WorldWideScience

Sample records for transgenic zebrafish line

  1. Investigating the application of a nitroreductase-expressing transgenic zebrafish line for high-throughput toxicity testing

    Directory of Open Access Journals (Sweden)

    Anna C. Chlebowski

    Full Text Available Nitroreductase enzymes are responsible for the reduction of nitro functional groups to amino functional groups, and are found in a range of animal models, zebrafish (Danio rerio excluded. Transgenic zebrafish models have been developed for tissue-specific cell ablation, which use nitroreductase to ablate specific tissues or cell types following exposure to the non-toxic pro-drug metronidazole (MTZ. When metabolized by nitroreductase, MTZ produces a potent cytotoxin, which specifically ablates the tissue in which metabolism occurs. Uses, beyond tissue-specific cell ablation, are possible for the hepatocyte-specific Tg(l-fabp:CFP-NTRs891 zebrafish line, including investigations of the role of nitroreductase in the toxicity of nitrated compounds. The hepatic ablation characteristics of this transgenic line were explored, in order to expand its potential uses. Embryos were exposed at 48, 72, or 96 h post fertilization (hpf to a range of MTZ concentrations, and the ablation profiles were compared. Ablation occurred at a 10-fold lower concentration than previously reported. Embryos were exposed to a selection of other compounds, with and without MTZ, in order to investigate alternative uses for this transgenic line. Test compounds were selected based on: their ability to undergo nitroreduction, known importance of hepatic metabolism to toxicity, and known pharmaceutical hepatotoxins. Selected compounds included nitrated polycyclic aromatic hydrocarbons (nitro-PAHs, the PAHs retene and benzo[a]pyrene, and the pharmaceuticals acetaminophen and flutamide. The results suggest a range of potential roles of the liver in the toxicity of these compounds, and highlight the additional uses of this transgenic model in toxicity testing. Keywords: Zebrafish, Transgenic, Nitroreductase, Nitrated polycyclic aromatic hydrocarbon, Tissue ablation, Pharmaceuticals

  2. Zebrafish transgenic line huORFZ is an effective living bioindicator for detecting environmental toxicants.

    Directory of Open Access Journals (Sweden)

    Hung-Chieh Lee

    Full Text Available Reliable animal models are invaluable for monitoring the extent of pollution in the aquatic environment. In this study, we demonstrated the potential of huORFZ, a novel transgenic zebrafish line that harbors a human upstream open reading frame of the chop gene fused with GFP reporter, as an animal model for monitoring environmental pollutants and stress-related cellular processes. When huORFZ embryos were kept under normal condition, no leaked GFP signal could be detected. When treated with hazardous chemicals, including heavy metals and endocrine-disrupting chemicals near their sublethal concentrations (LC50, huORFZ embryos exhibited different tissue-specific GFP expression patterns. For further analysis, copper (Cu2+, cadmium (Cd2+ and Chlorpyrifos were applied. Cu2+ triggered GFP responses in skin and muscle, whereas Cd2+ treatment triggered GFP responses in skin, olfactory epithelium and pronephric ducts. Moreover, fluorescence intensity, as exhibited by huORFZ embryos, was dose-dependent. After surviving treated embryos were returned to normal condition, survival rates, as well as TUNEL signals, returned to pretreatment levels with no significant morphological defects observed. Such results indicated the reversibility of treatment conditions used in this study, as long as embryos survived such conditions. Notably, GFP signals decreased along with recovery, suggesting that GFP signaling of huORFZ embryos likely reflected the overall physiological condition of the individual. To examine the performance of the huORFZ line under real-world conditions, we placed huORFZ embryos in different river water samples. We found that the huORFZ embryos correctly detected the presence of various kinds of pollutants. Based on these findings, we concluded that such uORFchop-based system can be integrated into a first-line water alarm system monitoring the discharge of hazardous pollutants.

  3. Zebrafish Transgenic Line huORFZ Is an Effective Living Bioindicator for Detecting Environmental Toxicants

    Science.gov (United States)

    Chu, Chien; Li, Hong-Ping; Tsai, Huai-Jen

    2014-01-01

    Reliable animal models are invaluable for monitoring the extent of pollution in the aquatic environment. In this study, we demonstrated the potential of huORFZ, a novel transgenic zebrafish line that harbors a human upstream open reading frame of the chop gene fused with GFP reporter, as an animal model for monitoring environmental pollutants and stress-related cellular processes. When huORFZ embryos were kept under normal condition, no leaked GFP signal could be detected. When treated with hazardous chemicals, including heavy metals and endocrine-disrupting chemicals near their sublethal concentrations (LC50), huORFZ embryos exhibited different tissue-specific GFP expression patterns. For further analysis, copper (Cu2+), cadmium (Cd2+) and Chlorpyrifos were applied. Cu2+ triggered GFP responses in skin and muscle, whereas Cd2+ treatment triggered GFP responses in skin, olfactory epithelium and pronephric ducts. Moreover, fluorescence intensity, as exhibited by huORFZ embryos, was dose-dependent. After surviving treated embryos were returned to normal condition, survival rates, as well as TUNEL signals, returned to pretreatment levels with no significant morphological defects observed. Such results indicated the reversibility of treatment conditions used in this study, as long as embryos survived such conditions. Notably, GFP signals decreased along with recovery, suggesting that GFP signaling of huORFZ embryos likely reflected the overall physiological condition of the individual. To examine the performance of the huORFZ line under real-world conditions, we placed huORFZ embryos in different river water samples. We found that the huORFZ embryos correctly detected the presence of various kinds of pollutants. Based on these findings, we concluded that such uORFchop-based system can be integrated into a first-line water alarm system monitoring the discharge of hazardous pollutants. PMID:24594581

  4. Establishment of a transgenic zebrafish line for superficial skin ablation and functional validation of apoptosis modulators in vivo.

    Directory of Open Access Journals (Sweden)

    Chi-Fang Chen

    Full Text Available BACKGROUND: Zebrafish skin is composed of enveloping and basal layers which form a first-line defense system against pathogens. Zebrafish epidermis contains ionocytes and mucous cells that aid secretion of acid/ions or mucous through skin. Previous studies demonstrated that fish skin is extremely sensitive to external stimuli. However, little is known about the molecular mechanisms that modulate skin cell apoptosis in zebrafish. METHODOLOGY/PRINCIPAL FINDINGS: This study aimed to create a platform to conduct conditional skin ablation and determine if it is possible to attenuate apoptotic stimuli by overexpressing potential apoptosis modulating genes in the skin of live animals. A transgenic zebrafish line of Tg(krt4:NTR-hKikGR(cy17 (killer line, which can conditionally trigger apoptosis in superficial skin cells, was first established. When the killer line was incubated with the prodrug metrodinazole, the superficial skin displayed extensive apoptosis as judged by detection of massive TUNEL- and active caspase 3-positive signals. Great reductions in NTR-hKikGR(+ fluorescent signals accompanied epidermal cell apoptosis. This indicated that NTR-hKikGR(+ signal fluorescence can be utilized to evaluate apoptotic events in vivo. After removal of metrodinazole, the skin integrity progressively recovered and NTR-hKikGR(+ fluorescent signals gradually restored. In contrast, either crossing the killer line with testing lines or transiently injecting the killer line with testing vectors that expressed human constitutive active Akt1, mouse constitutive active Stat3, or HPV16 E6 element displayed apoptosis-resistant phenotypes to cytotoxic metrodinazole as judged by the loss of reduction in NTR-hKikGR(+ fluorescent signaling. CONCLUSION/SIGNIFICANCE: The killer/testing line binary system established in the current study demonstrates a nitroreductase/metrodinazole system that can be utilized to conditionally perform skin ablation in a real-time manner, and

  5. Two types of Tet-On transgenic lines for doxycycline-inducible gene expression in zebrafish rod photoreceptors and a gateway-based tet-on toolkit.

    Directory of Open Access Journals (Sweden)

    Leah J Campbell

    Full Text Available The ability to control transgene expression within specific tissues is an important tool for studying the molecular and cellular mechanisms of development, physiology, and disease. We developed a Tet-On system for spatial and temporal control of transgene expression in zebrafish rod photoreceptors. We generated two transgenic lines using the Xenopus rhodopsin promoter to drive the reverse tetracycline-controlled transcriptional transactivator (rtTA, one with self-reporting GFP activity and one with an epitope tagged rtTA. The self-reporting line includes a tetracycline response element (TRE-driven GFP and, in the presence of doxycycline, expresses GFP in larval and adult rods. A time-course of doxycycline treatment demonstrates that maximal induction of GFP expression, as determined by the number of GFP-positive rods, is reached within approximately 24 hours of drug treatment. The epitope-tagged transgenic line eliminates the need for the self-reporting GFP activity by expressing a FLAG-tagged rtTA protein. Both lines demonstrate strong induction of TRE-driven transgenes from plasmids microinjected into one-cell embryos. These results show that spatial and temporal control of transgene expression can be achieved in rod photoreceptors. Additionally, system components are constructed in Gateway compatible vectors for the rapid cloning of doxycycline-inducible transgenes and use in other areas of zebrafish research.

  6. An α-smooth muscle actin (acta2/αsma zebrafish transgenic line marking vascular mural cells and visceral smooth muscle cells.

    Directory of Open Access Journals (Sweden)

    Thomas R Whitesell

    Full Text Available Mural cells of the vascular system include vascular smooth muscle cells (SMCs and pericytes whose role is to stabilize and/or provide contractility to blood vessels. One of the earliest markers of mural cell development in vertebrates is α smooth muscle actin (acta2; αsma, which is expressed by pericytes and SMCs. In vivo models of vascular mural cell development in zebrafish are currently lacking, therefore we developed two transgenic zebrafish lines driving expression of GFP or mCherry in acta2-expressing cells. These transgenic fish were used to trace the live development of mural cells in embryonic and larval transgenic zebrafish. acta2:EGFP transgenic animals show expression that largely mirrors native acta2 expression, with early pan-muscle expression starting at 24 hpf in the heart muscle, followed by skeletal and visceral muscle. At 3.5 dpf, expression in the bulbus arteriosus and ventral aorta marks the first expression in vascular smooth muscle. Over the next 10 days of development, the number of acta2:EGFP positive cells and the number of types of blood vessels associated with mural cells increases. Interestingly, the mural cells are not motile and remain in the same position once they express the acta2:EGFP transgene. Taken together, our data suggests that zebrafish mural cells develop relatively late, and have little mobility once they associate with vessels.

  7. Heart-specific expression of laminopathic mutations in transgenic zebrafish.

    Science.gov (United States)

    Verma, Ajay D; Parnaik, Veena K

    2017-07-01

    Lamins are key determinants of nuclear organization and function in the metazoan nucleus. Mutations in human lamin A cause a spectrum of genetic diseases that affect cardiac muscle and skeletal muscle as well as other tissues. A few laminopathies have been modeled using the mouse. As zebrafish is a well established model for the study of cardiac development and disease, we have investigated the effects of heart-specific lamin A mutations in transgenic zebrafish. We have developed transgenic lines of zebrafish expressing conserved lamin A mutations that cause cardiac dysfunction in humans. Expression of zlamin A mutations Q291P and M368K in the heart was driven by the zebrafish cardiac troponin T2 promoter. Homozygous mutant embryos displayed nuclear abnormalities in cardiomyocyte nuclei. Expression analysis showed the upregulation of genes involved in heart regeneration in transgenic mutant embryos and a cell proliferation marker was increased in adult heart tissue. At the physiological level, there was deviation of up to 20% from normal heart rate in transgenic embryos expressing mutant lamins. Adult homozygous zebrafish were fertile and did not show signs of early mortality. Our results suggest that transgenic zebrafish models of heart-specific laminopathies show cardiac regeneration and moderate deviations in heart rate during embryonic development. © 2017 International Federation for Cell Biology.

  8. Development of a convenient in vivo hepatotoxin assay using a transgenic zebrafish line with liver-specific DsRed expression.

    Directory of Open Access Journals (Sweden)

    Xiaoyan Zhang

    Full Text Available Previously we have developed a transgenic zebrafish line (LiPan with liver-specific red fluorescent protein (DsRed expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine] caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics and chlorphenamine (pain killer did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry

  9. Development of a Convenient In Vivo Hepatotoxin Assay Using a Transgenic Zebrafish Line with Liver-Specific DsRed Expression

    Science.gov (United States)

    Zhang, Xiaoyan; Li, Caixia; Gong, Zhiyuan

    2014-01-01

    Previously we have developed a transgenic zebrafish line (LiPan) with liver-specific red fluorescent protein (DsRed) expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone) in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate) behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine]) caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics) and chlorphenamine (pain killer) did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry provide a rapid

  10. Generation and characterization of gsuα:EGFP transgenic zebrafish for evaluating endocrine-disrupting effects

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Xiaoxia [Key Laboratory of Aquatic Biodiversity and Conservation of the Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei (China); University of Chinese Academy of Sciences, Beijing (China); Chen, Xiaowen; Jin, Xia; He, Jiangyan [Key Laboratory of Aquatic Biodiversity and Conservation of the Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei (China); Yin, Zhan, E-mail: zyin@ihb.ac.cn [Key Laboratory of Aquatic Biodiversity and Conservation of the Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei (China); Ningbo Laboratory, State Key Laboratory of Freshwater Ecology and Biotechnology (China)

    2014-07-01

    The glycoprotein subunit α (gsuα) gene encodes the shared α subunit of the three pituitary heterodimeric glycoprotein hormones: follicle-stimulating hormone β (Fshβ), luteinizing hormone β (Lhβ) and thyroid stimulating hormone β (Tshβ). In our current study, we identified and characterized the promoter region of zebrafish gsuα and generated a stable gsuα:EGFP transgenic line, which recapitulated the endogenous gsuα expression in the early developing pituitary gland. A relatively conserved regulatory element set is presented in the promoter regions of zebrafish and three other known mammalian gsuα promoters. Our results also demonstrated that the expression patterns of the gsuα:EGFP transgene were all identical to those expression patterns of the endogenous gsuα expression in the pituitary tissue when our transgenic fish were treated with various endocrine chemicals, including forskolin (FSK), SP600125, trichostatin A (TSA), KClO{sub 4}, dexamethasone (Dex), β-estradiol and progesterone. Thus, this gsuα:EGFP transgenic fish reporter line provides another valuable tool for investigating the lineage development of gsuα-expressing gonadotrophins and the coordinated regulation of various glycoprotein hormone subunit genes. These reporter fish can serve as a novel platform to perform screenings of endocrine-disrupting chemicals (EDCs) in vivo as well. - Highlights: • Identification of the promoter of zebrafish glycoprotein subunit α (gsuα) gene • Generation of stable transmission gsuα:EGFP transgenic zebrafish reporter • Demonstration of the recapitulation of the gsuα:EGFP and endogenous gsuα expression • Suggestion of the gsuα:EGFP transgenic zebrafish as a novel platform for EDC study.

  11. Generation and characterization of gsuα:EGFP transgenic zebrafish for evaluating endocrine-disrupting effects

    International Nuclear Information System (INIS)

    Cheng, Xiaoxia; Chen, Xiaowen; Jin, Xia; He, Jiangyan; Yin, Zhan

    2014-01-01

    The glycoprotein subunit α (gsuα) gene encodes the shared α subunit of the three pituitary heterodimeric glycoprotein hormones: follicle-stimulating hormone β (Fshβ), luteinizing hormone β (Lhβ) and thyroid stimulating hormone β (Tshβ). In our current study, we identified and characterized the promoter region of zebrafish gsuα and generated a stable gsuα:EGFP transgenic line, which recapitulated the endogenous gsuα expression in the early developing pituitary gland. A relatively conserved regulatory element set is presented in the promoter regions of zebrafish and three other known mammalian gsuα promoters. Our results also demonstrated that the expression patterns of the gsuα:EGFP transgene were all identical to those expression patterns of the endogenous gsuα expression in the pituitary tissue when our transgenic fish were treated with various endocrine chemicals, including forskolin (FSK), SP600125, trichostatin A (TSA), KClO 4 , dexamethasone (Dex), β-estradiol and progesterone. Thus, this gsuα:EGFP transgenic fish reporter line provides another valuable tool for investigating the lineage development of gsuα-expressing gonadotrophins and the coordinated regulation of various glycoprotein hormone subunit genes. These reporter fish can serve as a novel platform to perform screenings of endocrine-disrupting chemicals (EDCs) in vivo as well. - Highlights: • Identification of the promoter of zebrafish glycoprotein subunit α (gsuα) gene • Generation of stable transmission gsuα:EGFP transgenic zebrafish reporter • Demonstration of the recapitulation of the gsuα:EGFP and endogenous gsuα expression • Suggestion of the gsuα:EGFP transgenic zebrafish as a novel platform for EDC study

  12. A novel transgenic zebrafish model for blood-brain and blood-retinal barrier development

    Directory of Open Access Journals (Sweden)

    Sugimoto Masahiko

    2010-07-01

    Full Text Available Abstract Background Development and maintenance of the blood-brain and blood-retinal barrier is critical for the homeostasis of brain and retinal tissue. Despite decades of research our knowledge of the formation and maintenance of the blood-brain (BBB and blood-retinal (BRB barrier is very limited. We have established an in vivo model to study the development and maintenance of these barriers by generating a transgenic zebrafish line that expresses a vitamin D-binding protein fused with enhanced green fluorescent protein (DBP-EGFP in blood plasma, as an endogenous tracer. Results The temporal establishment of the BBB and BRB was examined using this transgenic line and the results were compared with that obtained by injection of fluorescent dyes into the sinus venosus of embryos at various stages of development. We also examined the expression of claudin-5, a component of tight junctions during the first 4 days of development. We observed that the BBB of zebrafish starts to develop by 3 dpf, with expression of claudin-5 in the central arteries preceding it at 2 dpf. The hyaloid vasculature in the zebrafish retina develops a barrier function at 3 dpf, which endows the zebrafish with unique advantages for studying the BRB. Conclusion Zebrafish embryos develop BBB and BRB function simultaneously by 3 dpf, which is regulated by tight junction proteins. The Tg(l-fabp:DBP-EGFP zebrafish will have great advantages in studying development and maintenance of the blood-neural barrier, which is a new application for the widely used vertebrate model.

  13. In Vivo Screening Using Transgenic Zebrafish Embryos Reveals New Effects of HDAC Inhibitors Trichostatin A and Valproic Acid on Organogenesis.

    Directory of Open Access Journals (Sweden)

    Ling Li

    Full Text Available The effects of endocrine disrupting chemicals (EDCs on reproduction are well known, whereas their developmental effects are much less characterized. However, exposure to endocrine disruptors during organogenesis may lead to deleterious and permanent problems later in life. Zebrafish (Danio rerio transgenic lines expressing the green fluorescent protein (GFP in specific organs and tissues are powerful tools to uncover developmental defects elicited by EDCs. Here, we used seven transgenic lines to visualize in vivo whether a series of EDCs and other pharmaceutical compounds can alter organogenesis in zebrafish. We used transgenic lines expressing GFP in pancreas, liver, blood vessels, inner ear, nervous system, pharyngeal tooth and pectoral fins. This screen revealed that four of the tested chemicals have detectable effects on different organs, which shows that the range of effects elicited by EDCs is wider than anticipated. The endocrine disruptor tetrabromobisphenol-A (TBBPA, as well as the three drugs diclofenac, trichostatin A (TSA and valproic acid (VPA induced abnormalities in the embryonic vascular system of zebrafish. Moreover, TSA and VPA induced specific alterations during the development of pancreas, an observation that was confirmed by in situ hybridization with specific markers. Developmental delays were also induced by TSA and VPA in the liver and in pharyngeal teeth, resulting in smaller organ size. Our results show that EDCs can induce a large range of developmental alterations during embryogenesis of zebrafish and establish GFP transgenic lines as powerful tools to screen for EDCs effects in vivo.

  14. Transgenic tools to characterize neuronal properties of discrete populations of zebrafish neurons.

    Science.gov (United States)

    Satou, Chie; Kimura, Yukiko; Hirata, Hiromi; Suster, Maximiliano L; Kawakami, Koichi; Higashijima, Shin-ichi

    2013-09-01

    The developing nervous system consists of a variety of cell types. Transgenic animals expressing reporter genes in specific classes of neuronal cells are powerful tools for the study of neuronal network formation. We generated a wide variety of transgenic zebrafish that expressed reporter genes in specific classes of neurons or neuronal progenitors. These include lines in which neurons of specific neurotransmitter phenotypes expressed fluorescent proteins or Gal4, and lines in which specific subsets of the dorsal progenitor domain in the spinal cord expressed fluorescent proteins. Using these, we examined domain organization in the developing dorsal spinal cord, and found that there are six progenitor domains in zebrafish, which is similar to the domain organization in mice. We also systematically characterized neurotransmitter properties of the neurons that are produced from each domain. Given that reporter gene expressions occurs in a wide area of the nervous system in the lines generated, these transgenic fish should serve as powerful tools for the investigation of not only the neurons in the dorsal spinal cord but also neuronal structures and functions in many other regions of the nervous system.

  15. A zebrafish transgenic model of Ewing's sarcoma reveals conserved mediators of EWS-FLI1 tumorigenesis.

    Science.gov (United States)

    Leacock, Stefanie W; Basse, Audrey N; Chandler, Garvin L; Kirk, Anne M; Rakheja, Dinesh; Amatruda, James F

    2012-01-01

    Ewing's sarcoma, a malignant bone tumor of children and young adults, is a member of the small-round-blue-cell tumor family. Ewing's sarcoma family tumors (ESFTs), which include peripheral primitive neuroectodermal tumors (PNETs), are characterized by chromosomal translocations that generate fusions between the EWS gene and ETS-family transcription factors, most commonly FLI1. The EWS-FLI1 fusion oncoprotein represents an attractive therapeutic target for treatment of Ewing's sarcoma. The cell of origin of ESFT and the molecular mechanisms by which EWS-FLI1 mediates tumorigenesis remain unknown, and few animal models of Ewing's sarcoma exist. Here, we report the use of zebrafish as a vertebrate model of EWS-FLI1 function and tumorigenesis. Mosaic expression of the human EWS-FLI1 fusion protein in zebrafish caused the development of tumors with histology strongly resembling that of human Ewing's sarcoma. The incidence of tumors increased in a p53 mutant background, suggesting that the p53 pathway suppresses EWS-FLI1-driven tumorigenesis. Gene expression profiling of the zebrafish tumors defined a set of genes that might be regulated by EWS-FLI1, including the zebrafish ortholog of a crucial EWS-FLI1 target gene in humans. Stable zebrafish transgenic lines expressing EWS-FLI1 under the control of the heat-shock promoter exhibit altered embryonic development and defective convergence and extension, suggesting that EWS-FLI1 interacts with conserved developmental pathways. These results indicate that functional targets of EWS-FLI1 that mediate tumorigenesis are conserved from zebrafish to human and provide a novel context in which to study the function of this fusion oncogene.

  16. Generation of FGF reporter transgenic zebrafish and their utility in chemical screens

    Directory of Open Access Journals (Sweden)

    Tsang Michael

    2007-06-01

    Full Text Available Abstract Background Fibroblast Growth Factors (FGFs represent a large family of secreted proteins that are required for proper development and physiological processes. Mutations in mouse and zebrafish FGFs result in abnormal embryogenesis and lethality. A key to understanding the precise role for these factors is to determine their spatial and temporal activity during embryogenesis. Results Expression of Dual Specificity Phosphatase 6 (dusp6, also known as Mkp3 is controlled by FGF signalling throughout development. The Dusp6 promoter was isolated from zebrafish and used to drive expression of destabilized green fluorescent protein (d2EGFP in transgenic embryos (Tg(Dusp6:d2EGFP. Expression of d2EGFP is initiated as early as 4 hours post-fertilization (hpf within the future dorsal region of the embryo, where fgf3 and fgf8 are initially expressed. At later stages, d2EGFP is detected within structures that correlate with the expression of Fgf ligands and their receptors. This includes the mid-hindbrain boundary (MHB, pharyngeal endoderm, otic vesicle, hindbrain, and Kupffer's vesicle. The expression of d2EGFP is under the control of FGF signalling as treatment with FGF Receptor (FGFR inhibitors results in the suppression of d2EGFP expression. In a pilot screen of commercially available small molecules we have evaluated the effectiveness of the transgenic lines to identify specific FGF inhibitors within the class of indolinones. These compounds were counter screened with the transgenic line Tg(Fli1:EGFPy1, that serves as an indirect read-out for Vascular Endothelial Growth Factor (VEGF signalling in order to determine the specificity between related receptor tyrosine kinases (RTKs. From these assays it is possible to determine the specificity of these indolinones towards specific RTK signalling pathways. This has enabled the identification of compounds that can block specifically the VEGFR or the FGFR signalling pathway. Conclusion The generation of

  17. Transgenic cassava lines carrying heterologous alternative oxidase ...

    African Journals Online (AJOL)

    Afuape

    2013-07-03

    Jul 3, 2013 ... production of flowers, apomixis (Nassar et al., 2000; ... In order to increase the stress tolerance capacity of ... stress-related procedure due to the activities of auxin ... the evaluation of the transgenic lines for rate of OES .... Some transgenic lines carrying the 35S-AOX fragment amplified using 35S303F1 and.

  18. Transgenic cassava lines carrying heterologous alternative oxidase ...

    African Journals Online (AJOL)

    Afuape

    2013-07-03

    Jul 3, 2013 ... Organized embryogenic callus development: In our experiment, somatic embryos were developed from leaf lobes collected from transgenic cassava lines carrying the AtAOX1a gene. Immature leaf lobes measuring about 1 to 6 mm obtained from about six weeks old in vitro derived plants were used.

  19. Synergistic Induction of Potential Warburg Effect in Zebrafish Hepatocellular Carcinoma by Co-Transgenic Expression of Myc and xmrk Oncogenes.

    Directory of Open Access Journals (Sweden)

    Zhen Li

    Full Text Available Previously we have generated inducible liver tumor models by transgenic expression of Myc or xmrk (activated EGFR homolog oncogenes in zebrafish. To investigate the interaction of the two oncogenes, we crossed the two transgenic lines and observed more severe and faster hepatocarcinogenesis in Myc/xmrk double transgenic zebrafish than either single transgenic fish. RNA-Seq analyses revealed distinct changes in many molecular pathways among the three types of liver tumors. In particular, we found dramatic alteration of cancer metabolism based on the uniquely enriched pathways in the Myc/xmrk tumors. Critical glycolytic genes including hk2, pkm and ldha were significantly up-regulated in Myc/xmrk tumors but not in either single oncogene-induced tumors, suggesting a potential Warburg effect. In RT-qPCR analyses, the specific pkm2 isoformin Warburg effect was found to be highly enriched in the Myc/xmrk tumors but not in Myc or xmrk tumors, consistent with the observations in many human cancers with Warburg effect. Moreover, the splicing factor genes (hnrnpa1, ptbp1a, ptbp1b and sfrs3b responsible for generating the pkm isoform were also greatly up-regulated in the Myc/xmrk tumors. As Pkm2 isoform is generally inactive and causes incomplete glycolysis to favor anabolism and tumor growth, by treatment with a Pkm2-specific activator, TEPP-46, we further demonstrated that activation of Pkm2 suppressed the growth of oncogenic liver as well as proliferation of liver cells. Collectively, our Myc/xmrk zebrafish model suggests synergetic effect of EGFR and MYC in triggering Warburg effect in the HCC formation and may provide a promising in vivo model for Warburg effect.

  20. A zebrafish transgenic model of Ewing’s sarcoma reveals conserved mediators of EWS-FLI1 tumorigenesis

    Directory of Open Access Journals (Sweden)

    Stefanie W. Leacock

    2012-01-01

    Ewing’s sarcoma, a malignant bone tumor of children and young adults, is a member of the small-round-blue-cell tumor family. Ewing’s sarcoma family tumors (ESFTs, which include peripheral primitive neuroectodermal tumors (PNETs, are characterized by chromosomal translocations that generate fusions between the EWS gene and ETS-family transcription factors, most commonly FLI1. The EWS-FLI1 fusion oncoprotein represents an attractive therapeutic target for treatment of Ewing’s sarcoma. The cell of origin of ESFT and the molecular mechanisms by which EWS-FLI1 mediates tumorigenesis remain unknown, and few animal models of Ewing’s sarcoma exist. Here, we report the use of zebrafish as a vertebrate model of EWS-FLI1 function and tumorigenesis. Mosaic expression of the human EWS-FLI1 fusion protein in zebrafish caused the development of tumors with histology strongly resembling that of human Ewing’s sarcoma. The incidence of tumors increased in a p53 mutant background, suggesting that the p53 pathway suppresses EWS-FLI1-driven tumorigenesis. Gene expression profiling of the zebrafish tumors defined a set of genes that might be regulated by EWS-FLI1, including the zebrafish ortholog of a crucial EWS-FLI1 target gene in humans. Stable zebrafish transgenic lines expressing EWS-FLI1 under the control of the heat-shock promoter exhibit altered embryonic development and defective convergence and extension, suggesting that EWS-FLI1 interacts with conserved developmental pathways. These results indicate that functional targets of EWS-FLI1 that mediate tumorigenesis are conserved from zebrafish to human and provide a novel context in which to study the function of this fusion oncogene.

  1. Transgenic zebrafish reveal tissue-specific differences in estrogen signaling in response to environmental water samples.

    Science.gov (United States)

    Gorelick, Daniel A; Iwanowicz, Luke R; Hung, Alice L; Blazer, Vicki S; Halpern, Marnie E

    2014-04-01

    Environmental endocrine disruptors (EEDs) are exogenous chemicals that mimic endogenous hormones such as estrogens. Previous studies using a zebrafish transgenic reporter demonstrated that the EEDs bisphenol A and genistein preferentially activate estrogen receptors (ERs) in the larval heart compared with the liver. However, it was not known whether the transgenic zebrafish reporter was sensitive enough to detect estrogens from environmental samples, whether environmental estrogens would exhibit tissue-specific effects similar to those of BPA and genistein, or why some compounds preferentially target receptors in the heart. We tested surface water samples using a transgenic zebrafish reporter with tandem estrogen response elements driving green fluorescent protein expression (5xERE:GFP). Reporter activation was colocalized with tissue-specific expression of ER genes by RNA in situ hybridization. We observed selective patterns of ER activation in transgenic fish exposed to river water samples from the Mid-Atlantic United States, with several samples preferentially activating receptors in embryonic and larval heart valves. We discovered that tissue specificity in ER activation was due to differences in the expression of ER subtypes. ERα was expressed in developing heart valves but not in the liver, whereas ERβ2 had the opposite profile. Accordingly, subtype-specific ER agonists activated the reporter in either the heart valves or the liver. The use of 5xERE:GFP transgenic zebrafish revealed an unexpected tissue-specific difference in the response to environmentally relevant estrogenic compounds. Exposure to estrogenic EEDs in utero was associated with adverse health effects, with the potentially unanticipated consequence of targeting developing heart valves.

  2. Use of TSHβ:EGFP transgenic zebrafish as a rapid in vivo model for assessing thyroid-disrupting chemicals

    Energy Technology Data Exchange (ETDEWEB)

    Ji, Cheng [Key Laboratory of Aquatic Biodiversity and Conservation of Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei (China); Graduate University of Chinese Academy of Sciences, Beijing (China); Jin, Xia; He, Jiangyan [Key Laboratory of Aquatic Biodiversity and Conservation of Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei (China); Yin, Zhan, E-mail: zyin@ihb.ac.cn [Key Laboratory of Aquatic Biodiversity and Conservation of Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei (China)

    2012-07-15

    Accumulating evidence indicates that a wide range of chemicals have the ability to interfere with the hypothalamic–pituitary–thyroid (HPT) axis. Novel endpoints should be evaluated in addition to existing methods in order to effectively assess the effects of these chemicals on the HPT axis. Thyroid-stimulating hormone subunit β (TSHβ) plays central regulatory roles in the HPT system. We identified the regulatory region that determines the expression level of zebrafish TSHβ in the anterior pituitary. In the transgenic zebrafish with EGFP driven by the TSHβ promoter, the similar responsive patterns between the expression levels of TSHβ:EGFP and endogenous TSHβ mRNA in the pituitary are observed following treatments with goitrogen chemicals and exogenous thyroid hormones (THs). These results suggest that the TSHβ:EGFP transgenic reporter zebrafish may be a useful alternative in vivo model for the assessment of chemicals interfering with the HPT system. Highlights: ► The promoter of zebrafish TSHβ gene has been identified. ► The stable TSHβ:EGFP transgenic zebrafish reporter germline has been generated. ► The EGFP in the transgenic fish recapitulated the pattern of pituitary TSHβ mRNA. ► The transgenic zebrafish may be an in vivo model for EDC assessment.

  3. Use of TSHβ:EGFP transgenic zebrafish as a rapid in vivo model for assessing thyroid-disrupting chemicals

    International Nuclear Information System (INIS)

    Ji, Cheng; Jin, Xia; He, Jiangyan; Yin, Zhan

    2012-01-01

    Accumulating evidence indicates that a wide range of chemicals have the ability to interfere with the hypothalamic–pituitary–thyroid (HPT) axis. Novel endpoints should be evaluated in addition to existing methods in order to effectively assess the effects of these chemicals on the HPT axis. Thyroid-stimulating hormone subunit β (TSHβ) plays central regulatory roles in the HPT system. We identified the regulatory region that determines the expression level of zebrafish TSHβ in the anterior pituitary. In the transgenic zebrafish with EGFP driven by the TSHβ promoter, the similar responsive patterns between the expression levels of TSHβ:EGFP and endogenous TSHβ mRNA in the pituitary are observed following treatments with goitrogen chemicals and exogenous thyroid hormones (THs). These results suggest that the TSHβ:EGFP transgenic reporter zebrafish may be a useful alternative in vivo model for the assessment of chemicals interfering with the HPT system. Highlights: ► The promoter of zebrafish TSHβ gene has been identified. ► The stable TSHβ:EGFP transgenic zebrafish reporter germline has been generated. ► The EGFP in the transgenic fish recapitulated the pattern of pituitary TSHβ mRNA. ► The transgenic zebrafish may be an in vivo model for EDC assessment.

  4. A comparative expression analysis of gene transcripts in brain tissue of non-transgenic and GH-transgenic zebrafish (Danio rerio using a DDRT-PCR approach

    Directory of Open Access Journals (Sweden)

    Fernanda A. Alves-Costa

    2012-06-01

    Full Text Available The presence of higher level of exogenous growth hormone (GH in transgenic animals could lead to several physiological alterations. A GH transgenic zebrafish (Danio rerio line was compared to nontransgenic (NT samples of the species through a DDRT-PCR approach, with the goal of identifying candidate differentially expressed transcripts in brain tissues that could be involved in GH overexpression. Densitometric analyses of two selected amplification products, p300 and ADCY2, pointed to a significant lower gene expression in the transgenic zebrafish (104.02 ± 57.71; 224.10 ± 91.73 when compared to NT samples (249.75 ± 30.08; 342.95 ± 65.19. The present data indicate that p300 and ADCY2 are involved in a regulation system for GH when high circulating levels of this hormone are found in zebrafishes.A presença de níveis mais elevados do hormônio de crescimento (GH em animais transgênicos poderia levar a várias alterações fisiológicas. Uma linhagem transgênica de paulistinha (Danio rerio para o GH foi comparada com amostras não transgênicas (NT desta espécie, através de uma abordagem de DDRT-PCR, com o objetivo de identificar transcritos candidatos diferencialmente expressos em tecido cerebral que poderiam estar envolvidos na superexpressão de GH. Análises densitométricas de dois produtos de amplificação selecionados, p300 e ADCY2, apontaram uma expressão gênica significativamente menor nas amostras transgênicas de paulistinha (104.02 ± 57.71; 224.10 ± 91.73, quando comparadas com as amostras NT (249.75 ± 30.08; 342.95±65.19. Os presentes dados indicam que p300 e ADCY2 estão envolvidos em um sistema de regulação do GH, quando altos níveis circulantes desse hormônio são encontrados em paulistinha.

  5. Analyses of pancreas development by generation of gfp transgenic zebrafish using an exocrine pancreas-specific elastaseA gene promoter

    International Nuclear Information System (INIS)

    Wan Haiyan; Korzh, Svitlana; Li Zhen; Mudumana, Sudha Puttur; Korzh, Vladimir; Jiang Yunjin; Lin Shuo; Gong Zhiyuan

    2006-01-01

    In contrast to what we know on development of endocrine pancreas, the formation of exocrine pancreas remains poorly understood. To create an animal model that allows observation of exocrine cell differentiation, proliferation, and morphogenesis in living animals, we used the zebrafish elastaseA (elaA) regulatory sequence to develop transgenic zebrafish that display highly specific exocrine pancreas expression of GFP in both larvae and adult. By following GFP expression, we found that the pancreas in early development was a relatively compact organ and later extended posterior along the intestine. By transferring the elaA:gfp transgene into slow muscle omitted mutant that is deficient in receiving Hedgehog signals, we further showed that Hedgehog signaling is required for exocrine morphogenesis but not for cell differentiation. We also applied the morpholino knockdown and toxin-mediated cell ablation approaches to this transgenic line. We showed that the development of exocrine pancreas is Islet-1 dependent. Injection of the diphtheria toxin A (DTA) construct under the elastaseA promoter resulted in selective ablation of exocrine cells while the endocrine cells and other endodermal derivatives (liver and intestine) were not affected. Thus, our works demonstrated the new transgenic line provided a useful experimental tool in analyzing exocrine pancreas development

  6. Sensory hair cell regeneration in the zebrafish lateral line.

    Science.gov (United States)

    Lush, Mark E; Piotrowski, Tatjana

    2014-10-01

    Damage or destruction of sensory hair cells in the inner ear leads to hearing or balance deficits that can be debilitating, especially in older adults. Unfortunately, the damage is permanent, as regeneration of the inner ear sensory epithelia does not occur in mammals. Zebrafish and other non-mammalian vertebrates have the remarkable ability to regenerate sensory hair cells and understanding the molecular and cellular basis for this regenerative ability will hopefully aid us in designing therapies to induce regeneration in mammals. Zebrafish not only possess hair cells in the ear but also in the sensory lateral line system. Hair cells in both organs are functionally analogous to hair cells in the inner ear of mammals. The lateral line is a mechanosensory system found in most aquatic vertebrates that detects water motion and aids in predator avoidance, prey capture, schooling, and mating. Although hair cell regeneration occurs in both the ear and lateral line, most research to date has focused on the lateral line due to its relatively simple structure and accessibility. Here we review the recent discoveries made during the characterization of hair cell regeneration in zebrafish. Copyright © 2014 Wiley Periodicals, Inc.

  7. SENSORY HAIR CELL REGENERATION IN THE ZEBRAFISH LATERAL LINE

    Science.gov (United States)

    Lush, Mark E.; Piotrowski, Tatjana

    2014-01-01

    Damage or destruction of sensory hair cells in the inner ear leads to hearing or balance deficits that can be debilitating, especially in older adults. Unfortunately, the damage is permanent, as regeneration of the inner ear sensory epithelia does not occur in mammals. Zebrafish and other non-mammalian vertebrates have the remarkable ability to regenerate sensory hair cells and understanding the molecular and cellular basis for this regenerative ability will hopefully aid us in designing therapies to induce regeneration in mammals. Zebrafish not only possess hair cells in the ear but also in the sensory lateral line system. Hair cells in both organs are functionally analogous to hair cells in the inner ear of mammals. The lateral line is a mechanosensory system found in most aquatic vertebrates that detects water motion and aids in predator avoidance, prey capture, schooling and mating. Although hair cell regeneration occurs in both the ear and lateral line, most research to date has focused on the lateral line due to its relatively simple structure and accessibility. Here we review the recent discoveries made during the characterization of hair cell regeneration in zebrafish. PMID:25045019

  8. Establishment and characterization of CAG/EGFP transgenic rabbit line.

    Science.gov (United States)

    Takahashi, Ri-ichi; Kuramochi, Takashi; Aoyagi, Kazuki; Hashimoto, Shu; Miyoshi, Ichiro; Kasai, Noriyuki; Hakamata, Yoji; Kobayashi, Eiji; Ueda, Masatsugu

    2007-02-01

    Cell marking is a very important procedure for identifying donor cells after cell and/or organ transplantation in vivo. Transgenic animals expressing marker proteins such as enhanced green fluorescent protein (EGFP) in their tissues are a powerful tool for research in fields of tissue engineering and regenerative medicine. The purpose of this study was to establish transgenic rabbit lines that ubiquitously express EGFP under the control of the cytomegalovirus immediate early enhancer/beta-actin promoter (CAG) to provide a fluorescent transgenic animal as a bioresource. We microinjected the EGFP expression vector into 945 rabbit eggs and 4 independent transgenic candidate pups were obtained. Two of them died before sexual maturation and one was infertile. One transgenic male candidate founder rabbit was obtained and could be bred by artificial insemination. The rabbit transmitted the transgene in a Mendelian manner. Using fluorescence in situ hybridization analysis, we detected the transgene at 7q11 on chromosome 7 as a large centromeric region in two F1 offspring (one female and one male). Eventually, one transgenic line was established. Ubiquitous EGFP fluorescence was confirmed in all examined organs. There were no gender-related differences in fluorescence. The established CAG/EGFP transgenic rabbit will be an important bioresource and a useful tool for various studies in tissue engineering and regenerative medicine.

  9. Biosecurity and Health Monitoring at the Zebrafish International Resource Center

    OpenAIRE

    Murray, Katrina N.; Varga, Zolt?n M.; Kent, Michael L.

    2016-01-01

    The Zebrafish International Resource Center (ZIRC) is a repository and distribution center for mutant, transgenic, and wild-type zebrafish. In recent years annual imports of new zebrafish lines to ZIRC have increased tremendously. In addition, after 15 years of research, we have identified some of the most virulent pathogens affecting zebrafish that should be avoided in large production facilities, such as ZIRC. Therefore, while importing a high volume of new lines we prioritize safeguarding ...

  10. Validation of visualized transgenic zebrafish as a high throughput model to assay bradycardia related cardio toxicity risk candidates.

    Science.gov (United States)

    Wen, Dingsheng; Liu, Aiming; Chen, Feng; Yang, Julin; Dai, Renke

    2012-10-01

    Drug-induced QT prolongation usually leads to torsade de pointes (TdP), thus for drugs in the early phase of development this risk should be evaluated. In the present study, we demonstrated a visualized transgenic zebrafish as an in vivo high-throughput model to assay the risk of drug-induced QT prolongation. Zebrafish larvae 48 h post-fertilization expressing green fluorescent protein in myocardium were incubated with compounds reported to induce QT prolongation or block the human ether-a-go-go-related gene (hERG) K⁺ current. The compounds sotalol, indapaminde, erythromycin, ofoxacin, levofloxacin, sparfloxacin and roxithromycin were additionally administrated by microinjection into the larvae yolk sac. The ventricle heart rate was recorded using the automatic monitoring system after incubation or microinjection. As a result, 14 out of 16 compounds inducing dog QT prolongation caused bradycardia in zebrafish. A similar result was observed with 21 out of 26 compounds which block hERG current. Among the 30 compounds which induced human QT prolongation, 25 caused bradycardia in this model. Thus, the risk of compounds causing bradycardia in this transgenic zebrafish correlated with that causing QT prolongation and hERG K⁺ current blockage in established models. The tendency that high logP values lead to high risk of QT prolongation in this model was indicated, and non-sensitivity of this model to antibacterial agents was revealed. These data suggest application of this transgenic zebrafish as a high-throughput model to screen QT prolongation-related cardio toxicity of the drug candidates. Copyright © 2012 John Wiley & Sons, Ltd.

  11. Development of putative transgenic lines of cassava variety H-226 ...

    African Journals Online (AJOL)

    CMD) caused by the Indian cassava mosaic virus (ICMV) and Sri Lankan cassava mosaic virus (SLCMV). An attempt was done to develop transgenic cassava lines resistant to SLCMV through RNAi vector targeting a conserved 440 bp of 5' end ...

  12. Adaptability and stability of transgenic soybean lines and cultivars in ...

    African Journals Online (AJOL)

    Subsequently, genotypic adaptability and stability were evaluated by the methods of Eberhart and Russel (1966), Lin and Binns modified by Carneiro, Annicchiarico and Centroid. All methods presented partial coherence on classifying the best genotypes and allowed the identification of the transgenic lines L1 and L4, and ...

  13. Case Study: Polycystic Livers in a Transgenic Mouse Line

    Energy Technology Data Exchange (ETDEWEB)

    Lovaglio, Jamie A.; Artwohl, James E.; Ward, Christopher J.; Diekwisch, Thomas G. H.; Ito, Yoshihiro; Fortman, Jeffrey D.

    2014-04-01

    Three mice (2 male, 1 female; age, 5 to 16 mo) from a mouse line transgenic for keratin 14 (K14)-driven LacZ expression and on an outbred Crl:CD1(ICR) background, were identified as having distended abdomens and livers that were diffusely enlarged by numerous cysts (diameter, 0.1 to 2.0 cm). Histopathology revealed hepatic cysts lined by biliary type epithelium and mild chronic inflammation, and confirmed the absence of parasites. Among 21 related mice, 5 additional affected mice were identified via laparotomy. Breeding of these 5 mice (after 5 mo of age) did not result in any offspring; the K14 mice with olycystic livers failed to reproduce. Affected male mice had degenerative testicular lesions, and their sperm was immotile. Nonpolycystic K14 control male mice bred well, had no testicular lesions, and had appropriate sperm motility. Genetic analysis did not identify an association of this phenotype with the transgene or insertion site.

  14. Polarization and migration in the zebrafish posterior lateral line system.

    Directory of Open Access Journals (Sweden)

    Hildur Knutsdottir

    2017-04-01

    Full Text Available Collective cell migration plays an important role in development. Here, we study the posterior lateral line primordium (PLLP a group of about 100 cells, destined to form sensory structures, that migrates from head to tail in the zebrafish embryo. We model mutually inhibitory FGF-Wnt signalling network in the PLLP and link tissue subdivision (Wnt receptor and FGF receptor activity domains to receptor-ligand parameters. We then use a 3D cell-based simulation with realistic cell-cell adhesion, interaction forces, and chemotaxis. Our model is able to reproduce experimentally observed motility with leading cells migrating up a gradient of CXCL12a, and trailing (FGF receptor active cells moving actively by chemotaxis towards FGF ligand secreted by the leading cells. The 3D simulation framework, combined with experiments, allows an investigation of the role of cell division, chemotaxis, adhesion, and other parameters on the shape and speed of the PLLP. The 3D model demonstrates reasonable behaviour of control as well as mutant phenotypes.

  15. Mutant human FUS Is ubiquitously mislocalized and generates persistent stress granules in primary cultured transgenic zebrafish cells.

    Directory of Open Access Journals (Sweden)

    Jamie Rae Acosta

    Full Text Available FUS mutations can occur in familial amyotrophic lateral sclerosis (fALS, a neurodegenerative disease with cytoplasmic FUS inclusion bodies in motor neurons. To investigate FUS pathology, we generated transgenic zebrafish expressing GFP-tagged wild-type or fALS (R521C human FUS. Cell cultures were made from these zebrafish and the subcellular localization of human FUS and the generation of stress granule (SG inclusions examined in different cell types, including differentiated motor neurons. We demonstrate that mutant FUS is mislocalized from the nucleus to the cytosol to a similar extent in motor neurons and all other cell types. Both wild-type and R521C FUS localized to SGs in zebrafish cells, demonstrating an intrinsic ability of human FUS to accumulate in SGs irrespective of the presence of disease-associated mutations or specific cell type. However, elevation in relative cytosolic to nuclear FUS by the R521C mutation led to a significant increase in SG assembly and persistence within a sub population of vulnerable cells, although these cells were not selectively motor neurons.

  16. A transgenic zebrafish model for the in vivo study of the blood and choroid plexus brain barriers using claudin 5

    Directory of Open Access Journals (Sweden)

    Lisanne Martine van Leeuwen

    2018-02-01

    Full Text Available The central nervous system (CNS has specific barriers that protect the brain from potential threats and tightly regulate molecular transport. Despite the critical functions of the CNS barriers, the mechanisms underlying their development and function are not well understood, and there are very limited experimental models for their study. Claudin 5 is a tight junction protein required for blood brain barrier (BBB and, probably, choroid plexus (CP structure and function in vertebrates. Here, we show that the gene claudin 5a is the zebrafish orthologue with high fidelity expression, in the BBB and CP barriers, that demonstrates the conservation of the BBB and CP between humans and zebrafish. Expression of claudin 5a correlates with developmental tightening of the BBB and is restricted to a subset of the brain vasculature clearly delineating the BBB. We show that claudin 5a-expressing cells of the CP are ciliated ependymal cells that drive fluid flow in the brain ventricles. Finally, we find that CP development precedes BBB development and that claudin 5a expression occurs simultaneously with angiogenesis. Thus, our novel transgenic zebrafish represents an ideal model to study CNS barrier development and function, critical in understanding the mechanisms underlying CNS barrier function in health and disease.

  17. Aberrant Hedgehog ligands induce progressive pancreatic fibrosis by paracrine activation of myofibroblasts and ductular cells in transgenic zebrafish.

    Directory of Open Access Journals (Sweden)

    In Hye Jung

    Full Text Available Hedgehog (Hh signaling is frequently up-regulated in fibrogenic pancreatic diseases including chronic pancreatitis and pancreatic cancer. Although recent series suggest exclusive paracrine activation of stromal cells by Hh ligands from epithelial components, debates still exist on how Hh signaling works in pathologic conditions. To explore how Hh signaling affects the pancreas, we investigated transgenic phenotypes in zebrafish that over-express either Indian Hh or Sonic Hh along with green fluorescence protein (GFP to enable real-time observation, or GFP alone as control, at the ptf1a domain. Transgenic embryos and zebrafish were serially followed for transgenic phenotypes, and investigated using quantitative reverse transcription-polymerase chain reaction (qRT-PCR, in situ hybridization, and immunohistochemistry. Over-expression of Ihh or Shh reveals virtually identical phenotypes. Hh induces morphologic changes in a developing pancreas without derangement in acinar differentiation. In older zebrafish, Hh induces progressive pancreatic fibrosis intermingled with proliferating ductular structures, which is accompanied by the destruction of the acinar structures. Both myofibroblasts and ductular are activated and proliferated by paracrine Hh signaling, showing restricted expression of Hh downstream components including Patched1 (Ptc1, Smoothened (Smo, and Gli1/2 in those Hh-responsive cells. Hh ligands induce matrix metalloproteinases (MMPs, especially MMP9 in all Hh-responsive cells, and transform growth factor-ß1 (TGFß1 only in ductular cells. Aberrant Hh over-expression, however, does not induce pancreatic tumors. On treatment with inhibitors, embryonic phenotypes are reversed by either cyclopamine or Hedgehog Primary Inhibitor-4 (HPI-4. Pancreatic fibrosis is only prevented by HPI-4. Our study provides strong evidence of Hh signaling which induces pancreatic fibrosis through paracrine activation of Hh-responsive cells in vivo. Induction of

  18. Efficient generation of knock-in transgenic zebrafish carrying reporter/driver genes by CRISPR/Cas9-mediated genome engineering.

    Science.gov (United States)

    Kimura, Yukiko; Hisano, Yu; Kawahara, Atsuo; Higashijima, Shin-ichi

    2014-10-08

    The type II bacterial CRISPR/Cas9 system is rapidly becoming popular for genome-engineering due to its simplicity, flexibility, and high efficiency. Recently, targeted knock-in of a long DNA fragment via homology-independent DNA repair has been achieved in zebrafish using CRISPR/Cas9 system. This raised the possibility that knock-in transgenic zebrafish could be efficiently generated using CRISPR/Cas9. However, how widely this method can be applied for the targeting integration of foreign genes into endogenous genomic loci is unclear. Here, we report efficient generation of knock-in transgenic zebrafish that have cell-type specific Gal4 or reporter gene expression. A donor plasmid containing a heat-shock promoter was co-injected with a short guide RNA (sgRNA) targeted for genome digestion, a sgRNA targeted for donor plasmid digestion, and Cas9 mRNA. We have succeeded in establishing stable knock-in transgenic fish with several different constructs for 4 genetic loci at a frequency being exceeding 25%. Due to its simplicity, design flexibility, and high efficiency, we propose that CRISPR/Cas9-mediated knock-in will become a standard method for the generation transgenic zebrafish.

  19. First molecular identification of the transgene red fluorescent protein (RFP in transgenic ornamental zebrafish (Danio rerio introduced in Peru

    Directory of Open Access Journals (Sweden)

    Carlos Scotto

    2013-09-01

    Full Text Available In this paper the transgenic fluorescent red, orange and pink zebra fish (Danio rerio, found in local aquariums in Peru, were identified using the PCR technique to amplify the transgene RFP sea anemone belonging to Discosoma spp. The gene expression of the red fluorescent protein (RFP transgene was found to determine different gradients-of-bioluminescence (shades in color in each GMO fish analyzed. We performed sequence analysis of the two variants of the RFP along with six variants of the existing fluorescent protein GFP from the Genbank, this could help identify quickly if they are new genes or variants thereof as these novel fluorescent proteins may be introduced in aquatic GMO in the future. Thus, developing and improving biosecurity measures through its timely detection at the molecular genetic level.

  20. Epigenetic variants of a transgenic petunia line show hypermethylation in transgene DNA: an indication for specific recognition of foreign DNA in transgenic plants.

    Science.gov (United States)

    Meyer, P; Heidmann, I

    1994-05-25

    We analysed de novo DNA methylation occurring in plants obtained from the transgenic petunia line R101-17. This line contains one copy of the maize A1 gene that leads to the production of brick-red pelargonidin pigment in the flowers. Due to its integration into an unmethylated genomic region the A1 transgene is hypomethylated and transcriptionally active. Several epigenetic variants of line 17 were selected that exhibit characteristic and somatically stable pigmentation patterns, displaying fully coloured, marbled or colourless flowers. Analysis of the DNA methylation patterns revealed that the decrease in pigmentation among the epigenetic variants was correlated with an increase in methylation, specifically of the transgene DNA. No change in methylation of the hypomethylated integration region could be detected. A similar increase in methylation, specifically in the transgene region, was also observed among progeny of R101-17del, a deletion derivative of R101-17 that no longer produces pelargonidin pigments due to a deletion in the A1 coding region. Again de novo methylation is specifically directed to the transgene, while the hypomethylated character of neighbouring regions is not affected. Possible mechanisms for transgene-specific methylation and its consequences for long-term use of transgenic material are discussed.

  1. A high level of liver-specific expression of oncogenic KrasV12 drives robust liver tumorigenesis in transgenic zebrafish

    Directory of Open Access Journals (Sweden)

    Anh Tuan Nguyen

    2011-11-01

    Human liver cancer is one of the deadliest cancers worldwide, with hepatocellular carcinoma (HCC being the most common type. Aberrant Ras signaling has been implicated in the development and progression of human HCC, but a complete understanding of the molecular mechanisms of this protein in hepatocarcinogenesis remains elusive. In this study, a stable in vivo liver cancer model using transgenic zebrafish was generated to elucidate Ras-driven tumorigenesis in HCC. Using the liver-specific fabp10 (fatty acid binding protein 10 promoter, we overexpressed oncogenic krasV12 specifically in the transgenic zebrafish liver. Only a high level of krasV12 expression initiated liver tumorigenesis, which progressed from hyperplasia to benign and malignant tumors with activation of the Ras-Raf-MEK-ERK and Wnt–β-catenin pathways. Histological diagnosis of zebrafish tumors identified HCC as the main lesion. The tumors were invasive and transplantable, indicating malignancy of these HCC cells. Oncogenic krasV12 was also found to trigger p53-dependent senescence as a tumor suppressive barrier in the pre-neoplastic stage. Microarray analysis of zebrafish liver hyperplasia and HCC uncovered the deregulation of several stage-specific and common biological processes and signaling pathways responsible for krasV12-driven liver tumorigenesis that recapitulated the molecular hallmarks of human liver cancer. Cross-species comparisons of cancer transcriptomes further defined a HCC-specific gene signature as well as a liver cancer progression gene signature that are evolutionarily conserved between human and zebrafish. Collectively, our study presents a comprehensive portrait of molecular mechanisms during progressive Ras-induced HCC. These observations indicate the validity of our transgenic zebrafish to model human liver cancer, and this model might act as a useful platform for drug screening and identifying new therapeutic targets.

  2. Zebrafish transgenic constructs label specific neurons in Xenopus laevis spinal cord and identify frog V0v spinal neurons.

    Science.gov (United States)

    Juárez-Morales, José L; Martinez-De Luna, Reyna I; Zuber, Michael E; Roberts, Alan; Lewis, Katharine E

    2017-09-01

    A correctly functioning spinal cord is crucial for locomotion and communication between body and brain but there are fundamental gaps in our knowledge of how spinal neuronal circuitry is established and functions. To understand the genetic program that regulates specification and functions of this circuitry, we need to connect neuronal molecular phenotypes with physiological analyses. Studies using Xenopus laevis tadpoles have increased our understanding of spinal cord neuronal physiology and function, particularly in locomotor circuitry. However, the X. laevis tetraploid genome and long generation time make it difficult to investigate how neurons are specified. The opacity of X. laevis embryos also makes it hard to connect functional classes of neurons and the genes that they express. We demonstrate here that Tol2 transgenic constructs using zebrafish enhancers that drive expression in specific zebrafish spinal neurons label equivalent neurons in X. laevis and that the incorporation of a Gal4:UAS amplification cassette enables cells to be observed in live X. laevis tadpoles. This technique should enable the molecular phenotypes, morphologies and physiologies of distinct X. laevis spinal neurons to be examined together in vivo. We have used an islet1 enhancer to label Rohon-Beard sensory neurons and evx enhancers to identify V0v neurons, for the first time, in X. laevis spinal cord. Our work demonstrates the homology of spinal cord circuitry in zebrafish and X. laevis, suggesting that future work could combine their relative strengths to elucidate a more complete picture of how vertebrate spinal cord neurons are specified, and function to generate behavior. © 2017 Wiley Periodicals, Inc. Develop Neurobiol 77: 1007-1020, 2017. © 2017 Wiley Periodicals, Inc.

  3. Screening estrogenic activities of chemicals or mixtures in vivo using transgenic (cyp19a1b-GFP zebrafish embryos.

    Directory of Open Access Journals (Sweden)

    François Brion

    Full Text Available The tg(cyp19a1b-GFP transgenic zebrafish expresses GFP (green fluorescent protein under the control of the cyp19a1b gene, encoding brain aromatase. This gene has two major characteristics: (i it is only expressed in radial glial progenitors in the brain of fish and (ii it is exquisitely sensitive to estrogens. Based on these properties, we demonstrate that natural or synthetic hormones (alone or in binary mixture, including androgens or progestagens, and industrial chemicals induce a concentration-dependent GFP expression in radial glial progenitors. As GFP expression can be quantified by in vivo imaging, this model presents a very powerful tool to screen and characterize compounds potentially acting as estrogen mimics either directly or after metabolization by the zebrafish embryo. This study also shows that radial glial cells that act as stem cells are direct targets for a large panel of endocrine disruptors, calling for more attention regarding the impact of environmental estrogens and/or certain pharmaceuticals on brain development. Altogether these data identify this in vivo bioassay as an interesting alternative to detect estrogen mimics in hazard and risk assessment perspective.

  4. SENSORY HAIR CELL REGENERATION IN THE ZEBRAFISH LATERAL LINE

    OpenAIRE

    Lush, Mark E.; Piotrowski, Tatjana

    2014-01-01

    Damage or destruction of sensory hair cells in the inner ear leads to hearing or balance deficits that can be debilitating, especially in older adults. Unfortunately, the damage is permanent, as regeneration of the inner ear sensory epithelia does not occur in mammals. Zebrafish and other non-mammalian vertebrates have the remarkable ability to regenerate sensory hair cells and understanding the molecular and cellular basis for this regenerative ability will hopefully aid us in designing ther...

  5. The zebrafish spi1 promoter drives myeloid-specific expression in stable transgenic fish

    NARCIS (Netherlands)

    Ward, AC; McPhee, DO; Condron, MM; Varma, S; Cody, SH; Onnebo, SMN; Paw, BH; Zon, LI; Lieschke, GJ

    2003-01-01

    The spi1 (pu.1) gene has recently been identified as a useful marker of early myeloid cells in zebrafish. To enhance the versatility of this organism as a model for studying myeloid development, the promoter of this gene has been isolated and characterized. Transient transgenesis revealed that a 5.3

  6. Biosecurity and Health Monitoring at the Zebrafish International Resource Center.

    Science.gov (United States)

    Murray, Katrina N; Varga, Zoltán M; Kent, Michael L

    2016-07-01

    The Zebrafish International Resource Center (ZIRC) is a repository and distribution center for mutant, transgenic, and wild-type zebrafish. In recent years annual imports of new zebrafish lines to ZIRC have increased tremendously. In addition, after 15 years of research, we have identified some of the most virulent pathogens affecting zebrafish that should be avoided in large production facilities, such as ZIRC. Therefore, while importing a high volume of new lines we prioritize safeguarding the health of our in-house fish colony. Here, we describe the biosecurity and health-monitoring program implemented at ZIRC. This strategy was designed to prevent introduction of new zebrafish pathogens, minimize pathogens already present in the facility, and ensure a healthy zebrafish colony for in-house uses and shipment to customers.

  7. Hybridization of downregulated-COMT transgenic switchgrass lines with field selected switchgrass for improved biomass traits

    Science.gov (United States)

    Transgenic switchgrass (Panicum virgatum L.) has been produced for improved cell walls for biofuels. Downregulated caffeic acid 3-O-methyltransferase (COMT) switchgrass produced significantly more biomass and biofuel than the non-transgenic progenitor line. In the present study we sought to further...

  8. Simplified methodology for large scale isolation of homozygous transgenic lines of lettuce

    Directory of Open Access Journals (Sweden)

    Flavia S. Darqui

    2018-01-01

    Conclusions: This protocol allows a simplified scaling-up of the production of multiple homozygous transgenic progeny lines in the early generations avoiding expensive and time-consuming molecular assays.

  9. Stability of transgene expression, field performance and recombination breeding of transformed barley lines

    DEFF Research Database (Denmark)

    Horvath, H.; Jensen, L.G.; Wong, O.T.

    2001-01-01

    in homozygous transgenic T-3 plants, and these remained constant over a 3-year period. In micro-malting experiments, the heat-stable enzyme reached levels of up to 1.4 mug.mg(-1) protein and survived kiln drying at levels of 70-100%. In the field trials of 1997 and 1998 the transgenic lines had a reduced 1000...... lines yielded approximately 6 t.ha(-1) and Golden Promise 7.7 t.ha(-1). Cross-breeding was carried out to transfer the transgene into a more suitable genetic background. Crosses of the semi-dwarf ari-e mutant Golden Promise gave rise to the four morphological phenotypes nutans, high erect, erect...... transformants were observed in some F-4 lines homozygous for the morphological phenotypes and for the transgene. In the case of a homozygous nutans line, the transgenic plants had a higher 1000-grain weight than those lacking the transgene. Like mutants providing useful output traits, transgenic plants...

  10. Mismatch repair deficiency does not enhance ENU mutagenesis in the zebrafish germ line.

    Science.gov (United States)

    Feitsma, Harma; de Bruijn, Ewart; van de Belt, Jose; Nijman, Isaac J; Cuppen, Edwin

    2008-07-01

    S(N)1-type alkylating agents such as N-ethyl-N-nitrosourea (ENU) are very potent mutagens. They act by transferring their alkyl group to DNA bases, which, upon mispairing during replication, can cause single base pair mutations in the next replication cycle. As DNA mismatch repair (MMR) proteins are involved in the recognition of alkylation damage, we hypothesized that ENU-induced mutation rates could be increased in a MMR-deficient background, which would be beneficial for mutagenesis approaches. We applied a standard ENU mutagenesis protocol to adult zebrafish deficient in the MMR gene msh6 and heterozygous controls to study the effect of MMR on ENU-induced DNA damage. Dose-dependent lethality was found to be similar for homozygous and heterozygous mutants, indicating that there is no difference in ENU resistance. Mutation discovery by high-throughput dideoxy resequencing of genomic targets in outcrossed progeny of the mutagenized fish did also not reveal any differences in germ line mutation frequency. These results may indicate that the maximum mutation load for zebrafish has been reached with the currently used, highly optimized ENU mutagenesis protocol. Alternatively, the MMR system in the zebrafish germ line may be saturated very rapidly, thereby having a limited effect on high-dose ENU mutagenesis.

