, Ernest

2007-01-01

A software interface has been devised to facilitate optimization of the shapes of valves, elbows, fittings, and other components used to handle fluids under extreme conditions. This software interface translates data files generated by PLOT3D (a NASA grid-based plotting-and- data-display program) and by computational fluid dynamics (CFD) software into a format in which the files can be read by Sculptor, which is a shape-deformation- and-optimization program. Sculptor enables the user to interactively, smoothly, and arbitrarily deform the surfaces and volumes in two- and three-dimensional CFD models. Sculptor also includes design-optimization algorithms that can be used in conjunction with the arbitrary-shape-deformation components to perform automatic shape optimization. In the optimization process, the output of the CFD software is used as feedback while the optimizer strives to satisfy design criteria that could include, for example, improved values of pressure loss, velocity, flow quality, mass flow, etc.

The preproghrelin 3056 TT genotype is associated with the feeling of hunger and low acylated ghrelin levels in Japanese patients with Helicobacter pylori-negative functional dyspepsia.

Science.gov (United States)

Futagami, Seiji; Shimpuku, Mayumi; Kawagoe, Tetsuro; Izumi, Nikki; Ohishi, Noriko; Yamawaki, Hiroshi; Shindo, Tomotaka; Nagoya, Hiroyuki; Horie, Akane; Kodaka, Yasuhiro; Gudis, Katya; Itoh, Takashi; Sakamoto, Choitsu

2013-01-01

An impairment of gastric motility is strongly associated with the pathophysiology of functional dyspepsia (FD). Plasma ghrelin is one of the key molecules linked to gastric motility. Therefore, this study aimed to evaluate whether ghrelin (GHRL) gene polymorphisms are associated with clinical symptoms, the plasma ghrelin levels and gastric emptying in patients with FD as defined by the Rome III classification. We enrolled 74 Helicobacter pylori-negative patients presenting with typical symptoms of FD (epigastric pain syndrome (EPS), n=23; postprandial distress syndrome (PDS), n=51) and 102 healthy volunteers. Gastric motility was evaluated according to the Tmax value and T1/2 using the (13)C-acetate breath test. We used the Rome III criteria to evaluate upper abdominal symptoms and SRQ-D scores to determine the depression status. The Arg51Gln(346G->A), preproghrelin3056T->C, Leu72Met(408C->A) and Gln90Leu(3412T->A) polymorphisms were analyzed in DNA in blood samples obtained from the enrolled subjects. Genotyping was performed using polymerase chain reaction. There was a significant relationship (p=0.048) between the preproghrelin 3056TT genotype and the serum levels of acylated ghrelin in the H. pylori-negative FD patients. The preproghrelin 3056TT genotype was significantly (p=0.047) associated with the feeling of hunger in the H. pylori-negative FD patients. The preproghrelin 3056TT genotype is significantly associated with the acylated ghrelin levels and the feeling of hunger in H. pylori-negative FD patients. Further studies are needed to clarify the association between the preproghrelin 3056TT genotype and lower plasma acylated ghrelin levels and the impact of this relationship on the feeling of hunger in H. pylori-negative FD patients.

Determinants of translation ambiguity

Science.gov (United States)

Degani, Tamar; Prior, Anat; Eddington, Chelsea M.; Arêas da Luz Fontes, Ana B.; Tokowicz, Natasha

2016-01-01

Ambiguity in translation is highly prevalent, and has consequences for second-language learning and for bilingual lexical processing. To better understand this phenomenon, the current study compared the determinants of translation ambiguity across four sets of translation norms from English to Spanish, Dutch, German and Hebrew. The number of translations an English word received was correlated across these different languages, and was also correlated with the number of senses the word has in English, demonstrating that translation ambiguity is partially determined by within-language semantic ambiguity. For semantically-ambiguous English words, the probability of the different translations in Spanish and Hebrew was predicted by the meaning-dominance structure in English, beyond the influence of other lexical and semantic factors, for bilinguals translating from their L1, and translating from their L2. These findings are consistent with models postulating direct access to meaning from L2 words for moderately-proficient bilinguals. PMID:27882188

THE EFFECT OF PROBLEM SOLVING LEARNING MODEL BASED JUST IN TIME TEACHING (JiTT ON SCIENCE PROCESS SKILLS (SPS ON STRUCTURE AND FUNCTION OF PLANT TISSUE CONCEPT

Directory of Open Access Journals (Sweden)

Resha Maulida

2017-11-01

Full Text Available The purpose of this study was to determine the effect of Problem Solving learning model based Just in Time Teaching (JiTT on students' science process skills (SPS on structure and function of plant tissue concept. This research was conducted at State Senior High School in South Tangerang .The research conducted using the quasi-experimental with Nonequivalent pretest-Postest Control Group Design. The samples of this study were 34 students for experimental group and 34 students for the control group. Data was obtained using a process skill test instrument (essai type that has been tested for its validity and reliability. Result of data analysis by ANACOVA, show that there were significant difference of postest between experiment and control group, by controlling the pretest score (F = 4.958; p <0.05. Thus, the problem-solving learning based on JiTT proved to improve students’ SPS. The contribution of this treatment in improving the students’ SPS was 7.2%. This shows that there was effect of problem solving model based JiTT on students’ SPS on the Structure and function of plant tissue concept.

Linguistic Levels of Translation: A Generic Exploration of Translation Difficulties in Literary Textual Corpus

Directory of Open Access Journals (Sweden)

Magda Madkour

2016-11-01

Full Text Available This case study research was based on a generic exploration of the translation problems that graduate students face in literary translation. Literary translation is fundamental to translation programs at higher education due to the upsurge that has occurred in publishing classical and modern literary works from various cultures. However, literary texts have special characteristics that make the process of transferring them from one language into another a daunting task. Translating literary texts is difficult even for professional translators because misinterpreting the messages of the source texts can lead to distorting the aesthetic aspects of the literary work. Students need to learn various linguistic levels of literary translation as well as strategies and methods of translation. Learning the linguistics levels of translation necessitates providing adequate training that is based on enhancing students’ cognitive abilities. Cognitive-based translation training helps students learn the procedures of solving the problems of translating sound and literary devices. Cognitive approaches are relevant to the translation process since cognition implies mental activities that students can use to understand and synthesize the literary text, and reconstruct it creatively. Therefore, the current study aimed at examining the relationship between cognitive teaching methodologies and students’ performance in literary translation. To examine this relationship, qualitative and quantitative data was collected from graduate students at the College of Languages and Translation at Imam Mohammed bin Saud Islamic University (IMAMU University, Riyadh, Saudi Arabia. In addition, corpus data was gathered from authentic literary texts including, novels, short stories, and poetry, to investigate the effect of linguistic analysis and cognitive strategies on the quality of literary translation. Quantitative data was analyzed using the Statistical Package for the

An analysis of machine translation and speech synthesis in speech-to-speech translation system

OpenAIRE

Hashimoto, K.; Yamagishi, J.; Byrne, W.; King, S.; Tokuda, K.

2011-01-01

This paper provides an analysis of the impacts of machine translation and speech synthesis on speech-to-speech translation systems. The speech-to-speech translation system consists of three components: speech recognition, machine translation and speech synthesis. Many techniques for integration of speech recognition and machine translation have been proposed. However, speech synthesis has not yet been considered. Therefore, in this paper, we focus on machine translation and speech synthesis, ...

Translation Meets Cognitive Science: The Imprint of Translation on Cognitive Processing

Science.gov (United States)

Rojo, Ana

2015-01-01

Translation has long played a role in linguistic and literary studies research. More recently, the theoretical and methodological concerns of process research have given translation an additional role in cognitive science. The interest in the cognitive aspects of translation has led scholars to turn to disciplines such as cognitive linguistics,…

Audiovisual Translation:A Critical Review on Sino-western Perspectives of Film Subtitle Translation

OpenAIRE

Junchen Zhang

2018-01-01

The paper argues the development of audiovisual translation (mainly focuses on the strand of film subtitle translation) in the West and China. Firstly, the paper discusses film translation from the perspective of the West and critically reviews the achievements produced by western researchers. Secondly, the paper analyzes film translation from Chinese perspective and outlines its change and development in Mainland China. Thirdly, some major issues exited in film translation such as cultural p...

TRANSLATING BLACKNESS: A CHALLENGE TO TRANSLATION STUDIES IN CONTEMPORANEITY

Directory of Open Access Journals (Sweden)

Maria Aparecida Andrade Salgueiro

2014-07-01

Full Text Available The present article presents aspects of a work in progress about both African-American and Afro-Brazilian Literatures as well as Translation Studies. As it makes observations about how blackness has been translated in different contexts and geographical spaces, it calls the reader’s attention to power relations, processes of colonial and post-colonial identity construction, the rising of literary canons, cultural hegemony and globalization, demystifying spaces and showing translation as an activity that does not take place in a neutral space, but, for sure, inside social and political concrete situations.

Word reading and translation in bilinguals: The impact of formal and informal translation expertise

Directory of Open Access Journals (Sweden)

Adolfo M. García

2014-11-01

Full Text Available Studies on bilingual word reading and translation have examined the effects of lexical variables (e.g., concreteness, cognate status by comparing groups of non-translators with varying levels of L2 proficiency. However, little attention has been paid to another relevant factor: translation expertise (TI. To explore this issue, we administered word reading and translation tasks to two groups of non-translators possessing different levels of informal TI (Experiment 1, and to three groups of bilinguals possessing different levels of translation training (Experiment 2. Reaction-time recordings showed that in all groups reading was faster than translation and unaffected by concreteness and cognate effects. Conversely, in both experiments, all groups translated concrete and cognate words faster than abstract and non-cognate words, respectively. Notably, an advantage of backward over forward translation was observed only for low-proficiency non-translators (in Experiment 1. Also, in Experiment 2, the modifications induced by translation expertise were more marked in the early than in the late stages of training and practice. The results suggest that TI contributes to modulating inter-equivalent connections in bilingual memory.

What is a translator?

Directory of Open Access Journals (Sweden)

Martha Pulido

2016-08-01

Full Text Available I copied the title from Foucault’s text, "Qu'est-ce qu'un auteur" in Dits et écrits [1969], Paris, Gallimard, 1994, that I read in French, then in English in Donald F. Bouchard’s and Sherry Simon’s translation, and finally in Spanish in Yturbe Corina’s translation, and applied for the translator some of the analysis that Foucault presents to define the author. Foucault suggests that if we cannot define an author, at least we can see where their function is reflected. My purpose in this paper is to present those surfaces where the function of the translator is reflected or where it can be revealed, and to analyse the categories that could lead us to the elaboration of a suitable definition of a Translator. I dare already give a compound noun for the translator: Translator-Function.

What is a translator?

Directory of Open Access Journals (Sweden)

Martha Martha Pulido

2016-05-01

Full Text Available I copied the title from Foucault’s text, "Qu'est-ce qu'un auteur" in Dits et écrits [1969], Paris, Gallimard, 1994, that I read in French, then in English in Donald F. Bouchard’s and Sherry Simon’s translation, and finally in Spanish in Yturbe Corina’s translation, and applied for the translator some of the analysis that Foucault presents to define the author. Foucault suggests that if we cannot define an author, at least we can see where their function is reflected. My purpose in this paper is to present those surfaces where the function of the translator is reflected or where it can be revealed, and to analyse the categories that could lead us to the elaboration of a suitable definition of a Translator. I dare already give a compound noun for the translator: Translator-Function.

Learning by Translating: A Contrastive Methodology for ESP Learning and Translation

Directory of Open Access Journals (Sweden)

Sara Laviosa

2015-11-01

Full Text Available Over the last few years applied linguists have explored the possibility of integrating the insights of second language acquisition theories, contrastive analysis, foreign language teaching methodologies, and translation studies with a view to enhancing current communicative models and techniques for L2 teaching and translator training (see for example Sewell and Higgins 1996; Laviosa-Braithwaite 1997; Campbell 1998; Malmkjær 1998; Laviosa 2000; Colina 2002. We intend to make a contribution to this interdisciplinary orientation by putting forward a translation-based methodology for learning ESP vocabulary and grammar through real life mediating communicative activities. With particular reference to the translation task itself, we endeavour to provide teachers of English for special purposes and translator trainers with a methodology for guiding their students in producing, to the best of their abilities, a target text which meets the quality criteria of terminological accuracy and stylistic fluency, and is also effective in terms of the communicative situation it is intended for. After outlining the rationale and main theoretical approaches underpinning our work, we will illustrate our methodology for learning ESP vocabulary and translation skills from a contrastive perspective, as in our book Learning by Translating (Laviosa and Cleverton 2003.

Translation and Intertextuality

Directory of Open Access Journals (Sweden)

Mohammad Rahimi

2015-09-01

Full Text Available This study is intends to describe and Presents a new theory of translation based on the "Intertextuality" unlike the Translation theories that presented to date, what all are based on the principle of "Equivalence". Our theory is based on the examples of Arabic poetry translated into Persian poetry. The major findings of this study show that the Intertextuality can serve as a link between the original text and the target. it can also interact with other texts is the translation result in the target language, Whtich is the book of poetic eloquence is addressed and was mentioned Literary robbery.

Compositional translation

NARCIS (Netherlands)

Appelo, Lisette; Janssen, Theo; Jong, de F.M.G.; Landsbergen, S.P.J.

1994-01-01

This book provides an in-depth review of machine translation by discussing in detail a particular method, called compositional translation, and a particular system, Rosetta, which is based on this method. The Rosetta project is a unique combination of fundamental research and large-scale

NASA strategic plan

Science.gov (United States)

1994-01-01

The NASA Strategic Plan is a living document. It provides far-reaching goals and objectives to create stability for NASA's efforts. The Plan presents NASA's top-level strategy: it articulates what NASA does and for whom; it differentiates between ends and means; it states where NASA is going and what NASA intends to do to get there. This Plan is not a budget document, nor does it present priorities for current or future programs. Rather, it establishes a framework for shaping NASA's activities and developing a balanced set of priorities across the Agency. Such priorities will then be reflected in the NASA budget. The document includes vision, mission, and goals; external environment; conceptual framework; strategic enterprises (Mission to Planet Earth, aeronautics, human exploration and development of space, scientific research, space technology, and synergy); strategic functions (transportation to space, space communications, human resources, and physical resources); values and operating principles; implementing strategy; and senior management team concurrence.

Sound Effects in Translation

DEFF Research Database (Denmark)

Mees, Inger M.; Dragsted, Barbara; Gorm Hansen, Inge

2013-01-01

On the basis of a pilot study using speech recognition (SR) software, this paper attempts to illustrate the benefits of adopting an interdisciplinary approach in translator training. It shows how the collaboration between phoneticians, translators and interpreters can (1) advance research, (2) have......), Translog was employed to measure task times. The quality of the products was assessed by three experienced translators, and the number and types of misrecognitions were identified by a phonetician. Results indicate that SR translation provides a potentially useful supplement to written translation...

Translation Training in the Jordanian Context: Curriculum Evaluation in Translator Education

Science.gov (United States)

Mahasneh, Anjad

2013-01-01

This study aims at drawing a clear picture of translator training in Jordan through the evaluation of translation programs at the Master's level. The framework of the Context, Input, Process, and Product components of the CIPP evaluation model developed by Daniel Stufflebeam in 1971 was used to evaluate the three translation Master's programs at…

Measuring Difficulty in English-Chinese Translation: Towards a General Model of Translation Difficulty

Science.gov (United States)

Sun, Sanjun

2012-01-01

Accurate assessment of a text's level of translation difficulty is critical for translator training and accreditation, translation research, and the language industry as well. Traditionally, people rely on their general impression to gauge a text's translation difficulty level. If the evaluation process is to be more effective and the…

Translator-computer interaction in action

DEFF Research Database (Denmark)

Bundgaard, Kristine; Christensen, Tina Paulsen; Schjoldager, Anne

2016-01-01

perspective, this paper investigates the relationship between machines and humans in the field of translation, analysing a CAT process in which machine-translation (MT) technology was integrated into a translation-memory (TM) suite. After a review of empirical research into the impact of CAT tools......Though we lack empirically-based knowledge of the impact of computer-aided translation (CAT) tools on translation processes, it is generally agreed that all professional translators are now involved in some kind of translator-computer interaction (TCI), using O’Brien’s (2012) term. Taking a TCI......, the study indicates that the tool helps the translator conform to project and customer requirements....

Computer-aided translation tools

DEFF Research Database (Denmark)

Christensen, Tina Paulsen; Schjoldager, Anne

2016-01-01

in Denmark is rather high in general, but limited in the case of machine translation (MT) tools: While most TSPs use translation-memory (TM) software, often in combination with a terminology management system (TMS), only very few have implemented MT, which is criticised for its low quality output, especially......The paper reports on a questionnaire survey from 2013 of the uptake and use of computer-aided translation (CAT) tools by Danish translation service providers (TSPs) and discusses how these tools appear to have impacted on the Danish translation industry. According to our results, the uptake...

Translation goes to the movies

CERN Document Server

Cronin, Michael

2008-01-01

This highly accessible introduction to translation theory, written by a leading author in the field, uses the genre of film to bring the main themes in translation to life. Through analyzing films as diverse as the Marx Brothers' A Night at the Opera, The Star Wars Trilogies and Lost in Translation, the reader is encouraged to think about both issues and problems of translation as they are played out on the screen and issues of filmic representation through examining the translation dimension of specific films. In highlighting how translation has featured in both mainstream commercial and arthouse films over the years, Cronin shows how translation has been a concern of filmmakers dealing with questions of culture, identity, conflict and representation. This book is a lively and accessible text for translation theory courses and offers a new and largely unexplored approach to topics of identity and representation on screen. Translation Goes to the Movies will be of interest to those on translation studies...

Measurements of tt̅ differential cross-sections of highly boosted top quarks decaying to all-hadronic final states with ATLAS

CERN Document Server

Cormier, Kyle James Read; The ATLAS collaboration

2018-01-01

Measurements are made of differential cross-sections of highly boosted pair-produced top quarks as a function of top-quark and tt¯ system kinematic observables using proton--proton collisions at a center-of-mass energy of √s=13 TeV. The data set corresponds to an integrated luminosity of 36.1 fb^{−1}, recorded in 2015 and 2016 with the ATLAS detector at the CERN Large Hadron Collider. Events with two large-radius jets in the final state, one with transverse momentum pT>500 GeV and a second with pT>350 GeV, are used for the measurement. The top-quark candidates are separated from the multijet background using jet substructure information and association with a b-tagged jet. The measured spectra are corrected for detector effects to a particle-level fiducial phase space and a parton-level limited phase space, and are compared to several Monte Carlo simulations by means of calculated χ2 values. The cross-section for tt¯ production in the fiducial phase-space region is 292±7 (stat)±76(syst) fb, to be com...

Jungmann's translation of Paradise Lost

OpenAIRE

Janů, Karel

2014-01-01

This thesis examines Josef Jungmann's translation of John Milton's Paradise Lost. Josef Jungmann was one of the leading figures of the Czech National Revival and translated Milton 's poem between the years 1800 and 1804. The thesis covers Jungmann's theoretical model of translation and presents Jungmann's motives for translation of Milton's epic poem. The paper also describes the aims Jungmann had with his translation and whether he has achieved them. The reception Jungmann's translation rece...

Internal NASA Study: NASAs Protoflight Research Initiative

Science.gov (United States)

Coan, Mary R.; Hirshorn, Steven R.; Moreland, Robert

2015-01-01

The NASA Protoflight Research Initiative is an internal NASA study conducted within the Office of the Chief Engineer to better understand the use of Protoflight within NASA. Extensive literature reviews and interviews with key NASA members with experience in both robotic and human spaceflight missions has resulted in three main conclusions and two observations. The first conclusion is that NASA's Protoflight method is not considered to be "prescriptive." The current policies and guidance allows each Program/Project to tailor the Protoflight approach to better meet their needs, goals and objectives. Second, Risk Management plays a key role in implementation of the Protoflight approach. Any deviations from full qualification will be based on the level of acceptable risk with guidance found in NPR 8705.4. Finally, over the past decade (2004 - 2014) only 6% of NASA's Protoflight missions and 6% of NASA's Full qualification missions experienced a publicly disclosed mission failure. In other words, the data indicates that the Protoflight approach, in and of it itself, does not increase the mission risk of in-flight failure. The first observation is that it would be beneficial to document the decision making process on the implementation and use of Protoflight. The second observation is that If a Project/Program chooses to use the Protoflight approach with relevant heritage, it is extremely important that the Program/Project Manager ensures that the current project's requirements falls within the heritage design, component, instrument and/or subsystem's requirements for both the planned and operational use, and that the documentation of the relevant heritage is comprehensive, sufficient and the decision well documented. To further benefit/inform this study, a recommendation to perform a deep dive into 30 missions with accessible data on their testing/verification methodology and decision process to research the differences between Protoflight and Full Qualification

The NASA Severe Thunderstorm Observations and Regional Modeling (NASA STORM) Project

Science.gov (United States)

Schultz, Christopher J.; Gatlin, Patrick N.; Lang, Timothy J.; Srikishen, Jayanthi; Case, Jonathan L.; Molthan, Andrew L.; Zavodsky, Bradley T.; Bailey, Jeffrey; Blakeslee, Richard J.; Jedlovec, Gary J.

2016-01-01

The NASA Severe Storm Thunderstorm Observations and Regional Modeling(NASA STORM) project enhanced NASA’s severe weather research capabilities, building upon existing Earth Science expertise at NASA Marshall Space Flight Center (MSFC). During this project, MSFC extended NASA’s ground-based lightning detection capacity to include a readily deployable lightning mapping array (LMA). NASA STORM also enabled NASA’s Short-term Prediction and Research Transition (SPoRT) to add convection allowing ensemble modeling to its portfolio of regional numerical weather prediction (NWP) capabilities. As a part of NASA STORM, MSFC developed new open-source capabilities for analyzing and displaying weather radar observations integrated from both research and operational networks. These accomplishments enabled by NASA STORM are a step towards enhancing NASA’s capabilities for studying severe weather and positions them for any future NASA related severe storm field campaigns.

Theory of Test Translation Error

Science.gov (United States)

Solano-Flores, Guillermo; Backhoff, Eduardo; Contreras-Nino, Luis Angel

2009-01-01

In this article, we present a theory of test translation whose intent is to provide the conceptual foundation for effective, systematic work in the process of test translation and test translation review. According to the theory, translation error is multidimensional; it is not simply the consequence of defective translation but an inevitable fact…

JavaScript DNA translator: DNA-aligned protein translations.

Science.gov (United States)

Perry, William L

2002-12-01

There are many instances in molecular biology when it is necessary to identify ORFs in a DNA sequence. While programs exist for displaying protein translations in multiple ORFs in alignment with a DNA sequence, they are often expensive, exist as add-ons to software that must be purchased, or are only compatible with a particular operating system. JavaScript DNA Translator is a shareware application written in JavaScript, a scripting language interpreted by the Netscape Communicator and Internet Explorer Web browsers, which makes it compatible with several different operating systems. While the program uses a familiar Web page interface, it requires no connection to the Internet since calculations are performed on the user's own computer. The program analyzes one or multiple DNA sequences and generates translations in up to six reading frames aligned to a DNA sequence, in addition to displaying translations as separate sequences in FASTA format. ORFs within a reading frame can also be displayed as separate sequences. Flexible formatting options are provided, including the ability to hide ORFs below a minimum size specified by the user. The program is available free of charge at the BioTechniques Software Library (www.Biotechniques.com).

Lost in Translation

Science.gov (United States)

Lass, Wiebke; Reusswig, Fritz

2014-05-01

Lost in Translation? Introducing Planetary Boundaries into Social Systems. Fritz Reusswig, Wiebke Lass Potsdam Institute for Climate Impact Research, Potsdam, Germany Identifying and quantifying planetary boundaries by interdisciplinary science efforts is a challenging task—and a risky one, as the 1972 Limits to Growth publication has shown. Even if we may be assured that scientific understanding of underlying processes of the Earth system has significantly improved since then, the challenge of translating these findings into the social systems of the planet remains crucial for any kind of action, and in many respects far more challenging. We would like to conceptualize what could also be termed a problem of coupling social and natural systems as a nested set of social translation processes, well aware of the limited applicability of the language-related translation metaphor. Societies must, first, perceive these boundaries, and they have to understand their relevance. This includes, among many other things, the organization of transdisciplinary scientific cooperation. They will then have to translate this understood perception into possible actions, i.e. strategies for different local bodies, actors, and institutional settings. This implies a lot of 'internal' translation processes, e.g. from the scientific subsystem to the mass media, the political and the economic subsystem. And it implies to develop subsystem-specific schemes of evaluation for these alternatives, e.g. convincing narratives, cost-benefit analyses, or ethical legitimacy considerations. And, finally, societies do have to translate chosen action alternatives into monitoring and evaluation schemes, e.g. for agricultural production or renewable energies. This process includes the continuation of observing and re-analyzing the planetary boundary concept itself, as a re-adjustment of these boundaries in the light of new scientific insights cannot be excluded. Taken all together, societies may well

Translation of incremental talk test responses to steady-state exercise training intensity.

Science.gov (United States)

Lyon, Ellen; Menke, Miranda; Foster, Carl; Porcari, John P; Gibson, Mark; Bubbers, Terresa

2014-01-01

The Talk Test (TT) is a submaximal, incremental exercise test that has been shown to be useful in prescribing exercise training intensity. It is based on a subject's ability to speak comfortably during exercise. This study defined the amount of reduction in absolute workload intensity from an incremental exercise test using the TT to give appropriate absolute training intensity for cardiac rehabilitation patients. Patients in an outpatient rehabilitation program (N = 30) performed an incremental exercise test with the TT given every 2-minute stage. Patients rated their speech comfort after reciting a standardized paragraph. Anything other than a "yes" response was considered the "equivocal" stage, while all preceding stages were "positive" stages. The last stage with the unequivocally positive ability to speak was the Last Positive (LP), and the preceding stages were (LP-1 and LP-2). Subsequently, three 20-minute steady-state training bouts were performed in random order at the absolute workload at the LP, LP-1, and LP-2 stages of the incremental test. Speech comfort, heart rate (HR), and rating of perceived exertion (RPE) were recorded every 5 minutes. The 20-minute exercise training bout was completed fully by LP (n = 19), LP-1 (n = 28), and LP-2 (n = 30). Heart rate, RPE, and speech comfort were similar through the LP-1 and LP-2 tests, but the LP stage was markedly more difficult. Steady-state exercise training intensity was easily and appropriately prescribed at intensity associated with the LP-1 and LP-2 stages of the TT. The LP stage may be too difficult for patients in a cardiac rehabilitation program.

Translation and Creation

Directory of Open Access Journals (Sweden)

Paulo Bezerra

2012-12-01

Full Text Available The article begins with the differences betweenscientific and fictional translations, and focus on the second.The fictional translation works with meanings, opens itselfto the plurissignification in the purpose to create a similarity of the dissimilarity; in this process, the translator does nottranslate a language, but what a creative individuality makeswith a language. At last there is an approach to the knowledgeand skills necessaries to a translator of literature: theknowledge of the theories of the literature and of thetranslation, the capacity to preserve the national color ofthe original text and at the same time to respect the arrivallanguage, and the sensibility to his national languagevariations present in the daily and in the literary spheres.

Translating Alcohol Research

Science.gov (United States)

Batman, Angela M.; Miles, Michael F.

2015-01-01

Alcohol use disorder (AUD) and its sequelae impose a major burden on the public health of the United States, and adequate long-term control of this disorder has not been achieved. Molecular and behavioral basic science research findings are providing the groundwork for understanding the mechanisms underlying AUD and have identified multiple candidate targets for ongoing clinical trials. However, the translation of basic research or clinical findings into improved therapeutic approaches for AUD must become more efficient. Translational research is a multistage process of streamlining the movement of basic biomedical research findings into clinical research and then to the clinical target populations. This process demands efficient bidirectional communication across basic, applied, and clinical science as well as with clinical practitioners. Ongoing work suggests rapid progress is being made with an evolving translational framework within the alcohol research field. This is helped by multiple interdisciplinary collaborative research structures that have been developed to advance translational work on AUD. Moreover, the integration of systems biology approaches with collaborative clinical studies may yield novel insights for future translational success. Finally, appreciation of genetic variation in pharmacological or behavioral treatment responses and optimal communication from bench to bedside and back may strengthen the success of translational research applications to AUD. PMID:26259085

On Literal Translation of English Idioms

Science.gov (United States)

Chen, Linli

2009-01-01

There are six translation tactics in translating English idioms into Chinese: literal translation, compensatory translation, free translation, explanational translation, borrowing, integrated approach. Each tactic should be reasonably employed in the process of translating, so as to keep the flavor of the original English idioms as well as to…

A Study of Translation Institutional Ethics

Institute of Scientific and Technical Information of China (English)

LuoXianfeng; ZhouJin

2017-01-01

Traditional translation ethics characterized by translators' ethics cannot provide a strong moral support to the translation practice,or guarantee the moral requirement towards translation activities in the social transformation caused by the market economy,because it does not have the power of punishment.Translation institutional ethics,however,a new form of translation ethics,integrates the translation ethic norm,translation regulations and relative laws together.As an inevitable outcome in the new era,it can escort the orderly and healthy translation activities.Its purpose is to strengthen the translators' moral consciousness,to sublimate their moral notions and to transfer from heteronomy to autonomy.

The Impact of Translators' Epistemological Beliefs and Gender on Their Translation Quality

Science.gov (United States)

Araghizade, Elmira; Jadidi, Esmaeil

2016-01-01

This study aimed to determine the relationship between translators' epistemological beliefs and gender on their Persian-to-English translation quality. To do so, a group of 53 MA translation students both male and female were selected, through convenient sampling to participate in this study. For data collection two instruments were employed: 1…

Onomastics and Translation: The Case of Igbo→English Translation ...

African Journals Online (AJOL)

The qualitative research method will be used to translate, analyze and explain the data from the anthroponomical, semiotic and linguistic perspectives to show that contrary to the view held in some Western circles that names are obscure and may consist of words that can hardly be interpreted or translated, they, as symbols ...

Sound Effects in Translation

DEFF Research Database (Denmark)

Mees, Inger M.; Dragsted, Barbara; Gorm Hansen, Inge

2015-01-01

), Translog was employed to measure task times. The quality of the products was assessed by three experienced translators, and the number and types of misrecognitions were identified by a phonetician. Results indicate that SR translation provides a potentially useful supplement to written translation...

Measurement of the top quark mass with the template method in the ttˉ→lepton+jets channel using ATLAS data

NARCIS (Netherlands)

Aad, G.; et al., [Unknown; Bentvelsen, S.; Colijn, A.P.; de Jong, P.; de Nooij, L.; Doxiadis, A.D.; Garitaonandia, H.; Geerts, D.A.A.; Gosselink, M.; Kayl, M.S.; Koffeman, E.; Lee, H.; Linde, F.; Mechnich, J.; Mussche, I.; Ottersbach, J.P.; Rijpstra, M.; Ruckstuhl, N.; Tsiakiris, M.; van der Kraaij, E.; van der Leeuw, R.; van der Poel, E.; van Kesteren, Z.; van Vulpen, I.; Vermeulen, J.C.; Vreeswijk, M.

2012-01-01

The top quark mass has been measured using the template method in the ttˉ→lepton+jets channel based on data recorded in 2011 with the ATLAS detector at the LHC. The data were taken at a proton-proton centre-of-mass energy of √s = 7 TeV and correspond to an integrated luminosity of 1.04 fb−1. The

The role of iron uptake in pathogenicity and symbiosis in Photorhabdus luminescens TT01

Directory of Open Access Journals (Sweden)

Joyce Susan A

2010-06-01

Full Text Available Abstract Background Photorhabdus are Gram negative bacteria that are pathogenic to insect larvae whilst also having a mutualistic interaction with nematodes from the family Heterorhabditis. Iron is an essential nutrient and bacteria have different mechanisms for obtaining both the ferrous (Fe2+ and ferric (Fe3+ forms of this metal from their environments. In this study we were interested in analyzing the role of Fe3+ and Fe2+ iron uptake systems in the ability of Photorhabdus to interact with its invertebrate hosts. Results We constructed targeted deletion mutants of exbD, feoABC and yfeABCD in P. luminescens TT01. The exbD mutant was predicted to be crippled in its ability to obtain Fe3+ and we show that this mutant does not grow well in iron-limited media. We also show that this mutant was avirulent to the insect but was unaffected in its symbiotic interaction with Heterorhabditis. Furthermore we show that a mutation in feoABC (encoding a predicted Fe2+ permease was unaffected in both virulence and symbiosis whilst the divalent cation transporter encoded by yfeABCD is required for virulence in the Tobacco Hornworm, Manduca sexta (Lepidoptera but not in the Greater Wax Moth, Galleria mellonella (Lepidoptera. Moreover the Yfe transporter also appears to have a role during colonization of the IJ stage of the nematode. Conclusion In this study we show that iron uptake (via the TonB complex and the Yfe transporter is important for the virulence of P. luminescens to insect larvae. Moreover this study also reveals that the Yfe transporter appears to be involved in Mn2+-uptake during growth in the gut lumen of the IJ nematode. Therefore, the Yfe transporter in P. luminescens TT01 is important during colonization of both the insect and nematode and, moreover, the metal ion transported by this pathway is host-dependent.

Disseminating NASA-based science through NASA's Universe of Learning: Girls STEAM Ahead

Science.gov (United States)

Marcucci, E.; Meinke, B. K.; Smith, D. A.; Ryer, H.; Slivinski, C.; Kenney, J.; Arcand, K.; Cominsky, L.

2017-12-01

The Girls STEAM Ahead with NASA (GSAWN) initiative partners the NASA's Universe of Learning (UoL) resources with public libraries to provide NASA-themed activities for girls and their families. The program expands upon the legacy program, NASA Science4Girls and Their Families, in celebration of National Women's History Month. Program resources include hands-on activities for engaging girls, such as coding experiences and use of remote telescopes, complementary exhibits, and professional development for library partner staff. The science-institute-embedded partners in NASA's UoL are uniquely poised to foster collaboration between scientists with content expertise and educators with pedagogy expertise. The thematic topics related to NASA Astrophysics enable audiences to experience the full range of NASA scientific and technical disciplines and the different career skills each requires. For example, an activity may focus on understanding exoplanets, methods of their detection, and characteristics that can be determined remotely. The events focus on engaging underserved and underrepresented audiences in Science, Technology, Engineering, and Mathematics (STEM) via use of research-based best practices, collaborations with libraries, partnerships with local and national organizations (e.g. National Girls Collaborative Project or NGCP), and remote engagement of audiences. NASA's UoL collaborated with another NASA STEM Activation partner, NASA@ My Library, to announce GSAWN to their extensive STAR_Net network of libraries. This partnership between NASA SMD-funded Science learning and literacy teams has included NASA@ My Library hosting a professional development webinar featuring a GSAWN activity, a newsletter and blog post about the program, and plans for future exhibit development. This presentation will provide an overview of the program's progress to engage girls and their families through the development and dissemination of NASA-based science programming.

Search for the 125 GeV Higgs boson in the ttH production mode with the ATLAS detector (ID#99)

CERN Document Server

Hu, Shuyang; The ATLAS collaboration

2017-01-01

This poster presents the results of a combined ttH search in the γγ, multilepton and bb decay channels using up to 13.3 fb-1 of proton-proton collison data at sqrt(s)=13 TeV collected with the ATLAS detector at the LHC. The poster is to be shown at PANIC17, which will be held in Beijing from Sep 1st to Sep 5th.

Translating DVD Subtitles English-German, English-Japanese, Using Example-based Machine Translation

DEFF Research Database (Denmark)

Armstrong, Stephen; Caffrey, Colm; Flanagan, Marian

2006-01-01

Due to limited budgets and an ever-diminishing time-frame for the production of subtitles for movies released in cinema and DVD, there is a compelling case for a technology-based translation solution for subtitles. In this paper we describe how an Example-Based Machine Translation (EBMT) approach...... to the translation of English DVD subtitles into German and Japanese can aid the subtitler. Our research focuses on an EBMT tool that produces fully automated translations, which in turn can be edited if required. To our knowledge this is the first time that any EBMT approach has been used with DVD subtitle...

TRANSLATION PROCESS AND THE USE OF COMPUTER A REPORT ON PROBLEM-SOLVING BEHAVIOUR DURING TRANSLATING

Directory of Open Access Journals (Sweden)

Engliana Engliana

2017-04-01

Full Text Available Emphasising on translation process including pre- and post-editing task using a text taken randomly from news on the Internet, this paper attempts to illustrate the behaviour patterns of some students currently studying English language at the university level in Jakarta. The students received texts to be translated using the computer equipped with screen recording software aimed to record all related activities during the translation process, including the pre- and post-editing. The method involves observing the participants‘ behaviour during translating focusing on the actions performed before and after using translation tool(s. The purposes of this investigation are to determine if the students: 1 use any software and the Internet to help them; 2 use the information in the translation process; 3 apply the translation theories. The results indicates that no pre-editing task was performed prior to translation

MULTIFUNCTION OF INTERNET IN TRANSLATION

Directory of Open Access Journals (Sweden)

Bayu Budiharjo

2017-04-01

Full Text Available Technology affects almost all areas, including translation. Many products of technology have made translational works easier, one of which is internet. Despite the wide use of internet, the potentials it has are sometimes unnoticed. While web-based dictionaries or thesaurus often serve as translators’ assistants and online Machine Translation issues become topics of many researches, other uses of internet related to translation may not be known by many. Internet can help disseminate newborn ideas, theories and findings worldwide to enhance translation theories. Besides, the contact between internet and translation generates new areas to examine. Internet also provides helping hand in the area of translation research. Researcher or anyone conducting research in the field of translation can find a range of research gaps as well as reference. Those who need group discussions to collect required data from informants, or researchers of the same interest coming from all over the world can meet and conduct Focus Group Discussion (FGD on virtual world. Furthermore, internet offers various forms of assistance for translation practitioners. The commonly used internet assistance consists of dictionaries, thesaurus and Machine Translations available on the internet. Other forms of aid provided by internet take form of parallel texts, images, and videos, which can be very helpful. Internet provides many things which can be utilized for the purpose of translation. Internet keeps on providing more as it develops from time to time in line with the development of technology. Internet awaits utilization of theorists, researchers, practitioners and those having concern on translation.

Investigation of tt in the full hadronic final state at CDF with a neural network approach

CERN Document Server

Sidoti, A; Busetto, G; Castro, A; Dusini, S; Lazzizzera, I; Wyss, J

2001-01-01

In this work we present the results of a neural network (NN) approach to the measurement of the tt production cross-section and top mass in the all-hadronic channel, analyzing data collected at the Collider Detector at Fermilab (CDF) experiment. We have used a hardware implementation of a feedforward neural network, TOTEM, the product of a collaboration of INFN (Istituto Nazionale Fisica Nucleare)-IRST (Istituto per la Ricerca Scientifica e Tecnologica)-University of Trento, Italy. Particular attention has been paid to the evaluation of the systematics specifically related to the NN approach. The results are consistent with those obtained at CDF by conventional data selection techniques. (38 refs).

The NASA Astrophysics Program

Science.gov (United States)

Zebulum, Ricardo S.

2011-01-01

NASA's scientists are enjoying unprecedented access to astronomy data from space, both from missions launched and operated only by NASA, as well as missions led by other space agencies to which NASA contributed instruments or technology. This paper describes the NASA astrophysics program for the next decade, including NASA's response to the ASTRO2010 Decadal Survey.

Advertisement Translation under Skopos Theory

Institute of Scientific and Technical Information of China (English)

严妙

2014-01-01

This paper is an analysis of advertisement translation under skopos theory.It is explained that the nature of advertisement translation under skopos theory is reconstructing the information of the source text to persuade target audience.Three translation strategies are put forward in translating advertisements.

NASA systems engineering handbook

Science.gov (United States)

Shishko, Robert; Aster, Robert; Chamberlain, Robert G.; McDuffee, Patrick; Pieniazek, Les; Rowell, Tom; Bain, Beth; Cox, Renee I.; Mooz, Harold; Polaski, Lou

1995-06-01

This handbook brings the fundamental concepts and techniques of systems engineering to NASA personnel in a way that recognizes the nature of NASA systems and environment. It is intended to accompany formal NASA training courses on systems engineering and project management when appropriate, and is designed to be a top-level overview. The concepts were drawn from NASA field center handbooks, NMI's/NHB's, the work of the NASA-wide Systems Engineering Working Group and the Systems Engineering Process Improvement Task team, several non-NASA textbooks and guides, and material from independent systems engineering courses taught to NASA personnel. Five core chapters cover systems engineering fundamentals, the NASA Project Cycle, management issues in systems engineering, systems analysis and modeling, and specialty engineering integration. It is not intended as a directive.

La experiencia de la traducción como apropiación simbólica y práctica ritual en los nasa, Colombia

Directory of Open Access Journals (Sweden)

Jairo Tocancipá-Falla

2015-09-01

Full Text Available In general terms, the idea of translating offers a conventional sense of bridging the linguistic gaps between different languages. However, the implications of undertaking such a task among ethnic groups are rarely examined, at least in a practical sense that transcends the plane of a mere understanding of the words. This thoughtful article seeks to document the experience of translating a book from English into Spanish (the latter being a generalized language amongst the Nasa people in southwestern Colombia and its symbolic and ritual appropriation. The article argues that this type of experience shows a way of understanding and appropriating writing as a symbolic instance of power and transformation, and thus it contributes to transcending the conventional concept of translation and entering new intercultural domains.

Memetics and Translation Studies

OpenAIRE

Andrew, Chesterman

2000-01-01

Translation Studies is a branch of memetics. This is a claim, a hypothesis. More specifically, it is an interpretive hypothesis: I claim that Translation Studies can be thus interpreted, and that this is a useful thing to do because it offers a new and beneficial way of understanding translation.

Measurement of the tt¯ production cross-section using eμ events with b-tagged jets in pp collisions at s=13TeV with the ATLAS detector

Directory of Open Access Journals (Sweden)

M. Aaboud

2016-10-01

Full Text Available This paper describes a measurement of the inclusive top quark pair production cross-section (σtt¯ with a data sample of 3.2fb−1 of proton–proton collisions at a centre-of-mass energy of s=13TeV, collected in 2015 by the ATLAS detector at the LHC. This measurement uses events with an opposite-charge electron–muon pair in the final state. Jets containing b-quarks are tagged using an algorithm based on track impact parameters and reconstructed secondary vertices. The numbers of events with exactly one and exactly two b-tagged jets are counted and used to determine simultaneously σtt¯ and the efficiency to reconstruct and b-tag a jet from a top quark decay, thereby minimising the associated systematic uncertainties. The cross-section is measured to be: σtt¯=818±8(stat±27(syst±19(lumi±12(beam pb, where the four uncertainties arise from data statistics, experimental and theoretical systematic effects, the integrated luminosity and the LHC beam energy, giving a total relative uncertainty of 4.4%. The result is consistent with theoretical QCD calculations at next-to-next-to-leading order. A fiducial measurement corresponding to the experimental acceptance of the leptons is also presented.

Automatic Evaluation of Machine Translation

DEFF Research Database (Denmark)

Martinez, Mercedes Garcia; Koglin, Arlene; Mesa-Lao, Bartolomé

2015-01-01

The availability of systems capable of producing fairly accurate translations has increased the popularity of machine translation (MT). The translation industry is steadily incorporating MT in their workflows engaging the human translator to post-edit the raw MT output in order to comply with a s...

Dicty_cDB: VSF173 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available TT ATTTCAGGAAAAGCACTTGCATTTTCA sequence update 2001. 3.22 Translated Amino Acid sequence ---*tskkwdmilkql*vf...vasyflapvpkyim* k*r*ffk*krni*rywvifnrsiyxiwicnsxdfspfryyfrkstcif Frame B: ---*tskkwdmilkql*vflahlqlvyylif*hv

Impact of Online Versus Hardcopy Dictionaries‟ Application on Translation Quality of Iranian M. A. Translation Students

Directory of Open Access Journals (Sweden)

Sheida Zarei

2017-12-01

Full Text Available The study aimed at investigating the impact of online versus hardcopy dictionaries‟ application on translation quality of senior M.A. students of translation based on Bleu model introduced by Papineni et al. (2002. To this end, using Oxford Proficiency test 50 (out of 70 female senior M.A. students of translation were selected and they were assigned to two groups: Online and hardcopy, using systematic sampling. Next, an English text was selected as the reference text. This reference text was given to three translators: 1 A male English translation expert with a Ph.D. degree in Computational Linguistics (Ref. 1; 2 A female English translation expert with an M.A. degree working at an English Translation Center and with more than 5 years of experience (Ref. 2, and 3 A male Ph.D. candidate in English translation (Ref. 3. These three versions were used as reference Persian standard translations to be entered into Bleu. Later, the English text was given to the hardcopy and online groups. Then, the translations of the participants were compared with the three reference Persian translations using Bleu. The time taken by each student to translate the text into Persian was also recorded. The results indicated that there was no statistically significant difference between the translations of the hardcopy and online groups from fluency/precision points of view. Comparison of the speed of translation in the two groups indicated that the online group was meaningfully faster. The possible beneficiaries of the findings of this research can be university professors, policy makers, and students in the realm of translation.