  11. Standardized orthotopic xenografts in zebrafish reveal glioma cell-line-specific characteristics and tumor cell heterogeneity

    Directory of Open Access Journals (Sweden)

    Alessandra M. Welker

    2016-02-01

    Full Text Available Glioblastoma (GBM is a deadly brain cancer, for which few effective drug treatments are available. Several studies have used zebrafish models to study GBM, but a standardized approach to modeling GBM in zebrafish was lacking to date, preventing comparison of data across studies. Here, we describe a new, standardized orthotopic xenotransplant model of GBM in zebrafish. Dose-response survival assays were used to define the optimal number of cells for tumor formation. Techniques to measure tumor burden and cell spread within the brain over real time were optimized using mouse neural stem cells as control transplants. Applying this standardized approach, we transplanted two patient-derived GBM cell lines, serum-grown adherent cells and neurospheres, into the midbrain region of embryonic zebrafish and analyzed transplanted larvae over time. Progressive brain tumor growth and premature larval death were observed using both cell lines; however, fewer transplanted neurosphere cells were needed for tumor growth and lethality. Tumors were heterogeneous, containing both cells expressing stem cell markers and cells expressing markers of differentiation. A small proportion of transplanted neurosphere cells expressed glial fibrillary acidic protein (GFAP or vimentin, markers of more differentiated cells, but this number increased significantly during tumor growth, indicating that these cells undergo differentiation in vivo. By contrast, most serum-grown adherent cells expressed GFAP and vimentin at the earliest times examined post-transplant. Both cell types produced brain tumors that contained Sox2+ cells, indicative of tumor stem cells. Transplanted larvae were treated with currently used GBM therapeutics, temozolomide or bortezomib, and this resulted in a reduction in tumor volume in vivo and an increase in survival. The standardized model reported here facilitates robust and reproducible analysis of glioblastoma tumor cells in real time and provides a

  12. Spatio Temporal Expression Pattern of an Insecticidal Gene (cry2A in Transgenic Cotton Lines

    Directory of Open Access Journals (Sweden)

    Allah BAKHSH

    2012-11-01

    Full Text Available The production of transgenic plants with stable, high-level transgene expression is important for the success of crop improvement programs based on genetic engineering. The present study was conducted to evaluate genomic integration and spatio temporal expression of an insecticidal gene (cry2A in pre-existing transgenic lines of cotton. Genomic integration of cry2A was evaluated using various molecular approaches. The expression levels of cry2A were determined at vegetative and reproductive stages of cotton at regular intervals. These lines showed a stable integration of insecticidal gene in advance lines of transgenic cotton whereas gene expression was found variable with at various growth stages as well as in different plant parts throughout the season. The leaves of transgenic cotton were found to have maximum expression of cry2A gene followed by squares, bolls, anthers and petals. The protein level in fruiting part was less as compared to other parts showing inconsistency in gene expression. It was concluded that for culturing of transgenic crops, strategies should be developed to ensure the foreign genes expression efficient, consistent and in a predictable manner.

  13. Line 63-1: A New Virus-resistant Transgenic Papaya

    NARCIS (Netherlands)

    Tennant, P.; Souza, M.T.; Fitch, M.M.; Manshardt, R.; Slightom, J.L.; Gonsalves, D.

    2005-01-01

    The disease resistance of a transgenic line expressing the coat protein (CP) gene of the mild strain of the papaya ringspot virus (PRSV) from Hawaii was further analyzed against PRSV isolates from Hawaii and other geographical regions. Line 63-1 originated from the same transformation experiment

  14. [Obtaining the transgenic lines of finger millet Eleusine coracana (L.) Gaertn. With dinitroaniline resistance].

    Science.gov (United States)

    Baer, G Ia; Emets, A I; Blium, Ia B

    2014-01-01

    The current data is dedicated to the study of bioballistic and Agrobacterium-mediated transformation of finger millet with the constructs carrying the mutant alpha-tubulin gene (TUAm 1), isolated from R-biotype goosegrass (Eleusine indica L.), for the decision of problem of dinitroaniline-resistance. It was found that 10 microM of trifluralin is optimal for the selection of transgene plants of finger millet. PCR analysis of transformed lines confirmed the transgene nature of plants. The analysis of seed of T1 oftransgene lines confirmed heterozygous character of inheritance of the resistance.

  15. Generation of doubled haploid transgenic wheat lines by microspore transformation.

    Directory of Open Access Journals (Sweden)

    Rhoda A T Brew-Appiah

    Full Text Available Microspores can be induced to develop homozygous doubled haploid plants in a single generation. In the present experiments androgenic microspores of wheat have been genetically transformed and developed into mature homozygous transgenic plants. Two different transformation techniques were investigated, one employing electroporation and the other co-cultivation with Agrobacterium tumefaciens. Different tissue culture and transfection conditions were tested on nine different wheat cultivars using four different constructs. A total of 19 fertile transformants in five genotypes from four market classes of common wheat were recovered by the two procedures. PCR followed by DNA sequencing of the products, Southern blot analyses and bio/histo-chemical and histological assays of the recombinant enzymes confirmed the presence of the transgenes in the T0 transformants and their stable inheritance in homozygous T1∶2 doubled haploid progenies. Several decisive factors determining the transformation and regeneration efficiency with the two procedures were determined: (i pretreatment of immature spikes with CuSO4 solution (500 mg/L at 4°C for 10 days; (ii electroporation of plasmid DNA in enlarged microspores by a single pulse of ∼375 V; (iii induction of microspores after transfection at 28°C in NPB-99 medium and regeneration at 26°C in MMS5 medium; (iv co-cultivation with Agrobacterium AGL-1 cells for transfer of plasmid T-DNA into microspores at day 0 for <24 hours; and (v elimination of AGL-1 cells after co-cultivation with timentin (200-400 mg/L.

  16. Somatic mutagenesis with a Sleeping Beauty transposon system leads to solid tumor formation in zebrafish.

    Directory of Open Access Journals (Sweden)

    Maura McGrail

    2011-04-01

    Full Text Available Large-scale sequencing of human cancer genomes and mouse transposon-induced tumors has identified a vast number of genes mutated in different cancers. One of the outstanding challenges in this field is to determine which genes, when mutated, contribute to cellular transformation and tumor progression. To identify new and conserved genes that drive tumorigenesis we have developed a novel cancer model in a distantly related vertebrate species, the zebrafish, Danio rerio. The Sleeping Beauty (SB T2/Onc transposon system was adapted for somatic mutagenesis in zebrafish. The carp ß-actin promoter was cloned into T2/Onc to create T2/OncZ. Two transgenic zebrafish lines that contain large concatemers of T2/OncZ were isolated by injection of linear DNA into the zebrafish embryo. The T2/OncZ transposons were mobilized throughout the zebrafish genome from the transgene array by injecting SB11 transposase RNA at the 1-cell stage. Alternatively, the T2/OncZ zebrafish were crossed to a transgenic line that constitutively expresses SB11 transposase. T2/OncZ transposon integration sites were cloned by ligation-mediated PCR and sequenced on a Genome Analyzer II. Between 700-6800 unique integration events in individual fish were mapped to the zebrafish genome. The data show that introduction of transposase by transgene expression or RNA injection results in an even distribution of transposon re-integration events across the zebrafish genome. SB11 mRNA injection resulted in neoplasms in 10% of adult fish at ∼10 months of age. T2/OncZ-induced zebrafish tumors contain many mutated genes in common with human and mouse cancer genes. These analyses validate our mutagenesis approach and provide additional support for the involvement of these genes in human cancers. The zebrafish T2/OncZ cancer model will be useful for identifying novel and conserved genetic drivers of human cancers.

  17. Beta-cell lines derived from transgenic mice expressing a hybrid insulin gene-oncogene

    DEFF Research Database (Denmark)

    Efrat, S; Linde, S; Kofod, Hans

    1988-01-01

    Three pancreatic beta-cell lines have been established from insulinomas derived from transgenic mice carrying a hybrid insulin-promoted simian virus 40 tumor antigen gene. The beta tumor cell (beta TC) lines maintain the features of differentiated beta cells for about 50 passages in culture. The ...... both to immortalize a rare cell type and to provide a selection for the maintenance of its differentiated phenotype....

  18. Natural bizbenzoquinoline derivatives protect zebrafish lateral line sensory hair cells from aminoglycoside toxicity

    Directory of Open Access Journals (Sweden)

    Matthew eKruger

    2016-03-01

    Full Text Available Moderate to severe hearing loss affects 360 million people worldwide and most often results from damage to sensory hair cells. Hair cell damage can result from aging, genetic mutations, excess noise exposure, and certain medications including aminoglycoside antibiotics. Aminoglycosides are effective at treating infections associated with cystic fibrosis and other life-threatening conditions such as sepsis, but cause hearing loss in 20-30% of patients. It is therefore imperative to develop new therapies to combat hearing loss and allow safe use of these potent antibiotics. We approach this drug discovery question using the larval zebrafish lateral line because zebrafish hair cells are structurally and functionally similar to mammalian inner ear hair cells and respond similarly to toxins. We screened a library of 502 natural compounds in order to identify novel hair cell protectants. Our screen identified four bisbenzylisoquinoline derivatives: berbamine, E6 berbamine, hernandezine, and isotetrandrine, each of which robustly protected hair cells from aminoglycoside-induced damage. Using fluorescence microscopy and electrophysiology, we demonstrated that the natural compounds confer protection by reducing antibiotic uptake into hair cells and showed that hair cells remain functional during and after incubation in E6 berbamine. We also determined that these natural compounds do not reduce antibiotic efficacy. Together, these natural compounds represent a novel source of possible otoprotective drugs that may offer therapeutic options for patients receiving aminoglycoside treatment.

  19. Effectiveness of hCMV, mEF1a and mAct promoters on driving of foreign gene expression in transgenic zebrafish

    Directory of Open Access Journals (Sweden)

    . Alimuddin

    2007-01-01

    Full Text Available Highly unsaturated fatty acids (HUFA, especially eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA have long been recognized for its beneficial effect for human health and development.   The D6 fatty acid desaturase is generally considered to be the rate-limiting factor in HUFA biosynthesis.  Here, as the first step of study, we conducted experiment to select an appropriate construct that allows higher expression levels of masu salmon (Oncorhynchus masou D6-desaturase gene in zebrafish (Danio rerio in order to increase its activity for synthesizing EPA/DHA.  Salmon D6-desaturase cDNA (sD6 was separately ligated with human cytomegalovirus (hCMV, medaka elongation factor 1a (mEF1a and medaka b-actin (mAct promoters.  The resulted construct was designated as hCMV-sD6, mEF1a-sD6 and mAct-sD6, respectively.  Each of the constructs in circular DNA form was microinjected into 1-cell stage embryos at a concentration of 30mg/ml. Transgenic individuals were identified by polymerase chain reaction (PCR and their expression levels were analyzed by reverse transcription PCR.  The first (F1 and second (F2 generation was produced by crossing the transgenic founder F0 and F1, respectively, with wild-type fish.  The results showed that the highest transient gene expression level was obtained from the mAct-D6 construct, followed respectively by EF1a-D6 and hCMV-D6 construct. The transmission rate of transgene into F1 generation was 4.2%-44.1%, and into F2 was followed the Mendellian segregation pattern.   Expression of transgene in F2 generation was varied between strains regarding as the mosaics of F0 fish.  Now, a transgenic system to study the modification of fatty acid biosynthesis pathways in fish was established.  Further investigations are to produce fish containing higher levels of EPA and DHA. Keywords: desaturase, nutraceutical fatty acid, transgenic, zebrafish, masu salmon   Abstrak Promoter merupakan regulator yang menentukan

  20. Transgenic fluorescent zebrafish Tg(fli1:EGFP)y¹ for the identification of vasotoxicity within the zFET.

    Science.gov (United States)

    Delov, Vera; Muth-Köhne, Elke; Schäfers, Christoph; Fenske, Martina

    2014-05-01

    The fish embryo toxicity test (FET) is currently one of the most advocated animal alternative tests in ecotoxicology. To date, the application of the FET with zebrafish (zFET) has focused on acute toxicity assessment, where only lethal morphological effects are accounted for. An application of the zFET beyond acute toxicity, however, necessitates the establishment of more refined and quantifiable toxicological endpoints. A valuable tool in this context is the use of gene expression-dependent fluorescent markers that can even be measured in vivo. We investigated the application of embryos of Tg(fli1:EGFP)(y1) for the identification of vasotoxic substances within the zFET. Tg(fli1:EGFP)(y1) fish express enhanced GFP in the entire vasculature under the control of the fli1 promoter, and thus enable the visualization of vascular defects in live zebrafish embryos. We assessed the fli1 driven EGFP-expression in the intersegmental blood vessels (ISVs) qualitatively and quantitatively, and found an exposure concentration related increase in vascular damage for chemicals like triclosan, cartap and genistein. The fluorescence endpoint ISV-length allowed an earlier and more sensitive detection of vasotoxins than the bright field assessment method. In combination with the standard bright field morphological effect assessment, an increase in significance and value of the zFET for a mechanism-specific toxicity evaluation was achieved. This study highlights the benefits of using transgenic zebrafish as convenient tools for identifying toxicity in vivo and to increase sensitivity and specificity of the zFET. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. FLAX OIL FROM TRANSGENIC LINUM USITATISSIMUM SELECTIVELY INHIBITS IN VITRO PROLIFERATION OF HUMAN CANCER CELL LINES.

    Science.gov (United States)

    Gebarowski, Tomasz; Gebczak, Katarzyna; Wiatrak, Benita; Kulma, Anna; Pelc, Katarzyna; Czuj, Tadeusz; Szopa, Jan; Gasiorowski, Kazimierz

    2017-03-01

    Emulsions made of oils from transgenic flaxseeds significantly decreased in vitro proliferation of six tested human cancer cell lines in 48-h cultures, as assessed with the standard sulforhodamine assay. However, the emulsions also increased proliferation rate of normal human dermal fibroblasts and, to a lower extend, of keratinocytes. Both inhibition of in vitro proliferation of human cancer cell lines and stimulation of proliferation of normal dermal fibroblasts and keratinocytes were especially strong with the emulsion type B and with emulsion type M. Oils from seeds of transgenic flax type B and M should be considered as valuable adjunct to standard cytostatic therapy of human cancers and also could be applied to improve the treatment of skin lesions in wound healing.

  2. RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

    International Nuclear Information System (INIS)

    Wang Tiegu; Huang Qunce; Feng Weisen

    2007-01-01

    Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning

  3. RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

    Science.gov (United States)

    Wang, Tiegu; Huang, Qunce; Feng, Weisen

    2007-10-01

    Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.

  4. RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

    Energy Technology Data Exchange (ETDEWEB)

    Tiegu, Wang [Henan Provincial Key Laboratory of Ion Beam Bio-Engineering, Zhengzhou University, Zhengzhou 450052 (China); Qunce, Huang [Henan Provincial Key Laboratory of Ion Beam Bio-Engineering, Zhengzhou University, Zhengzhou 450052 (China); Weisen, Feng [Luoyang Institute of Agricultural Science, Luoyang 471022 (China)

    2007-10-15

    Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.

  5. Evaluation of the agronomic performance of atrazine-tolerant transgenic japonica rice parental lines for utilization in hybrid seed production.

    Directory of Open Access Journals (Sweden)

    Luhua Zhang

    Full Text Available Currently, the purity of hybrid seed is a crucial limiting factor when developing hybrid japonica rice (Oryza sativa L.. To chemically control hybrid seed purity, we transferred an improved atrazine chlorohydrolase gene (atzA from Pseudomonas ADP into hybrid japonica parental lines (two maintainers, one restorer, and Nipponbare, by using Agrobacterium-mediated transformation. We subsequently selected several transgenic lines from each genotype by using PCR, RT-PCR, and germination analysis. In the presence of the investigated atrazine concentrations, particularly 150 µM atrazine, almost all of the transgenic lines produced significantly larger seedlings, with similar or higher germination percentages, than did the respective controls. Although the seedlings of transgenic lines were taller and gained more root biomass compared to the respective control plants, their growth was nevertheless inhibited by atrazine treatment compared to that without treatment. When grown in soil containing 2 mg/kg or 5 mg/kg atrazine, the transgenic lines were taller, and had higher total chlorophyll contents than did the respective controls; moreover, three of the strongest transgenic lines completely recovered after 45 days of growth. After treatment with 2 mg/kg or 5 mg/kg of atrazine, the atrazine residue remaining in the soil was 2.9-7.0% or 0.8-8.7% respectively, for transgenic lines, and 44.0-59.2% or 28.1-30.8%, respectively, for control plants. Spraying plants at the vegetative growth stage with 0.15% atrazine effectively killed control plants, but not transgenic lines. Our results indicate that transgenic atzA rice plants show tolerance to atrazine, and may be used as parental lines in future hybrid seed production.

  6. Characterization of gastric adenocarcinoma cell lines established from CEA424/SV40 T antigen-transgenic mice with or without a human CEA transgene

    International Nuclear Information System (INIS)

    Nöckel, Jessica; Engel, Natasja K van den; Winter, Hauke; Hatz, Rudolf A; Zimmermann, Wolfgang; Kammerer, Robert

    2006-01-01

    Gastric carcinoma is one of the most frequent cancers worldwide. Patients with gastric cancer at an advanced disease stage have a poor prognosis, due to the limited efficacy of available therapies. Therefore, the development of new therapies, like immunotherapy for the treatment of gastric cancer is of utmost importance. Since the usability of existing preclinical models for the evaluation of immunotherapies for gastric adenocarcinomas is limited, the goal of the present study was to establish murine in vivo models which allow the stepwise improvement of immunotherapies for gastric cancer. Since no murine gastric adenocarcinoma cell lines are available we established four cell lines (424GC, mGC3, mGC5, mGC8) from spontaneously developing tumors of CEA424/SV40 T antigen (CEA424/Tag) mice and three cell lines derived from double-transgenic offsprings of CEA424/Tag mice mated with human carcinoembryonic antigen (CEA)-transgenic (CEA424/Tag-CEA) mice (mGC2 CEA , mGC4 CEA , mGC11 CEA ). CEA424/Tag is a transgenic C57BL/6 mouse strain harboring the Tag under the control of a -424/-8 bp CEA gene promoter which leads to the development of invasive adenocarcinoma in the glandular stomach. Tumor cell lines established from CEA424/Tag-CEA mice express the well defined tumor antigen CEA under the control of its natural regulatory elements. The epithelial origin of the tumor cells was proven by morphological criteria including the presence of mucin within the cells and the expression of the cell adhesion molecules EpCAM and CEACAM1. All cell lines consistently express the transgenes CEA and/or Tag and MHC class I molecules leading to their susceptibility to lysis by Tag-specific CTL in vitro. Despite the presentation of CTL-epitopes derived from the transgene products the tumor cell lines were tumorigenic when grafted into C57BL/6, CEA424/Tag or CEA424/Tag-CEA-transgenic hosts and no significant differences in tumor take and tumor growth were observed in the different hosts

  7. Effect-directed analysis for estrogenic compounds in a fluvial sediment sample using transgenic cyp19a1b-GFP zebrafish embryos.

    Science.gov (United States)

    Fetter, Eva; Krauss, Martin; Brion, François; Kah, Olivier; Scholz, Stefan; Brack, Werner

    2014-09-01

    Xenoestrogens may persist in the environment by binding to sediments or suspended particulate matter serving as long-term reservoir and source of exposure, particularly for organisms living in or in contact with sediments. In this study, we present for the first time an effect-directed analysis (EDA) for identifying estrogenic compounds in a sediment sample using embryos of a transgenic reporter fish strain. In the tg(cyp19a1b-GFP) transgenic zebrafish strain, the expression of GFP (green fluorescent protein) in the brain is driven by an oestrogen responsive element in the promoter of the cyp19a1b (aromatase) gene. The selected sediment sample of the Czech river Bilina had already been analysed in a previous EDA using the yeast oestrogen screening assay and had revealed fractions containing estrogenic compounds. When normal phase HPLC (high performance liquid chromatography) fractionation was used for the separation of the sediment sample, the biotest with transgenic fish embryos revealed two estrogenic fractions. Chemical analysis of candidate compounds in these sediment fractions suggested alkylphenols and estrone as candidate compounds responsible for the observed estrogenic effect. Alkylphenol concentrations could partially explain the estrogenicity of the fractions. However, xenoestrogens below the analytical detection limit or non-targeted estrogenic compounds have probably also contributed to the sample's estrogenic potency. The results indicated the suitability of the tg(cyp19a1b-GFP) fish embryo for an integrated chemical-biological analysis of estrogenic effects. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Cyp1a reporter zebrafish reveals target tissues for dioxin

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kun-Hee [Department of Biomedical Sciences, Chonnam National University Medical School, Gwangju (Korea, Republic of); Department of Microbiology, Chonnam National University Medical School, Gwangju (Korea, Republic of); Park, Hye-Jeong [Department of Biomedical Sciences, Chonnam National University Medical School, Gwangju (Korea, Republic of); Kim, Jin Hee [Department of Biomedical Sciences, Chonnam National University Medical School, Gwangju (Korea, Republic of); Department of Microbiology, Chonnam National University Medical School, Gwangju (Korea, Republic of); Kim, Suhyun [Graduate School of Medicine, Korea University, Ansan (Korea, Republic of); Williams, Darren R. [New Drug Targets Laboratory, School of Life Sciences, Gwangju Institute of Science and Technology, Gwangju (Korea, Republic of); Kim, Myeong-Kyu [Department of Neurology, Chonnam National University Medical School, Gwangju (Korea, Republic of); Jung, Young Do [Department of Biochemistry, Chonnam National University Medical School, Gwangju (Korea, Republic of); Teraoka, Hiroki [School of Veterinary Medicine, Rakuno Gakuen University, Ebetsu (Japan); Park, Hae-Chul [Graduate School of Medicine, Korea University, Ansan (Korea, Republic of); Choy, Hyon E., E-mail: hyonchoy@chonnam.ac.kr [Department of Microbiology, Chonnam National University Medical School, Gwangju (Korea, Republic of); Shin, Boo Ahn, E-mail: bashin@chonnam.ac.kr [Department of Microbiology, Chonnam National University Medical School, Gwangju (Korea, Republic of); Choi, Seok-Yong, E-mail: zebrafish@chonnam.ac.kr [Department of Biomedical Sciences, Chonnam National University Medical School, Gwangju (Korea, Republic of); School of Biological Sciences and Technology, Chonnam National University, Gwangju (Korea, Republic of)

    2013-06-15

    Highlights: •2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is the most toxic anthropogenic substance ever identified. •Transgenic cyp1a reporter zebrafish reveals target tissues for TCDD. •The retinal bipolar cells, otic vesicle, lateral line, pancreas, cloaca and pectoral fin bud are novel targets in zebrafish for TCDD. •Our findings will further understanding of human health risks by TCDD. -- Abstract: 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is the unintentional byproduct of various industrial processes, is classified as human carcinogen and could disrupt reproductive, developmental and endocrine systems. Induction of cyp1a1 is used as an indicator of TCDD exposure. We sought to determine tissues that are vulnerable to TCDD toxicity using a transgenic zebrafish (Danio rerio) model. We inserted a nuclear enhanced green fluorescent protein gene (EGFP) into the start codon of a zebrafish cyp1a gene in a fosmid clone using DNA recombineering. The resulting recombineered fosmid was then used to generate cyp1a reporter zebrafish, embryos of which were exposed to TCDD. Expression pattern of EGFP in the reporter zebrafish mirrored that of endogenous cyp1a mRNA. In addition, exposure of the embryos to TCDD at as low as 10 pM for 72 h, which does not elicit morphological abnormalities of embryos, markedly increased GFP expression. Furthermore, the reporter embryos responded to other AhR ligands as well. Exposure of the embryos to TCDD revealed previously reported (the cardiovascular system, liver, pancreas, kidney, swim bladder and skin) and unreported target tissues (retinal bipolar cells, otic vesicle, lateral line, cloaca and pectoral fin bud) for TCDD. Transgenic cyp1a reporter zebrafish we have developed can further understanding of ecotoxicological relevance and human health risks by TCDD. In addition, they could be used to identify agonists of AhR and antidotes to TCDD toxicity.

  9. Inheritance and effectiveness of two transgenes determining PVY resistance in progeny from crossing independently transformed tobacco lines.

    Science.gov (United States)

    Czubacka, Anna; Sacco, Ermanno; Olszak-Przybyś, Hanna; Doroszewska, Teresa

    2017-05-01

    Genetic transformation of plants allows us to obtain improved genotypes enriched with the desired traits. However, if transgenic lines were to be used in breeding programs the stability of inserted transgenes is essential. In the present study, we followed the inheritance of transgenes in hybrids originated from crossing two transgenic tobacco lines resistant to Potato virus Y (PVY): MN 944 LMV with the transgene containing Lettuce mosaic virus coat protein gene (LMV CP) and AC Gayed ROKY2 with PVY replicase gene (ROKY2). Progeny populations generated by successive self-pollination were analyzed with respect to the transgene segregation ratio and resistance to Potato virus Y in tests carried out under greenhouse conditions. The presence of the virus in inoculated plants was detected by DAS-ELISA method. The results demonstrated the Mendelian fashion of inheritance of transgenes which were segregated independently and stably. As a result, we obtained T 4 generation of hybrid with both transgenes stacked and which was highly resistant to PVY.

  10. Differences in toxicity of anionic and cationic PAMAM and PPI dendrimers in zebrafish embryos and cancer cell lines

    International Nuclear Information System (INIS)

    Bodewein, Lambert; Schmelter, Frank; Di Fiore, Stefano; Hollert, Henner; Fischer, Rainer; Fenske, Martina

    2016-01-01

    Dendrimers are an emerging class of polymeric nanoparticles with beneficial biomedical applications like early diagnostics, in vitro gene transfection or controlled drug delivery. However, the potential toxic impact of exposure on human health or the environment is often inadequately defined. Thus, polyamidoamine (PAMAM) dendrimers of generations G3.0, 3.5, 4.0, 4.5 and 5.0 and polypropylenimine (PPI) dendrimers G3.0, 4.0 and 5.0 were tested in zebrafish embryos for 96 h and human cancer cell lines for 24 h, to assess and compare developmental in vivo toxicity with cytotoxicity. The zebrafish embryo toxicity of cationic PAMAM and PPI dendrimers increased over time, with EC50 values ranging from 0.16 to just below 1.7 μM at 24 and 48 hpf. The predominant effects were mortality, plus reduced heartbeat and blood circulation for PPI dendrimers. Apoptosis in the embryos increased in line with the general toxicity concentration-dependently. Hatch and dechorionation of the embryos increased the toxicity, suggesting a protective role of the chorion. Lower generation dendrimers were more toxic in the embryos whereas the toxicity in the HepG2 and DU145 cell lines increased with increasing generation of cationic PAMAMs and PPI dendrimers. HepG2 were less sensitive than DU145 cells, with IC50 values ≥ 402 μM (PAMAMs) and ≤ 240 μM (PPIs) for HepG2 and ≤ 13.24 μM (PAMAMs) and ≤ 12.84 μM (PPIs) for DU145. Neither in fish embryos nor cells toxicity thresholds were determinable for anionic PAMAM G3.5 and G4.5. The study demonstrated that the cytotoxicity underestimated the in-vivo toxicity of the dendrimers in the fish embryos. - Highlights: • Zebrafish embryo toxicity of cationic PAMAM and PPI dendrimers increased over time. • Zebrafish embryo toxicity of cationic dendrimers did not increase with generation. • Cationic dendrimers induced apoptosis in zebrafish embryos. • Toxicity of cationic dendrimers was lower in HepG2 and DU145 than zebrafish embryos.

  11. Differences in toxicity of anionic and cationic PAMAM and PPI dendrimers in zebrafish embryos and cancer cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Bodewein, Lambert [Fraunhofer Institute for Molecular Biology and Applied Ecology IME, Project Group Translational Medicine and Pharmacology, Frankfurt & Aachen (Germany); Institute of Environmental Research (Biology V), RWTH Aachen University (Germany); Schmelter, Frank; Di Fiore, Stefano [Fraunhofer Institute for Molecular Biology and Applied Ecology IME, Molecular Biology Division, Aachen (Germany); Hollert, Henner [Institute of Environmental Research (Biology V), RWTH Aachen University (Germany); Fischer, Rainer [Fraunhofer Institute for Molecular Biology and Applied Ecology IME, Project Group Translational Medicine and Pharmacology, Frankfurt & Aachen (Germany); Fraunhofer Institute for Molecular Biology and Applied Ecology IME, Molecular Biology Division, Aachen (Germany); Fenske, Martina, E-mail: martina.fenske@ime.fraunhofer.de [Fraunhofer Institute for Molecular Biology and Applied Ecology IME, Project Group Translational Medicine and Pharmacology, Frankfurt & Aachen (Germany)

    2016-08-15

    Dendrimers are an emerging class of polymeric nanoparticles with beneficial biomedical applications like early diagnostics, in vitro gene transfection or controlled drug delivery. However, the potential toxic impact of exposure on human health or the environment is often inadequately defined. Thus, polyamidoamine (PAMAM) dendrimers of generations G3.0, 3.5, 4.0, 4.5 and 5.0 and polypropylenimine (PPI) dendrimers G3.0, 4.0 and 5.0 were tested in zebrafish embryos for 96 h and human cancer cell lines for 24 h, to assess and compare developmental in vivo toxicity with cytotoxicity. The zebrafish embryo toxicity of cationic PAMAM and PPI dendrimers increased over time, with EC50 values ranging from 0.16 to just below 1.7 μM at 24 and 48 hpf. The predominant effects were mortality, plus reduced heartbeat and blood circulation for PPI dendrimers. Apoptosis in the embryos increased in line with the general toxicity concentration-dependently. Hatch and dechorionation of the embryos increased the toxicity, suggesting a protective role of the chorion. Lower generation dendrimers were more toxic in the embryos whereas the toxicity in the HepG2 and DU145 cell lines increased with increasing generation of cationic PAMAMs and PPI dendrimers. HepG2 were less sensitive than DU145 cells, with IC50 values ≥ 402 μM (PAMAMs) and ≤ 240 μM (PPIs) for HepG2 and ≤ 13.24 μM (PAMAMs) and ≤ 12.84 μM (PPIs) for DU145. Neither in fish embryos nor cells toxicity thresholds were determinable for anionic PAMAM G3.5 and G4.5. The study demonstrated that the cytotoxicity underestimated the in-vivo toxicity of the dendrimers in the fish embryos. - Highlights: • Zebrafish embryo toxicity of cationic PAMAM and PPI dendrimers increased over time. • Zebrafish embryo toxicity of cationic dendrimers did not increase with generation. • Cationic dendrimers induced apoptosis in zebrafish embryos. • Toxicity of cationic dendrimers was lower in HepG2 and DU145 than zebrafish embryos.

  12. GENETIC TRANSFORMATION AND ANALYSIS OF WHEAT TRANSGENIC CELL LINES BY IRAP-PCR

    Directory of Open Access Journals (Sweden)

    Bavol A. V.

    2013-12-01

    Full Text Available The transgenic wheat cell lines were obtained via biolistic transformation of the callus cultures initiated from the 3-day-old sterile seedling shoot apexes. The pAHC25 vector construction used for 14- and 28-day-old callus cultures transformation carried the selective phosphinothricin-N-acetyltransferase (bar gene and reporter ?-glucuronidase gene. The cell line selection was carried out on the media with phosphinothricin by means of graduated cell selection. The transgenic status of the obtained forms was proved by PCR-analysis. The presence of new relatively high molecular (more than 1 000 bp amplicons were found out for three transformed lines by means of IRAP PCRanalysis with the primers coding for long termainal repeats sequences of SIRE 1 retrotransposon. This fact may prove transposition of this mobile genetic element. The new DNA fragments were detected for three of the seven analyzed lines but for the control callus. It is possible to assume at induction of SIRE 1 transposition bis probably caused by the genomic stress of foreign DNA inserting or associated with the transformation process (mechanical wounding, cultivation on selective media.

  13. Establishment of a pig fibroblast-derived cell line for locus-directed transgene expression in cell cultures and blastocysts

    DEFF Research Database (Denmark)

    Jakobsen, Jannik E; Li, Juan; Moldt, Brian

    2011-01-01

    We report the establishment of a spontaneously immortalized pig cell line designated Pig Flip-in Visualize (PFV) for locus-directed transgene expression in pig cells and blastocysts. The PFV cell line was isolated from pig ear fibroblasts transfected with a Sleeping Beauty DNA transposon-based do......We report the establishment of a spontaneously immortalized pig cell line designated Pig Flip-in Visualize (PFV) for locus-directed transgene expression in pig cells and blastocysts. The PFV cell line was isolated from pig ear fibroblasts transfected with a Sleeping Beauty DNA transposon...

  14. Development of transgenic Brassica juncea lines for reduced seed sinapine content by perturbing phenylpropanoid pathway genes.

    Directory of Open Access Journals (Sweden)

    Sachin Kajla

    Full Text Available Sinapine is a major anti-nutritive compound that accumulates in the seeds of Brassica species. When ingested, sinapine imparts gritty flavuor in meat and milk of animals and fishy odor to eggs of brown egg layers, thereby compromising the potential use of the valuable protein rich seed meal. Sinapine content in Brassica juncea germplasm ranges from 6.7 to 15.1 mg/g of dry seed weight (DSW which is significantly higher than the prescribed permissible level of 3.0 mg/g of DSW. Due to limited natural genetic variability, conventional plant breeding approach for reducing the sinapine content has largely been unsuccessful. Hence, transgenic approach for gene silencing was adopted by targeting two genes-SGT and SCT, encoding enzymes UDP- glucose: sinapate glucosyltransferase and sinapoylglucose: choline sinapoyltransferase, respectively, involved in the final two steps of sinapine biosynthetic pathway. These two genes were isolated from B. juncea and eight silencing constructs were developed using three different RNA silencing approaches viz. antisense RNA, RNAi and artificial microRNA. Transgenics in B. juncea were developed following Agrobacterium-mediated transformation. From a total of 1232 independent T0 transgenic events obtained using eight silencing constructs, 25 homozygous lines showing single gene inheritance were identified in the T2 generation. Reduction of seed sinapine content in these lines ranged from 15.8% to 67.2%; the line with maximum reduction had sinapine content of 3.79 mg/g of DSW. The study also revealed that RNAi method was more efficient than the other two methods used in this study.

  15. The Macrophage-Specific Promoter mfap4 Allows Live, Long-Term Analysis of Macrophage Behavior during Mycobacterial Infection in Zebrafish.

    Directory of Open Access Journals (Sweden)

    Eric M Walton

    Full Text Available Transgenic labeling of innate immune cell lineages within the larval zebrafish allows for real-time, in vivo analyses of microbial pathogenesis within a vertebrate host. To date, labeling of zebrafish macrophages has been relatively limited, with the most specific expression coming from the mpeg1 promoter. However, mpeg1 transcription at both endogenous and transgenic loci becomes attenuated in the presence of intracellular pathogens, including Salmonella typhimurium and Mycobacterium marinum. Here, we describe mfap4 as a macrophage-specific promoter capable of producing transgenic lines in which transgene expression within larval macrophages remains stable throughout several days of infection. Additionally, we have developed a novel macrophage-specific Cre transgenic line under the control of mfap4, enabling macrophage-specific expression using existing floxed transgenic lines. These tools enrich the repertoire of transgenic lines and promoters available for studying zebrafish macrophage dynamics during infection and inflammation and add flexibility to the design of future macrophage-specific transgenic lines.

  16. Transgenic Xenopus laevis Line for In Vivo Labeling of Nephrons within the Kidney

    Directory of Open Access Journals (Sweden)

    Mark E. Corkins

    2018-04-01

    Full Text Available Xenopus laevis embryos are an established model for studying kidney development. The nephron structure and genetic pathways that regulate nephrogenesis are conserved between Xenopus and humans, allowing for the study of human disease-causing genes. Xenopus embryos are also amenable to large-scale screening, but studies of kidney disease-related genes have been impeded because assessment of kidney development has largely been limited to examining fixed embryos. To overcome this problem, we have generated a transgenic line that labels the kidney. We characterize this cdh17:eGFP line, showing green fluorescent protein (GFP expression in the pronephric and mesonephric kidneys and colocalization with known kidney markers. We also demonstrate the feasibility of live imaging of embryonic kidney development and the use of cdh17:eGFP as a kidney marker for secretion assays. Additionally, we develop a new methodology to isolate and identify kidney cells for primary culture. We also use morpholino knockdown of essential kidney development genes to establish that GFP expression enables observation of phenotypes, previously only described in fixed embryos. Taken together, this transgenic line will enable primary kidney cell culture and live imaging of pronephric and mesonephric kidney development. It will also provide a simple means for high-throughput screening of putative human kidney disease-causing genes.

  17. Transgenic mice produced by retroviral transduction of male germ-line stem cells

    OpenAIRE

    Nagano, Makoto; Brinster, Clayton J.; Orwig, Kyle E.; Ryu, Buom-Yong; Avarbock, Mary R.; Brinster, Ralph L.

    2001-01-01

    Male germ-line stem cells are the only cell type in postnatal mammals that have the capability to self-renew and to contribute genes to the next generation. Genetic modification of these cells would provide an opportunity to study the biology of their complex self-renewal and differentiation processes, as well as enable the generation of transgenic animals in a wide range of species. Although retroviral vectors have been used as an efficient method to introduce genes into a variety of cell ty...

  18. A characterization of the ZFL cell line and primary hepatocytes as in vitro liver cell models for the zebrafish (Danio rerio)

    International Nuclear Information System (INIS)

    Eide, Marta; Rusten, Marte; Male, Rune; Jensen, Knut Helge Midtbø; Goksøyr, Anders

    2014-01-01

    Highlights: •The ZFL cell line and primary hepatocytes were characterized. •Basic and induced expression of nuclear receptors and target genes were found. •The ZFL cell line expresses very low basic levels of most genes. •The ZFL cells have low induction of gene expression following exposures. •Primary hepatocytes show large sex-dependent differences in gene expression. -- Abstract: The zebrafish (Danio rerio) is a widely used model species in biomedical research. The ZFL cell line, established from zebrafish liver, and freshly isolated primary hepatocytes from zebrafish have been used in several toxicological studies. However, no previous report has compared and characterized these two systems at the level of gene expression. The aim of this study was to evaluate the ZFL cell line in comparison to primary hepatocytes as in vitro models for studying effects of environmental contaminants in zebrafish liver. Using quantitative real-time PCR, the basal level and transcriptional induction potential of key genes involved in toxic responses in the ZFL cell line, primary hepatocytes and whole liver from zebrafish were compared. The study showed that the ZFL cells have lower levels of mRNA of most selected genes compared to zebrafish liver. The induced gene transcription following exposure to ligand was much lower in ZFL cells compared to zebrafish primary hepatocytes at the doses tested. Importantly, oestrogen receptor and vitellogenin genes showed low basal transcription and no induction response in the ZFL cell line. In conclusion, it appears that primary hepatocytes are well suited for studying environmental contaminants including xenoestrogens, but may show large sex-dependent differences in gene transcription. The ZFL cell line shows potential in toxicological studies involving the aryl hydrocarbon receptor pathway. However, low potential for transcriptional induction of genes in general should be expected, especially notable when studying estrogenic

  19. A characterization of the ZFL cell line and primary hepatocytes as in vitro liver cell models for the zebrafish (Danio rerio)

    Energy Technology Data Exchange (ETDEWEB)

    Eide, Marta, E-mail: marta.eide@bio.uib.no [Department of Biology, University of Bergen, Bergen (Norway); Rusten, Marte; Male, Rune [Department of Molecular Biology, University of Bergen, Bergen (Norway); Jensen, Knut Helge Midtbø; Goksøyr, Anders [Department of Biology, University of Bergen, Bergen (Norway)

    2014-02-15

    Highlights: •The ZFL cell line and primary hepatocytes were characterized. •Basic and induced expression of nuclear receptors and target genes were found. •The ZFL cell line expresses very low basic levels of most genes. •The ZFL cells have low induction of gene expression following exposures. •Primary hepatocytes show large sex-dependent differences in gene expression. -- Abstract: The zebrafish (Danio rerio) is a widely used model species in biomedical research. The ZFL cell line, established from zebrafish liver, and freshly isolated primary hepatocytes from zebrafish have been used in several toxicological studies. However, no previous report has compared and characterized these two systems at the level of gene expression. The aim of this study was to evaluate the ZFL cell line in comparison to primary hepatocytes as in vitro models for studying effects of environmental contaminants in zebrafish liver. Using quantitative real-time PCR, the basal level and transcriptional induction potential of key genes involved in toxic responses in the ZFL cell line, primary hepatocytes and whole liver from zebrafish were compared. The study showed that the ZFL cells have lower levels of mRNA of most selected genes compared to zebrafish liver. The induced gene transcription following exposure to ligand was much lower in ZFL cells compared to zebrafish primary hepatocytes at the doses tested. Importantly, oestrogen receptor and vitellogenin genes showed low basal transcription and no induction response in the ZFL cell line. In conclusion, it appears that primary hepatocytes are well suited for studying environmental contaminants including xenoestrogens, but may show large sex-dependent differences in gene transcription. The ZFL cell line shows potential in toxicological studies involving the aryl hydrocarbon receptor pathway. However, low potential for transcriptional induction of genes in general should be expected, especially notable when studying estrogenic

  20. A human beta cell line with drug inducible excision of immortalizing transgenes

    Science.gov (United States)

    Benazra, Marion; Lecomte, Marie-José; Colace, Claire; Müller, Andreas; Machado, Cécile; Pechberty, Severine; Bricout-Neveu, Emilie; Grenier-Godard, Maud; Solimena, Michele; Scharfmann, Raphaël; Czernichow, Paul; Ravassard, Philippe

    2015-01-01

    Objectives Access to immortalized human pancreatic beta cell lines that are phenotypically close to genuine adult beta cells, represent a major tool to better understand human beta cell physiology and develop new therapeutics for Diabetes. Here we derived a new conditionally immortalized human beta cell line, EndoC-βH3 in which immortalizing transgene can be efficiently removed by simple addition of tamoxifen. Methods We used lentiviral mediated gene transfer to stably integrate a tamoxifen inducible form of CRE (CRE-ERT2) into the recently developed conditionally immortalized EndoC βH2 line. The resulting EndoC-βH3 line was characterized before and after tamoxifen treatment for cell proliferation, insulin content and insulin secretion. Results We showed that EndoC-βH3 expressing CRE-ERT2 can be massively amplified in culture. We established an optimized tamoxifen treatment to efficiently excise the immortalizing transgenes resulting in proliferation arrest. In addition, insulin expression raised by 12 fold and insulin content increased by 23 fold reaching 2 μg of insulin per million cells. Such massive increase was accompanied by enhanced insulin secretion upon glucose stimulation. We further observed that tamoxifen treated cells maintained a stable function for 5 weeks in culture. Conclusions EndoC βH3 cell line represents a powerful tool that allows, using a simple and efficient procedure, the massive production of functional non-proliferative human beta cells. Such cells are close to genuine human beta cells and maintain a stable phenotype for 5 weeks in culture. PMID:26909308

  1. A comparative study on pathological features of transgenic rat lines expressing either three or four repeat misfolded tau.

    Science.gov (United States)

    Valachova, Bernadeta; Brezovakova, Veronika; Bugos, Ondrej; Jadhav, Santosh; Smolek, Tomas; Novak, Petr; Zilka, Norbert

    2018-08-01

    Human tauopathies represent a heterogeneous group of neurodegenerative disorders characterized by distinct clinical features, typical histopathological structures, and defined ratio(s) of three-repeat and four-repeat tau isoforms within pathological aggregates. How the optional microtubule-binding repeat of tau influences this differentiation of pathologies is understudied. We have previously generated and characterized transgenic rodent models expressing human truncated tau aa151-391 with either three (SHR24) or four microtubule-binding repeats (SHR72). Here, we compare the behavioral and neuropathological hallmarks of these two transgenic lines using a battery of tests for sensorimotor, cognitive, and neurological functions over the age range of 3.5-15 months. Progression of sensorimotor and neurological deficits was similar in both transgenic lines; however, the lifespan of transgenic line SHR72 expressing truncated four-repeat tau was markedly shorter than SHR24. Moreover, the expression of three or four-repeat tau induced distinct neurofibrillary pathology in these lines. Transgenic lines displayed different distribution of tau pathology and different type of neurofibrillary tangles. Our results suggest that three- and four-repeat isoforms of tau may display different modes of action in the diseased brain. © 2018 Wiley Periodicals, Inc.

  2. Effect of histone deacetylase inhibitors trichostatin A and valproic acid on hair cell regeneration in zebrafish lateral line neuromasts

    Science.gov (United States)

    He, Yingzi; Cai, Chengfu; Tang, Dongmei; Sun, Shan; Li, Huawei

    2014-01-01

    In humans, auditory hair cells are not replaced when injured. Thus, cochlear hair cell loss causes progressive and permanent hearing loss. Conversely, non-mammalian vertebrates are capable of regenerating lost sensory hair cells. The zebrafish lateral line has numerous qualities that make it well-suited for studying hair cell development and regeneration. Histone deacetylase (HDAC) activity has been shown to have an important role in regenerative processes in vertebrates, but its function in hair cell regeneration in vivo is not fully understood. Here, we have examined the role of HDAC activity in hair cell regeneration in the zebrafish lateral line. We eliminated lateral line hair cells of 5-day post-fertilization larvae using neomycin and then treated the larvae with HDAC inhibitors. To assess hair cell regeneration, we used 5-bromo-2-deoxyuridine (BrdU) incorporation in zebrafish larvae to label mitotic cells after hair cell loss. We found that pharmacological inhibition of HDACs using trichostatin A (TSA) or valproic acid (VPA) increased histone acetylation in the regenerated neuromasts following neomycin-induced damage. We also showed that treatment with TSA or VPA decreased the number of supporting cells and regenerated hair cells in response to hair cell damage. Additionally, BrdU immunostaining and western blot analysis showed that TSA or VPA treatment caused a significant decrease in the percentage of S-phase cells and induced p21Cip1 and p27Kip1 expression, both of which are likely to explain the decrease in the amount of newly regenerated hair cells in treated embryos. Finally, we showed that HDAC inhibitors induced no observable cell death in neuromasts as measured by cleaved caspase-3 immunohistochemistry and western blot analysis. Taken together, our results demonstrate that HDAC activity has an important role in the regeneration of hair cells in the lateral line. PMID:25431550

  3. Effect of histone deacetylase inhibitors trichostatin A and valproic acid on hair cell regeneration in zebrafish lateral line neuromasts

    Directory of Open Access Journals (Sweden)

    Yingzi eHe

    2014-11-01

    Full Text Available In humans, auditory hair cells are not replaced when injured. Thus, cochlear hair cell loss causes progressive and permanent hearing loss. Conversely, nonmammalian vertebrates are capable of regenerating lost sensory hair cells. The zebrafish lateral line has numerous qualities that make it well suited for studying hair cell development and regeneration. Histone deacetylase (HDAC activity has been shown to have an important role in regenerative processes in vertebrates, but its function in hair cell regeneration in vivo is not fully understood. Here, we have examined the role of HDAC activity in hair cell regeneration in the zebrafish lateral line. We eliminated lateral line hair cells of 5-day post-fertilization larvae using neomycin and then treated the larvae with HDAC inhibitors. To assess hair cell regeneration, we used 5-bromo-2-deoxyuridine (BrdU incorporation in zebrafish larvae to label mitotic cells after hair cell loss. We found that pharmacological inhibition of HDACs using trichostatin A (TSA or valproic acid (VPA increased histone acetylation in the regenerated neuromasts following neomycin-induced damage. We also showed that treatment with TSA or VPA decreased the number of supporting cells and regenerated hair cells in response to hair cell damage. Additionally, BrdU immunostaining and western blot analysis showed that TSA or VPA treatment caused a significant decrease in the percentage of S-phase cells and induced p21Cip1 and p27Kip1 expression, both of which are likely to explain the decrease in the amount of newly regenerated hair cells in treated embryos. Finally, we showed that HDAC inhibitors induced no observable cell death in neuromasts as measured by cleaved caspase-3 immunohistochemistry and western blot analysis. Taken together, our results demonstrate that HDAC activity has an important role in the regeneration of hair cells in the lateral line.

  4. Leading and trailing cells cooperate in collective migration of the zebrafish posterior lateral line primordium.

    Science.gov (United States)

    Dalle Nogare, Damian; Somers, Katherine; Rao, Swetha; Matsuda, Miho; Reichman-Fried, Michal; Raz, Erez; Chitnis, Ajay B

    2014-08-01

    Collective migration of cells in the zebrafish posterior lateral line primordium (PLLp) along a path defined by Cxcl12a expression depends on Cxcr4b receptors in leading cells and on Cxcr7b in trailing cells. Cxcr7b-mediated degradation of Cxcl12a by trailing cells generates a local gradient of Cxcl12a that guides PLLp migration. Agent-based computer models were built to explore how a polarized response to Cxcl12a, mediated by Cxcr4b in leading cells and prevented by Cxcr7b in trailing cells, determines unidirectional migration of the PLLp. These chemokine signaling-based models effectively recapitulate many behaviors of the PLLp and provide potential explanations for the characteristic behaviors that emerge when the PLLp is severed by laser to generate leading and trailing fragments. As predicted by our models, the bilateral stretching of the leading fragment is lost when chemokine signaling is blocked in the PLLp. However, movement of the trailing fragment toward the leading cells, which was also thought to be chemokine dependent, persists. This suggested that a chemokine-independent mechanism, not accounted for in our models, is responsible for this behavior. Further investigation of trailing cell behavior shows that their movement toward leading cells depends on FGF signaling and it can be re-oriented by exogenous FGF sources. Together, our observations reveal the simple yet elegant manner in which leading and trailing cells coordinate migration; while leading cells steer PLLp migration by following chemokine cues, cells further back play follow-the-leader as they migrate toward FGFs produced by leading cells. © 2014. Published by The Company of Biologists Ltd.

  5. Expression levels of antimicrobial peptide tachyplesin I in transgenic Ornithogalum lines affect the resistance to Pectobacterium infection.

    Science.gov (United States)

    Lipsky, Alexander; Joshi, Janak Raj; Carmi, Nir; Yedidia, Iris

    2016-11-20

    The genus Ornithogalum includes several ornamental species that suffer substantial losses from bacterial soft rot caused by Pectobacteria. The absence of effective control measures for use against soft rot bacteria led to the initiation of a project in which a small antimicrobial peptide from an Asian horseshoe crab, tachyplesin (tpnI), was introduced into two commercial cultivars: O. dubium and O. thyrsoides. Disease severity and bacterial colonization were examined in transgenic lines expressing this peptide. Disease resistance was evaluated in six lines of each species by measuring bacterial proliferation in the plant tissue. Three transgenic lines of each species were subjected to further analysis in which the expression level of the transgene was evaluated using RT-PCR and qRT-PCR. The development of disease symptoms and bacterial colonization of the plant tissue were also examined using GFP-expressing strain of P. carotovorum subsp. brasiliense Pcb3. Confocal-microscopy imaging revealed significantly reduced quantities of bacterial cells in the transgenic plant lines that had been challenged with the bacterium. The results clearly demonstrate that tpnI expression reduces bacterial proliferation, colonization and disease symptom (reduced by 95-100%) in the transgenic plant tissues. The quantity of tpnI transcripts, as measured by qRT-PCR, was negatively correlated with the protection afforded to the plants, as measured by the reduced severity of disease symptoms in the tissue. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Generation of a double binary transgenic zebrafish model to study myeloid gene regulation in response to oncogene activation in melanocytes.

    Science.gov (United States)

    Kenyon, Amy; Gavriouchkina, Daria; Zorman, Jernej; Chong-Morrison, Vanessa; Napolitani, Giorgio; Cerundolo, Vincenzo; Sauka-Spengler, Tatjana

    2018-04-06

    A complex network of inflammatory genes is closely linked to somatic cell transformation and malignant disease. Immune cells and their associated molecules are responsible for detecting and eliminating cancer cells as they establish themselves as the precursors of a tumour. By the time a patient has a detectable solid tumour, cancer cells have escaped the initial immune response mechanisms. Here, we describe the development of a double binary zebrafish model that enables regulatory programming of the myeloid cells as they respond to oncogene-activated melanocytes to be explored, focussing on the initial phase when cells become the precursors of cancer. A hormone-inducible binary system allows for temporal control of expression of different Ras oncogenes ( NRas Q61K , HRas G12V and KRas G12V ) in melanocytes, leading to proliferation and changes in morphology of the melanocytes. This model was coupled to binary cell-specific biotagging models allowing in vivo biotinylation and subsequent isolation of macrophage or neutrophil nuclei for regulatory profiling of their active transcriptomes. Nuclear transcriptional profiling of neutrophils, performed as they respond to the earliest precursors of melanoma in vivo , revealed an intricate landscape of regulatory factors that may promote progression to melanoma, including Serpinb1l4, Fgf1, Fgf6, Cathepsin H, Galectin 1 and Galectin 3. The model presented here provides a powerful platform to study the myeloid response to the earliest precursors of melanoma. © 2018. Published by The Company of Biologists Ltd.

  7. Transgenic Chinese hamster V79 cell lines which exhibit variable levels of gpt mutagenesis

    International Nuclear Information System (INIS)

    Klein, C.B.; Rossman, T.G.

    1990-01-01

    The Escherichia coli gpt gene coding for xanthine-guanine phosphoribosyl transferase has been stably transfected into HPRT - Chinese hamster V79 cells. Several gpt - cell lines have been established, which retain the sequence(s) even after long-term culture without selection for gpt. While spontaneous mutagenesis to gpt - occurs rather frequently for most cell lines, it cannot be correlated with either the number of plasmid integration sites or deletion of the plasmid sequence(s). One transgenic cell line (g12), which continuously maintains a low spontaneous mutation frequency was used in comparative mutagenesis studies with wild-type V79 cells (gpt vs. hprt). Alkylating agents such as N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) and β-propiolactone (BPL) are shown to be equally toxic and mutagenic in both g12 and V79 cells. UV and X-rays are also equally toxic to both cell lines. The data presented here suggests that g12 cells may be useful to study mammalian mutagenesis by agents which yield limited response at the hprt locus

  8. Effect of transgenic Bacillus thuringiensis rice lines on mortality and feeding behavior of rice stem borers (Lepidoptera: Crambidae).

    Science.gov (United States)

    Chen, Hao; Zhang, Guoan; Zhang, Qifa; Lin, Yongjun

    2008-02-01

    Ten transgenic Bacillus thuringiensis Bt rice, Oryza sativa L., lines with different Bt genes (two Cry1Ac lines, three Cry2A lines, and five Cry9C lines) derived from the same variety Minghui 63 were evaluated in both the laboratory and the field. Bioassays were conducted by using the first instars of two main rice lepidopteran insect species: yellow stem borer, Scirpophaga incertulas (Walker) and Asiatic rice borer, Chilo suppressalis (Walker). All transgenic lines exhibited high toxicity to these two rice borers. Field evaluation results also showed that all transgenic lines were highly insect resistant with both natural infestation and manual infestation of the neonate larvae of S. incertulas compared with the nontransformed Minghui63. Bt protein concentrations in leaves of 10 transgenic rice lines were estimated by the sandwich enzyme-linked immunosorbent assay. The cry9C gene had the highest expression level, next was cry2A gene, and the cry1Ac gene expressed at the lowest level. The feeding behavior of 7-d-old Asiatic rice borer to three classes of Bt transgenic rice lines also was detected by using rice culm cuttings. The results showed that 7-d-old larvae of Asiatic rice borer have the capacity to distinguish Bt and non-Bt culm cuttings and preferentially fed on non-Bt cuttings. When only Bt culm cuttings with three classes of different Bt proteins (CrylAc, Cry2A, and Cry9C) were fed, significant distribution difference of 7-d-old Asiatic rice borer in culm cuttings of different Bt proteins also was found. In the current study, we evaluate different Bt genes in the same rice variety in both the laboratory and the field, and also tested feeding behavior of rice insect to these Bt rice. These data are valuable for the further development of two-toxin Bt rice and establishment of appropriate insect resistance management in the future.

  9. Molecular conservation of estrogen-response associated with cell cycle regulation, hormonal carcinogenesis and cancer in zebrafish and human cancer cell lines

    Directory of Open Access Journals (Sweden)

    Govindarajan Kunde R

    2011-05-01

    Full Text Available Abstract Background The zebrafish is recognized as a versatile cancer and drug screening model. However, it is not known whether the estrogen-responsive genes and signaling pathways that are involved in estrogen-dependent carcinogenesis and human cancer are operating in zebrafish. In order to determine the potential of zebrafish model for estrogen-related cancer research, we investigated the molecular conservation of estrogen responses operating in both zebrafish and human cancer cell lines. Methods Microarray experiment was performed on zebrafish exposed to estrogen (17β-estradiol; a classified carcinogen and an anti-estrogen (ICI 182,780. Zebrafish estrogen-responsive genes sensitive to both estrogen and anti-estrogen were identified and validated using real-time PCR. Human homolog mapping and knowledge-based data mining were performed on zebrafish estrogen responsive genes followed by estrogen receptor binding site analysis and comparative transcriptome analysis with estrogen-responsive human cancer cell lines (MCF7, T47D and Ishikawa. Results Our transcriptome analysis captured multiple estrogen-responsive genes and signaling pathways that increased cell proliferation, promoted DNA damage and genome instability, and decreased tumor suppressing effects, suggesting a common mechanism for estrogen-induced carcinogenesis. Comparative analysis revealed a core set of conserved estrogen-responsive genes that demonstrate enrichment of estrogen receptor binding sites and cell cycle signaling pathways. Knowledge-based and network analysis led us to propose that the mechanism involving estrogen-activated estrogen receptor mediated down-regulation of human homolog HES1 followed by up-regulation cell cycle-related genes (human homologs E2F4, CDK2, CCNA, CCNB, CCNE, is highly conserved, and this mechanism may involve novel crosstalk with basal AHR. We also identified mitotic roles of polo-like kinase as a conserved signaling pathway with multiple entry

  10. Expression of sall4 in taste buds of zebrafish.

    Science.gov (United States)

    Jackson, Robyn; Braubach, Oliver R; Bilkey, Jessica; Zhang, Jing; Akimenko, Marie-Andrée; Fine, Alan; Croll, Roger P; Jonz, Michael G

    2013-07-01

    We characterized the expression of sall4, a gene encoding a zinc finger transcription factor involved in the maintenance of embryonic stem cells, in taste buds of zebrafish (Danio rerio). Using an enhancer trap line (ET5), we detected enhanced green fluorescent protein (EGFP) in developing and adult transgenic zebrafish in regions containing taste buds: the lips, branchial arches, and the nasal and maxillary barbels. Localization of EGFP to taste cells of the branchial arches and lips was confirmed by co-immunolabeling with antibodies against calretinin and serotonin, and a zebrafish-derived neuronal marker (zn-12). Transgenic insertion of the ET construct into the zebrafish genome was evaluated and mapped to chromosome 23 in proximity (i.e. 23 kb) to the sall4 gene. In situ hybridization and expression analysis between 24 and 96 h post-fertilization (hpf) demonstrated that transgenic egfp expression in ET5 zebrafish was correlated with the spatial and temporal pattern of expression of sall4 in the wild-type. Expression was first observed in the central nervous system and branchial arches at 24 hpf. At 48 hpf, sall4 and egfp expression was observed in taste bud primordia surrounding the mouth and branchial arches. At 72 and 96 hpf, expression was detected in the upper and lower lips and branchial arches. Double fluorescence in situ hybridization at 3 and 10 dpf confirmed colocalization of sall4 and egfp in the lips and branchial arches. These studies reveal sall4 expression in chemosensory cells and implicate this transcription factor in the development and renewal of taste epithelia in zebrafish. Copyright © 2013 Wiley Periodicals, Inc.

  11. Lactation Defect in a Widely Used MMTV-Cre Transgenic Line of Mice

    Science.gov (United States)

    Yuan, Taichang; Wang, Yongping; Pao, Lily; Anderson, Steve M.; Gu, Haihua

    2011-01-01

    Background MMTV-Cre mouse lines have played important roles in our understanding about the functions of numerous genes in mouse mammary epithelial cells during mammary gland development and tumorigenesis. However, numerous studies have not included MMTV-Cre mice as controls, and many investigators have not indicated which of the different MMTV-Cre founder lines were used in their studies. Here, we describe a lactation defect that severely limits the use of one of the most commonly used MMTV-Cre founder lines. Methodology/Principal Findings To explore the role of protein tyrosine phosphatase Shp1 in mammary gland development, mice bearing the floxed Shp1 gene were crossed with MMTV-Cre mice and mammary gland development was examined by histological and biochemical techniques, while lactation competency was assessed by monitoring pup growth. Surprisingly, both the Shp1fl/+;MMTV-Cre and MMTV-Cre female mice displayed a severe lactation defect when compared to the Shp1 fl/+ control mice. Histological and biochemical analyses reveal that female mice expressing the MMTV-Cre transgene, either alone or in combination with floxed genes, exhibit defects in lobuloalveolar expansion, presence of large cytoplasmic lipid droplets in luminal alveolar epithelial cells postpartum, and precocious induction of involution. Using a PCR-based genotyping method, the three different founder lines can be distinguished, and we determined that the MMTV-Cre line A, the most widely used MMTV-Cre founder line, exhibits a profound lactation defect that limits its use in studies on mammary gland development. Conclusions/Significance The identification of a lactation defect in the MMTV-Cre line A mice indicates that investigators must use MMTV-Cre alone mice as control in studies that utilize Cre recombinase to excise genes of interest from mammary epithelial cells. Our results also suggest that previous results obtained in studies using the MMTV-Cre line A line should be re-evaluated if the

  12. Directional cell migration establishes the axes of planar polarity in the posterior lateral-line organ of the zebrafish.

    Science.gov (United States)

    López-Schier, Hernán; Starr, Catherine J; Kappler, James A; Kollmar, Richard; Hudspeth, A J

    2004-09-01

    The proper orientation of mechanosensory hair cells along the lateral-line organ of a fish or amphibian is essential for the animal's ability to sense directional water movements. Within the sensory epithelium, hair cells are polarized in a stereotyped manner, but the mechanisms that control their alignment relative to the body axes are unknown. We have found, however, that neuromasts can be oriented either parallel or perpendicular to the anteroposterior body axis. By characterizing the strauss mutant zebrafish line and by tracking labeled cells, we have demonstrated that neuromasts of these two orientations originate from, respectively, the first and second primordia. Furthermore, altering the migratory pathway of a primordium reorients a neuromast's axis of planar polarity. We propose that the global orientation of hair cells relative to the body axes is established through an interaction between directional movement by primordial cells and the timing of neuromast maturation.

  13. Transgenic overexpression of BAFF regulates the expression of ...

    Indian Academy of Sciences (India)

    To investigate whether transgenic overexpression of the zebrafish BAFF leads to ... and BAFF proteins were expressed separately and confirmed in HeLa cells. ... body homogenate of zebrafish and demonstrated a significant increase in ...