How Do English Translation Majors Use Translation Strategies? A Survey of the Iranian EFL Context

Science.gov (United States)

Asgarian, Amir; Vefali, Gülsen Musayeva

2015-01-01

Translation language learning strategies, especially in relation to translation students, have not received adequate attention in the research to date. Therefore, the present study attempted to explore Iranian translation students' use of translation strategies, related beliefs, and academic achievement. It was a survey study involving…

rs11613352 polymorphism (TT genotype) associates with a decrease of triglycerides and an increase of HDL in familial hypercholesterolemia patients.

Science.gov (United States)

Aledo, Rosa; Padró, Teresa; Mata, Pedro; Alonso, Rodrigo; Badimon, Lina

2015-04-01

Recent genome-wide association studies have identified a locus on chromosome 12q13.3 associated with plasma levels of triglyceride and high-density lipoprotein cholesterol, with rs11613352 being the lead single nucleotide polymorphism in this genome-wide association study locus. The aim of the study is to investigate the involvement of rs11613352 in a population with high cardiovascular risk due to familial hypercholesterolemia. The single nucleotide polymorphism was genotyped by Taqman(®) assay in a cohort of 601 unrelated familial hypercholesterolemia patients and its association with plasma triglyceride and high-density lipoprotein cholesterol levels was analyzed by multivariate methods based on linear regression. Minimal allele frequency was 0.17 and genotype frequencies were 0.69, 0.27, and 0.04 for CC, CT, and TT genotypes, respectively. The polymorphism is associated in a recessive manner (TT genotype) with a decrease in triglyceride levels (P=.002) and with an increase in high-density lipoprotein cholesterol levels (P=.021) after adjusting by age and sex. The polymorphism rs11613352 may contribute to modulate the cardiovascular risk by modifying plasma lipid levels in familial hypercholesterolemia patients. Copyright © 2014 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

Strategy Of Translating Gadget Brochure

Directory of Open Access Journals (Sweden)

Deny Kusuma

2015-10-01

Full Text Available The title of this writing is strategy of translating gadget brochure. There were two problems discussed in this thesis, namely (1 terms found in the gadget manual book and its equivalence in Indonesia, (2 strategies applied in translating gadget brochure. Based on the analysis result, it was found that the terms and its equivalent words found in the gadget brochure were classified based on: 1 simple words or compound words and terminology forming phrase. 2 words category found are: noun and verb. The recommended pattern to determine the equivalent word was pure borrowing strategy, not adaptation borrowing strategy. The adaptation borrowing in this context was related to the spellings, the pronunciation or sound adaptation in the TL rather than adaptation for the cultural substitutes that conceptually mismatches with the standardized terminology in the SL. In addition, the result of the analysis that there were seven strategies found in gadget brochure, they were translation by more general word (Superordinate, translation by a more neutral/expressive word, translation by cultural substitution, translation by using loan word or loan word plus explanation, translation by paraphrase using related word, translation by omission and translation by illustration.

The wise translator: reflecting on judgement in translator education ...

African Journals Online (AJOL)

The question of how one goes about teaching students to be translators is a central area of concern for translation teachers. As a reflective practitioner, I have a hunch about how to solve my problem. This paper is therefore in itself part of a reflective practicum, part of my reflection-in-action. I am in the process of restructuring ...

Poetic tradition and the voice of the translator: The first verse translations of Dante’s Commedia

Directory of Open Access Journals (Sweden)

Marta Marfany

2017-12-01

Full Text Available This paper analyses and compares the variety of text types in the first verse translations of Dante’s Commedia: the Catalan translation by Andreu Febrer (1429, the Spanish translation by Pedro Fernández de Villegas (printed in 1515, and an anonymous French translation preserved in a manuscript dating from between 1491 and 1530. All these translations are the first verse translations of the work into their respective languages.

On Deletion of Sutra Translation

Institute of Scientific and Technical Information of China (English)

CHEN Shu-juan

2017-01-01

Dao An's the metaphor of translation "wine diluted with water' ' expressed a view about translation that had been abridged.Later Kumarajiva provided metaphor "rice chewed—tasteless and downright disgusting".Both of them felt regretted at the weakening of taste,sometimes even the complete loss of flavor caused by deletion in translation of Buddhist sutras.In early sutra translation,deletion is unavoidable which made many sutra translators felt confused and drove them to study it further and some even managed to give their understanding to this issue.This thesis will discuss the definition,and what causes deletion and the measures adopted by the sutra translators.

Translation: Aids, Robots, and Automation.

Science.gov (United States)

Andreyewsky, Alexander

1981-01-01

Examines electronic aids to translation both as ways to automate it and as an approach to solve problems resulting from shortage of qualified translators. Describes the limitations of robotic MT (Machine Translation) systems, viewing MAT (Machine-Aided Translation) as the only practical solution and the best vehicle for further automation. (MES)

History and theory of Scripture translations

Directory of Open Access Journals (Sweden)

Jean-Claude Loba-Mkole

2008-01-01

Full Text Available This article argues for the importance of Bible translations through its historical achievements and theoretical frames of reference. The missionary expansion of Christianity owes its very being to translations. The early Christian communities knew the Bible through the LXX translations while churches today still continue to use various translations. Translations shape Scripture interpretations, especially when a given interpretation depends on a particular translation. A particular interpretation can also influence a given translation. The article shows how translation theories have been developed to clarify and how the transaction source-target is culturally handled. The articles discuss some of these “theoretical frames”, namely the functional equivalence, relevance, literary functional equivalence and intercultural mediation. By means of a historical overview and a reflection on Bible translation theories the article aims to focus on the role of Africa in translation history.

The Reproducibility of 4-km Time Trial (TT) Performance Following Individualised Sodium Bicarbonate Supplementation: a Randomised Controlled Trial in Trained Cyclists.

Science.gov (United States)

Gough, Lewis Anthony; Deb, Sanjoy Kumar; Sparks, Andy; McNaughton, Lars Robert

2017-09-21

Individual time to peak blood bicarbonate (HCO 3 - ) has demonstrated good to excellent reproducibility following ingestion of both 0.2 g kg -1 body mass (BM) and 0.3 g kg -1 BM sodium bicarbonate (NaHCO 3 ), but the consistency of the time trial (TT) performance response using such an individualised NaHCO 3 ingestion strategy remains unknown. This study therefore evaluated the reproducibility of 4-km TT performance following NaHCO 3 ingestion individualised to time to peak blood bicarbonate. Eleven trained male cyclists completed five randomised treatments with prior ingestion of 0.2 g kg -1 (SBC2) or 0.3 g kg -1 BM (SBC3) NaHCO 3 , on two separate occasions each, or a control trial entailing no supplementation. Participants completed a 4-km cycling TT on a Velotron ergometer where time to complete, power and speed were measured, whilst acid-base blood parameters were also recorded (pH and blood bicarbonate concentration HCO 3 - ) and lactate [La - ]. Alkalosis was achieved prior to exercise in both SBC2 and SBC3, as pH and HCO 3 - were greater compared to baseline (p  0.05). The reproducibility of the mean absolute change from baseline to peak in HCO 3 - was good in SBC2 (r = 0.68) and excellent in SBC3 (r = 0.78). The performance responses following both SBC2 and SBC3 displayed excellent reproducibility (r range = 0.97 to 0.99). Results demonstrate excellent reproducibility of exercise performance following individualised NaHCO 3 ingestion, which is due to the high reproducibility of blood acid-base variables with repeat administration of NaHCO 3 . Using a time to peak HCO 3 - strategy seems to cause no dose-dependent effects on performance for exercise of this duration and intensity; therefore, athletes may consider smaller doses of NaHCO 3 to mitigate gastrointestinal (GI) discomfort.

Studies of tt+cc production with MadGraph5_aMC@NLO and Herwig++ for the ATLAS experiment

CERN Document Server

The ATLAS collaboration

2016-01-01

Studies of the simulation of ttcc at the LHC, at a centre-of-mass energy of 13 TeV, based on next-to-leading order calculations with MadGraph5_aMC@NLO matched to Herwig++ are presented. Samples with ttcc in the three flavour scheme, in a next-to-leading order matrix element are compared to an inclusive tt sample with the charm contribution coming from the parton shower. The effects of generator-level cuts, the functional form of the renormalization and factorization scales, and the starting scale of the parton shower are investigated.

Levelling-out and register variation in the translations of experienced and inexperienced translators: a corpus-based study

Directory of Open Access Journals (Sweden)

Karien Redelinghuys

2016-07-01

Full Text Available Explicitation, simplification, normalisation and levelling-out, the four features of translation proposed by Baker (1996, have attracted considerable attention in translation studies. Although the first three have been studied extensively, levelling-out has been the subject of less empirical investigation. Furthermore, there are no studies to date that have investigated the extent to which levelling-out occurs in translations by experienced translators and inexperienced translators. In this study, levelling-out is operationalised in terms of register. It is hypothesised that less register variation will be apparent in translations by inexperienced translators and, in keeping with the features of translation hypothesis, it is predicted that select linguistic features will demonstrate less register variation in translations than in non-translations. A custom-built corpus was compiled to test these hypotheses. While some light is shed on how translation expertise contributes to register sensitivity and the distribution of certain features across different registers, little evidence could be found for levelling-out as register variation is evident in the translation corpora.

Dicty_cDB: VHB673 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available TC TT sequence update 2002.10.25 Translated Amino Acid sequence llayw*hctnryhkrc*fiktagrwpwxvgir*gvcnns...llayw*hctnryhkrc*fiktagrwpwxvgir*gvcnnspakwtspeng*r*qwmvdaqs lkeviilltcrka*r*RKSLNVNSSGVXFSADLDG--- ---**hdl

The Temple Translator's Workstation Project

National Research Council Canada - National Science Library

Vanni, Michelle; Zajac, Remi

1996-01-01

.... The Temple Translator's Workstation is incorporated into a Tipster document management architecture and it allows both translator/analysts and monolingual analysts to use the machine- translation...

A Taxonomy of Human Translation Styles

DEFF Research Database (Denmark)

Carl, Michael; Dragsted, Barbara; Lykke Jakobsen, Arnt

2011-01-01

on the translators' activity data, we develop a taxonomy of translation styles. The taxonomy could serve to inform the development of advanced translation assistance tools and provide a basis for a felicitous and grounded integration of human machine interaction in translation.......While the translation profession becomes increasingly technological, we are still far from understanding how humans actually translate and how they could be best supported by machines. In this paper we outline a method which helps to uncover characteristics of human translation processes. Based...

Dual axis translation apparatus and system for translating an optical beam and related method

Science.gov (United States)

Cassidy, Kelly

1991-01-01

A dual axis translation device and system in accordance with this invention, for translating an optical beam along both an x-axis and a y-axis which are perpendicular to one another, has a beam directing means acting on said optical beam for directing the beam along a particular path transverse to said x and y axes. An arrangement supporting said beam directing means for movement in the x and y direction within a given plane is provided. The arrangement includes a first means for translating said beam directing means along the x-axis in said given plane in order to translate the beam along said x-axis. The arrangement comprises a second means for translating said beam directing means along the y-axis in said given plane in order to translate the beam along said y-axis.

NASA Extreme Environment Mission Operations: Science Operations Development for Human Exploration

Science.gov (United States)

Bell, Mary S.

2014-01-01

The purpose of NASA Extreme Environment Mission Operations (NEEMO) mission 16 in 2012 was to evaluate and compare the performance of a defined series of representative near-Earth asteroid (NEA) extravehicular activity (EVA) tasks under different conditions and combinations of work systems, constraints, and assumptions considered for future human NEA exploration missions. NEEMO 16 followed NASA's 2011 Desert Research and Technology Studies (D-RATS), the primary focus of which was understanding the implications of communication latency, crew size, and work system combinations with respect to scientific data quality, data management, crew workload, and crew/mission control interactions. The 1-g environment precluded meaningful evaluation of NEA EVA translation, worksite stabilization, sampling, or instrument deployment techniques. Thus, NEEMO missions were designed to provide an opportunity to perform a preliminary evaluation of these important factors for each of the conditions being considered. NEEMO 15 also took place in 2011 and provided a first look at many of the factors, but the mission was cut short due to a hurricane threat before all objectives were completed. ARES Directorate (KX) personnel consulted with JSC engineers to ensure that high-fidelity planetary science protocols were incorporated into NEEMO mission architectures. ARES has been collaborating with NEEMO mission planners since NEEMO 9 in 2006, successively building upon previous developments to refine science operations concepts within engineering constraints; it is expected to continue the collaboration as NASA's human exploration mission plans evolve.

An Evaluation of Output Quality of Machine Translation (Padideh Software vs. Google Translate)

Science.gov (United States)

Azer, Haniyeh Sadeghi; Aghayi, Mohammad Bagher

2015-01-01

This study aims to evaluate the translation quality of two machine translation systems in translating six different text-types, from English to Persian. The evaluation was based on criteria proposed by Van Slype (1979). The proposed model for evaluation is a black-box type, comparative and adequacy-oriented evaluation. To conduct the evaluation, a…

Thinking Chinese Translation A Course in Translation Method; Chinese to English

CERN Document Server

Valerie, Pellatt

2010-01-01

Suitable for advanced undergraduates and postgraduate students of Chinese. "Thinking Chinese Translation", this book explores the ways in which memory, general knowledge, and creativity (summed up as 'schema') contribute to the linguistic ability necessary to create a good translation

The Complexity of Indirect Translation

DEFF Research Database (Denmark)

Wenjie, L. I.

2017-01-01

its complex nature, and thus determined that many facets of ITr remain to be studied. The present article will try to encompass the complexity of ITr by looking into the reasons for translating indirectly, the challenge of finding out mediating texts (MTs), indirectness in both translation...... of which have been translated and interpreted indirectly through major languages like English, will be employed as examples. Hopefully, this study will offer more insights into the nature of translation as a social activity and raise further interests in studying translation as a complex phenomenon....

Translational Epidemiology in Psychiatry

Science.gov (United States)

Weissman, Myrna M.; Brown, Alan S.; Talati, Ardesheer

2012-01-01

Translational research generally refers to the application of knowledge generated by advances in basic sciences research translated into new approaches for diagnosis, prevention, and treatment of disease. This direction is called bench-to-bedside. Psychiatry has similarly emphasized the basic sciences as the starting point of translational research. This article introduces the term translational epidemiology for psychiatry research as a bidirectional concept in which the knowledge generated from the bedside or the population can also be translated to the benches of laboratory science. Epidemiologic studies are primarily observational but can generate representative samples, novel designs, and hypotheses that can be translated into more tractable experimental approaches in the clinical and basic sciences. This bedside-to-bench concept has not been explicated in psychiatry, although there are an increasing number of examples in the research literature. This article describes selected epidemiologic designs, providing examples and opportunities for translational research from community surveys and prospective, birth cohort, and family-based designs. Rapid developments in informatics, emphases on large sample collection for genetic and biomarker studies, and interest in personalized medicine—which requires information on relative and absolute risk factors—make this topic timely. The approach described has implications for providing fresh metaphors to communicate complex issues in interdisciplinary collaborations and for training in epidemiology and other sciences in psychiatry. PMID:21646577

A Protocol of Japanese-English Translation

OpenAIRE

三浦, 勲夫; MIURA, Isao

1999-01-01

Every year I translate Japanes enewspaper articles into English and publish them in book form containing 12 or more translations. In translating there are regular procedures I go through:1)initial translation done by me and 2) corrected translation done through discussion between a native English speaker and me.

INTEGRATING MACHINE TRANSLATION AND SPEECH SYNTHESIS COMPONENT FOR ENGLISH TO DRAVIDIAN LANGUAGE SPEECH TO SPEECH TRANSLATION SYSTEM

Directory of Open Access Journals (Sweden)

J. SANGEETHA

2015-02-01

Full Text Available This paper provides an interface between the machine translation and speech synthesis system for converting English speech to Tamil text in English to Tamil speech to speech translation system. The speech translation system consists of three modules: automatic speech recognition, machine translation and text to speech synthesis. Many procedures for incorporation of speech recognition and machine translation have been projected. Still speech synthesis system has not yet been measured. In this paper, we focus on integration of machine translation and speech synthesis, and report a subjective evaluation to investigate the impact of speech synthesis, machine translation and the integration of machine translation and speech synthesis components. Here we implement a hybrid machine translation (combination of rule based and statistical machine translation and concatenative syllable based speech synthesis technique. In order to retain the naturalness and intelligibility of synthesized speech Auto Associative Neural Network (AANN prosody prediction is used in this work. The results of this system investigation demonstrate that the naturalness and intelligibility of the synthesized speech are strongly influenced by the fluency and correctness of the translated text.

Precision translator

Science.gov (United States)

Reedy, Robert P.; Crawford, Daniel W.

1984-01-01

A precision translator for focusing a beam of light on the end of a glass fiber which includes two turning fork-like members rigidly connected to each other. These members have two prongs each with its separation adjusted by a screw, thereby adjusting the orthogonal positioning of a glass fiber attached to one of the members. This translator is made of simple parts with capability to keep adjustment even in condition of rough handling.

Lost in Translation?

NARCIS (Netherlands)

Jonkers, Peter

2017-01-01

Translating sacred scriptures is not only a praxis that is crucial for the fruitful, i.e. non-distorted and unbiased dialogue between different religious traditions, but also raises some fundamental theoretical questions when it comes to translating the sacred texts of the religious other or

Translating Romans: some persistent headaches

Directory of Open Access Journals (Sweden)

A.B. du Toit

2010-07-01

Full Text Available Translating Romans: some persistent headaches Gone are the days when it was axiomatic that expertise in biblical languages automatically qualified one as a Bible translator. In 1949, Ronald Knox, who for nine years conscientiously struggled with translating the Bible for his generation, published a booklet under the title The trials of a translator. At that stage Bible translation as the subject of scientific study was still in its infancy. Since then, research into the intricacies of communicating the biblical message in an authentic but understandable manner, has made significant progress (cf. Roberts, 2009. However, the frustrations of Bible translators, first of all to really understand what the biblical authors wanted to convey to their original addressees, and then to commu-nicate that message to their own targeted readers in a meaningful way, have not disappeared. In fact, the challenge to meet the vary-ing requirements of the multiple kinds of translation that are present-ly in vogue, has only increased.

The Translation and the Translator of the Peshitta of Hosea

Science.gov (United States)

Tully, Eric J.

2012-01-01

This comprehensive examination of the Syriac Peshitta of Hosea (P-Hosea) is the first study of the Peshitta conducted via insights and methods from the discipline of Translation Studies. It uses in particular Andrew Chesterman's Causal Model and Gideon Toury's descriptive approach. Every translator leaves residue of his or her…

NASA reports

Science.gov (United States)

Obrien, John E.; Fisk, Lennard A.; Aldrich, Arnold A.; Utsman, Thomas E.; Griffin, Michael D.; Cohen, Aaron

1992-01-01

Activities and National Aeronautics and Space Administration (NASA) programs, both ongoing and planned, are described by NASA administrative personnel from the offices of Space Science and Applications, Space Systems Development, Space Flight, Exploration, and from the Johnson Space Center. NASA's multi-year strategic plan, called Vision 21, is also discussed. It proposes to use the unique perspective of space to better understand Earth. Among the NASA programs mentioned are the Magellan to Venus and Galileo to Jupiter spacecraft, the Cosmic Background Explorer, Pegsat (the first Pegasus payload), Hubble, the Joint U.S./German ROSAT X-ray Mission, Ulysses to Jupiter and over the sun, the Astro-Spacelab Mission, and the Gamma Ray Observatory. Copies of viewgraphs that illustrate some of these missions, and others, are provided. Also discussed were life science research plans, economic factors as they relate to space missions, and the outlook for international cooperation.

Local health department translation processes: potential of machine translation technologies to help meet needs.

Science.gov (United States)

Turner, Anne M; Mandel, Hannah; Capurro, Daniel

2013-01-01

Limited English proficiency (LEP), defined as a limited ability to read, speak, write, or understand English, is associated with health disparities. Despite federal and state requirements to translate health information, the vast majority of health materials are solely available in English. This project investigates barriers to translation of health information and explores new technologies to improve access to multilingual public health materials. We surveyed all 77 local health departments (LHDs) in the Northwest about translation needs, practices, barriers and attitudes towards machine translation (MT). We received 67 responses from 45 LHDs. Translation of health materials is the principle strategy used by LHDs to reach LEP populations. Cost and access to qualified translators are principle barriers to producing multilingual materials. Thirteen LHDs have used online MT tools. Many respondents expressed concerns about the accuracy of MT. Overall, respondents were positive about its potential use, if low costs and quality could be assured.

TEACHING TRANSLATION: OBJECTIVES AND METHODS

OpenAIRE

Kobyakova, Iryna; Shvachko, Svitlana

2016-01-01

The article is focused on the set of items: teaching translation, objectives, exercises and assignments (both word-centered and text-centered translation), translation analysis. The choice of the items is motivated by the dominant functions of transatology (nominative and communicative). The latter succeed in identification of adequate, congruent, equivalent translation. The article discusses the problems of professional validity, theoretical insertions, textocentric analysis. Gains, achievem...

Translating Management Practices in Hierarchical Organizations

DEFF Research Database (Denmark)

Wæraas, Arild; Nielsen, Jeppe Agger

structures affect translators’ approaches taken towards management ideas. This paper reports the findings from a longitudinal case study of the translation of Leadership Pipeline in a Danish fire department and how the translators’ approach changed over time from a modifying to a reproducing mode. The study......This study examines how translators in a hierarchical context approach the translation of management practices. Although current translation theory and research emphasize the importance of contextual factors in translation processes, little research has investigated how strongly hierarchical...... finds that translation does not necessarily imply transformation of the management idea, pointing instead to aspects of exact imitation and copying of an ”original” idea. It also highlights how translation is likely to involve multiple and successive translation modes and, furthermore, that strongly...

Translational Research from an Informatics Perspective

Science.gov (United States)

Bernstam, Elmer; Meric-Bernstam, Funda; Johnson-Throop, Kathy A.; Turley, James P.; Smith, Jack W.

2007-01-01

Clinical and translational research (CTR) is an essential part of a sustainable global health system. Informatics is now recognized as an important en-abler of CTR and informaticians are increasingly called upon to help CTR efforts. The US National Institutes of Health mandated biomedical informatics activity as part of its new national CTR grant initiative, the Clinical and Translational Science Award (CTSA). Traditionally, translational re-search was defined as the translation of laboratory discoveries to patient care (bench to bedside). We argue, however, that there are many other kinds of translational research. Indeed, translational re-search requires the translation of knowledge dis-covered in one domain to another domain and is therefore an information-based activity. In this panel, we will expand upon this view of translational research and present three different examples of translation to illustrate the point: 1) bench to bedside, 2) Earth to space and 3) academia to community. We will conclude with a discussion of our local translational research efforts that draw on each of the three examples.

Translational ecology for hydrogeology.

Science.gov (United States)

Schlesinger, William H

2013-01-01

Translational ecology--a special discipline aimed to improve the accessibility of science to policy makers--will help hydrogeologists contribute to the solution of pressing environmental problems. Patterned after translational medicine, translational ecology is a partnership to ensure that the right science gets done in a timely fashion, so that it can be communicated to those who need it. © 2013, National Ground Water Association.

Ames Life Science Data Archive: Translational Rodent Research at Ames

Science.gov (United States)

Wood, Alan E.; French, Alison J.; Ngaotheppitak, Ratana; Leung, Dorothy M.; Vargas, Roxana S.; Maese, Chris; Stewart, Helen

2014-01-01

The Life Science Data Archive (LSDA) office at Ames is responsible for collecting, curating, distributing and maintaining information pertaining to animal and plant experiments conducted in low earth orbit aboard various space vehicles from 1965 to present. The LSDA will soon be archiving data and tissues samples collected on the next generation of commercial vehicles; e.g., SpaceX & Cygnus Commercial Cargo Craft. To date over 375 rodent flight experiments with translational application have been archived by the Ames LSDA office. This knowledge base of fundamental research can be used to understand mechanisms that affect higher organisms in microgravity and help define additional research whose results could lead the way to closing gaps identified by the Human Research Program (HRP). This poster will highlight Ames contribution to the existing knowledge base and how the LSDA can be a resource to help answer the questions surrounding human health in long duration space exploration. In addition, it will illustrate how this body of knowledge was utilized to further our understanding of how space flight affects the human system and the ability to develop countermeasures that negate the deleterious effects of space flight. The Ames Life Sciences Data Archive (ALSDA) includes current descriptions of over 700 experiments conducted aboard the Shuttle, International Space Station (ISS), NASA/MIR, Bion/Cosmos, Gemini, Biosatellites, Apollo, Skylab, Russian Foton, and ground bed rest studies. Research areas cover Behavior and Performance, Bone and Calcium Physiology, Cardiovascular Physiology, Cell and Molecular Biology, Chronobiology, Developmental Biology, Endocrinology, Environmental Monitoring, Gastrointestinal Physiology, Hematology, Immunology, Life Support System, Metabolism and Nutrition, Microbiology, Muscle Physiology, Neurophysiology, Pharmacology, Plant Biology, Pulmonary Physiology, Radiation Biology, Renal, Fluid and Electrolyte Physiology, and Toxicology. These

Introduction and Rollout of a New Group A Meningococcal Conjugate Vaccine (PsA-TT) in African Meningitis Belt Countries, 2010–2014

Science.gov (United States)

Djingarey, Mamoudou H.; Diomandé, Fabien V. K.; Barry, Rodrigue; Kandolo, Denis; Shirehwa, Florence; Lingani, Clement; Novak, Ryan T.; Tevi-Benissan, Carol; Perea, William; Preziosi, Marie-Pierre; LaForce, F. Marc

2015-01-01

Background. A group A meningococcal conjugate vaccine (PsA-TT) was developed specifically for the African “meningitis belt” and was prequalified by the World Health Organization (WHO) in June 2010. The vaccine was first used widely in Burkina Faso, Mali, and Niger in December 2010 with great success. The remaining 23 meningitis belt countries wished to use this new vaccine. Methods. With the help of African countries, WHO developed a prioritization scheme and used or adapted existing immunization guidelines to mount PsA-TT vaccination campaigns. Vaccine requirements were harmonized with the Serum Institute of India, Ltd. Results. Burkina Faso was the first country to fully immunize its 1- to 29-year-old population in December 2010. Over the next 4 years, vaccine coverage was extended to 217 million Africans living in 15 meningitis belt countries. Conclusions. The new group A meningococcal conjugate vaccine was well received, with country coverage rates ranging from 85% to 95%. The rollout proceeded smoothly because countries at highest risk were immunized first while attention was paid to geographic contiguity to maximize herd protection. Community participation was exemplary. PMID:26553672

Mass spectrometric imaging as a high-spatial resolution tool for functional genomics: Tissue-specific gene expression of TT7 inferred from heterogeneous distribution of metabolites in Arabidopsis flowers

Energy Technology Data Exchange (ETDEWEB)

Korte, Andrew R.; Song, Zhihong; Nikolau, Basil J.; Lee, Young Jin

2011-12-23

Laser desorption/ionization (LDI) mass spectrometry imaging (MSI) was used to acquire chemical images of flavonoid metabolites on the surface of wild-type and mutant (tt7) Arabidopsis thaliana flowers. Flavonoids were localized to the petals and carpels of flowers, with tissue heterogeneity in the petals. Specifically, kaempferol and/or its glycosides were abundant in the distal region of petals and quercetin and its downstream flavonoids were highly enriched in the more proximal region of petals. As a result of a mutation in the TT7 gene which blocks the conversion of dihydrokaempferol to dihydroquercetin, the downstream metabolites, quercetin, isohamnetin, and their glycosides, were not observed in the mutant flowers. Instead, the metabolites in an alternative pathway, kaempferol and/or its glycosides, were as highly abundant on the proximal region of the petals as in the distal region. In addition, the combined flavonoid amounts on the proximal region of petals in the wild-type are almost equivalent to the amounts of kaempferol and/or its glycosides in the mutant. This strongly suggests that the expression of the TT7 gene is localized on the proximal part of the petal while the other genes in the upper stream pathway are evenly expressed throughout the petal. Most importantly, this work demonstrates MSI of metabolites can be utilized for the localization of gene expression.

Perceived radial translation during centrifugation

NARCIS (Netherlands)

Bos, J.E.; Correia Grácio, B.J.

2015-01-01

BACKGROUND: Linear acceleration generally gives rise to translation perception. Centripetal acceleration during centrifugation, however, has never been reported giving rise to a radial, inward translation perception. OBJECTIVE: To study whether centrifugation can induce a radial translation

Russian translations for Cochrane.

Science.gov (United States)

Yudina, E V; Ziganshina, L E

2015-01-01

Cochrane collaboration has made a huge contribution to the development of evidence-based medicine; Cochrane work is the international gold standard of independent, credible and reliable high-quality information in medicine. Over the past 20 years the Cochrane Collaboration helped transforming decision-making in health and reforming it significantly, saving lives and contributing to longevity [1]. Until recently, Cochrane evidence were available only in English, which represents a significant barrier to their wider use in non-English speaking countries. To provide access to evidence, obtained from Cochrane Reviews, for health professionals and general public (from non-English-speaking countries), bypassing language barriers, Cochrane collaboration in 2014 initiated an international project of translating Plain language summaries of Cochrane Reviews into other languages [2, 3]. Russian translations of Plain language summaries were started in May 2014 by the team from Kazan Federal University (Department of Basic and Clinical Pharmacology; 2014-2015 as an Affiliated Centre in Tatarstan of the Nordic Cochrane Centre, since August 2015 as Cochrane Russia, a Russian branch of Cochrane Nordic, Head - Liliya Eugenevna Ziganshina) on a voluntary basis. To assess the quality of Russian translations of Cochrane Plain Language Summaries (PLS) and their potential impact on the Russian speaking community through user feedback with the overarching aim of furthering the translations project. We conducted the continuous online survey via Google Docs. We invited respondents through the electronic Russian language discussion forum on Essential Medicines (E-lek), links to survey on the Russian Cochrane.org website, invitations to Cochrane contributors registered in Archie from potential Russian-speaking countries. We set up the survey in Russian and English. The respondents were asked to respond to the questionnaire regarding the relevance and potential impact of the Cochrane Russian

National Center for Advancing Translational Sciences

Science.gov (United States)

... Models Core Technologies Clinical Innovation Clinical and Translational Science Awards Program Rare Diseases Clinical Research Network Patient ... to our monthly e-newsletter. About Translation Translational Science Spectrum Explore the full spectrum of translational science, ...

Gregory Rabassa’s Views on Translation

Directory of Open Access Journals (Sweden)

Bolaños Cuéllar Sergio

2011-06-01

Full Text Available Gregory Rabassa is noted for his translations of famous Latin American authors (García Márquez, Vargas Llosa, Clarice Lispector, Jorge Amado, etc.. Less known are his views on translating. In this paper I aim at presenting and discussing his viewpoints as to the definition of translation (with a key discussion of the concept of equivalence, the role of the translator (a model speaker-listener of the target text, and some of the translation strategies he applies in his translational work (original's pre-eminence, problem solving, foreignizing, fictionalizing, and semantic networking. I argue that most of Rabassa's stances towards translating can be explained and are still valid within the framework of a modern translation approach. Examples from the English, French, German, Portuguese and Russian translations of García Márquez's Cien años de soledad are taken from a multilingual parallel corpus collected by the author of this paper.

Investigation of tt-bar in the full hadronic final state at CDF with a neural network approach

International Nuclear Information System (INIS)

Sidoti, A.; Azzi, P.; Busetto, G.; Castro, A.; Dusini, S.; Lazzizzera, I.; Wyss, J.L.

2001-01-01

In this work we present the results of a neural network (NN) approach to the measurement of the tt-bar production cross-section and top mass in the all-hadronic channel, analyzing data collected at the Collider Detector at Fermilab (CDF) experiment. We have used a hardware implementation of a feed forward neural network, TOTEM, the product of a collaboration of INFN (Istituto Nazionale Fisica Nucleare) - IRST (Istituto per la Ricerca Scientifica e Tecnologica) - University of Trento, Italy. Particular attention has been paid to the evaluation of the systematics specifically related to the NN approach. The results are consistent with those obtained at CDF by conventional data selection techniques

TRANSLATION OF SELF-HELP BOOKS: TRANSLATION PROBLEMS IN RHONDA BYRNE'S "THE SECRET"

OpenAIRE

Furlan, Ana

2013-01-01

Self-help books are becoming very popular nowadays and have to be translated in other languages in order to be accessible to a wider audience from other countries. All self-help books share the same goal: to help the readers find solutions to their problems. They are written with a specific purpose and have special characteristics, which have to be considered when translating them. This graduation thesis focuses on the translation of self-help books in general and gives an analysis of som...

Authorial and Editorial Voices in Translation

DEFF Research Database (Denmark)

Translation Studies now recognizes that translators are not the only agents involved in translation. Authors and editors provide suggestions and instructions. Publishers have considerable power over the final text and how it is presented to the public. While it is well-known that translations...... understanding of the processes through which authors, publishers, editors, directors, and critics can affect translation. Empirical studies from historical and contemporary settings examine forms of collaboration and negotiation, or conflict, with special attention to the multiple voices in theatre translation....

Incorporating translation into sociolinguistic research: translation policy in an international non-governmental organisation

OpenAIRE

Tesseur, Wine

2017-01-01

This article explores aspects of translation, multilingualism and language policy in the field of transnational civil society. By focusing on translation policies at Amnesty International, an international non-governmental organisation that performs a key role in global governance, this article seeks to contribute to a globalisation-sensitive sociolinguistics. It argues that combining a sociolinguistic approach, more precisely linguistic ethnography, with translation studies leads to an incre...

Mamma Mia, A Singable Translation!

Directory of Open Access Journals (Sweden)

Andrej Stopar

2016-06-01

Full Text Available The article discusses and analyzes approaches to translating singable texts. It presents a linguistic (prosodic, lexical and structural analysis of the Slovenian translation of the musical Mamma Mia! The aim of the qualitative and quantitative study is to investigate the translation strategies used to produce a singable target text. The results of the analysis suggest that producing a prosodic match is a basic requirement, whereas the lexical, structural and/or poetic characteristics of the source text are subject to changes. Overall, the findings show that the function and the purpose of the translation play a crucial role in the prioritization of translation strategies.

Measuring Translation Literality

DEFF Research Database (Denmark)

Carl, Michael; Schaeffer, Moritz

2017-01-01

Tirkkonen-Condit (2005: 407–408) argues that “It looks as if literal translation is [the result of] a default rendering procedure”. As a corollary, more literal translations should be easier to process, and less literal ones should be associated with more cognitive effort. In order to assess this...

Bringing translation out of the shadows: translation as an issue of methodological significance in cross-cultural qualitative research.

Science.gov (United States)

Wong, Josephine Pui-Hing; Poon, Maurice Kwong-Lai

2010-04-01

Translation is an integral component of cross-cultural research that has remained invisible. It is commonly assumed that translation is an objective and neutral process, in which the translators are "technicians" in producing texts in different languages. Drawing from the field of translation studies and the findings of a translation exercise conducted with three bilingual Cantonese-English translators, the authors highlight some of the methodological issues about translation in cross-cultural qualitative research. They argue that only by making translation visible and through open dialogue can researchers uncover the richness embedded in the research data and facilitate multiple ways of knowing.

A phased translation function

International Nuclear Information System (INIS)

Read, R.J.; Schierbeek, A.J.

1988-01-01

A phased translation function, which takes advantage of prior phase information to determine the position of an oriented mulecular replacement model, is examined. The function is the coefficient of correlation between the electron density computed with the prior phases and the electron density of the translated model, evaluated in reciprocal space as a Fourier transform. The correlation coefficient used in this work is closely related to an overlap function devised by Colman, Fehlhammer and Bartels. Tests with two protein structures, one of which was solved with the help of the phased translation function, show that little phase information is required to resolve the translation problem, and that the function is relatively insensitive to misorientation of the model. (orig.)

Single acting translational/rotational brake

Science.gov (United States)

Allred, Johnny W. (Inventor); Fleck, Jr., Vincent J. (Inventor)

1996-01-01

A brake system is provided that applies braking forces on surfaces in both the translational and rotational directions using a single acting self-contained actuator that travels with the translational mechanism. The brake engages a mechanical lock and creates a frictional force on the translational structure preventing translation while simultaneously creating a frictional torque that prevents rotation of the vertical support. The system may include serrations on the braking surfaces to provide increased braking forces.

The Translator's Turn: in the Cultural Turn

Institute of Scientific and Technical Information of China (English)

徐玮玮

2003-01-01

@@ Introduction: Douglas Robinson rose to the defense of the " atheoretical" American literary translator in The Translator's Turn (1991). Here, I borrowed the title from him, but I will write my paper in the thought of the translator's role in translating. In his book, Robinson argued that the literary translator embodies an integration of feeling and thought, of intuition and systematization. In analyzing the " turn" that the translator take from the source text to the target text, Robinson offered a " dialogical" model, that is the translator's dialogical engagement with the source language and with the ethic of the target language. Robinson allows for the translator to intervene, subvert, divert, even entertain, emphasizing the creative aspect of literary translation. The translation linguists, scientists, and philosophers have had their chance at translation theory; now it is time, he argued, for the literary translators to have their " turn".

On the Systematicity of Human Translation Processes

DEFF Research Database (Denmark)

Carl, Michael; Dragsted, Barbara; Lykke Jakobsen, Arnt

While translation careers and the translation profession become more globalised and more technological, we are still far from understanding how humans actually translate and how they could be best supported by machines. In this paper we attempt to outline a method which helps to uncover character......While translation careers and the translation profession become more globalised and more technological, we are still far from understanding how humans actually translate and how they could be best supported by machines. In this paper we attempt to outline a method which helps to uncover...... characteristic steps in human translation processes. Based on the translators' activity data, we develop a taxonomy of translation styles, which are characteristic for different kinds of translators. The taxonomy could serve to inform the development of advanced translation assistance tools and provide a basis...

Allocation of Cognitive Resources in Translation

DEFF Research Database (Denmark)

Hvelplund, Kristian Tangsgaard

The present study is an empirical investigation of translators' allocation of cognitive resources during the translation process, and it aims at investigating how translators' mental processing resources are put to use during translation. The study bases ts analyses on quantitative eye...

Knowledge translation of research findings

Directory of Open Access Journals (Sweden)

Grimshaw Jeremy M

2012-05-01

Full Text Available Abstract Background One of the most consistent findings from clinical and health services research is the failure to translate research into practice and policy. As a result of these evidence-practice and policy gaps, patients fail to benefit optimally from advances in healthcare and are exposed to unnecessary risks of iatrogenic harms, and healthcare systems are exposed to unnecessary expenditure resulting in significant opportunity costs. Over the last decade, there has been increasing international policy and research attention on how to reduce the evidence-practice and policy gap. In this paper, we summarise the current concepts and evidence to guide knowledge translation activities, defined as T2 research (the translation of new clinical knowledge into improved health. We structure the article around five key questions: what should be transferred; to whom should research knowledge be transferred; by whom should research knowledge be transferred; how should research knowledge be transferred; and, with what effect should research knowledge be transferred? Discussion We suggest that the basic unit of knowledge translation should usually be up-to-date systematic reviews or other syntheses of research findings. Knowledge translators need to identify the key messages for different target audiences and to fashion these in language and knowledge translation products that are easily assimilated by different audiences. The relative importance of knowledge translation to different target audiences will vary by the type of research and appropriate endpoints of knowledge translation may vary across different stakeholder groups. There are a large number of planned knowledge translation models, derived from different disciplinary, contextual (i.e., setting, and target audience viewpoints. Most of these suggest that planned knowledge translation for healthcare professionals and consumers is more likely to be successful if the choice of knowledge

Knowledge translation of research findings.

Science.gov (United States)

Grimshaw, Jeremy M; Eccles, Martin P; Lavis, John N; Hill, Sophie J; Squires, Janet E

2012-05-31

One of the most consistent findings from clinical and health services research is the failure to translate research into practice and policy. As a result of these evidence-practice and policy gaps, patients fail to benefit optimally from advances in healthcare and are exposed to unnecessary risks of iatrogenic harms, and healthcare systems are exposed to unnecessary expenditure resulting in significant opportunity costs. Over the last decade, there has been increasing international policy and research attention on how to reduce the evidence-practice and policy gap. In this paper, we summarise the current concepts and evidence to guide knowledge translation activities, defined as T2 research (the translation of new clinical knowledge into improved health). We structure the article around five key questions: what should be transferred; to whom should research knowledge be transferred; by whom should research knowledge be transferred; how should research knowledge be transferred; and, with what effect should research knowledge be transferred? We suggest that the basic unit of knowledge translation should usually be up-to-date systematic reviews or other syntheses of research findings. Knowledge translators need to identify the key messages for different target audiences and to fashion these in language and knowledge translation products that are easily assimilated by different audiences. The relative importance of knowledge translation to different target audiences will vary by the type of research and appropriate endpoints of knowledge translation may vary across different stakeholder groups. There are a large number of planned knowledge translation models, derived from different disciplinary, contextual (i.e., setting), and target audience viewpoints. Most of these suggest that planned knowledge translation for healthcare professionals and consumers is more likely to be successful if the choice of knowledge translation strategy is informed by an assessment of the

TEACHING COMMUNICATIVE TRANSLATION: AN ACTIVE RECEPTION ANALYSIS BETWEEN THE TRANSLATION AND READER’S RECEPTION

Directory of Open Access Journals (Sweden)

Venny Eka Meidasari

2014-06-01

Full Text Available Literary theory sees reception theory from the reader response that emphasizes the reader’s reception of a literary text. It is generally called audience reception in the analysis of communications models. In literary studies, reception theory originated from the work of Hans-Robert Jauss in the late 1960s. Communication only means that the original message will be clearly sent in its equivalent context to the target receptor. Similarly, the main role of translators is to send the message across without any form of distortion or emphasis. It is delivering the genuine context of the message to the language that the active receptor understands. A single mistake in a context translation can result to offensive message that can eventually lead to misunderstandings between active receptors. This paper proposes on the role of translator as the mediator between a writer of the original text and the active target language receptors of translated version in the course of communication which definitely affects the process and result of translation practice. It also reveals the emphasis on the creation text of the translation theories originated from the strategic communication theories, which hopefully leads to a dream of the most equivalence between the text and the translated version.

Problems in Translating Figures of Speech: A Review of Persian Translations of Harry Potter Series

Directory of Open Access Journals (Sweden)

Fatemeh Masroor

2016-12-01

Full Text Available Due to the important role of figures of speech in prose, the present research tried to investigate the figures of speech in the novel, Harry Potter Series, and their Persian translations. The main goal of this research was to investigate the translators’ problems in translating figures of speech from English into Persian. To achieve this goal, the collected data were analyzed and compared with their Persian equivalents. Then, the theories of Newmark (1988 & 2001, Larson (1998, and Nolan (2005 were used in order to find the applied strategies for rendering the figures of speech by the translators. After identifying the applied translation strategies, the descriptive and inferential analyses were applied to answer the research question and test its related hypothesis. The results confirmed that the most common pitfalls in translating figures of speech from English into Persian based on Nolan (2005 were, not identifying of figures of speech, their related meanings and translating them literally. Overall, the research findings rejected the null hypothesis. The findings of present research can be useful for translators, especially beginners. They can be aware of the existing problems in translating figures of speech, so they can avoid committing the same mistakes in their works.

Translational plant proteomics: A perspective

NARCIS (Netherlands)

Agrawal, G.K.; Pedreschi, R.; Barkla, B.J.; Bindschedler, L.V.; Cramer, R.; Sarkar, A.; Renaut, J.; Job, D.; Rakwal, R.

2012-01-01

Translational proteomics is an emerging sub-discipline of the proteomics field in the biological sciences. Translational plant proteomics aims to integrate knowledge from basic sciences to translate it into field applications to solve issues related but not limited to the recreational and economic

Machine Translation Effect on Communication

DEFF Research Database (Denmark)

Jensen, Mika Yasuoka; Bjørn, Pernille

2011-01-01

Intercultural collaboration facilitated by machine translation has gradually spread in various settings. Still, little is known as for the practice of machine-translation mediated communication. This paper investigates how machine translation affects intercultural communication in practice. Based...... on communication in which multilingual communication system is applied, we identify four communication types and its’ influences on stakeholders’ communication process, especially focusing on establishment and maintenance of common ground. Different from our expectation that quality of machine translation results...