  14. Advancements in zebrafish applications for 21st century toxicology.

    Science.gov (United States)

    Garcia, Gloria R; Noyes, Pamela D; Tanguay, Robert L

    2016-05-01

    The zebrafish model is the only available high-throughput vertebrate assessment system, and it is uniquely suited for studies of in vivo cell biology. A sequenced and annotated genome has revealed a large degree of evolutionary conservation in comparison to the human genome. Due to our shared evolutionary history, the anatomical and physiological features of fish are highly homologous to humans, which facilitates studies relevant to human health. In addition, zebrafish provide a very unique vertebrate data stream that allows researchers to anchor hypotheses at the biochemical, genetic, and cellular levels to observations at the structural, functional, and behavioral level in a high-throughput format. In this review, we will draw heavily from toxicological studies to highlight advances in zebrafish high-throughput systems. Breakthroughs in transgenic/reporter lines and methods for genetic manipulation, such as the CRISPR-Cas9 system, will be comprised of reports across diverse disciplines. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Development of transgenic cotton lines expressing Allium sativum agglutinin (ASAL) for enhanced resistance against major sap-sucking pests.

    Science.gov (United States)

    Vajhala, Chakravarthy S K; Sadumpati, Vijaya Kumar; Nunna, Hariprasad Rao; Puligundla, Sateesh Kumar; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2013-01-01

    Mannose-specific Allium sativum leaf agglutinin encoding gene (ASAL) and herbicide tolerance gene (BAR) were introduced into an elite cotton inbred line (NC-601) employing Agrobacterium-mediated genetic transformation. Cotton transformants were produced from the phosphinothricin (PPT)-resistant shoots obtained after co-cultivation of mature embryos with the Agrobacterium strain EHA105 harbouring recombinant binary vector pCAMBIA3300-ASAL-BAR. PCR and Southern blot analysis confirmed the presence and stable integration of ASAL and BAR genes in various transformants of cotton. Basta leaf-dip assay, northern blot, western blot and ELISA analyses disclosed variable expression of BAR and ASAL transgenes in different transformants. Transgenes, ASAL and BAR, were stably inherited and showed co-segregation in T1 generation in a Mendelian fashion for both PPT tolerance and insect resistance. In planta insect bioassays on T2 and T3 homozygous ASAL-transgenic lines revealed potent entomotoxic effects of ASAL on jassid and whitefly insects, as evidenced by significant decreases in the survival, development and fecundity of the insects when compared to the untransformed controls. Furthermore, the transgenic cotton lines conferred higher levels of resistance (1-2 score) with minimal plant damage against these major sucking pests when bioassays were carried out employing standard screening techniques. The developed transgenics could serve as a potential genetic resource in recombination breeding aimed at improving the pest resistance of cotton. This study represents the first report of its kind dealing with the development of transgenic cotton resistant to two major sap-sucking insects.

  16. Analysis of T-DNA/Host-Plant DNA Junction Sequences in Single-Copy Transgenic Barley Lines

    Directory of Open Access Journals (Sweden)

    Joanne G. Bartlett

    2014-01-01

    Full Text Available Sequencing across the junction between an integrated transfer DNA (T-DNA and a host plant genome provides two important pieces of information. The junctions themselves provide information regarding the proportion of T-DNA which has integrated into the host plant genome, whilst the transgene flanking sequences can be used to study the local genetic environment of the integrated transgene. In addition, this information is important in the safety assessment of GM crops and essential for GM traceability. In this study, a detailed analysis was carried out on the right-border T-DNA junction sequences of single-copy independent transgenic barley lines. T-DNA truncations at the right-border were found to be relatively common and affected 33.3% of the lines. In addition, 14.3% of lines had rearranged construct sequence after the right border break-point. An in depth analysis of the host-plant flanking sequences revealed that a significant proportion of the T-DNAs integrated into or close to known repetitive elements. However, this integration into repetitive DNA did not have a negative effect on transgene expression.

  17. Inhibition of H3K27me3 Histone Demethylase Activity Prevents the Proliferative Regeneration of Zebrafish Lateral Line Neuromasts

    Science.gov (United States)

    Bao, Beier; He, Yingzi; Tang, Dongmei; Li, Wenyan; Li, Huawei

    2017-01-01

    The H3K27 demethylases are involved in a variety of biological processes, including cell differentiation, proliferation, and cell death by regulating transcriptional activity. However, the function of H3K27 demethylation in the field of hearing research is poorly understood. Here, we investigated the role of H3K27me3 histone demethylase activity in hair cell regeneration using an in vivo animal model. Our data showed that pharmacologic inhibition of H3K27 demethylase activity with the specific small-molecule inhibitor GSK-J4 decreased the number of regenerated hair cells in response to neomycin damage. Furthermore, inhibition of H3K27me3 histone demethylase activity dramatically suppressed cell proliferation and activated caspase-3 levels in the regenerating neuromasts of the zebrafish lateral line. GSK-J4 administration also increased the expression of p21 and p27 in neuromast cells and inhibited the ERK signaling pathway. Collectively, our findings indicate that H3K27me3 demethylation is a key epigenetic regulator in the process of hair cell regeneration in zebrafish and suggest that H3K27me3 histone demethylase activity might be a novel therapeutic target for the treatment of hearing loss. PMID:28348517

  18. Germline recombination in a novel Cre transgenic line, Prl3b1-Cre mouse.

    Science.gov (United States)

    Al-Soudy, Al-Sayed; Nakanishi, Tsuyoshi; Mizuno, Seiya; Hasegawa, Yoshikazu; Shawki, Hossam H; Katoh, Megumi C; Basha, Walaa A; Ibrahim, Abdelaziz E; El-Shemy, Hany A; Iseki, Hiroyoshi; Yoshiki, Atsushi; Hiromori, Youhei; Nagase, Hisamitsu; Takahashi, Satoru; Oishi, Hisashi; Sugiyama, Fumihiro

    2016-07-01

    Spermatogenesis is a complex and highly regulated process by which spermatogonial stem cells differentiate into spermatozoa. To better understand the molecular mechanisms of the process, the Cre/loxP system has been widely utilized for conditional gene knockout in mice. In this study, we generated a transgenic mouse line that expresses Cre recombinase under the control of the 2.5 kbp of the Prolactin family 3, subfamily b, member 1 (Prl3b1) gene promoter (Prl3b1-cre). Prl3b1 was initially reported to code for placental lactogen 2 (PL-2) protein in placenta along with increased expression toward the end of pregnancy. PL-2 was found to be expressed in germ cells in the testis, especially in spermatocytes. To analyze the specificity and efficiency of Cre recombinase activity in Prl3b1-cre mice, the mice were mated with reporter R26GRR mice, which express GFP ubiquitously before and tdsRed exclusively after Cre recombination. The systemic examination of Prl3b1-cre;R26GRR mice revealed that tdsRed-positive cells were detected only in the testis and epididymis. Fluorescence imaging of Prl3b1-cre;R26GRR testes suggested that Cre-mediated recombination took place in the germ cells with approximately 74% efficiency determined by in vitro fertilization. In conclusion, our results suggest that the Prl3b1-cre mice line provides a unique resource to understand testicular germ-cell development. genesis 54:389-397, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  19. Triclosan Lacks (Anti-Estrogenic Effects in Zebrafish Cells but Modulates Estrogen Response in Zebrafish Embryos

    Directory of Open Access Journals (Sweden)

    Hélène Serra

    2018-04-01

    Full Text Available Triclosan (TCS, an antimicrobial agent widely found in the aquatic environment, is suspected to act as an endocrine disrupting compound, however mechanistic information is lacking in regards to aquatic species. This study assessed the ability of TCS to interfere with estrogen receptor (ER transcriptional activity, in zebrafish-specific in vitro and in vivo reporter gene assays. We report that TCS exhibits a lack of either agonistic or antagonistic effects on a panel of ER-expressing zebrafish (ZELH-zfERα and -zfERβ and human (MELN cell lines. At the organism level, TCS at concentrations of up to 0.3 µM had no effect on ER-regulated brain aromatase gene expression in transgenic cyp19a1b-GFP zebrafish embryos. At a concentration of 1 µM, TCS interfered with the E2 response in an ambivalent manner by potentializing a low E2 response (0.625 nM, but decreasing a high E2 response (10 nM. Altogether, our study suggests that while modulation of ER-regulated genes by TCS may occur in zebrafish, it does so irrespective of a direct binding and activation of zfERs.

  20. Micrometam C Protects against Oxidative Stress in Inflammation Models in Zebrafish and RAW264.7 Macrophages

    Directory of Open Access Journals (Sweden)

    Hao Tang

    2015-08-01

    Full Text Available Micrometam C is a core of novel marine compound isolated from the mangrove associates Micromelum falcatum. In this study, we investigated the protective effects of micrometam C in inflammation models in the transgenic zebrafish line Tg (corola: eGFP and RAW264.7 macrophages. We found that micrometam C significantly suppressed the migration of immune cells in tail-cutting-induced inflammation in transgenic zebrafish and reduced lipopolysaccharide (LPS-induced reactive oxygen species (ROS in both zebrafish and macrophages. In addition, micrometam C also restored LPS-induced reduction of endogenous antioxidants, such as catalase (CAT, glutathione (GSH and superoxide dismutase (SOD. The protective effects of micrometam C were in parallel to its inhibition of NADPH oxidase and nuclear factor-kappa-binding (NF-κB activity. Thus, the present results demonstrate that micrometam C protects against LPS-induced inflammation possibly through its antioxidant property.

  1. Role of the durum wheat dehydrin in the function of proteases conferring salinity tolerance in Arabidopsis thaliana transgenic lines.

    Science.gov (United States)

    Saibi, Walid; Zouari, Nabil; Masmoudi, Khaled; Brini, Faiçal

    2016-04-01

    Dehydrins are claimed to stabilize macromolecules against freezing damage, dehydration, ionic or osmotic stresses, thermal stress and re-folding yield. However, their precise function remains unknown. In this context, we report the behavior of protease activities in dehydrin transgenic Arabidopsis lines against the wild type plant under salt stress (100mM NaCl). Indeed, proteases play key roles in plants, maintaining strict protein quality control and degrading specific sets of proteins in response to diverse environmental and developmental stimuli. We proved that durum wheat DHN-5 modulates the activity of some proteases, summarized on the promotion of the Cysteinyl protease and the decrease of the Aspartyl protease activity. This fact is also upgraded in salt stress conditions. We conclude that the dehydrin transgenic context encodes salinity tolerance in transgenic lines through the modulation of the interaction not only at transcriptional level but also at protein level and also with the impact of salt stress as an endogenous and exogenous effector on some biocatalysts like proteases. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Generation of an ABCG2GFPn-puro transgenic line - A tool to study ABCG2 expression in mice

    International Nuclear Information System (INIS)

    Orford, Michael; Mean, Richard; Lapathitis, George; Genethliou, Nicholas; Panayiotou, Elena; Panayi, Helen; Malas, Stavros

    2009-01-01

    The ATP-binding cassette (ABC) transporter 2 (ABCG2) is expressed by stem cells in many organs and in stem cells of solid tumors. These cells are isolated based on the side population (SP) phenotype, a Hoechst 3342 dye efflux property believed to be conferred by ABCG2. Because of the limitations of this approach we generated transgenic mice that express Nuclear GFP (GFPn) coupled to the Puromycin-resistance gene, under the control of ABCG2 promoter/enhancer sequences. We show that ABCG2 is expressed in neural progenitors of the developing forebrain and spinal cord and in embryonic and adult endothelial cells of the brain. Using the neurosphere assay, we isolated tripotent ABCG2-expressing neural stem cells from embryonic mouse brain. This transgenic line is a powerful tool for studying the expression of ABCG2 in many tissues and for performing functional studies in different experimental settings.

  3. Generation of an ABCG2{sup GFPn-puro} transgenic line - A tool to study ABCG2 expression in mice

    Energy Technology Data Exchange (ETDEWEB)

    Orford, Michael; Mean, Richard; Lapathitis, George; Genethliou, Nicholas; Panayiotou, Elena; Panayi, Helen [The Cyprus Institute of Neurology and Genetics, Airport Avenue, No. 6, Agios Dometios 2370, Nicosia (Cyprus); Malas, Stavros, E-mail: smalas@cing.ac.cy [The Cyprus Institute of Neurology and Genetics, Airport Avenue, No. 6, Agios Dometios 2370, Nicosia (Cyprus); Department of Biological Sciences, University of Cyprus, P.O. Box 20537, 1678 Nicosia (Cyprus)

    2009-06-26

    The ATP-binding cassette (ABC) transporter 2 (ABCG2) is expressed by stem cells in many organs and in stem cells of solid tumors. These cells are isolated based on the side population (SP) phenotype, a Hoechst 3342 dye efflux property believed to be conferred by ABCG2. Because of the limitations of this approach we generated transgenic mice that express Nuclear GFP (GFPn) coupled to the Puromycin-resistance gene, under the control of ABCG2 promoter/enhancer sequences. We show that ABCG2 is expressed in neural progenitors of the developing forebrain and spinal cord and in embryonic and adult endothelial cells of the brain. Using the neurosphere assay, we isolated tripotent ABCG2-expressing neural stem cells from embryonic mouse brain. This transgenic line is a powerful tool for studying the expression of ABCG2 in many tissues and for performing functional studies in different experimental settings.

  4. Characterisation of the p53 pathway in cell lines established from TH-MYCN transgenic mouse tumours.

    Science.gov (United States)

    Chen, Lindi; Esfandiari, Arman; Reaves, William; Vu, Annette; Hogarty, Michael D; Lunec, John; Tweddle, Deborah A

    2018-03-01

    Cell lines established from the TH-MYCN transgenic murine model of neuroblastoma are a valuable preclinical, immunocompetent, syngeneic model of neuroblastoma, for which knowledge of their p53 pathway status is important. In this study, the Trp53 status and functional response to Nutlin-3 and ionising radiation (IR) were determined in 6 adherent TH-MYCN transgenic cell lines using Sanger sequencing, western blot analysis and flow cytometry. Sensitivity to structurally diverse MDM2 inhibitors (Nutlin-3, MI-63, RG7388 and NDD0005) was determined using XTT proliferation assays. In total, 2/6 cell lines were Trp53 homozygous mutant (NHO2A and 844MYCN+/+) and 1/6 (282MYCN+/-) was Trp53 heterozygous mutant. For 1/6 cell lines (NHO2A), DNA from the corresponding primary tumour was found to be Trp53 wt. In all cases, the presence of a mutation was consistent with aberrant p53 signalling in response to Nutlin-3 and IR. In comparison to TP53 wt human neuroblastoma cells, Trp53 wt murine control and TH-MYCN cell lines were significantly less sensitive to growth inhibition mediated by MI-63 and RG7388. These murine Trp53 wt and mutant TH-MYCN cell lines are useful syngeneic, immunocompetent neuroblastoma models, the former to test p53-dependent therapies in combination with immunotherapies, such as anti-GD2, and the latter as models of chemoresistant relapsed neuroblastoma when aberrations in the p53 pathway are more common. The spontaneous development of Trp53 mutations in 3 cell lines from TH-MYCN mice may have arisen from MYCN oncogenic driven and/or ex vivo selection. The identified species-dependent selectivity of MI-63 and RG7388 should be considered when interpreting in vivo toxicity studies of MDM2 inhibitors.

  5. T-DNA integration patterns in transgenic maize lines mediated by ...

    African Journals Online (AJOL)

    Jane

    2011-10-03

    Oct 3, 2011 ... locus can have profound effects on the level and stability of transgene ..... Thane N, Henke J, Wang T, Ruppert J, Shah N, Rotter K, Hodges J, ... Chia JM, Deragon JM, Estill JC, Fu Y, Jeddeloh JA, Han YJ, Lee H,. Li PH, Lisch ...

  6. N. plumbaginifolia zeaxanthin epoxidase transgenic lines have unaltered baseline ABA accumulations in roots and xylem sap, but contrasting sensitivities of ABA accumulation to water deficit.

    Science.gov (United States)

    Borel, C; Audran, C; Frey, A; Marion-Poll, A; Tardieu, F; Simonneau, T

    2001-03-01

    A series of transgenic lines of Nicotiana plumbaginifolia with modified expression of zeaxanthin epoxidase gene (ZEP) provided contrasting ABA accumulation in roots and xylem sap. For mild water stress, concentration of ABA in the xylem sap ([ABA](xylem)) was clearly lower in plants underexpressing ZEP mRNA (complemented mutants and antisense transgenic lines) than in wild-type. In well-watered conditions, all lines presented similar [ABA](xylem) and similar ABA accumulation rates in detached roots. Plants could, therefore, be grown under normal light intensities and evaporative demand. Both ZEP mRNA abundance and ABA accumulation rate in roots increased with water deficit in all transgenic lines, except in complemented aba2-s1 mutants in which the ZEP gene was controlled by a constitutive promoter which does not respond to water deficit. These lines presented no change in root ABA content either with time or dehydration. The increase in ZEP mRNA abundance in roots with decreasing RWC was more pronounced in detached roots than in whole plants, suggesting a difference in mechanism. In all transgenic lines, a linear relationship was observed between predawn leaf water potential and [ABA](xylem), which could be reproduced in several experiments in the greenhouse and in the growth chamber. It is therefore possible to represent the effect of the transformation by a single parameter, thereby allowing the use of a quantitative approach to assist understanding of the behaviour of transgenic lines.

  7. Generation and characterization of neurogenin1-GFP transgenic medaka with potential for rapid developmental neurotoxicity screening

    International Nuclear Information System (INIS)

    Fan Chunyang; Simmons, Steven O.; Law, Sheran H.W.; Jensen, Karl; Cowden, John; Hinton, David; Padilla, Stephanie; Ramabhadran, Ram

    2011-01-01

    Fish models such as zebrafish and medaka are increasingly used as alternatives to rodents in developmental and toxicological studies. These developmental and toxicological studies can be facilitated by the use of transgenic reporters that permit the real-time, noninvasive observation of the fish. Here we report the construction and characterization of transgenic medaka lines expressing green fluorescent protein (GFP) under the control of the zebrafish neurogenin 1 (ngn1) gene promoter. Neurogenin (ngn1) is a helix-loop-helix transcription factor expressed in proliferating neuronal progenitor cells early in neuronal differentiation and plays a crucial role in directing neurogenesis. GFP expression was detected from 24 h post-fertilization until hatching, in a spatial pattern consistent with the previously reported zebrafish ngn1 expression. Temporal expression of the transgene parallels the expression profile of the endogenous medaka ngn1 transcript. Further, we demonstrate that embryos from the transgenic line permit the non-destructive, real-time screening of ngn1 promoter-directed GFP expression in a 96-well format, enabling higher throughput studies of developmental neurotoxicants. This strain has been deposited with and maintained by the National BioResource Project and is available on request ( (http://www.shigen.nig.ac.jp/medaka/strainDetailAction.do?quickSearch=true and strainId=5660)).

  8. Promoter, transgene, and cell line effects in the transfection of mammalian cells using PDMAEMA-based nano-stars

    Directory of Open Access Journals (Sweden)

    Alexander Raup

    2016-09-01

    Full Text Available Non-viral transfection protocols are typically optimized using standard cells and reporter proteins, potentially underestimating cellular or transgene effects. Here such effects were studied for two human (Jurkat, HEK-293 and two rodent (CHO-K1, L929 cell lines and three fluorescent reporter proteins. Expression of the enhanced green fluorescent protein (EGFP was studied under the control of the human elongation factor 1 alpha promoter and three viral promoters (SV40, SV40/enhancer, CMV, that of ZsYellow1 (yellow fluorescence and mCherry (red fluorescence for the CMV promoter. Results varied with the cell line, in particular for the Jurkat cells. Pair-wise co-transfection of the CMV controlled transgenes resulted in a significant fraction of monochromatic cells (EGFP for EGFP/YFP and EGFP/RFP co-transfections, YFP in case of YFP/RFP co-transfections. Only Jurkat cells were almost incapable of expressing YFP. Dilution of the plasmid DNA with a non-expressed plasmid showed cell line dependent effects on transfection efficiency and/or expression levels.

  9. Cry1Ac Protein expression in tissues of potato (solanumtuberosum spp. andigena) transgenic lines var. Diacol Capiro

    International Nuclear Information System (INIS)

    Vanegas Araujo, Pablo Andres; Blanco Martinez, Jennifer Teresa; Chaparro Giraldo, Alejandro

    2010-01-01

    The potato plant is the fourth most important crop in the world. In Colombia around 2.8 million tons are produced annually economically supporting 90000 families. In the country, the major economic impact in the crop is caused by Tecia solanivora that originates loses up to 100% in the tuber production. The genetic plant breeding related to the introduction of Cry genes which codify insecticidal crystal proteins is an alternative for reducing the insect attack in commercial crops. In this work, the insertion, transcription and expression of Cry1Ac gen was characterized in different tissues and three development stages of two transgenic lines of Solanum tuberosum variety Diacol Capiro that were previously transformed by Agrobacterium tumefaciens method. The characterization was realized by PCR, RT-PCR and ELISA techniques. The gen insertion and transcription was confirmed using primers for Cry1Ac gen that amplified a specific band of 766 bp. The protein expression levels were higher than 45 µg/g and were not significantly different between the analyzed lines or the three development stages. Furthermore, taking into account some relevant phenotypic features, no significant differences were found between transgenic lines and controls. The results suggest that monitoring and biosecurity assays are necessary with this vegetal material because their high level expression inside all the tissues analyzed that could affect non-targeted insects.

  10. Transgene inheritances and genetic similarities of near isogenic lines of genetically modified common beans Herança de transgenes e similaridade genética de linhagens quase isogênicas de feijoeiro-comum geneticamente modificado

    Directory of Open Access Journals (Sweden)

    Patrícia Valle Pinheiro

    2009-09-01

    Full Text Available The objective of the present work was to determine the inheritance and stability of transgenes of a transgenic bean line expressing the genes rep-trap-ren from Bean golden mosaic virus and the bar gene. Crosses were done between the transgenic line and four commercial bean cultivars, followed by four backcrosses to the commercial cultivars. Progenies from each cross were evaluated for the presence of the transgenes by brushing the leaves with glufosinate ammonium and by polymerase chain reaction using specific oligonucleotides. Advanced generations were rub-inoculated with an isolate of Bean common mosaic necrosis virus (BCMNV. The transgenes were inherited consistently in a Mendelian pattern in the four crosses studied. The analyzed lines recovered close to 80% of the characteristics of the recurrent parent, as determined by the random amplified DNA markers used, besides maintaining important traits such as resistance to BCMNV. The presence of the transgene did not cause any detectable undesirable effect in the evaluated progenies.O objetivo do presente trabalho foi determinar a herança e a estabilidade de transgenes de uma linhagem de feijoeiro-comum com expressão dos genes rep-trap-ren, do Bean golden mosaic virus, e do gene bar. Foram realizados cruzamentos entre a linhagem transgênica e quatro cultivares comerciais de feijão, seguidos de quatro retrocruzamentos. As progênies de cada cruzamento foram avaliadas quanto à presença dos transgenes, com aplicação do glifosinato de amônia nas folhas e por meio da reação da polimerase em cadeia com uso de oligonucleotídeos específicos. O vírus do mosaico comum necrótico do feijoeiro, Bean common mosaic necrosis virus (BCMNV, foi inoculado mecanicamente nas gerações avançadas. Os transgenes foram herdados em padrão mendeliano nos quatro cruzamentos estudados. As linhagens analisadas apresentaram cerca de 80% das características do parental recorrente, conforme determinado por an

  11. A zebrafish model of chordoma initiated by notochord-driven expression of HRASV12.

    Science.gov (United States)

    Burger, Alexa; Vasilyev, Aleksandr; Tomar, Ritu; Selig, Martin K; Nielsen, G Petur; Peterson, Randall T; Drummond, Iain A; Haber, Daniel A

    2014-07-01

    Chordoma is a malignant tumor thought to arise from remnants of the embryonic notochord, with its origin in the bones of the axial skeleton. Surgical resection is the standard treatment, usually in combination with radiation therapy, but neither chemotherapeutic nor targeted therapeutic approaches have demonstrated success. No animal model and only few chordoma cell lines are available for preclinical drug testing, and, although no druggable genetic drivers have been identified, activation of EGFR and downstream AKT-PI3K pathways have been described. Here, we report a zebrafish model of chordoma, based on stable transgene-driven expression of HRASV12 in notochord cells during development. Extensive intra-notochordal tumor formation is evident within days of transgene expression, ultimately leading to larval death. The zebrafish tumors share characteristics of human chordoma as demonstrated by immunohistochemistry and electron microscopy. The mTORC1 inhibitor rapamycin, which has some demonstrated activity in a chordoma cell line, delays the onset of tumor formation in our zebrafish model, and improves survival of tumor-bearing fish. Consequently, the HRASV12-driven zebrafish model of chordoma could enable high-throughput screening of potential therapeutic agents for the treatment of this refractory cancer. © 2014. Published by The Company of Biologists Ltd.

  12. A zebrafish model of chordoma initiated by notochord-driven expression of HRASV12

    Directory of Open Access Journals (Sweden)

    Alexa Burger

    2014-07-01

    Full Text Available Chordoma is a malignant tumor thought to arise from remnants of the embryonic notochord, with its origin in the bones of the axial skeleton. Surgical resection is the standard treatment, usually in combination with radiation therapy, but neither chemotherapeutic nor targeted therapeutic approaches have demonstrated success. No animal model and only few chordoma cell lines are available for preclinical drug testing, and, although no druggable genetic drivers have been identified, activation of EGFR and downstream AKT-PI3K pathways have been described. Here, we report a zebrafish model of chordoma, based on stable transgene-driven expression of HRASV12 in notochord cells during development. Extensive intra-notochordal tumor formation is evident within days of transgene expression, ultimately leading to larval death. The zebrafish tumors share characteristics of human chordoma as demonstrated by immunohistochemistry and electron microscopy. The mTORC1 inhibitor rapamycin, which has some demonstrated activity in a chordoma cell line, delays the onset of tumor formation in our zebrafish model, and improves survival of tumor-bearing fish. Consequently, the HRASV12-driven zebrafish model of chordoma could enable high-throughput screening of potential therapeutic agents for the treatment of this refractory cancer.

  13. Comparison of the rhizosphere bacterial communities of Zigongdongdou soybean and a high-methionine transgenic line of this cultivar.

    Directory of Open Access Journals (Sweden)

    Jingang Liang

    Full Text Available Previous studies have shown that methionine from root exudates affects the rhizosphere bacterial population involved in soil nitrogen fixation. A transgenic line of Zigongdongdou soybean cultivar (ZD91 that expresses Arabidopsis cystathionine γ-synthase resulting in an increased methionine production was examined for its influence to the rhizosphere bacterial population. Using 16S rRNA gene-based pyrosequencing analysis of the V4 region and DNA extracted from bacterial consortia collected from the rhizosphere of soybean plants grown in an agricultural field at the pod-setting stage, we characterized the populational structure of the bacterial community involved. In total, 87,267 sequences (approximately 10,908 per sample were analyzed. We found that Acidobacteria, Proteobacteria, Bacteroidetes, Actinobacteria, Chloroflexi, Planctomycetes, Gemmatimonadetes, Firmicutes, and Verrucomicrobia constitute the dominant taxonomic groups in either the ZD91 transgenic line or parental cultivar ZD, and that there was no statistically significant difference in the rhizosphere bacterial community structure between the two cultivars.

  14. The flexural stiffness of superficial neuromasts in the zebrafish (Danio rerio) lateral line

    NARCIS (Netherlands)

    McHenry, Matthew J.; van Netten, Sietse M.

    2007-01-01

    Superficial neuromasts are structures that detect water flow on the surface of the body of fish and amphibians. As a component of the lateral line system, these receptors are distributed along the body, where they sense flow patterns that mediate a wide variety of behaviors. Their ability to detect

  15. High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and mice.

    Directory of Open Access Journals (Sweden)

    Jin Hee Kim

    Full Text Available When expression of more than one gene is required in cells, bicistronic or multicistronic expression vectors have been used. Among various strategies employed to construct bicistronic or multicistronic vectors, an internal ribosomal entry site (IRES has been widely used. Due to the large size and difference in expression levels between genes before and after IRES, however, a new strategy was required to replace IRES. A self-cleaving 2A peptide could be a good candidate to replace IRES because of its small size and high cleavage efficiency between genes upstream and downstream of the 2A peptide. Despite the advantages of the 2A peptides, its use is not widespread because (i there are no publicly available cloning vectors harboring a 2A peptide gene and (ii comprehensive comparison of cleavage efficiency among various 2A peptides reported to date has not been performed in different contexts. Here, we generated four expression plasmids each harboring different 2A peptides derived from the foot-and-mouth disease virus, equine rhinitis A virus, Thosea asigna virus and porcine teschovirus-1, respectively, and evaluated their cleavage efficiency in three commonly used human cell lines, zebrafish embryos and adult mice. Western blotting and confocal microscopic analyses revealed that among the four 2As, the one derived from porcine teschovirus-1 (P2A has the highest cleavage efficiency in all the contexts examined. We anticipate that the 2A-harboring cloning vectors we generated and the highest efficiency of the P2A peptide we demonstrated would help biomedical researchers easily adopt the 2A technology when bicistronic or multicistronic expression is required.

  16. mRNA processing in mutant zebrafish lines generated by chemical and CRISPR-mediated mutagenesis produces unexpected transcripts that escape nonsense-mediated decay.

    Directory of Open Access Journals (Sweden)

    Jennifer L Anderson

    2017-11-01

    Full Text Available As model organism-based research shifts from forward to reverse genetics approaches, largely due to the ease of genome editing technology, a low frequency of abnormal phenotypes is being observed in lines with mutations predicted to lead to deleterious effects on the encoded protein. In zebrafish, this low frequency is in part explained by compensation by genes of redundant or similar function, often resulting from the additional round of teleost-specific whole genome duplication within vertebrates. Here we offer additional explanations for the low frequency of mutant phenotypes. We analyzed mRNA processing in seven zebrafish lines with mutations expected to disrupt gene function, generated by CRISPR/Cas9 or ENU mutagenesis methods. Five of the seven lines showed evidence of altered mRNA processing: one through a skipped exon that did not lead to a frame shift, one through nonsense-associated splicing that did not lead to a frame shift, and three through the use of cryptic splice sites. These results highlight the need for a methodical analysis of the mRNA produced in mutant lines before making conclusions or embarking on studies that assume loss of function as a result of a given genomic change. Furthermore, recognition of the types of adaptations that can occur may inform the strategies of mutant generation.

  17. Identification of estrogen target genes during zebrafish embryonic development through transcriptomic analysis.

    Directory of Open Access Journals (Sweden)

    Ruixin Hao

    Full Text Available Estrogen signaling is important for vertebrate embryonic development. Here we have used zebrafish (Danio rerio as a vertebrate model to analyze estrogen signaling during development. Zebrafish embryos were exposed to 1 µM 17β-estradiol (E2 or vehicle from 3 hours to 4 days post fertilization (dpf, harvested at 1, 2, 3 and 4 dpf, and subjected to RNA extraction for transcriptome analysis using microarrays. Differentially expressed genes by E2-treatment were analyzed with hierarchical clustering followed by biological process and tissue enrichment analysis. Markedly distinct sets of genes were up and down-regulated by E2 at the four different time points. Among these genes, only the well-known estrogenic marker vtg1 was co-regulated at all time points. Despite this, the biological functional categories targeted by E2 were relatively similar throughout zebrafish development. According to knowledge-based tissue enrichment, estrogen responsive genes were clustered mainly in the liver, pancreas and brain. This was in line with the developmental dynamics of estrogen-target tissues that were visualized using transgenic zebrafish containing estrogen responsive elements driving the expression of GFP (Tg(5xERE:GFP. Finally, the identified embryonic estrogen-responsive genes were compared to already published estrogen-responsive genes identified in male adult zebrafish (Gene Expression Omnibus database. The expressions of a few genes were co-regulated by E2 in both embryonic and adult zebrafish. These could potentially be used as estrogenic biomarkers for exposure to estrogens or estrogenic endocrine disruptors in zebrafish. In conclusion, our data suggests that estrogen effects on early embryonic zebrafish development are stage- and tissue- specific.

  18. The effect of excess expression of GFP in a novel heart-specific green fluorescence zebrafish regulated by nppa enhancer at early embryonic development.

    Science.gov (United States)

    Huang, Wen; Deng, Yun; Dong, Wei; Yuan, Wuzhou; Wan, Yongqi; Mo, Xiaoyan; Li, Yongqing; Wang, Zequn; Wang, Yuequn; Ocorr, Karen; Zhang, Bo; Lin, Shuo; Wu, Xiushan

    2011-02-01

    In order to study the impalpable effect of GFP in homozygous heart-specific GFP-positive zebrafish during the early stage, the researchers analyzed the heart function of morphology and physiology at the first 3 days after fertilization. This zebrafish line was produced by a large-scale Tol2 transposon mediated enhancer trap screen that generated a transgenic zebrafish with a heart-specific expression of green fluorescent protein (GFP)-tagged under control of the nppa enhancer. In situ hybridization experiments showed that the nppa:GFP line faithfully recapitulated both the spatial and temporal expressions of the endogenous nppa. Green fluorescence was intensively and specifically expressed in the myocardial cells located both in the heart chambers and in the atrioventricular canal. The embryonic heart of nppa:GFP line developed normally compared with those in the wild type. There was no difference between the nappa:GFP and wild type lines with respect to heart rate, overall size, ejection volume, and fractional shortening. Thus the excess expression of GFP in this transgenic line seemed to exert no detrimental effects on zebrafish hearts during the early stages.

  19. Simple, economical heat-shock devices for zebrafish housing racks.

    Science.gov (United States)

    Duszynski, Robert J; Topczewski, Jacek; LeClair, Elizabeth E

    2011-12-01

    One reason for the popularity of the zebrafish (Danio rerio) as a model vertebrate is the ability to manipulate gene expression in this organism. A common method is to induce gene expression transiently under control of a heat-shock promoter (e.g., hsp70l). By making simple mechanical adjustments to small aquarium heaters (25-50W), we were able to produce consistent and reliable heat-shock conditions within a conventional zebrafish housing system. Up to two heat-shock intervals per day (>37°C) could be maintained under conditions of continuous flow (5-25 mL/min). Temperature logging every 30 s indicated rapid warm up times, consistent heat-shock lengths, and accurate and precise peak water temperatures (mean±SD=38°C±0.2°C). The biological effects of these heat-shock treatments were confirmed by observing inducible expression of enhanced green fluorescent protein (EGFP) and inhibition of caudal fin regeneration in a transgenic fish line expressing a dominant negative fibroblast growth factor receptor (Tg(hsp70l:dnfgfr1-EGFP)(pd1)). These devices are inexpensive, easily modified, and can be calibrated to accommodate a variety of experimental designs. After setup on a programmable timer, the heaters require no intervention to produce consistent daily heat shocks, and all other standard care protocols can be followed in the fish facility. The simplicity and stability of these devices make them suitable for long-term heat shocks at any stage of the zebrafish lifecycle (>7 days postfertilization), and useful for both laboratory and classroom experiments on transgenic zebrafish.

  20. Knockdown of Zebrafish Blood Vessel Epicardial Substance Results in Incomplete Retinal Lamination

    Directory of Open Access Journals (Sweden)

    Yu-Ching Wu

    2014-01-01

    Full Text Available Cell polarity during eye development determines the normal retinal lamination and differentiation of photoreceptor cells in the retina. In vertebrates, blood vessel epicardial substance (Bves is known to play an important role in the formation and maintenance of the tight junctions essential for epithelial cell polarity. In the current study, we generated a transgenic zebrafish Bves (zbves promoter-EGFP zebrafish line to investigate the expression pattern of Bves in the retina and to study the role of zbves in retinal lamination. Immunostaining with different specific antibodies from retinal cells and transmission electron microscopy were used to identify the morphological defects in normal and Bves knockdown zebrafish. In normal zebrafish, Bves is located at the apical junctions of embryonic retinal neuroepithelia during retinogenesis; later, it is strongly expressed around inner plexiform layer (IPL and retinal pigment epithelium (RPE. In contrast, a loss of normal retinal lamination and cellular polarity was found with undifferentiated photoreceptor cells in Bves knockdown zebrafish. Herein, our results indicated that disruption of Bves will result in a loss of normal retinal lamination.

  1. A transgenic mouse line for molecular genetic analysis of excitatory glutamatergic neurons

    DEFF Research Database (Denmark)

    Borgius, Lotta; Restrepo, C. Ernesto; Leao, Richardson N.

    2010-01-01

    Excitatory glutamatergic neurons are part of most of the neuronal circuits in the mammalian nervous system. We have used BAC-technology to generate a BAC-Vglut2::Cre mouse line where Cre expression is driven by the vesicular glutamate transporter 2 (Vglut2) promotor. This BAC-Vglut2::Cre mouse line...... showed specific expression of Cre in Vglut2 positive cells in the spinal cord with no ectopic expression in GABAergic or glycinergic neurons. This mouse line also showed specific Cre expression in Vglut2 positive structures in the brain such as thalamus, hypothalamus, superior colliculi, inferior...... colliculi and deep cerebellar nuclei together with nuclei in the midbrain and hindbrain. Cre-mediated recombination was restricted to Cre expressing cells in the spinal cord and brain and occurred as early as E 12.5. Known Vglut2 positive neurons showed normal electrophysiological properties in the BAC...

  2. A Phox2b BAC Transgenic Rat Line Useful for Understanding Respiratory Rhythm Generator Neural Circuitry.

    Directory of Open Access Journals (Sweden)

    Keiko Ikeda

    Full Text Available The key role of the respiratory neural center is respiratory rhythm generation to maintain homeostasis through the control of arterial blood pCO2/pH and pO2 levels. The neuronal network responsible for respiratory rhythm generation in neonatal rat resides in the ventral side of the medulla and is composed of two groups; the parafacial respiratory group (pFRG and the pre-Bötzinger complex group (preBötC. The pFRG partially overlaps in the retrotrapezoid nucleus (RTN, which was originally identified in adult cats and rats. Part of the pre-inspiratory (Pre-I neurons in the RTN/pFRG serves as central chemoreceptor neurons and the CO2 sensitive Pre-I neurons express homeobox gene Phox2b. Phox2b encodes a transcription factor and is essential for the development of the sensory-motor visceral circuits. Mutations in human PHOX2B cause congenital hypoventilation syndrome, which is characterized by blunted ventilatory response to hypercapnia. Here we describe the generation of a novel transgenic (Tg rat harboring fluorescently labeled Pre-I neurons in the RTN/pFRG. In addition, the Tg rat showed fluorescent signals in autonomic enteric neurons and carotid bodies. Because the Tg rat expresses inducible Cre recombinase in PHOX2B-positive cells during development, it is a potentially powerful tool for dissecting the entire picture of the respiratory neural network during development and for identifying the CO2/O2 sensor molecules in the adult central and peripheral nervous systems.

  3. Regeneration of multiple shoots from transgenic potato events facilitates the recovery of phenotypically normal lines: assessing a cry9Aa2 gene conferring insect resistance

    Directory of Open Access Journals (Sweden)

    Jacobs Jeanne ME

    2011-10-01

    Full Text Available Abstract Background The recovery of high performing transgenic lines in clonal crops is limited by the occurrence of somaclonal variation during the tissue culture phase of transformation. This is usually circumvented by developing large populations of transgenic lines, each derived from the first shoot to regenerate from each transformation event. This study investigates a new strategy of assessing multiple shoots independently regenerated from different transformed cell colonies of potato (Solanum tuberosum L.. Results A modified cry9Aa2 gene, under the transcriptional control of the CaMV 35S promoter, was transformed into four potato cultivars using Agrobacterium-mediated gene transfer using a nptII gene conferring kanamycin resistance as a selectable marker gene. Following gene transfer, 291 transgenic lines were grown in greenhouse experiments to assess somaclonal variation and resistance to potato tuber moth (PTM, Phthorimaea operculella (Zeller. Independently regenerated lines were recovered from many transformed cell colonies and Southern analysis confirmed whether they were derived from the same transformed cell. Multiple lines regenerated from the same transformed cell exhibited a similar response to PTM, but frequently exhibited a markedly different spectrum of somaclonal variation. Conclusions A new strategy for the genetic improvement of clonal crops involves the regeneration and evaluation of multiple shoots from each transformation event to facilitate the recovery of phenotypically normal transgenic lines. Most importantly, regenerated lines exhibiting the phenotypic appearance most similar to the parental cultivar are not necessarily derived from the first shoot regenerated from a transformed cell colony, but can frequently be a later regeneration event.

  4. Investigation of the Effects of Perfluorooctanoic Acid (PFOA and Perfluorooctane Sulfonate (PFOS on Apoptosis and Cell Cycle in a Zebrafish (Danio rerio Liver Cell Line

    Directory of Open Access Journals (Sweden)

    Yuan Cui

    2015-12-01

    Full Text Available This study aimed to explore the effects of perfluorooctanoic acid (PFOA and perfluorooctane sulfonate (PFOS on apoptosis and cell cycle in a zebrafish (Danio rerio liver cell line (ZFL. Treatment groups included a control group, PFOA-IC50, PFOA-IC80, PFOS-IC50 and PFOS-IC80 groups. IC50 and IC80 concentrations were identified by cellular modeling and MTT assays. mRNA levels of p53, Bcl-2, Bax, Caspase-3 and NF-κB p65 were detected by qPCR. Cell apoptosis and cell cycle were detected by flow cytometry and the protein levels of p53, Bcl-2, Bax, Caspase-3 and NF-κB p65 were determined by western blotting. Both PFOA and PFOS inhibited the growth of zebrafish liver cells, and the inhibition rate of PFOS was higher than that of PFOA. Bcl-2 expression levels in the four groups were significantly higher than the control group and Bcl-2 increased significantly in the PFOA-IC80 group. However, the expression levels of Bax in the four treatment groups were higher than the control group. The percentage of cell apoptosis increased significantly with the treatment of PFOA and PFOS (p < 0.05. Cell cycle and cell proliferation were blocked in both the PFOA-IC80 and PFOS-IC80 groups, indicating that PFOA-IC80 and PFOS-IC50 enhanced apoptosis in ZFL cells.

  5. Murine transgenic embryonic stem cell lines for the investigation of sinoatrial node-related molecular pathways

    Directory of Open Access Journals (Sweden)

    Stefanie Schmitteckert

    2017-12-01

    Full Text Available The elucidation of molecular mechanisms that restrict the potential of pluripotent stem cells and promote cardiac lineage differentiation is of crucial relevance, since embryonic stem cells (ESCs hold great potential for cell based heart therapies. The homeodomain transcription factor Shox2 is essential for the development and proper function of the native cardiac pacemaker, the sinoatrial node. This prompted us to develop a cardiac differentiation model using ESC lines isolated from blastocysts of Shox2-deficient mice. The established cell model provides a fundamental basis for the investigation of molecular pathways under physiological and pathophysiological conditions for evaluating novel therapeutic approaches.

  6. New tides: using zebrafish to study renal regeneration.

    Science.gov (United States)

    McCampbell, Kristen K; Wingert, Rebecca A

    2014-02-01

    Over the past several decades, the zebrafish has become one of the major vertebrate model organisms used in biomedical research. In this arena, the zebrafish has emerged as an applicable system for the study of kidney diseases and renal regeneration. The relevance of the zebrafish model for nephrology research has been increasingly appreciated as the understanding of zebrafish kidney structure, ontogeny, and the response to damage has steadily expanded. Recent studies have documented the amazing regenerative characteristics of the zebrafish kidney, which include the ability to replace epithelial populations after acute injury and to grow new renal functional units, termed nephrons. Here we discuss how nephron composition is conserved between zebrafish and mammals, and highlight how recent findings from zebrafish studies utilizing transgenic technologies and chemical genetics can complement traditional murine approaches in the effort to dissect how the kidney responds to acute damage and identify therapeutics that enhance human renal regeneration. Copyright © 2014 Mosby, Inc. All rights reserved.

  7. Aproach study of freedom to operate for transgenic line rice in Colombia

    Directory of Open Access Journals (Sweden)

    Alejandro Chaparro Giraldo

    2016-01-01

    Full Text Available The development of a genetically modified variety (GM is a scientific and legal challenge, by genetic engineering techniques used and the intellectual property rights (IPR involved. Approximate analysis of freedom of operation for a GM line derived from a Colombian rice variety, express an optimized version of the cry1Ac gene; in order to pursue their commercial release in Colombia was made. To do this, a deconstruction of innovation, which potentially protectable elements DPI on which patent searches and patent applications were made in the national and international context, databases were determined public access was performed. 59 patents and patent applications were found in the international arena. The Superintendency of Industry and Trade of Colombia (SIC three applications for patents that may affect the freedom of operation for this innovation were found. It is concluded that the higher the possibility of developing a GM rice line expressing cry1Ac gene without affecting the interest of third parties , as long as it is done in the country to commercialize.

  8. Transgenic Mouse Lines Subdivide External Segment of the Globus Pallidus (GPe) Neurons and Reveal Distinct GPe Output Pathways

    Science.gov (United States)

    Mastro, Kevin J.; Bouchard, Rachel S.; Holt, Hiromi A. K.

    2014-01-01

    Cell-type diversity in the brain enables the assembly of complex neural circuits, whose organization and patterns of activity give rise to brain function. However, the identification of distinct neuronal populations within a given brain region is often complicated by a lack of objective criteria to distinguish one neuronal population from another. In the external segment of the globus pallidus (GPe), neuronal populations have been defined using molecular, anatomical, and electrophysiological criteria, but these classification schemes are often not generalizable across preparations and lack consistency even within the same preparation. Here, we present a novel use of existing transgenic mouse lines, Lim homeobox 6 (Lhx6)–Cre and parvalbumin (PV)–Cre, to define genetically distinct cell populations in the GPe that differ molecularly, anatomically, and electrophysiologically. Lhx6–GPe neurons, which do not express PV, are concentrated in the medial portion of the GPe. They have lower spontaneous firing rates, narrower dynamic ranges, and make stronger projections to the striatum and substantia nigra pars compacta compared with PV–GPe neurons. In contrast, PV–GPe neurons are more concentrated in the lateral portions of the GPe. They have narrower action potentials, deeper afterhyperpolarizations, and make stronger projections to the subthalamic nucleus and parafascicular nucleus of the thalamus. These electrophysiological and anatomical differences suggest that Lhx6–GPe and PV–GPe neurons participate in different circuits with the potential to contribute to different aspects of motor function and dysfunction in disease. PMID:24501350

  9. Targeted knock-in of CreER T2 in zebrafish using CRISPR/Cas9.

    Science.gov (United States)

    Kesavan, Gokul; Hammer, Juliane; Hans, Stefan; Brand, Michael

    2018-04-01

    New genome-editing approaches, such as the CRISPR/Cas system, have opened up great opportunities to insert or delete genes at targeted loci and have revolutionized genetics in model organisms like the zebrafish. The Cre-loxp recombination system is widely used to activate or inactivate genes with high spatial and temporal specificity. Using a CRISPR/Cas9-mediated knock-in strategy, we inserted a zebrafish codon-optimized CreER T2 transgene at the otx2 gene locus to generate a conditional Cre-driver line. We chose otx2 as it is a patterning gene of the anterior neural plate that is expressed during early development. By knocking in CreER T2 upstream of the endogenous ATG of otx2, we utilized this gene's native promoter and enhancer elements to perfectly match CreER T2 and endogenous otx2 expression patterns. Next, by combining this novel driver line with a Cre-dependent reporter line, we show that only in the presence of tamoxifen can efficient Cre-loxp-mediated recombination be achieved in the anterior neural plate-derived tissues like the telencephalon, the eye and the optic tectum. Our results imply that the otx2:CreER T2 transgenic fish will be a valuable tool for lineage tracing and conditional mutant studies in larval and adult zebrafish.

  10. Monitoring changes in anthocyanin and steroid alkaloid glycoside content in lines of transgenic potato plants using liquid chromatography/mass spectrometry.

    Science.gov (United States)

    Stobiecki, Maciej; Matysiak-Kata, Iwona; Frański, Rafał; Skała, Jacek; Szopa, Jan

    2003-03-01

    Transgenic potato plants overexpressing and repressing enzymes of flavonoids biosynthesis were created and analyzed. The selected plants clearly showed the expected changes in anthocyanins synthesis level. Overexpression of a DNA encoding dihydroflavonol 4-reductase (DFR) in sense orientation resulted in an increase in tuber anthocyanins, a 4-fold increase in petunidin and pelargonidin derivatives. A significant decrease in anthocyanin level was observed when the plant was transformed with a corresponding antisense construct. The transformation of potato plants was also accompanied by significant changes in steroid alkaloid glycosides (SAG) level in transgenic potato tuber. The changes in SAGs content was not dependent on flavonoid composition in transgenic potato. However, in an extreme situation where the highest (DFR11) or the lowest (DFRa3) anthocyanin level was detected the positive correlation with steroid alkaloid content was clearly visible. It is suggested that the changes in SAGs content resulted from chromatin stressed upon transformation. A liquid chromatography/mass spectrometry (LC/MS) system with electrospray ionization was applied for profiling qualitative and quantitative changes of steroid alkaloid glycosides in tubers of twelve lines of transgenic potato plants. Except alpha-chaconine and alpha-solanine, in the extracts from dried tuber skin alpha-solamargine and alpha-solasonine, triglycosides of solasonine, were identified in minor amounts, triglycosides of solanidine dehydrodimers were also recognized.

  11. Kita driven expression of oncogenic HRAS leads to early onset and highly penetrant melanoma in zebrafish.

    Directory of Open Access Journals (Sweden)

    Cristina Santoriello

    2010-12-01

    Full Text Available Melanoma is the most aggressive and lethal form of skin cancer. Because of the increasing incidence and high lethality of melanoma, animal models for continuously observing melanoma formation and progression as well as for testing pharmacological agents are needed.Using the combinatorial Gal4-UAS system, we have developed a zebrafish transgenic line that expresses oncogenic HRAS under the kita promoter. Already at 3 days transgenic kita-GFP-RAS larvae show a hyper-pigmentation phenotype as earliest evidence of abnormal melanocyte growth. By 2-4 weeks, masses of transformed melanocytes form in the tail stalk of the majority of kita-GFP-RAS transgenic fish. The adult tumors evident between 1-3 months of age faithfully reproduce the immunological, histological and molecular phenotypes of human melanoma, but on a condensed time-line. Furthermore, they show transplantability, dependence on mitfa expression and do not require additional mutations in tumor suppressors. In contrast to kita expressing melanocyte progenitors that efficiently develop melanoma, mitfa expressing progenitors in a second Gal4-driver line were 4 times less efficient in developing melanoma during the three months observation period.This indicates that zebrafish kita promoter is a powerful tool for driving oncogene expression in the right cells and at the right level to induce early onset melanoma in the presence of tumor suppressors. Thus our zebrafish model provides a link between kita expressing melanocyte progenitors and melanoma and offers the advantage of a larval phenotype suitable for large scale drug and genetic modifier screens.

  12. Heterogeneous transgene expression in the retinas of the TH-RFP, TH-Cre, TH-BAC-Cre and DAT-Cre mouse lines.

    Science.gov (United States)

    Vuong, H E; Pérez de Sevilla Müller, L; Hardi, C N; McMahon, D G; Brecha, N C

    2015-10-29

    Transgenic mouse lines are essential tools for understanding the connectivity, physiology and function of neuronal circuits, including those in the retina. This report compares transgene expression in the retina of a tyrosine hydroxylase (TH)-red fluorescent protein (RFP) mouse line with three catecholamine-related Cre recombinase mouse lines [TH-bacterial artificial chromosome (BAC)-, TH-, and dopamine transporter (DAT)-Cre] that were crossed with a ROSA26-tdTomato reporter line. Retinas were evaluated and immunostained with commonly used antibodies including those directed to TH, GABA and glycine to characterize the RFP or tdTomato fluorescent-labeled amacrine cells, and an antibody directed to RNA-binding protein with multiple splicing to identify ganglion cells. In TH-RFP retinas, types 1 and 2 dopamine (DA) amacrine cells were identified by their characteristic cellular morphology and type 1 DA cells by their expression of TH immunoreactivity. In the TH-BAC-, TH-, and DAT-tdTomato retinas, less than 1%, ∼ 6%, and 0%, respectively, of the fluorescent cells were the expected type 1 DA amacrine cells. Instead, in the TH-BAC-tdTomato retinas, fluorescently labeled AII amacrine cells were predominant, with some medium diameter ganglion cells. In TH-tdTomato retinas, fluorescence was in multiple neurochemical amacrine cell types, including four types of polyaxonal amacrine cells. In DAT-tdTomato retinas, fluorescence was in GABA immunoreactive amacrine cells, including two types of bistratified and two types of monostratified amacrine cells. Although each of the Cre lines was generated with the intent to specifically label DA cells, our findings show a cellular diversity in Cre expression in the adult retina and indicate the importance of careful characterization of transgene labeling patterns. These mouse lines with their distinctive cellular labeling patterns will be useful tools for future studies of retinal function and visual processing. Published by Elsevier

  13. Evaluation of the toxic effects of brominated compounds (BDE-47, 99, 209, TBBPA) and bisphenol A (BPA) using a zebrafish liver cell line, ZFL

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Jie; Chan, King Ming, E-mail: kingchan@cuhk.edu.hk

    2015-02-15

    Highlights: • A homologous zebrafish thyroid hormone (TH) receptor (TR) reporter gene system was developed in a zebrafish liver cell-line (ZFL) to study the possible effects of chemicals on TR activities. • BPA was found to have antagonistic effects on T3 induced TR activity, BDE-47, BDE-99, and TBBPA did not show any interference of TR activity. • Down regulation of deiodinases and some sulfation enzymes or phase II enzymes by the tested chemicals indicated their impacts on TH eleiminations. • The up-regulation of tranthyretin by BDE-47 at 96 h long-term exposure gave a link to the CYP family for its role in producing a more toxic and oxidized form. - Abstract: The toxic effects of three polybrominated diphenyl ether (PBDE) congeners (BDE-47, -99, and -209), tetrabromobisphenol A (TBBPA) and bisphenol A (BPA), were evaluated by determining their 24 h and 96 h median lethal concentrations using a zebrafish liver cell line, ZFL. It was found that BDE-47, BDE-99 and TBBPA showed comparative cytotoxicity within the range of 1.2–4.2 μM, and were more toxic than BPA (367.1 μM at 24 h and 357.6 μM at 96 h). However, BDE-209 induced only 15% lethality with exposures up to 25 μM. The molecular stresses of BDE-47, -99, TBBPA and BPA involved in thyroid hormone (TH) homeostasis and hepatic metabolism were also investigated. Using a reporter gene system to detect zebrafish thyroid hormone receptor β (zfTRβ) transcriptional activity, the median effective concentration of triiodothyronine (T3) was determined to be 9.2 × 10{sup −11} M. BDE-47, BDE-99, TBBPA and BPA alone, however, did not exhibit zfTRβ agonistic activity. BPA displayed T3 (0.1 nM) induced zfTRβ antagonistic activity with a median inhibitory concentration of 19.3 μM. BDE-47, BDE-99 and TBBPA displayed no antagonistic effects of T3-induced zfTRβ activity. Target gene expressions were also examined under acute exposures. The significant inhibition of different types of deiodinases by all of

  14. Inhibition of H3K9me2 Reduces Hair Cell Regeneration after Hair Cell Loss in the Zebrafish Lateral Line by Down-Regulating the Wnt and Fgf Signaling Pathways

    Science.gov (United States)

    Tang, Dongmei; Lin, Qin; He, Yingzi; Chai, Renjie; Li, Huawei

    2016-01-01

    The activation of neuromast (NM) supporting cell (SC) proliferation leads to hair cell (HC) regeneration in the zebrafish lateral line. Epigenetic mechanisms have been reported that regulate HC regeneration in the zebrafish lateral line, but the role of H3K9me2 in HC regeneration after HC loss remains poorly understood. In this study, we focused on the role of H3K9me2 in HC regeneration following neomycin-induced HC loss. To investigate the effects of H3K9me2 in HC regeneration, we took advantage of the G9a/GLP-specific inhibitor BIX01294 that significantly reduces the dimethylation of H3K9. We found that BIX01294 significantly reduced HC regeneration after neomycin-induced HC loss in the zebrafish lateral line. BIX01294 also significantly reduced the proliferation of NM cells and led to fewer SCs in the lateral line. In situ hybridization showed that BIX01294 significantly down-regulated the Wnt and Fgf signaling pathways, which resulted in reduced SC proliferation and HC regeneration in the NMs of the lateral line. Altogether, our results suggest that down-regulation of H3K9me2 significantly decreases HC regeneration after neomycin-induced HC loss through inactivation of the Wnt/β-catenin and Fgf signaling pathways. Thus H3K9me2 plays a critical role in HC regeneration. PMID:27303264

  15. Inhibition of H3K9me2 Reduces Hair Cell Regeneration after Hair Cell Loss in the Zebrafish Lateral Line by Down-Regulating the Wnt and Fgf Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Dongmei eTang

    2016-05-01

    Full Text Available The activation of neuromast supporting cell (SC proliferation leads to hair cell (HC regeneration in the zebrafish lateral line. Epigenetic mechanisms have been reported that regulate HC regeneration in the zebrafish lateral line, but the role of H3K9me2 in HC regeneration after HC loss remains poorly understood. In this study, we focused on the role of H3K9me2 in HC regeneration following neomycin-induced HC loss. To investigate the effects of H3K9me2 in HC regeneration, we took advantage of the G9a/GLP-specific inhibitor BIX01294 that significantly reduces the dimethylation of H3K9. We found that BIX01294 significantly reduced HC regeneration after neomycin-induced HC loss in the zebrafish lateral line. BIX01294 also significantly reduced the proliferation of neuromast cells and led to fewer SCs in the lateral line. In situ hybridization showed that BIX01294 significantly down-regulated the Wnt and Fgf signaling pathways, which resulted in reduced SC proliferation and HC regeneration in the neuromasts of the lateral line. Altogether, our results suggest that down-regulation of H3K9me2 significantly decreases HC regeneration after neomycin-induced HC loss through inactivation of the Wnt/β-catenin and Fgf signaling pathways. Thus H3K9me2 plays a critical role in HC regeneration.

  16. Effects of seed mixture sowing with transgenic Bt rice and its parental line on the population dynamics of target stemborers and leafrollers, and non-target planthoppers.

    Science.gov (United States)

    Li, Zhuo; Li, Li-Kun; Liu, Bin; Wang, Long; Parajulee, Megha N; Chen, Fa-Jun

    2018-01-24

    The widespread planting of insect-resistant crops has caused a dramatic shift in agricultural landscapes, thus raising concerns about the potential impacts on both target and non-target pests. In this study, we examined the potential effects of intra-specific seed mixture sowing with transgenic Bt rice (Bt) and its parental non-transgenic line (Nt) (100% Bt rice [Bt 100 ], 5% Nt+95% Bt [Nt 05 Bt 95 ], 10% Nt+90% Bt [Nt 10 Bt 90 ], 20% Nt+80% Bt [Nt 20 Bt 80 ], 40% Nt+60% Bt [Nt 40 Bt 60 ] and 100% Nt rice [Nt 100 ]) on target and non-target pests in a 2-year field trial in southern China. The occurrence of target pests, Sesamia inferens, Chilo suppressalis and Cnaphalocrocis medinalis, decreased with the increased ratio of Bt rice, and the mixture ratios with more than 90% Bt rice (Bt 100 and Nt 05 Bt 95 ) significantly increased the pest suppression efficiency, with the lowest occurrences of non-target planthoppers, Nilaparvata lugens and Sogatella furcifera in Nt 100 and Nt 05 Bt 95 . Furthermore, there were no significant differences in 1000-grain dry weight and grain dry weight per 100 plants between Bt 100 and Nt 05 Bt 95 . Seed mixture sowing of Bt rice with ≤10% (especially 5%) of its parent line was sufficient to overcome potential compliance issues that exist with the use of block or structured refuge to provide most effective control of both target and non-target pests without compromising the grain yield. It is also expected that the strategy of seed mixture sowing with transgenic Bt rice and the non-transgenic parental line would provide rice yield stability while decreasing the insecticide use frequency in rice production. © 2018 Institute of Zoology, Chinese Academy of Sciences.

  17. Miniaturized embryo array for automated trapping, immobilization and microperfusion of zebrafish embryos.

    Directory of Open Access Journals (Sweden)

    Jin Akagi

    Full Text Available Zebrafish (Danio rerio has recently emerged as a powerful experimental model in drug discovery and environmental toxicology. Drug discovery screens performed on zebrafish embryos mirror with a high level of accuracy the tests usually performed on mammalian animal models, and fish embryo toxicity assay (FET is one of the most promising alternative approaches to acute ecotoxicity testing with adult fish. Notwithstanding this, automated in-situ analysis of zebrafish embryos is still deeply in its infancy. This is mostly due to the inherent limitations of conventional techniques and the fact that metazoan organisms are not easily susceptible to laboratory automation. In this work, we describe the development of an innovative miniaturized chip-based device for the in-situ analysis of zebrafish embryos. We present evidence that automatic, hydrodynamic positioning, trapping and long-term immobilization of single embryos inside the microfluidic chips can be combined with time-lapse imaging to provide real-time developmental analysis. Our platform, fabricated using biocompatible polymer molding technology, enables rapid trapping of embryos in low shear stress zones, uniform drug microperfusion and high-resolution imaging without the need of manual embryo handling at various developmental stages. The device provides a highly controllable fluidic microenvironment and post-analysis eleuthero-embryo stage recovery. Throughout the incubation, the position of individual embryos is registered. Importantly, we also for first time show that microfluidic embryo array technology can be effectively used for the analysis of anti-angiogenic compounds using transgenic zebrafish line (fli1a:EGFP. The work provides a new rationale for rapid and automated manipulation and analysis of developing zebrafish embryos at a large scale.

  18. The dynamics of neutrophils in zebrafish (Danio rerio) during infection with the parasite Ichthyophthirius multifiliis

    DEFF Research Database (Denmark)

    Jørgensen, Louise von Gersdorff

    2016-01-01

    Ichthyophthirius multifiliis is a ciliated protozoan parasite infecting the skin and gills of freshwater fish. Neutrophils are attracted to the infection sites, as a part of the innate immune response. In this study a transgenic line of zebrafish (Tg(MPO:GFP)i114) with GFP-tagged neutrophils was ...... the infection. Neutrophils interacted directly with the parasites with pseudopod formation projecting towards the pathogen. These results indicate a strong innate immune response immediately following infection and/or a subsequent immune evasion by the parasite....

  19. Protective effects of edaravone against cisplatin-induced hair cell damage in zebrafish.

    Science.gov (United States)

    Hong, Seok Jin; Im, Gi Jung; Chang, Jiwon; Chae, Sung Won; Lee, Seung Hoon; Kwon, Soon Young; Jung, Hak Hyun; Chung, Ah Young; Park, Hae Chul; Choi, June

    2013-06-01

    Edaravone is known to have a potent free radical scavenging effect. The objective of the present study was to evaluate the effects of edaravone on cisplatin-induced ototoxicity in transgenic zebrafish (Brn3C: EGFP). Five day post-fertilization zebrafish larvae were exposed to 1000 μM cisplatin and 50 μM, 100 μM, 250 μM, 500 μM, 750 μM, and 1000 μM concentrations of edaravone for 4h. Hair cells within neuromasts of the supraorbital (SO1 and SO2), otic (O1), and occipital (OC1) lateral lines were analyzed by fluorescence microscopy and confocal microscopy (n=10). Hair cell survival was calculated as a percentage of the hair cells in the control group that were not exposed to cisplatin. Ultrastructural changes were evaluated using scanning electron microscopy and transmission electron microscopy. Edaravone protected cisplatin-induced hair cell loss of neuromasts (edaravone 750 μM: 8.7 ± 1.5 cells, cisplatin 1000 μM only: 3.7 ± 0.9 cells; n=10, pedaravone for 4h. Edaravone attenuated cisplatin-induced hair cell damage in zebrafish. The results of the current study suggest that cisplatin induces apoptosis, and the apoptotic cell death can be prevented by treatment with edaravone in zebrafish. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  20. Progenitor potential of nkx6.1-expressing cells throughout zebrafish life and during beta cell regeneration.

    Science.gov (United States)

    Ghaye, Aurélie P; Bergemann, David; Tarifeño-Saldivia, Estefania; Flasse, Lydie C; Von Berg, Virginie; Peers, Bernard; Voz, Marianne L; Manfroid, Isabelle

    2015-09-02

    In contrast to mammals, the zebrafish has the remarkable capacity to regenerate its pancreatic beta cells very efficiently. Understanding the mechanisms of regeneration in the zebrafish and the differences with mammals will be fundamental to discovering molecules able to stimulate the regeneration process in mammals. To identify the pancreatic cells able to give rise to new beta cells in the zebrafish, we generated new transgenic lines allowing the tracing of multipotent pancreatic progenitors and endocrine precursors. Using novel bacterial artificial chromosome transgenic nkx6.1 and ascl1b reporter lines, we established that nkx6.1-positive cells give rise to all the pancreatic cell types and ascl1b-positive cells give rise to all the endocrine cell types in the zebrafish embryo. These two genes are initially co-expressed in the pancreatic primordium and their domains segregate, not as a result of mutual repression, but through the opposite effects of Notch signaling, maintaining nkx6.1 expression while repressing ascl1b in progenitors. In the adult zebrafish, nkx6.1 expression persists exclusively in the ductal tree at the tip of which its expression coincides with Notch active signaling in centroacinar/terminal end duct cells. Tracing these cells reveals that they are able to differentiate into other ductal cells and into insulin-expressing cells in normal (non-diabetic) animals. This capacity of ductal cells to generate endocrine cells is supported by the detection of ascl1b in the nkx6.1:GFP ductal cell transcriptome. This transcriptome also reveals, besides actors of the Notch and Wnt pathways, several novel markers such as id2a. Finally, we show that beta cell ablation in the adult zebrafish triggers proliferation of ductal cells and their differentiation into insulin-expressing cells. We have shown that, in the zebrafish embryo, nkx6.1+ cells are bona fide multipotent pancreatic progenitors, while ascl1b+ cells represent committed endocrine precursors. In

  1. Rapid development of stable transgene CHO cell lines by CRISPR/Cas9-mediated site-specific integration into C12orf35.

    Science.gov (United States)

    Zhao, Menglin; Wang, Jiaxian; Luo, Manyu; Luo, Han; Zhao, Meiqi; Han, Lei; Zhang, Mengxiao; Yang, Hui; Xie, Yueqing; Jiang, Hua; Feng, Lei; Lu, Huili; Zhu, Jianwei

    2018-07-01

    Chinese hamster ovary (CHO) cells are the most widely used mammalian hosts for recombinant protein production. However, by conventional random integration strategy, development of a high-expressing and stable recombinant CHO cell line has always been a difficult task due to the heterogenic insertion and its caused requirement of multiple rounds of selection. Site-specific integration of transgenes into CHO hot spots is an ideal strategy to overcome these challenges since it can generate isogenic cell lines with consistent productivity and stability. In this study, we investigated three sites with potential high transcriptional activities: C12orf35, HPRT, and GRIK1, to determine the possible transcriptional hot spots in CHO cells, and further construct a reliable site-specific integration strategy to develop recombinant cell lines efficiently. Genes encoding representative proteins mCherry and anti-PD1 monoclonal antibody were targeted into these three loci respectively through CRISPR/Cas9 technology. Stable cell lines were generated successfully after a single round of selection. In comparison with a random integration control, all the targeted integration cell lines showed higher productivity, among which C12orf35 locus was the most advantageous in both productivity and cell line stability. Binding affinity and N-glycan analysis of the antibody revealed that all batches of product were of similar quality independent on integrated sites. Deep sequencing demonstrated that there was low level of off-target mutations caused by CRISPR/Cas9, but none of them contributed to the development process of transgene cell lines. Our results demonstrated the feasibility of C12orf35 as the target site for exogenous gene integration, and strongly suggested that C12orf35 targeted integration mediated by CRISPR/Cas9 is a reliable strategy for the rapid development of recombinant CHO cell lines.

  2. Generation and phenotypic analysis of a transgenic line of rabbits secreting active recombinant human erythropoietin in the milk

    Czech Academy of Sciences Publication Activity Database

    Mikuš, Tomáš; Poplštein, M.; Sedláková, J.; Landa, Vladimír; Jeníková, Gabriela; Trefil, P.; Lidický, J.; Malý, Petr

    2004-01-01

    Roč. 13, č. 5 (2004), s. 487-498 ISSN 0962-8819 R&D Projects: GA ČR GA304/03/0090 Institutional research plan: CEZ:AV0Z5052915 Keywords : erythropoietin, mammary gland, transgenic rabbit Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.107, year: 2004

  3. Derivation of mouse embryonic stem cell lines from tyrosine hydroxylase reporter mice crossed with a human SNCA transgenic mouse model of Parkinson's disease

    Directory of Open Access Journals (Sweden)

    Margarita Chumarina

    2017-03-01

    Full Text Available Mouse embryonic stem cell (mESC lines were derived by crossing heterozygous transgenic (tg mice expressing green fluorescent protein (GFP under the control of the rat tyrosine hydroxylase (TH promoter, with homozygous alpha-synuclein (aSYN mice expressing human mutant SNCAA53T under the control of the mouse Prion promoter (MoPrP, or wildtype (WT mice. The expression of GFP and human aSYN was validated by immunocytochemistry in midbrain neuron cultures upon differentiation of mESC lines using stromal cell-derived inducing activity. These mESC lines can help to study the impact of human aSYN expression in neurons and oligodendrocytes, and also trace GFP-expressing midbrain neurons.

  4. Glyphosate and Roundup® alter morphology and behavior in zebrafish.

    Science.gov (United States)

    Bridi, Daiane; Altenhofen, Stefani; Gonzalez, Jonas Brum; Reolon, Gustavo Kellermann; Bonan, Carla Denise

    2017-12-01

    Glyphosate has become the most widely used herbicide in the world, due to the wide scale adoption of transgenic glyphosate resistant crops after its introduction in 1996. Glyphosate may be used alone, but it is commonly applied as an active ingredient of the herbicide Roundup ® . This pesticide contains several adjuvants, which may promote an unknown toxicity. The indiscriminate application poses numerous problems, both for the health of the applicators and consumers, and for the environment, contaminating the soil, water and leading to the death of plants and animals. Zebrafish (Danio rerio) is quickly gaining popularity in behavioral research, because of physiological similarity to mammals, sensitivity to pharmacological factors, robust performance, low cost, short spawning intervals, external fertilization, transparency of embryos through larval stages, and rapid development. The aim of this study was evaluate the effects of glyphosate and Roundup ® on behavioral and morphological parameters in zebrafish larvae and adults. Zebrafish larvae at 3days post-fertilization and adults were exposed to glyphosate (0.01, 0.065, and 0.5mg/L) or Roundup ® (0.01, 0.065, and 0.5mg/L) for 96h. Immediately after the exposure, we performed the analysis of locomotor activity, aversive behavior, and morphology for the larvae and exploratory behavior, aggression and inhibitory avoidance memory for adult zebrafish. In zebrafish larvae, there were significant differences in the locomotor activity and aversive behavior after glyphosate or Roundup ® exposure when compared to the control group. Our findings demonstrated that exposure to glyphosate at the concentration of 0.5mg/L, Roundup ® at 0.065 or 0.5mg/L reduced the distance traveled, the mean speed and the line crossings in adult zebrafish. A decreased ocular distance was observed for larvae exposed at 0.5mg/L of glyphosate. We verified that at 0.5mg/L of Roundup ® -treated adult zebrafish demonstrated a significant

  5. ZNStress: a high-throughput drug screening protocol for identification of compounds modulating neuronal stress in the transgenic mutant sod1G93R zebrafish model of amyotrophic lateral sclerosis.

    Science.gov (United States)

    McGown, Alexander; Shaw, Dame Pamela J; Ramesh, Tennore

    2016-07-26

    Amyotrophic lateral sclerosis (ALS) is a lethal neurodegenerative disease with death on average within 2-3 years of symptom onset. Mutations in superoxide dismutase 1 (SOD1) have been identified to cause ALS. Riluzole, the only neuroprotective drug for ALS provides life extension of only 3 months on average. Thishighlights the need for compound screening in disease models to identify new neuroprotective therapies for this disease. Zebrafish is an emerging model system that is well suited for the study of diseasepathophysiology and also for high throughput (HT) drug screening. The mutant sod1 zebrafish model of ALS mimics the hallmark features of ALS. Using a fluorescence based readout of neuronal stress, we developed a high throughput (HT) screen to identify neuroprotective compounds. Here we show that the zebrafish screen is a robust system that can be used to rapidly screen thousands ofcompounds and also demonstrate that riluzole is capable of reducing neuronal stress in this model system. The screen shows optimal quality control, maintaining a high sensitivity and specificity withoutcompromising throughput. Most importantly, we demonstrate that many compounds previously failed in human clinical trials, showed no stress reducing activity in the zebrafish assay. We conclude that HT drug screening using a mutant sod1 zebrafish is a reliable model system which supplemented with secondary assays would be useful in identifying drugs with potential for neuroprotective efficacy in ALS.

  6. Optogenetic dissection of neuronal circuits in zebrafish using viral gene transfer and the Tet system

    Directory of Open Access Journals (Sweden)

    Peixin Zhu

    2009-12-01

    Full Text Available The conditional expression of transgenes at high levels in sparse and specific populations of neurons is important for high-resolution optogenetic analyses of neuronal circuits. We explored two complementary methods, viral gene delivery and the iTet-Off system, to express transgenes in the brain of zebrafish. High-level gene expression in neurons was achieved by Sindbis and Rabies viruses. The Tet system produced strong and specific gene expression that could be modulated conveniently by doxycycline. Moreover, transgenic lines showed expression in distinct, sparse and stable populations of neurons that appeared to be subsets of the neurons targeted by the promoter driving the Tet activator. The Tet system therefore provides the opportunity to generate libraries of diverse expression patterns similar to gene trap approaches or the thy-1 promoter in mice, but with the additional possibility to pre-select cell types of interest. In transgenic lines expressing channelrhodopsin-2, action potential firing could be precisely controlled by two-photon stimulation at low laser power, presumably because the expression levels of the Tet-controlled genes were high even in adults. In channelrhodopsin-2-expressing larvae, optical stimulation with a single blue LED evoked distinct swimming behaviors including backward swimming. These approaches provide new opportunities for the optogenetic dissection of neuronal circuit structure and function.

  7. Data on metabolic-dependent antioxidant response in the cardiovascular tissues of living zebrafish under stress conditions

    Directory of Open Access Journals (Sweden)

    Emiliano Panieri

    2017-06-01

    Full Text Available In this article we used transgenic zebrafish lines that express compartment-specific isoforms of the roGFP2-Orp1 and Grx1-roGFP2 biosensors, described in Panieri et al (2017 [1], to test the contribute of the pentose phosphate pathway and of the glutathione biosynthesis in the antioxidant capacity of myocardial and endothelial cells in vivo. The transgenic zebrafish embryos were subdued to metabolic inhibition and subsequently challenged with H2O2 or the redox-cycling agent menadione to respectively mimic acute or chronic oxidative stress. Confocal time-lapse recordings were performed to follow the compartmentalized H2O2 and EGSH changes in the cardiovascular tissues of zebrafish embryos at 48 h post fertilization. After sequential excitation at 405 nm and 488 nm the emission was collected between 500–520 nm every 2 min for an overall duration of 60 min. The 405/488 nm ratio was normalized to the initial value obtained before oxidants addition and plotted over time. The analysis and the interpretation of the data can be found in the associated article [1].

  8. Generation of mRx-Cre Transgenic Mouse Line for Efficient Conditional Gene Deletion in Early Retinal Progenitors

    Czech Academy of Sciences Publication Activity Database

    Klímová, Lucie; Láchová, Jitka; Machoň, Ondřej; Sedláček, Radislav; Kozmik, Zbyněk

    2013-01-01

    Roč. 8, č. 5 (2013), e63029 E-ISSN 1932-6203 R&D Projects: GA ČR GAP305/11/2198; GA MŠk(CZ) LK11214; GA MŠk(CZ) LM2011032; GA ČR GAP305/10/2143; GA MŠk ED1.1.00/02.0109 Institutional support: RVO:68378050 Keywords : eye development * lens * retina * transgenic mice Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.534, year: 2013

  9. Enhanced Salt Tolerance Conferred by the Complete 2.3 kb cDNA of the Rice Vacuolar Na(+)/H(+) Antiporter Gene Compared to 1.9 kb Coding Region with 5' UTR in Transgenic Lines of Rice.

    Science.gov (United States)

    Amin, U S M; Biswas, Sudip; Elias, Sabrina M; Razzaque, Samsad; Haque, Taslima; Malo, Richard; Seraj, Zeba I

    2016-01-01

    Soil salinity is one of the most challenging problems that restricts the normal growth and production of rice worldwide. It has therefore become very important to produce more saline tolerant rice varieties. This study shows constitutive over-expression of the vacuolar Na(+)/H(+) antiporter gene (OsNHX1) from the rice landrace (Pokkali) and attainment of enhanced level of salinity tolerance in transgenic rice plants. It also shows that inclusion of the complete un-translated regions (UTRs) of the alternatively spliced OsNHX1 gene provides a higher level of tolerance to the transgenic rice. Two separate transformation events of the OsNHX1 gene, one with 1.9 kb region containing the 5' UTR with CDS and the other of 2.3 kb, including 5' UTR, CDS, and the 3' UTR regions were performed. The transgenic plants with these two different constructs were advanced to the T3 generation and physiological and molecular screening of homozygous plants was conducted at seedling and reproductive stages under salinity (NaCl) stress. Both transgenic lines were observed to be tolerant compared to WT plants at both physiological stages. However, the transgenic lines containing the CDS with both the 5' and 3' UTR were significantly more tolerant compared to the transgenic lines containing OsNHX1 gene without the 3' UTR. At the seedling stage at 12 dS/m stress, the chlorophyll content was significantly higher (P kb > 1.9 kb > and WT lines. Yield in g/plant in the best line from the 2.3 kb plants was significantly more (P kb line and WT plants at stress of 6 dS/m. Transformation with the complete transcripts rather than the CDS may therefore provide more durable level of tolerance.

  10. Generation of Pet1210-Cre Transgenic Mouse Line Reveals Non-Serotonergic Expression Domains of Pet1 Both in CNS and Periphery

    Science.gov (United States)

    Pelosi, Barbara; Migliarini, Sara; Pacini, Giulia; Pratelli, Marta; Pasqualetti, Massimo

    2014-01-01

    Neurons producing serotonin (5-hydroxytryptamine, 5-HT) constitute one of the most widely distributed neuronal networks in the mammalian central nervous system (CNS) and exhibit a profuse innervation throughout the CNS already at early stages of development. Serotonergic neuron specification is controlled by a combination of secreted molecules and transcription factors such as Shh, Fgf4/8, Nkx2.2, Lmx1b and Pet1. In the mouse, Pet1 mRNA expression appears between 10 and 11 days post coitum (dpc) in serotonergic post-mitotic precursors and persists in serotonergic neurons up to adulthood, where it promotes the expression of genes defining the mature serotonergic phenotype such as tryptophan hydroxylase 2 (Tph2) and serotonin transporter (SERT). Hence, the generation of genetic tools based on Pet1 specific expression represents a valuable approach to study the development and function of the serotonergic system. Here, we report the generation of a Pet1210-Cre transgenic mouse line in which the Cre recombinase is expressed under the control of a 210 kb fragment from the Pet1 genetic locus to ensure a reliable and faithful control of somatic recombination in Pet1 cell lineage. Besides Cre-mediated recombination accurately occurred in the serotonergic system as expected and according to previous studies, Pet1210-Cre transgenic mouse line allowed us to identify novel, so far uncharacterized, Pet1 expression domains. Indeed, we showed that in the raphe Pet1 is expressed also in a non-serotonergic neuronal population intermingled with Tph2-expressing cells and mostly localized in the B8 and B9 nuclei. Moreover, we detected Cre-mediated recombination also in the developing pancreas and in the ureteric bud derivatives of the kidney, where it reflected a specific Pet1 expression. Thus, Pet1210-Cre transgenic mouse line faithfully drives Cre-mediated recombination in all Pet1 expression domains representing a valuable tool to genetically manipulate serotonergic and non

  11. Hesperidin Protects against Acute Alcoholic Injury through Improving Lipid Metabolism and Cell Damage in Zebrafish Larvae

    Directory of Open Access Journals (Sweden)

    Zhenting Zhou

    2017-01-01

    Full Text Available Alcoholic liver disease (ALD is a series of abnormalities of liver function, including alcoholic steatosis, steatohepatitis, and cirrhosis. Hesperidin, the major constituent of flavanone in grapefruit, is proved to play a role in antioxidation, anti-inflammation, and reducing multiple organs damage in various animal experiments. However, the underlying mechanism of resistance to alcoholic liver injury is still unclear. Thus, we aimed to investigate the protective effects of hesperidin against ALD and its molecular mechanism in this study. We established an ALD zebrafish larvae model induced by 350 mM ethanol for 32 hours, using wild-type and transgenic line with liver-specific eGFP expression Tg (lfabp10α:eGFP zebrafish larvae (4 dpf. The results revealed that hesperidin dramatically reduced the hepatic morphological damage and the expressions of alcohol and lipid metabolism related genes, including cyp2y3, cyp3a65, hmgcra, hmgcrb, fasn, and fads2 compared with ALD model. Moreover, the findings demonstrated that hesperidin alleviated hepatic damage as well, which is reflected by the expressions of endoplasmic reticulum stress and DNA damage related genes (chop, gadd45αa, and edem1. In conclusion, this study revealed that hesperidin can inhibit alcoholic damage to liver of zebrafish larvae by reducing endoplasmic reticulum stress and DNA damage, regulating alcohol and lipid metabolism.

  12. Isthmin 1 (ism1) is required for normal hematopoiesis in developing zebrafish.

    Science.gov (United States)

    Berrun, Arturo; Harris, Elena; Stachura, David L

    2018-01-01

    Hematopoiesis is an essential and highly regulated biological process that begins with hematopoietic stem cells (HSCs). In healthy organisms, HSCs are responsible for generating a multitude of mature blood cells every day, yet the molecular pathways that instruct HSCs to self-renew and differentiate into post-mitotic blood cells are not fully known. To understand these molecular pathways, we investigated novel genes expressed in hematopoietic-supportive cell lines from the zebrafish (Danio rerio), a model system increasingly utilized to uncover molecular pathways important in the development of other vertebrate species. We performed RNA sequencing of the transcriptome of three stromal cell lines derived from different stages of embryonic and adult zebrafish and identified hundreds of highly expressed transcripts. For our studies, we focused on isthmin 1 (ism1) due to its shared synteny with its human gene ortholog and because it is a secreted protein. To characterize ism1, we performed loss-of-function experiments to identify if mature blood cell production was disrupted. Myeloid and erythroid lineages were visualized and scored with transgenic zebrafish expressing lineage-specific markers. ism1 knockdown led to reduced numbers of neutrophils, macrophages, and erythrocytes. Analysis of clonal methylcellulose assays from ism1 morphants also showed a reduction in total hematopoietic stem and progenitor cells (HSPCs). Overall, we demonstrate that ism1 is required for normal generation of HSPCs and their downstream progeny during zebrafish hematopoiesis. Further investigation into ism1 and its importance in hematopoiesis may elucidate evolutionarily conserved processes in blood formation that can be further investigated for potential clinical utility.

  13. Isthmin 1 (ism1) is required for normal hematopoiesis in developing zebrafish

    Science.gov (United States)

    Berrun, Arturo; Harris, Elena

    2018-01-01

    Hematopoiesis is an essential and highly regulated biological process that begins with hematopoietic stem cells (HSCs). In healthy organisms, HSCs are responsible for generating a multitude of mature blood cells every day, yet the molecular pathways that instruct HSCs to self-renew and differentiate into post-mitotic blood cells are not fully known. To understand these molecular pathways, we investigated novel genes expressed in hematopoietic-supportive cell lines from the zebrafish (Danio rerio), a model system increasingly utilized to uncover molecular pathways important in the development of other vertebrate species. We performed RNA sequencing of the transcriptome of three stromal cell lines derived from different stages of embryonic and adult zebrafish and identified hundreds of highly expressed transcripts. For our studies, we focused on isthmin 1 (ism1) due to its shared synteny with its human gene ortholog and because it is a secreted protein. To characterize ism1, we performed loss-of-function experiments to identify if mature blood cell production was disrupted. Myeloid and erythroid lineages were visualized and scored with transgenic zebrafish expressing lineage-specific markers. ism1 knockdown led to reduced numbers of neutrophils, macrophages, and erythrocytes. Analysis of clonal methylcellulose assays from ism1 morphants also showed a reduction in total hematopoietic stem and progenitor cells (HSPCs). Overall, we demonstrate that ism1 is required for normal generation of HSPCs and their downstream progeny during zebrafish hematopoiesis. Further investigation into ism1 and its importance in hematopoiesis may elucidate evolutionarily conserved processes in blood formation that can be further investigated for potential clinical utility. PMID:29758043

  14. Transgenic expression of an unedited mitochondrial orfB gene product from wild abortive (WA) cytoplasm of rice (Oryza sativa L.) generates male sterility in fertile rice lines.

    Science.gov (United States)

    Chakraborty, Anirban; Mitra, Joy; Bhattacharyya, Jagannath; Pradhan, Subrata; Sikdar, Narattam; Das, Srirupa; Chakraborty, Saikat; Kumar, Sachin; Lakhanpaul, Suman; Sen, Soumitra K

    2015-06-01

    Over-expression of the unedited mitochondrial orfB gene product generates male sterility in fertile indica rice lines in a dose-dependent manner. Cytoplasmic male sterility (CMS) and nuclear-controlled fertility restoration are widespread developmental features in plant reproductive systems. In self-pollinated crop plants, these processes often provide useful tools to exploit hybrid vigour. The wild abortive CMS has been employed in the majority of the "three-line" hybrid rice production since 1970s. In the present study, we provide experimental evidence for a positive functional relationship between the 1.1-kb unedited orfB gene transcript, and its translated product in the mitochondria with male sterility. The generation of the 1.1-kb unedited orfB gene transcripts increased during flowering, resulting in low ATP synthase activity in sterile plants. Following insertion of the unedited orfB gene into the genome of male-fertile plants, the plants became male sterile in a dose-dependent manner with concomitant reduction of ATPase activity of F1F0-ATP synthase (complex V). Fertility of the transgenic lines and normal activity of ATP synthase were restored by down-regulation of the unedited orfB gene expression through RNAi-mediated silencing. The genetic elements deciphered in this study could further be tested for their use in hybrid rice development.

  15. The Zebrafish Anillin-eGFP Reporter Marks Late Dividing Retinal Precursors and Stem Cells Entering Neuronal Lineages.

    Directory of Open Access Journals (Sweden)

    Meret Cepero Malo

    Full Text Available Monitoring cycling behaviours of stem and somatic cells in the living animal is a powerful tool to better understand tissue development and homeostasis. The tg(anillin:anillin-eGFP transgenic line carries the full-length zebrafish F-actin binding protein Anillin fused to eGFP from a bacterial artificial chromosome (BAC containing Anillin cis-regulatory sequences. Here we report the suitability of the Anillin-eGFP reporter as a direct indicator of cycling cells in the late embryonic and post-embryonic retina. We show that combining the anillin:anillin-eGFP with other transgenes such as ptf1a:dsRed and atoh7:gap-RFP allows obtaining spatial and temporal resolution of the mitotic potentials of specific retinal cell populations. This is exemplified by the analysis of the origin of the previously reported apically and non-apically dividing late committed precursors of the photoreceptor and horizontal cell layers.

  16. ZNStress: a high-throughput drug screening protocol for identification of compounds modulating neuronal stress in the transgenic mutant sod1G93R zebrafish model of amyotrophic lateral sclerosis

    OpenAIRE

    McGown, Alexander; Shaw, Dame Pamela J.; Ramesh, Tennore

    2016-01-01

    Background Amyotrophic lateral sclerosis (ALS) is a lethal neurodegenerative disease with death on average within 2?3 years of symptom onset. Mutations in superoxide dismutase 1 (SOD1) have been identified to cause ALS. Riluzole, the only neuroprotective drug for ALS provides life extension of only 3 months on average. Thishighlights the need for compound screening in disease models to identify new neuroprotective therapies for this disease. Zebrafish is an emerging model system that is well ...

  17. WNK1/HSN2 mutation in human peripheral neuropathy deregulates KCC2 expression and posterior lateral line development in zebrafish (Danio rerio.

    Directory of Open Access Journals (Sweden)

    Valérie Bercier

    Full Text Available Hereditary sensory and autonomic neuropathy type 2 (HSNAII is a rare pathology characterized by an early onset of severe sensory loss (all modalities in the distal limbs. It is due to autosomal recessive mutations confined to exon "HSN2" of the WNK1 (with-no-lysine protein kinase 1 serine-threonine kinase. While this kinase is well studied in the kidneys, little is known about its role in the nervous system. We hypothesized that the truncating mutations present in the neural-specific HSN2 exon lead to a loss-of-function of the WNK1 kinase, impairing development of the peripheral sensory system. To investigate the mechanisms by which the loss of WNK1/HSN2 isoform function causes HSANII, we used the embryonic zebrafish model and observed strong expression of WNK1/HSN2 in neuromasts of the peripheral lateral line (PLL system by immunohistochemistry. Knocking down wnk1/hsn2 in embryos using antisense morpholino oligonucleotides led to improper PLL development. We then investigated the reported interaction between the WNK1 kinase and neuronal potassium chloride cotransporter KCC2, as this transporter is a target of WNK1 phosphorylation. In situ hybridization revealed kcc2 expression in mature neuromasts of the PLL and semi-quantitative RT-PCR of wnk1/hsn2 knockdown embryos showed an increased expression of kcc2 mRNA. Furthermore, overexpression of human KCC2 mRNA in embryos replicated the wnk1/hsn2 knockdown phenotype. We validated these results by obtaining double knockdown embryos, both for wnk1/hsn2 and kcc2, which alleviated the PLL defects. Interestingly, overexpression of inactive mutant KCC2-C568A, which does not extrude ions, allowed a phenocopy of the PLL defects. These results suggest a pathway in which WNK1/HSN2 interacts with KCC2, producing a novel regulation of its transcription independent of KCC2's activation, where a loss-of-function mutation in WNK1 induces an overexpression of KCC2 and hinders proper peripheral sensory nerve

  18. Investigating Pollen and Gene Flow of WYMV-Resistant Transgenic Wheat N12-1 Using a Dwarf Male-Sterile Line as the Pollen Receptor.

    Science.gov (United States)

    Dong, Shanshan; Liu, Yan; Yu, Cigang; Zhang, Zhenhua; Chen, Ming; Wang, Changyong

    2016-01-01

    Pollen-mediated gene flow (PMGF) is the main mode of transgene flow in flowering plants. The study of pollen and gene flow of transgenic wheat can help to establish the corresponding strategy for preventing transgene escape and contamination between compatible genotypes in wheat. To investigate the pollen dispersal and gene flow frequency in various directions and distances around the pollen source and detect the association between frequency of transgene flow and pollen density from transgenic wheat, a concentric circle design was adopted to conduct a field experiment using transgenic wheat with resistance to wheat yellow mosaic virus (WYMV) as the pollen donor and dwarf male-sterile wheat as the pollen receptor. The results showed that the pollen and gene flow of transgenic wheat varied significantly among the different compass sectors. A higher pollen density and gene flow frequency was observed in the downwind SW and W sectors, with average frequencies of transgene flow of 26.37 and 23.69% respectively. The pollen and gene flow of transgenic wheat declined dramatically with increasing distance from its source. Most of the pollen grains concentrated within 5 m and only a few pollen grains were detected beyond 30 m. The percentage of transgene flow was the highest where adjacent to the pollen source, with an average of 48.24% for all eight compass directions at 0 m distance. Transgene flow was reduced to 50% and 95% between 1.61 to 3.15 m, and 10.71 to 20.93 m, respectively. Our results suggest that climate conditions, especially wind direction, may significantly affect pollen dispersal and gene flow of wheat. The isolation-by-distance model is one of the most effective methods for achieving stringent transgene confinement in wheat. The frequency of transgene flow is directly correlated with the relative density of GM pollen grains in air currents, and pollen competition may be a major factor influencing transgene flow.

  19. Investigating Pollen and Gene Flow of WYMV-Resistant Transgenic Wheat N12-1 Using a Dwarf Male-Sterile Line as the Pollen Receptor.

    Directory of Open Access Journals (Sweden)

    Shanshan Dong

    Full Text Available Pollen-mediated gene flow (PMGF is the main mode of transgene flow in flowering plants. The study of pollen and gene flow of transgenic wheat can help to establish the corresponding strategy for preventing transgene escape and contamination between compatible genotypes in wheat. To investigate the pollen dispersal and gene flow frequency in various directions and distances around the pollen source and detect the association between frequency of transgene flow and pollen density from transgenic wheat, a concentric circle design was adopted to conduct a field experiment using transgenic wheat with resistance to wheat yellow mosaic virus (WYMV as the pollen donor and dwarf male-sterile wheat as the pollen receptor. The results showed that the pollen and gene flow of transgenic wheat varied significantly among the different compass sectors. A higher pollen density and gene flow frequency was observed in the downwind SW and W sectors, with average frequencies of transgene flow of 26.37 and 23.69% respectively. The pollen and gene flow of transgenic wheat declined dramatically with increasing distance from its source. Most of the pollen grains concentrated within 5 m and only a few pollen grains were detected beyond 30 m. The percentage of transgene flow was the highest where adjacent to the pollen source, with an average of 48.24% for all eight compass directions at 0 m distance. Transgene flow was reduced to 50% and 95% between 1.61 to 3.15 m, and 10.71 to 20.93 m, respectively. Our results suggest that climate conditions, especially wind direction, may significantly affect pollen dispersal and gene flow of wheat. The isolation-by-distance model is one of the most effective methods for achieving stringent transgene confinement in wheat. The frequency of transgene flow is directly correlated with the relative density of GM pollen grains in air currents, and pollen competition may be a major factor influencing transgene flow.

  20. Comparison of nutritional value of transgenic peanut expressing bar and rcg3 genes with non-transgenic counterparts

    International Nuclear Information System (INIS)

    Robab, U.E.; )

    2014-01-01

    The transgenic peanut plants expressing bar and rcg3 genes were subjected to assessment of any change in nutritional value of the crop at various locations. The protein and fat contents of transgenic lines were compared with the non-transgenic parent varieties. Protein content in the transgenic lines was higher as compared to that in non-transgenic counterparts and differences among locations for fat and protein content were significant. No differences among fatty acids were recorded for genes, events and locations. Irrespective of small differences, all the values were in range described for this crop and transgenic lines appeared to be substantially equivalent to non-transgenic parent varieties. (author)

  1. Oxidative stress and regulation of Pink1 in zebrafish (Danio rerio.

    Directory of Open Access Journals (Sweden)

    Madhusmita Priyadarshini

    Full Text Available Oxidative stress-mediated neuronal dysfunction is characteristic of several neurodegenerative disorders, including Parkinson's disease (PD. The enzyme tyrosine hydroxylase (TH catalyzes the formation of L-DOPA, the rate-limiting step in the biosynthesis of dopamine. A lack of dopamine in the striatum is the most characteristic feature of PD, and the cause of the most dominant symptoms. Loss of function mutations in the PTEN-induced putative kinase (PINK1 gene cause autosomal recessive PD. This study explored the basic mechanisms underlying the involvement of pink1 in oxidative stress-mediated PD pathology using zebrafish as a tool. We generated a transgenic line, Tg(pink1:EGFP, and used it to study the effect of oxidative stress (exposure to H2O2 on pink1 expression. GFP expression was enhanced throughout the brain of zebrafish larvae subjected to oxidative stress. In addition to a widespread increase in pink1 mRNA expression, mild oxidative stress induced a clear decline in tyrosine hydroxylase 2 (th2, but not tyrosine hydroxylase 1 (th1 expression, in the brain of wild-type larvae. The drug L-Glutathione Reduced (LGR has been associated with anti-oxidative and possible neuroprotective properties. Administration of LGR normalized the increased fluorescence intensity indicating pink1 transgene expression and endogenous pink1 mRNA expression in larvae subjected to oxidative stress by H2O2. In the pink1 morpholino oliogonucleotide-injected larvae, the reduction in the expression of th1 and th2 was partially rescued by LGR. The pink1 gene is a sensitive marker of oxidative stress in zebrafish, and LGR effectively normalizes the consequences of mild oxidative stress, suggesting that the neuroprotective effects of pink1 and LGR may be significant and useful in drug development.

  2. Transient exposure to ethanol during zebrafish embryogenesis results in defects in neuronal differentiation: an alternative model system to study FASD.

    Directory of Open Access Journals (Sweden)

    Xavier Joya

    Full Text Available The exposure of the human embryo to ethanol results in a spectrum of disorders involving multiple organ systems, including the impairment of the development of the central nervous system (CNS. In spite of the importance for human health, the molecular basis of prenatal ethanol exposure remains poorly understood, mainly to the difficulty of sample collection. Zebrafish is now emerging as a powerful organism for the modeling and the study of human diseases. In this work, we have assessed the sensitivity of specific subsets of neurons to ethanol exposure during embryogenesis and we have visualized the sensitive embryonic developmental periods for specific neuronal groups by the use of different transgenic zebrafish lines.In order to evaluate the teratogenic effects of acute ethanol exposure, we exposed zebrafish embryos to ethanol in a given time window and analyzed the effects in neurogenesis, neuronal differentiation and brain patterning. Zebrafish larvae exposed to ethanol displayed small eyes and/or a reduction of the body length, phenotypical features similar to the observed in children with prenatal exposure to ethanol. When neuronal populations were analyzed, we observed a clear reduction in the number of differentiated neurons in the spinal cord upon ethanol exposure. There was a decrease in the population of sensory neurons mainly due to a decrease in cell proliferation and subsequent apoptosis during neuronal differentiation, with no effect in motoneuron specification.Our investigation highlights that transient exposure to ethanol during early embryonic development affects neuronal differentiation although does not result in defects in early neurogenesis. These results establish the use of zebrafish embryos as an alternative research model to elucidate the molecular mechanism(s of ethanol-induced developmental toxicity at very early stages of embryonic development.

  3. Transient Exposure to Ethanol during Zebrafish Embryogenesis Results in Defects in Neuronal Differentiation: An Alternative Model System to Study FASD

    Science.gov (United States)

    Joya, Xavier; Garcia-Algar, Oscar; Vall, Oriol; Pujades, Cristina

    2014-01-01

    Background The exposure of the human embryo to ethanol results in a spectrum of disorders involving multiple organ systems, including the impairment of the development of the central nervous system (CNS). In spite of the importance for human health, the molecular basis of prenatal ethanol exposure remains poorly understood, mainly to the difficulty of sample collection. Zebrafish is now emerging as a powerful organism for the modeling and the study of human diseases. In this work, we have assessed the sensitivity of specific subsets of neurons to ethanol exposure during embryogenesis and we have visualized the sensitive embryonic developmental periods for specific neuronal groups by the use of different transgenic zebrafish lines. Methodology/Principal Findings In order to evaluate the teratogenic effects of acute ethanol exposure, we exposed zebrafish embryos to ethanol in a given time window and analyzed the effects in neurogenesis, neuronal differentiation and brain patterning. Zebrafish larvae exposed to ethanol displayed small eyes and/or a reduction of the body length, phenotypical features similar to the observed in children with prenatal exposure to ethanol. When neuronal populations were analyzed, we observed a clear reduction in the number of differentiated neurons in the spinal cord upon ethanol exposure. There was a decrease in the population of sensory neurons mainly due to a decrease in cell proliferation and subsequent apoptosis during neuronal differentiation, with no effect in motoneuron specification. Conclusion Our investigation highlights that transient exposure to ethanol during early embryonic development affects neuronal differentiation although does not result in defects in early neurogenesis. These results establish the use of zebrafish embryos as an alternative research model to elucidate the molecular mechanism(s) of ethanol-induced developmental toxicity at very early stages of embryonic development. PMID:25383948

  4. Persistent Oxytetracycline Exposure Induces an Inflammatory Process That Improves Regenerative Capacity in Zebrafish Larvae

    Science.gov (United States)

    Barros-Becker, Francisco; Romero, Jaime; Pulgar, Alvaro; Feijóo, Carmen G.

    2012-01-01

    Background The excessive use of antibiotics in aquaculture can adversely affect not only the environment, but also fish themselves. In this regard, there is evidence that some antibiotics can activate the immune system and reduce their effectiveness. None of those studies consider in detail the adverse inflammatory effect that the antibiotic remaining in the water may cause to the fish. In this work, we use the zebrafish to analyze quantitatively the effects of persistent exposure to oxytetracycline, the most common antibiotic used in fish farming. Methodology We developed a quantitative assay in which we exposed zebrafish larvae to oxytetracycline for a period of 24 to 96 hrs. In order to determinate if the exposure causes any inflammation reaction, we evaluated neutrophils infiltration and quantified their total number analyzing the Tg(mpx:GFP)i114 transgenic line by fluorescence stereoscope, microscope and flow cytometry respectively. On the other hand, we characterized the process at a molecular level by analyzing several immune markers (il-1β, il-10, lysC, mpx, cyp1a) at different time points by qPCR. Finally, we evaluated the influence of the inflammation triggered by oxytetracycline on the regeneration capacity in the lateral line. Conclusions Our results suggest that after 48 hours of exposure, the oxytetracycline triggered a widespread inflammation process that persisted until 96 hours of exposure. Interestingly, larvae that developed an inflammation process showed an improved regeneration capacity in the mechanosensory system lateral line. PMID:22590621

  5. Zebrafish Database: Customizable, Free, and Open-Source Solution for Facility Management.

    Science.gov (United States)

    Yakulov, Toma Antonov; Walz, Gerd

    2015-12-01

    Zebrafish Database is a web-based customizable database solution, which can be easily adapted to serve both single laboratories and facilities housing thousands of zebrafish lines. The database allows the users to keep track of details regarding the various genomic features, zebrafish lines, zebrafish batches, and their respective locations. Advanced search and reporting options are available. Unique features are the ability to upload files and images that are associated with the respective records and an integrated calendar component that supports multiple calendars and categories. Built on the basis of the Joomla content management system, the Zebrafish Database is easily extendable without the need for advanced programming skills.

  6. Meisoindigo, but not its core chemical structure indirubin, inhibits zebrafish interstitial leukocyte chemotactic migration.

    Science.gov (United States)

    Ye, Baixin; Xiong, Xiaoxing; Deng, Xu; Gu, Lijuan; Wang, Qiongyu; Zeng, Zhi; Gao, Xiang; Gao, Qingping; Wang, Yueying

    2017-12-01

    Inflammatory disease is a big threat to human health. Leukocyte chemotactic migration is required for efficient inflammatory response. Inhibition of leukocyte chemotactic migration to the inflammatory site has been shown to provide therapeutic targets for treating inflammatory diseases. Our study was designed to discover effective and safe compounds that can inhibit leukocyte chemotactic migration, thus providing possible novel therapeutic strategy for treating inflammatory diseases. In this study, we used transgenic zebrafish model (Tg:zlyz-EGFP line) to visualize the process of leukocyte chemotactic migration. Then, we used this model to screen the hit compound and evaluate its biological activity on leukocyte chemotactic migration. Furthermore, western blot analysis was performed to evaluate the effect of the hit compound on the AKT or ERK-mediated pathway, which plays an important role in leukocyte chemotactic migration. In this study, using zebrafish-based chemical screening, we identified that the hit compound meisoindigo (25 μM, 50 μM, 75 μM) can significantly inhibit zebrafish leukocyte chemotactic migration in a dose-dependent manner (p = 0.01, p = 0.0006, p migration (p = 0.43). Furthermore, our results unexpectedly showed that indirubin, the core structure of meisoindigo, had no significant effect on zebrafish leukocyte chemotactic migration (p = 0.6001). Additionally, our results revealed that meisoindigo exerts no effect on the Akt or Erk-mediated signalling pathway. Our results suggest that meisoindigo, but not indirubin, is effective for inhibiting leukocyte chemotactic migration, thus providing a potential therapeutic agent for treating inflammatory diseases.

  7. Establishment of infection models in zebrafish larvae (Danio rerio to study the pathogenesis of Aeromonas hydrophila.

    Directory of Open Access Journals (Sweden)

    Paolo Roberto Saraceni

    2016-08-01

    Full Text Available Aeromonas hydrophila is a Gram-negative opportunistic pathogen of fish and terrestrial animals. In humans, A. hydrophila mainly causes gastroenteritis, septicaemia and tissue infections. The mechanisms of infection, the main virulence factors and the host immune response triggered by A. hydrophila have been studied in detail using murine models and adult fish. However, the great limitation of studying adult animals is that the animal must be sacrificed and its tissues/organs extracted, which prevents the study of the infectious processes in the whole living animal.Zebrafish larvae are being used for the analysis of several infectious diseases, but their use for studying the pathogenesis of A. hydrophila has never been explored. The great advantage of zebrafish larvae is their transparency during the first week after fertilization, which allows detailed descriptions of the infectious processes using in vivo imaging techniques such as differential interferential contrast (DIC and fluorescence microscopy. Moreover, the availability of fluorescent pathogens and transgenic reporter zebrafish lines expressing fluorescent immune cells, immune marker genes or cytokines/chemokines allows the host-pathogen interactions to be characterized.The present study explores the suitability of zebrafish larvae to study the pathogenesis of A. hydrophila and the interaction mechanisms between the bacterium and the innate immune responses through an infection model using different routes for infection. We used an early-embryo infection model at 3 days post-fertilization (dpf through the microinjection of A. hydrophila into the duct of Cuvier, caudal vein, notochord or muscle and two bath infection models using 4 dpf healthy and injured larvae. The latter resembled the natural conditions under which A. hydrophila produces infectious diseases in animals. We compared the cellular processes after infection in each anatomical site by confocal fluorescence imaging and

  8. A dominant negative zebrafish Ahr2 partially protects developing zebrafish from dioxin toxicity.

    Directory of Open Access Journals (Sweden)

    Kevin A Lanham

    Full Text Available The toxicity by 2,3,7,8 tetrachlorodibenzo-p-dioxin (TCDD is thought to be caused by activation of the aryl hydrocarbon receptor (AHR. However, our understanding of how AHR activation by TCDD leads to toxic effects is poor. Ideally we would like to manipulate AHR activity in specific tissues and at specific times. One route to this is expressing dominant negative AHRs (dnAHRs. This work describes the construction and characterization of dominant negative forms of the zebrafish Ahr2 in which the C-terminal transactivation domain was either removed, or replaced with the inhibitory domain from the Drosophila engrailed repressor protein. One of these dnAhr2s was selected for expression from the ubiquitously active e2fα promoter in transgenic zebrafish. We found that these transgenic zebrafish expressing dnAhr2 had reduced TCDD induction of the Ahr2 target gene cyp1a, as measured by 7-ethoxyresorufin-O-deethylase activity. Furthermore, the cardiotoxicity produced by TCDD, pericardial edema, heart malformation, and reduced blood flow, were all mitigated in the zebrafish expressing the dnAhr2. These results provide in vivo proof-of-principle results demonstrating the effectiveness of dnAHRs in manipulating AHR activity in vivo, and demonstrating that this approach can be a means for blocking TCDD toxicity.

  9. Assessing Fungal Population in Soil Planted with Cry1Ac and CPTI Transgenic Cotton and Its Conventional Parental Line using 18S and ITS rDNA Sequences over Four Seasons

    Directory of Open Access Journals (Sweden)

    Xiemin Qi

    2016-07-01

    Full Text Available Long-term growth of genetically modified plants (GMPs has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S and region II (ITS1, 5.8S and ITS2 rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10 and 15-year plantation of various transgenic cotton cultivars (TC-15mix over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC were also compared. No notable differences were observed in soil fertility variables among CC, TC-10 and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line.

  10. Expression of bgt gene in transgenic birch (Betula platyphylla Suk ...

    African Journals Online (AJOL)

    Study on the characteristics of integration and expression is the basis of genetic stability of foreign genes in transgenic trees. To obtain insight into the relationship of transgene copy number and expression level, we screened 22 transgenic birch lines. Southern blot analysis of the transgenic birch plants indicated that the ...

  11. Expression of bgt gene in transgenic birch (Betula platyphylla Suk.)

    African Journals Online (AJOL)

    STORAGESEVER

    2009-08-04

    Aug 4, 2009 ... Study on the characteristics of integration and expression is the basis of genetic stability of foreign genes in transgenic trees. To obtain insight into the relationship of transgene copy number and expression level, we screened 22 transgenic birch lines. Southern blot analysis of the transgenic birch.

  12. Establishment and characterization of murine small cell lung carcinoma cell lines derived from HPV-16 E6/E7 transgenic mice.

    Science.gov (United States)

    Carraresi, Laura; Martinelli, Rosanna; Vannoni, Alessandro; Riccio, Massimo; Dembic, Maja; Tripodi, Sergio; Cintorino, Marcella; Santi, Spartaco; Bigliardi, Elisa; Carmellini, Mario; Rossini, Mara

    2006-01-08

    We have established two murine cell lines derived from Small Cell Lung Carcinomas (SCLCs) developed by HPV-E6/E7 transgenic mice. These cells named PPAP-9 and PPAP-10 were isolated from mice bearing tumors, 9 and 10 months old, respectively. The cells, 5 microm in diameter, express HPV oncoproteins and sustain tumor formation after subcutaneous injection in syngenic mice. A detailed analysis indicated the epithelial origin and the neuroendocrine differentiation of these cells. We showed by confocal immunofluorescence the expression of the epithelial marker cytokeratin 5, whose gene promoter was used to direct the expression of HPV E6/E. Cells express several neuroendocrine markers such as CGRP, MAP-2, Ash1, CgrA, Scg2. The neuroendocrine differentiation of these cells was further confirmed by electron microscopy demonstrating neuropeptides secreting granules in their cytoplasm. Furthermore, in agreement with the altered expression observed in the majority of human SCLC we showed in these cells the absence of both p53 and pRB and a dramatic reduction in the expression of Caveolin-1.

  13. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  14. Insect resistance to Nilaparvata lugens and Cnaphalocrocis medinalis in transgenic indica rice and the inheritance of gna+sbti transgenes.

    Science.gov (United States)

    Li, Guiying; Xu, Xinping; Xing, Hengtai; Zhu, Huachen; Fan, Qin

    2005-04-01

    Molecular genetic analysis and insect bioassay of transgenic indica rice 'Zhuxian B' plants carrying snowdrop lectin gene (gna) and soybean trypsin inhibitor gene (sbti) were investigated in detail. PCR, 'dot' blot and PCR-Southern blot analysis showed that both transgenes had been incorporated into the rice genome and transmitted up to R3 progeny in most lines tested. Some transgenic lines exhibited Mendelian segregation, but the other showed either 1:1 (positive: negative for the transgenes) or other aberrant segregation patterns. The segregation patterns of gna gene crossed between R2 and R3 progeny. In half of transgenic R3 lines, gna and sbti transgenes co-segregated. Two independent homozygous lines expressing double transgenes were identified in R3 progeny. Southern blot analysis demonstrated that the copy numbers of integrated gna and sbti transgenes varied from one to ten in different lines. Insect bioassay data showed that most transgenic plants had better resistance to both Nilaparvata lugens (Stahl) and Cnaphalocrocis medinalis (Guenee) than wild-type plants. The insect resistance of transgenic lines increased with the increase in transgene positive ratio in most of the transgenic lines. In all, we obtained nine lines of R3 transgenic plants, including one pure line, which had better resistance to both N lugens and C medinalis than wild-type plants. Copyright 2005 Society of Chemical Industry.

  15. Contemporary zebrafish transgenesis with Tol2 and application for Cre/lox recombination experiments.

    Science.gov (United States)

    Felker, A; Mosimann, C

    2016-01-01

    Spatiotemporal transgene regulation by transgenic DNA recombinases is a central tool for reverse genetics in multicellular organisms, with excellent applications for misexpression and lineage tracing experiments. One of the most widespread technologies for this purpose is Cre recombinase-controlled lox site recombination that is attracting increasing interest in the zebrafish field. Tol2-mediated zebrafish transgenesis provides a stable platform to integrate lox cassette transgenes, while the amenability of the zebrafish embryo to drug treatments makes the model an ideal candidate for tamoxifen-inducible CreERT2 experiments. In addition, advanced transgenesis technologies such as phiC31 or CRISPR-Cas9-based knock-ins are even further promoting zebrafish transgenesis for Cre/lox applications. In this chapter, we will first introduce the basics of Cre/lox methodology, CreERT2 regulation by tamoxifen, as well as the utility of Tol2 and other contemporary transgenesis techniques for Cre/lox experiments. We will then outline in detail practical experimental steps for efficient transgenesis toward the creation of single-insertion transgenes and will introduce protocols for 4-hydroxytamoxifen-mediated CreERT2 induction to perform spatiotemporal lox transgene regulation experiments in zebrafish embryos. Last, we will discuss advanced experimental applications of Cre/lox beyond traditional lineage tracing approaches. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. No direct effects of two transgenic Bt rice lines, T1C-19 and T2A-1, on the arthropod communities.

    Science.gov (United States)

    Lu, Z B; Tian, J C; Han, N S; Hu, C; Peng, Y F; Stanley, David; Ye, G Y

    2014-10-01

    A 2-yr field trial was conducted to assess the impacts of two new transgenic Bt rice lines, T1C-19 expressing Cry1C protein and T2A-1 expressing Cry2A protein, on the arthropod community sampled via vacuum. All the arthropods were classified into five guilds, including herbivores, parasitoids, predators, detritivores, and others. The seasonal density and dominance distribution of each guild and community-level indices (species richness, Shannon-Wiener diversity index, Simpson diversity index, and evenness index) were compared among rice types. Principal response curves were used to investigate the differences of entire arthropod community of Bt rice plots relative to non-Bt rice plots. The results showed no significant difference was detected in the community-level indices and dominance distribution of guilds between Bt and non-Bt rice plots. The seasonal density of herbivores, detritivores, and others as well as density of the arthropod overall community were also not significantly affected by rice types in either year, although the density of predators and parasitoids in Bt rice plots was significantly lower than those in non-Bt rice plots. The lower abundances of Braconidae, Eulophidae, Cyrtorhinus lividipennis (Reuter) (Hemiptera: Miridae), and Theridiidae in Bt rice plots are likely attributed to the lower abundances of prey species or hosts. Principal response curves revealed that arthropod community in Bt was similar with that in non-Bt rice plots. In conclusion, our findings indicate that these two tested Bt rice lines had no marked negative effects on the arthropod community in the paddy fields.

  17. Pineal photoreceptor cells are required for maintaining the circadian rhythms of behavioral visual sensitivity in zebrafish.

    Directory of Open Access Journals (Sweden)

    Xinle Li

    Full Text Available In non-mammalian vertebrates, the pineal gland functions as the central pacemaker that regulates the circadian rhythms of animal behavior and physiology. We generated a transgenic zebrafish line [Tg(Gnat2:gal4-VP16/UAS:nfsB-mCherry] in which the E. coli nitroreductase is expressed in pineal photoreceptor cells. In developing embryos and young adults, the transgene is expressed in both retinal and pineal photoreceptor cells. During aging, the expression of the transgene in retinal photoreceptor cells gradually diminishes. By 8 months of age, the Gnat2 promoter-driven nitroreductase is no longer expressed in retinal photoreceptor cells, but its expression in pineal photoreceptor cells persists. This provides a tool for selective ablation of pineal photoreceptor cells, i.e., by treatments with metronidazole. In the absence of pineal photoreceptor cells, the behavioral visual sensitivity of the fish remains unchanged; however, the circadian rhythms of rod and cone sensitivity are diminished. Brief light exposures restore the circadian rhythms of behavioral visual sensitivity. Together, the data suggest that retinal photoreceptor cells respond to environmental cues and are capable of entraining the circadian rhythms of visual sensitivity; however, they are insufficient for maintaining the rhythms. Cellular signals from the pineal photoreceptor cells may be required for maintaining the circadian rhythms of visual sensitivity.

  18. Transgenic overexpression of BAFF regulates the expression of ...

    Indian Academy of Sciences (India)

    LI ZHANG

    Hubei 430030, People's Republic of China. 3Second ... body homogenate of zebrafish and demonstrated a significant increase in BAFF-transgenic group. Therefore, our ... diet and brine shrimp according to the conditions in our sys- tem (Li et al. 2014). ... images were captured using a Leica DM3000B microscope. Embryos ...

  19. Multiple upstream modules regulate zebrafish myf5 expression

    Directory of Open Access Journals (Sweden)

    Weng Chih-Wei

    2007-01-01

    Full Text Available Abstract Background Myf5 is one member of the basic helix-loop-helix family of transcription factors, and it functions as a myogenic factor that is important for the specification and differentiation of muscle cells. The expression of myf5 is somite- and stage-dependent during embryogenesis through a delicate regulation. However, this complex regulatory mechanism of myf5 is not clearly understood. Results We isolated a 156-kb bacterial artificial chromosome clone that includes an upstream 80-kb region and a downstream 70-kb region of zebrafish myf5 and generated a transgenic line carrying this 156-kb segment fused to a green fluorescent protein (GFP reporter gene. We find strong GFP expression in the most rostral somite and in the presomitic mesoderm during segmentation stages, similar to endogenous myf5 expression. Later, the GFP signals persist in caudal somites near the tail bud but are down-regulated in the older, rostral somites. During the pharyngula period, we detect GFP signals in pectoral fin buds, dorsal rostral myotomes, hypaxial myotomes, and inferior oblique and superior oblique muscles, a pattern that also corresponds well with endogenous myf5 transcripts. To characterize the specific upstream cis-elements that regulate this complex and dynamic expression pattern, we also generated several transgenic lines that harbor various lengths within the upstream 80-kb segment. We find that (1 the -80 kb/-9977 segment contains a fin and cranial muscle element and a notochord repressor; (2 the -9977/-6213 segment contains a strong repressive element that does not include the notochord-specific repressor; (3 the -6212/-2938 segment contains tissue-specific elements for bone and spinal cord; (4 the -2937/-291 segment contains an eye enhancer, and the -2937/-2457 segment is required for notochord and myocyte expression; and (5 the -290/-1 segment is responsible for basal transcription in somites and the presomitic mesoderm. Conclusion We suggest

  20. Macrophage–Microbe Interactions: Lessons from the Zebrafish Model

    Directory of Open Access Journals (Sweden)

    Nagisa Yoshida

    2017-12-01

    Full Text Available Macrophages provide front line defense against infections. The study of macrophage–microbe interplay is thus crucial for understanding pathogenesis and infection control. Zebrafish (Danio rerio larvae provide a unique platform to study macrophage–microbe interactions in vivo, from the level of the single cell to the whole organism. Studies using zebrafish allow non-invasive, real-time visualization of macrophage recruitment and phagocytosis. Furthermore, the chemical and genetic tractability of zebrafish has been central to decipher the complex role of macrophages during infection. Here, we discuss the latest developments using zebrafish models of bacterial and fungal infection. We also review novel aspects of macrophage biology revealed by zebrafish, which can potentiate development of new therapeutic strategies for humans.

  1. Evaluating human cancer cell metastasis in zebrafish

    International Nuclear Information System (INIS)

    Teng, Yong; Xie, Xiayang; Walker, Steven; White, David T; Mumm, Jeff S; Cowell, John K

    2013-01-01

    In vivo metastasis assays have traditionally been performed in mice, but the process is inefficient and costly. However, since zebrafish do not develop an adaptive immune system until 14 days post-fertilization, human cancer cells can survive and metastasize when transplanted into zebrafish larvae. Despite isolated reports, there has been no systematic evaluation of the robustness of this system to date. Individual cell lines were stained with CM-Dil and injected into the perivitelline space of 2-day old zebrafish larvae. After 2-4 days fish were imaged using confocal microscopy and the number of metastatic cells was determined using Fiji software. To determine whether zebrafish can faithfully report metastatic potential in human cancer cells, we injected a series of cells with different metastatic potential into the perivitelline space of 2 day old embryos. Using cells from breast, prostate, colon and pancreas we demonstrated that the degree of cell metastasis in fish is proportional to their invasion potential in vitro. Highly metastatic cells such as MDA231, DU145, SW620 and ASPC-1 are seen in the vasculature and throughout the body of the fish after only 24–48 hours. Importantly, cells that are not invasive in vitro such as T47D, LNCaP and HT29 do not metastasize in fish. Inactivation of JAK1/2 in fibrosarcoma cells leads to loss of invasion in vitro and metastasis in vivo, and in zebrafish these cells show limited spread throughout the zebrafish body compared with the highly metastatic parental cells. Further, knockdown of WASF3 in DU145 cells which leads to loss of invasion in vitro and metastasis in vivo also results in suppression of metastasis in zebrafish. In a cancer progression model involving normal MCF10A breast epithelial cells, the degree of invasion/metastasis in vitro and in mice is mirrored in zebrafish. Using a modified version of Fiji software, it is possible to quantify individual metastatic cells in the transparent larvae to correlate with

  2. Identification of Chemical Inhibitors of β-Catenin-Driven Liver Tumorigenesis in Zebrafish.

    Directory of Open Access Journals (Sweden)

    Kimberley J Evason

    2015-07-01

    Full Text Available Hepatocellular carcinoma (HCC is one of the most lethal human cancers. The search for targeted treatments has been hampered by the lack of relevant animal models for the genetically diverse subsets of HCC, including the 20-40% of HCCs that are defined by activating mutations in the gene encoding β-catenin. To address this chemotherapeutic challenge, we created and characterized transgenic zebrafish expressing hepatocyte-specific activated β-catenin. By 2 months post fertilization (mpf, 33% of transgenic zebrafish developed HCC in their livers, and 78% and 80% of transgenic zebrafish showed HCC at 6 and 12 mpf, respectively. As expected for a malignant process, transgenic zebrafish showed significantly decreased mean adult survival compared to non-transgenic control siblings. Using this novel transgenic model, we screened for druggable pathways that mediate β-catenin-induced liver growth and identified two c-Jun N-terminal kinase (JNK inhibitors and two antidepressants (one tricyclic antidepressant, amitriptyline, and one selective serotonin reuptake inhibitor that suppressed this phenotype. We further found that activated β-catenin was associated with JNK pathway hyperactivation in zebrafish and in human HCC. In zebrafish larvae, JNK inhibition decreased liver size specifically in the presence of activated β-catenin. The β-catenin-specific growth-inhibitory effect of targeting JNK was conserved in human liver cancer cells. Our other class of hits, antidepressants, has been used in patient treatment for decades, raising the exciting possibility that these drugs could potentially be repurposed for cancer treatment. In support of this proposal, we found that amitriptyline decreased tumor burden in a mouse HCC model. Our studies implicate JNK inhibitors and antidepressants as potential therapeutics for β-catenin-induced liver tumors.

  3. Zebrafish models of cardiovascular diseases and their applications in herbal medicine research.

    Science.gov (United States)

    Seto, Sai-Wang; Kiat, Hosen; Lee, Simon M Y; Bensoussan, Alan; Sun, Yu-Ting; Hoi, Maggie P M; Chang, Dennis

    2015-12-05

    The zebrafish (Danio rerio) has recently become a powerful animal model for cardiovascular research and drug discovery due to its ease of maintenance, genetic manipulability and ability for high-throughput screening. Recent advances in imaging techniques and generation of transgenic zebrafish have greatly facilitated in vivo analysis of cellular events of cardiovascular development and pathogenesis. More importantly, recent studies have demonstrated the functional similarity of drug metabolism systems between zebrafish and humans, highlighting the clinical relevance of employing zebrafish in identifying lead compounds in Chinese herbal medicine with potential beneficial cardiovascular effects. This paper seeks to summarise the scope of zebrafish models employed in cardiovascular studies and the application of these research models in Chinese herbal medicine to date. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.

  4. Myotonia congenita-associated mutations in chloride channel-1 affect zebrafish body wave swimming kinematics.

    Science.gov (United States)

    Cheng, Wei; Tian, Jing; Burgunder, Jean-Marc; Hunziker, Walter; Eng, How-Lung

    2014-01-01

    Myotonia congenita is a human muscle disorder caused by mutations in CLCN1, which encodes human chloride channel 1 (CLCN1). Zebrafish is becoming an increasingly useful model for human diseases, including muscle disorders. In this study, we generated transgenic zebrafish expressing, under the control of a muscle specific promoter, human CLCN1 carrying mutations that have been identified in human patients suffering from myotonia congenita. We developed video analytic tools that are able to provide precise quantitative measurements of movement abnormalities in order to analyse the effect of these CLCN1 mutations on adult transgenic zebrafish swimming. Two new parameters for body-wave kinematics of swimming reveal changes in body curvature and tail offset in transgenic zebrafish expressing the disease-associated CLCN1 mutants, presumably due to their effect on muscle function. The capability of the developed video analytic tool to distinguish wild-type from transgenic zebrafish could provide a useful asset to screen for compounds that reverse the disease phenotype, and may be applicable to other movement disorders besides myotonia congenita.

  5. Myotonia congenita-associated mutations in chloride channel-1 affect zebrafish body wave swimming kinematics.

    Directory of Open Access Journals (Sweden)

    Wei Cheng

    Full Text Available Myotonia congenita is a human muscle disorder caused by mutations in CLCN1, which encodes human chloride channel 1 (CLCN1. Zebrafish is becoming an increasingly useful model for human diseases, including muscle disorders. In this study, we generated transgenic zebrafish expressing, under the control of a muscle specific promoter, human CLCN1 carrying mutations that have been identified in human patients suffering from myotonia congenita. We developed video analytic tools that are able to provide precise quantitative measurements of movement abnormalities in order to analyse the effect of these CLCN1 mutations on adult transgenic zebrafish swimming. Two new parameters for body-wave kinematics of swimming reveal changes in body curvature and tail offset in transgenic zebrafish expressing the disease-associated CLCN1 mutants, presumably due to their effect on muscle function. The capability of the developed video analytic tool to distinguish wild-type from transgenic zebrafish could provide a useful asset to screen for compounds that reverse the disease phenotype, and may be applicable to other movement disorders besides myotonia congenita.

  6. Protective Effect of Phillyrin on Lethal LPS-Induced Neutrophil Inflammation in Zebrafish

    Directory of Open Access Journals (Sweden)

    Liling Yang

    2017-10-01

    Full Text Available Background/Aims: Forsythia suspensa Vahl. (Oleaceae fruits are widely used in traditional Chinese medicine to treat pneumonia, typhoid, dysentery, ulcers and oedema. Antibacterial and anti-inflammatory activities have been reported for phillyrin (PHN, the main ingredient in Forsythia suspensa Vahl fruits, in vitro. However, the underlying mechanisms in vivo remain poorly defined. In this study, we discovered that PHN exerted potent anti-inflammatory effects in lethal LPS-induced neutrophil inflammation by suppressing the MyD88-dependent signalling pathway in zebrafish. Methods: LPS-yolk microinjection was used to induce a lethal LPS-infected zebrafish model. The effect of PHN on the survival of zebrafish challenged with lethal LPS was evaluated using survival analysis. The effect of PHN on neutrophil inflammation grading in vivo was assessed by tracking neutrophils with a transgenic line. The effects of PHN on neutrophil production and migration were analysed by SB+ cell counts during consecutive hours after modelling. Additionally, key cytokines and members of the MyD88 signalling pathway that are involved in inflammatory response were detected using quantitative RT-PCR. To assess gene expression changes during consecutive hours after modelling, the IL-1β, IL-6, TNF-α, MyD88, TRIF, ERK1/2, JNK, IκBa and NF-κB expression levels were measured. Results: PHN could protect zebrafish against a lethal LPS challenge in a dose-dependent manner, as indicated by decreased neutrophil infltration, reduced tissue necrosis and increased survival rates. Up-regulated IL-1β, IL-6 and TNF-α expression also showed the same tendencies of depression by PHN. Critically, PHN significantly inhibited the LPS-induced activation of MyD88, IκBa, and NF-κB but did not affect the expression of ERK1/2 MAPKs or JNK MAPKs in LPS-stimulated zebrafish. Additionally, PHN regulated the MyD88/IκBα/NF-κB signalling pathway by controlling IκBα, IL-1β, IL-6, and TNF

  7. Hedgehog-PKA signaling and gnrh3 regulate the development of zebrafish gnrh3 neurons.

    Directory of Open Access Journals (Sweden)

    Ming-Wei Kuo

    Full Text Available GnRH neurons secrete GnRH that controls the development of the reproduction system. Despite many studies, the signals controlling the development of GnRH neurons from its progenitors have not been fully established. To understand the development of GnRH neurons, we examined the development of gnrh3-expressing cells using a transgenic zebrafish line that expresses green fluorescent protein (GFP and LacZ driven by the gnrh3 promoter. GFP and LacZ expression recapitulated that of gnrh3 in the olfactory region, olfactory bulb and telencephalon. Depletion of gnrh3 by morpholinos led to a reduction of GFP- and gnrh3-expressing cells, while over-expression of gnrh3 mRNA increased the number of these cells. This result indicates a positive feed-forward regulation of gnrh3 cells by gnrh3. The gnrh3 cells were absent in embryos that lack Hedgehog signaling, but their numbers were increased in embryos overexpressing shhb. We manipulated the amounts of kinase that antagonizes the Hedgehog signaling pathway, protein kinase A (PKA, by treating embryos with PKA activator forskolin or by injecting mRNAs encoding its constitutively active catalytic subunit (PKA* and dominant negative regulatory subunit (PKI into zebrafish embryos. PKA* misexpression or forskolin treatment decreased GFP cell numbers, while PKI misexpression led to ectopic production of GFP cells. Our data indicate that the Hedgehog-PKA pathway participates in the development of gnrh3-expressing neurons during embryogenesis.