Translation and Manipulation in Renaissance England

Directory of Open Access Journals (Sweden)

John Denton

2016-12-01

Full Text Available This supplementary volume to JEMS is part of an ongoing research project which began with a series of articles published by the author in the 1990s on the translation of Classical historical texts in Renaissance England. The methodology followed is that of Descriptive Translation Studies as developed by scholars such as Lefevere and Hermans with the accent on manipulation of the source text in line with the ideological stance of the translator and the need to ensure that readers of the translation received the ‘correct’ moral lessons.  Particular attention is devoted to a case study of the strategies followed in Thomas North’s domesticating English translation of Jacques Amyot’s French translation of Plutarch’s Lives and the consequences for Shakespeare’s perception of Plutarch.Biography John Denton was associate professor of English Language and Translation at the University of Florence until retirement in 2015. He  has published on contrastive analysis, history of translation (with special reference to the Early Modern England, religious discourse, literary and audiovisual translation. 

Considerations for acceptability in Bible translation

Directory of Open Access Journals (Sweden)

Diphus C. Chemorion

2009-09-01

Full Text Available The ministry of Bible translation is an important component of the Great Commission (Matthew 28:18�20 and its mandate is to reach everyone with the word of God. One of the main goals of a Bible translation project is to produce a translation that will be used by the church in a given language group. Bible translation teams believe that the lives of the intended recipients will be changed positively when they gain access to Scripture in their own language. However, recent developments regarding Scripture use have shown that the success of any Bible translation project depends on whether or not its products are acceptable. If a translation is not acceptable to the intended audience, it may not be used, and as a result, it may fail to bring about the desired impact. This article explores the concept of �acceptability� as used in Bible translation and highlights important considerations that translators need to keep in mind in order to enhance the acceptability of their translation products.

NASA's Design and Development of a Field Goniometer Instrument Using Solid Works

Science.gov (United States)

Turner, Mark; Sasaki, Glen; Jennings, Ernest (Technical Monitor)

2000-01-01

input at the very early stages, which added significant benefit to the final product. Fabrication cost and schedule savings have been realized by having complex part geometries translated directly from the SolidWorks design models to Surfcam and other computer-aided manufacturing (CAM) software. This direct model translation capability optimized the fabrication processes. The end result was that we were able to successfully complete the project on time and on budget. Other advantages of using SolidWorks, as cited by the design team, include a rapid negotiation of the initial learning curve, the ability to develop solid model hardware prototypes (used to communicate the design intent to both the customer and the fabricator), and the ability to work as a team collaborating on a large, complex model. These types of tools and efforts represent our response to NASA's challenge to produce higher quality products within shorter design and fabrication times.

Studies on the Mental Processes in Translation Memory-assisted Translation – the State of the Art

DEFF Research Database (Denmark)

Christensen, Tina Paulsen

2011-01-01

This article reviews research on the mental translation processes involved in translation memory-assisted translation. First, based on recent developments in cognitive science the article provides a working definition of mental TM research. Next the article analyses a selection of mental TM studies...... with a view to discovering their aims, data, methods and results. In doing so, the paper attempts to find out what we know by now about the mental aspects of translation memory-assisted translation. The analysis suggests fruitful avenues for future research and concludes that particularly more research...... is needed which takes into account the recent developments within TM technology and looks into both internal and external translation processes....

The Beads of Translation: Using Beads to Translate mRNA into a Polypeptide Bracelet

Science.gov (United States)

Dunlap, Dacey; Patrick, Patricia

2012-01-01

During this activity, by making beaded bracelets that represent the steps of translation, students simulate the creation of an amino acid chain. They are given an mRNA sequence that they translate into a corresponding polypeptide chain (beads). This activity focuses on the events and sites of translation. The activity provides students with a…

Stimulating translational research

DEFF Research Database (Denmark)

Bentires-Alj, Mohamed; Rajan, Abinaya; van Harten, Wim

2015-01-01

Translational research leaves no-one indifferent and everyone expects a particular benefit. We as EU-LIFE (www.eu-life.eu), an alliance of 13 research institutes in European life sciences, would like to share our experience in an attempt to identify measures to promote translational research with...... without undermining basic exploratory research and academic freedom....

Translational Implications of Tamil "Hamlets."

Science.gov (United States)

Kanakaraj, S.

1994-01-01

Discusses the use of translation when teaching English as a Second Language in a Tamil context. Singles out the fencing episode in Shakespeare's "Hamlet" to illustrate the difficulties of translating cultural aspects. Concludes that successful translations of Shakespeare into Indian languages should involve collaboration between…

NASA's GeneLab Phase II: Federated Search and Data Discovery

Science.gov (United States)

Berrios, Daniel C.; Costes, Sylvain V.; Tran, Peter B.

2017-01-01

GeneLab is currently being developed by NASA to accelerate 'open science' biomedical research in support of the human exploration of space and the improvement of life on earth. Phase I of the four-phase GeneLab Data Systems (GLDS) project emphasized capabilities for submission, curation, search, and retrieval of genomics, transcriptomics and proteomics ('omics') data from biomedical research of space environments. The focus of development of the GLDS for Phase II has been federated data search for and retrieval of these kinds of data across other open-access systems, so that users are able to conduct biological meta-investigations using data from a variety of sources. Such meta-investigations are key to corroborating findings from many kinds of assays and translating them into systems biology knowledge and, eventually, therapeutics.

NASAs GeneLab Phase II: Federated Search and Data Discovery

Science.gov (United States)

Berrios, Daniel C.; Costes, Sylvain; Tran, Peter

2017-01-01

GeneLab is currently being developed by NASA to accelerate open science biomedical research in support of the human exploration of space and the improvement of life on earth. Phase I of the four-phase GeneLab Data Systems (GLDS) project emphasized capabilities for submission, curation, search, and retrieval of genomics, transcriptomics and proteomics (omics) data from biomedical research of space environments. The focus of development of the GLDS for Phase II has been federated data search for and retrieval of these kinds of data across other open-access systems, so that users are able to conduct biological meta-investigations using data from a variety of sources. Such meta-investigations are key to corroborating findings from many kinds of assays and translating them into systems biology knowledge and, eventually, therapeutics.

TRADUCCIÓN DE ACRÓNIMOS Y SIGLAS EN TEXTOS MÉDICOS DE CARDIOLOGÍA / Translation of acronyms and initialisms in medical texts on cardiology

Directory of Open Access Journals (Sweden)

Ana V. Fernández Peraza

2013-01-01

cumplimiento de su función comunicativa fundamental, brindar información útil al personal de la salud. / Abstract Introduction and Objectives: Acronyms and initialisms are frequently used in medical texts. Their translation is not only language-dependent, but also culture-bound. The objective of this research was to analyze the problems associated to the translation from English into Spanish of acronyms and initialisms used in medical texts on Cardiology. Method: This is a qualitative, interpretive, descriptive, synchronic study based on the lexical analysis of acronyms and initialisms in the English source text (ST and the Spanish target text (TT, within the framework of descriptive translation studies. An empirical textual sample of 8 medical articles on Cardiology was analyzed, as well as their corresponding translations into Spanish. Results: In the corpus 83 acronyms and initialisms were identified. Only 15 were identified as acronyms. When analyzing the acronyms and initialisms, it was found that, in most of the cases, suitable solutions were given to the translation problems posed by their use in the TT, and such solutions coincided with the ones proposed in the reviewed literature on the topic. Some difficulties were found, however; they were related to the use of acronyms and initialisms appearing in the ST without their full form or without an explanation, especially those referring to institutions and regional or national organizations. Conclusions: Acronyms and initialisms are not only linguistic forms, but they are also objective phenomena within scientific culture and they are cultural referents. That is why their use and translation imply linguistic as well as extra-linguistic considerations which demand from the translator the use of auxiliary sources and reference materials, including interviews to specialists, to achieve quality and precision in the translated text. This will guarantee the fulfillment of its main communicative function, that is, to provide

ERRORS AND DIFFICULTIES IN TRANSLATING LEGAL TEXTS

Directory of Open Access Journals (Sweden)

Camelia, CHIRILA

2014-11-01

Full Text Available Nowadays the accurate translation of legal texts has become highly important as the mistranslation of a passage in a contract, for example, could lead to lawsuits and loss of money. Consequently, the translation of legal texts to other languages faces many difficulties and only professional translators specialised in legal translation should deal with the translation of legal documents and scholarly writings. The purpose of this paper is to analyze translation from three perspectives: translation quality, errors and difficulties encountered in translating legal texts and consequences of such errors in professional translation. First of all, the paper points out the importance of performing a good and correct translation, which is one of the most important elements to be considered when discussing translation. Furthermore, the paper presents an overview of the errors and difficulties in translating texts and of the consequences of errors in professional translation, with applications to the field of law. The paper is also an approach to the differences between languages (English and Romanian that can hinder comprehension for those who have embarked upon the difficult task of translation. The research method that I have used to achieve the objectives of the paper was the content analysis of various Romanian and foreign authors' works.

Gentzler, Edwin. Translation, hypertext, and creativity: Contemporary translation theories. Bristol: Multilingual Matters, 2001. 232 p.

Directory of Open Access Journals (Sweden)

Davi S. Gonçalves

2018-01-01

Full Text Available Contemporary translation theories (Gentzler,2001 provides readers with a thorough historical analysis of how the notion of creativity and autonomy in what regards reading has been transformed – as well as regarding its influence towards the idea of translation. The place occupied by the translator is a place between spaces; a fluid locale where any concreteness has melted. Meaning is thus not graspable or amenable to be tamed; on the contrary, literature is about opening up more space for the wilderness to be (rediscovered. A text is many texts, a hypertext, filled in with narratives that mutually supplement one another, deconstructing and reconstructing meanings; and, within such picture, translation emerges not as an opportunity to resurrect the body of an original text, but as a phantasm of both sameness and uniqueness. What does exist cannot be seen; it is always on the run; meanings surface from liquefied pages, pages that escape our attempt of defining them for good. This is why translation can be taken as metonym: as s/he recreates the original text within the target context, the translator choose to highlight those textual elements that s/he deems relevant – those fragments of the text that have touched and determined his/her reading. The experience of translation, that goes beyond dichotomist standards (e.g. foreign/domestic, equivalent/adapted, etc., is finally taken as a profitable realm for the literary discourse to validate its impalpability. Such shift in the approach towards translation is significant because, even though the process of recreation takes place in every textual practice, tradition has been pressuring translation scholars towards the designing of guidelines and norms that, I dare say, only obstruct the task of translating.

Translation between cultures

Directory of Open Access Journals (Sweden)

Henrique de Oliveira Lee

2016-05-01

Full Text Available This article will question the pertinence of understanding interculturality in terms of translation between cultures. I shall study this hypothesis in two ways : 1 / the cosmopolitan horizon, which the idea of translation may implicate ; 2 / the critique of the premises of unique origin and homogeneity of cultures which this hypothesis makes possible.

Translational Repression in Malaria Sporozoites

Science.gov (United States)

Turque, Oliver; Tsao, Tiffany; Li, Thomas; Zhang, Min

2016-01-01

Malaria is a mosquito-borne infectious disease of humans and other animals. It is caused by the parasitic protozoan, Plasmodium. Sporozoites, the infectious form of malaria parasites, are quiescent when they remain in the salivary glands of the Anopheles mosquito until transmission into a mammalian host. Metamorphosis of the dormant sporozoite to its active form in the liver stage requires transcriptional and translational regulations. Here, we summarize recent advances in the translational repression of gene expression in the malaria sporozoite. In sporozoites, many mRNAs that are required for liver stage development are translationally repressed. Phosphorylation of eukaryotic Initiation Factor 2α (eIF2α) leads to a global translational repression in sporozoites. The eIF2α kinase, known as Upregulated in Infectious Sporozoite 1 (UIS1), is dominant in the sporozoite. The eIF2α phosphatase, UIS2, is translationally repressed by the Pumilio protein Puf2. This translational repression is alleviated when sporozoites are delivered into the mammalian host. PMID:28357358

Translational repression in malaria sporozoites

Directory of Open Access Journals (Sweden)

Oliver Turque

2016-04-01

Full Text Available Malaria is a mosquito-borne infectious disease of humans and other animals. It is caused by the parasitic protozoan, Plasmodium. Sporozoites, the infectious form of malaria parasites, are quiescent when they remain in the salivary glands of the Anopheles mosquito until transmission into a mammalian host. Metamorphosis of the dormant sporozoite to its active form in the liver stage requires transcriptional and translational regulations. Here, we summarize recent advances in the translational repression of gene expression in the malaria sporozoite. In sporozoites, many mRNAs that are required for liver stage development are translationally repressed. Phosphorylation of eukaryotic Initiation Factor 2α (eIF2α leads to a global translational repression in sporozoites. The eIF2α kinase, known as Upregulated in Infectious Sporozoite 1 (UIS1, is dominant in the sporozoite. The eIF2α phosphatase, UIS2, is translationally repressed by the Pumilio protein Puf2. This translational repression is alleviated when sporozoites are delivered into the mammalian host.

Motion Perception and Manual Control Performance During Passive Tilt and Translation Following Space Flight

Science.gov (United States)

Clement, Gilles; Wood, Scott J.

2010-01-01

This joint ESA-NASA study is examining changes in motion perception following Space Shuttle flights and the operational implications of post-flight tilt-translation ambiguity for manual control performance. Vibrotactile feedback of tilt orientation is also being evaluated as a countermeasure to improve performance during a closed-loop nulling task. METHODS. Data has been collected on 5 astronaut subjects during 3 preflight sessions and during the first 8 days after Shuttle landings. Variable radius centrifugation (216 deg/s) combined with body translation (12-22 cm, peak-to-peak) is utilized to elicit roll-tilt perception (equivalent to 20 deg, peak-to-peak). A forward-backward moving sled (24-390 cm, peak-to-peak) with or without chair tilting in pitch is utilized to elicit pitch tilt perception (equivalent to 20 deg, peak-to-peak). These combinations are elicited at 0.15, 0.3, and 0.6 Hz for evaluating the effect of motion frequency on tilt-translation ambiguity. In both devices, a closed-loop nulling task is also performed during pseudorandom motion with and without vibrotactile feedback of tilt. All tests are performed in complete darkness. PRELIMINARY RESULTS. Data collection is currently ongoing. Results to date suggest there is a trend for translation motion perception to be increased at the low and medium frequencies on landing day compared to pre-flight. Manual control performance is improved with vibrotactile feedback. DISCUSSION. The results of this study indicate that post-flight recovery of motion perception and manual control performance is complete within 8 days following short-duration space missions. Vibrotactile feedback of tilt improves manual control performance both before and after flight.

Through the Eyes of NASA: NASA's 2017 Eclipse Education Progam

Science.gov (United States)

Mayo, L.

2017-12-01

Over the last three years, NASA has been developing plans to bring the August 21st total solar eclipse to the nation, "as only NASA can", leveraging its considerable space assets, technology, scientists, and its unmatched commitment to science education. The eclipse, long anticipated by many groups, represents the largest Big Event education program that NASA has ever undertaken. It is the latest in a long string of successful Big Event international celebrations going back two decades including both transits of Venus, three solar eclipses, solar maximum, and mission events such as the MSL/Curiosity landing on Mars, and the launch of the Lunar Reconnaissance Orbiter (LRO) to name a few. This talk will detail NASA's program development methods, strategic partnerships, and strategies for using this celestial event to engage the nation and improve overall science literacy.

Specialised Translation Dictionaries for Learners

DEFF Research Database (Denmark)

Nielsen, Sandro

2010-01-01

Specialised translation dictionaries for learners are reference tools that can help users with domain discourse in a foreign language in connection with translation. The most common type is the business dictionary covering several more or less related subject fields. However, business dictionaries...... the needs of learners, it is proposed that specialised translation dictionaries should be designed as augmented reference tools. It is argued that electronic and printed dictionaries should include sections or CD-ROMs with syntactic, translation etc. data as well as exercises and illustrative documents...

NASA Earthdata Forums: An Interactive Venue for Discussions of NASA Data and Earth Science

Science.gov (United States)

Hearty, Thomas J., III; Acker, James; Meyer, Dave; Northup, Emily A.; Bagwell, Ross E.

2017-01-01

We demonstrate how students and teachers can register to use the NASA Earthdata Forums. The NASA Earthdata forums provide a venue where registered users can pose questions regarding NASA Earth science data in a moderated forum, and have their questions answered by data experts and scientific subject matter experts connected with NASA Earth science missions and projects. Since the forums are also available for research scientists to pose questions and discuss pertinent topics, the NASA Earthdata Forums provide a unique opportunity for students and teachers to gain insight from expert scientists and enhance their knowledge of the many different ways that NASA Earth observations can be used in research and applications.

Next-generation sequencing-based transcriptome analysis of Helicoverpa armigera Larvae immune-primed with Photorhabdus luminescens TT01.

Directory of Open Access Journals (Sweden)

Zengyang Zhao

Full Text Available Although invertebrates are incapable of adaptive immunity, immunal reactions which are functionally similar to the adaptive immunity of vertebrates have been described in many studies of invertebrates including insects. The phenomenon was termed immune priming. In order to understand the molecular mechanism of immune priming, we employed Illumina/Solexa platform to investigate the transcriptional changes of the hemocytes and fat body of Helicoverpa armigera larvae immune-primed with the pathogenic bacteria Photorhabdus luminescens TT01. A total of 43.6 and 65.1 million clean reads with 4.4 and 6.5 gigabase sequence data were obtained from the TT01 (the immune-primed and PBS (non-primed cDNA libraries and assembled into 35,707 all-unigenes (non-redundant transcripts, which has a length varied from 201 to 16,947 bp and a N50 length of 1,997 bp. For 35,707 all-unigenes, 20,438 were functionally annotated and 2,494 were differentially expressed after immune priming. The differentially expressed genes (DEGs are mainly related to immunity, detoxification, development and metabolism of the host insect. Analysis on the annotated immune related DEGs supported a hypothesis that we proposed previously: the immune priming phenomenon observed in H. armigera larvae was achieved by regulation of key innate immune elements. The transcriptome profiling data sets (especially the sequences of 1,022 unannotated DEGs and the clues (such as those on immune-related signal and regulatory pathways obtained from this study will facilitate immune-related novel gene discovery and provide valuable information for further exploring the molecular mechanism of immune priming of invertebrates. All these will increase our understanding of invertebrate immunity which may provide new approaches to control insect pests or prevent epidemic of infectious diseases in economic invertebrates in the future.

Eye-movements During Translation

DEFF Research Database (Denmark)

Balling, Laura Winther

2013-01-01

texts as well as both eye-tracking and keylogging data. Based on this database, I present a large-scale analysis of gaze on the source text based on 91 translators' translations of six different texts from English into four different target languages. I use mixed-effects modelling to compare from......, and variables indexing the alignment between the source and target texts. The results are related to current models of translation processes and reading and compared to a parallel analysis of production time....

Barriers vs Creativity in Translator Training

Science.gov (United States)

Yazici, Mine

2016-01-01

This paper discusses translation problems awaiting Turkish students as well as the creative solutions they develop in overcoming them. It consists of two parts; The first part studies the barriers concerning translation procedures from the perspective of translation theory and Turkish translation history; The second parts analyses the impact of…

Measurements of top quark spin observables in tt̄ events using dilepton final states in √s=8 TeV pp collisions with the ATLAS detector

Energy Technology Data Exchange (ETDEWEB)

Aaboud, M. [Faculté des Sciences, Université Mohamed Premier and LPTPM, Oujda (Morocco); Aad, G. [CPPM, Aix-Marseille Université and CNRS/IN2P3, Marseille (France); Abbott, B. [Homer L. Dodge Department of Physics and Astronomy, University of Oklahoma, Norman OK, United States of America (United States); Abdallah, J. [Department of Physics, The University of Texas at Arlington, Arlington TX, United States of America (United States); Collaboration: The ATLAS collaboration; and others

2017-03-22

Measurements of top quark spin observables in tt̄ events are presented based on 20.2 fb{sup −1} of √s=8 TeV proton-proton collisions recorded with the ATLAS detector at the LHC. The analysis is performed in the dilepton final state, characterised by the presence of two isolated leptons (electrons or muons). There are 15 observables, each sensitive to a different coefficient of the spin density matrix of tt̄ production, which are measured independently. Ten of these observables are measured for the first time. All of them are corrected for detector resolution and acceptance effects back to the parton and stable-particle levels. The measured values of the observables at parton level are compared to Standard Model predictions at next-to-leading order in QCD. The corrected distributions at stable-particle level are presented and the means of the distributions are compared to Monte Carlo predictions. No significant deviation from the Standard Model is observed for any observable.

NASA EEE Parts and NASA Electronic Parts and Packaging (NEPP) Program Update 2018

Science.gov (United States)

Label, Kenneth A.; Sampson, Michael J.; Pellish, Jonathan A.; Majewicz, Peter J.

2018-01-01

NASA Electronic Parts and Packaging (NEPP) Program and NASA Electronic Parts Assurance Group (NEPAG) are NASAs point-of-contacts for reliability and radiation tolerance of EEE parts and their packages. This presentation includes an FY18 program overview.

Synthetic Biology and the Translational Imperative.

Science.gov (United States)

Heidari Feidt, Raheleh; Ienca, Marcello; Elger, Bernice Simone; Folcher, Marc

2017-12-18

Advances at the interface between the biological sciences and engineering are giving rise to emerging research fields such as synthetic biology. Harnessing the potential of synthetic biology requires timely and adequate translation into clinical practice. However, the translational research enterprise is currently facing fundamental obstacles that slow down the transition of scientific discoveries from the laboratory to the patient bedside. These obstacles including scarce financial resources and deficiency of organizational and logistic settings are widely discussed as primary impediments to translational research. In addition, a number of socio-ethical considerations inherent in translational research need to be addressed. As the translational capacity of synthetic biology is tightly linked to its social acceptance and ethical approval, ethical limitations may-together with financial and organizational problems-be co-determinants of suboptimal translation. Therefore, an early assessment of such limitations will contribute to proactively favor successful translation and prevent the promising potential of synthetic biology from remaining under-expressed. Through the discussion of two case-specific inventions in synthetic biology and their associated ethical implications, we illustrate the socio-ethical challenges ahead in the process of implementing synthetic biology into clinical practice. Since reducing the translational lag is essential for delivering the benefits of basic biomedical research to society at large and promoting global health, we advocate a moral obligation to accelerating translational research: the "translational imperative."