  8. A live zebrafish-based screening system for human nuclear receptor ligand and cofactor discovery.

    Science.gov (United States)

    Tiefenbach, Jens; Moll, Pamela R; Nelson, Meryl R; Hu, Chun; Baev, Lilia; Kislinger, Thomas; Krause, Henry M

    2010-03-22

    Nuclear receptors (NRs) belong to a superfamily of transcription factors that regulate numerous homeostatic, metabolic and reproductive processes. Taken together with their modulation by small lipophilic molecules, they also represent an important and successful class of drug targets. Although many NRs have been targeted successfully, the majority have not, and one third are still orphans. Here we report the development of an in vivo GFP-based reporter system suitable for monitoring NR activities in all cells and tissues using live zebrafish (Danio rerio). The human NR fusion proteins used also contain a new affinity tag cassette allowing the purification of receptors with bound molecules from responsive tissues. We show that these constructs 1) respond as expected to endogenous zebrafish hormones and cofactors, 2) facilitate efficient receptor and cofactor purification, 3) respond robustly to NR hormones and drugs and 4) yield readily quantifiable signals. Transgenic lines representing the majority of human NRs have been established and are available for the investigation of tissue- and isoform-specific ligands and cofactors.

  9. A live zebrafish-based screening system for human nuclear receptor ligand and cofactor discovery.

    Directory of Open Access Journals (Sweden)

    Jens Tiefenbach

    2010-03-01

    Full Text Available Nuclear receptors (NRs belong to a superfamily of transcription factors that regulate numerous homeostatic, metabolic and reproductive processes. Taken together with their modulation by small lipophilic molecules, they also represent an important and successful class of drug targets. Although many NRs have been targeted successfully, the majority have not, and one third are still orphans. Here we report the development of an in vivo GFP-based reporter system suitable for monitoring NR activities in all cells and tissues using live zebrafish (Danio rerio. The human NR fusion proteins used also contain a new affinity tag cassette allowing the purification of receptors with bound molecules from responsive tissues. We show that these constructs 1 respond as expected to endogenous zebrafish hormones and cofactors, 2 facilitate efficient receptor and cofactor purification, 3 respond robustly to NR hormones and drugs and 4 yield readily quantifiable signals. Transgenic lines representing the majority of human NRs have been established and are available for the investigation of tissue- and isoform-specific ligands and cofactors.

  10. Hypoxia-induced retinal neovascularization in zebrafish embryos: a potential model of retinopathy of prematurity.

    Science.gov (United States)

    Wu, Yu-Ching; Chang, Chao-Yuan; Kao, Alex; Hsi, Brian; Lee, Shwu-Huey; Chen, Yau-Hung; Wang, I-Jong

    2015-01-01

    Retinopathy of prematurity, formerly known as a retrolental fibroplasia, is a leading cause of infantile blindness worldwide. Retinopathy of prematurity is caused by the failure of central retinal vessels to reach the retinal periphery, creating a nonperfused peripheral retina, resulting in retinal hypoxia, neovascularization, vitreous hemorrhage, vitreoretinal fibrosis, and loss of vision. We established a potential retinopathy of prematurity model by using a green fluorescent vascular endothelium zebrafish transgenic line treated with cobalt chloride (a hypoxia-inducing agent), followed by GS4012 (a vascular endothelial growth factor inducer) at 24 hours postfertilization, and observed that the number of vascular branches and sprouts significantly increased in the central retinal vascular trunks 2-4 days after treatment. We created an angiography method by using tetramethylrhodamine dextran, which exhibited severe vascular leakage through the vessel wall into the surrounding retinal tissues. The quantification of mRNA extracted from the heads of the larvae by using real-time quantitative polymerase chain reaction revealed a twofold increase in vegfaa and vegfr2 expression compared with the control group, indicating increased vascular endothelial growth factor signaling in the hypoxic condition. In addition, we demonstrated that the hypoxic insult could be effectively rescued by several antivascular endothelial growth factor agents such as SU5416, bevacizumab, and ranibizumab. In conclusion, we provide a simple, highly reproducible, and clinically relevant retinopathy of prematurity model based on zebrafish embryos; this model may serve as a useful platform for clarifying the mechanisms of human retinopathy of prematurity and its progression.

  11. Ex vivo tools for the clonal analysis of zebrafish hematopoiesis

    Czech Academy of Sciences Publication Activity Database

    Svoboda, Ondřej; Stachura, D.L.; Machoňová, Olga; Zon, L.I.; Traver, D.; Bartůněk, Petr

    2016-01-01

    Roč. 11, č. 5 (2016), s. 1007-1020 ISSN 1754-2189 R&D Projects: GA MŠk LO1419; GA ČR GA16-21024S Institutional support: RVO:68378050 Keywords : stem-cells * in-vitro * vertebrate hematopoiesis * transgenic zebrafish * progenitor cells * danio-rerio * fish * thrombopoietin * identification * specification Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 10.032, year: 2016

  12. Simultaneous mapping of membrane voltage and calcium in zebrafish heart in vivo reveals chamber-specific developmental transitions in ionic currents

    Directory of Open Access Journals (Sweden)

    Jennifer H Hou

    2014-09-01

    Full Text Available The cardiac action potential (AP and the consequent cytosolic Ca2+ transient are key indicators of cardiac function. Natural developmental processes, as well as many drugs and pathologies change the waveform, propagation, or variability (between cells or over time of these parameters. Here we apply a genetically encoded dual-function calcium and voltage reporter (CaViar to study the development of the zebrafish heart in vivo between 1.5 and 4 days post fertilization (dpf. We developed a high-sensitivity spinning disk confocal microscope and associated software for simultaneous three-dimensional optical mapping of voltage and calcium. We produced a transgenic zebrafish line expressing CaViar under control of the heart-specific cmlc2 promoter, and applied ion channel blockers at a series of developmental stages to map the maturation of the action potential in vivo. Early in development, the AP initiated via a calcium current through L-type calcium channels. Between 90 – 102 hours post fertilization (hpf, the ventricular AP switched to a sodium-driven upswing, while the atrial AP remained calcium driven. In the adult zebrafish heart, a sodium current drives the AP in both the atrium and ventricle. Simultaneous voltage and calcium imaging with genetically encoded reporters provides a new approach for monitoring cardiac development, and the effects of drugs on cardiac function.

  13. Additive effects of levonorgestrel and ethinylestradiol on brain aromatase (cyp19a1b) in zebrafish specific in vitro and in vivo bioassays

    Energy Technology Data Exchange (ETDEWEB)

    Hinfray, N., E-mail: nathalie.hinfray@ineris.fr [INERIS, Unité d' écotoxicologie in vitro et in vivo , Verneuil-en-Halatte (France); Tebby, C. [INERIS, Unité Modèles pour l' Ecotoxicologie et la Toxicologie, Verneuil-en-Halatte (France); Garoche, C.; Piccini, B. [INERIS, Unité d' écotoxicologie in vitro et in vivo , Verneuil-en-Halatte (France); Bourgine, G. [IRSET, équipe NEED, Université de Rennes 1, Rennes (France); Aït-Aïssa, S. [INERIS, Unité d' écotoxicologie in vitro et in vivo , Verneuil-en-Halatte (France); Kah, O. [IRSET, équipe NEED, Université de Rennes 1, Rennes (France); Pakdel, F. [IRSET, Inserm U1085, équipe TREC, Université de Rennes 1, Rennes (France); Brion, F. [INERIS, Unité d' écotoxicologie in vitro et in vivo , Verneuil-en-Halatte (France)

    2016-09-15

    Estrogens and progestins are widely used in combination in human medicine and both are present in aquatic environment. Despite the joint exposure of aquatic wildlife to estrogens and progestins, very little information is available on their combined effects. In the present study we investigated the effect of ethinylestradiol (EE2) and Levonorgestrel (LNG), alone and in mixtures, on the expression of the brain specific ER-regulated cyp19a1b gene. For that purpose, recently established zebrafish-derived tools were used: (i) an in vitro transient reporter gene assay in a human glial cell line (U251-MG) co-transfected with zebrafish estrogen receptors (zfERs) and the luciferase gene under the control of the zebrafish cyp19a1b gene promoter and (ii) an in vivo bioassay using a transgenic zebrafish expressing GFP under the control of the zebrafish cyp19a1b gene promoter (cyp19a1b-GFP). Concentration-response relationships for single chemicals were modeled and used to design the mixture experiments following a ray design. The results from mixture experiments were analyzed to predict joint effects according to concentration addition and statistical approaches were used to characterize the potential interactions between the components of the mixtures (synergism/antagonism). We confirmed that some progestins could elicit estrogenic effects in fish brain. In mixtures, EE2 and LNG exerted additive estrogenic effects both in vitro and in vivo, suggesting that some environmental progestin could exert effects that will add to those of environmental (xeno-)estrogens. Moreover, our zebrafish specific assays are valuable tools that could be used in risk assessment for both single chemicals and their mixtures. - Highlights: • Combined effects of EE2 and LNG were assessed on ER-dependent cyp19a1b expression. • EE2 and LNG alone induced brain aromatase in zebrafish specific bioassays. • Experimental ray design allowed complete concentration-response surfaces modeling. • EE2 and

  14. Accumulation of nickel in transgenic tobacco

    Science.gov (United States)

    Sidik, Nik Marzuki; Othman, Noor Farhan

    2013-11-01

    The accumulation of heavy metal Ni in the roots and leaves of four T1 transgenic lines of tobacco (T(1)20E, T(1)24C, T(1)18B1 and T(1)20B) expressing eiMT1 from E.indica was assessed. The aim of the study was to investigate the level of Ni accumulation in the leaves and roots of each transgenic lines and to evaluate the eligibility of the plants to be classified as a phytoremediation agent. All of the transgenic lines showed different ability in accumulating different metals and has translocation factor (TF) less than 1 (TFtransgenic lines, transgenic line T(1)24C showed the highest accumulation of Ni (251.9 ± 0.014 mg/kg) and the lowest TF value (TFT(1)24C=0.0875) at 60 ppm Ni.

  15. Culturable gut microbiota diversity in zebrafish.

    Science.gov (United States)

    Cantas, Leon; Sørby, Jan Roger Torp; Aleström, Peter; Sørum, Henning

    2012-03-01

    The zebrafish (Danio rerio) is an increasingly used laboratory animal model in basic biology and biomedicine, novel drug development, and toxicology. The wide use has increased the demand for optimized husbandry protocols to ensure animal health care and welfare. The knowledge about the correlation between culturable zebrafish intestinal microbiota and health in relation to environmental factors and management procedures is very limited. A semi-quantitative level of growth of individual types of bacteria was determined and associated with sampling points. A total of 72 TAB line zebrafish from four laboratories (Labs A-D) in the Zebrafish Network Norway were used. Diagnostic was based on traditional bacterial culture methods and biochemical characterization using commercial kits, followed by 16S rDNA gene sequencing from pure subcultures. Also selected Gram-negative isolates were analyzed for antibiotic susceptibility to 8 different antibiotics. A total of 13 morphologically different bacterial species were the most prevalent: Aeromonas hydrophila, Aeromonas sobria, Vibrio parahaemolyticus, Photobacterium damselae, Pseudomonas aeruginosa, Pseudomonas fluorescens, Pseudomonas luteola, Comamonas testosteroni, Ochrobactrum anthropi, Staphylococcus cohnii, Staphylococcus epidermidis, Staphylococcus capitis, and Staphylococcus warneri. Only Lab B had significantly higher levels of total bacterial growth (OR=2.03), whereas numbers from Lab C (OR=1.01) and Lab D (OR=1.12) were found to be similar to the baseline Lab A. Sexually immature individuals had a significantly higher level of harvested total bacterial growth than mature fish (OR=0.82), no statistically significant differences were found between male and female fish (OR=1.01), and the posterior intestinal segment demonstrated a higher degree of culturable bacteria than the anterior segment (OR=4.1). Multiple antibiotic (>3) resistance was observed in 17% of the strains. We propose that a rapid conventional

  16. Rapid method for identification of transgenic fish zygosity

    Directory of Open Access Journals (Sweden)

    . Alimuddin

    2007-07-01

    Full Text Available Identification of zygosity in transgenik fish is normally achieved by PCR analysis with genomic DNA template extracted from the tissue of progenies which are derived by mating the transgenic fish and wild-type counterpart.  This method needs relatively large amounts of fish material and is time- and labor-intensive. New approaches addressing this problem could be of great help for fish biotechnologists.  In this experiment, we applied a quantitative real-time PCR (qr-PCR method to analyze zygosity in a stable line of transgenic zebrafish (Danio rerio carrying masu salmon, Oncorhynchus masou D6-desaturase-like gene. The qr-PCR was performed using iQ SYBR Green Supermix in the iCycler iQ Real-time PCR Detection System (Bio-Rad Laboratories, USA.  Data were analyzed using the comparative cycle threshold method.  The results demonstrated a clear-cut identification of all transgenic fish (n=20 classified as a homozygous or heterozygous.  Mating of those fish with wild-type had revealed transgene transmission to the offspring following expected Mendelian laws. Thus, we found that the qTR-PCR to be effective for a rapid and precise determination of zygosity in transgenic fish. This technique could be useful in the establishment of breeding programs for mass transgenic fish production and in experiments in which zygosity effect could have a functional impact. Keywords: quantitative real-time PCR; zygosity; transgenic fish; mass production   ABSTRAK Identifikasi sigositas ikan transgenik biasanya dilakukan menggunakan analisa PCR dengan cetakan DNA genomik yang diekstraksi dari jaringan ikan hasil persilangan antara ikan transgenik dan ikan normal.   Metode ini memerlukan ikan dalam jumlah yang banyak, dan juga waktu serta tenaga.  Pendekatan baru untuk mengatasi masalah tersebut akan memberikan manfaat besar kepada peneliti bioteknologi perikanan.  Pada penelitian ini, kami menggunakan metode PCR real-time kuantitatif (krt-PCR untuk

  17. Stimulatory and inhibitory mechanisms of slow muscle-specific myosin heavy chain gene expression in fish: Transient and transgenic analysis of torafugu MYHM86-2 promoter in zebrafish embryos

    International Nuclear Information System (INIS)

    Asaduzzaman, Md.; Kinoshita, Shigeharu; Bhuiyan, Sharmin Siddique; Asakawa, Shuichi; Watabe, Shugo

    2013-01-01

    The myosin heavy chain gene, MYH M86-2 , exhibited restricted expression in slow muscle fibers of torafugu embryos and larvae, suggesting its functional roles for embryonic and larval muscle development. However, the transcriptional mechanisms involved in its expression are still ambiguous. The present study is the first extensive analysis of slow muscle-specific MYH M86-2 promoter in fish for identifying the cis-elements that are crucial for its expression. Combining both transient transfection and transgenic approaches, we demonstrated that the 2614 bp 5′-flanking sequences of MYH M86-2 contain a sufficient promoter activity to drive gene expression specific to superficial slow muscle fibers. By cyclopamine treatment, we also demonstrated that the differentiation of such superficial slow muscle fibers depends on hedgehog signaling activity. The deletion analyses defined an upstream fragment necessary for repressing ectopic MYH M86-2 expression in the fast muscle fibers. The transcriptional mechanism that prevents MYH M86-2 expression in the fast muscle fibers is mediated through Sox6 binding elements. We also demonstrated that Sox6 may function as a transcriptional repressor of MYH M86-2 expression. We further discovered that nuclear factor of activated T cells (NFAT) binding elements plays a key role and myocyte enhancer factor-2 (MEF2) binding elements participate in the transcriptional regulation of MYH M86-2 expression. - Highlights: ► MYH M86-2 is highly expressed in slow muscle fibers of torafugu embryos and larvae. ► MYH M86-2 promoter activity depends on the hedgehog signaling. ► Sox6 binding elements inhibits MYH M86-2 expression in fast muscle fibers. ► Sox6 elements function as transcriptional repressor of MYH M86-2 promoter activity. ► NFAT and MEF2 binding elements play a key role for directing MYH M86-2 expression

  18. 2013 North Dakota Transgenic Barley Research and FHB Nursery Report

    Science.gov (United States)

    Research continues to develop and test new transgenic plants using genes provided by collaborators. As lines are developed in Golden Promise, they are crossed to Conlon for field testing. Transgenic lines developed in Conlon are being crossed to resistant lines developed by the breeding programs. ...

  19. Swimming Effects on Developing Zebrafish

    NARCIS (Netherlands)

    Kranenbarg, S.; Pelster, B.

    2013-01-01

    Zebrafish represent an important vertebrate model species in developmental biology. This chapter reviews the effects of exercise on the development of the musculoskeletal system, the cardiovascular system, metabolic capacities of developing zebrafish, and regulation of these processes on the gene

  20. The mechanism of thioacetamide-induced apoptosis in the L37 albumin-SV40 T-antigen transgenic rat hepatocyte-derived cell line occurs without DNA fragmentation.

    Science.gov (United States)

    Bulera, S J; Sattler, C A; Gast, W L; Heath, S; Festerling, T A; Pitot, H C

    1998-10-01

    The hepatotoxicant thioacetamide (TH) has classically been used as a model to study hepatic necrosis; however, recent studies have shown that TH can also induce apoptosis. In this report we demonstrate that 2.68+/-0.54% of the albumin-SV40 T-antigen transgenic rat hepatocytes undergo TH-induced apoptosis, a level comparable to other in vivo models of liver apoptosis. In addition, TH could induce apoptosis and necrosis in the L37 albumin-SV40 T-antigen transgenic rat liver-derived cell line. Examination of dying L37 cells treated with 100 mM TH by electron microscopy revealed distinct morphological characteristics that could be attributed to apoptosis. Quantitation of apoptosis by FACS analysis 24 h after treatment with 100 mM TH revealed that 81.3+/-1.6% of the cells were undergoing apoptosis. In contrast, when L37 cells were treated with 250 mM TH, cells exhibited characteristics consistent with necrotic cell death. DNA fragmentation ladders were produced by growth factor withdrawal-induced apoptosis; however, in 100 mM TH-induced apoptosis, DNA fragmentation ladders were not observed. Analysis of endonuclease activity in L37 cells revealed that the enzymes were not inactivated in the presence of 100 mM TH. The data presented in this report indicate that the L37 cell line could be used to study the mechanism of TH-induced apoptosis that was not mediated through a mechanism requiring DNA fragmentation.

  1. Zebrafish syntenic relationship to human/mouse genomes revealed by radiation hybrid mapping

    International Nuclear Information System (INIS)

    Samonte, Irene E.

    2007-01-01

    Zebrafish (Danio rerio) is an excellent model system for vertebrate developmental analysis and a new model for human disorders. In this study, however, zebrafish was used to determine its syntenic relationship to human/mouse genomes using the zebrafish-hamster radiation hybrid panel. The focus was on genes residing on chromosomes 6 and 17 of human and mouse, respectively, and some other genes of either immunologic or evolutionary importance. Gene sequences of interest and zebrafish expressed sequence tags deposited in the GenBank were used in identifying zebrafish homologs. Polymerase chain reaction (PCR) amplification, cloning and subcloning, sequencing, and phylogenetic analysis were done to confirm the homology of the candidate genes in zebrafish. The promising markers were then tested in the 94 zebrafish-hamster radiation hybrid panel cell lines and submitted for logarithm of the odds (LOD) score analysis to position genes on the zebrafish map. A total of 19 loci were successfully mapped to zebrafish linkage groups 1, 14, 15, 19, and 20. Four of these loci were positioned in linkage group 20, whereas, 3 more loci were added in linkage group 19, thus increasing to 34 loci the number of human genes syntenic to the group. With the sequencing of the zebrafish genome, about 20 more MHC genes were reported linked on the same group. (Author)

  2. Zebrafish ( Danio rerio) as a model for investigating the safety of GM feed ingredients (soya and maize); performance, stress response and uptake of dietary DNA sequences.

    Science.gov (United States)

    Sissener, Nini H; Johannessen, Lene E; Hevrøy, Ernst M; Wiik-Nielsen, Christer R; Berdal, Knut G; Nordgreen, Andreas; Hemre, Gro-Ingunn

    2010-01-01

    A 20-d zebrafish (Danio rerio) feeding trial, in which a near doubling of fish weight was achieved, was conducted with GM feed ingredients to evaluate feed intake, growth, stress response and uptake of dietary DNA. A partial aim of the study was to assess zebrafish as a model organism in GM safety assessments. Roundup Ready soya (RRS), YieldGard Bt maize (MON810) and their non-modified, maternal, near-isogenic lines were used in a 2 x 2 factorial design. Soya variety and maize variety were the main factors, both with two levels; non-GM and GM. Compared with fish fed non-GM maize, those fed GM maize exhibited significantly better growth, had lower mRNA transcription levels of superoxide dismutase (SOD)-1 and a tendency (non-significant) towards lower transcription of heat shock protein 70 in liver. Sex of the fish and soya variety had significant interaction effects on total RNA yield from the whole liver and transcription of SOD-1, suggesting that some diet component affecting males and females differently was present in different levels in the GM and the non-GM soya used in the present study. Dietary DNA sequences were detected in all of the organs analysed, but not all of the samples. Soya and maize rubisco (non-transgenic, multicopy genes) were most frequently detected, while MON810 transgenic DNA fragments were detected in some samples and RRS fragments were not detected. In conclusion, zebrafish shows promise as a model for this application.

  3. Characterization of Pax3 and Sox10 transgenic Xenopus laevis embryos as tools to study neural crest development.

    Science.gov (United States)

    Alkobtawi, Mansour; Ray, Heather; Barriga, Elias H; Moreno, Mauricio; Kerney, Ryan; Monsoro-Burq, Anne-Helene; Saint-Jeannet, Jean-Pierre; Mayor, Roberto

    2018-03-06

    The neural crest is a multipotent population of cells that originates a variety of cell types. Many animal models are used to study neural crest induction, migration and differentiation, with amphibians and birds being the most widely used systems. A major technological advance to study neural crest development in mouse, chick and zebrafish has been the generation of transgenic animals in which neural crest specific enhancers/promoters drive the expression of either fluorescent proteins for use as lineage tracers, or modified genes for use in functional studies. Unfortunately, no such transgenic animals currently exist for the amphibians Xenopus laevis and tropicalis, key model systems for studying neural crest development. Here we describe the generation and characterization of two transgenic Xenopus laevis lines, Pax3-GFP and Sox10-GFP, in which GFP is expressed in the pre-migratory and migratory neural crest, respectively. We show that Pax3-GFP could be a powerful tool to study neural crest induction, whereas Sox10-GFP could be used in the study of neural crest migration in living embryos. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Zebrafish Health Conditions in the China Zebrafish Resource Center and 20 Major Chinese Zebrafish Laboratories.

    Science.gov (United States)

    Liu, Liyue; Pan, Luyuan; Li, Kuoyu; Zhang, Yun; Zhu, Zuoyan; Sun, Yonghua

    2016-07-01

    In China, the use of zebrafish as an experimental animal in the past 15 years has widely expanded. The China Zebrafish Resource Center (CZRC), which was established in 2012, is becoming one of the major resource centers in the global zebrafish community. Large-scale use and regular exchange of zebrafish resources have put forward higher requirements on zebrafish health issues in China. This article reports the current aquatic infrastructure design, animal husbandry, and health-monitoring programs in the CZRC. Meanwhile, through a survey of 20 Chinese zebrafish laboratories, we also describe the current health status of major zebrafish facilities in China. We conclude that it is of great importance to establish a widely accepted health standard and health-monitoring strategy in the Chinese zebrafish research community.

  5. Effects of copper oxide nanoparticles and copper ions to zebrafish (Danio rerio) cells, embryos and fry

    DEFF Research Database (Denmark)

    Thit, Amalie; Skjolding, Lars Michael; Selck, Henriette

    2017-01-01

    The use of engineered metal nanoparticles (NPs) is continuously increasing and so is the need for information regarding their toxicity. This study compares the toxicity of CuO NPs with ionic Cu in three zebrafish model systems; zebrafish hepatoma cell line (ZFL), fish embryo toxicity test (FET) a...

  6. Multiple zebrafish atoh1 genes specify a diversity of neuronal types in the zebrafish cerebellum.

    Science.gov (United States)

    Kidwell, Chelsea U; Su, Chen-Ying; Hibi, Masahiko; Moens, Cecilia B

    2018-06-01

    A single Atoh1 basic-helix-loop-helix transcription factor specifies multiple neuron types in the mammalian cerebellum and anterior hindbrain. The zebrafish genome encodes three paralagous atoh1 genes whose functions in cerebellum and anterior hindbrain development we explore here. With use of a transgenic reporter, we report that zebrafish atoh1c-expressing cells are organized in two distinct domains that are separated both by space and developmental time. An early isthmic expression domain gives rise to an extracerebellar population in rhombomere 1 and an upper rhombic lip domain gives rise to granule cell progenitors that migrate to populate all four granule cell territories of the fish cerebellum. Using genetic mutants we find that of the three zebrafish atoh1 paralogs, atoh1c and atoh1a are required for the full complement of granule neurons. Surprisingly, the two genes are expressed in non-overlapping granule cell progenitor populations, indicating that fish use duplicate atoh1 genes to generate granule cell diversity that is not detected in mammals. Finally, live imaging of granule cell migration in wildtype and atoh1c mutant embryos reveals that while atoh1c is not required for granule cell specification per se, it is required for granule cells to delaminate and migrate away from the rhombic lip. Copyright © 2018 Elsevier Inc. All rights reserved.

  7. A genetic screen for vascular mutants in zebrafish reveals dynamic roles for Vegf/Plcg1 signaling during artery development.

    Science.gov (United States)

    Covassin, L D; Siekmann, A F; Kacergis, M C; Laver, E; Moore, J C; Villefranc, J A; Weinstein, B M; Lawson, N D

    2009-05-15

    In this work we describe a forward genetic approach to identify mutations that affect blood vessel development in the zebrafish. By applying a haploid screening strategy in a transgenic background that allows direct visualization of blood vessels, it was possible to identify several classes of mutant vascular phenotypes. Subsequent characterization of mutant lines revealed that defects in Vascular endothelial growth factor (Vegf) signaling specifically affected artery development. Comparison of phenotypes associated with different mutations within a functional zebrafish Vegf receptor-2 ortholog (referred to as kdr-like, kdrl) revealed surprisingly varied effects on vascular development. In parallel, we identified an allelic series of mutations in phospholipase c gamma 1 (plcg1). Together with in vivo structure-function analysis, our results suggest a requirement for Plcg1 catalytic activity downstream of receptor tyrosine kinases. We further find that embryos lacking both maternal and zygotic plcg1 display more severe defects in artery differentiation but are otherwise similar to zygotic mutants. Finally, we demonstrate through mosaic analysis that plcg1 functions autonomously in endothelial cells. Together our genetic analyses suggest that Vegf/Plcg1 signaling acts at multiple time points and in different signaling contexts to mediate distinct aspects of artery development.

  8. Toxicity assessment of zebrafish following exposure to CdTe QDs

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wei, E-mail: wzhang@ecust.edu.cn [State Environmental Protection Key Laboratory of Environmental Risk Assessment and Control on Chemical Process, East China University of Science and Technology, Shanghai 200237 (China); Shanghai Key Laboratory of Functional Materials Chemistry, East China University of Science and Technology, Shanghai 200237 (China); School of Resource and Environmental Engineering, East China University of Science and Technology, Shanghai 200237 (China); Lin, Kuangfei, E-mail: kflin@ecust.edu.cn [State Environmental Protection Key Laboratory of Environmental Risk Assessment and Control on Chemical Process, East China University of Science and Technology, Shanghai 200237 (China); Shanghai Key Laboratory of Functional Materials Chemistry, East China University of Science and Technology, Shanghai 200237 (China); School of Resource and Environmental Engineering, East China University of Science and Technology, Shanghai 200237 (China); Miao, Youna [State Environmental Protection Key Laboratory of Environmental Risk Assessment and Control on Chemical Process, East China University of Science and Technology, Shanghai 200237 (China); Shanghai Key Laboratory of Functional Materials Chemistry, East China University of Science and Technology, Shanghai 200237 (China); School of Resource and Environmental Engineering, East China University of Science and Technology, Shanghai 200237 (China); Dong, Qiaoxiang; Huang, Changjiang; Wang, Huili [Zhejiang Provincial Key Lab for Technology and Application of Model Organisms, Wenzhou Medical College, Wenzhou 325035 (China); Guo, Meijin [State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237 (China); Cui, Xinhong [Shanghai Institute of Landscape Gardening, Shanghai 200233 (China)

    2012-04-30

    Highlights: Black-Right-Pointing-Pointer The LC{sub 50} of TGA-CdTe for zebrafish at 120 hpf was 185.9 nM. Black-Right-Pointing-Pointer Zebrafish exposed to TGA-CdTe resulted in lower hatch rate and more malformation. Black-Right-Pointing-Pointer Body length and heart beat of zebrafish declined after exposure to TGA-CdTe. Black-Right-Pointing-Pointer Larvae exposure to TGA-CdTe elicited a higher basal swimming rate. Black-Right-Pointing-Pointer Abnormal vascular of FLI-1 transgenic zebrafish larvae exposed to TGA-CdTe occurred. - Abstract: CdTe quantum dots (QDs) are nanocrystals of unique composition and properties that have found many new commercial applications; therefore, their potential toxicity to aquatic organisms has become a hot research topic. The lab study was performed to determine the developmental and behavioral toxicities to zebrafish under continuous exposure to low concentrations of CdTe QDs (1-400 nM) coated with thioglycolic acid (TGA). The results show: (1) the 120 h LC{sub 50} of 185.9 nM, (2) the lower hatch rate and body length, more malformations, and less heart beat and swimming speed of the exposed zebrafish, (3) the brief burst and a higher basal swimming rate of the exposed zebrafish larvae during a rapid transition from light-to-dark, and (4) the vascular hyperplasia, vascular bifurcation, vascular crossing and turbulence of the exposed FLI-1 transgenic zebrafish larvae.

  9. Innovative Disease Model: Zebrafish as an In Vivo Platform for Intestinal Disorder and Tumors

    Directory of Open Access Journals (Sweden)

    Jeng-Wei Lu

    2017-09-01

    Full Text Available Colorectal cancer (CRC is one of the world’s most common cancers and is the second leading cause of cancer deaths, causing more than 50,000 estimated deaths each year. Several risk factors are highly associated with CRC, including being overweight, eating a diet high in red meat and over-processed meat, having a history of inflammatory bowel disease, and smoking. Previous zebrafish studies have demonstrated that multiple oncogenes and tumor suppressor genes can be regulated through genetic or epigenetic alterations. Zebrafish research has also revealed that the activation of carcinogenesis-associated signal pathways plays an important role in CRC. The biology of cancer, intestinal disorders caused by carcinogens, and the morphological patterns of tumors have been found to be highly similar between zebrafish and humans. Therefore, the zebrafish has become an important animal model for translational medical research. Several zebrafish models have been developed to elucidate the characteristics of gastrointestinal diseases. This review article focuses on zebrafish models that have been used to study human intestinal disorders and tumors, including models involving mutant and transgenic fish. We also report on xenograft models and chemically-induced enterocolitis. This review demonstrates that excellent zebrafish models can provide novel insights into the pathogenesis of gastrointestinal diseases and help facilitate the evaluation of novel anti-tumor drugs.

  10. Requirement of vasculogenesis and blood circulation in late stages of liver growth in zebrafish

    Directory of Open Access Journals (Sweden)

    Wohland Thorsten

    2008-09-01

    Full Text Available Abstract Background Early events in vertebrate liver development have been the major focus in previous studies, however, late events of liver organogenesis remain poorly understood. Liver vasculogenesis in vertebrates occurs through the interaction of endoderm-derived liver epithelium and mesoderm-derived endothelial cells (ECs. In zebrafish, although it has been found that ECs are not required for liver budding, how and when the spatio-temporal pattern of liver growth is coordinated with ECs remains to be elucidated. Results To study the process of liver development and vasculogenesis in vivo, a two-color transgenic zebrafish line Tg(lfabf:dsRed; elaA:EGFP was generated and named LiPan for liver-specific expression of DsRed RFP and exocrine pancreas-specific expression of GFP. Using the LiPan line, we first followed the dynamic development of liver from live embryos to adult and showed the formation of three distinct yet connected liver lobes during development. The LiPan line was then crossed with Tg(fli1:EGFPy1 and vascular development in the liver was traced in vivo. Liver vasculogenesis started at 55–58 hpf when ECs first surrounded hepatocytes from the liver bud surface and then invaded the liver to form sinusoids and later the vascular network. Using a novel non-invasive and label-free fluorescence correction spectroscopy, we detected blood circulation in the liver starting at ~72 hpf. To analyze the roles of ECs and blood circulation in liver development, both cloche mutants (lacking ECs and Tnnt2 morphants (no blood circulation were employed. We found that until 70 hpf liver growth and morphogenesis depended on ECs and nascent sinusoids. After 72 hpf, a functional sinusoidal network was essential for continued liver growth. An absence of blood circulation in Tnnt2 morphants caused defects in liver vasculature and small liver. Conclusion There are two phases of liver development in zebrafish, budding and growth. In the growth phase

  11. Transcriptomic Analysis Of Purified Embryonic Neural Stem Cells From Zebrafish Embryos Reveals Signalling Pathways Involved In Glycine-dependent Neurogenesis

    Directory of Open Access Journals (Sweden)

    Eric eSAMARUT

    2016-03-01

    Full Text Available How is the initial set of neurons correctly established during the development of the vertebrate central nervous system? In the embryo, glycine and GABA are depolarizing due the immature chloride gradient, which is only reversed to become hyperpolarizing later in post-natal development. We previously showed that glycine regulates neurogenesis via paracrine signalling that promotes calcium transients in neural stem cells (NSCs and their differentiation into interneurons within the spinal cord of the zebrafish embryo. However, the subjacent molecular mechanisms are not yet understood. Our previous work suggests that early neuronal progenitors were not differentiating correctly in the developing spinal cord. As a result, we aimed at identifying the downstream molecular mechanisms involved specifically in NSCs during glycine-dependent embryonic neurogenesis. Using a gfap:GFP transgenic line, we successfully purified NSCs by fluorescence-activated cell sorting (FACS from whole zebrafish embryos and in embryos in which the glycine receptor was knocked down. The strength of this approach is that it focused on the NSC population while tackling the biological issue in an in vivo context in whole zebrafish embryos. After sequencing the transcriptome by RNA-sequencing, we analyzed the genes whose expression was changed upon disruption of glycine signalling and we confirmed the differential expression by independent RTqPCR assay. While over a thousand genes showed altered expression levels, through pathway analysis we identified 14 top candidate genes belonging to five different canonical signalling pathways (signalling by calcium, TGF-beta, sonic hedgehog, Wnt and p53-related apoptosis that are likely to mediate the promotion of neurogenesis by glycine.

  12. Whole-body and multispectral photoacoustic imaging of adult zebrafish

    Science.gov (United States)

    Huang, Na; Xi, Lei

    2016-10-01

    Zebrafish is a top vertebrate model to study developmental biology and genetics, and it is becoming increasingly popular for studying human diseases due to its high genome similarity to that of humans and the optical transparency in embryonic stages. However, it becomes difficult for pure optical imaging techniques to volumetric visualize the internal organs and structures of wild-type zebrafish in juvenile and adult stages with excellent resolution and penetration depth. Even with the establishment of mutant lines which remain transparent over the life cycle, it is still a challenge for pure optical imaging modalities to image the whole body of adult zebrafish with micro-scale resolution. However, the method called photoacoustic imaging that combines all the advantages of the optical imaging and ultrasonic imaging provides a new way to image the whole body of the zebrafish. In this work, we developed a non-invasive photoacoustic imaging system with optimized near-infrared illumination and cylindrical scanning to image the zebrafish. The lateral and axial resolution yield to 80 μm and 600 μm, respectively. Multispectral strategy with wavelengths from 690 nm to 930 nm was employed to image various organs inside the zebrafish. From the reconstructed images, most major organs and structures inside the body can be precisely imaged. Quantitative and statistical analysis of absorption for organs under illumination with different wavelengths were carried out.

  13. Lipid Uptake, Metabolism, and Transport in the Larval Zebrafish

    Directory of Open Access Journals (Sweden)

    Vanessa H. Quinlivan

    2017-11-01

    Full Text Available The developing zebrafish is a well-established model system for studies of energy metabolism, and is amenable to genetic, physiological, and biochemical approaches. For the first 5 days of life, nutrients are absorbed from its endogenous maternally deposited yolk. At 5 days post-fertilization, the yolk is exhausted and the larva has a functional digestive system including intestine, liver, gallbladder, pancreas, and intestinal microbiota. The transparency of the larval zebrafish, and the genetic and physiological similarity of its digestive system to that of mammals make it a promising system in which to address questions of energy homeostasis relevant to human health. For example, apolipoprotein expression and function is similar in zebrafish and mammals, and transgenic animals may be used to examine both the transport of lipid from yolk to body in the embryo, and the trafficking of dietary lipids in the larva. Additionally, despite the identification of many fatty acid and lipid transport proteins expressed by vertebrates, the cell biological processes that mediate the transport of dietary lipids from the intestinal lumen to the interior of enterocytes remain to be elucidated. Genetic tractability and amenability to live imaging and a range of biochemical methods make the larval zebrafish an ideal model in which to address open questions in the field of lipid transport, energy homeostasis, and nutrient metabolism.

  14. Imaging Subcellular Structures in the Living Zebrafish Embryo.

    Science.gov (United States)

    Engerer, Peter; Plucinska, Gabriela; Thong, Rachel; Trovò, Laura; Paquet, Dominik; Godinho, Leanne

    2016-04-02

    In vivo imaging provides unprecedented access to the dynamic behavior of cellular and subcellular structures in their natural context. Performing such imaging experiments in higher vertebrates such as mammals generally requires surgical access to the system under study. The optical accessibility of embryonic and larval zebrafish allows such invasive procedures to be circumvented and permits imaging in the intact organism. Indeed the zebrafish is now a well-established model to visualize dynamic cellular behaviors using in vivo microscopy in a wide range of developmental contexts from proliferation to migration and differentiation. A more recent development is the increasing use of zebrafish to study subcellular events including mitochondrial trafficking and centrosome dynamics. The relative ease with which these subcellular structures can be genetically labeled by fluorescent proteins and the use of light microscopy techniques to image them is transforming the zebrafish into an in vivo model of cell biology. Here we describe methods to generate genetic constructs that fluorescently label organelles, highlighting mitochondria and centrosomes as specific examples. We use the bipartite Gal4-UAS system in multiple configurations to restrict expression to specific cell-types and provide protocols to generate transiently expressing and stable transgenic fish. Finally, we provide guidelines for choosing light microscopy methods that are most suitable for imaging subcellular dynamics.

  15. [Progress in transgenic fish techniques and application].

    Science.gov (United States)

    Ye, Xing; Tian, Yuan-Yuan; Gao, Feng-Ying

    2011-05-01

    Transgenic technique provides a new way for fish breeding. Stable lines of growth hormone gene transfer carps, salmon and tilapia, as well as fluorescence protein gene transfer zebra fish and white cloud mountain minnow have been produced. The fast growth characteristic of GH gene transgenic fish will be of great importance to promote aquaculture production and economic efficiency. This paper summarized the progress in transgenic fish research and ecological assessments. Microinjection is still the most common used method, but often resulted in multi-site and multi-copies integration. Co-injection of transposon or meganuclease will greatly improve the efficiency of gene transfer and integration. "All fish" gene or "auto gene" should be considered to produce transgenic fish in order to eliminate misgiving on food safety and to benefit expression of the transferred gene. Environmental risk is the biggest obstacle for transgenic fish to be commercially applied. Data indicates that transgenic fish have inferior fitness compared with the traditional domestic fish. However, be-cause of the genotype-by-environment effects, it is difficult to extrapolate simple phenotypes to the complex ecological interactions that occur in nature based on the ecological consequences of the transgenic fish determined in the laboratory. It is critical to establish highly naturalized environments for acquiring reliable data that can be used to evaluate the environ-mental risk. Efficacious physical and biological containment strategies remain to be crucial approaches to ensure the safe application of transgenic fish technology.

  16. Neuroanatomy and transgenic technologies

    Science.gov (United States)

    This is a short review that introduces recent advances of neuroanatomy and transgenic technologies. The anatomical complexity of the nervous system remains a subject of tremendous fascination among neuroscientists. In order to tackle this extraordinary complexity, powerful transgenic technologies a...

  17. In silico and in situ characterization of the zebrafish (Danio rerio gnrh3 (sGnRH gene

    Directory of Open Access Journals (Sweden)

    Husebye Harald

    2002-08-01

    Full Text Available Abstract Background Gonadotropin releasing hormone (GnRH is responsible for stimulation of gonadotropic hormone (GtH in the hypothalamus-pituitary-gonadal axis (HPG. The regulatory mechanisms responsible for brain specificity make the promoter attractive for in silico analysis and reporter gene studies in zebrafish (Danio rerio. Results We have characterized a zebrafish [Trp7, Leu8] or salmon (s GnRH variant, gnrh3. The gene includes a 1.6 Kb upstream regulatory region and displays the conserved structure of 4 exons and 3 introns, as seen in other species. An in silico defined enhancer at -976 in the zebrafish promoter, containing adjacent binding sites for Oct-1, CREB and Sp1, was predicted in 2 mammalian and 5 teleost GnRH promoters. Reporter gene studies confirmed the importance of this enhancer for cell specific expression in zebrafish. Interestingly the promoter of human GnRH-I, known as mammalian GnRH (mGnRH, was shown capable of driving cell specific reporter gene expression in transgenic zebrafish. Conclusions The characterized zebrafish Gnrh3 decapeptide exhibits complete homology to the Atlantic salmon (Salmo salar GnRH-III variant. In silico analysis of mammalian and teleost GnRH promoters revealed a conserved enhancer possessing binding sites for Oct-1, CREB and Sp1. Transgenic and transient reporter gene expression in zebrafish larvae, confirmed the importance of the in silico defined zebrafish enhancer at -976. The capability of the human GnRH-I promoter of directing cell specific reporter gene expression in zebrafish supports orthology between GnRH-I and GnRH-III.

  18. LINES

    Directory of Open Access Journals (Sweden)

    Minas Bakalchev

    2015-10-01

    Full Text Available The perception of elements in a system often creates their interdependence, interconditionality, and suppression. The lines from a basic geometrical element have become the model of a reductive world based on isolation according to certain criteria such as function, structure, and social organization. Their traces are experienced in the contemporary world as fragments or ruins of a system of domination of an assumed hierarchical unity. How can one release oneself from such dependence or determinism? How can the lines become less “systematic” and forms more autonomous, and less reductive? How is a form released from modernistic determinism on the new controversial ground? How can these elements or forms of representation become forms of action in the present complex world? In this paper, the meaning of lines through the ideas of Le Corbusier, Leonidov, Picasso, and Hitchcock is presented. Spatial research was made through a series of examples arising from the projects of the architectural studio “Residential Transformations”, which was a backbone for mapping the possibilities ranging from playfulness to exactness, as tactics of transformation in the different contexts of the contemporary world.

  19. CRISPR/Cas9-Mediated Zebrafish Knock-in as a Novel Strategy to Study Midbrain-Hindbrain Boundary Development.

    Science.gov (United States)

    Kesavan, Gokul; Chekuru, Avinash; Machate, Anja; Brand, Michael

    2017-01-01

    The midbrain-hindbrain boundary (MHB) acts as an organizer and controls the fate of neighboring cells to develop into either mesencephalic (midbrain) or metencephalic (hindbrain) cells by secreting signaling molecules like Wnt1 and Fgf8. The zebrafish is an excellent vertebrate model for studying MHB development due to the ease of gene manipulation and the possibility of following cellular dynamics and morphogenetic processes using live imaging. Currently, only very few reporter and/or Cre-driver lines are available to study gene expression at the MHB, hampering the understanding of MHB development, and traditional transgenic technologies using promoter/enhancer fragments or bacterial artificial chromosome (BAC)-mediated transgenesis often do not faithfully recapitulate endogenous expression patterns. In contrast, CRISPR/Cas9-mediated genome editing technology now provides a great opportunity to efficiently knock-in or knock-out genes. We have generated four CRISPR/Cas9-based knock-in fluorescent reporter lines for two crucial genes involved in MHB development, namely otx2 and pax2a . The coding sequences of the reporters were knocked-in upstream of the corresponding ATG and are, thus, under the control of the endogenous promoter/enhancer elements. Interestingly, this strategy does not disturb endogenous gene expression. Using the fast maturing fluorescent protein reporter, Venus, enabled us to follow MHB development using cell tracking and live imaging. In addition, we show that these reporter lines label various neuronal and glial cell types in the adult zebrafish brain, making them highly suitable for investigating embryonic and adult midbrain, hindbrain, and MHB development.

  20. Transposon-mediated BAC transgenesis in zebrafish and mice

    Directory of Open Access Journals (Sweden)

    Sumiyama Kenta

    2009-10-01

    Full Text Available Abstract Background Bacterial artificial chromosomes (BACs are among the most widely used tools for studies of gene regulation and function in model vertebrates, yet methods for predictable delivery of BAC transgenes to the genome are currently limited. This is because BAC transgenes are usually microinjected as naked DNA into fertilized eggs and are known to integrate as multi-copy concatamers in the genome. Although conventional methods for BAC transgenesis have been very fruitful, complementary methods for generating single copy BAC integrations would be desirable for many applications. Results We took advantage of the precise cut-and-paste behavior of a natural transposon, Tol2, to develop a new method for BAC transgenesis. In this new method, the minimal sequences of the Tol2 transposon were used to deliver precisely single copies of a ~70 kb BAC transgene to the zebrafish and mouse genomes. We mapped the BAC insertion sites in the genome by standard PCR methods and confirmed transposase-mediated integrations. Conclusion The Tol2 transposon has a surprisingly large cargo capacity that can be harnessed for BAC transgenesis. The precise delivery of single-copy BAC transgenes by Tol2 represents a useful complement to conventional BAC transgenesis, and could aid greatly in the production of transgenic fish and mice for genomics projects, especially those in which single-copy integrations are desired.

  1. Cerebroventricular Microinjection (CVMI) into Adult Zebrafish Brain Is an Efficient Misexpression Method for Forebrain Ventricular Cells

    Science.gov (United States)

    Kizil, Caghan; Brand, Michael

    2011-01-01

    The teleost fish Danio rerio (zebrafish) has a remarkable ability to generate newborn neurons in its brain at adult stages of its lifespan-a process called adult neurogenesis. This ability relies on proliferating ventricular progenitors and is in striking contrast to mammalian brains that have rather restricted capacity for adult neurogenesis. Therefore, investigating the zebrafish brain can help not only to elucidate the molecular mechanisms of widespread adult neurogenesis in a vertebrate species, but also to design therapies in humans with what we learn from this teleost. Yet, understanding the cellular behavior and molecular programs underlying different biological processes in the adult zebrafish brain requires techniques that allow manipulation of gene function. As a complementary method to the currently used misexpression techniques in zebrafish, such as transgenic approaches or electroporation-based delivery of DNA, we devised a cerebroventricular microinjection (CVMI)-assisted knockdown protocol that relies on vivo morpholino oligonucleotides, which do not require electroporation for cellular uptake. This rapid method allows uniform and efficient knockdown of genes in the ventricular cells of the zebrafish brain, which contain the neurogenic progenitors. We also provide data on the use of CVMI for growth factor administration to the brain – in our case FGF8, which modulates the proliferation rate of the ventricular cells. In this paper, we describe the CVMI method and discuss its potential uses in zebrafish. PMID:22076157

  2. Cell migration during heart regeneration in zebrafish.

    Science.gov (United States)

    Tahara, Naoyuki; Brush, Michael; Kawakami, Yasuhiko

    2016-07-01

    Zebrafish possess the remarkable ability to regenerate injured hearts as adults, which contrasts the very limited ability in mammals. Although very limited, mammalian hearts do in fact have measurable levels of cardiomyocyte regeneration. Therefore, elucidating mechanisms of zebrafish heart regeneration would provide information of naturally occurring regeneration to potentially apply to mammalian studies, in addition to addressing this biologically interesting phenomenon in itself. Studies over the past 13 years have identified processes and mechanisms of heart regeneration in zebrafish. After heart injury, pre-existing cardiomyocytes dedifferentiate, enter the cell cycle, and repair the injured myocardium. This process requires interaction with epicardial cells, endocardial cells, and vascular endothelial cells. Epicardial cells envelope the heart, while endocardial cells make up the inner lining of the heart. They provide paracrine signals to cardiomyocytes to regenerate the injured myocardium, which is vascularized during heart regeneration. In addition, accumulating results suggest that local migration of these major cardiac cell types have roles in heart regeneration. In this review, we summarize the characteristics of various heart injury methods used in the research community and regeneration of the major cardiac cell types. Then, we discuss local migration of these cardiac cell types and immune cells during heart regeneration. Developmental Dynamics 245:774-787, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  3. DNA mismatch repair, genome instability and cancer in zebrafish

    NARCIS (Netherlands)

    Feitsma, H.

    2008-01-01

    The objective of this study was to find out whether the zebrafish can be an appropriate model for studying DNA repair and cancer. For this purpose three fish lines were used that lack components of an important mechanism for the repair of small DNA damage: DNA mismatch repair. These fish are

  4. Feature Binding in Zebrafish

    Directory of Open Access Journals (Sweden)

    P Neri

    2012-07-01

    Full Text Available Binding operations are primarily ascribed to cortex or similarly complex avian structures. My experiments show that the zebrafish, a lower vertebrate lacking cortex, supports visual feature binding of form and motion for the purpose of social behavior. These results challenge the notion that feature binding may require highly evolved neural structures and demonstrate that the nervous system of lower vertebrates can afford unexpectedly complex computations.

  5. Transgenic plants with enhanced growth characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

    2018-01-09

    The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

  6. Transgenic plants with enhanced growth characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

    2016-09-06

    The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

  7. Requirement for Pdx1 in specification of latent endocrine progenitors in zebrafish

    Directory of Open Access Journals (Sweden)

    Ellertsdottir Elin

    2011-10-01

    Full Text Available Abstract Background Insulin-producing beta cells emerge during pancreas development in two sequential waves. Recently described later-forming beta cells in zebrafish show high similarity to second wave mammalian beta cells in developmental capacity. Loss-of-function studies in mouse and zebrafish demonstrated that the homeobox transcription factors Pdx1 and Hb9 are both critical for pancreas and beta cell development and discrete stage-specific requirements for these genes have been uncovered. Previously, exocrine and endocrine cell recovery was shown to follow loss of pdx1 in zebrafish, but the progenitor cells and molecular mechanisms responsible have not been clearly defined. In addition, interactions of pdx1 and hb9 in beta cell formation have not been addressed. Results To learn more about endocrine progenitor specification, we examined beta cell formation following morpholino-mediated depletion of pdx1 and hb9. We find that after early beta cell reduction, recovery occurs following loss of either pdx1 or hb9 function. Unexpectedly, simultaneous knockdown of both hb9 and pdx1 leads to virtually complete and persistent beta cell deficiency. We used a NeuroD:EGFP transgenic line to examine endocrine cell behavior in vivo and developed a novel live-imaging technique to document emergence and migration of late-forming endocrine precursors in real time. Our data show that Notch-responsive progenitors for late-arising endocrine cells are predominantly post mitotic and depend on pdx1. By contrast, early-arising endocrine cells are specified and differentiate independent of pdx1. Conclusions The nearly complete beta cell deficiency after combined loss of hb9 and pdx1 suggests functional cooperation, which we clarify as distinct roles in early and late endocrine cell formation. A novel imaging approach permitted visualization of the emergence of late endocrine cells within developing embryos for the first time. We demonstrate a pdx1-dependent

  8. Pharmacological analyses of learning and memory in zebrafish (Danio rerio).

    Science.gov (United States)

    Bailey, Jordan M; Oliveri, Anthony N; Levin, Edward D

    2015-12-01

    Over the last decade, zebrafish (Danio rerio) have become valuable as a complementary model in behavioral pharmacology, opening a new avenue for understanding the relationships between drug action and behavior. This species offers a useful intermediate approach bridging the gap between in vitro studies and traditional mammalian models. Zebrafish offer great advantages of economy compared to their rodent counterparts, their complex brains and behavioral repertoire offer great translational potential relative to in vitro models. The development and validation of a variety of tests to measure behavior, including cognition, in zebrafish have set the stage for the use of this animal for behavioral pharmacology studies. This has led to research into the basic mechanisms of cognitive function as well as screening for potential cognition-improving drug therapies, among other lines of research. As with all models, zebrafish have limitations, which span pharmacokinetic challenges to difficulties quantifying behavior. The use, efficacy and limitations associated with a zebrafish model of cognitive function are discussed in this review, within the context of behavioral pharmacology. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Regulation of zebrafish CYP3A65 transcription by AHR2

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Chin-Teng; Chung, Hsin-Yu; Su, Hsiao-Ting; Tseng, Hua-Pin [Institute of Bioscience and Biotechnology, National Taiwan Ocean University, Keelung, Taiwan (China); Tzou, Wen-Shyong [Institute of Bioscience and Biotechnology, National Taiwan Ocean University, Keelung, Taiwan (China); Center of Excellence for Marine Bioenvironment and Biotechnology, National Taiwan Ocean University, Keelung, Taiwan (China); Hu, Chin-Hwa, E-mail: chhu@mail.ntou.edu.tw [Institute of Bioscience and Biotechnology, National Taiwan Ocean University, Keelung, Taiwan (China); Center of Excellence for Marine Bioenvironment and Biotechnology, National Taiwan Ocean University, Keelung, Taiwan (China)

    2013-07-15

    CYP3A proteins are the most abundant CYPs in the liver and intestines, and they play a pivotal role in drug metabolism. In mammals, CYP3A genes are induced by various xenobiotics through processes mediated by PXR. We previously identified zebrafish CYP3A65 as a CYP3A ortholog that is constitutively expressed in gastrointestinal tissues, and is upregulated by treatment with dexamethasone, rifampicin or tetrachlorodibenzo-p-dioxin (TCDD). However, the underlying mechanism of TCDD-mediated CYP3A65 transcription is unclear. Here we generated two transgenic zebrafish, Tg(CYP3A65S:EGFP) and Tg(CYP3A65L:EGFP), which contain 2.1 and 5.4 kb 5′ flanking sequences, respectively, of the CYP3A65 gene upstream of EGFP. Both transgenic lines express EGFP in larval gastrointestinal tissues in a pattern similar to that of the endogenous CYP3A65 gene. Moreover, EGFP expression can be significantly induced by TCDD exposure during the larval stage. In addition, EGFP expression can be stimulated by kynurenine, a putative AHR ligand produced during tryptophan metabolism. AHRE elements in the upstream regulatory region of the CYP3A65 gene are indispensible for basal and TCDD-induced transcription. Furthermore, the AHR2 DNA and ligand-binding domains are required to mediate effective CYP3A65 transcription. AHRE sequences are present in the promoters of many teleost CYP3 genes, but not of mammalian CYP3 genes, suggesting that AHR/AHR2-mediated transcription is likely a common regulatory mechanism for teleost CYP3 genes. It may also reflect the different environments that terrestrial and aquatic organisms encounter. - Highlights: • Tg(CYP3A65:EGFP) and CYP3A65 exhibits identical expression pattern. • CYP3A65 can be significantly induced by TCDD or kynurenine. • The AHRE elements are required to mediate CYP3A65 transcription. • The AHR2 DNA and ligand-binding domains are required for CYP3A65 transcription. • AHRE elements are present in many teleost CYP3 genes, but not in

  10. Regulation of zebrafish CYP3A65 transcription by AHR2

    International Nuclear Information System (INIS)

    Chang, Chin-Teng; Chung, Hsin-Yu; Su, Hsiao-Ting; Tseng, Hua-Pin; Tzou, Wen-Shyong; Hu, Chin-Hwa

    2013-01-01

    CYP3A proteins are the most abundant CYPs in the liver and intestines, and they play a pivotal role in drug metabolism. In mammals, CYP3A genes are induced by various xenobiotics through processes mediated by PXR. We previously identified zebrafish CYP3A65 as a CYP3A ortholog that is constitutively expressed in gastrointestinal tissues, and is upregulated by treatment with dexamethasone, rifampicin or tetrachlorodibenzo-p-dioxin (TCDD). However, the underlying mechanism of TCDD-mediated CYP3A65 transcription is unclear. Here we generated two transgenic zebrafish, Tg(CYP3A65S:EGFP) and Tg(CYP3A65L:EGFP), which contain 2.1 and 5.4 kb 5′ flanking sequences, respectively, of the CYP3A65 gene upstream of EGFP. Both transgenic lines express EGFP in larval gastrointestinal tissues in a pattern similar to that of the endogenous CYP3A65 gene. Moreover, EGFP expression can be significantly induced by TCDD exposure during the larval stage. In addition, EGFP expression can be stimulated by kynurenine, a putative AHR ligand produced during tryptophan metabolism. AHRE elements in the upstream regulatory region of the CYP3A65 gene are indispensible for basal and TCDD-induced transcription. Furthermore, the AHR2 DNA and ligand-binding domains are required to mediate effective CYP3A65 transcription. AHRE sequences are present in the promoters of many teleost CYP3 genes, but not of mammalian CYP3 genes, suggesting that AHR/AHR2-mediated transcription is likely a common regulatory mechanism for teleost CYP3 genes. It may also reflect the different environments that terrestrial and aquatic organisms encounter. - Highlights: • Tg(CYP3A65:EGFP) and CYP3A65 exhibits identical expression pattern. • CYP3A65 can be significantly induced by TCDD or kynurenine. • The AHRE elements are required to mediate CYP3A65 transcription. • The AHR2 DNA and ligand-binding domains are required for CYP3A65 transcription. • AHRE elements are present in many teleost CYP3 genes, but not in

  11. Injury-induced ctgfa directs glial bridging and spinal cord regeneration in zebrafish

    Science.gov (United States)

    Mokalled, Mayssa H.; Patra, Chinmoy; Dickson, Amy L.; Endo, Toyokazu; Stainier, Didier Y. R.; Poss, Kenneth D.

    2016-01-01

    Unlike mammals, zebrafish efficiently regenerate functional nervous system tissue after major spinal cord injury. Whereas glial scarring presents a roadblock for mammalian spinal cord repair, glial cells in zebrafish form a bridge across severed spinal cord tissue and facilitate regeneration, a relatively unexplored process. Here, we performed a genome-wide profiling screen for secreted factors that are upregulated during zebrafish spinal cord regeneration. We find that connective tissue growth factor a (ctgfa) is induced in and around glial cells that participate in initial bridging events. Mutations in ctgfa disrupt spinal cord repair, while transgenic ctgfa overexpression and local human CTGF recombinant protein delivery accelerate bridging and functional regeneration. Our study reveals that CTGF is necessary and sufficient to stimulate glial bridging and natural spinal cord regeneration. PMID:27811277

  12. Label-free imaging of developing vasculature in zebrafish with phase variance optical coherence microscopy

    Science.gov (United States)

    Chen, Yu; Fingler, Jeff; Trinh, Le A.; Fraser, Scott E.

    2016-03-01

    A phase variance optical coherence microscope (pvOCM) has been created to visualize blood flow in the vasculature of zebrafish embryos, without using exogenous labels. The pvOCM imaging system has axial and lateral resolutions of 2 μm in tissue, and imaging depth of more than 100 μm. Imaging of 2-5 days post-fertilization zebrafish embryos identified the detailed structures of somites, spinal cord, gut and notochord based on intensity contrast. Visualization of the blood flow in the aorta, veins and intersegmental vessels was achieved with phase variance contrast. The pvOCM vasculature images were confirmed with corresponding fluorescence microscopy of a zebrafish transgene that labels the vasculature with green fluorescent protein. The pvOCM images also revealed functional information of the blood flow activities that is crucial for the study of vascular development.

  13. Multiplex conditional mutagenesis in zebrafish using the CRISPR/Cas system.

    Science.gov (United States)

    Yin, L; Maddison, L A; Chen, W

    2016-01-01

    The clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein (Cas) system is a powerful tool for genome editing in numerous organisms. However, the system is typically used for gene editing throughout the entire organism. Tissue and temporal specific mutagenesis is often desirable to determine gene function in a specific stage or tissue and to bypass undesired consequences of global mutations. We have developed the CRISPR/Cas system for conditional mutagenesis in transgenic zebrafish using tissue-specific and/or inducible expression of Cas9 and U6-driven expression of sgRNA. To allow mutagenesis of multiple targets, we have isolated four distinct U6 promoters and designed Golden Gate vectors to easily assemble transgenes with multiple sgRNAs. We provide experimental details on the reagents and applications for multiplex conditional mutagenesis in zebrafish. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Knockdown of Laminin gamma-3 (Lamc3 impairs motoneuron guidance in the zebrafish embryo [version 1; referees: 2 approved, 2 approved with reservations

    Directory of Open Access Journals (Sweden)

    Alexander M. J. Eve

    2017-11-01

    Full Text Available Background: Previous work in the zebrafish embryo has shown that laminin γ-3 (lamc3 is enriched in endothelial cells marked by expression of fli1a, but the role of Lamc3 has been unknown. Methods: We use antisense morpholino oligonucleotides, and CRISPR/Cas9 mutagenesis of F0 embryos, to create zebrafish embryos in which lamc3 expression is compromised. Transgenic imaging, immunofluorescence, and in situ hybridisation reveal that Lamc3 loss-of-function affects the development of muscle pioneers, endothelial cells, and motoneurons. Results: Lamc3 is enriched in endothelial cells during zebrafish development, but it is also expressed by other tissues. Depletion of Lamc3 by use of antisense morpholino oligonucleotides perturbs formation of the parachordal chain and subsequently the thoracic duct, but Lamc3 is not required for sprouting of the cardinal vein. F0 embryos in which lamc3 expression is perturbed by a CRISPR/Cas9 approach also fail to form a parachordal chain, but we were unable to establish a stable lamc3 null line. Lamc3 is dispensable for muscle pioneer specification and for the expression of netrin-1a in these cells. Lamc3 knockdown causes netrin-1a up-regulation in the neural tube and there is increased Netrin-1 protein throughout the trunk of the embryo. Axonal guidance of rostral primary motoneurons is defective in Lamc3 knockdown embryos. Conclusions: We suggest that knockdown of Lamc3 perturbs migration of rostral primary motoneurons at the level of the horizontal myoseptum, indicating that laminin γ3 plays a role in motoneuron guidance.

  15. Genome-wide analysis of Tol2 transposon reintegration in zebrafish

    Directory of Open Access Journals (Sweden)

    Parinov Sergey

    2009-09-01

    Full Text Available Abstract Background Tol2, a member of the hAT family of transposons, has become a useful tool for genetic manipulation of model animals, but information about its interactions with vertebrate genomes is still limited. Furthermore, published reports on Tol2 have mainly been based on random integration of the transposon system after co-injection of a plasmid DNA harboring the transposon and a transposase mRNA. It is important to understand how Tol2 would behave upon activation after integration into the genome. Results We performed a large-scale enhancer trap (ET screen and generated 338 insertions of the Tol2 transposon-based ET cassette into the zebrafish genome. These insertions were generated by remobilizing the transposon from two different donor sites in two transgenic lines. We found that 39% of Tol2 insertions occurred in transcription units, mostly into introns. Analysis of the transposon target sites revealed no strict specificity at the DNA sequence level. However, Tol2 was prone to target AT-rich regions with weak palindromic consensus sequences centered at the insertion site. Conclusion Our systematic analysis of sequential remobilizations of the Tol2 transposon from two independent sites within a vertebrate genome has revealed properties such as a tendency to integrate into transcription units and into AT-rich palindrome-like sequences. This information will influence the development of various applications involving DNA transposons and Tol2 in particular.

  16. Genome-wide analysis of Tol2 transposon reintegration in zebrafish.

    Science.gov (United States)

    Kondrychyn, Igor; Garcia-Lecea, Marta; Emelyanov, Alexander; Parinov, Sergey; Korzh, Vladimir

    2009-09-08

    Tol2, a member of the hAT family of transposons, has become a useful tool for genetic manipulation of model animals, but information about its interactions with vertebrate genomes is still limited. Furthermore, published reports on Tol2 have mainly been based on random integration of the transposon system after co-injection of a plasmid DNA harboring the transposon and a transposase mRNA. It is important to understand how Tol2 would behave upon activation after integration into the genome. We performed a large-scale enhancer trap (ET) screen and generated 338 insertions of the Tol2 transposon-based ET cassette into the zebrafish genome. These insertions were generated by remobilizing the transposon from two different donor sites in two transgenic lines. We found that 39% of Tol2 insertions occurred in transcription units, mostly into introns. Analysis of the transposon target sites revealed no strict specificity at the DNA sequence level. However, Tol2 was prone to target AT-rich regions with weak palindromic consensus sequences centered at the insertion site. Our systematic analysis of sequential remobilizations of the Tol2 transposon from two independent sites within a vertebrate genome has revealed properties such as a tendency to integrate into transcription units and into AT-rich palindrome-like sequences. This information will influence the development of various applications involving DNA transposons and Tol2 in particular.

  17. Cranial vasculature in zebrafish forms by angioblast cluster-derived angiogenesis.

    Science.gov (United States)

    Proulx, Kira; Lu, Annie; Sumanas, Saulius

    2010-12-01

    Formation of embryonic vasculature involves vasculogenesis as endothelial cells differentiate and aggregate into vascular cords and angiogenesis which includes branching from the existing vessels. In the zebrafish which has emerged as an advantageous model to study vasculogenesis, cranial vasculature is thought to originate by a combination of vasculogenesis and angiogenesis, but how these processes are coordinated is not well understood. To determine how angioblasts assemble into cranial vasculature, we generated an etsrp:GFP transgenic line in which GFP reporter is expressed under the promoter control of an early regulator of vascular and myeloid development, etsrp/etv2. By utilizing time-lapse imaging we show that cranial vessels originate by angiogenesis from angioblast clusters, which themselves form by the mechanism of vasculogenesis. The two major pairs of bilateral clusters include the rostral organizing center (ROC) which gives rise to the most rostral cranial vessels and the midbrain organizing center (MOC) which gives rise to the posterior cranial vessels and to the myeloid and endocardial lineages. In Etsrp knockdown embryos initial cranial vasculogenesis proceeds normally but endothelial and myeloid progenitors fail to initiate differentiation, migration and angiogenesis. Such angioblast cluster-derived angiogenesis is likely to be involved during vasculature formation in other vertebrate systems as well. Copyright © 2010 Elsevier Inc. All rights reserved.

  18. Rapid Recovery of Visual Function Associated with Blue Cone Ablation in Zebrafish

    Science.gov (United States)

    Hagerman, Gordon F.; Noel, Nicole C. L.; Cao, Sylvia Y.; DuVal, Michèle G.; Oel, A. Phillip; Allison, W. Ted

    2016-01-01

    Hurdles in the treatment of retinal degeneration include managing the functional rewiring of surviving photoreceptors and integration of any newly added cells into the remaining second-order retinal neurons. Zebrafish are the premier genetic model for such questions, and we present two new transgenic lines allowing us to contrast vision loss and recovery following conditional ablation of specific cone types: UV or blue cones. The ablation of each cone type proved to be thorough (killing 80% of cells in each intended cone class), specific, and cell-autonomous. We assessed the loss and recovery of vision in larvae via the optomotor behavioural response (OMR). This visually mediated behaviour decreased to about 5% or 20% of control levels following ablation of UV or blue cones, respectively (Pvision recovery following UV cone ablation was robust, as measured by both assays, returning to control levels within four days. In contrast, robust functional recovery following blue cone ablation was unexpectedly rapid, returning to normal levels within 24 hours after ablation. Ablation of cones led to increased proliferation in the retina, though the rapid recovery of vision following blue cone ablation was demonstrated to not be mediated by blue cone regeneration. Thus rapid visual recovery occurs following ablation of some, but not all, cone subtypes, suggesting an opportunity to contrast and dissect the sources and mechanisms of outer retinal recovery during cone photoreceptor death and regeneration. PMID:27893779

  19. A transgenic Xenopus laevis reporter model to study lymphangiogenesis

    Directory of Open Access Journals (Sweden)

    Annelii Ny

    2013-07-01

    The importance of the blood- and lymph vessels in the transport of essential fluids, gases, macromolecules and cells in vertebrates warrants optimal insight into the regulatory mechanisms underlying their development. Mouse and zebrafish models of lymphatic development are instrumental for gene discovery and gene characterization but are challenging for certain aspects, e.g. no direct accessibility of embryonic stages, or non-straightforward visualization of early lymphatic sprouting, respectively. We previously demonstrated that the Xenopus tadpole is a valuable model to study the processes of lymphatic development. However, a fluorescent Xenopus reporter directly visualizing the lymph vessels was lacking. Here, we created transgenic Tg(Flk1:eGFP Xenopus laevis reporter lines expressing green fluorescent protein (GFP in blood- and lymph vessels driven by the Flk1 (VEGFR-2 promoter. We also established a high-resolution fluorescent dye labeling technique selectively and persistently visualizing lymphatic endothelial cells, even in conditions of impaired lymph vessel formation or drainage function upon silencing of lymphangiogenic factors. Next, we applied the model to dynamically document blood and lymphatic sprouting and patterning of the initially avascular tadpole fin. Furthermore, quantifiable models of spontaneous or induced lymphatic sprouting into the tadpole fin were developed for dynamic analysis of loss-of-function and gain-of-function phenotypes using pharmacologic or genetic manipulation. Together with angiography and lymphangiography to assess functionality, Tg(Flk1:eGFP reporter tadpoles readily allowed detailed lymphatic phenotyping of live tadpoles by fluorescence microscopy. The Tg(Flk1:eGFP tadpoles represent a versatile model for functional lymph/angiogenomics and drug screening.

  20. [Production of human proteins in the blood of transgenic animals

    NARCIS (Netherlands)

    Massoud, M.; Bischoff, Rainer; Dalemans, W.; Pointu, H.; Attal, J.; Schultz, H.; Clesse, D.; Stinnakre, M.G.; Pavirani, A.; Houdebine, L.M.

    1990-01-01

    The human alpha 1-antitrypsin gene has been microinjected into rabbit embryos. A line of transgenic rabbits has thus been established. Human alpha 1-antitrypsin was found in the blood of transgenic animals at the concentration of 1 mg/ml plasma. The human protein was active and separable from its

  1. Hepatic steatosis in transgenic mice overexpressing human histone deacetylase 1

    International Nuclear Information System (INIS)

    Wang, Ai-Guo; Seo, Sang-Beom; Moon, Hyung-Bae; Shin, Hye-Jun; Kim, Dong Hoon; Kim, Jin-Man; Lee, Tae-Hoon; Kwon, Ho Jeong; Yu, Dae-Yeul; Lee, Dong-Seok

    2005-01-01

    It is generally thought that histone deacetylases (HDACs) play important roles in the transcriptional regulation of genes. However, little information is available concerning the specific functions of individual HDACs in disease states. In this study, two transgenic mice lines were established which harbored the human HDAC1 gene. Overexpressed HDAC1 was detected in the nuclei of transgenic liver cells, and HDAC1 enzymatic activity was significantly higher in the transgenic mice than in control littermates. The HDAC1 transgenic mice exhibited a high incidence of hepatic steatosis and nuclear pleomorphism. Molecular studies showed that HDAC1 may contribute to nuclear pleomorphism through the p53/p21 signaling pathway

  2. Competitive performance of transgenic wheat resistant to powdery mildew.

    Directory of Open Access Journals (Sweden)

    Olena Kalinina

    Full Text Available Genetically modified (GM plants offer an ideal model system to study the influence of single genes that confer constitutive resistance to pathogens on the ecological behaviour of plants. We used phytometers to study competitive interactions between GM lines of spring wheat Triticum aestivum carrying such genes and control lines. We hypothesized that competitive performance of GM lines would be reduced due to enhanced transgene expression under pathogen levels typically encountered in the field. The transgenes pm3b from wheat (resistance against powdery mildew Blumeria graminis or chitinase and glucanase genes from barley (resistance against fungi in general were introduced with the ubiquitin promoter from maize (pm3b and chitinase genes or the actin promoter from rice (glucanase gene. Phytometers of 15 transgenic and non-transgenic wheat lines were transplanted as seedlings into plots sown with the same 15 lines as competitive environments and subject to two soil nutrient levels. Pm3b lines had reduced mildew incidence compared with control lines. Chitinase and chitinase/glucanase lines showed the same high resistance to mildew as their control in low-nutrient treatment and slightly lower mildew rates than the control in high-nutrient environment. Pm3b lines were weaker competitors than control lines. This resulted in reduced yield and seed number. The Pm3b line with the highest transgene expression had 53.2% lower yield than the control whereas the Pm3b line which segregated in resistance and had higher mildew rates showed only minor costs under competition. The line expressing both chitinase and glucanase genes also showed reduced yield and seed number under competition compared with its control. Our results suggest that single transgenes conferring constitutive resistance to pathogens can have ecological costs and can weaken plant competitiveness even in the presence of the pathogen. The magnitude of these costs appears related to the degree

  3. Welfare assessment in transgenic pigs expressing green fluorescent protein (GFP)

    DEFF Research Database (Denmark)

    Huber, Reinhard C.; Remuge, Liliana; Carlisle, Ailsa

    2012-01-01

    Since large animal transgenesis has been successfully attempted for the first time about 25 years ago, the technology has been applied in various lines of transgenic pigs. Nevertheless one of the concerns with the technology—animal welfare—has not been approached through systematic assessment...... and statements regarding the welfare of transgenic pigs have been based on anecdotal observations during early stages of transgenic programs. The main aim of the present study was therefore to perform an extensive welfare assessment comparing heterozygous transgenic animals expressing GFP with wildtype animals...... months. The absence of significant differences between GFP and wildtype animals in the parameters observed suggests that the transgenic animals in question are unlikely to suffer from deleterious effects of transgene expression on their welfare and thus support existing anecdotal observations of pigs...

  4. A Fully Automated High-Throughput Zebrafish Behavioral Ototoxicity Assay.

    Science.gov (United States)

    Todd, Douglas W; Philip, Rohit C; Niihori, Maki; Ringle, Ryan A; Coyle, Kelsey R; Zehri, Sobia F; Zabala, Leanne; Mudery, Jordan A; Francis, Ross H; Rodriguez, Jeffrey J; Jacob, Abraham

    2017-08-01

    Zebrafish animal models lend themselves to behavioral assays that can facilitate rapid screening of ototoxic, otoprotective, and otoregenerative drugs. Structurally similar to human inner ear hair cells, the mechanosensory hair cells on their lateral line allow the zebrafish to sense water flow and orient head-to-current in a behavior called rheotaxis. This rheotaxis behavior deteriorates in a dose-dependent manner with increased exposure to the ototoxin cisplatin, thereby establishing itself as an excellent biomarker for anatomic damage to lateral line hair cells. Building on work by our group and others, we have built a new, fully automated high-throughput behavioral assay system that uses automated image analysis techniques to quantify rheotaxis behavior. This novel system consists of a custom-designed swimming apparatus and imaging system consisting of network-controlled Raspberry Pi microcomputers capturing infrared video. Automated analysis techniques detect individual zebrafish, compute their orientation, and quantify the rheotaxis behavior of a zebrafish test population, producing a powerful, high-throughput behavioral assay. Using our fully automated biological assay to test a standardized ototoxic dose of cisplatin against varying doses of compounds that protect or regenerate hair cells may facilitate rapid translation of candidate drugs into preclinical mammalian models of hearing loss.

  5. Accurate measure of transgene copy number in crop plants using droplet digital PCR

    Science.gov (United States)

    Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy numb...

  6. Effect of 5'-flanking sequence deletions on expression of the human insulin gene in transgenic mice

    DEFF Research Database (Denmark)

    Fromont-Racine, M; Bucchini, D; Madsen, O

    1990-01-01

    Expression of the human insulin gene was examined in transgenic mouse lines carrying the gene with various lengths of DNA sequences 5' to the transcription start site (+1). Expression of the transgene was demonstrated by 1) the presence of human C-peptide in urine, 2) the presence of specific...... of the transgene was observed in cell types other than beta-islet cells....

  7. Graph theoretical model of a sensorimotor connectome in zebrafish.

    Science.gov (United States)

    Stobb, Michael; Peterson, Joshua M; Mazzag, Borbala; Gahtan, Ethan

    2012-01-01

    Mapping the detailed connectivity patterns (connectomes) of neural circuits is a central goal of neuroscience. The best quantitative approach to analyzing connectome data is still unclear but graph theory has been used with success. We present a graph theoretical model of the posterior lateral line sensorimotor pathway in zebrafish. The model includes 2,616 neurons and 167,114 synaptic connections. Model neurons represent known cell types in zebrafish larvae, and connections were set stochastically following rules based on biological literature. Thus, our model is a uniquely detailed computational representation of a vertebrate connectome. The connectome has low overall connection density, with 2.45% of all possible connections, a value within the physiological range. We used graph theoretical tools to compare the zebrafish connectome graph to small-world, random and structured random graphs of the same size. For each type of graph, 100 randomly generated instantiations were considered. Degree distribution (the number of connections per neuron) varied more in the zebrafish graph than in same size graphs with less biological detail. There was high local clustering and a short average path length between nodes, implying a small-world structure similar to other neural connectomes and complex networks. The graph was found not to be scale-free, in agreement with some other neural connectomes. An experimental lesion was performed that targeted three model brain neurons, including the Mauthner neuron, known to control fast escape turns. The lesion decreased the number of short paths between sensory and motor neurons analogous to the behavioral effects of the same lesion in zebrafish. This model is expandable and can be used to organize and interpret a growing database of information on the zebrafish connectome.

  8. Graph theoretical model of a sensorimotor connectome in zebrafish.

    Directory of Open Access Journals (Sweden)

    Michael Stobb

    Full Text Available Mapping the detailed connectivity patterns (connectomes of neural circuits is a central goal of neuroscience. The best quantitative approach to analyzing connectome data is still unclear but graph theory has been used with success. We present a graph theoretical model of the posterior lateral line sensorimotor pathway in zebrafish. The model includes 2,616 neurons and 167,114 synaptic connections. Model neurons represent known cell types in zebrafish larvae, and connections were set stochastically following rules based on biological literature. Thus, our model is a uniquely detailed computational representation of a vertebrate connectome. The connectome has low overall connection density, with 2.45% of all possible connections, a value within the physiological range. We used graph theoretical tools to compare the zebrafish connectome graph to small-world, random and structured random graphs of the same size. For each type of graph, 100 randomly generated instantiations were considered. Degree distribution (the number of connections per neuron varied more in the zebrafish graph than in same size graphs with less biological detail. There was high local clustering and a short average path length between nodes, implying a small-world structure similar to other neural connectomes and complex networks. The graph was found not to be scale-free, in agreement with some other neural connectomes. An experimental lesion was performed that targeted three model brain neurons, including the Mauthner neuron, known to control fast escape turns. The lesion decreased the number of short paths between sensory and motor neurons analogous to the behavioral effects of the same lesion in zebrafish. This model is expandable and can be used to organize and interpret a growing database of information on the zebrafish connectome.

  9. A transgenic mouse model for trilateral retinoblastoma

    NARCIS (Netherlands)

    O'Brien, J.M.; Marcus, D.M.; Bernards, R.A.; Carpenter, J.L.; Windle, J.J.; Mellon, P.; Albert, D.M.

    1990-01-01

    We present a murine model of trilateral retinoblastoma. Ocular retinoblastoma and central nervous system tumors are observed in a line of mice formed by the transgenic expression of SV40 T-antigen. An oncogenic protein known to bind to the retinoblastoma gene product (p105-Rb) is specifically

  10. Using local chromatin structure to improve CRISPR/Cas9 efficiency in zebrafish.

    Science.gov (United States)

    Chen, Yunru; Zeng, Shiyang; Hu, Ruikun; Wang, Xiangxiu; Huang, Weilai; Liu, Jiangfang; Wang, Luying; Liu, Guifen; Cao, Ying; Zhang, Yong

    2017-01-01

    Although the CRISPR/Cas9 has been successfully applied in zebrafish, considerable variations in efficiency have been observed for different gRNAs. The workload and cost of zebrafish mutant screening is largely dependent on the mutation rate of injected embryos; therefore, selecting more effective gRNAs is especially important for zebrafish mutant construction. Besides the sequence features, local chromatin structures may have effects on CRISPR/Cas9 efficiency, which remain largely unexplored. In the only related study in zebrafish, nucleosome organization was not found to have an effect on CRISPR/Cas9 efficiency, which is inconsistent with recent studies in vitro and in mammalian cell lines. To understand the effects of local chromatin structure on CRISPR/Cas9 efficiency in zebrafish, we first determined that CRISPR/Cas9 introduced genome editing mainly before the dome stage. Based on this observation, we reanalyzed our published nucleosome organization profiles and generated chromatin accessibility profiles in the 256-cell and dome stages using ATAC-seq technology. Our study demonstrated that chromatin accessibility showed positive correlation with CRISPR/Cas9 efficiency, but we did not observe a clear correlation between nucleosome organization and CRISPR/Cas9 efficiency. We constructed an online database for zebrafish gRNA selection based on local chromatin structure features that could prove beneficial to zebrafish homozygous mutant construction via CRISPR/Cas9.

  11. Quaternary and tertiary aldoxime antidotes for organophosphate exposure in a zebrafish model system

    Energy Technology Data Exchange (ETDEWEB)

    Schmidt, Hayden R. [Department of Biology, Whittier College, Whittier, CA 90608 (United States); Radić, Zoran; Taylor, Palmer [Department of Pharmacology, Skaggs School of Pharmacy and Pharmaceutical Sciences, University of California at San Diego, La Jolla, CA 92093-0650 (United States); Fradinger, Erica A., E-mail: efrading@whittier.edu [Department of Biology, Whittier College, Whittier, CA 90608 (United States)

    2015-04-15

    The zebrafish is rapidly becoming an important model system for screening of new therapeutics. Here we evaluated the zebrafish as a potential pharmacological model for screening novel oxime antidotes to organophosphate (OP)-inhibited acetylcholinesterase (AChE). The k{sub i} values determined for chlorpyrifos oxon (CPO) and dichlorvos (DDVP) showed that CPO was a more potent inhibitor of both human and zebrafish AChE, but overall zebrafish AChE was less sensitive to OP inhibition. In contrast, aldoxime antidotes, the quaternary ammonium 2-PAM and tertiary amine RS-194B, showed generally similar overall reactivation kinetics, k{sub r}, in both zebrafish and human AChE. However, differences between the K{sub ox} and k{sub 2} constants suggest that zebrafish AChE associates more tightly with oximes, but has a slower maximal reactivation rate than human AChE. Homology modeling suggests that these kinetic differences result from divergences in the amino acids lining the entrance to the active site gorge. Although 2-PAM had the more favorable in vitro reactivation kinetics, RS-194B was more effective antidote in vivo. In intact zebrafish embryos, antidotal treatment with RS-194B rescued embryos from OP toxicity, whereas 2-PAM had no effect. Dechorionation of the embryos prior to antidotal treatment allowed both 2-PAM and RS-194B to rescue zebrafish embryos from OP toxicity. Interestingly, RS-194B and 2-PAM alone increased cholinergic motor activity in dechorionated embryos possibly due to the reversible inhibition kinetics, K{sub i} and αK{sub i}, of the oximes. Together these results demonstrate that the zebrafish at various developmental stages provides an excellent model for investigating membrane penetrant antidotes to OP exposure. - Highlights: • Zebrafish AChE shares significant structural similarities with human AChE. • OP-inhibited zebrafish and human AChE exhibit similar reactivation kinetics. • The zebrafish chorion is permeable to BBB penetrant and not

  12. Zebrafish enpp1 mutants exhibit pathological mineralization, mimicking features of generalized arterial calcification of infancy (GACI and pseudoxanthoma elasticum (PXE

    Directory of Open Access Journals (Sweden)

    Alexander Apschner

    2014-07-01

    Full Text Available In recent years it has become clear that, mechanistically, biomineralization is a process that has to be actively inhibited as a default state. This inhibition must be released in a rigidly controlled manner in order for mineralization to occur in skeletal elements and teeth. A central aspect of this concept is the tightly controlled balance between phosphate, a constituent of the biomineral hydroxyapatite, and pyrophosphate, a physiochemical inhibitor of mineralization. Here, we provide a detailed analysis of a zebrafish mutant, dragonfish (dgf, which is mutant for ectonucleoside pyrophosphatase/phosphodiesterase 1 (Enpp1, a protein that is crucial for supplying extracellular pyrophosphate. Generalized arterial calcification of infancy (GACI is a fatal human disease, and the majority of cases are thought to be caused by mutations in ENPP1. Furthermore, some cases of pseudoxanthoma elasticum (PXE have recently been linked to ENPP1. Similar to humans, we show here that zebrafish enpp1 mutants can develop ectopic calcifications in a variety of soft tissues – most notably in the skin, cartilage elements, the heart, intracranial space and the notochord sheet. Using transgenic reporter lines, we demonstrate that ectopic mineralizations in these tissues occur independently of the expression of typical osteoblast or cartilage markers. Intriguingly, we detect cells expressing the osteoclast markers Trap and CathepsinK at sites of ectopic calcification at time points when osteoclasts are not yet present in wild-type siblings. Treatment with the bisphosphonate etidronate rescues aspects of the dgf phenotype, and we detected deregulated expression of genes that are involved in phosphate homeostasis and mineralization, such as fgf23, npt2a, entpd5 and spp1 (also known as osteopontin. Employing a UAS-GalFF approach, we show that forced expression of enpp1 in blood vessels or the floorplate of mutant embryos is sufficient to rescue the notochord

  13. Cloning of transgenic tobacco BY-2 cells; an efficient method to analyse and reduce high natural heterogeneity of transgene expression.

    Science.gov (United States)

    Nocarova, Eva; Fischer, Lukas

    2009-04-22

    Phenotypic characterization of transgenic cell lines, frequently used in plant biology studies, is complicated because transgene expression in individual cells is often heterogeneous and unstable. To identify the sources and to reduce this heterogeneity, we transformed tobacco (Nicotiana tabacum L.) BY-2 cells with a gene encoding green fluorescent protein (GFP) using Agrobacterium tumefaciens, and then introduced a simple cloning procedure to generate cell lines derived from the individual transformed cells. Expression of the transgene was monitored by analysing GFP fluorescence in the cloned lines and also in lines obtained directly after transformation. The majority ( approximately 90%) of suspension culture lines derived from calli that were obtained directly from transformation consisted of cells with various levels of GFP fluorescence. In contrast, nearly 50% of lines generated by cloning cells from the primary heterogeneous suspensions consisted of cells with homogenous GFP fluorescence. The rest of the lines exhibited "permanent heterogeneity" that could not be resolved by cloning. The extent of fluorescence heterogeneity often varied, even among genetically identical clones derived from the primary transformed lines. In contrast, the offspring of subsequent cloning of the cloned lines was uniform, showing GFP fluorescence intensity and heterogeneity that corresponded to the original clone. The results demonstrate that, besides genetic heterogeneity detected in some lines, the primary lines often contained a mixture of epigenetically different cells that could be separated by cloning. This indicates that a single integration event frequently results in various heritable expression patterns, which are probably accidental and become stabilized in the offspring of the primary transformed cells early after the integration event. Because heterogeneity in transgene expression has proven to be a serious problem, it is highly advisable to use transgenes tagged with

  14. Glycinebetaine synthesizing transgenic potato plants exhibit enhanced tolerance to salt and cold stresses

    International Nuclear Information System (INIS)

    Ahmad, R.; Hussain, J.

    2014-01-01

    Abiotic stresses are the most important contributors towards low productivity of major food crops. Various attempts have been made to enhance abiotic stress tolerance of crop plants by classical breeding and genetic transformation. Genetic transformation with glycinebetaine (GB) synthesizing enzymes' gene(s) in naturally non accumulating plants has resulted in enhanced tolerance against variety of abiotic stresses. Present study was aimed to evaluate the performance of GB synthesizing transgenic potato plants against salt and cold stresses. Transgenic potato plants were challenged against salt and cold stresses at whole plant level. Transgenic lines were characterized to determine the transgene copy number. Different parameters like integrity, chlorophyll contents, tuber yield and vegetative biomass were studied to monitor the stress tolerance of transgenic potato plants. The results were compared with Non-transgenic (NT) plants and statistically analyzed to evaluate significant differences. Multi-copy insertion of expression cassette was found in both transgenic lines. Upon salt stress, transgenic plants maintained better growth as compared to NT plants. The tuber yield of transgenic plants was significantly greater than NT plants in salt stress. Transgenic plants showed improved membrane integrity against cold stress by depicting appreciably reduced ion leakage as compared to NT plants. Moreover, transgenic plants showed significantly less chlorophyll bleaching than NT plants upon cold stress. In addition, NT plants accumulated significantly less biomass, and yielded fewer tubers as compared to transgenic plants after cold stress treatment. The study will be a committed step for field evaluation of transgenic plants with the aim of commercialization. (author)

  15. The Zebrafish Model Organism Database (ZFIN)

    Data.gov (United States)

    U.S. Department of Health & Human Services — ZFIN serves as the zebrafish model organism database. It aims to: a) be the community database resource for the laboratory use of zebrafish, b) develop and support...

  16. Genetic transformation and gene silencing mediated by multiple copies of a transgene in eastern white pine.

    Science.gov (United States)

    Tang, Wei; Newton, Ronald J; Weidner, Douglas A

    2007-01-01

    An efficient transgenic eastern white pine (Pinus strobus L.) plant regeneration system has been established using Agrobacterium tumefaciens strain GV3850-mediated transformation and the green fluorescent protein (gfp) gene as a reporter in this investigation. Stable integration of transgenes in the plant genome of pine was confirmed by polymerase chain reaction (PCR), Southern blot, and northern blot analyses. Transgene expression was analysed in pine T-DNA transformants carrying different numbers of copies of T-DNA insertions. Post-transcriptional gene silencing (PTGS) was mostly obtained in transgenic lines with more than three copies of T-DNA, but not in transgenic lines with one copy of T-DNA. In situ hybridization chromosome analysis of transgenic lines demonstrated that silenced transgenic lines had two or more T-DNA insertions in the same chromosome. These results suggest that two or more T-DNA insertions in the same chromosome facilitate efficient gene silencing in transgenic pine cells expressing green fluorescent protein. There were no differences in shoot differentiation and development between transgenic lines with multiple T-DNA copies and transgenic lines with one or two T-DNA copies.

  17. in transgenic cucumber

    African Journals Online (AJOL)

    Jane

    2011-07-18

    Jul 18, 2011 ... College of Horticulture, South China Agriculture University, Guangzhou 510642, Guangdong ... The pattern of expression vector pBI-PacPAP. ..... Disease scale ... These transgenic T0 plants were self-pollinated and the.

  18. Transgene mus som sygdomsmodeller

    DEFF Research Database (Denmark)

    Schuster, Mikkel Bruhn; Porse, Bo Torben

    2003-01-01

    Transgenic animal models have proven to be useful tools in understanding both basic biology and the events associated with disease. Recent technical advances in the area of genomic manipulation in combination with the availability of the human and murine genomic sequences now allow the precise...... tailoring of the mouse genome. In this review we describe a few systems in which transgenic animal models have been employed for the purpose of studying the etiology of human diseases. Udgivelsesdato: 2003-Feb-17...

  19. Hypothalamic Projections to the Optic Tectum in Larval Zebrafish

    Science.gov (United States)

    Heap, Lucy A.; Vanwalleghem, Gilles C.; Thompson, Andrew W.; Favre-Bulle, Itia; Rubinsztein-Dunlop, Halina; Scott, Ethan K.

    2018-01-01

    The optic tectum of larval zebrafish is an important model for understanding visual processing in vertebrates. The tectum has been traditionally viewed as dominantly visual, with a majority of studies focusing on the processes by which tectal circuits receive and process retinally-derived visual information. Recently, a handful of studies have shown a much more complex role for the optic tectum in larval zebrafish, and anatomical and functional data from these studies suggest that this role extends beyond the visual system, and beyond the processing of exclusively retinal inputs. Consistent with this evolving view of the tectum, we have used a Gal4 enhancer trap line to identify direct projections from rostral hypothalamus (RH) to the tectal neuropil of larval zebrafish. These projections ramify within the deepest laminae of the tectal neuropil, the stratum album centrale (SAC)/stratum griseum periventriculare (SPV), and also innervate strata distinct from those innervated by retinal projections. Using optogenetic stimulation of the hypothalamic projection neurons paired with calcium imaging in the tectum, we find rebound firing in tectal neurons consistent with hypothalamic inhibitory input. Our results suggest that tectal processing in larval zebrafish is modulated by hypothalamic inhibitory inputs to the deep tectal neuropil. PMID:29403362

  20. Hypothalamic Projections to the Optic Tectum in Larval Zebrafish

    Directory of Open Access Journals (Sweden)

    Lucy A. Heap

    2018-01-01

    Full Text Available The optic tectum of larval zebrafish is an important model for understanding visual processing in vertebrates. The tectum has been traditionally viewed as dominantly visual, with a majority of studies focusing on the processes by which tectal circuits receive and process retinally-derived visual information. Recently, a handful of studies have shown a much more complex role for the optic tectum in larval zebrafish, and anatomical and functional data from these studies suggest that this role extends beyond the visual system, and beyond the processing of exclusively retinal inputs. Consistent with this evolving view of the tectum, we have used a Gal4 enhancer trap line to identify direct projections from rostral hypothalamus (RH to the tectal neuropil of larval zebrafish. These projections ramify within the deepest laminae of the tectal neuropil, the stratum album centrale (SAC/stratum griseum periventriculare (SPV, and also innervate strata distinct from those innervated by retinal projections. Using optogenetic stimulation of the hypothalamic projection neurons paired with calcium imaging in the tectum, we find rebound firing in tectal neurons consistent with hypothalamic inhibitory input. Our results suggest that tectal processing in larval zebrafish is modulated by hypothalamic inhibitory inputs to the deep tectal neuropil.

  1. Split-Cre complementation restores combination activity on transgene excision in hair roots of transgenic tobacco.

    Directory of Open Access Journals (Sweden)

    Mengling Wen

    Full Text Available The Cre/loxP system is increasingly exploited for genetic manipulation of DNA in vitro and in vivo. It was previously reported that inactive ''split-Cre'' fragments could restore Cre activity in transgenic mice when overlapping co-expression was controlled by two different promoters. In this study, we analyzed recombination activities of split-Cre proteins, and found that no recombinase activity was detected in the in vitro recombination reaction in which only the N-terminal domain (NCre of split-Cre protein was expressed, whereas recombination activity was obtained when the C-terminal (CCre or both NCre and CCre fragments were supplied. We have also determined the recombination efficiency of split-Cre proteins which were co-expressed in hair roots of transgenic tobacco. No Cre recombination event was observed in hair roots of transgenic tobacco when the NCre or CCre genes were expressed alone. In contrast, an efficient recombination event was found in transgenic hairy roots co-expressing both inactive split-Cre genes. Moreover, the restored recombination efficiency of split-Cre proteins fused with the nuclear localization sequence (NLS was higher than that of intact Cre in transgenic lines. Thus, DNA recombination mediated by split-Cre proteins provides an alternative method for spatial and temporal regulation of gene expression in transgenic plants.

  2. Functional and Genetic Analysis of Choroid Plexus Development in Zebrafish

    Directory of Open Access Journals (Sweden)

    Hannah Elizabeth Henson

    2014-11-01

    Full Text Available The choroid plexus, an epithelial-based structure localized in the brain ventricle, is the major component of the blood-cerebrospinal fluid barrier. The choroid plexus produces the cerebrospinal fluid and regulates the components of the cerebrospinal fluid. Abnormal choroid plexus function is associated with neurodegenerative diseases, tumor formation in the choroid plexus epithelium, and hydrocephaly. In this study, we used zebrafish (Danio rerio as a model system to understand the genetic components of choroid plexus development. We generated an enhancer trap line, Et(cp:EGFPsj2, that expresses enhanced green fluorescent protein (EGFP in the choroid plexus epithelium. Using immunohistochemistry and fluorescent tracers, we demonstrated that the zebrafish choroid plexus possesses brain barrier properties such as tight junctions and transporter activity. Thus, we have established zebrafish as a functionally relevant model to study choroid plexus development. Using an unbiased approach, we performed a forward genetic dissection of the choroid plexus to identify genes essential for its formation and function. Using Et(cp:EGFPsj2, we isolated 10 recessive mutant lines with choroid plexus abnormalities, which were grouped into five classes based on GFP intensity, epithelial localization, and overall choroid plexus morphology. We also mapped the mutation for two mutant lines to chromosomes 4 and 21, respectively. The mutants generated in this study can be used to elucidate specific genes and signaling pathways essential for choroid plexus development, function, and/or maintenance and will provide important insights into how these genetic mutations contribute to disease.

  3. The First Fifteen Years of Steroid Receptor Research in Zebrafish; Characterization and Functional Analysis of the Receptors

    Directory of Open Access Journals (Sweden)

    Marcel J. M. Schaaf

    2017-07-01

    Full Text Available Steroid hormones regulate a wide range of processes in our body, and their effects are mediated by steroid receptors. In addition to their physiological role, these receptors mediate the effects of endocrine disrupting chemicals (EDCs and are widely used targets for dugs involved in the treatment of numerous diseases, ranging from cancer to inflammatory disorders. Over the last fifteen years, the zebrafish has increasingly been used as an animal model in steroid receptor research. Orthologues of all human steroid receptor genes appear to be present in zebrafish. All zebrafish steroid receptors have been characterized in detail, and their expression patterns have been analyzed. Functional studies have been performed using morpholino knockdown of receptor expression and zebrafish lines carrying mutations in one of their steroid receptor genes. To investigate the activity of the receptors in vivo, specific zebrafish reporter lines have been developed, and transcriptomic studies have been carried out to identify biomarkers for steroid receptor action. In this review, an overview of research on steroid receptors in zebrafish is presented, and it is concluded that further exploitation of the possibilities of the zebrafish model system will contribute significantly to the advancement of steroid receptor research in the next decade.

  4. Object recognition memory in zebrafish.

    Science.gov (United States)

    May, Zacnicte; Morrill, Adam; Holcombe, Adam; Johnston, Travis; Gallup, Joshua; Fouad, Karim; Schalomon, Melike; Hamilton, Trevor James

    2016-01-01

    The novel object recognition, or novel-object preference (NOP) test is employed to assess recognition memory in a variety of organisms. The subject is exposed to two identical objects, then after a delay, it is placed back in the original environment containing one of the original objects and a novel object. If the subject spends more time exploring one object, this can be interpreted as memory retention. To date, this test has not been fully explored in zebrafish (Danio rerio). Zebrafish possess recognition memory for simple 2- and 3-dimensional geometrical shapes, yet it is unknown if this translates to complex 3-dimensional objects. In this study we evaluated recognition memory in zebrafish using complex objects of different sizes. Contrary to rodents, zebrafish preferentially explored familiar over novel objects. Familiarity preference disappeared after delays of 5 mins. Leopard danios, another strain of D. rerio, also preferred the familiar object after a 1 min delay. Object preference could be re-established in zebra danios by administration of nicotine tartrate salt (50mg/L) prior to stimuli presentation, suggesting a memory-enhancing effect of nicotine. Additionally, exploration biases were present only when the objects were of intermediate size (2 × 5 cm). Our results demonstrate zebra and leopard danios have recognition memory, and that low nicotine doses can improve this memory type in zebra danios. However, exploration biases, from which memory is inferred, depend on object size. These findings suggest zebrafish ecology might influence object preference, as zebrafish neophobia could reflect natural anti-predatory behaviour. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. F-spondin/spon1b expression patterns in developing and adult zebrafish.

    Directory of Open Access Journals (Sweden)

    Veronica Akle

    Full Text Available F-spondin, an extracellular matrix protein, is an important player in embryonic morphogenesis and CNS development, but its presence and role later in life remains largely unknown. We generated a transgenic zebrafish in which GFP is expressed under the control of the F-spondin (spon1b promoter, and used it in combination with complementary techniques to undertake a detailed characterization of the expression patterns of F-spondin in developing and adult brain and periphery. We found that F-spondin is often associated with structures forming long neuronal tracts, including retinal ganglion cells, the olfactory bulb, the habenula, and the nucleus of the medial longitudinal fasciculus (nMLF. F-spondin expression coincides with zones of adult neurogenesis and is abundant in CSF-contacting secretory neurons, especially those in the hypothalamus. Use of this new transgenic model also revealed F-spondin expression patterns in the peripheral CNS, notably in enteric neurons, and in peripheral tissues involved in active patterning or proliferation in adults, including the endoskeleton of zebrafish fins and the continuously regenerating pharyngeal teeth. Moreover, patterning of the regenerating caudal fin following fin amputation in adult zebrafish was associated with F-spondin expression in the blastema, a proliferative region critical for tissue reconstitution. Together, these findings suggest major roles for F-spondin in the CNS and periphery of the developing and adult vertebrate.

  6. Robust Identification of Developmentally Active Endothelial Enhancers in Zebrafish Using FANS-Assisted ATAC-Seq.

    Science.gov (United States)

    Quillien, Aurelie; Abdalla, Mary; Yu, Jun; Ou, Jianhong; Zhu, Lihua Julie; Lawson, Nathan D

    2017-07-18

    Identification of tissue-specific and developmentally active enhancers provides insights into mechanisms that control gene expression during embryogenesis. However, robust detection of these regulatory elements remains challenging, especially in vertebrate genomes. Here, we apply fluorescent-activated nuclei sorting (FANS) followed by Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq) to identify developmentally active endothelial enhancers in the zebrafish genome. ATAC-seq of nuclei from Tg(fli1a:egfp) y1 transgenic embryos revealed expected patterns of nucleosomal positioning at transcriptional start sites throughout the genome and association with active histone modifications. Comparison of ATAC-seq from GFP-positive and -negative nuclei identified more than 5,000 open elements specific to endothelial cells. These elements flanked genes functionally important for vascular development and that displayed endothelial-specific gene expression. Importantly, a majority of tested elements drove endothelial gene expression in zebrafish embryos. Thus, FANS-assisted ATAC-seq using transgenic zebrafish embryos provides a robust approach for genome-wide identification of active tissue-specific enhancer elements. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  7. The role of Sox6 in zebrafish muscle fiber type specification.

    Science.gov (United States)

    Jackson, Harriet E; Ono, Yosuke; Wang, Xingang; Elworthy, Stone; Cunliffe, Vincent T; Ingham, Philip W

    2015-01-01

    The transcription factor Sox6 has been implicated in regulating muscle fiber type-specific gene expression in mammals. In zebrafish, loss of function of the transcription factor Prdm1a results in a slow to fast-twitch fiber type transformation presaged by ectopic expression of sox6 in slow-twitch progenitors. Morpholino-mediated Sox6 knockdown can suppress this transformation but causes ectopic expression of only one of three slow-twitch specific genes assayed. Here, we use gain and loss of function analysis to analyse further the role of Sox6 in zebrafish muscle fiber type specification. The GAL4 binary misexpression system was used to express Sox6 ectopically in zebrafish embryos. Cis-regulatory elements were characterized using transgenic fish. Zinc finger nuclease mediated targeted mutagenesis was used to analyse the effects of loss of Sox6 function in embryonic, larval and adult zebrafish. Zebrafish transgenic for the GCaMP3 Calcium reporter were used to assay Ca2+ transients in wild-type and mutant muscle fibres. Ectopic Sox6 expression is sufficient to downregulate slow-twitch specific gene expression in zebrafish embryos. Cis-regulatory elements upstream of the slow myosin heavy chain 1 (smyhc1) and slow troponin c (tnnc1b) genes contain putative Sox6 binding sites required for repression of the former but not the latter. Embryos homozygous for sox6 null alleles expressed tnnc1b throughout the fast-twitch muscle whereas other slow-specific muscle genes, including smyhc1, were expressed ectopically in only a subset of fast-twitch fibers. Ca2+ transients in sox6 mutant fast-twitch fibers were intermediate in their speed and amplitude between those of wild-type slow- and fast-twitch fibers. sox6 homozygotes survived to adulthood and exhibited continued misexpression of tnnc1b as well as smaller slow-twitch fibers. They also exhibited a striking curvature of the spine. The Sox6 transcription factor is a key regulator of fast-twitch muscle fiber differentiation

  8. Arsenic transport by zebrafish aquaglyceroporins

    Directory of Open Access Journals (Sweden)

    Landfear Scott M

    2009-11-01

    Full Text Available Abstract Background Arsenic is one of the most ubiquitous toxins and endangers the health of tens of millions of humans worldwide. It is a mainly a water-borne contaminant. Inorganic trivalent arsenic (AsIII is one of the major species that exists environmentally. The transport of AsIII has been studied in microbes, plants and mammals. Members of the aquaglyceroporin family have been shown to actively conduct AsIII and its organic metabolite, monomethylarsenite (MAsIII. However, the transport of AsIII and MAsIII in in any fish species has not been characterized. Results In this study, five members of the aquaglyceroporin family from zebrafish (Danio rerio were cloned, and their ability to transport water, glycerol, and trivalent arsenicals (AsIII and MAsIII and antimonite (SbIII was investigated. Genes for at least seven aquaglyceroporins have been annotated in the zebrafish genome project. Here, five genes which are close homologues to human AQP3, AQP9 and AQP10 were cloned from a zebrafish cDNA preparation. These genes were named aqp3, aqp3l, aqp9a, aqp9b and aqp10 according to their similarities to the corresponding human AQPs. Expression of aqp9a, aqp9b, aqp3, aqp3l and aqp10 in multiple zebrafish organs were examined by RT-PCR. Our results demonstrated that these aquaglyceroporins exhibited different tissue expression. They are all detected in more than one tissue. The ability of these five aquaglyceroporins to transport water, glycerol and the metalloids arsenic and antimony was examined following expression in oocytes from Xenopus leavis. Each of these channels showed substantial glycerol transport at equivalent rates. These aquaglyceroporins also facilitate uptake of inorganic AsIII, MAsIII and SbIII. Arsenic accumulation in fish larvae and in different tissues from adult zebrafish was studied following short-term arsenic exposure. The results showed that liver is the major organ of arsenic accumulation; other tissues such as gill, eye

  9. Transgenic modification of potato pectic polysaccharides also affects type and level of cell wall xyloglucan

    NARCIS (Netherlands)

    Huang, Jie Hong; Jiang, Rui; Kortstee, Anne; Dees, Dianka C.T.; Trindade, Luisa M.; Gruppen, Harry; Schols, Henk A.

    2017-01-01

    BACKGROUND: Genes encoding pectic enzymes were introduced into wild-type potato Karnico. Cell wall materials were extracted from Karnico and transgenic lines expressing β-galactosidase (β-Gal-14) or rhamnogalacturonan lyase (RGL-18). Pectic polysaccharides from the β-Gal-14 transgenic line exhibited

  10. Expression of CALR mutants causes mpl-dependent thrombocytosis in zebrafish.

    Science.gov (United States)

    Lim, K-H; Chang, Y-C; Chiang, Y-H; Lin, H-C; Chang, C-Y; Lin, C-S; Huang, L; Wang, W-T; Gon-Shen Chen, C; Chou, W-C; Kuo, Y-Y

    2016-10-07

    CALR mutations are identified in about 30% of JAK2/MPL-unmutated myeloproliferative neoplasms (MPNs) including essential thrombocythemia (ET) and primary myelofibrosis. Although the molecular pathogenesis of CALR mutations leading to MPNs has been studied using in vitro cell lines models, how mutant CALR may affect developmental hematopoiesis remains unknown. Here we took advantage of the zebrafish model to examine the effects of mutant CALR on early hematopoiesis and model human CALR-mutated MPNs. We identified three zebrafish genes orthologous to human CALR, referred to as calr, calr3a and calr3b. The expression of CALR-del52 and CALR-ins5 mutants caused an increase in the hematopoietic stem/progenitor cells followed by thrombocytosis without affecting normal angiogenesis. The expression of CALR mutants also perturbed early developmental hematopoiesis in zebrafish. Importantly, morpholino knockdown of mpl but not epor or csf3r could significantly attenuate the effects of mutant CALR. Furthermore, the expression of mutant CALR caused jak-stat signaling activation in zebrafish that could be blocked by JAK inhibitors (ruxolitinib and fedratinib). These findings showed that mutant CALR activates jak-stat signaling through an mpl-dependent mechanism to mediate pathogenic thrombopoiesis in zebrafish, and illustrated that the signaling machinery related to mutant CALR tumorigenesis are conserved between human and zebrafish.

  11. Comparison of the Exomes of Common Carp (Cyprinus carpio) and Zebrafish (Danio rerio)

    Science.gov (United States)

    Henkel, Christiaan V.; Dirks, Ron P.; Jansen, Hans J.; Forlenza, Maria; Wiegertjes, Geert F.; Howe, Kerstin; van den Thillart, Guido E.E.J.M.

    2012-01-01

    Abstract Research on common carp, Cyprinus carpio, is beneficial for zebrafish research because of resources available owing to its large body size, such as the availability of sufficient organ material for transcriptomics, proteomics, and metabolomics. Here we describe the shot gun sequencing of a clonal double-haploid common carp line. The assembly consists of 511891 scaffolds with an N50 of 17 kb, predicting a total genome size of 1.4–1.5 Gb. A detailed analysis of the ten largest scaffolds indicates that the carp genome has a considerably lower repeat coverage than zebrafish, whilst the average intron size is significantly smaller, making it comparable to the fugu genome. The quality of the scaffolding was confirmed by comparisons with RNA deep sequencing data sets and a manual analysis for synteny with the zebrafish, especially the Hox gene clusters. In the ten largest scaffolds analyzed, the synteny of genes is almost complete. Comparisons of predicted exons of common carp with those of the zebrafish revealed only few genes specific for either zebrafish or carp, most of these being of unknown function. This supports the hypothesis of an additional genome duplication event in the carp evolutionary history, which—due to a higher degree of compactness—did not result in a genome larger than that of zebrafish. PMID:22715948

  12. Recent advances in the development of new transgenic animal technology.

    Science.gov (United States)

    Miao, Xiangyang

    2013-03-01

    Transgenic animal technology is one of the fastest growing biotechnology areas. It is used to integrate exogenous genes into the animal genome by genetic engineering technology so that these genes can be inherited and expressed by offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors in the production of transgenic animals. A variety of transgenic technologies are available. Each has its own advantages and disadvantages and needs further study because of unresolved technical and safety issues. Further studies will allow transgenic technology to explore gene function, animal genetic improvement, bioreactors, animal disease models, and organ transplantation. This article reviews the recently developed animal transgenic technologies, including the germ line stem cell-mediated method to improve efficiency, gene targeting to improve accuracy, RNA interference-mediated gene silencing technology, zinc-finger nuclease gene targeting technology and induced pluripotent stem cell technology. These new transgenic techniques can provide a better platform to develop transgenic animals for breeding new animal varieties and promote the development of medical sciences, livestock production, and other fields.

  13. Large-scale assessment of the zebrafish embryo as a possible predictive model in toxicity testing.

    Directory of Open Access Journals (Sweden)

    Shaukat Ali

    Full Text Available BACKGROUND: In the drug discovery pipeline, safety pharmacology is a major issue. The zebrafish has been proposed as a model that can bridge the gap in this field between cell assays (which are cost-effective, but low in data content and rodent assays (which are high in data content, but less cost-efficient. However, zebrafish assays are only likely to be useful if they can be shown to have high predictive power. We examined this issue by assaying 60 water-soluble compounds representing a range of chemical classes and toxicological mechanisms. METHODOLOGY/PRINCIPAL FINDINGS: Over 20,000 wild-type zebrafish embryos (including controls were cultured individually in defined buffer in 96-well plates. Embryos were exposed for a 96 hour period starting at 24 hours post fertilization. A logarithmic concentration series was used for range-finding, followed by a narrower geometric series for LC(50 determination. Zebrafish embryo LC(50 (log mmol/L, and published data on rodent LD(50 (log mmol/kg, were found to be strongly correlated (using Kendall's rank correlation tau and Pearson's product-moment correlation. The slope of the regression line for the full set of compounds was 0.73403. However, we found that the slope was strongly influenced by compound class. Thus, while most compounds had a similar toxicity level in both species, some compounds were markedly more toxic in zebrafish than in rodents, or vice versa. CONCLUSIONS: For the substances examined here, in aggregate, the zebrafish embryo model has good predictivity for toxicity in rodents. However, the correlation between zebrafish and rodent toxicity varies considerably between individual compounds and compound class. We discuss the strengths and limitations of the zebrafish model in light of these findings.

  14. Gene flow from transgenic common beans expressing the bar gene.

    Science.gov (United States)

    Faria, Josias C; Carneiro, Geraldo E S; Aragão, Francisco J L

    2010-01-01

    Gene flow is a common phenomenon even in self-pollinated plant species. With the advent of genetically modified plants this subject has become of the utmost importance due to the need for controlling the spread of transgenes. This study was conducted to determine the occurrence and intensity of outcrossing in transgenic common beans. In order to evaluate the outcross rates, four experiments were conducted in Santo Antonio de Goiás (GO, Brazil) and one in Londrina (PR, Brazil), using transgenic cultivars resistant to the herbicide glufosinate ammonium and their conventional counterparts as recipients of the transgene. Experiments with cv. Olathe Pinto and the transgenic line Olathe M1/4 were conducted in a completely randomized design with ten replications for three years in one location, whereas the experiments with cv. Pérola and the transgenic line Pérola M1/4 were conducted at two locations for one year, with the transgenic cultivar surrounded on all sides by the conventional counterpart. The outcross occurred at a negligible rate of 0.00741% in cv. Pérola, while none was observed (0.0%) in cv. Olathe Pinto. The frequency of gene flow was cultivar dependent and most of the observed outcross was within 2.5 m from the edge of the pollen source. Index terms: Phaseolus vulgaris, outcross, glufosinate ammonium.

  15. Design and Management of Field Trials of Transgenic Cereals

    Science.gov (United States)

    Bedő, Zoltán; Rakszegi, Mariann; Láng, László

    The development of gene transformation systems has allowed the introgression of alien genes into plant genomes, thus providing a mechanism for broadening the genetic resources available to plant breeders. The design and the management of field trials vary according to the purpose for which transgenic cereals are developed. Breeders study the phenotypic and genotypic stability of transgenic plants, monitor the increase in homozygosity of transgenic genotypes under field conditions, and develop backcross generations to transfer the introduced genes into secondary transgenic cereal genotypes. For practical purposes, they may also multiply seed of the transgenic lines to produce sufficient amounts of grain for the detailed analysis of trait(s) of interest, to determine the field performance of transgenic lines, and to compare them with the non-transformed parental genotypes. Prior to variety registration, the Distinctness, Uniformity and Stability (DUS) tests and Value for Cultivation and Use (VCU) experiments are carried out in field trials. Field testing includes specific requirements for transgenic cereals to assess potential environmental risks. The capacity of the pollen to survive, establish and disseminate in the field test environment, the potential for gene transfer, the effects of products expressed by the introduced sequences and phenotypic and genotypic instability that might cause deleterious effects must all be specifically monitored, as required by EU Directives 2003/701/EC (1) on the release of genetically modified higher plants in the environment.

  16. Estrogenic effects of several BPA analogs in the developing zebrafish brain

    Directory of Open Access Journals (Sweden)

    Joel eCano-Nicolau

    2016-03-01

    Full Text Available Important set of studies have demonstrated the endocrine disrupting activity of Bisphenol A (BPA. The present work aimed at defining estrogenic-like activity of several BPA structural analogs, including BPS, BPF, BPAF, and BPAP, on 4-day or 7-day post-fertilization (dpf zebrafish larva as an in vivo model. We measured the induction level of the estrogen-sensitive marker cyp19a1b gene (Aromatase B, expressed in the brain, using three different in situ/in vivo strategies: 1 Quantification of cyp19a1b transcripts using RT-qPCR in wild type 7-dpf larva brains exposed to bisphenols ; 2 Detection and distribution of cyp19a1b transcripts using in situ hybridization on 7-dpf brain sections (hypothalamus; and 3 Quantification of the cyp19a1b promoter activity in live cyp19a1b-GFP transgenic zebrafish (EASZY assay at 4-dpf larval stage. These three different experimental approaches demonstrated that BPS, BPF or BPAF exposure, similarly to BPA, significantly activates the expression of the estrogenic marker in the brain of developing zebrafish. In vitro experiments using both reporter gene assay in a glial cell context and competitive ligand binding assays strongly suggested that up-regulation of cyp19a1b is largely mediated by the zebrafish estrogen nuclear receptor alpha (zfERα. Importantly, and in contrast to other tested bisphenol A analogs, the bisphenol AP (BPAP did not show estrogenic activity in our model.

  17. Dissection and lateral mounting of zebrafish embryos: analysis of spinal cord development.

    Science.gov (United States)

    Beck, Aaron P; Watt, Roland M; Bonner, Jennifer

    2014-02-28

    The zebrafish spinal cord is an effective investigative model for nervous system research for several reasons. First, genetic, transgenic and gene knockdown approaches can be utilized to examine the molecular mechanisms underlying nervous system development. Second, large clutches of developmentally synchronized embryos provide large experimental sample sizes. Third, the optical clarity of the zebrafish embryo permits researchers to visualize progenitor, glial, and neuronal populations. Although zebrafish embryos are transparent, specimen thickness can impede effective microscopic visualization. One reason for this is the tandem development of the spinal cord and overlying somite tissue. Another reason is the large yolk ball, which is still present during periods of early neurogenesis. In this article, we demonstrate microdissection and removal of the yolk in fixed embryos, which allows microscopic visualization while preserving surrounding somite tissue. We also demonstrate semipermanent mounting of zebrafish embryos. This permits observation of neurodevelopment in the dorso-ventral and anterior-posterior axes, as it preserves the three-dimensionality of the tissue.

  18. Sequential assessment via daphnia and zebrafish for systematic toxicity screening of heterogeneous substances.

    Science.gov (United States)

    Jang, Gun Hyuk; Park, Chang-Beom; Kang, Benedict J; Kim, Young Jun; Lee, Kwan Hyi

    2016-09-01

    Environment and organisms are persistently exposed by a mixture of various substances. However, the current evaluation method is mostly based on an individual substance's toxicity. A systematic toxicity evaluation of heterogeneous substances needs to be established. To demonstrate toxicity assessment of mixture, we chose a group of three typical ingredients in cosmetic sunscreen products that frequently enters ecosystems: benzophenone-3 (BP-3), ethylhexyl methoxycinnamate (EHMC), and titanium dioxide nanoparticle (TiO2 NP). We first determined a range of nominal toxic concentration of each ingredient or substance using Daphnia magna, and then for the subsequent organismal level phenotypic assessment, chose the wild-type zebrafish embryos. Any phenotype change, such as body deformation, led to further examinations on the specific organs of transgenic zebrafish embryos. Based on the systematic toxicity assessments of the heterogeneous substances, we offer a sequential environmental toxicity assessment protocol that starts off by utilizing Daphnia magna to determine a nominal concentration range of each substance and finishes by utilizing the zebrafish embryos to detect defects on the embryos caused by the heterogeneous substances. The protocol showed additive toxic effects of the mixtures. We propose a sequential environmental toxicity assessment protocol for the systematic toxicity screening of heterogeneous substances from Daphnia magna to zebrafish embryo in-vivo models. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. High-Throughput Light Sheet Microscopy for the Automated Live Imaging of Larval Zebrafish

    Science.gov (United States)

    Baker, Ryan; Logan, Savannah; Dudley, Christopher; Parthasarathy, Raghuveer

    The zebrafish is a model organism with a variety of useful properties; it is small and optically transparent, it reproduces quickly, it is a vertebrate, and there are a large variety of transgenic animals available. Because of these properties, the zebrafish is well suited to study using a variety of optical technologies including light sheet fluorescence microscopy (LSFM), which provides high-resolution three-dimensional imaging over large fields of view. Research progress, however, is often not limited by optical techniques but instead by the number of samples one can examine over the course of an experiment, which in the case of light sheet imaging has so far been severely limited. Here we present an integrated fluidic circuit and microscope which provides rapid, automated imaging of zebrafish using several imaging modes, including LSFM, Hyperspectral Imaging, and Differential Interference Contrast Microscopy. Using this system, we show that we can increase our imaging throughput by a factor of 10 compared to previous techniques. We also show preliminary results visualizing zebrafish immune response, which is sensitive to gut microbiota composition, and which shows a strong variability between individuals that highlights the utility of high throughput imaging. National Science Foundation, Award No. DBI-1427957.

  20. Control over the morphology and segregation of Zebrafish germ cell granules during embryonic development

    Directory of Open Access Journals (Sweden)

    Nakkrasae La-Iad

    2008-05-01

    Full Text Available Abstract Background Zebrafish germ cells contain granular-like structures, organized around the cell nucleus. These structures share common features with polar granules in Drosophila, germinal granules in Xenopus and chromatoid bodies in mice germ cells, such as the localization of the zebrafish Vasa, Piwi and Nanos proteins, among others. Little is known about the structure of these granules as well as their segregation in mitosis during early germ-cell development. Results Using transgenic fish expressing a fluorescently labeled novel component of Zebrafish germ cell granules termed Granulito, we followed the morphology and distribution of the granules. We show that whereas these granules initially exhibit a wide size variation, by the end of the first day of development they become a homogeneous population of medium size granules. We investigated this resizing event and demonstrated the role of microtubules and the minus-end microtubule dependent motor protein Dynein in the process. Last, we show that the function of the germ cell granule resident protein the Tudor domain containing protein-7 (Tdrd7 is required for determination of granule morphology and number. Conclusion Our results suggest that Zebrafish germ cell granules undergo a transformation process, which involves germ cell specific proteins as well as the microtubular network.

  1. Imaging retinal progenitor lineages in developing zebrafish embryos.

    Science.gov (United States)

    Jusuf, Patricia; Harris, William A; Poggi, Lucia

    2013-03-01

    In this protocol, we describe how to make and analyze four dimensional (4D) movies of retinal lineage in the zebrafish embryo in vivo. 4D consists of three spatial dimensions (3D) reconstructed from stacks of confocal planes plus one time dimension. Our imaging is performed on transgenic cells that express fluorescent proteins under the control of cell-specific promoters or on cells that transiently express such reporters in specific retinal cell progenitors. An important aspect of lineage tracing is the ability to follow individual cells as they undergo multiple cell divisions, final migration, and differentiation. This may mean many hours of 4D imaging, requiring that cells be kept healthy and maintained under conditions suitable for normal development. The longest movies we have made are ∼50 h. By analyzing these movies, we can see when a specific cell was born and who its sister was, allowing us to reconstruct its retinal lineages in vivo.

  2. Identification and functional characterization of cardiac pacemaker cells in zebrafish.

    Directory of Open Access Journals (Sweden)

    Federico Tessadori

    Full Text Available In the mammalian heart a conduction system of nodes and conducting cells generates and transduces the electrical signals evoking myocardial contractions. Specialized pacemaker cells initiating and controlling cardiac contraction rhythmicity are localized in an anatomically identifiable structure of myocardial origin, the sinus node. We previously showed that in mammalian embryos sinus node cells originate from cardiac progenitors expressing the transcription factors T-box transcription factor 3 (Tbx3 and Islet-1 (Isl1. Although cardiac development and function are strikingly conserved amongst animal classes, in lower vertebrates neither structural nor molecular distinguishable components of a conduction system have been identified, questioning its evolutionary origin. Here we show that zebrafish embryos lacking the LIM/homeodomain-containing transcription factor Isl1 display heart rate defects related to pacemaker dysfunction. Moreover, 3D reconstructions of gene expression patterns in the embryonic and adult zebrafish heart led us to uncover a previously unidentified, Isl1-positive and Tbx2b-positive region in the myocardium at the junction of the sinus venosus and atrium. Through their long interconnecting cellular protrusions the identified Isl1-positive cells form a ring-shaped structure. In vivo labeling of the Isl1-positive cells by transgenic technology allowed their isolation and electrophysiological characterization, revealing their unique pacemaker activity. In conclusion we demonstrate that Isl1-expressing cells, organized as a ring-shaped structure around the venous pole, hold the pacemaker function in the adult zebrafish heart. We have thereby identified an evolutionary conserved, structural and molecular distinguishable component of the cardiac conduction system in a lower vertebrate.

  3. Skeletogenic fate of zebrafish cranial and trunk neural crest.

    Directory of Open Access Journals (Sweden)

    Erika Kague

    Full Text Available The neural crest (NC is a major contributor to the vertebrate craniofacial skeleton, detailed in model organisms through embryological and genetic approaches, most notably in chick and mouse. Despite many similarities between these rather distant species, there are also distinct differences in the contribution of the NC, particularly to the calvariae of the skull. Lack of information about other vertebrate groups precludes an understanding of the evolutionary significance of these differences. Study of zebrafish craniofacial development has contributed substantially to understanding of cartilage and bone formation in teleosts, but there is currently little information on NC contribution to the zebrafish skeleton. Here, we employ a two-transgene system based on Cre recombinase to genetically label NC in the zebrafish. We demonstrate NC contribution to cells in the cranial ganglia and peripheral nervous system known to be NC-derived, as well as to a subset of myocardial cells. The indelible labeling also enables us to determine NC contribution to late-forming bones, including the calvariae. We confirm suspected NC origin of cartilage and bones of the viscerocranium, including cartilages such as the hyosymplectic and its replacement bones (hymandibula and symplectic and membranous bones such as the opercle. The cleithrum develops at the border of NC and mesoderm, and as an ancestral component of the pectoral girdle was predicted to be a hybrid bone composed of both NC and mesoderm tissues. However, we find no evidence of a NC contribution to the cleithrum. Similarly, in the vault of the skull, the parietal bones and the caudal portion of the frontal bones show no evidence of NC contribution. We also determine a NC origin for caudal fin lepidotrichia; the presumption is that these are derived from trunk NC, demonstrating that these cells have the ability to form bone during normal vertebrate development.