Translators’ Use of Digital Resources during Translation

DEFF Research Database (Denmark)

Hvelplund, Kristian Tangsgaard

2017-01-01

This paper presents the findings from a study on translators’ use of digital resources during the translation process. Eye tracking data and screen recording data from 18 professional translators are analysed in order to 1) examine how much time translators spend on digital resource consultation...... compared with translation drafting and translation revision, 2) examine how eye movements differ between translation drafting, revision and digital resource consultation and 3) investigate what types of digital resources are used by translators. The findings demonstrate that digital resource consultation...... constitutes a considerable amount of the translation process. The findings also show longer fixations and larger pupils during resource consultation, indicating heavier cognitive load, and finally the study identifies considerable variation in the use of resources between translators....

Lexical Discourse Analysis in Translation

Science.gov (United States)

Al Khotaba, Eissa; Al Tarawneh, Khaled

2015-01-01

Lexical Discourse very often depend on lexis. Lexical Discourse analysis, however, has not yet been given enough consideration of the phenomenon of translation. This paper investigates lexical discourse analysis in translation from one language to another. This qualitative study comprises 15 text translated by M.A. students at the Department of…

NASA Parts Selection List (NPSL) WWW Site http://nepp.nasa.gov/npsl

Science.gov (United States)

Brusse, Jay

2000-01-01

The NASA Parts Selection List (NPSL) is an on-line resource for electronic parts selection tailored for use by spaceflight projects. The NPSL provides a list of commonly used electronic parts that have a history of satisfactory use in spaceflight applications. The objective of this www site is to provide NASA projects, contractors, university experimenters, et al with an easy to use resource that provides a baseline of electronic parts from which designers are encouraged to select. The NPSL is an ongoing resource produced by Code 562 in support of the NASA HQ funded NASA Electronic Parts and Packaging (NEPP) Program. The NPSL is produced as an electronic format deliverable made available via the referenced www site administered by Code 562. The NPSL does not provide information pertaining to patented or proprietary information. All of the information contained in the NPSL is available through various other public domain resources such as US Military procurement specifications for electronic parts, NASA GSFC's Preferred Parts List (PPL-21), and NASA's Standard Parts List (MIL-STD975).

Programmable High-Rate Multi-Mission Receiver for Space Communications, Phase II

Data.gov (United States)

National Aeronautics and Space Administration — Current and upcoming NASA space links require both highly reliable low-rate communications links supporting critical TT&C, ranging and voice services and highly...

Programmable High-Rate Multi-Mission Receiver for Space Communications, Phase I

Data.gov (United States)

National Aeronautics and Space Administration — Current and upcoming NASA space links require both highly reliable low-rate communications links supporting critical TT&C, ranging and voice services and highly...

From Polarity to Plurality in Translation Scholarship

Directory of Open Access Journals (Sweden)

Abdolla Karimzadeh

2012-09-01

Full Text Available Review of the literature in translation studies shows that translation scholarship can be discussed in 3 Macro-levels including 1 Corpus-based studies, 2 Protocol-based studies, and 3 Systems- based studies. Researchers in the corpus-based studies test the hypothesis about the universals of translation. They also try to identify translation norms and regular linguistic patterns. This scholarship aims at showing that the language of translation is different from that of non-translation. The other purpose is to identify the techniques and strategies adopted by the translators. In protocol –based studies, the researchers study the mental activities and the individual behaviors of the translators while translating. They aim to describe the behavior of professional translators (versus translator trainees during the process of translation in a bid to identify how they chunk the source text (unit of translation and to describe how the translation trainees develop their translation competence. These studies are longitudinal for the reason that they aim to investigate the change of intended behaviors in the subjects of the study. Like corpus-based studies, they are experimental and data for analysis are collected by various methods including the translators’ verbal report, keystroke logging, eye tracking, and so on. Recently, in a method called “triangulation”, they combine the above-mentioned methods of data collection to test their hypotheses on a stronger experimental basis. To collect the data, they also employ the methods used in neurology (for example the technology of Electroencephalogram in order to obtain information on the physiological processes in the brains of the translators while translating. And finally in the systems-based studies, the researchers analyze more extended systems of production, distribution, and consumption of translations and their impacts on the target culture in a specific socio-cultural context. Differentiating

Energy deposition in liquid metals for D-T, D-D and T-T fusion sources

International Nuclear Information System (INIS)

Ragheb, M.M.H.; Zahakaylo, D.

1983-01-01

The nuclear performance of candidate liquid metals: lithium, lead, sodium, potassiu, Na(22%) K(78%), Na(56%) K(44%), is estimated with respect to their neutron and gamma-ray heat deposition rates. Three different neutron sources are considered: DT, DD and TT fusion neutrons. This is intended for the cooling of inertial confinement cavities using fusion pellets with internal tritrium breeding that will possibly eliminate the need to breed tritium in a lithium blanket. Compared to lithium with respect to neutron and gamma energy generation, blanket multiplication and pumping power, it appears that the considered metals can be used only if the environmental and safety advantages from the reduction of the tritium inventory and the avoidance of lithium, outweight the lithium advantages in higher energy production and lower pumping requirement by one to two orders of magnitude. (orig.) [de

NASA Accountability Report

Science.gov (United States)

1997-01-01

NASA is piloting fiscal year (FY) 1997 Accountability Reports, which streamline and upgrade reporting to Congress and the public. The document presents statements by the NASA administrator, and the Chief Financial Officer, followed by an overview of NASA's organizational structure and the planning and budgeting process. The performance of NASA in four strategic enterprises is reviewed: (1) Space Science, (2) Mission to Planet Earth, (3) Human Exploration and Development of Space, and (4) Aeronautics and Space Transportation Technology. Those areas which support the strategic enterprises are also reviewed in a section called Crosscutting Processes. For each of the four enterprises, there is discussion about the long term goals, the short term objectives and the accomplishments during FY 1997. The Crosscutting Processes section reviews issues and accomplishments relating to human resources, procurement, information technology, physical resources, financial management, small and disadvantaged businesses, and policy and plans. Following the discussion about the individual areas is Management's Discussion and Analysis, about NASA's financial statements. This is followed by a report by an independent commercial auditor and the financial statements.

NASA Technology Plan 1998

Science.gov (United States)

1998-01-01

This NASA Strategic Plan describes an ambitious, exciting vision for the Agency across all its Strategic Enterprises that addresses a series of fundamental questions of science and research. This vision is so challenging that it literally depends on the success of an aggressive, cutting-edge advanced technology development program. The objective of this plan is to describe the NASA-wide technology program in a manner that provides not only the content of ongoing and planned activities, but also the rationale and justification for these activities in the context of NASA's future needs. The scope of this plan is Agencywide, and it includes technology investments to support all major space and aeronautics program areas, but particular emphasis is placed on longer term strategic technology efforts that will have broad impact across the spectrum of NASA activities and perhaps beyond. Our goal is to broaden the understanding of NASA technology programs and to encourage greater participation from outside the Agency. By relating technology goals to anticipated mission needs, we hope to stimulate additional innovative approaches to technology challenges and promote more cooperative programs with partners outside NASA who share common goals. We also believe that this will increase the transfer of NASA-sponsored technology into nonaerospace applications, resulting in an even greater return on the investment in NASA.

Machine Translation for Academic Purposes

Science.gov (United States)

Lin, Grace Hui-chin; Chien, Paul Shih Chieh

2009-01-01

Due to the globalization trend and knowledge boost in the second millennium, multi-lingual translation has become a noteworthy issue. For the purposes of learning knowledge in academic fields, Machine Translation (MT) should be noticed not only academically but also practically. MT should be informed to the translating learners because it is a…

Multi-disciplinary investigation of the tomb of Menna (TT69), Theban Necropolis, Egypt.

Science.gov (United States)

Vandenabeele, Peter; Garcia-Moreno, Renata; Mathis, François; Leterme, Kerstin; Van Elslande, Elsa; Hocquet, François-Philippe; Rakkaa, Saïd; Laboury, Dimitri; Moens, Luc; Strivay, David; Hartwig, Melinda

2009-08-01

The archaeometrical survey of the tomb of Menna (TT69), which took place in November-December 2007, is part of the extended research program that aims to study and preserve this tomb in all its aspects. Menna was a high official who served as an overseer of Cadastral surveys during the reigns of pharaohs Tuthmosis IV and Amenhotep III (ca. 1419-1370 BC). The research team aimed to gather information, in a totally non-destructive way, on the materials used and the painting techniques. The technical examinations included photography with normal and raking light, macrophotography, ultra-violet (UV) fluorescence photography, and microscopy. On selected points X-ray fluorescence (XRF) was combined with diffuse reflectance UV-spectrometry, near infrared (NIR) diffuse reflectance spectroscopy and Raman spectroscopy. The technical aspects as well as problems that are inherently associated with an interdisciplinary survey of this extent, are discussed. The project worked with a large team of people with different backgrounds and sensitive technical equipment. Working conditions were quite hostile, including elevated temperatures and dust hampering the examinations.

Crafting Flight: Aircraft Pioneers and the Contributions of the Men and Women of NASA Langley Research Center

Science.gov (United States)

Schultz, James

2003-01-01

While this is a self-contained history of NASA Langley Research Center's contributions to flight, many other organizations around the country played a vital role in the work described in this book.When you pass through the front gates of NASA Langley Research Center you are entering an extraordinary place. You could easily miss that fact, however. A few years cross-state bicycle tour passed through the Center. As interesting as looping around Center was, the riders observed that nothing about the vaguely industrial site fit the conventional stereotypes of what high tech looks like. NASA Langley does not fit many stereotypes. It takes a close examination to discover the many ways it has contributed to development of flight. As part of the national celebrations commemorating the 100th anniversary of the Wright brothers first flight, James Schultz, an experienced journalist with a gift for translating the language of engineers and scientists into prose that nonspecialists can comprehend, has revised and expanded Winds of Change , his wonderful guide to the Center. This revised book, Crafting Flight , invites you inside. You will read about one of the Nation s oldest research and development facilities, a place of imagination and ingenuity.

NASA Information Technology Implementation Plan

Science.gov (United States)

2000-01-01

NASA's Information Technology (IT) resources and IT support continue to be a growing and integral part of all NASA missions. Furthermore, the growing IT support requirements are becoming more complex and diverse. The following are a few examples of the growing complexity and diversity of NASA's IT environment. NASA is conducting basic IT research in the Intelligent Synthesis Environment (ISE) and Intelligent Systems (IS) Initiatives. IT security, infrastructure protection, and privacy of data are requiring more and more management attention and an increasing share of the NASA IT budget. Outsourcing of IT support is becoming a key element of NASA's IT strategy as exemplified by Outsourcing Desktop Initiative for NASA (ODIN) and the outsourcing of NASA Integrated Services Network (NISN) support. Finally, technology refresh is helping to provide improved support at lower cost. Recently the NASA Automated Data Processing (ADP) Consolidation Center (NACC) upgraded its bipolar technology computer systems with Complementary Metal Oxide Semiconductor (CMOS) technology systems. This NACC upgrade substantially reduced the hardware maintenance and software licensing costs, significantly increased system speed and capacity, and reduced customer processing costs by 11 percent.

Turkish EFL Academicians' Problems Concerning Translation Activities and Practices, Attitudes towards the Use of Online and Printed Translation Tools, and Suggestions for Quality Translation Practice

Science.gov (United States)

Zengin, Bugra; Kacar, Isil Gunseli

2011-01-01

This mixed method research study aimed to highlight the problems of EFL academicians concerning their current translation practices, their attitudes towards the use of various translation tools, and offer suggestions for more quality translation practices. Seventy-three EFL academicians from three Turkish universities participated in the study.…

Using example-based machine translation to translate DVD subtitles

DEFF Research Database (Denmark)

Flanagan, Marian

between Swedish and Danish and Swedish and Norwegian subtitles, with the company already reporting a successful return on their investment. The hybrid EBMT/SMT system used in the current research, on the other hand, remains within the confines of academic research, and the real potential of the system...... allotted to produce the subtitles have both decreased. Therefore, this market is recognised as a potential real-world application of MT. Recent publications have introduced Corpus-Based MT approaches to translate subtitles. An SMT system has been implemented in a Swedish subtitling company to translate...

Typologically robust statistical machine translation : Understanding and exploiting differences and similarities between languages in machine translation

NARCIS (Netherlands)

Daiber, J.

2018-01-01

Machine translation systems often incorporate modeling assumptions motivated by properties of the language pairs they initially target. When such systems are applied to language families with considerably different properties, translation quality can deteriorate. Phrase-based machine translation

Translating Signs, Producing Subjects

Directory of Open Access Journals (Sweden)

Brett Neilson

2009-08-01

Full Text Available This paper moves between two streets: Liverpool Road in the Sydney suburb of Ashfield and Via Sarpi in the Italian city of Milan. What connects these streets is that both have become important sites for businesses in the Chinese diaspora. Moreover, both are streets on which locals have expressed desires for Chinese signs to be translated into the national lingua franca. The paper argues that the cultural politics inherent in this demand for translation cannot be fully understood in the context of national debates about diversity and integration. It is also necessary to consider the emergence of the official Chinese Putonghua as global language, which competes with English but also colonizes dialects and minority languages. In the case of these dual language signs, the space between languages can neither be reduced to a contact zone of minority and majority cultures nor celebrated as a ‘third space’ where the power relations implied by such differences are subverted. At stake is rather a space characterised by what Naoki Sakai calls the schema of co-figuration, which allows the representation of translation as the passage between two equivalents that resemble each other and thus makes possible their determination as conceptually different and comparable. Drawing on arguments about translation and citizenship, the paper critically interrogates the ethos of interchangeability implied by this regime of translation. A closing argument is made for a vision of the common that implies neither civilisational harmony nor the translation of all values into a general equivalent. Primary sources include government reports, internet texts and media stories. These are analyzed using techniques of discourse analysis and interpreted with the help of secondary literature concerning globalisation, language and migration. The disciplinary matrix cuts and mixes between cultural studies, translation studies, citizenship studies, globalization studies and

[Qualitative translational science in clinical practice].

Science.gov (United States)

Mu, Pei-Fan

2013-10-01

Qualitative translational research refers to the "bench-to-bedside" enterprise of harnessing knowledge from the basic sciences to produce new treatment options or nursing interventions for patients. Three evidence-based translational problems related to qualitative translational research discussed this year address the interfaces among the nursing paradigm, the basic sciences, and clinical nursing work. This article illustrates the definition of translational science and translational blocks of evidence-based practice; discusses the qualitative research perspective in evidence synthesis, evidence translation and evidence utilization; and discusses the research questions that must be answered to solve the problems of the three translational gaps from the qualitative research perspective. Qualitative inquiry has an essential role to play in efforts to improve current healthcare-provider nursing interventions, experiences, and contexts. Thus, it is vital to introduce qualitative perspectives into evidence-based practice from the knowledge discovery through to the knowledge implementation process.

Interdisciplinarity in translation teaching: competence-based education, translation task-based approach, context-based text typology

Directory of Open Access Journals (Sweden)

Edelweiss Vitol Gysel

2017-05-01

Full Text Available In the context of competence-based teaching, this paper draws upon the model of Translation Competence (TC put forward by the PACTE group (2003 to establish a dialogue between cognitive-constructivist paradigms for translation teaching and the model of the Context-based Text Typology (MATTHIESSEN et al., 2007. In this theoretical environment, it proposes a model for the design of a Teaching Unit (TU for the development of the bilingual competence in would-be-translators.To this end, it explores translation as a cognitive, communicative and textual activity (HURTADO ALBIR, 2011 and considers its teaching from the translation task-based approach (HURTADO ALBIR, 1999. This approach is illustrated through the practical example of the design of a TU elaborated for the subject ‘Introduction to Specialized Translation’,part of the curricular grid of the program ‘Secretariado Executivo’ at Universidade Federal de Santa Catarina. Aspects such as the establishment of learning objectives and their alignment with the translation tasks composing the TU are addressed for this specific pedagogical situation. We argue for the development of textual competences by means of the acquisition of strategies derived from the Context-based Text Typology to solve problems arising from the translation of different text types and contextual configurations.

Improved performance of polymer solar cells using PBDTT-F-TT:PC{sub 71}BM blend film as active layer

Energy Technology Data Exchange (ETDEWEB)

Zang, Yue; Gao, Xiumin, E-mail: oemt@hdu.edu.cn; Lu, Xinmiao; Xin, Qing; Lin, Jun; Zhao, Jufeng

2016-07-15

Highlights: • The PCE of PBDTT-F-TT-based PSCs was improved to 9.34% by morphology control and device engineering. • Effect of DIO additive on the BHJ morphology and charge transport was investigated. • Effect of device architecture on the performance was studied in depth by optical modeling. • A low-temperature processed interfacial layer was introduced for plastic substrates. - Abstract: A detailed study of high-efficiency polymer solar cells (PSCs) based on a low bandgap polymer PBDTT-F-TT and PC{sub 71}BM as the bulk heterojunction (BHJ) layer is carried out. By using 1,8-diiodooctane (DIO) as solvent additive to control the morphology of active layer and comparing different device architecture to optimize the optical field distribution, the power conversion efficiency (PCE) of the resulted devices can be reached as high as 9.34%. Comprehensive characterization and optical modeling of the resulting devices is performed to understand the effect of DIO and device geometry on photovoltaic performance. It was found that the addition of DIO can significantly improve the nanoscale morphology and increased electron mobility in the BHJ layer. The inverted device architecture was chosen because the results from optical modeling shows that it offers better optical field distribution and exciton generation profile. Based on these results, a low-temperature processed ZnO was finally introduced as an electron transport layer to facility the fabrication on flexible substrates and showed comparable performance with the device based on conventional ZnO interlayer prepared by sol-gel process.

Improved performance of polymer solar cells using PBDTT-F-TT:PC_7_1BM blend film as active layer

International Nuclear Information System (INIS)

Zang, Yue; Gao, Xiumin; Lu, Xinmiao; Xin, Qing; Lin, Jun; Zhao, Jufeng

2016-01-01

Highlights: • The PCE of PBDTT-F-TT-based PSCs was improved to 9.34% by morphology control and device engineering. • Effect of DIO additive on the BHJ morphology and charge transport was investigated. • Effect of device architecture on the performance was studied in depth by optical modeling. • A low-temperature processed interfacial layer was introduced for plastic substrates. - Abstract: A detailed study of high-efficiency polymer solar cells (PSCs) based on a low bandgap polymer PBDTT-F-TT and PC_7_1BM as the bulk heterojunction (BHJ) layer is carried out. By using 1,8-diiodooctane (DIO) as solvent additive to control the morphology of active layer and comparing different device architecture to optimize the optical field distribution, the power conversion efficiency (PCE) of the resulted devices can be reached as high as 9.34%. Comprehensive characterization and optical modeling of the resulting devices is performed to understand the effect of DIO and device geometry on photovoltaic performance. It was found that the addition of DIO can significantly improve the nanoscale morphology and increased electron mobility in the BHJ layer. The inverted device architecture was chosen because the results from optical modeling shows that it offers better optical field distribution and exciton generation profile. Based on these results, a low-temperature processed ZnO was finally introduced as an electron transport layer to facility the fabrication on flexible substrates and showed comparable performance with the device based on conventional ZnO interlayer prepared by sol-gel process.

NASA's Big Data Task Force

Science.gov (United States)

Holmes, C. P.; Kinter, J. L.; Beebe, R. F.; Feigelson, E.; Hurlburt, N. E.; Mentzel, C.; Smith, G.; Tino, C.; Walker, R. J.

2017-12-01

Two years ago NASA established the Ad Hoc Big Data Task Force (BDTF - https://science.nasa.gov/science-committee/subcommittees/big-data-task-force), an advisory working group with the NASA Advisory Council system. The scope of the Task Force included all NASA Big Data programs, projects, missions, and activities. The Task Force focused on such topics as exploring the existing and planned evolution of NASA's science data cyber-infrastructure that supports broad access to data repositories for NASA Science Mission Directorate missions; best practices within NASA, other Federal agencies, private industry and research institutions; and Federal initiatives related to big data and data access. The BDTF has completed its two-year term and produced several recommendations plus four white papers for NASA's Science Mission Directorate. This presentation will discuss the activities and results of the TF including summaries of key points from its focused study topics. The paper serves as an introduction to the papers following in this ESSI session.

IQ and Reading Comprehension in Translation Quality

Directory of Open Access Journals (Sweden)

Mohsen Askari

2017-10-01

Full Text Available Having a deeper understanding of determining factors in the quality of translation is in the interest of almost all scholars of translation studies. Students’ intelligence is being measured constantly in order to determine their aptitude for entering into different programs. However, in translation studies, the variable of intelligence quotient (IQ has been curiously ignored among researchers. This study aimed to explore the strength of both IQ and reading comprehension in predicting translation quality among Iranian translation students.  A sample of forty-six translation students from Alborz University of Qazvin participated in this study. Data were collected using three tests including Raven’s Advanced Progressive Matrices, Colina’s (2008 componential translation quality rating scheme and the reading comprehension test of IELTS. The results show IQ test scores and reading comprehension significantly predict translation quality assessment. Surprisingly, the most significant finding is that IQ score is by far a better predictor of translation quality than reading comprehension. Overall, it is concluded that translation quality assessment is more of a deeper cognitive function than solely language process, which could lead to more research on cognitive aspects of translation.

The NASA Climate Change Research Initiative - A Scientist's Perspective

Science.gov (United States)

LeGrande, A. N.; Pearce, M. D.; Dulaney, N.; Kelly, S. M.