  4. Deletion of Pr130 Interrupts Cardiac Development in Zebrafish

    Directory of Open Access Journals (Sweden)

    Jie Yang

    2016-11-01

    Full Text Available Protein phosphatase 2 regulatory subunit B, alpha (PPP2R3A, a regulatory subunit of protein phosphatase 2A (PP2A, is a major serine/threonine phosphatase that regulates crucial function in development and growth. Previous research has implied that PPP2R3A was involved in heart failure, and PR130, the largest transcription of PPP2R3A, functioning in the calcium release of sarcoplasmic reticulum (SR, plays an important role in the excitation-contraction (EC coupling. To obtain a better understanding of PR130 functions in myocardium and cardiac development, two pr130-deletion zebrafish lines were generated using clustered regularly interspaced short palindromic repeats (CRISPR/CRISPR-associated proteins (Cas system. Pr130-knockout zebrafish exhibited cardiac looping defects and decreased cardiac function (decreased fractional area and fractional shortening. Hematoxylin and eosin (H&E staining demonstrated reduced cardiomyocytes. Subsequent transmission electron microscopy revealed that the bright and dark bands were narrowed and blurred, the Z- and M-lines were fogged, and the gaps between longitudinal myocardial fibers were increased. Additionally, increased apoptosis was observed in cardiomyocyte in pr130-knockout zebrafish compared to wild-type (WT. Taken together, our results suggest that pr130 is required for normal myocardium formation and efficient cardiac contractile function.

  5. Dcc regulates asymmetric outgrowth of forebrain neurons in zebrafish.

    Directory of Open Access Journals (Sweden)

    Jingxia Gao

    Full Text Available The guidance receptor DCC (deleted in colorectal cancer ortholog UNC-40 regulates neuronal asymmetry development in Caenorhabditis elegans, but it is not known whether DCC plays a role in the specification of neuronal polarity in vertebrates. To examine the roles of DCC in neuronal asymmetry regulation in vertebrates, we studied zebrafish anterior dorsal telencephalon (ADt neuronal axons. We generated transgenic zebrafish animals expressing the photo-convertible fluorescent protein Kaede in ADt neurons and then photo-converted Kaede to label specifically the ADt neuron axons. We found that ADt axons normally project ventrally. Knock down of Dcc function by injecting antisense morpholino oligonucleotides caused the ADt neurons to project axons dorsally. To examine the axon projection pattern of individual ADt neurons, we labeled single ADt neurons using a forebrain-specific promoter to drive fluorescent protein expression. We found that individual ADt neurons projected axons dorsally or formed multiple processes after morpholino knock down of Dcc function. We further found that knock down of the Dcc ligand, Netrin1, also caused ADt neurons to project axons dorsally. Knockdown of Neogenin1, a guidance receptor closely related to Dcc, enhanced the formation of aberrant dorsal axons in embryos injected with Dcc morpholino. These experiments provide the first evidence that Dcc regulates polarized axon initiation and asymmetric outgrowth of forebrain neurons in vertebrates.

  6. Myocardial Polyploidization Creates a Barrier to Heart Regeneration in Zebrafish.

    Science.gov (United States)

    González-Rosa, Juan Manuel; Sharpe, Michka; Field, Dorothy; Soonpaa, Mark H; Field, Loren J; Burns, Caroline E; Burns, C Geoffrey

    2018-02-26

    Correlative evidence suggests that polyploidization of heart muscle, which occurs naturally in post-natal mammals, creates a barrier to heart regeneration. Here, we move beyond a correlation by demonstrating that experimental polyploidization of zebrafish cardiomyocytes is sufficient to suppress their proliferative potential during regeneration. Initially, we determined that zebrafish myocardium becomes susceptible to polyploidization upon transient cytokinesis inhibition mediated by dominant-negative Ect2. Using a transgenic strategy, we generated adult animals containing mosaic hearts composed of differentially labeled diploid and polyploid-enriched cardiomyocyte populations. Diploid cardiomyocytes outcompeted their polyploid neighbors in producing regenerated heart muscle. Moreover, hearts composed of equivalent proportions of diploid and polyploid cardiomyocytes failed to regenerate altogether, demonstrating that a critical percentage of diploid cardiomyocytes is required to achieve heart regeneration. Our data identify cardiomyocyte polyploidization as a barrier to heart regeneration and suggest that mobilizing rare diploid cardiomyocytes in the human heart will improve its regenerative capacity. Copyright © 2018 Elsevier Inc. All rights reserved.

  7. Caspase-mediated apoptosis induction in zebrafish cerebellar Purkinje neurons.

    Science.gov (United States)

    Weber, Thomas; Namikawa, Kazuhiko; Winter, Barbara; Müller-Brown, Karina; Kühn, Ralf; Wurst, Wolfgang; Köster, Reinhard W

    2016-11-15

    The zebrafish is a well-established model organism in which to study in vivo mechanisms of cell communication, differentiation and function. Existing cell ablation methods are either invasive or they rely on the cellular expression of prokaryotic enzymes and the use of antibiotic drugs as cell death-inducing compounds. We have recently established a novel inducible genetic cell ablation system based on tamoxifen-inducible Caspase 8 activity, thereby exploiting mechanisms of cell death intrinsic to most cell types. Here, we prove its suitability in vivo by monitoring the ablation of cerebellar Purkinje cells (PCs) in transgenic zebrafish that co-express the inducible caspase and a fluorescent reporter. Incubation of larvae in tamoxifen for 8 h activated endogenous Caspase 3 and cell death, whereas incubation for 16 h led to the near-complete loss of PCs by apoptosis. We observed synchronous cell death autonomous to the PC population and phagocytosing microglia in the cerebellum, reminiscent of developmental apoptosis in the forebrain. Thus, induction of apoptosis through targeted activation of caspase by tamoxifen (ATTAC TM ) further expands the repertoire of genetic tools for conditional interrogation of cellular functions. © 2016. Published by The Company of Biologists Ltd.

  8. A dominant-negative mutation within AtMYB90 blocks flower pigment production in transgenic tobacco.

    Science.gov (United States)

    During de novo shoot induction in cultured transgenic tobacco callus a spontaneous mutation within the coding region of a AtMYB90 transgene produced a plant line in which the original transgene-induced over-pigmented phenotype (dark red/purple from anthocyanin overproduction in most tissues) was los...

  9. Transgenics in Agriculture

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 6; Issue 2. Transgenics in Agriculture. D Rex Arunraj B Gajendra Babu. Classroom Volume 6 Issue 2 February 2001 pp 83-92. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/006/02/0083-0092 ...

  10. Intraspinal serotonergic neurons consist of two, temporally distinct populations in developing zebrafish.

    Science.gov (United States)

    Montgomery, Jacob E; Wiggin, Timothy D; Rivera-Perez, Luis M; Lillesaar, Christina; Masino, Mark A

    2016-06-01

    Zebrafish intraspinal serotonergic neuron (ISN) morphology and distribution have been examined in detail at different ages; however, some aspects of the development of these cells remain unclear. Although antibodies to serotonin (5-HT) have detected ISNs in the ventral spinal cord of embryos, larvae, and adults, the only tryptophan hydroxylase (tph) transcript that has been described in the spinal cord is tph1a. Paradoxically, spinal tph1a is only expressed transiently in embryos, which brings the source of 5-HT in the ISNs of larvae and adults into question. Because the pet1 and tph2 promoters drive transgene expression in the spinal cord, we hypothesized that tph2 is expressed in spinal cords of zebrafish larvae. We confirmed this hypothesis through in situ hybridization. Next, we used 5-HT antibody labeling and transgenic markers of tph2-expressing neurons to identify a transient population of ISNs in embryos that was distinct from ISNs that appeared later in development. The existence of separate ISN populations may not have been recognized previously due to their shared location in the ventral spinal cord. Finally, we used transgenic markers and immunohistochemical labeling to identify the transient ISN population as GABAergic Kolmer-Agduhr double-prime (KA″) neurons. Altogether, this study revealed a novel developmental paradigm in which KA″ neurons are transiently serotonergic before the appearance of a stable population of tph2-expressing ISNs. © 2015 Wiley Periodicals, Inc.

  11. Inheritance and segregation of exogenous genes in transgenic cotton

    Indian Academy of Sciences (India)

    Three transgenic cotton varieties (lines) were chosen for the study of inheritance and segregation of foreign Bt (Bacillus thuringiensis toxin) and tfdA genes in cotton. The transformed cotton varieties CCRI 30 and NewCott 33B expressing the Bt cryIA gene, and cotton line TFD expressing the tfdA gene were crossed with ...

  12. microRNA-183 is Essential for Hair Cell Regeneration after Neomycin Injury in Zebrafish.

    Science.gov (United States)

    Kim, Chang Woo; Han, Ji Hyuk; Wu, Ling; Choi, Jae Young

    2018-01-01

    microRNAs (miRNAs) are non-coding RNAs composed of 20 to 22 nucleotides that regulate development and differentiation in various organs by silencing specific RNAs and regulating gene expression. In the present study, we show that the microRNA (miR)-183 cluster is upregulated during hair cell regeneration and that its inhibition reduces hair cell regeneration following neomycin-induced ototoxicity in zebrafish. miRNA expression patterns after neomycin exposure were analyzed using microarray chips. Quantitative polymerase chain reaction was performed to validate miR-183 cluster expression patterns following neomycin exposure (500 μM for 2 h). After injection of an antisense morpholino (MO) to miR-183 (MO-183) immediately after fertilization, hair cell regeneration after neomycin exposure in neuromast cells was evaluated by fluorescent staining (YO-PRO1). The MO-183 effect also was assessed in transgenic zebrafish larvae expressing green fluorescent protein (GFP) in inner ear hair cells. Microarray analysis clearly showed that the miR-183 cluster (miR-96, miR-182, and miR-183) was upregulated after neomycin treatment. We also confirmed upregulated expression of the miR-183 cluster during hair cell regeneration after neomycin-induced ototoxicity. miR-183 inhibition using MO-183 reduced hair cell regeneration in both wild-type and GFP transgenic zebrafish larvae. Our work demonstrates that the miR-183 cluster is essential for the regeneration of hair cells following ototoxic injury in zebrafish larvae. Therefore, regulation of the miR-183 cluster can be a novel target for stimulation of hair cell regeneration. © Copyright: Yonsei University College of Medicine 2018

  13. Efficient genetic transformation of okra (Abelmoschus esculentus (L.) Moench) and generation of insect-resistant transgenic plants expressing the cry1Ac gene.

    Science.gov (United States)

    Narendran, M; Deole, Satish G; Harkude, Satish; Shirale, Dattatray; Nanote, Asaram; Bihani, Pankaj; Parimi, Srinivas; Char, Bharat R; Zehr, Usha B

    2013-08-01

    Agrobacterium -mediated transformation system for okra using embryos was devised and the transgenic Bt plants showed resistance to the target pest, okra shoot, and fruit borer ( Earias vittella ). Okra is an important vegetable crop and progress in genetic improvement via genetic transformation has been impeded by its recalcitrant nature. In this paper, we describe a procedure using embryo explants for Agrobacterium-mediated transformation and tissue culture-based plant regeneration for efficient genetic transformation of okra. Twenty-one transgenic okra lines expressing the Bacillus thuringiensis gene cry1Ac were generated from five transformation experiments. Molecular analysis (PCR and Southern) confirmed the presence of the transgene and double-antibody sandwich ELISA analysis revealed Cry1Ac protein expression in the transgenic plants. All 21 transgenic plants were phenotypically normal and fertile. T1 generation plants from these lines were used in segregation analysis of the transgene. Ten transgenic lines were selected randomly for Southern hybridization and the results confirmed the presence of transgene integration into the genome. Normal Mendelian inheritance (3:1) of cry1Ac gene was observed in 12 lines out of the 21 T0 lines. We selected 11 transgenic lines segregating in a 3:1 ratio for the presence of one transgene for insect bioassays using larvae of fruit and shoot borer (Earias vittella). Fruit from seven transgenic lines caused 100 % larval mortality. We demonstrate an efficient transformation system for okra which will accelerate the development of transgenic okra with novel agronomically useful traits.

  14. Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs.

    Science.gov (United States)

    Yin, Linlin; Maddison, Lisette A; Li, Mingyu; Kara, Nergis; LaFave, Matthew C; Varshney, Gaurav K; Burgess, Shawn M; Patton, James G; Chen, Wenbiao

    2015-06-01

    Determining the mechanism of gene function is greatly enhanced using conditional mutagenesis. However, generating engineered conditional alleles is inefficient and has only been widely used in mice. Importantly, multiplex conditional mutagenesis requires extensive breeding. Here we demonstrate a system for one-generation multiplex conditional mutagenesis in zebrafish (Danio rerio) using transgenic expression of both cas9 and multiple single guide RNAs (sgRNAs). We describe five distinct zebrafish U6 promoters for sgRNA expression and demonstrate efficient multiplex biallelic inactivation of tyrosinase and insulin receptor a and b, resulting in defects in pigmentation and glucose homeostasis. Furthermore, we demonstrate temporal and tissue-specific mutagenesis using transgenic expression of Cas9. Heat-shock-inducible expression of cas9 allows temporal control of tyr mutagenesis. Liver-specific expression of cas9 disrupts insulin receptor a and b, causing fasting hypoglycemia and postprandial hyperglycemia. We also show that delivery of sgRNAs targeting ascl1a into the eye leads to impaired damage-induced photoreceptor regeneration. Our findings suggest that CRISPR/Cas9-based conditional mutagenesis in zebrafish is not only feasible but rapid and straightforward. Copyright © 2015 by the Genetics Society of America.

  15. Expression of an osmotin-like protein from Solanum nigrum confers drought tolerance in transgenic soybean.

    Science.gov (United States)

    Weber, Ricardo Luís Mayer; Wiebke-Strohm, Beatriz; Bredemeier, Christian; Margis-Pinheiro, Márcia; de Brito, Giovani Greigh; Rechenmacher, Ciliana; Bertagnolli, Paulo Fernando; de Sá, Maria Eugênia Lisei; Campos, Magnólia de Araújo; de Amorim, Regina Maria Santos; Beneventi, Magda Aparecida; Margis, Rogério; Grossi-de-Sa, Maria Fátima; Bodanese-Zanettini, Maria Helena

    2014-12-10

    Drought is by far the most important environmental factor contributing to yield losses in crops, including soybeans [Glycine max (L.) Merr.]. To address this problem, a gene that encodes an osmotin-like protein isolated from Solanum nigrum var. americanum (SnOLP) driven by the UBQ3 promoter from Arabidopsis thaliana was transferred into the soybean genome by particle bombardment. Two independently transformed soybean lines expressing SnOLP were produced. Segregation analyses indicated single-locus insertions for both lines. qPCR analysis suggested a single insertion of SnOLP in the genomes of both transgenic lines, but one copy of the hpt gene was inserted in the first line and two in the second line. Transgenic plants exhibited no remarkable phenotypic alterations in the seven analyzed generations. When subjected to water deficit, transgenic plants performed better than the control ones. Leaf physiological measurements revealed that transgenic soybean plants maintained higher leaf water potential at predawn, higher net CO2 assimilation rate, higher stomatal conductance and higher transpiration rate than non-transgenic plants. Grain production and 100-grain weight were affected by water supply. Decrease in grain productivity and 100-grain weight were observed for both transgenic and non-transgenic plants under water deficit; however, it was more pronounced for non-transgenic plants. Moreover, transgenic lines showed significantly higher 100-grain weight than non-transgenic plants under water shortage. This is the first report showing that expression of SnOLP in transgenic soybeans improved physiological responses and yield components of plants when subjected to water deficit, highlighting the potential of this gene for biotechnological applications.

  16. Bio-electrosprayed multicellular zebrafish embryos are viable and develop normally

    International Nuclear Information System (INIS)

    Clarke, Jonathan D W; Jayasinghe, Suwan N

    2008-01-01

    Bio-electrosprays are rapidly emerging as a viable protocol for directly engineering living cells. This communication reports the bio-electrospraying of multicellular organisms, namely zebrafish embryos. The results demonstrate that the bio-electrospray protocol fails to induce any embryological perturbations. In addition to analysing overall embryo morphology, we use transgenic embryos that express green fluorescent protein in specific brain neurons to determine that neuronal numbers and organization are completely normal. These results demonstrate that the bio-electrospraying protocol does not interfere with the complex gene regulation and cell movements required for the development of a multicellular organism. (communication)

  17. Histological Characterization of the Dicer1 Mutant Zebrafish Retina

    Directory of Open Access Journals (Sweden)

    Saeed Akhtar

    2015-01-01

    Full Text Available DICER1, a multidomain RNase III endoribonuclease, plays a critical role in microRNA (miRNA and RNA-interference (RNAi functional pathways. Loss of Dicer1 affects different developmental processes. Dicer1 is essential for retinal development and maintenance. DICER1 was recently shown to have another function of silencing the toxicity of Alu RNAs in retinal pigment epithelium (RPE cells, which are involved in the pathogenesis of age related macular degeneration. In this study, we characterized a Dicer1 mutant fish line, which carries a nonsense mutation (W1457Ter induced by N-ethyl-N-nitrosourea mutagenesis. Zebrafish DICER1 protein is highly conserved in the evolution. Zebrafish Dicer1 is expressed at the earliest stages of zebrafish development and persists into late developmental stages; it is widely expressed in adult tissues. Homozygous Dicer1 mutant fish (DICER1W1457Ter/W1457Ter have an arrest in early growth with significantly smaller eyes and are dead at 14–18 dpf. Heterozygous Dicer1 mutant fish have similar retinal structure to that of control fish; the retinal pigment epithelium (RPE cells are normal with no sign of degeneration at the age of 20 months.

  18. Dehydrins Impart Protection against Oxidative Stress in Transgenic Tobacco Plants.

    Science.gov (United States)

    Halder, Tanmoy; Upadhyaya, Gouranga; Basak, Chandra; Das, Arup; Chakraborty, Chandrima; Ray, Sudipta

    2018-01-01

    Environmental stresses generate reactive oxygen species (ROS) which might be detrimental to the plants when produced in an uncontrolled way. However, the plants ameliorate such stresses by synthesizing antioxidants and enzymes responsible for the dismutation of ROS. Additionally, the dehydrins were also able to protect the inactivation of the enzyme lactate dehydrogenase against hydroxyl radicals (OH ⋅ ) generated during Fenton's reaction. SbDhn1 and SbDhn2 overexpressing transgenic tobacco plants were able to protect against oxidative damage. Transgenic tobacco lines showed better photosynthetic efficiency along with high chlorophyll content, soluble sugar and proline. However, the malonyl dialdehyde (MDA) content was significantly lower in transgenic lines. Experimental evidence demonstrates the protective effect of dehydrins on electron transport chain in isolated chloroplast upon methyl viologen (MV) treatment. The transgenic tobacco plants showed significantly lower superoxide radical generation () upon MV treatment. The accumulation of the H 2 O 2 was also lower in the transgenic plants. Furthermore, in the transgenic plants the expression of ROS scavenging enzymes was higher compared to non-transformed (NT) or vector transformed (VT) plants. Taken together these data, during oxidative stress dehydrins function by scavenging the () directly and also by rendering protection to the enzymes responsible for the dismutation of () thereby significantly reducing the amount of hydrogen peroxides formed. Increase in proline content along with other antioxidants might also play a significant role in stress amelioration. Dehydrins thus function co-operatively with other protective mechanisms under oxidative stress conditions rendering protection in stress environment.

  19. Modeling Myeloid Malignancies Using Zebrafish

    Directory of Open Access Journals (Sweden)

    Kathryn S. Potts

    2017-12-01

    Full Text Available Human myeloid malignancies represent a substantial disease burden to individuals, with significant morbidity and death. The genetic underpinnings of disease formation and progression remain incompletely understood. Large-scale human population studies have identified a high frequency of potential driver mutations in spliceosomal and epigenetic regulators that contribute to malignancies, such as myelodysplastic syndromes (MDS and leukemias. The high conservation of cell types and genes between humans and model organisms permits the investigation of the underlying mechanisms of leukemic development and potential therapeutic testing in genetically pliable pre-clinical systems. Due to the many technical advantages, such as large-scale screening, lineage-tracing studies, tumor transplantation, and high-throughput drug screening approaches, zebrafish is emerging as a model system for myeloid malignancies. In this review, we discuss recent advances in MDS and leukemia using the zebrafish model.

  20. Morphological and molecular evidence for functional organization along the rostrocaudal axis of the adult zebrafish intestine

    Directory of Open Access Journals (Sweden)

    Lam Siew

    2010-06-01

    Full Text Available Abstract Background The zebrafish intestine is a simple tapered tube that is folded into three sections. However, whether the intestine is functionally similar along its length remains unknown. Thus, a systematic structural and functional characterization of the zebrafish intestine is desirable for future studies of the digestive tract and the intestinal biology and development. Results To characterize the structure and function of the adult zebrafish intestine, we divided the intestine into seven roughly equal-length segments, S1-S7, and systematically examined the morphology of the mucosal lining, histology of the epithelium, and molecular signatures from transcriptome analysis. Prominent morphological features are circumferentially-oriented villar ridges in segments S1-S6 and the absence of crypts. Molecular characterization of the transcriptome from each segment shows that segments S1-S5 are very similar while S6 and S7 unique. Gene ontology analyses reveal that S1-S5 express genes whose functions involve metabolism of carbohydrates, transport of lipids and energy generation, while the last two segments display relatively limited function. Based on comparative Gene Set Enrichment Analysis, the first five segments share strong similarity with human and mouse small intestine while S6 shows similarity with human cecum and rectum, and S7 with human rectum. The intestinal tract does not display the anatomical, morphological, and molecular signatures of a stomach and thus we conclude that this organ is absent from the zebrafish digestive system. Conclusions Our genome-wide gene expression data indicate that, despite the lack of crypts, the rostral, mid, and caudal portions of the zebrafish intestine have distinct functions analogous to the mammalian small and large intestine, respectively. Organization of ridge structures represents a unique feature of zebrafish intestine, though they produce similar cross sections to mammalian intestines

  1. Transgenic algae engineered for higher performance

    Science.gov (United States)

    Unkefer, Pat J; Anderson, Penelope S; Knight, Thomas J

    2014-10-21

    The present disclosure relates to transgenic algae having increased growth characteristics, and methods of increasing growth characteristics of algae. In particular, the disclosure relates to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and a glutamine synthetase.

  2. Transgenic Cavendish bananas with resistance to Fusarium wilt tropical race 4.

    Science.gov (United States)

    Dale, James; James, Anthony; Paul, Jean-Yves; Khanna, Harjeet; Smith, Mark; Peraza-Echeverria, Santy; Garcia-Bastidas, Fernando; Kema, Gert; Waterhouse, Peter; Mengersen, Kerrie; Harding, Robert

    2017-11-14

    Banana (Musa spp.) is a staple food for more than 400 million people. Over 40% of world production and virtually all the export trade is based on Cavendish banana. However, Cavendish banana is under threat from a virulent fungus, Fusarium oxysporum f. sp. cubense tropical race 4 (TR4) for which no acceptable resistant replacement has been identified. Here we report the identification of transgenic Cavendish with resistance to TR4. In our 3-year field trial, two lines of transgenic Cavendish, one transformed with RGA2, a gene isolated from a TR4-resistant diploid banana, and the other with a nematode-derived gene, Ced9, remain disease free. Transgene expression in the RGA2 lines is strongly correlated with resistance. Endogenous RGA2 homologs are also present in Cavendish but are expressed tenfold lower than that in our most resistant transgenic line. The expression of these homologs can potentially be elevated through gene editing, to provide non-transgenic resistance.

  3. Zebrafish kidney phagocytes utilize macropinocytosis and Ca+-dependent endocytic mechanisms.

    Directory of Open Access Journals (Sweden)

    Claudia Hohn

    Full Text Available BACKGROUND: The innate immune response constitutes the first line of defense against invading pathogens and consists of a variety of immune defense mechanisms including active endocytosis by macrophages and granulocytes. Endocytosis can be used as a reliable measure of selective and non-selective mechanisms of antigen uptake in the early phase of an immune response. Numerous assays have been developed to measure this response in a variety of mammalian and fish species. The small size of the zebrafish has prevented the large-scale collection of monocytes/macrophages and granulocytes for these endocytic assays. METHODOLOGY/PRINCIPAL FINDINGS: Pooled zebrafish kidney hematopoietic tissues were used as a source of phagocytic cells for flow-cytometry based endocytic assays. FITC-Dextran, Lucifer Yellow and FITC-Edwardsiella ictaluri were used to evaluate selective and non-selective mechanisms of uptake in zebrafish phagocytes. CONCLUSIONS/SIGNIFICANCE: Zebrafish kidney phagocytes characterized as monocytes/macrophages, neutrophils and lymphocytes utilize macropinocytosis and Ca(2+-dependant endocytosis mechanisms of antigen uptake. These cells do not appear to utilize a mannose receptor. Heat-killed Edwardsiella ictaluri induces cytoskeletal interactions for internalization in zebrafish kidney monocytes/macrophages and granulocytes. The proposed method is easy to implement and should prove especially useful in immunological, toxicological and epidemiological research.

  4. Epilepsy, Behavioral Abnormalities, and Physiological Comorbidities in Syntaxin-Binding Protein 1 (STXBP1 Mutant Zebrafish.

    Directory of Open Access Journals (Sweden)

    Brian P Grone

    Full Text Available Mutations in the synaptic machinery gene syntaxin-binding protein 1, STXBP1 (also known as MUNC18-1, are linked to childhood epilepsies and other neurodevelopmental disorders. Zebrafish STXBP1 homologs (stxbp1a and stxbp1b have highly conserved sequence and are prominently expressed in the larval zebrafish brain. To understand the functions of stxbp1a and stxbp1b, we generated loss-of-function mutations using CRISPR/Cas9 gene editing and studied brain electrical activity, behavior, development, heart physiology, metabolism, and survival in larval zebrafish. Homozygous stxbp1a mutants exhibited a profound lack of movement, low electrical brain activity, low heart rate, decreased glucose and mitochondrial metabolism, and early fatality compared to controls. On the other hand, homozygous stxbp1b mutants had spontaneous electrographic seizures, and reduced locomotor activity response to a movement-inducing "dark-flash" visual stimulus, despite showing normal metabolism, heart rate, survival, and baseline locomotor activity. Our findings in these newly generated mutant lines of zebrafish suggest that zebrafish recapitulate clinical phenotypes associated with human syntaxin-binding protein 1 mutations.

  5. Effects of titanium dioxide nanoparticles exposure on parkinsonism in zebrafish larvae and PC12.

    Science.gov (United States)

    Hu, Qinglian; Guo, Fengliang; Zhao, Fenghui; Fu, Zhengwei

    2017-04-01

    Nanomaterials hold significant potential for industrial and biomedical application these years. Therefore, the relationship between nanoparticles and neurodegenerative disease is of enormous interest. In this contribution, zebrafish embryos and PC12 cell lines were selected for studying neurotoxicity of titanium dioxide nanoparticles (TiO 2 NPs). After exposure of different concentrations of TiO 2 NPs to embryos from fertilization to 96 hpf, the hatching time of zebrafish was decreased, accompanied by an increase in malformation rate. However, no significant increases in mortality relative to control were observed. These results indicated that TiO 2 NPs exposure hold a risk for premature of zebrafish embryos, but not fatal. The further investigation confirmed that TiO 2 NPs could accumulate in the brain of zebrafish larvae, resulting in reactive oxygen species (ROS) generation and cell death of hypothalamus. Meanwhile, q-PCR analysis showed that TiO 2 NPs exposure increased the pink1, parkin, α-syn and uchl1 gene expression, which are related with the formation of Lewy bodies. We also observed loss of dopaminergic neurons in zebrafish and in vitro. These remarkable hallmarks are all linked to these Parkinson's disease (PD) symptoms. Our results indicate that TiO 2 NPs exposure induces neurotoxicity in vivo and in vitro, which poses a significant risk factor for the development of PD. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Overexpression of host plant urease in transgenic silkworms.

    Science.gov (United States)

    Jiang, Liang; Huang, Chunlin; Sun, Qiang; Guo, Huizhen; Peng, Zhengwen; Dang, Yinghui; Liu, Weiqiang; Xing, Dongxu; Xu, Guowen; Zhao, Ping; Xia, Qingyou

    2015-06-01

    Bombyx mori and mulberry constitute a model of insect-host plant interactions. Urease hydrolyzes urea to ammonia and is important for the nitrogen metabolism of silkworms because ammonia is assimilated into silk protein. Silkworms do not synthesize urease and acquire it from mulberry leaves. We synthesized the artificial DNA sequence ureas using the codon bias of B. mori to encode the signal peptide and mulberry urease protein. A transgenic vector that overexpresses ure-as under control of the silkworm midgut-specific P2 promoter was constructed. Transgenic silkworms were created via embryo microinjection. RT-PCR results showed that urease was expressed during the larval stage and qPCR revealed the expression only in the midgut of transgenic lines. Urea concentration in the midgut and hemolymph of transgenic silkworms was significantly lower than in a nontransgenic line when silkworms were fed an artificial diet. Analysis of the daily body weight and food conversion efficiency of the fourth and fifth instar larvae and economic characteristics indicated no differences between transgenic silkworms and the nontransgenic line. These results suggested that overexpression of host plant urease promoted nitrogen metabolism in silkworms.

  7. Plant biotechnology: transgenic crops.

    Science.gov (United States)

    Shewry, Peter R; Jones, Huw D; Halford, Nigel G

    2008-01-01

    Transgenesis is an important adjunct to classical plant breeding, in that it allows the targeted manipulation of specific characters using genes from a range of sources. The current status of crop transformation is reviewed, including methods of gene transfer, the selection of transformed plants and control of transgene expression. The application of genetic modification technology to specific traits is then discussed, including input traits relating to crop production (herbicide tolerance and resistance to insects, pathogens and abiotic stresses) and output traits relating to the composition and quality of the harvested organs. The latter include improving the nutritional quality for consumers as well as the improvement of functional properties for food processing.

  8. Dynamic neuroanatomy at subcellular resolution in the zebrafish.

    Science.gov (United States)

    Faucherre, Adèle; López-Schier, Hernán

    2014-01-01

    Genetic means to visualize and manipulate neuronal circuits in the intact animal have revolutionized neurobiology. "Dynamic neuroanatomy" defines a range of approaches aimed at quantifying the architecture or subcellular organization of neurons over time during their development, regeneration, or degeneration. A general feature of these approaches is their reliance on the optical isolation of defined neurons in toto by genetically expressing markers in one or few cells. Here we use the afferent neurons of the lateral line as an example to describe a simple method for the dynamic neuroanatomical study of axon terminals in the zebrafish by laser-scanning confocal microscopy.

  9. Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus.

    Science.gov (United States)

    Le, Dung Tien; Chu, Ha Duc; Sasaya, Takahide

    2015-01-01

    Rice tungro spherical virus (RTSV), also known as Rice waika virus, does not cause visible symptoms in infected rice plants. However, the virus plays a critical role in spreading Rice tungro bacilliform virus (RTBV), which is the major cause of severe symptoms of rice tungro disease. Recent studies showed that RNA interference (RNAi) can be used to develop virus-resistance transgenic rice plants. In this report, we presented simple procedures and protocols needed for the creation of transgenic rice plants capable of producing small interfering RNA specific against RTSV sequences. Notably, our study showed that 60 out of 64 individual hygromycin-resistant lines (putative transgenic lines) obtained through transformation carried transgenes designed for producing hairpin double-stranded RNA. Northern blot analyses revealed the presence of small interfering RNA of 21- to 24-mer in 46 out of 56 confirmed transgenic lines. Taken together, our study indicated that transgenic rice plants carrying an inverted repeat of 500-bp fragments encoding various proteins of RTSV can produce small interfering RNA from the hairpin RNA transcribed from that transgene. In light of recent studies with other viruses, it is possible that some of these transgenic rice lines might be resistant to RTSV.

  10. Transgenic poplars with reduced lignin show impaired xylem conductivity, growth efficiency and survival

    Science.gov (United States)

    Steven L. Voelker; Barbara Lachenbruch; Frederick C. Meinzer; Peter Kitin; Steven H. Strauss

    2011-01-01

    We studied xylem anatomy and hydraulic architecture in 14 transgenic insertion events and a control line of hybrid poplar (Populus spp.) that varied in lignin content. Transgenic events had different levels of down-regulation of two genes encoding 4-coumarate:coenzyme A ligase (4CL). Two-year-old trees were characterized after...

  11. [TSA improve transgenic porcine cloned embryo development and transgene expression].

    Science.gov (United States)

    Kong, Qing-Ran; Zhu, Jiang; Huang, Bo; Huan, Yan-Jun; Wang, Feng; Shi, Yong-Qian; Liu, Zhong-Feng; Wu, Mei-Ling; Liu, Zhong-Hua

    2011-07-01

    Uncompleted epigenetic reprogramming is attributed to the low efficiency of producing transgenic cloned animals. Histone modification associated with epigenetics can directly influence the embryo development and transgene expression. Trichostatin A (TSA), as an inhibitor of histone deacetylase, can change the status of histone acetylation, improve somatic cell reprogramming, and enhance cloning efficiency. TSA prevents the chromatin structure from being condensed, so that transcription factor could binds to DNA sequence easily and enhance transgene expression. Our study established the optimal TSA treatment on porcine donor cells and cloned embryos, 250 nmol/L, 24 h and 40 nmol/L, 24 h, respectively. Furthermore, we found that both the cloned embryo and the donor cell treated by TSA resulted in the highest development efficiency. Meanwhile, TSA can improve transgene expression in donor cell and cloned embryo. In summary, TSA can significantly improve porcine reconstructed embryo development and transgene expression.

  12. Development of transgenic watermelon resistant to Cucumber mosaic virus and Watermelon mosaic virus by using a single chimeric transgene construct.

    Science.gov (United States)

    Lin, Ching-Yi; Ku, Hsin-Mei; Chiang, Yi-Hua; Ho, Hsiu-Yin; Yu, Tsong-Ann; Jan, Fuh-Jyh

    2012-10-01

    Watermelon, an important fruit crop worldwide, is prone to attack by several viruses that often results in destructive yield loss. To develop a transgenic watermelon resistant to multiple virus infection, a single chimeric transgene comprising a silencer DNA from the partial N gene of Watermelon silver mottle virus (WSMoV) fused to the partial coat protein (CP) gene sequences of Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV) and Watermelon mosaic virus (WMV) was constructed and transformed into watermelon (cv. Feeling) via Agrobacterium-mediated transformation. Single or multiple transgene copies randomly inserted into various locations in the genome were confirmed by Southern blot analysis. Transgenic watermelon R(0) plants were individually challenged with CMV, CGMMV or WMV, or with a mixture of these three viruses for resistance evaluation. Two lines were identified to exhibit resistance to CMV, CGMMV, WMV individually, and a mixed inoculation of the three viruses. The R(1) progeny of the two resistant R(0) lines showed resistance to CMV and WMV, but not to CGMMV. Low level accumulation of transgene transcripts in resistant plants and small interfering (si) RNAs specific to CMV and WMV were readily detected in the resistant R(1) plants by northern blot analysis, indicating that the resistance was established via RNA-mediated post-transcriptional gene silencing (PTGS). Loss of the CGMMV CP-transgene fragment in R1 progeny might be the reason for the failure to resistant CGMMV infection, as shown by the absence of a hybridization signal and no detectable siRNA specific to CGMMV in Southern and northern blot analyses. In summary, this study demonstrated that fusion of different viral CP gene fragments in transgenic watermelon contributed to multiple virus resistance via PTGS. The construct and resistant watermelon lines developed in this study could be used in a watermelon breeding program for resistance to multiple viruses.

  13. Intein-mediated Cre protein assembly for transgene excision in hybrid progeny of transgenic Arabidopsis.

    Science.gov (United States)

    Ge, Jia; Wang, Lijun; Yang, Chen; Ran, Lingyu; Wen, Mengling; Fu, Xianan; Fan, Di; Luo, Keming

    2016-10-01

    An approach for restoring recombination activity of complementation split-Cre was developed to excise the transgene in hybrid progeny of GM crops. Growing concerns about the biosafety of genetically modified (GM) crops has currently become a limited factor affecting the public acceptance. Several approaches have been developed to generate selectable-marker-gene-free GM crops. However, no strategy was reported to be broadly applicable to hybrid crops. Previous studies have demonstrated that complementation split-Cre recombinase restored recombination activity in transgenic plants. In this study, we found that split-Cre mediated by split-intein Synechocystis sp. DnaE had high recombination efficiency when Cre recombinase was split at Asp232/Asp233 (866 bp). Furthermore, we constructed two plant expression vectors, pCA-NCre-In and pCA-Ic-CCre, containing NCre866-In and Ic-CCre866 fragments, respectively. After transformation, parent lines of transgenic Arabidopsis with one single copy were generated and used for hybridization. The results of GUS staining demonstrated that the recombination activity of split-Cre could be reassembled in these hybrid progeny of transgenic plants through hybridization and the foreign genes flanked by two loxP sites were efficiently excised. Our strategy may provide an effective approach for generating the next generation of GM hybrid crops without biosafety concerns.

  14. Single molecule Raman spectroscopic assay to detect transgene from GM plants.

    Science.gov (United States)

    Kadam, Ulhas S; Chavhan, Rahul L; Schulz, Burkhard; Irudayaraj, Joseph

    2017-09-01

    Substantial concerns have been raised for the safety of transgenics on human health and environment. Many organizations, consumer groups, and environmental agencies advocate for stringent regulations to avoid transgene products' contamination in food cycle or in nature. Here we demonstrate a novel approach using surface enhanced Raman spectroscopy (SERS) to detect and quantify transgene from GM plants. We show a highly sensitive and accurate quantification of transgene DNA from multiple transgenic lines of Arabidopsis. The assay allows us to detect and quantify the transgenes as low as 0.10 pg without need for PCR-amplification. This technology is relatively cheap, quick, simple, and suitable for detection at low target concentration. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. The importance of Zebrafish in biomedical research.

    Science.gov (United States)

    Tavares, Bárbara; Santos Lopes, Susana

    2013-01-01

    Zebrafish (Danio rerio) is an ideal model organism for the study of vertebrate development. This is due to the large clutches that each couple produces, with up to 200 embryos every 7 days, and to the fact that the embryos and larvae are small, transparent and undergo rapid external development. Using scientific literature research tools available online and the keywords Zebrafish, biomedical research, human disease, and drug screening, we reviewed original studies and reviews indexed in PubMed. In this review we summarized work conducted with this model for the advancement of our knowledge related to several human diseases. We also focused on the biomedical research being performed in Portugal with the zebrafish model. Powerful live imaging and genetic tools are currently available for zebrafish making it a valuable model in biomedical research. The combination of these properties with the optimization of automated systems for drug screening has transformed the zebrafish into "a top model" in biomedical research, drug discovery and toxicity testing. Furthermore, with the optimization of xenografts technology it will be possible to use zebrafish to aide in the choice of the best therapy for each patient. Zebrafish is an excellent model organism in biomedical research, drug development and in clinical therapy.

  16. Zebrafish: an exciting model for investigating the spatio-temporal pattern of enteric nervous system development.

    LENUS (Irish Health Repository)

    Doodnath, Reshma

    2012-02-01

    AIM: Recently, the zebrafish (Danio rerio) has been shown to be an excellent model for human paediatric research. Advantages over other models include its small size, externally visually accessible development and ease of experimental manipulation. The enteric nervous system (ENS) consists of neurons and enteric glia. Glial cells permit cell bodies and processes of neurons to be arranged and maintained in a proper spatial arrangement, and are essential in the maintenance of basic physiological functions of neurons. Glial fibrillary acidic protein (GFAP) is expressed in astrocytes, but also expressed outside of the central nervous system. The aim of this study was to investigate the spatio-temporal pattern of GFAP expression in developing zebrafish ENS from 24 h post-fertilization (hpf), using transgenic fish that express green fluorescent protein (GFP). METHODS: Zebrafish embryos were collected from transgenic GFP Tg(GFAP:GFP)(mi2001) adult zebrafish from 24 to 120 hpf, fixed and processed for whole mount immunohistochemistry. Antibodies to Phox2b were used to identify enteric neurons. Specimens were mounted on slides and imaging was performed using a fluorescent laser confocal microscope. RESULTS: GFAP:GFP labelling outside the spinal cord was identified in embryos from 48 hpf. The patterning was intracellular and consisted of elongated profiles that appeared to migrate away from the spinal cord into the periphery. At 72 and 96 hpf, GFAP:GFP was expressed dorsally and ventrally to the intestinal tract. At 120 hpf, GFAP:GFP was expressed throughout the intestinal wall, and clusters of enteric neurons were identified using Phox2b immunofluorescence along the pathway of GFAP:GFP positive processes, indicative of a migratory pathway of ENS precursors from the spinal cord into the intestine. CONCLUSION: The pattern of migration of GFAP:GFP expressing cells outside the spinal cord suggests an organized, early developing migratory pathway to the ENS. This shows for the

  17. 2017 Midwest Zebrafish Meeting Report.

    Science.gov (United States)

    Sandquist, Elizabeth; Petersen, Sarah C; Smith, Cody J

    2017-12-01

    The 2017 Midwest Zebrafish meeting was held from June 16 to 18 at the University of Cincinnati, sponsored by the Cincinnati Children's Hospital Divisions of Developmental Biology, Molecular Cardiovascular Biology, and Gastroenterology, Hepatology, and Nutrition. The meeting, organized by Saulius Sumanas, Joshua Waxman, and Chunyue Yin, hosted >130 attendees from 16 different states. Scientific sessions were focused on morphogenesis, neural development, novel technologies, and disease models, with Steve Ekker, Stephen Potter, and Lila Solnica-Krezel presenting keynote talks. In this article, we highlight the results and emerging themes from the meeting.

  18. Bipolar Cell-Photoreceptor Connectivity in the Zebrafish (Danio rerio) Retina

    Science.gov (United States)

    Li, Yong N.; Tsujimura, Taro; Kawamura, Shoji; Dowling, John E.

    2013-01-01

    Bipolar cells convey luminance, spatial and color information from photoreceptors to amacrine and ganglion cells. We studied the photoreceptor connectivity of 321 bipolar cells in the adult zebrafish retina. 1,1'-Dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate (DiI) was inserted into whole-mounted transgenic zebrafish retinas to label bipolar cells. The photoreceptors that connect to these DiI-labeled cells were identified by transgenic fluorescence or their positions relative to the fluorescent cones, as cones are arranged in a highly-ordered mosaic: rows of alternating blue- (B) and ultraviolet-sensitive (UV) single cones alternate with rows of red- (R) and green-sensitive (G) double cones. Rod terminals intersperse among cone terminals. As many as 18 connectivity subtypes were observed, 9 of which – G, GBUV, RG, RGB, RGBUV, RGRod, RGBRod, RGBUVRod and RRod bipolar cells – accounted for 96% of the population. Based on their axon terminal stratification, these bipolar cells could be further sub-divided into ON, OFF, and ON-OFF cells. The dendritic spread size, soma depth and size, and photoreceptor connections of the 308 bipolar cells within the 9 common connectivity subtypes were determined, and their dendritic tree morphologies and axonal stratification patterns compared. We found that bipolar cells with the same axonal stratification patterns could have heterogeneous photoreceptor connectivity whereas bipolar cells with the same dendritic tree morphology usually had the same photoreceptor connectivity, although their axons might stratify on different levels. PMID:22907678

  19. Production of transgenic brassica juncea with the synthetic chitinase gene (nic) conferring resistance to alternaria brassicicola

    International Nuclear Information System (INIS)

    Munir, I.; Hussan, W.; Kazi, M.; Mian, A.

    2016-01-01

    Brassica juncea is an important oil seed crop throughout the world. The demand and cultivation of oil seed crops has gained importance due to rapid increase in world population and industrialization. Fungal diseases pose a great threat to Brassica productivity worldwide. Absence of resistance genes against fungal infection within crossable germplasms of this crop necessitates deployment of genetic engineering approaches to produce transgenic plants with resistance against fungal infections. In the current study, hypocotyls and cotyledons of Brassica juncea, used as explants, were transformed with Agrobacterium tumefacien strain EHA101 harboring binary vector pEKB/NIC containing synthetic chitinase gene (NIC), an antifungal gene under the control of cauliflower mosaic virus promoter (CaMV35S). Bar genes and nptII gene were used as selectable markers. Presence of chitinase gene in trangenic lines was confirmed by PCR and southern blotting analysis. Effect of the extracted proteins from non-transgenic and transgenic lines was observed on the growth of Alternaria brassicicola, a common disease causing pathogen in brassica crop. In comparison to non-transgenic control lines, the leaf tissue extracts of the transgenic lines showed considerable resistance and antifungal activity against A. brassicicola. The antifungal activity in transgenic lines was observed as corresponding to the transgene copy number. (author)

  20. Recombineering strategies for developing next generation BAC transgenic tools for optogenetics and beyond.

    Science.gov (United States)

    Ting, Jonathan T; Feng, Guoping

    2014-01-01

    The development and application of diverse BAC transgenic rodent lines has enabled rapid progress for precise molecular targeting of genetically-defined cell types in the mammalian central nervous system. These transgenic tools have played a central role in the optogenetic revolution in neuroscience. Indeed, an overwhelming proportion of studies in this field have made use of BAC transgenic Cre driver lines to achieve targeted expression of optogenetic probes in the brain. In addition, several BAC transgenic mouse lines have been established for direct cell-type specific expression of Channelrhodopsin-2 (ChR2). While the benefits of these new tools largely outweigh any accompanying challenges, many available BAC transgenic lines may suffer from confounds due in part to increased gene dosage of one or more "extra" genes contained within the large BAC DNA sequences. Here we discuss this under-appreciated issue and propose strategies for developing the next generation of BAC transgenic lines that are devoid of extra genes. Furthermore, we provide evidence that these strategies are simple, reproducible, and do not disrupt the intended cell-type specific transgene expression patterns for several distinct BAC clones. These strategies may be widely implemented for improved BAC transgenesis across diverse disciplines.

  1. Hardwiring of fine synaptic layers in the zebrafish visual pathway

    Directory of Open Access Journals (Sweden)

    Taylor Michael R

    2008-12-01

    Full Text Available Abstract Background Neuronal connections are often arranged in layers, which are divided into sublaminae harboring synapses with similar response properties. It is still debated how fine-grained synaptic layering is established during development. Here we investigated two stratified areas of the zebrafish visual pathway, the inner plexiform layer (IPL of the retina and the neuropil of the optic tectum, and determined if activity is required for their organization. Results The IPL of 5-day-old zebrafish larvae is composed of at least nine sublaminae, comprising the connections between different types of amacrine, bipolar, and ganglion cells (ACs, BCs, GCs. These sublaminae were distinguished by their expression of cell type-specific transgenic fluorescent reporters and immunohistochemical markers, including protein kinase Cβ (PKC, parvalbumin (Parv, zrf3, and choline acetyltransferase (ChAT. In the tectum, four retinal input layers abut a laminated array of neurites of tectal cells, which differentially express PKC and Parv. We investigated whether these patterns were affected by experimental disruptions of retinal activity in developing fish. Neither elimination of light inputs by dark rearing, nor a D, L-amino-phosphono-butyrate-induced reduction in the retinal response to light onset (but not offset altered IPL or tectal lamination. Moreover, thorough elimination of chemical synaptic transmission with Botulinum toxin B left laminar synaptic arrays intact. Conclusion Our results call into question a role for activity-dependent mechanisms – instructive light signals, balanced on and off BC activity, Hebbian plasticity, or a permissive role for synaptic transmission – in the synaptic stratification we examined. We propose that genetically encoded cues are sufficient to target groups of neurites to synaptic layers in this vertebrate visual system.

  2. TL transgenic mouse strains

    International Nuclear Information System (INIS)

    Obata, Y.; Matsudaira, Y.; Hasegawa, H.; Tamaki, H.; Takahashi, T.; Morita, A.; Kasai, K.

    1993-01-01

    As a result of abnormal development of the thymus of these mice, TCR αβ lineage of the T cell differentiation is disturbed and cells belonging to the TCR γδ CD4 - CD8 - double negative (DN) lineage become preponderant. The γδ DN cells migrate into peripheral lymphoid organs and constitute nearly 50% of peripheral T cells. Immune function of the transgenic mice is severely impaired, indicating that the γδ cells are incapable of participating in these reactions. Molecular and serological analyses of T-cell lymphomas reveal that they belong to the γδ lineage. Tg.Tla a -3-1 mice should be useful in defining the role of TL in normal and abnormal T cell differentiation as well as in the development of T-cell lymphomas, and further they should facilitate studies on the differentiation and function of γδ T cells. We isolated T3 b -TL gene from B6 mice and constructed a chimeric gene in which T3 b -TL is driven by the promoter of H-2K b . With the chimeric gene, two transgenic mouse strains, Tg. Con.3-1 and -2 have been derived in C3H background. Both strains express TL antigen in various tissues including skin. The skin graft of transgenic mice on C3H and (B6 X C3H)F 1 mice were rejected. In the mice which rejected the grafts, CD8 + TCRαβ cytotoxic T cells (CTL) against TL antigens were recognized. The recognition of TL by CTL did not require the antigen presentation by H-2 molecules. The results indicated that TL antigen in the skin becomes a transplantation antigen and behaves like a typical allogeneic MHC class I antigen. The facts that (B6 X C3H)F 1 mice rejected the skin expressing T3 b -TL antigen and induced CTL that killed TL + lymphomas of B6 origin revealed that TL antigen encoded by T3 b -TL is recognized as non-self in B6 mice. Experiments are now extended to analyze immune responses to TL antigen expressed on autochthonous T cell lymphomas. (J.P.N.)

  3. Sprouting Buds of Zebrafish Research in Malaysia: First Malaysia Zebrafish Disease Model Workshop.

    Science.gov (United States)

    Okuda, Kazuhide Shaun; Tan, Pei Jean; Patel, Vyomesh

    2016-04-01

    Zebrafish is gaining prominence as an important vertebrate model for investigating various human diseases. Zebrafish provides unique advantages such as optical clarity of embryos, high fecundity rate, and low cost of maintenance, making it a perfect complement to the murine model equivalent in biomedical research. Due to these advantages, researchers in Malaysia are starting to take notice and incorporate the zebrafish model into their research activities. However, zebrafish research in Malaysia is still in its infancy stage and many researchers still remain unaware of the full potential of the zebrafish model or have limited access to related tools and techniques that are widely utilized in many zebrafish laboratories worldwide. To overcome this, we organized the First Malaysia Zebrafish Disease Model Workshop in Malaysia that took place on 11th and 12th of November 2015. In this workshop, we showcased how the zebrafish model is being utilized in the biomedical field in international settings as well as in Malaysia. For this, notable international speakers and those from local universities known to be carrying out impactful research using zebrafish were invited to share some of the cutting edge techniques that are used in their laboratories that may one day be incorporated in the Malaysian scientific community.

  4. Segregation and expression of transgenes in the progenies of Bt ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-04-17

    Apr 17, 2012 ... segregation was observed in BC1F1, BC1F2 and F2 populations derived .... randomly chosen at the tillering stage respectively and were ground .... Figure 2. Southern blot of Hind III-digested DNA from Bt transgenic rice line ...

  5. Transgenic engineering of male-specific muscular hypertrophy

    DEFF Research Database (Denmark)

    Pirottin, D.; Grobet, L.; Adamantidis, A.

    2005-01-01

    Using a two-step procedure involving insertional gene targeting and recombinase-mediated cassette exchange in ES cells, we have produced two lines of transgenic mice expressing a dominant-negative latency-associated myostatin propeptide under control of the myosin light chain 1F promoter and 1/3 ...

  6. Complex genomic rearrangement in CCS-LacZ transgenic mice.

    Science.gov (United States)

    Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I

    2007-02-01

    The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.

  7. A review of monoaminergic neuropsychopharmacology in zebrafish.

    Science.gov (United States)

    Maximino, Caio; Herculano, Anderson Manoel

    2010-12-01

    Monoamine neurotransmitters are the major regulatory mechanisms in the vertebrate brain, involved in the adjustment of motivation, emotion, and cognition. The chemical anatomy of these systems is thought to be highly conserved in the brain of all vertebrates, including zebrafish. Recently, the development of behavioral assays in zebrafish allowed the neuropsychopharmacological investigation of these circuits and its functions. Here we review neuroanatomical, genetic, neurochemical, and psychopharmacological evidence regarding the roles of histaminergic, dopaminergic, noradrenergic, serotonergic, and melatonergic systems in this species. We conclude that, in spite of species differences, zebrafish are suitable for the investigation of neuropsychopharmacology of drugs that affect theses systems; nonetheless, more thorough validation of behavioral methods is still needed.

  8. Learning and memory in zebrafish larvae

    Science.gov (United States)

    Roberts, Adam C.; Bill, Brent R.; Glanzman, David L.

    2013-01-01

    Larval zebrafish possess several experimental advantages for investigating the molecular and neural bases of learning and memory. Despite this, neuroscientists have only recently begun to use these animals to study memory. However, in a relatively short period of time a number of forms of learning have been described in zebrafish larvae, and significant progress has been made toward their understanding. Here we provide a comprehensive review of this progress; we also describe several promising new experimental technologies currently being used in larval zebrafish that are likely to contribute major insights into the processes that underlie learning and memory. PMID:23935566

  9. Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots.

    Science.gov (United States)

    Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke; Hühns, Maja; Broer, Inge; Valkonen, Jari P T

    2014-12-01

    Composite potato plants offer an extremely fast, effective and reliable system for studies on gene functions in roots using antisense or inverted-repeat but not sense constructs for gene inactivation. Composite plants, with transgenic roots on a non-transgenic shoot, can be obtained by shoot explant transformation with Agrobacterium rhizogenes. The aim of this study was to generate composite potato plants (Solanum tuberosum) to be used as a model system in future studies on root-pathogen interactions and gene silencing in the roots. The proportion of transgenic roots among the roots induced was high (80-100%) in the four potato cultivars tested (Albatros, Desirée, Sabina and Saturna). No wild-type adventitious roots were formed at mock inoculation site. All strains of A. rhizogenes tested induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots of composite potato plants expressed significantly higher amounts of β-glucuronidase (GUS) than the roots of a GUS-transgenic potato line event. Silencing of the uidA transgene (GUS) was tested by inducing roots on the GUS-transgenic cv. Albatros event with strains of A. rhizogenes over-expressing either the uidA sense or antisense transcripts, or inverted-repeat or hairpin uidA RNA. The three last mentioned constructs caused 2.5-4.0 fold reduction in the uidA mRNA expression. In contrast, over-expression of uidA resulted in over 3-fold increase in the uidA mRNA and GUS expression, indicating that sense-mediated silencing (co-suppression) was not functional in roots. The results suggest that composite plants offer a useful experimental system for potato research, which has gained little previous attention.

  10. Ginger Stimulates Hematopoiesis via Bmp Pathway in Zebrafish

    Science.gov (United States)

    Ferri-Lagneau, Karine F.; Moshal, Karni S.; Grimes, Matthew; Zahora, Braden; Lv, Lishuang; Sang, Shengmin; Leung, TinChung

    2012-01-01

    Background Anemia is a hematologic disorder with decreased number of erythrocytes. Erythropoiesis, the process by which red blood cells differentiate, are conserved in humans, mice and zebrafish. The only known agents available to treat pathological anemia are erythropoietin and its biologic derivatives. However, erythropoietin therapy elicits unwanted side-effects, high cost and intravenous or subcutaneous injection, warranting the development of a more cost effective and non-peptide alternative. Ginger (Zingiber officinale) has been widely used in traditional medicine; however, to date there is no scientific research documenting the potential of ginger to stimulate hematopoiesis. Methodology/Principal Findings Here, we utilized gata1:dsRed transgenic zebrafish embryos to investigate the effect of ginger extract on hematopoiesis in vivo and we identified its bioactive component, 10-gingerol. We confirmed that ginger and 10-gingerol promote the expression of gata1 in erythroid cells and increase the expression of hematopoietic progenitor markers cmyb and scl. We also demonstrated that ginger and 10-gingerol can promote the hematopoietic recovery from acute hemolytic anemia in zebrafish, by quantifying the number of circulating erythroid cells in the dorsal aorta using video microscopy. We found that ginger and 10-gingerol treatment during gastrulation results in an increase of bmp2b and bmp7a expression, and their downstream effectors, gata2 and eve1. At later stages ginger and 10-gingerol can induce bmp2b/7a, cmyb, scl and lmo2 expression in the caudal hematopoietic tissue area. We further confirmed that Bmp/Smad pathway mediates this hematopoiesis promoting effect of ginger by using the Bmp-activated Bmp type I receptor kinase inhibitors dorsomorphin, LND193189 and DMH1. Conclusions/Significance Our study provides a strong foundation to further evaluate the molecular mechanism of ginger and its bioactive components during hematopoiesis and to investigate their

  11. Chitinase activities, scab resistance, mycorrhization rates and biomass of own-rooted and grafted transgenic apple

    Directory of Open Access Journals (Sweden)

    Tina Schäfer

    2012-01-01

    Full Text Available This study investigated the impact of constitutively expressed Trichoderma atroviride genes encoding exochitinase nag70 or endochitinase ech42 in transgenic lines of the apple cultivar Pinova on the symbiosis with arbuscular mycorrhizal fungi (AMF. We compared the exo- and endochitinase activities of leaves and roots from non-transgenic Pinova and the transgenic lines T386 and T389. Local and systemic effects were examined using own-rooted trees and trees grafted onto rootstock M9. Scab susceptibility was also assessed in own-rooted and grafted trees. AMF root colonization was assessed microscopically in the roots of apple trees cultivated in pots with artificial substrate and inoculated with the AMF Glomus intraradices and Glomus mosseae. Own-rooted transgenic lines had significantly higher chitinase activities in their leaves and roots compared to non-transgenic Pinova. Both of the own-rooted transgenic lines showed significantly fewer symptoms of scab infection as well as significantly lower root colonization by AMF. Biomass production was significantly reduced in both own-rooted transgenic lines. Rootstock M9 influenced chitinase activities in the leaves of grafted scions. When grafted onto M9, the leaf chitinase activities of non-transgenic Pinova (M9/Pinova and transgenic lines (M9/T386 and M9/T389 were not as different as when grown on their own roots. M9/T386 and M9/T389 were only temporarily less infected by scab than M9/Pinova. M9/T386 and M9/T389 did not differ significantly from M9/Pinova in their root chitinase activities, AMF root colonization and biomass.

  12. Transgene Expression and Repression in Transgenic Rats Bearing the Phosphoenolpyruvate Carboxykinase-Simian Virus 40 T Antigen or the Phosphoenolpyruvate Carboxykinase-Transforming Growth Factor-α Constructs

    Science.gov (United States)

    Haas, Michael J.; Dragan, Yvonne P.; Hikita, Hiroshi; Shimel, Randee; Takimoto, Koichi; Heath, Susan; Vaughan, Jennifer; Pitot, Henry C.

    1999-01-01

    Transgenic Sprague-Dawley rats expressing either human transforming growth factor-α (TGFα) or simian virus 40 large and small T antigen (TAg), each under the control of the phosphoenolpyruvate carboxykinase (PEPCK) promoter, were developed as an approach to the study of the promotion of hepatocarcinogenesis in the presence of a transgene regulatable by diet and/or hormones. Five lines of PEPCK-TGFα transgenic rats were established, each genetic line containing from one to several copies of the transgene per haploid genome. Two PEPCK-TAg transgenic founder rats were obtained, each with multiple copies of the transgene. Expression of the transgene was undetectable in the TGFα transgenic rats and could not be induced when the animals were placed on a high-protein, low-carbohydrate diet. The transgene was found to be highly methylated in all of these lines. No pathological alterations in the liver and intestine were observed at any time (up to 2 years) during the lives of these rats. One line of transgenic rats expressing the PEPCK-TAg transgene developed pancreatic islet cell hyperplasias and carcinomas, with few normal islets evident in the pancreas. This transgene is integrated as a hypomethylated tandem array of 10 to 12 copies on chromosome 8q11. Expression of large T antigen is highest in pancreatic neoplasms, but is also detectable in the normal brain, kidney, and liver. Mortality is most rapid in males, starting at 5 months of age and reaching 100% by 8 months. Morphologically, islet cell differentiation in the tumors ranges from poor to well differentiated, with regions of necrosis and fibrosis. Spontaneous metastasis of TAg-positive tumor cells to regional lymph nodes was observed. These studies indicate the importance of DNA methylation in the repression of specific transgenes in the rat. However, the expression of the PEPCK-TAg induces neoplastic transformation in islet cells, probably late in neuroendocrine cell differentiation. T antigen expression

  13. Kaempferol Identified by Zebrafish Assay and Fine Fractionations Strategy from Dysosma versipellis Inhibits Angiogenesis through VEGF and FGF Pathways

    Science.gov (United States)

    Liang, Fang; Han, Yuxiang; Gao, Hao; Xin, Shengchang; Chen, Shaodan; Wang, Nan; Qin, Wei; Zhong, Hanbing; Lin, Shuo; Yao, Xinsheng; Li, Song

    2015-01-01

    Natural products are a rich resource for the discovery of therapeutic substances. By directly using 504 fine fractions from isolated traditional Chinese medicine plants, we performed a transgenic zebrafish based screen for anti-angiogenesis substances. One fraction, DYVE-D3, was found to inhibit the growth of intersegmental vessels in the zebrafish vasculature. Bioassay-guided isolation of DYVE-D3 indicates that the flavonoid kaempferol was the active substance. Kaempferol also inhibited the proliferation and migration of HUVECs in vitro. Furthermore, we found that kaempferol suppressed angiogenesis through inhibiting VEGFR2 expression, which can be enhanced by FGF inhibition. In summary, this study shows that the construction of fine fraction libraries allows efficient identification of active substances from natural products. PMID:26446489

  14. Transgene x environment interactions in genetically modified wheat.

    Science.gov (United States)

    Zeller, Simon L; Kalinina, Olena; Brunner, Susanne; Keller, Beat; Schmid, Bernhard

    2010-07-12

    The introduction of transgenes into plants may cause unintended phenotypic effects which could have an impact on the plant itself and the environment. Little is published in the scientific literature about the interrelation of environmental factors and possible unintended effects in genetically modified (GM) plants. We studied transgenic bread wheat Triticum aestivum lines expressing the wheat Pm3b gene against the fungus powdery mildew Blumeria graminis f.sp. tritici. Four independent offspring pairs, each consisting of a GM line and its corresponding non-GM control line, were grown under different soil nutrient conditions and with and without fungicide treatment in the glasshouse. Furthermore, we performed a field experiment with a similar design to validate our glasshouse results. The transgene increased the resistance to powdery mildew in all environments. However, GM plants reacted sensitive to fungicide spraying in the glasshouse. Without fungicide treatment, in the glasshouse GM lines had increased vegetative biomass and seed number and a twofold yield compared with control lines. In the field these results were reversed. Fertilization generally increased GM/control differences in the glasshouse but not in the field. Two of four GM lines showed up to 56% yield reduction and a 40-fold increase of infection with ergot disease Claviceps purpurea compared with their control lines in the field experiment; one GM line was very similar to its control. Our results demonstrate that, depending on the insertion event, a particular transgene can have large effects on the entire phenotype of a plant and that these effects can sometimes be reversed when plants are moved from the glasshouse to the field. However, it remains unclear which mechanisms underlie these effects and how they may affect concepts in molecular plant breeding and plant evolutionary ecology.

  15. Transgene x environment interactions in genetically modified wheat.

    Directory of Open Access Journals (Sweden)

    Simon L Zeller

    Full Text Available BACKGROUND: The introduction of transgenes into plants may cause unintended phenotypic effects which could have an impact on the plant itself and the environment. Little is published in the scientific literature about the interrelation of environmental factors and possible unintended effects in genetically modified (GM plants. METHODS AND FINDINGS: We studied transgenic bread wheat Triticum aestivum lines expressing the wheat Pm3b gene against the fungus powdery mildew Blumeria graminis f.sp. tritici. Four independent offspring pairs, each consisting of a GM line and its corresponding non-GM control line, were grown under different soil nutrient conditions and with and without fungicide treatment in the glasshouse. Furthermore, we performed a field experiment with a similar design to validate our glasshouse results. The transgene increased the resistance to powdery mildew in all environments. However, GM plants reacted sensitive to fungicide spraying in the glasshouse. Without fungicide treatment, in the glasshouse GM lines had increased vegetative biomass and seed number and a twofold yield compared with control lines. In the field these results were reversed. Fertilization generally increased GM/control differences in the glasshouse but not in the field. Two of four GM lines showed up to 56% yield reduction and a 40-fold increase of infection with ergot disease Claviceps purpurea compared with their control lines in the field experiment; one GM line was very similar to its control. CONCLUSIONS: Our results demonstrate that, depending on the insertion event, a particular transgene can have large effects on the entire phenotype of a plant and that these effects can sometimes be reversed when plants are moved from the glasshouse to the field. However, it remains unclear which mechanisms underlie these effects and how they may affect concepts in molecular plant breeding and plant evolutionary ecology.