2017-12-01

For the last four years, I have been a lead mentor in the NASA GISS Climate Change Research Initiative (CCRI) program, a component in the NASA GSFC Office of Education portfolio. It creates a multidisciplinary; vertical research team including a NYC metropolitan teacher, graduate student, undergraduate student, and high school student. While the college and high school members of this research team function like a more traditional internship component, the teacher component provides a powerful, direct way to connect state-of-the art research with students in the classroom. Because the teacher internship lasts a full year, it affords a similar relationship with a teacher that normally only exists between a PhD student and scientist. It also provides an opportunity to train the teacher in using the extensive data archives and other information maintained on NASA's publicly available websites. This time and access provide PhD-level training in the techniques and tools used in my climate research to the high school teacher. The teacher then uses his/her own pedagogical expertise to translate these techniques into age/level appropriate lesson plans for the classroom aligned with current STEM education trends and expectations. Throughout the process, there is an exchange of knowledge between the teacher and scientist that is very similar to the training given to PhD level graduate students. The teacher's understanding of the topic and implementation of the tools is done under a very close collaboration with the scientist supervisor and the NASA Education Program Specialist. This vertical team model encourages collegial communication between teachers and learners from many different educational levels and capitalizes on the efficacy of near peer mentoring strategies. This relationship is important in building trust through the difficult, iterative process that results in the development of highly accurate and quality (continuously discussed and vetted) curriculum composed

Translational research in medicine

Directory of Open Access Journals (Sweden)

Bakir Mehić

2011-05-01

Full Text Available Translational medicine is a medical practice based on interventional epidemiology. It is regarded by its proponents as a natural progression from Evidence-Based Medicine. It integrates research from the basic sciences, social sciences and political sciences with the aim of optimizing patient care and preventive measures which may extend beyond healthcare services. In short, it is the process of turning appropriate biological discoveries into drugs and medical devices that can be used in the treatment of patients.[1]Scientific research and the development of modern powerful techniques are crucial for improving patient care in a society that is increasingly demanding the highest quality health services.[2] Indeed, effective patient care requires the continuous improvement of knowledge on the pathophysiology of the diseases, diagnostic procedures and therapeutic tools available. To this end, development of both clinical and basic research in health sciences is required. However, what is most effective in improving medical knowledge, and hence patient care, is the cross-fertilization between basic and clinical science. This has been specifically highlighted in recent years with the coining of the term “translational research”.[3] Translational research is of great importance in all medical specialties.Translational Research is the basis for Translational Medicine. It is the process which leads from evidence based medicine to sustainable solutions for public health problems.[4] It aims to improve the health and longevity of the world’s populations and depends on developing broad-based teams of scientists and scholars who are able to focus their efforts to link basic scientific discoveries with the arena of clinical investigation, and translating the results of clinical trials into changes in clinical practice, informed by evidence from the social and political sciences. Clinical science and ecological support from effective policies can�

Translating the covenant: The behavior analyst as ambassador and translator.

Science.gov (United States)

Foxx, R M

1996-01-01

Behavior analysts should be sensitive to how others react to and interpret our language because it is inextricably related to our image. Our use of conceptual revision, with such terms as punishment, has created communicative confusion and hostility on the part of general and professional audiences we have attempted to influence. We must, therefore, adopt the role of ambassador and translator in the nonbehavioral world. A number of recommendations are offered for promoting, translating, and disseminating behavior analysis.

Strategies for Translating Vocative Texts

Directory of Open Access Journals (Sweden)

Olga COJOCARU

2014-12-01

Full Text Available The paper deals with the linguistic and cultural elements of vocative texts and the techniques used in translating them by giving some examples of texts that are typically vocative (i.e. advertisements and instructions for use. Semantic and communicative strategies are popular in translation studies and each of them has its own advantages and disadvantages in translating vocative texts. The advantage of semantic translation is that it takes more account of the aesthetic value of the SL text, while communicative translation attempts to render the exact contextual meaning of the original text in such a way that both content and language are readily acceptable and comprehensible to the readership. Focus is laid on the strategies used in translating vocative texts, strategies that highlight and introduce a cultural context to the target audience, in order to achieve their overall purpose, that is to sell or persuade the reader to behave in a certain way. Thus, in order to do that, a number of advertisements from the field of cosmetics industry and electronic gadgets were selected for analysis. The aim is to gather insights into vocative text translation and to create new perspectives on this field of research, now considered a process of innovation and diversion, especially in areas as important as economy and marketing.

The paradigm of description in ethnographic translation: the translator Levi-Strauss in Tristes Tropiques

Directory of Open Access Journals (Sweden)

Alice Maria de Araújo Ferreira

2014-11-01

Full Text Available Published in 1955, Tristes Tropiques by Claude Levi-Strauss is an account of the journey that the author and ethnographer made on the American continent, especially in Brazil, in 1930. With a free poetic style not restricted by the austerity of scientific work, Levi-Strauss introduced a reflection that established a crucial rupture in ethnographic studies and in the humanities in general, or rather, the rupture of the gaze. His aim is not precisely the culture of the indigenous people in Brazil, but Levi-Strauss himself as the subject of the gaze. How may one grasp an object that changes as one gazes at it? How does the gaze affect the object while gazing, observing, analyzing, describing, and translating it? Current essay discusses what the translator does to the speech of the other when translating it. Different translation strategies from Portuguese into French proposed by Levi-Strauss in Tristes Tropiques are discussed. Conceiving ethnographic translation from the description paradigm and as an encounter of cultures (but not as replacement, the author analyzes the process performed within the gap between the gaze experience and the production of speech of such gaze to understand the value produced at the end of the axis corresponding to the ethnographic translation-description.

The "Pedagogue as Translator" in the Classroom

Science.gov (United States)

Dobson, Stephen

2012-01-01

Translation theory has faced criticism from professional translators for adopting an ivory tower stance to the "real world" challenges of translation. This article argues that a case can be made for considering the challenges of translation as it takes place in the school classroom. In support of such an argument the pedagogue as translator is…

The Hermeneutical Approach in Translation Studies

Directory of Open Access Journals (Sweden)

Bernd Stefanink

2017-09-01

Full Text Available Our aim is to convince the reader of the validity of the hermeneutical approach in translation studies. In a first part, we will show that this validity is based on the fact that the hermeneutical approach integrates factors like subjectivity, intuition, corporeality and creativity in its theoretical reflection, being thus close to the reality of the translation process. In a second part, we will situate this approach in the context of the development of modern translation studies since the 1950s, and show that this development was characterized by a dominating tendency that led from an atomistic to a more and more holistic view of the translation unit, legitimating the holistic approach, which is fundamental in translational hermeneutics. Our third part relates the history of philosophical hermeneutics as the legitimate foundation of translational hermeneutics. In a fourth part, devoted to the “outcoming perspectives”, we will try to reinforce the legitimacy of the hermeneutical approach by showing how it is supported by recent results of research in cognitive science. In order to foster further research in translational hermeneutics we also offer a methodology based on hermeneutic principles to study the translation process. Finally, we give an example of legitimation of a creative problemsolving based on a hermeneutical approach of a translation problem which finds its validation in the results of cognitive research.

Rosmary Waldrop and Theories of Translation

Directory of Open Access Journals (Sweden)

Duffy Nikolai

2012-07-01

Full Text Available Since the 1960s, the German-born US-American poet, Rosmarie Waldrop, has translated over 40 different works, largely from French and German, including 14 volumes by the Jewish French-language writer, Edmond Jabès (Jabès was expelled from Egypt in 1956 during the Suez Crisis. In 2003, Waldrop was made a Chevalier des Arts et des Lettres by the French Government, and in 2008 she received the PEN Award for Poetry in Translation in 2008, for her translation of Ulf Stolterfoht’s book, Lingos I-IX. As well as practising translation, however, Waldrop has also written several significant essays which reflect on different theories of translation and their implications for practice. Much of these considerations are taken up with the question of the relation between translation and writing, of thinking the ways in which theories of writing might suggest the lines for developing a specific form of poetic practice.This essay provides an overview of Waldrop’s central thoughts on translation and contextualises these in relation to some of the major theories of literary translation. In the latter part of the essay, these ideas are developed in specific relation to Waldrop’s translations of the work of Edmond Jabès and to the notion of writing practice it suggests.

Distribuição volumétrica de pontas de pulverização Turbo Teejet 11002 em diferentes condições operacionais Distribution pattern of nozzle TT 11002 under different operational conditions

Directory of Open Access Journals (Sweden)

F.C.L. Freitas

2005-03-01

Full Text Available Este trabalho teve como objetivo determinar a uniformidade de distribuição para a ponta de pulverização TT 11002 em função de espaçamento entre bicos, altura de barra e pressão de trabalho, bem como avaliar a possibilidade de redução do volume de calda por meio da alteração do espaçamento entre bicos. Foram avaliados os perfis de distribuição de pontas TT 11002, para as alturas de 30, 40 e 50 cm, nas pressões de 100, 200, 300 e 400 kPa. A determinação foi realizada em mesa de teste para pontas de pulverização hidráulica, composta por canaletas em "V", espaçadas de 5 cm. Foram utilizadas, para cada configuração, 10 unidades de pontas TT 11002, instaladas isoladamente no centro da mesa. Em seguida, procedeu-se à coleta e à medição do volume pulverizado por 60 segundos e determinou-se o perfil de distribuição. A partir do perfil de distribuição em cada uma das configurações estudadas, simulou-se, utilizando programa computacional, a deposição ao longo da barra de pulverização para bicos espaçados de 40, 50, 80, 100, 120 e 150 cm. A uniformidade de distribuição foi avaliada pelo coeficiente de variação (CV, em uma barra de 12 metros de largura, onde foram utilizados os dados dos seis metros centrais. A ponta de pulverização TT 11002 apresentou boa uniformidade de distribuição (CV inferior a 7%, na pressão de 100 kPa, para bicos espaçados até 50 cm e nas alturas de barra de 40 e 50 cm. Nas pressões acima de 200 kPa, boa uniformidade de distribuição foi verificada para espaçamentos de até 50, 100 e 120 cm, para as alturas de barra de 30, 40 e 50 cm, respectivamente. A ponta TT 11002 possibilita redução de volume de calda com o aumento do espaçamento entre bicos, mantendo boa uniformidade de distribuição com maior capacidade operacional do equipamento de aplicação.This work aimed to evaluate spray distribution uniformity for nozzle TT 11002 using varying nozzle spacing, spray height and

Translation, Quality and Growth

DEFF Research Database (Denmark)

Petersen, Margrethe

The paper investigates the feasibility and some of the possible consequences of applying quality management to translation. It first gives an introduction to two different schools of translation and to (total) quality management. It then examines whether quality management may, in theory...

Designing Course An Initial Approach To Translation Teaching

Directory of Open Access Journals (Sweden)

Roswani Siregar

2017-09-01

Full Text Available Along with the human history translation is the sustainable communication tool among the cultures to preserve this knowledge from generation to generations. Undoubtedly both translation plays a very important role in an increasingly globalized world and translators have the prominent roles in the development of countries. Many translators really enjoy their work but hesitated to teach a course due to their lack of pedagogical knowledge and believe that the translation skill is gained by personal experiences and talents. Thus this paper attempt to promote the translation teaching in classroom by set the preliminary approach to teach translation. The sequences of teaching design are described by propose the brief definition to the nature of translation the importance translation teaching the translator competence and design of translation course. This paper is the preliminary approach to translation teaching for beginners in university setting.

German Translation Theories and Their Practicalness

Directory of Open Access Journals (Sweden)

Carol Alexandru MOHR

2012-01-01

Full Text Available The translator should not be perceived as a simple producer of texts based on other texts, but as an expert, with skills, tasks and precise responsibilities, who works in cooperation with other "actors", that are part of the translating process. Text translating is not a simple linguistic act, but a complex one, that involves Linguistics, Hermeneutics (because texts must be interpreted and Semiology (because signs and symbols must be decoded. In this paper is being explained the difference between translation studies (or translatology and the linguistic theory of translation and why translatological concepts like “purpose”, “adequacy” and “actor” (as they were defined by Reiß, Vermeer and Mänttäri are essential and necessary required for a complete description and a responsible fulfillment of translating acts.

New Trends outside the Translation Classroom

Directory of Open Access Journals (Sweden)

Silvia Martínez Martínez

2014-09-01

Full Text Available This paper is based on the study of different elements at the University of Granada’s Faculty of Translation and Interpreting and seeks to elaborate a prototype for a multilingual and accessible audio guide (audio description, SDHH and Spanish sign language interpretation. We defend a new methodology, one that focuses on teaching the translation process from previous museum-based learning experiences in the translation classroom using QR codes. Our main goal is to innovate translation-related teaching based on the new approaches acquired through learning workshop perspectives. In this sense, we will offer an ideal framework in developing the new concept of translation learning. This concept involves systemising a new means of learning and organising the realities of translation itself, encompassing objectives, competences, methodology and evaluation.

Regulation of mRNA translation during mitosis.

Science.gov (United States)

Tanenbaum, Marvin E; Stern-Ginossar, Noam; Weissman, Jonathan S; Vale, Ronald D

2015-08-25

Passage through mitosis is driven by precisely-timed changes in transcriptional regulation and protein degradation. However, the importance of translational regulation during mitosis remains poorly understood. Here, using ribosome profiling, we find both a global translational repression and identified ~200 mRNAs that undergo specific translational regulation at mitotic entry. In contrast, few changes in mRNA abundance are observed, indicating that regulation of translation is the primary mechanism of modulating protein expression during mitosis. Interestingly, 91% of the mRNAs that undergo gene-specific regulation in mitosis are translationally repressed, rather than activated. One of the most pronounced translationally-repressed genes is Emi1, an inhibitor of the anaphase promoting complex (APC) which is degraded during mitosis. We show that full APC activation requires translational repression of Emi1 in addition to its degradation. These results identify gene-specific translational repression as a means of controlling the mitotic proteome, which may complement post-translational mechanisms for inactivating protein function.

Developing a translational ecology workforce

Science.gov (United States)

Schwartz, Mark W.; Hiers, J. Kevin; Davis, Frank W.; Garfin, Gregg; Jackson, Stephen T.; Terando, Adam J.; Woodhouse, Connie A.; Morelli, Toni; Williamson, Matthew A.; Brunson, Mark W.

2017-01-01

We define a translational ecologist as a professional ecologist with diverse disciplinary expertise and skill sets, as well as a suitable personal disposition, who engages across social, professional, and disciplinary boundaries to partner with decision makers to achieve practical environmental solutions. Becoming a translational ecologist requires specific attention to obtaining critical non‐scientific disciplinary breadth and skills that are not typically gained through graduate‐level education. Here, we outline a need for individuals with broad training in interdisciplinary skills, use our personal experiences as a basis for assessing the types of interdisciplinary skills that would benefit potential translational ecologists, and present steps that interested ecologists may take toward becoming translational. Skills relevant to translational ecologists may be garnered through personal experiences, informal training, short courses, fellowships, and graduate programs, among others. We argue that a translational ecology workforce is needed to bridge the gap between science and natural resource decisions. Furthermore, we argue that this task is a cooperative responsibility of individuals interested in pursuing these careers, educational institutions interested in training scientists for professional roles outside of academia, and employers seeking to hire skilled workers who can foster stakeholder‐engaged decision making.

Working with corpora in the translation classroom

Directory of Open Access Journals (Sweden)

Ralph Krüger

2012-10-01

Full Text Available This article sets out to illustrate possible applications of electronic corpora in the translation classroom. Starting with a survey of corpus use within corpus-based translation studies, the didactic value of corpora in the translation classroom and their epistemic value in translation teaching and practice will be elaborated. A typology of translation practice-oriented corpora will be presented, and the use of corpora in translation will be positioned within two general models of translation competence. Special consideration will then be given to the design and application of so-called Do-it-yourself (DIY corpora, which are compiled ad hoc with the aim of completing a specific translation task. In this context, possible sources for retrieving corpus texts will be presented and evaluated and it will be argued that, owing to time and availability constraints in real-life translation, the Internet should be used as a major source of corpus data. After a brief discussion of possible Internet research techniques for targeted and quality-focused corpus compilation, the possible use of the Internet itself as a macro-corpus will be elaborated. The article concludes with a brief presentation of corpus use in translation teaching in the MA in Specialised Translation Programme offered at Cologne University of Applied Sciences, Germany.

Biomedical informatics and translational medicine

Directory of Open Access Journals (Sweden)

Sarkar Indra

2010-02-01

Full Text Available Abstract Biomedical informatics involves a core set of methodologies that can provide a foundation for crossing the "translational barriers" associated with translational medicine. To this end, the fundamental aspects of biomedical informatics (e.g., bioinformatics, imaging informatics, clinical informatics, and public health informatics may be essential in helping improve the ability to bring basic research findings to the bedside, evaluate the efficacy of interventions across communities, and enable the assessment of the eventual impact of translational medicine innovations on health policies. Here, a brief description is provided for a selection of key biomedical informatics topics (Decision Support, Natural Language Processing, Standards, Information Retrieval, and Electronic Health Records and their relevance to translational medicine. Based on contributions and advancements in each of these topic areas, the article proposes that biomedical informatics practitioners ("biomedical informaticians" can be essential members of translational medicine teams.

Revising and editing for translators

CERN Document Server

Mossop, Brian

2014-01-01

Revising and Editing for Translators provides guidance and learning materials for translation students learning to edit texts written by others, and professional translators wishing to improve their self-revision ability or learning to revise the work of others. Editing is understood as making corrections and improvements to texts, with particular attention to tailoring them to the given readership. Revising is this same task applied to draft translations. The linguistic work of editors and revisers is related to the professional situations in which they work. Mossop offers in-depth coverage of a wide range of topics, including copyediting, style editing, structural editing, checking for consistency, revising procedures and principles, and translation quality assessment. This third edition provides extended coverage of computer aids for revisers, and of the different degrees of revision suited to different texts. The inclusion of suggested activities and exercises, numerous real-world examples, a proposed gra...

Translation of feminine: Szymborska

Directory of Open Access Journals (Sweden)

Olga Donata Guerizoli Kempinska

2014-07-01

Full Text Available http://dx.doi.org/10.5007/2175-7968.2014v1n33p35 The paper discusses the problems present in the process of the translation of the feminine, related to the discursive articulations of the gender and to the socio-historical conditions of its construction. The differences between languages make this articulation hard to transpose and such is the case in some of Wisława Szymborska’s poems. An attentive reading of her work and of its translations in different languages reveals that the transposition of its specifically feminine humor is also a challenge for the translator

Translational Educational Research

Science.gov (United States)

Issenberg, S. Barry; Cohen, Elaine R.; Barsuk, Jeffrey H.; Wayne, Diane B.

2012-01-01

Medical education research contributes to translational science (TS) when its outcomes not only impact educational settings, but also downstream results, including better patient-care practices and improved patient outcomes. Simulation-based medical education (SBME) has demonstrated its role in achieving such distal results. Effective TS also encompasses implementation science, the science of health-care delivery. Educational, clinical, quality, and safety goals can only be achieved by thematic, sustained, and cumulative research programs, not isolated studies. Components of an SBME TS research program include motivated learners, curriculum grounded in evidence-based learning theory, educational resources, evaluation of downstream results, a productive research team, rigorous research methods, research resources, and health-care system acceptance and implementation. National research priorities are served from translational educational research. National funding priorities should endorse the contribution and value of translational education research. PMID:23138127

Harold Pinter in Slovene Translation

Directory of Open Access Journals (Sweden)

Darja Hribar

2004-12-01

Full Text Available This article examines the translation of Harold Pinter’s most notable stylistic peculiarities into Slovene, illustrating its main points with examples taken from his play The Homecoming. The findings demonstrate above all a marked degree of non-observance of the special verbal pattern (special cohesion of the originals, a failure to convey Pinter’s special configuration of meaning (special coherence, and a disregard for internal unifying coincidences. It argues that the Slovene translations of Pinter rely mostly on traditional theories of meaning and of language norms, thus preventing the reproduction of those emotional and psychological actions of Pinter’s characters which are usually not expressed by means of the rhetorical, informative elements of his dialogue, but by its form and sonority, i. e. the length, strength, and level of articulation of verbal expression. This blurs Pinter’s famous logic of emotion, narrows the proverbial openness and conceptual uncertainty of his plays, and limits their potential vitality in translation. Taking into account current drama and theatre translation practices in Slovenia, i.e. the rarity of published drama translation and the dependence on a translated performance text for subsequent theatrical productions, the article argues that in such cases the drama translation should be retrospective, i.e. aiming at a maximum reconstruction of all relevant linguistic, stylistic, and textual properties of the original, leaving expressly subjective interventions in the text to the theatre practitioners.

PCI: A PATRAN-NASTRAN model translator

Science.gov (United States)

Sheerer, T. J.

1990-01-01

The amount of programming required to develop a PATRAN-NASTRAN translator was surprisingly small. The approach taken produced a highly flexible translator comparable with the PATNAS translator and superior to the PATCOS translator. The coding required varied from around ten lines for a shell element to around thirty for a bar element, and the time required to add a feature to the program is typically less than an hour. The use of a lookup table for element names makes the translator also applicable to other versions of NASTRAN. The saving in time as a result of using PDA's Gateway utilities was considerable. During the writing of the program it became apparent that, with a somewhat more complex structure, it would be possible to extend the element data file to contain all data required to define the translation from PATRAN to NASTRAN by mapping of data between formats. Similar data files on property, material and grid formats would produce a completely universal translator from PATRAN to any FEA program, or indeed any CAE system.

Students' Differentiated Translation Processes

Science.gov (United States)

Bossé, Michael J.; Adu-Gyamfi, Kwaku; Chandler, Kayla

2014-01-01

Understanding how students translate between mathematical representations is of both practical and theoretical importance. This study examined students' processes in their generation of symbolic and graphic representations of given polynomial functions. The purpose was to investigate how students perform these translations. The result of the study…

Translation, Interpreting and Lexicography

DEFF Research Database (Denmark)

Dam, Helle Vrønning; Tarp, Sven

2018-01-01

in the sense that their practice fields are typically ‘about something else’. Translators may, for example, be called upon to translate medical texts, and interpreters may be assigned to work on medical speeches. Similarly, practical lexicography may produce medical dictionaries. In this perspective, the three...

Lost in translation?

DEFF Research Database (Denmark)

Zethsen, Karen Korning; Askehave, Inger

2011-01-01

This article deals with an aspect of patient information that differs somewhat from the traditional scope of this journal; namely the linguistic and translational aspects of Patient Information Leaflets (PILs). During the past decade much work has been dedicated to making the English PILs...... as informative and lay-friendly as possible. However, much of the good work is ruined when the PIL is translated. Why is this so and what can be done about it?...

Beyond Translation

DEFF Research Database (Denmark)

Olwig, Mette Fog

2013-01-01

This article contributes to the growing scholarship on local development practitioners by re-examining conceptualizations of practitioners as ‘brokers’ strategically translating between ‘travelling’ (development institution) rationalities and ‘placed’ (recipient area) rationalities in relation...... and practice spurred by new challenges deriving from climate change anxiety, the study shows how local practitioners often make local activities fit into travelling development rationalities as a matter of habit, rather than as a conscious strategy. They may therefore cease to ‘translate’ between different...... rationalities. This is shown to have important implications for theory, research and practice concerning disaster risk reduction and climate change adaptation in which such translation is often expected....

Preserved Network Metrics across Translated Texts

Science.gov (United States)

Cabatbat, Josephine Jill T.; Monsanto, Jica P.; Tapang, Giovanni A.

2014-09-01

Co-occurrence language networks based on Bible translations and the Universal Declaration of Human Rights (UDHR) translations in different languages were constructed and compared with random text networks. Among the considered network metrics, the network size, N, the normalized betweenness centrality (BC), and the average k-nearest neighbors, knn, were found to be the most preserved across translations. Moreover, similar frequency distributions of co-occurring network motifs were observed for translated texts networks.

Trans-acting translational regulatory RNA binding proteins.

Science.gov (United States)

Harvey, Robert F; Smith, Tom S; Mulroney, Thomas; Queiroz, Rayner M L; Pizzinga, Mariavittoria; Dezi, Veronica; Villenueva, Eneko; Ramakrishna, Manasa; Lilley, Kathryn S; Willis, Anne E

2018-05-01

The canonical molecular machinery required for global mRNA translation and its control has been well defined, with distinct sets of proteins involved in the processes of translation initiation, elongation and termination. Additionally, noncanonical, trans-acting regulatory RNA-binding proteins (RBPs) are necessary to provide mRNA-specific translation, and these interact with 5' and 3' untranslated regions and coding regions of mRNA to regulate ribosome recruitment and transit. Recently it has also been demonstrated that trans-acting ribosomal proteins direct the translation of specific mRNAs. Importantly, it has been shown that subsets of RBPs often work in concert, forming distinct regulatory complexes upon different cellular perturbation, creating an RBP combinatorial code, which through the translation of specific subsets of mRNAs, dictate cell fate. With the development of new methodologies, a plethora of novel RNA binding proteins have recently been identified, although the function of many of these proteins within mRNA translation is unknown. In this review we will discuss these methodologies and their shortcomings when applied to the study of translation, which need to be addressed to enable a better understanding of trans-acting translational regulatory proteins. Moreover, we discuss the protein domains that are responsible for RNA binding as well as the RNA motifs to which they bind, and the role of trans-acting ribosomal proteins in directing the translation of specific mRNAs. This article is categorized under: RNA Interactions with Proteins and Other Molecules > RNA-Protein Complexes Translation > Translation Regulation Translation > Translation Mechanisms. © 2018 Medical Research Council and University of Cambridge. WIREs RNA published by Wiley Periodicals, Inc.

Translational plant proteomics: a perspective.

Science.gov (United States)

Agrawal, Ganesh Kumar; Pedreschi, Romina; Barkla, Bronwyn J; Bindschedler, Laurence Veronique; Cramer, Rainer; Sarkar, Abhijit; Renaut, Jenny; Job, Dominique; Rakwal, Randeep

2012-08-03

Translational proteomics is an emerging sub-discipline of the proteomics field in the biological sciences. Translational plant proteomics aims to integrate knowledge from basic sciences to translate it into field applications to solve issues related but not limited to the recreational and economic values of plants, food security and safety, and energy sustainability. In this review, we highlight the substantial progress reached in plant proteomics during the past decade which has paved the way for translational plant proteomics. Increasing proteomics knowledge in plants is not limited to model and non-model plants, proteogenomics, crop improvement, and food analysis, safety, and nutrition but to many more potential applications. Given the wealth of information generated and to some extent applied, there is the need for more efficient and broader channels to freely disseminate the information to the scientific community. This article is part of a Special Issue entitled: Translational Proteomics. Copyright © 2012 Elsevier B.V. All rights reserved.

NASA and the National Climate Assessment: Promoting awareness of NASA Earth science

Science.gov (United States)

Leidner, A. K.

2014-12-01

NASA Earth science observations, models, analyses, and applications made significant contributions to numerous aspects of the Third National Climate Assessment (NCA) report and are contributing to sustained climate assessment activities. The agency's goal in participating in the NCA was to ensure that NASA scientific resources were made available to understand the current state of climate change science and climate change impacts. By working with federal agency partners and stakeholder communities to develop and write the report, the agency was able to raise awareness of NASA climate science with audiences beyond the traditional NASA community. To support assessment activities within the NASA community, the agency sponsored two competitive programs that not only funded research and tools for current and future assessments, but also increased capacity within our community to conduct assessment-relevant science and to participate in writing assessments. Such activities fostered the ability of graduate students, post-docs, and senior researchers to learn about the science needs of climate assessors and end-users, which can guide future research activities. NASA also contributed to developing the Global Change Information System, which deploys information from the NCA to scientists, decision makers, and the public, and thus contributes to climate literacy. Finally, NASA satellite imagery and animations used in the Third NCA helped the pubic and decision makers visualize climate changes and were frequently used in social media to communicate report key findings. These resources are also key for developing educational materials that help teachers and students explore regional climate change impacts and opportunities for responses.

Translational Science Research: Towards Better Health

Directory of Open Access Journals (Sweden)

Emir Festic

2009-10-01

Full Text Available Even though it is considered a 21st century term, translational research has been present for much longer. Idea of translating experimental discovery to its’ clinical application and use is old as research itself. However, it is the understanding of missing links between the basic science research and clinical research that emerged in the past decade and mobilized scientific and clinical communities and organizations worldwide. Hence term, translational research, which represents an “enterprise of harnessing knowledge from basic sciences to produce new drugs, devices, and treatment options for patients” (1. It has been also characterized as “effective translation of the new knowledge, mechanisms, and techniques generated by advances in basic science research into new approaches for prevention, diagnosis, and treatment of disease, which is essential for improving health” (2.This translation is a complex process and involves more than one step for transfer of research knowledge. At least 3 such roadblocks have been identified (Figure 1 ; T1 translation: “The transfer of new understandings of disease mechanisms gained in the laboratory into the development of new methods for diagnosis, therapy, and prevention and their first testing in humans”, T2 translation: “The translation of results from clinical studies into everyday clinical practice and health decision making”, and T3 translation: “Practice-based research, which is often necessary before distilled knowledge (e.g., systematic reviews, guidelines can be implemented in practice” (3-5.The international research community rapidly recognized importance for promotion of translational research and made it their priority(5. In the USA, National Institutes of Health, (NIH expects to fund 60 translational research centers with a budget of $500 million per year by 2012 (6. Besides academic centers, foundations, industry, disease-related organizations, and individual hospitals and

THE DEVELOPMENT OF SCREEN TRANSLATION

OpenAIRE

Sang Ayu Isnu Maharani

2014-01-01

Screen translations involve oral translation known as dubbing and revoicing. Re-voicing consists of lip-sync dubbing, free commentary, narration and voice over. The written version is called subtitle. Dubbing and subtitling are two preferred mode used in the screen translation even though various numbers of current options are available nowadays. Dubbing commenced to be used in larger countries in Europe meanwhile smaller countries apply subtitling because it is more...

Expanding the knowledge translation metaphor.

Science.gov (United States)

Engebretsen, Eivind; Sandset, Tony Joakim; Ødemark, John

2017-03-13

Knowledge translation (KT) is a buzzword in modern medical science. However, there has been little theoretical reflection on translation as a process of meaning production in KT. In this paper, we argue that KT will benefit from the incorporation of a more theoretical notion of translation as an entangled material, textual and cultural process. We discuss and challenge fundamental assumptions in KT, drawing on theories of translation from the human sciences. We show that the current construal of KT as separate from and secondary to the original scientific message is close to the now deeply compromised literary view of translation as the simple act of copying the original. Inspired by recent theories of translation, we claim that KT can be more adequately understood in terms of a 'double supplement' - on the one hand, KT offers new approaches to the communication of scientific knowledge to different groups in the healthcare system with the aim of supplementing a lack of knowledge among clinicians (and patients). On the other, it demonstrates that a textual and cultural supplement, namely a concern with target audiences (clinicians and patients), is inevitable in the creation of an 'autonomous' science. Hence, the division between science and its translation is unproductive and impossible to maintain. We discuss some possible implications of our suggested shift in concept by drawing on pharmaceutical interventions for the prevention of HIV as a case. We argue that such interventions are based on a supplementary and paradoxical relation to the target audiences, both presupposing and denying their existence. More sophisticated theories of translation can lay the foundation for an expanded model of KT that incorporates a more adequate and reflective description of the interdependency of scientific, cultural, textual and material practices.

Translation teaching in Macao’s polytechnic education

Directory of Open Access Journals (Sweden)

Maria de Lurdes Nogueira Escaleira

2013-03-01

Full Text Available This article "Translation teaching in Higher Education in Macau at the Polytechnic" aims to discuss the issues around teaching and learning of Chinese / Portuguese Translation in Macau, and the role played by the Macau Polytechnic Institute in translators training. For more than four centuries, Macau has been a place of intercultural contact where the Portuguese and the Chinese, now the current official languages, have coexisted and implied constant translation efforts; today, Macau is seen as an important platform between the People's Republic of China and Portuguese Speaking Countries, which has stressed the importance of translation professionals. Despite several attempts, Macau’s public higher education was only established in 1991, as well as a translation degree program; until then, and for more than a century, the translators training was held by a government department. We will discuss several curricular structures implemented over the years in the Macao Polytechnic Institute for training translators who can intermediate between Chinese and Portuguese languages and cultures growingly expanding in Macau, given the significant increase in the demand for properly trained translators/interpreters

Functional approaches in translation studies in Germany Functional approaches in translation studies in Germany

Directory of Open Access Journals (Sweden)

Paul Kussmaul

2008-04-01

Full Text Available In the early phase of translation studies in Germany, contrastive linguistics played a major role. I shall briefly describe this approach so that the functional approach will become clearer by contrast. Influenced by the representatives of stylistique comparée, Vinay/Darbelnet (1968 Wolfram Wilss, for instance, in his early work (1971, 1977 makes frequent use of the notion transposition (German “Ausdrucksverschiebung“, cf. also Catford’s (1965 term shift. As a whole, of course, Wilss’ work has a much broader scope. More recently, he has investigated the role of cognition (1988 and the various factors in translator behaviour (1996. Nevertheless, transposition is still a very important and useful notion in describing the translation process. The need for transpositions arises when there is no possibility of formal one-to-one correspondence between source and target-language structures. The basic idea is that whenever there is a need for transposition, we are faced with a translation problem. In the early phase of translation studies in Germany, contrastive linguistics played a major role. I shall briefly describe this approach so that the functional approach will become clearer by contrast. Influenced by the representatives of stylistique comparée, Vinay/Darbelnet (1968 Wolfram Wilss, for instance, in his early work (1971, 1977 makes frequent use of the notion transposition (German “Ausdrucksverschiebung“, cf. also Catford’s (1965 term shift. As a whole, of course, Wilss’ work has a much broader scope. More recently, he has investigated the role of cognition (1988 and the various factors in translator behaviour (1996. Nevertheless, transposition is still a very important and useful notion in describing the translation process. The need for transpositions arises when there is no possibility of formal one-to-one correspondence between source and target-language structures. The basic idea is that whenever there is a need for

Update on NASA Microelectronics Activities

Science.gov (United States)

Label, Kenneth A.; Sampson, Michael J.; Casey, Megan; Lauenstein, Jean-Marie

2017-01-01

Mission Statement: The NASA Electronic Parts and Packaging (NEPP) Program provides NASA's leadership for developing and maintaining guidance for the screening, qualification, test. and usage of EEE parts by NASA as well as in collaboration with other government Agencies and industry. NASA Space Technology Mission Directorate (STMD) "STMD rapidly develops, demonstrates, and infuses revolutionary, high-payoff technologies through transparent, collaborative partnerships, expanding the boundaries of the aerospace enterprise." Mission Statement: The Space Environments Testing Management Office (SETMO) will identify, prioritize, and manage a select suite of Agency key capabilities/assets that are deemed to be essential to the future needs of NASA or the nation, including some capabilities that lack an adequate business base over the budget horizon. NESC mission is to perform value-added independent testing, analysis, and assessments of NASA's high-risk projects to ensure safety and mission success. NASA Space Environments and Avionics Fellows as well as Radiation and EEE Parts Community of Practice (CoP) leads.

Translation as (Global) Writing

Science.gov (United States)

Horner, Bruce; Tetreault, Laura

2016-01-01

This article explores translation as a useful point of departure and framework for taking a translingual approach to writing engaging globalization. Globalization and the knowledge economy are putting renewed emphasis on translation as a key site of contest between a dominant language ideology of monolingualism aligned with fast capitalist…

Classroom Interactions in a Cooperative Translation Task

Directory of Open Access Journals (Sweden)

Hui chuan Wang

2013-03-01

Full Text Available For the past decade, translation learning has become one of the main foci for university language students in Taiwan. However, many studies have shown that translation teachers tend to adopt traditional teaching methods without considering class dynamics and student interactions. This paper therefore looks into the interactions in the researcher’s designed cooperative translation task, the Cooperative Translation Task, to see how these interactions helped or hindered students’ translation learning. A small class of 25 translation students and two translation teachers were participants. Videotaping and interviews were conducted in order to investigate the interaction modes and student participants’ perspectives toward each interaction mode. Six interaction modes were found in this task: within group, between group, translator group and comment-giver group, instructor and students, guest teacher and students, and instructor and guest teacher. Based on the results and participants’ responses, suggested teaching guidelines are provided.

Association of neural tube defects in children of mothers with MTHFR 677TT genotype and abnormal carbohydrate metabolism risk: a case-control study.

Science.gov (United States)

Cadenas-Benitez, N M; Yanes-Sosa, F; Gonzalez-Meneses, A; Cerrillos, L; Acosta, D; Praena-Fernandez, J M; Neth, O; Gomez de Terreros, I; Ybot-González, P

2014-03-26

Abnormalities in maternal folate and carbohydrate metabolism have both been shown to induce neural tube defects (NTD) in humans and animal models. However, the relationship between these two factors in the development of NTDs remains unclear. Data from mothers of children with spina bifida seen at the Unidad de Espina Bífida del Hospital Infantil Virgen del Rocío (case group) were compared to mothers of healthy children with no NTD (control group) who were randomly selected from patients seen at the outpatient ward in the same hospital. There were 25 individuals in the case group and 41 in the control group. Analysis of genotypes for the methylenetetrahydrofolate reductase (MTHFR) 677CT polymorphism in women with or without risk factors for abnormal carbohydrate metabolism revealed that mothers who were homozygous for the MTHFR 677TT polymorphism and at risk of abnormal carbohydrate metabolism were more likely to have offspring with spina bifida and high levels of homocysteine, compared to the control group. The increased incidence of NTDs in mothers homozygous for the MTHFR 677TT polymorphism and at risk of abnormal carbohydrate metabolism stresses the need for careful metabolic screening in pregnant women, and, if necessary, determination of the MTHFR 677CT genotype in those mothers at risk of developing abnormal carbohydrate metabolism.

Professional Communication and Translation in Convergence

DEFF Research Database (Denmark)

Gnecci, Marusca; Maylath, Bruce; Mousten, Birthe

2008-01-01

As translation of technical documents becomes commonplace, and as translation becomes more automated, the roles of translator and technical communicator appear to be converging. This paper examines the trend revealed from recent surveys, and it suggests further research to determine if the trend...

The Translation of Chinese Dish Names

Institute of Scientific and Technical Information of China (English)

龚佳文

2015-01-01

The traditional food of a nation reflects its historical and cultural characteristics This thesis begins with an introduction to the translation situation of Chinese dish names and its existing problem nowadays, and proceeds to the translation principles and tactics for English translation of the names of Chinese dishes, based on Eugene A. Nida’ s Functional Equivalence, with an aim to improve translation efficiency and promote cross-cultural communication, and promoting Chinese food culture throughout the globe.

Characterization of in vitro translation products

International Nuclear Information System (INIS)

Jagus, R.

1987-01-01

This chapter describes the characterization of in vitro translation products by the most commonly used techniques. The methods include SDS-polyacrylamide gel electrophoresis (SDS-PAGE), combined with immunoprecipitation and/or fluorography of [ 35 S]methionine-labeled translation products. The other frequently used characterization tool, translation of hybrid-selected mRNA or hybrid-arrested translation, is treated separately in this volume. Methods are also given for the recognition of mRNAs coding for secreted or membrane proteins

Translation Ambiguity in and out of Context

Science.gov (United States)

Prior, Anat; Wintner, Shuly; MacWhinney, Brian; Lavie, Alon

2011-01-01

We compare translations of single words, made by bilingual speakers in a laboratory setting, with contextualized translation choices of the same items, made by professional translators and extracted from parallel language corpora. The translation choices in both cases show moderate convergence, demonstrating that decontextualized translation…

EQUIVALENCE VERSUS NON-EQUIVALENCE IN ECONOMIC TRANSLATION

Directory of Open Access Journals (Sweden)

Cristina, Chifane

2012-01-01

Full Text Available This paper aims at highlighting the fact that “equivalence” represents a concept worth revisiting and detailing upon when tackling the translation process of economic texts both from English into Romanian and from Romanian into English. Far from being exhaustive, our analysis will focus upon the problems arising from the lack of equivalence at the word level. Consequently, relevant examples from the economic field will be provided to account for the following types of non-equivalence at word level: culturespecific concepts; the source language concept is not lexicalised in the target language; the source language word is semantically complex; differences in physical and interpersonal perspective; differences in expressive meaning; differences in form; differences in frequency and purpose of using specific forms and the use of loan words in the source text. Likewise, we shall illustrate a number of translation strategies necessary to deal with the afore-mentioned cases of non-equivalence: translation by a more general word (superordinate; translation by a more neutral/less expressive word; translation by cultural substitution; translation using a loan word or loan word plus explanation; translation by paraphrase using a related word; translation by paraphrase using unrelated words; translation by omission and translation by illustration.

Translating VDM to Alloy

DEFF Research Database (Denmark)

Lausdahl, Kenneth

2013-01-01

specifications. However, to take advantage of the automated analysis of Alloy, the model-oriented VDM specifications must be translated into a constraint-based Alloy specifications. We describe how a sub- set of VDM can be translated into Alloy and how assertions can be expressed in VDM and checked by the Alloy...

Idioms and Back Translation

Science.gov (United States)

Griffin, Frank

2004-01-01

The challenges of intercultural communication are an integral part of many undergraduate business communication courses. Marketing gaffes clearly illustrate the pitfalls of translation and underscore the importance of a knowledge of the culture with which one is attempting to communicate. A good way to approach the topic of translation pitfalls in…

Geometry and topology of wild translation surfaces

OpenAIRE

Randecker, Anja

2016-01-01

A translation surface is a two-dimensional manifold, equipped with a translation structure. It can be obtained by considering Euclidean polygons and identifying their edges via translations. The vertices of the polygons form singularities if the translation structure can not be extended to them. We study translation surfaces with wild singularities, regarding the topology (genus and space of ends), the geometry (behavior of the singularities), and how the topology and the geometry are related.

Machine Translation in Post-Contemporary Era

Science.gov (United States)

Lin, Grace Hui Chin

2010-01-01

This article focusing on translating techniques via personal computer or laptop reports updated artificial intelligence progresses before 2010. Based on interpretations and information for field of MT [Machine Translation] by Yorick Wilks' book, "Machine Translation, Its scope and limits," this paper displays understandable theoretical frameworks…

Localizing apps a practical guide for translators and translation students

CERN Document Server

Roturier, Johann

2015-01-01

The software industry has undergone rapid development since the beginning of the twenty-first century. These changes have had a profound impact on translators who, due to the evolving nature of digital content, are under increasing pressure to adapt their ways of working. Localizing Apps looks at these challenges by focusing on the localization of software applications, or apps. In each of the five core chapters, Johann Roturier examines:The role of translation and other linguistic activities in adapting software to the needs of different cultures (localization);The procedures required to prep

Semiotics of Umberto Eco in a Literary Translation Class: The Model Reader as the Competent Translator

Science.gov (United States)

Ozturk Kasar, Sündüz; Can, Alize

2017-01-01

Classroom environment can be thought as an absolute place to practice and improve translation skills of students. They have the possibility to brainstorm and discuss problematic points they face with each other during a translation activity. It can be estimated in the same way in a literary translation class. Students who are supposed to become…

Machine vs. human translation of SNOMED CT terms.

Science.gov (United States)

Schulz, Stefan; Bernhardt-Melischnig, Johannes; Kreuzthaler, Markus; Daumke, Philipp; Boeker, Martin

2013-01-01

In the context of past and current SNOMED CT translation projects we compare three kinds of SNOMED CT translations from English to German by: (t1) professional medical translators; (t2) a free Web-based machine translation service; (t3) medical students. 500 SNOMED CT fully specified names from the (English) International release were randomly selected. Based on this, German translations t1, t2, and t3 were generated. A German and an Austrian physician rated the translations for linguistic correctness and content fidelity. Kappa for inter-rater reliability was 0.4 for linguistic correctness and 0.23 for content fidelity. Average ratings of linguistic correctness did not differ significantly between human translation scenarios. Content fidelity was rated slightly better for student translators compared to professional translators. Comparing machine to human translation, the linguistic correctness differed about 0.5 scale units in favour of the human translation and about 0.25 regarding content fidelity, equally in favour of the human translation. The results demonstrate that low-cost translation solutions of medical terms may produce surprisingly good results. Although we would not recommend low-cost translation for producing standardized preferred terms, this approach can be useful for creating additional language-specific entry terms. This may serve several important use cases. We also recommend testing this method to bootstrap a crowdsourcing process, by which term translations are gathered, improved, maintained, and rated by the user community.

Chinese translation norms for 1,429 English words.

Science.gov (United States)

Wen, Yun; van Heuven, Walter J B

2017-06-01

We present Chinese translation norms for 1,429 English words. Chinese-English bilinguals (N = 28) were asked to provide the first Chinese translation that came to mind for 1,429 English words. The results revealed that 71 % of the English words received more than one correct translation indicating the large amount of translation ambiguity when translating from English to Chinese. The relationship between translation ambiguity and word frequency, concreteness and language proficiency was investigated. Although the significant correlations were not strong, results revealed that English word frequency was positively correlated with the number of alternative translations, whereas English word concreteness was negatively correlated with the number of translations. Importantly, regression analyses showed that the number of Chinese translations was predicted by word frequency and concreteness. Furthermore, an interaction between these predictors revealed that the number of translations was more affected by word frequency for more concrete words than for less concrete words. In addition, mixed-effects modelling showed that word frequency, concreteness and English language proficiency were all significant predictors of whether or not a dominant translation was provided. Finally, correlations between the word frequencies of English words and their Chinese dominant translations were higher for translation-unambiguous pairs than for translation-ambiguous pairs. The translation norms are made available in a database together with lexical information about the words, which will be a useful resource for researchers investigating Chinese-English bilingual language processing.