  16. High-content screening in zebrafish embryos identifies butafenacil as a potent inducer of anemia.

    Directory of Open Access Journals (Sweden)

    Jessica K Leet

    Full Text Available Using transgenic zebrafish (fli1:egfp that stably express enhanced green fluorescent protein (eGFP within vascular endothelial cells, we recently developed and optimized a 384-well high-content screening (HCS assay that enables us to screen and identify chemicals affecting cardiovascular development and function at non-teratogenic concentrations. Within this assay, automated image acquisition procedures and custom image analysis protocols are used to quantify body length, heart rate, circulation, pericardial area, and intersegmental vessel area within individual live embryos exposed from 5 to 72 hours post-fertilization. After ranking developmental toxicity data generated from the U.S. Environmental Protection Agency's (EPA's zebrafish teratogenesis assay, we screened 26 of the most acutely toxic chemicals within EPA's ToxCast Phase-I library in concentration-response format (0.05-50 µM using this HCS assay. Based on this screen, we identified butafenacil as a potent inducer of anemia, as exposure from 0.39 to 3.125 µM butafenacil completely abolished arterial circulation in the absence of effects on all other endpoints evaluated. Butafenacil is an herbicide that inhibits protoporphyrinogen oxidase (PPO--an enzyme necessary for heme production in vertebrates. Using o-dianisidine staining, we then revealed that severe butafenacil-induced anemia in zebrafish was due to a complete loss of hemoglobin following exposure during early development. Therefore, six additional PPO inhibitors within the ToxCast Phase-I library were screened to determine whether anemia represents a common adverse outcome for these herbicides. Embryonic exposure to only one of these PPO inhibitors--flumioxazin--resulted in a similar phenotype as butafenacil, albeit not as severe as butafenacil. Overall, this study highlights the potential utility of this assay for (1 screening chemicals for cardiovascular toxicity and (2 prioritizing chemicals for future hypothesis

  17. Transgenics, agroindustry and food sovereignty

    Directory of Open Access Journals (Sweden)

    Xavier Alejandro León Vega

    2014-10-01

    Full Text Available Food sovereignty has been implemented constitutionally in Ecuador; however, many of the actions and policies are designed to benefit the dominant model of food production, based in agroindustry, intensive monocultures, agrochemicals and transgenics. This article reflects upon the role of family farming as a generator of food sovereignty, and secondly the threat to them by agroindustry agriculture based in transgenic. The role played by food aid in the introduction of transgenic in Latin America and other regions of the world is also analyzed.

  18. Episodic-like memory in zebrafish.

    Science.gov (United States)

    Hamilton, Trevor J; Myggland, Allison; Duperreault, Erika; May, Zacnicte; Gallup, Joshua; Powell, Russell A; Schalomon, Melike; Digweed, Shannon M

    2016-11-01

    Episodic-like memory tests often aid in determining an animal's ability to recall the what, where, and which (context) of an event. To date, this type of memory has been demonstrated in humans, wild chacma baboons, corvids (Scrub jays), humming birds, mice, rats, Yucatan minipigs, and cuttlefish. The potential for this type of memory in zebrafish remains unexplored even though they are quickly becoming an essential model organism for the study of a variety of human cognitive and mental disorders. Here we explore the episodic-like capabilities of zebrafish (Danio rerio) in a previously established mammalian memory paradigm. We demonstrate that when zebrafish were presented with a familiar object in a familiar context but a novel location within that context, they spend more time in the novel quadrant. Thus, zebrafish display episodic-like memory as they remember what object they saw, where they saw it (quadrant location), and on which occasion (yellow or blue walls) it was presented.

  19. Post-mortem re-cloning of a transgenic red fluorescent protein dog.

    Science.gov (United States)

    Hong, So Gun; Koo, Ok Jae; Oh, Hyun Ju; Park, Jung Eun; Kim, Minjung; Kim, Geon-A; Park, Eun Jung; Jang, Goo; Lee, Byeong-Chun

    2011-12-01

    Recently, the world's first transgenic dogs were produced by somatic cell nuclear transfer. However, cellular senescence is a major limiting factor for producing more advanced transgenic dogs. To overcome this obstacle, we rejuvenated transgenic cells using a re-cloning technique. Fibroblasts from post-mortem red fluorescent protein (RFP) dog were reconstructed with in vivo matured oocytes and transferred into 10 surrogate dogs. One puppy was produced and confirmed as a re-cloned dog. Although the puppy was lost during birth, we successfully established a rejuvenated fibroblast cell line from this animal. The cell line was found to stably express RFP and is ready for additional genetic modification.

  20. Enhanced leaf photosynthesis as a target to increase grain yield: insights from transgenic rice lines with variable Rieske FeS protein content in the cytochrome b6 /f complex.

    Science.gov (United States)

    Yamori, Wataru; Kondo, Eri; Sugiura, Daisuke; Terashima, Ichiro; Suzuki, Yuji; Makino, Amane

    2016-01-01

    Although photosynthesis is the most important source for biomass and grain yield, a lack of correlation between photosynthesis and plant yield among different genotypes of various crop species has been frequently observed. Such observations contribute to the ongoing debate whether enhancing leaf photosynthesis can improve yield potential. Here, transgenic rice plants that contain variable amounts of the Rieske FeS protein in the cytochrome (cyt) b6 /f complex between 10 and 100% of wild-type levels have been used to investigate the effect of reductions of these proteins on photosynthesis, plant growth and yield. Reductions of the cyt b6 /f complex did not affect the electron transport rates through photosystem I but decreased electron transport rates through photosystem II, leading to concomitant decreases in CO2 assimilation rates. There was a strong control of plant growth and grain yield by the rate of leaf photosynthesis, leading to the conclusion that enhancing photosynthesis at the single-leaf level would be a useful target for improving crop productivity and yield both via conventional breeding and biotechnology. The data here also suggest that changing photosynthetic electron transport rates via manipulation of the cyt b6 /f complex could be a potential target for enhancing photosynthetic capacity in higher plants. © 2015 John Wiley & Sons Ltd.

  1. Transgenic mosquitoes expressing a phospholipase A(2 gene have a fitness advantage when fed Plasmodium falciparum-infected blood.

    Directory of Open Access Journals (Sweden)

    Ryan C Smith

    Full Text Available Genetically modified mosquitoes have been proposed as an alternative strategy to reduce the heavy burden of malaria. In recent years, several proof-of-principle experiments have been performed that validate the idea that mosquitoes can be genetically modified to become refractory to malaria parasite development.We have created two transgenic lines of Anophelesstephensi, a natural vector of Plasmodium falciparum, which constitutively secrete a catalytically inactive phospholipase A2 (mPLA2 into the midgut lumen to interfere with Plasmodium ookinete invasion. Our experiments show that both transgenic lines expressing mPLA2 significantly impair the development of rodent malaria parasites, but only one line impairs the development of human malaria parasites. In addition, when fed on malaria-infected blood, mosquitoes from both transgenic lines are more fecund than non-transgenic mosquitoes. Consistent with these observations, cage experiments with mixed populations of transgenic and non-transgenic mosquitoes show that the percentage of transgenic mosquitoes increases when maintained on Plasmodium-infected blood.Our results suggest that the expression of an anti-Plasmodium effector gene gives transgenic mosquitoes a fitness advantage when fed malaria-infected blood. These findings have important implications for future applications of transgenic mosquito technology in malaria control.

  2. Pyramiding of transgenic Pm3 alleles in wheat results in improved powdery mildew resistance in the field.

    Science.gov (United States)

    Koller, Teresa; Brunner, Susanne; Herren, Gerhard; Hurni, Severine; Keller, Beat

    2018-04-01

    The combined effects of enhanced total transgene expression level and allele-specificity combination in transgenic allele-pyramided Pm3 wheat lines result in improved powdery mildew field resistance without negative pleiotropic effects. Allelic Pm3 resistance genes of wheat confer race-specific resistance to powdery mildew (Blumeria graminis f. sp. tritici, Bgt) and encode nucleotide-binding domain, leucine-rich repeat (NLR) receptors. Transgenic wheat lines overexpressing alleles Pm3a, b, c, d, f, and g have previously been generated by transformation of cultivar Bobwhite and tested in field trials, revealing varying degrees of powdery mildew resistance conferred by the transgenes. Here, we tested four transgenic lines each carrying two pyramided Pm3 alleles, which were generated by crossbreeding of lines transformed with single Pm3 alleles. All four allele-pyramided lines showed strongly improved powdery mildew resistance in the field compared to their parental lines. The improved resistance results from the two effects of enhanced total transgene expression levels and allele-specificity combinations. In contrast to leaf segment tests on greenhouse-grown seedlings, no allelic suppression was observed in the field. Plant development and yield scores of the pyramided lines were similar to the mean scores of the corresponding parental lines, and thus, the allele pyramiding did not cause any negative effects. On the contrary, in pyramided line, Pm3b × Pm3f normal plant development was restored compared to the delayed development and reduced seed set of parental line Pm3f. Allele-specific RT qPCR revealed additive transgene expression levels of the two Pm3 alleles in the pyramided lines. A positive correlation between total transgene expression level and powdery mildew field resistance was observed. In summary, allele pyramiding of Pm3 transgenes proved to be successful in enhancing powdery mildew field resistance.

  3. Identification and characterization of zebrafish thrombocytes.

    Science.gov (United States)

    Jagadeeswaran, P; Sheehan, J P; Craig, F E; Troyer, D

    1999-12-01

    To analyse primary haemostasis in the zebrafish we have identified and characterized the zebrafish thrombocyte by morphologic, immunologic and functional approaches. Novel methods were developed for harvesting zebrafish blood with preservation of thrombocytes, and assaying whole blood adhesion/aggregation responses in microtitre plates. Light and electron microscopy of the thrombocyte illustrated morphological characteristics including the formation of aggregates, pseudopodia, and surface-connected vesicles analagous to the platelet canalicular system. Immunostaining with polyclonal antisera versus human platelet glycoproteins demonstrated the presence of glycoprotein Ib and IIb/IIIa-like complexes on the thrombocyte surface. Whole blood assays for adhesion/aggregation and ATP release showed ristocetin-induced adhesion without ATP release, and platelet agonist (collagen, arachidonic acid) induced aggregation with ATP release. Blood harvested from zebrafish treated with aspirin demonstrated inhibition of arachidonic acid induced aggregation and agonist induced ATP release, consistent with at least partial dependence on an intact cyclo oxygenase pathway. The combined morphologic immunologic and functional evidence suggest that the zebrafish thrombocyte is the haemostatic homologue of the mammalian platelet. Conservation of major haemostatic pathways involved in platelet function and coagulation suggests that the zebrafish is a relevant model for mammalian haemostasis and thrombosis.

  4. Genomic Organization of Zebrafish microRNAs

    Directory of Open Access Journals (Sweden)

    Paydar Ima

    2008-05-01

    Full Text Available Abstract Background microRNAs (miRNAs are small (~22 nt non-coding RNAs that regulate cell movement, specification, and development. Expression of miRNAs is highly regulated, both spatially and temporally. Based on direct cloning, sequence conservation, and predicted secondary structures, a large number of miRNAs have been identified in higher eukaryotic genomes but whether these RNAs are simply a subset of a much larger number of noncoding RNA families is unknown. This is especially true in zebrafish where genome sequencing and annotation is not yet complete. Results We analyzed the zebrafish genome to identify the number and location of proven and predicted miRNAs resulting in the identification of 35 new miRNAs. We then grouped all 415 zebrafish miRNAs into families based on seed sequence identity as a means to identify possible functional redundancy. Based on genomic location and expression analysis, we also identified those miRNAs that are likely to be encoded as part of polycistronic transcripts. Lastly, as a resource, we compiled existing zebrafish miRNA expression data and, where possible, listed all experimentally proven mRNA targets. Conclusion Current analysis indicates the zebrafish genome encodes 415 miRNAs which can be grouped into 44 families. The largest of these families (the miR-430 family contains 72 members largely clustered in two main locations along chromosome 4. Thus far, most zebrafish miRNAs exhibit tissue specific patterns of expression.

  5. Studying disorders of vertebrate iron and heme metabolism using zebrafish.

    Science.gov (United States)

    van der Vorm, Lisa N; Paw, Barry H

    2017-01-01

    Iron is a crucial component of heme- and iron-sulfur clusters, involved in vital cellular functions such as oxygen transport, DNA synthesis, and respiration. Both excess and insufficient levels of iron and heme-precursors cause human disease, such as iron-deficiency anemia, hemochromatosis, and porphyrias. Hence, their levels must be tightly regulated, requiring a complex network of transporters and feedback mechanisms. The use of zebrafish to study these pathways and the underlying genetics offers many advantages, among others their optical transparency, ex-vivo development and high genetic and physiological conservations. This chapter first reviews well-established methods, such as large-scale mutagenesis screens that have led to the initial identification of a series of iron and heme transporters and the generation of a variety of mutant lines. Other widely used techniques are based on injection of RNA, including complementary morpholino knockdown and gene overexpression. In addition, we highlight several recently developed approaches, most notably endonuclease-based gene knockouts such as TALENs or the CRISPR/Cas9 system that have been used to study how loss of function can induce human disease phenocopies in zebrafish. Rescue by chemical complementation with iron-based compounds or small molecules can subsequently be used to confirm causality of the genetic defect for the observed phenotype. All together, zebrafish have proven to be - and will continue to serve as an ideal model to advance our understanding of the pathogenesis of human iron and heme-related diseases and to develop novel therapies to treat these conditions. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Inexhaustible hair-cell regeneration in young and aged zebrafish

    Directory of Open Access Journals (Sweden)

    Filipe Pinto-Teixeira

    2015-07-01

    Full Text Available Animals have evolved two general strategies to counter injury and maintain physiological function. The most prevalent is protection by isolating vital organs into body cavities. However, protection is not optimal for sensory systems because their external components need to be exposed to the environment to fulfill their receptive function. Thus, a common strategy to maintain sensory abilities against persistent environmental insult involves repair and regeneration. However, whether age or frequent injuries affect the regenerative capacity of sensory organs remains unknown. We have found that neuromasts of the zebrafish lateral line regenerate mechanosensory hair cells after recurrent severe injuries and in adulthood. Moreover, neuromasts can reverse transient imbalances of Notch signaling that result in defective organ proportions during repair. Our results reveal inextinguishable hair-cell regeneration in the lateral line, and suggest that the neuromast epithelium is formed by plastic territories that are maintained by continuous intercellular communication.

  7. Transgene teknikker erstatter problematisk avl

    DEFF Research Database (Denmark)

    Alstrup, Aage Kristian Olsen; Hansen, Axel Kornerup

    2016-01-01

    Dyremodeller har ofte været baseret på avl, der ud fra et alment velfærdsmæssigt synspunkt var problematisk. Transgene teknikker kan ofte forbedre dyrevelfærden ved at erstatte disse traditionelle avlsmetoder.......Dyremodeller har ofte været baseret på avl, der ud fra et alment velfærdsmæssigt synspunkt var problematisk. Transgene teknikker kan ofte forbedre dyrevelfærden ved at erstatte disse traditionelle avlsmetoder....

  8. Development of transgenic wheat (Triticum aestivum L.) expressing avidin gene conferring resistance to stored product insects.

    Science.gov (United States)

    Abouseadaa, Heba H; Osman, Gamal H; Ramadan, Ahmed M; Hassanein, Sameh E; Abdelsattar, Mohamed T; Morsy, Yasser B; Alameldin, Hussien F; El-Ghareeb, Doaa K; Nour-Eldin, Hanan A; Salem, Reda; Gad, Adel A; Elkhodary, Soheir E; Shehata, Maher M; Mahfouz, Hala M; Eissa, Hala F; Bahieldin, Ahmed

    2015-07-22

    Wheat is considered the most important cereal crop all over the world. The wheat weevil Sitophilus granarius is a serious insect pests in much of the wheat growing area worldwide and is responsible for significant loss of yield. Avidin proteins has been proposed to function as plant defense agents against insect pests. A synthetic avidin gene was introduced into spring wheat (Triticum aestivum L.) cv. Giza 168 using a biolistic bombardment protocol. The presence and expression of the transgene in six selected T0 transgenic wheat lines were confirmed at the molecular level. Accumulation of avidin protein was detected in transgenic plants compared to non-transgenic plants. Avidin transgene was stably integrated, transcribed and translated as indicated by Southern blot, ELISA, and dot blot analyses, with a high level of expression in transgenic wheat seeds. However, no expression was detected in untransformed wheat seeds. Functional integrity of avidin was confirmed by insect bioassay. The results of bioassay using transgenic wheat plants challenged with wheat weevil revealed 100 % mortality of the insects reared on transgenic plants after 21 days. Transgenic wheat plants had improved resistance to Sitophilus granarius.

  9. Detailed characterization of Mirafiori lettuce virus-resistant transgenic lettuce.

    Science.gov (United States)

    Kawazu, Yoichi; Fujiyama, Ryoi; Noguchi, Yuji; Kubota, Masaharu; Ito, Hidekazu; Fukuoka, Hiroyuki

    2010-04-01

    Lettuce big-vein disease is caused by Mirafiori lettuce virus (MiLV), which is vectored by the soil-borne fungus Olpidium brassicae. A MiLV-resistant transgenic lettuce line was developed through introducing inverted repeats of the MiLV coat protein (CP) gene. Here, a detailed characterization study of this lettuce line was conducted by comparing it with the parental, non-transformed 'Kaiser' cultivar. There were no significant differences between transgenic and non-transgenic lettuce in terms of pollen fertility, pollen dispersal, seed production, seed dispersal, dormancy, germination, growth of seedlings under low or high temperature, chromatographic patterns of leaf extracts, or effects of lettuce on the growth of broccoli or soil microflora. A significant difference in pollen size was noted, but the difference was small. The length of the cotyledons of the transgenic lettuce was shorter than that of 'Kaiser,' but there were no differences in other morphological characteristics. Agrobacterium tumefaciens used for the production of transgenic lettuce was not detected in transgenic seeds. The transgenic T(3), T(4), and T(5) generations showed higher resistance to MiLV and big-vein symptoms expression than the resistant 'Pacific' cultivar, indicating that high resistance to lettuce big-vein disease is stably inherited. PCR analysis showed that segregation of the CP gene was nearly 3:1 in the T(1) and T(2) generations, and that the transgenic T(3) generation was homozygous for the CP gene. Segregation of the neomycin phosphotransferase II (npt II) gene was about 3:1 in the T(1) generation, but the full length npt II gene was not detected in the T(2) or T(3) generation. The segregation pattern of the CP and npt II genes in the T(1) generation showed the expected 9:3:3:1 ratio. These results suggest that the fragment including the CP gene and that including the npt II gene have been integrated into two unlinked loci, and that the T(1) plant selected in our study did

  10. Zebrafish neurobehavioral phenomics for aquatic neuropharmacology and toxicology research.

    Science.gov (United States)

    Kalueff, Allan V; Echevarria, David J; Homechaudhuri, Sumit; Stewart, Adam Michael; Collier, Adam D; Kaluyeva, Aleksandra A; Li, Shaomin; Liu, Yingcong; Chen, Peirong; Wang, JiaJia; Yang, Lei; Mitra, Anisa; Pal, Subharthi; Chaudhuri, Adwitiya; Roy, Anwesha; Biswas, Missidona; Roy, Dola; Podder, Anupam; Poudel, Manoj K; Katare, Deepshikha P; Mani, Ruchi J; Kyzar, Evan J; Gaikwad, Siddharth; Nguyen, Michael; Song, Cai

    2016-01-01

    Zebrafish (Danio rerio) are rapidly emerging as an important model organism for aquatic neuropharmacology and toxicology research. The behavioral/phenotypic complexity of zebrafish allows for thorough dissection of complex human brain disorders and drug-evoked pathological states. As numerous zebrafish models become available with a wide spectrum of behavioral, genetic, and environmental methods to test novel drugs, here we discuss recent zebrafish phenomics methods to facilitate drug discovery, particularly in the field of biological psychiatry. Additionally, behavioral, neurological, and endocrine endpoints are becoming increasingly well-characterized in zebrafish, making them an inexpensive, robust and effective model for toxicology research and pharmacological screening. We also discuss zebrafish behavioral phenotypes, experimental considerations, pharmacological candidates and relevance of zebrafish neurophenomics to other 'omics' (e.g., genomic, proteomic) approaches. Finally, we critically evaluate the limitations of utilizing this model organism, and outline future strategies of research in the field of zebrafish phenomics. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Development and regeneration of the zebrafish maxillary barbel: a novel study system for vertebrate tissue growth and repair.

    Science.gov (United States)

    LeClair, Elizabeth E; Topczewski, Jacek

    2010-01-15

    Barbels are integumentary sense organs found in fishes, reptiles and amphibians. The zebrafish, Danio rerio, develops paired nasal and maxillary barbels approximately one month post fertilization. Small in diameter and optically clear, these adult appendages offer a window on the development, maintenance and function of multiple cell types including skin cells, neural-crest derived pigment cells, circulatory vessels, taste buds and sensory nerves. Importantly, barbels in other otophysan fishes (e.g., catfish) are known to regenerate; however, this capacity has not been tested in zebrafish. We describe the development of the maxillary barbel in a staged series of wild type and transgenic zebrafish using light microscopy, histology and immunohistochemistry. By imaging transgenic zebrafish containing fluorescently labeled endothelial cells (Tg(fli1a:EGFP)), we demonstrate that the barbel contains a long ( approximately 2-3 mm) closed-end vessel that we interpret as a large lymphatic. The identity of this vessel was further supported by live imaging of the barbel circulation, extending recent descriptions of the lymphatic system in zebrafish. The maxillary barbel can be induced to regenerate by proximal amputation. After more than 750 experimental surgeries in which approximately 85% of the barbel's length was removed, we find that wound healing is complete within hours, followed by blastema formation ( approximately 3 days), epithelial redifferentiation (3-5 days) and appendage elongation. Maximum regrowth occurs within 2 weeks of injury. Although superficially normal, the regenerates are shorter and thicker than the contralateral controls, have abnormally organized mesenchymal cells and extracellular matrix, and contain prominent connective tissue "stumps" at the plane of section--a mode of regeneration more typical of mammalian scarring than other zebrafish appendages. Finally, we show that the maxillary barbel can regenerate after repeated injury and also in

  12. Development and regeneration of the zebrafish maxillary barbel: a novel study system for vertebrate tissue growth and repair.

    Directory of Open Access Journals (Sweden)

    Elizabeth E LeClair

    2010-01-01

    Full Text Available Barbels are integumentary sense organs found in fishes, reptiles and amphibians. The zebrafish, Danio rerio, develops paired nasal and maxillary barbels approximately one month post fertilization. Small in diameter and optically clear, these adult appendages offer a window on the development, maintenance and function of multiple cell types including skin cells, neural-crest derived pigment cells, circulatory vessels, taste buds and sensory nerves. Importantly, barbels in other otophysan fishes (e.g., catfish are known to regenerate; however, this capacity has not been tested in zebrafish.We describe the development of the maxillary barbel in a staged series of wild type and transgenic zebrafish using light microscopy, histology and immunohistochemistry. By imaging transgenic zebrafish containing fluorescently labeled endothelial cells (Tg(fli1a:EGFP, we demonstrate that the barbel contains a long ( approximately 2-3 mm closed-end vessel that we interpret as a large lymphatic. The identity of this vessel was further supported by live imaging of the barbel circulation, extending recent descriptions of the lymphatic system in zebrafish. The maxillary barbel can be induced to regenerate by proximal amputation. After more than 750 experimental surgeries in which approximately 85% of the barbel's length was removed, we find that wound healing is complete within hours, followed by blastema formation ( approximately 3 days, epithelial redifferentiation (3-5 days and appendage elongation. Maximum regrowth occurs within 2 weeks of injury. Although superficially normal, the regenerates are shorter and thicker than the contralateral controls, have abnormally organized mesenchymal cells and extracellular matrix, and contain prominent connective tissue "stumps" at the plane of section--a mode of regeneration more typical of mammalian scarring than other zebrafish appendages. Finally, we show that the maxillary barbel can regenerate after repeated injury and

  13. Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

    Science.gov (United States)

    Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

    2000-06-01

    Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.

  14. Transcription regulation of the vegf gene by the BMP/Smad pathway in the angioblast of zebrafish embryos

    International Nuclear Information System (INIS)

    He Chen; Chen Xiaozhuo

    2005-01-01

    Vascular endothelial growth factor (VEGF) is a mitogen that is critically involved in vasculogenesis, angiogenesis, and hematopoiesis. However, what and how transcription factors participate in the regulation of vegf gene expression are not fully understood. Here we report the cloning and sequencing of the zebrafish vegf promoter which revealed that the promoter contains a number of bone morphogenetic protein (BMP)-activated Smad binding elements (SBE), implicating Smad1 and Smad5 in the regulation of BMP-induced expression of vegf. Electrophoretic mobility shift assays of adding recombinant Smad proteins to the SBE-containing DNA oligonucleotides that represent portions of zebrafish vegf promoter resulted in mobility shift of the oligonucleotides. These changes demonstrate potential interactions between Smad1/5 and the vegf promoter. Reporter activity assays using the wild-type or SBE-deleted vegf promoters to drive the luciferase reporter gene expression revealed that Smad1 stimulated while Smad5 repressed the vegf promoter activity in zebrafish embryos. These data indicate that the BMP/Smad signaling pathway is involved in the regulation of zebrafish vegf transcription. In addition, we demonstrate that transgenic expression of human BMP4 in zebrafish embryos induced an expansion of the posterior intermediate cell mass (ICM, also commonly called blood island), a population of cells containing endothelial and hematopoietic precursors. In the expanded ICM, vegf and VEGF receptor 2 (flk-1) were ectopically co-expressed, suggesting that an autocrine/paracrine regulation of vegf expression may exist and contribute to the BMP-induced hemangiogenic cell proliferation

  15. Lactobacillus rhamnosus accelerates zebrafish backbone calcification and gonadal differentiation through effects on the GnRH and IGF systems.

    Directory of Open Access Journals (Sweden)

    Matteo A Avella

    Full Text Available Endogenous microbiota play essential roles in the host's immune system, physiology, reproduction and nutrient metabolism. We hypothesized that a continuous administration of an exogenous probiotic might also influence the host's development. Thus, we treated zebrafish from birth to sexual maturation (2-months treatment with Lactobacillus rhamnosus, a probiotic species intended for human use. We monitored for the presence of L. rhamnosus during the entire treatment. Zebrafish at 6 days post fertilization (dpf exhibited elevated gene expression levels for Insulin-like growth factors -I and -II, Peroxisome proliferator activated receptors -α and -β, VDR-α and RAR-γ when compared to untreated-10 days old zebrafish. Using a gonadotropin-releasing hormone 3 GFP transgenic zebrafish (GnRH3-GFP, higher GnRH3 expression was found at 6, 8 and 10 dpf upon L. rhamnosus treatment. The same larvae exhibited earlier backbone calcification and gonad maturation. Noteworthy in the gonad development was the presence of first testes differentiation at 3 weeks post fertilization in the treated zebrafish population -which normally occurs at 8 weeks- and a dramatic sex ratio modulation (93% females, 7% males in control vs. 55% females, 45% males in the treated group. We infer that administration of L. rhamnosus stimulated the IGF system, leading to a faster backbone calcification. Moreover we hypothesize a role for administration of L. rhamnosus on GnRH3 modulation during early larval development, which in turn affects gonadal development and sex differentiation. These findings suggest a significant role of the microbiota composition on the host organism development profile and open new perspectives in the study of probiotics usage and application.

  16. Identification of Secretory Odontoblasts Using DMP1-GFP Transgenic Mice

    Science.gov (United States)

    Balic, Anamaria; Mina, Mina

    2011-01-01

    Terminal differentiation of odontoblasts from dental papilla is a long process involving several intermediate steps and changes in the transcriptional profile and expression of proteins secreted by cells in the odontoblast lineage. Transgenic mouse lines in which GFP expression is under the control of tissue-and stage specific promoters have provided powerful experimental tools for identification and isolation of cells at specific stages of differentiation along a lineage. Our previous studies showed utilization of pOBCol3.6GFP and pOBCol2.3GFP animals for identification of odontoblasts at early and late stages of polarization respectively. In the present study we used the DMP1-GFP transgenic animal as an experimental model to examine its expression during the differentiation of odontoblasts from progenitor cells in vivo and in vitro. Our observations showed that DMP1-GFP transgene is first activated in secretory/functional odontoblasts engaged in secretion of predentin and then transiently expressed at high levels in newly differentiated odontoblasts. Expression of DMP1-GFP was down-regulated in highly differentiated odontoblasts. The temporal and spatial pattern of expression of DMP1-GFP transgene closely mimics the expression of endogenous DMP1. This transgenic animal will facilitate studies of gene expression and biological functions in secretory/functional odontoblasts. PMID:21172466

  17. A wheat calreticulin gene (TaCRT1) contributes to drought tolerance in transgenic arabidopsis

    International Nuclear Information System (INIS)

    Xiang, V.; Du, C.; Jia, H.; Song, M.; Wang, Y.; Ma, Z.

    2018-01-01

    The TaCRT1 gene is a member of calreticulin (CRT) family in wheat. In our previous study, we showed that transgenic tobacco lines over expressing wheat TaCRT1 showed enhanced tolerance to salt stress. This study aimed to determine whether TaCRT1 over expression would increase drought tolerance in transgenic Arabidopsis. Over expression of TaCRT1 in Arabidopsis plants enhances tolerance to drought stress. However, the transgenic line was found to retard the growth. Moreover, the transgenic line showed decreased water loss but higher sensitivity to exogenous abscisic acid (ABA) compared with the wild type (Col-0). Meanwhile, the transgenic line had the elevated endogenous ABA level. The semi-quantitative RT-PCR (sqRT-PCR) analysis showed that transcription levels of ABA-biosynthesizing gene (NCED3) and ABA-responsive gene (ABF3) were higher in the transgenic line than that in the Col-0 under normal condition. The above results implied that the TaCRT1 might be able to used as a potential target to improve the drought tolerance in crops. (author)

  18. High blood pressure in transgenic mice carrying the rat angiotensinogen gene.

    Science.gov (United States)

    Kimura, S; Mullins, J J; Bunnemann, B; Metzger, R; Hilgenfeldt, U; Zimmermann, F; Jacob, H; Fuxe, K; Ganten, D; Kaling, M

    1992-01-01

    Transgenic mice were generated by injecting the entire rat angiotensinogen gene into the germline of NMRI mice. The resulting transgenic animals were characterized with respect to hemodynamics, parameters of the renin angiotension system, and expression of the transgene. The transgenic line TGM(rAOGEN)123 developed hypertension with a mean arterial blood pressure of 158 mmHg in males and 132 mmHg in females. In contrast, the transgenic line TGM(rAOGEN)92 was not hypertensive. Rat angiotensinogen was detectable only in plasma of animals of line 123. Total plasma angiotensinogen and plasma angiotensin II concentrations were about three times as high as those of negative control mice. In TGM(rAOGEN)123 the transgene was highly expressed in liver and brain. Transcripts were also detected in heart, kidney and testis. In TGM(rAOGEN)92 the brain was the main expressing organ. In situ hybridization revealed an mRNA distribution in the brain of TGM(rAOGEN)123 similar to the one in rat. In TGM(rAOGEN)92 the expression pattern in the brain was aberrant. These data indicate that overexpression of the angiotensinogen gene in liver and brain leads to the development of hypertension in transgenic mice. The TGM(rAOGEN)123 constitutes a high angiotensin II type of hypertension and may provide a new experimental animal model to study the kinetics and function of the renin angiotensin system. Images PMID:1547785

  19. In Vivo Testing of MicroRNA-Mediated Gene Knockdown in Zebrafish

    Directory of Open Access Journals (Sweden)

    Ivone Un San Leong

    2012-01-01

    Full Text Available The zebrafish (Danio rerio has become an attractive model for human disease modeling as there are a large number of orthologous genes that encode similar proteins to those found in humans. The number of tools available to manipulate the zebrafish genome is limited and many currently used techniques are only effective during early development (such as morpholino-based antisense technology or it is phenotypically driven and does not offer targeted gene knockdown (such as chemical mutagenesis. The use of RNA interference has been met with controversy as off-target effects can make interpreting phenotypic outcomes difficult; however, this has been resolved by creating zebrafish lines that contain stably integrated miRNA constructs that target the desired gene of interest. In this study, we show that a commercially available miRNA vector system with a mouse-derived miRNA backbone is functional in zebrafish and is effective in causing eGFP knockdown in a transient in vivo eGFP sensor assay system. We chose to apply this system to the knockdown of transcripts that are implicated in the human cardiac disorder, Long QT syndrome.

  20. Discriminating Different Cancer Cells Using a Zebrafish in Vivo Assay

    International Nuclear Information System (INIS)

    Moshal, Karni S.; Ferri-Lagneau, Karine F.; Haider, Jamil; Pardhanani, Pooja; Leung, TinChung

    2011-01-01

    Despite the expanded understanding of tumor angiogenesis phenomenon and how it impacts cancer treatment outcomes, we have yet to develop a robust assay that can quickly, easily, and quantitatively measure tumor-induced angiogenesis. Since the zebrafish/tumor xenograft represents an emerging tool in this regard, the present study strives to capitalize on the ease, effectiveness, and the adaptability of this model to quantify tumor angiogenesis. In order to test a range of responses, we chose two different tumorigenic cell lines, the human non-small cell lung carcinoma (H1299) and the mouse lung adenocarcinoma (CL13). Non-tumorigenic 3T3-L1 cells served as negative control. The cells were grafted near to the perivitelline space of the zebrafish embryos and the angiogenic response was analyzed using whole-mount alkaline phosphatase (AP) vessel staining and fluorescence microscopy. Angiogenic activity was scored based on the length and number of the newly formed ectopic vessels and the percentage of embryos with ectopic vessels. At 2 day-post-implantation, we detected a significant increase in the length and number of ectopic vessels with H1299 cell implantation compared to CL13 cell transplantation, both are higher than 3T3-L1 control. We also observed a significantly higher percentage of embryos with ectopic vessels with H1299 and CL13 transplantation compared to the 3T3-L1 control, but this parameter is not as robust and reliable as measuring the length and number of ectopic vessels. Furthermore, the systemic exposure of zebrafish embryos to an anti-angiogenesis drug (PTK 787, inhibitor of vascular endothelial growth factor receptor tyrosine kinase) inhibited tumor-induced angiogenesis, suggesting that the assay can be used to evaluate anti-angiogenic drugs. This study implicates the feasibility of using zebrafish xenotransplantation to perform quantitative measurement of the angiogenic activity of cancer cells which can be further extended to measure cancer cell

  1. Discriminating Different Cancer Cells Using a Zebrafish in Vivo Assay

    Directory of Open Access Journals (Sweden)

    Pooja Pardhanani

    2011-10-01

    Full Text Available Despite the expanded understanding of tumor angiogenesis phenomenon and how it impacts cancer treatment outcomes, we have yet to develop a robust assay that can quickly, easily, and quantitatively measure tumor-induced angiogenesis. Since the zebrafish/tumor xenograft represents an emerging tool in this regard, the present study strives to capitalize on the ease, effectiveness, and the adaptability of this model to quantify tumor angiogenesis. In order to test a range of responses, we chose two different tumorigenic cell lines, the human non-small cell lung carcinoma (H1299 and the mouse lung adenocarcinoma (CL13. Non-tumorigenic 3T3-L1 cells served as negative control. The cells were grafted near to the perivitelline space of the zebrafish embryos and the angiogenic response was analyzed using whole-mount alkaline phosphatase (AP vessel staining and fluorescence microscopy. Angiogenic activity was scored based on the length and number of the newly formed ectopic vessels and the percentage of embryos with ectopic vessels. At 2 day-post-implantation, we detected a significant increase in the length and number of ectopic vessels with H1299 cell implantation compared to CL13 cell transplantation, both are higher than 3T3-L1 control. We also observed a significantly higher percentage of embryos with ectopic vessels with H1299 and CL13 transplantation compared to the 3T3-L1 control, but this parameter is not as robust and reliable as measuring the length and number of ectopic vessels. Furthermore, the systemic exposure of zebrafish embryos to an anti-angiogenesis drug (PTK 787, inhibitor of vascular endothelial growth factor receptor tyrosine kinase inhibited tumor-induced angiogenesis, suggesting that the assay can be used to evaluate anti-angiogenic drugs. This study implicates the feasibility of using zebrafish xenotransplantation to perform quantitative measurement of the angiogenic activity of cancer cells which can be further extended to

  2. Distribution and chronotropic effects of serotonin in the zebrafish heart.

    Science.gov (United States)

    Stoyek, Matthew R; Jonz, Michael G; Smith, Frank M; Croll, Roger P

    2017-09-01

    Several lines of evidence suggest that serotonin (5-HT) has a regulatory role in cardiovascular function from embryogenesis through adulthood. However, the reported actions of 5-HT are often contradictory and include bradycardia or tachycardia, hypotension or hypertension, and vasodilation or vasoconstriction. Clarifying such cardiac effects requires further research and may benefit from utilizing a model simpler than the mammalian hearts traditionally used in these studies. In the present study, we describe the cardiac distribution and chronotropic responses of 5-HT in the zebrafish heart. A combined anatomical, electrophysiological, and pharmacological approach was used to investigate the involvement of 5-HT pathways, and to compare neural and direct myocardial pathways of biological action. Immunohistochemical methods revealed 5-HT in endocardial cells, glial-like cells, and intracardiac neurons in the atrium. Electrocardiogram (ECG) recordings combined with the administration of pharmacological agents demonstrated that 5-HT acted predominantly through direct myocardial pathways resulting in a reduction of heart rate. Overall, the results of this study contribute significant advances in the establishment of the zebrafish as a new model for studies of the role of 5-HT in autonomic cardiac control. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. LSD1 is Required for Hair Cell Regeneration in Zebrafish.

    Science.gov (United States)

    He, Yingzi; Tang, Dongmei; Cai, Chengfu; Chai, Renjie; Li, Huawei

    2016-05-01

    Lysine-specific demethylase 1 (LSD1/KDM1A) plays an important role in complex cellular processes such as differentiation, proliferation, apoptosis, and cell cycle progression. It has recently been demonstrated that during development, downregulation of LSD1 inhibits cell proliferation, modulates the expression of cell cycle regulators, and reduces hair cell formation in the zebrafish lateral line, which suggests that LSD1-mediated epigenetic regulation plays a key role in the development of hair cells. However, the role of LSD1 in hair cell regeneration after hair cell loss remains poorly understood. Here, we demonstrate the effect of LSD1 on hair cell regeneration following neomycin-induced hair cell loss. We show that the LSD1 inhibitor trans-2-phenylcyclopropylamine (2-PCPA) significantly decreases the regeneration of hair cells in zebrafish after neomycin damage. In addition, immunofluorescent staining demonstrates that 2-PCPA administration suppresses supporting cell proliferation and alters cell cycle progression. Finally, in situ hybridization shows that 2-PCPA significantly downregulates the expression of genes related to Wnt/β-catenin and Fgf activation. Altogether, our data suggest that downregulation of LSD1 significantly decreases hair cell regeneration after neomycin-induced hair cell loss through inactivation of the Wnt/β-catenin and Fgf signaling pathways. Thus, LSD1 plays a critical role in hair cell regeneration and might represent a novel biomarker and potential therapeutic approach for the treatment of hearing loss.

  4. Excision of Nucleopolyhedrovirus Form Transgenic Silkworm Using the CRISPR/Cas9 System

    Directory of Open Access Journals (Sweden)

    Zhanqi Dong

    2018-02-01

    Full Text Available The CRISPR/Cas9-mediated genome engineering has been shown to efficiently suppress infection by disrupting genes of the pathogen. We recently constructed transgenic lines expressing CRISPR/Cas9 and the double sgRNA target Bombyx mori nucleopolyhedrovirus (BmNPV immediate early-1 (ie-1 gene in the silkworm, respectively, and obtained four transgenic hybrid lines by G1 generation hybridization: Cas9(-/sgRNA(-, Cas9(+/sgRNA(-, Cas9(-/sgRNA(+, and Cas9(+/sgRNA(+. We demonstrated that the Cas9(+/sgRNA(+ transgenic lines effectively edited the target site of the BmNPV genome, and large fragment deletion was observed after BmNPV infection. Further antiviral analysis of the Cas9(+/sgRNA(+ transgenic lines shows that the median lethal dose (LD50 is 1,000-fold higher than the normal lines after inoculation with occlusion bodies. The analysis of economic characters and off-target efficiency of Cas9(+/sgRNA(+ transgenic hybrid line showed no significant difference compared with the normal lines. Our findings indicate that CRISPR/Cas9-mediated genome engineering more effectively targets the BmNPV genomes and could be utilized as an insect antiviral treatment.

  5. Excision of Nucleopolyhedrovirus Form Transgenic Silkworm Using the CRISPR/Cas9 System.

    Science.gov (United States)

    Dong, Zhanqi; Dong, Feifan; Yu, Xinbo; Huang, Liang; Jiang, Yaming; Hu, Zhigang; Chen, Peng; Lu, Cheng; Pan, Minhui

    2018-01-01

    The CRISPR/Cas9-mediated genome engineering has been shown to efficiently suppress infection by disrupting genes of the pathogen. We recently constructed transgenic lines expressing CRISPR/Cas9 and the double sgRNA target Bombyx mori nucleopolyhedrovirus (BmNPV) immediate early-1 ( ie-1 ) gene in the silkworm, respectively, and obtained four transgenic hybrid lines by G1 generation hybridization: Cas9(-)/sgRNA(-), Cas9(+)/sgRNA(-), Cas9(-)/sgRNA(+), and Cas9(+)/sgRNA(+). We demonstrated that the Cas9(+)/sgRNA(+) transgenic lines effectively edited the target site of the BmNPV genome, and large fragment deletion was observed after BmNPV infection. Further antiviral analysis of the Cas9(+)/sgRNA(+) transgenic lines shows that the median lethal dose (LD50) is 1,000-fold higher than the normal lines after inoculation with occlusion bodies. The analysis of economic characters and off-target efficiency of Cas9(+)/sgRNA(+) transgenic hybrid line showed no significant difference compared with the normal lines. Our findings indicate that CRISPR/Cas9-mediated genome engineering more effectively targets the BmNPV genomes and could be utilized as an insect antiviral treatment.

  6. Transgenic rice plants harboring an introduced potato proteinase inhibitor II gene are insect resistant.

    Science.gov (United States)

    Duan, X; Li, X; Xue, Q; Abo-el-Saad, M; Xu, D; Wu, R

    1996-04-01

    We introduced the potato proteinase inhibitor II (PINII) gene (pin2) into several Japonica rice varieties, and regenerated a large number of transgenic rice plants. Wound-inducible expression of the pin2 gene driven by its own promoter, together with the first intron of the rice actin 1 gene (act1), resulted in high-level accumulation of the PINII protein in the transgenic plants. The introduced pin2 gene was stably inherited in the second, third, and fourth generations, as shown by molecular analyses. Based on data from the molecular analyses, several homozygous transgenic lines were obtained. Bioassay for insect resistance with the fifth-generation transgenic rice plants showed that transgenic rice plants had increased resistance to a major rice insect pest, pink stem borer (Sesamia inferens). Thus, introduction of an insecticidal proteinase inhibitor gene into cereal plants can be used as a general strategy for control of insect pests.

  7. The Relationship between Insect Resistance and Tree Age of Transgenic Triploid Populus tomentosa Plants.

    Science.gov (United States)

    Ren, Yachao; Zhang, Jun; Wang, Guiying; Liu, Xiaojie; Li, Li; Wang, Jinmao; Yang, Minsheng

    2018-01-01

    To explore the stability of insect resistance during the development of transgenic insect-resistant trees, this study investigated how insect resistance changes as transgenic trees age. We selected 19 transgenic insect-resistant triploid Populus tomentosa lines as plant material. The presence of exogenous genes and Cry1Ac protein expression were verified using polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA) analyses. The toxicity for Clostera anachoreta and Lymantria dispar was evaluated by feeding fresh leaves to first instar larvae after the trees were planted in the field for 2 years and after the sixth year. Results of PCR showed that the exogenous genes had a long-term presence in the poplar genome. ELISA analyses showed significant differences existed on the 6-year-old transgenic lines. The insect-feeding experiment demonstrated significant differences in the mortality rates of C. anachoreta and L. dispar among different transgenic lines. The average corrected mortality rates of C. anachoreta and L. dispar ranged from 5.6-98.7% to 35.4-7.2% respectively. The larval mortality rates differed significantly between the lines at different ages. Up to 52.6% of 1-year-old transgenic lines and 42.1% of 2-year-old transgenic lines caused C. anachoreta larval mortality rates to exceed 80%, whereas only 26.3% of the 6-year-old transgenic lines. The mortality rates of L. dispar exhibited the same trend: 89.5% of 1-year-old transgenic lines and 84.2% of 2-year-old transgenic lines caused L. dispar larval mortality rates to exceed 80%; this number decreased to 63.2% for the 6-year-old plants. The proportion of 6-year-old trees with over 80% larval mortality rates was clearly lower than that of the younger trees. The death distribution of C. anachoreta in different developmental stages also showed the larvae that fed on the leaves of 1-year-old trees were killed mostly during L 1 and L 2 stages, whereas the proportion of larvae that died in L 3

  8. Transcriptome analysis of zebrafish embryogenesis using microarrays.

    Directory of Open Access Journals (Sweden)

    Sinnakaruppan Mathavan

    2005-08-01

    Full Text Available Zebrafish (Danio rerio is a well-recognized model for the study of vertebrate developmental genetics, yet at the same time little is known about the transcriptional events that underlie zebrafish embryogenesis. Here we have employed microarray analysis to study the temporal activity of developmentally regulated genes during zebrafish embryogenesis. Transcriptome analysis at 12 different embryonic time points covering five different developmental stages (maternal, blastula, gastrula, segmentation, and pharyngula revealed a highly dynamic transcriptional profile. Hierarchical clustering, stage-specific clustering, and algorithms to detect onset and peak of gene expression revealed clearly demarcated transcript clusters with maximum gene activity at distinct developmental stages as well as co-regulated expression of gene groups involved in dedicated functions such as organogenesis. Our study also revealed a previously unidentified cohort of genes that are transcribed prior to the mid-blastula transition, a time point earlier than when the zygotic genome was traditionally thought to become active. Here we provide, for the first time to our knowledge, a comprehensive list of developmentally regulated zebrafish genes and their expression profiles during embryogenesis, including novel information on the temporal expression of several thousand previously uncharacterized genes. The expression data generated from this study are accessible to all interested scientists from our institute resource database (http://giscompute.gis.a-star.edu.sg/~govind/zebrafish/data_download.html.

  9. Forward Genetic Screening Using Behavioral Tests in Zebrafish: A Proof of Concept Analysis of Mutants.

    Science.gov (United States)

    Gerlai, Robert; Poshusta, Tanya L; Rampersad, Mindy; Fernandes, Yohaan; Greenwood, Tammy M; Cousin, Margot A; Klee, Eric W; Clark, Karl J

    2017-01-01

    The zebrafish enjoys several advantages over other model organisms. It is small, easy to maintain, prolific, and numerous genetic tools are available for it. For example, forward genetic screens have allowed investigators to identify important genes potentially involved in a variety of functions from embryogenesis to cancer. However, despite its sophisticated behavioral repertoire, behavioral methods have rarely been utilized in forward genetic screens. Here, we employ a two-tiered strategy, a proof of concept study, to explore the feasibility of behavioral screens. We generated mutant lines using transposon-based insertional mutagenesis, allowing us to bias mutant selection with target genes expressed within the brain. Furthermore, we employed an efficient and fast behavioral pre-selection in which we investigated the locomotory response of 5-day post-fertilization old larval fish to hyperosmotic shock. Based on this assay, we selected five lines for our lower throughput secondary adult behavioral screen. The latter screen utilized tests in which computer animated image presentation and video-tracking-based automated quantification of behavior allowed us to compare heterozygous zebrafish with their wild-type siblings on their responses to a variety of stimuli. We found significant mutation induced adult behavioral alterations in 4 out of the 5 lines analyzed, including changes in response to social or fear inducing stimuli, to handling and novelty, or in habituation to novelty. We discuss the pros and cons of behavioral phenotyping and of the use of different forward genetic methods in biomedical research with zebrafish.

  10. The zebrafish genome: a review and msx gene case study.

    Science.gov (United States)

    Postlethwait, J H

    2006-01-01

    Zebrafish is one of several important teleost models for understanding principles of vertebrate developmental, molecular, organismal, genetic, evolutionary, and genomic biology. Efficient investigation of the molecular genetic basis of induced mutations depends on knowledge of the zebrafish genome. Principles of zebrafish genomic analysis, including gene mapping, ortholog identification, conservation of syntenies, genome duplication, and evolution of duplicate gene function are discussed here using as a case study the zebrafish msxa, msxb, msxc, msxd, and msxe genes, which together constitute zebrafish orthologs of tetrapod Msx1, Msx2, and Msx3. Genomic analysis suggests orthologs for this difficult to understand group of paralogs.

  11. [Biofuels, food security and transgenic crops].

    Science.gov (United States)

    Acosta, Orlando; Chaparro-Giraldo, Alejandro

    2009-01-01

    Soaring global food prices are threatening to push more poor people back below the poverty line; this will probably become aggravated by the serious challenge that increasing population and climate changes are posing for food security. There is growing evidence that human activities involving fossil fuel consumption and land use are contributing to greenhouse gas emissions and consequently changing the climate worldwide. The finite nature of fossil fuel reserves is causing concern about energy security and there is a growing interest in the use of renewable energy sources such as biofuels. There is growing concern regarding the fact that biofuels are currently produced from food crops, thereby leading to an undesirable competition for their use as food and feed. Nevertheless, biofuels can be produced from other feedstocks such as lingo-cellulose from perennial grasses, forestry and vegetable waste. Biofuel energy content should not be exceeded by that of the fossil fuel invested in its production to ensure that it is energetically sustainable; however, biofuels must also be economically competitive and environmentally acceptable. Climate change and biofuels are challenging FAO efforts aimed at eradicating hunger worldwide by the next decade. Given that current crops used in biofuel production have not been domesticated for this purpose, transgenic technology can offer an enormous contribution towards improving biofuel crops' environmental and economic performance. The present paper critically presents some relevant relationships between biofuels, food security and transgenic plant technology.

  12. Increased yield of heterologous viral glycoprotein in the seeds of homozygous transgenic tobacco plants cultivated underground.

    Science.gov (United States)

    Tackaberry, Eilleen S; Prior, Fiona; Bell, Margaret; Tocchi, Monika; Porter, Suzanne; Mehic, Jelica; Ganz, Peter R; Sardana, Ravinder; Altosaar, Illimar; Dudani, Anil

    2003-06-01

    The use of transgenic plants in the production of recombinant proteins for human therapy, including subunit vaccines, is being investigated to evaluate the efficacy and safety of these emerging biopharmaceutical products. We have previously shown that synthesis of recombinant glycoprotein B (gB) of human cytomegalovirus can be targeted to seeds of transgenic tobacco when directed by the rice glutelin 3 promoter, with gB retaining critical features of immunological reactivity (E.S. Tackaberry et al. 1999. Vaccine, 17: 3020-3029). Here, we report development of second generation transgenic plant lines (T1) homozygous for the transgene. Twenty progeny plants from two lines (A23T(1)-2 and A24T(1)-3) were grown underground in an environmentally contained mine shaft. Based on yields of gB in their seeds, the A23T(1)-2 line was then selected for scale-up in the same facility. Analyses of mature seeds by ELISA showedthat gB specific activity in A23T(1)-2 seeds was over 30-fold greater than the best T0 plants from the same transformation series, representing 1.07% total seed protein. These data demonstrate stable inheritance, an absence of transgene inactivation, and enhanced levels of gB expression in a homozygous second generation plant line. They also provide evidence for the suitability of using this environmentally secure facility to grow transgenic plants producing therapeutic biopharmaceuticals.

  13. PDH45 overexpressing transgenic tobacco and rice plants provide salinity stress tolerance via less sodium accumulation.

    Science.gov (United States)

    Nath, Manoj; Garg, Bharti; Sahoo, Ranjan Kumar; Tuteja, Narendra

    2015-01-01

    Salinity stress negatively affects the crop productivity worldwide, including that of rice. Coping with these losses is a major concern for all countries. The pea DNA helicase, PDH45 is a unique member of helicase family involved in the salinity stress tolerance. However, the exact mechanism of the PDH45 in salinity stress tolerance is yet to be established. Therefore, the present study was conducted to investigate the mechanism of PDH45-mediated salinity stress tolerance in transgenic tobacco and rice lines along with wild type (WT) plants using CoroNa Green dye based sodium localization in root and shoot sections. The results showed that under salinity stress root and shoot of PDH45 overexpressing transgenic tobacco and rice accumulated less sodium (Na(+)) as compared to their respective WT. The present study also reports salinity tolerant (FL478) and salinity susceptible (Pusa-44) varieties of rice accumulated lowest and highest Na(+) level, respectively. All the varieties and transgenic lines of rice accumulate differential Na(+) ions in root and shoot. However, roots accumulate high Na(+) as compared to the shoots in both tobacco and rice transgenic lines suggesting that the Na(+) transport in shoot is somehow inhibited. It is proposed that the PDH45 is probably involved in the deposition of apoplastic hydrophobic barriers and consequently inhibit Na(+) transport to shoot and therefore confers salinity stress tolerance to PDH45 overexpressing transgenic lines. This study concludes that tobacco (dicot) and rice (monocot) transgenic plants probably share common salinity tolerance mechanism mediated by PDH45 gene.

  14. Constitutive expression of a fungus-inducible carboxylesterase improves disease resistance in transgenic pepper plants.

    Science.gov (United States)

    Ko, Moonkyung; Cho, Jung Hyun; Seo, Hyo-Hyoun; Lee, Hyun-Hwa; Kang, Ha-Young; Nguyen, Thai Son; Soh, Hyun Cheol; Kim, Young Soon; Kim, Jeong-Il

    2016-08-01

    Resistance against anthracnose fungi was enhanced in transgenic pepper plants that accumulated high levels of a carboxylesterase, PepEST in anthracnose-susceptible fruits, with a concurrent induction of antioxidant enzymes and SA-dependent PR proteins. A pepper esterase gene (PepEST) is highly expressed during the incompatible interaction between ripe fruits of pepper (Capsicum annuum L.) and a hemibiotrophic anthracnose fungus (Colletotrichum gloeosporioides). In this study, we found that exogenous application of recombinant PepEST protein on the surface of the unripe pepper fruits led to a potentiated state for disease resistance in the fruits, including generation of hydrogen peroxide and expression of pathogenesis-related (PR) genes that encode mostly small proteins with antimicrobial activity. To elucidate the role of PepEST in plant defense, we further developed transgenic pepper plants overexpressing PepEST under the control of CaMV 35S promoter. Molecular analysis confirmed the establishment of three independent transgenic lines carrying single copy of transgenes. The level of PepEST protein was estimated to be approximately 0.002 % of total soluble protein in transgenic fruits. In response to the anthracnose fungus, the transgenic fruits displayed higher expression of PR genes, PR3, PR5, PR10, and PepThi, than non-transgenic control fruits did. Moreover, immunolocalization results showed concurrent localization of ascorbate peroxidase (APX) and PR3 proteins, along with the PepEST protein, in the infected region of transgenic fruits. Disease rate analysis revealed significantly low occurrence of anthracnose disease in the transgenic fruits, approximately 30 % of that in non-transgenic fruits. Furthermore, the transgenic plants also exhibited resistance against C. acutatum and C. coccodes. Collectively, our results suggest that overexpression of PepEST in pepper confers enhanced resistance against the anthracnose fungi by activating the defense signaling

  15. Small GTPase R-Ras participates in neural tube formation in zebrafish embryonic spinal cord.

    Science.gov (United States)

    Ohata, Shinya; Uga, Hideko; Okamoto, Hitoshi; Katada, Toshiaki

    2018-06-27

    Ras related (R-Ras), a small GTPase, is involved in the maintenance of apico-basal polarity in neuroepithelial cells of the zebrafish hindbrain, axonal collapse in cultured murine hippocampal neurons, and maturation of blood vessels in adult mice. However, the role of R-Ras in neural tube formation remains unknown. Using antisense morpholino oligonucleotides (AMOs), we found that in the spinal cord of zebrafish embryos, the lumen was formed bilaterally in rras morphants, whereas it was formed at the midline in control embryos. As AMO can cause off-target effects, we generated rras mutant zebrafish lines using CRISPR/Cas9 technology. Although these rras mutant embryos did not have a bilateral lumen in the spinal cord, the following findings suggest that the phenotype is unlikely due to an off-target effect of rras AMO: 1) The rras morphant phenotype was rescued by an injection of AMO-resistant rras mRNA, and 2) a bilaterally segregated spinal cord was not observed in rras mutant embryos injected with rras AMO. The results suggest that the function of other ras family genes may be redundant in rras mutants. Previous research reported a bilaterally formed lumen in the spinal cord of zebrafish embryos with a mutation in a planar cell polarity (PCP) gene, van gogh-like 2 (vangl2). In the present study, in cultured cells, R-Ras was co-immunoprecipitated with Vangl2 but not with another PCP regulator, Pricke1. Interestingly, the interaction between R-Ras and Vangl2 was stronger in guanine-nucleotide free point mutants of R-Ras than in wild-type or constitutively active (GTP-bound) forms of R-Ras. R-Ras may regulate neural tube formation in cooperation with Vangl2 in the developing zebrafish spinal cord. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. Neutrophil Reverse Migration Becomes Transparent with Zebrafish

    Directory of Open Access Journals (Sweden)

    Taylor W. Starnes

    2012-01-01

    Full Text Available The precise control of neutrophil-mediated inflammation is critical for both host defense and the prevention of immunopathology. In vivo imaging studies in zebrafish, and more recently in mice, have made the novel observation that neutrophils leave a site of inflammation through a process called neutrophil reverse migration. The application of advanced imaging techniques to the genetically tractable, optically transparent zebrafish larvae was critical for these advances. Still, the mechanisms underlying neutrophil reverse migration and its effects on the resolution or priming of immune responses remain unclear. Here, we review the current knowledge of neutrophil reverse migration, its potential roles in host immunity, and the live imaging tools that make zebrafish a valuable model for increasing our knowledge of neutrophil behavior in vivo.

  17. Tributyltin and Zebrafish: Swimming in Dangerous Water

    Directory of Open Access Journals (Sweden)

    Clemilson Berto-Júnior

    2018-04-01

    Full Text Available Zebrafish has been established as a reliable biological model with important insertion in academy (morphologic, biochemical, and pathophysiological studies and pharmaceutical industry (toxicology and drug development due to its molecular complexity and similar systems biology that recapitulate those from other organisms. Considering the toxicological aspects, many efforts using zebrafish models are being done in order to elucidate the effects of endocrine disruptors, and some of them are focused on tributyltin (TBT and its mechanism of action. TBT is an antifouling agent applied in ship’s hull that is constantly released into the water and absorbed by marine organisms, leading to bioaccumulation and biomagnification effects. Thus, several findings of malformations and changes in the normal biochemical and physiologic aspects of these marine animals have been related to TBT contamination. In the present review, we have compiled the most significant studies related to TBT effects in zebrafish, also taking into consideration the effects found in other study models.

  18. Tributyltin and Zebrafish: Swimming in Dangerous Water

    Science.gov (United States)

    Berto-Júnior, Clemilson; de Carvalho, Denise Pires; Soares, Paula; Miranda-Alves, Leandro

    2018-01-01

    Zebrafish has been established as a reliable biological model with important insertion in academy (morphologic, biochemical, and pathophysiological studies) and pharmaceutical industry (toxicology and drug development) due to its molecular complexity and similar systems biology that recapitulate those from other organisms. Considering the toxicological aspects, many efforts using zebrafish models are being done in order to elucidate the effects of endocrine disruptors, and some of them are focused on tributyltin (TBT) and its mechanism of action. TBT is an antifouling agent applied in ship’s hull that is constantly released into the water and absorbed by marine organisms, leading to bioaccumulation and biomagnification effects. Thus, several findings of malformations and changes in the normal biochemical and physiologic aspects of these marine animals have been related to TBT contamination. In the present review, we have compiled the most significant studies related to TBT effects in zebrafish, also taking into consideration the effects found in other study models. PMID:29692757

  19. Untranslatable tospoviral NSs fragment coupled with L conserved region enhances transgenic resistance against the homologous virus and a serologically unrelated tospovirus.

    Science.gov (United States)

    Yazhisai, Uthaman; Rajagopalan, Prem Anand; Raja, Joseph A J; Chen, Tsung-Chi; Yeh, Shyi-Dong

    2015-08-01

    Tospoviruses cause severe damages to important crops worldwide. In this study, Nicotiana benthamiana transgenic lines carrying individual untranslatable constructs comprised of the conserved region of the L gene (denoted as L), the 5' half of NSs coding sequence (NSs) or the antisense fragment of whole N coding sequence (N) of Watermelon silver mottle virus (WSMoV), individually or in combination, were generated. A total of 15-17 transgenic N. benthamiana lines carrying individual transgenes were evaluated against WSMoV and the serologically unrelated Tomato spotted wilt virus (TSWV). Among lines carrying single or chimeric transgenes, the level of resistance ranged from susceptible to completely resistant against WSMoV. From the lines carrying individual transgenes and highly resistant to WSMoV (56-63% of lines assayed), 30% of the L lines (3/10 lines assayed) and 11% of NSs lines (1/9 lines assayed) were highly resistant against TSWV. The chimeric transgenes provided higher degrees of resistance against WSMoV (80-88%), and the NSs fragment showed an additive effect to enhance the resistance to TSWV. Particularly, the chimeric transgenes with the triple combination of fragments, namely L/NSs/N or HpL/NSs/N (a hairpin construct), provided a higher degree of resistance (both 50%, with 7/14 lines assayed) against TSWV. Our results indicate that the untranslatable NSs fragment is able to enhance the transgenic resistance conferred by the L conserved region. The better performance of L/NSs/N and HpL/NSs/N in transgenic N. benthamiana lines suggests their potential usefulness in generating high levels of enhanced transgenic resistance against serologically unrelated tospoviruses in agronomic crops.

  20. ZyFISH: a simple, rapid and reliable zygosity assay for transgenic mice.

    Directory of Open Access Journals (Sweden)

    Donal McHugh

    Full Text Available Microinjection of DNA constructs into fertilized mouse oocytes typically results in random transgene integration at a single genomic locus. The resulting transgenic founders can be used to establish hemizygous transgenic mouse lines. However, practical and experimental reasons often require that such lines be bred to homozygosity. Transgene zygosity can be determined by progeny testing assays which are expensive and time-consuming, by quantitative Southern blotting which is labor-intensive, or by quantitative PCR (qPCR which requires transgene-specific design. Here, we describe a zygosity assessment procedure based on fluorescent in situ hybridization (zyFISH. The zyFISH protocol entails the detection of transgenic loci by FISH and the concomitant assignment of homozygosity using a concise and unbiased scoring system. The method requires small volumes of blood, is scalable to at least 40 determinations per assay, and produces results entirely consistent with the progeny testing assay. This combination of reliability, simplicity and cost-effectiveness makes zyFISH a method of choice for transgenic mouse zygosity determinations.

  1. Transgenic expression of phytase in wheat endosperm increases bioavailability of iron and zinc in grains.

    Science.gov (United States)

    Abid, Nabeela; Khatoon, Asia; Maqbool, Asma; Irfan, Muhammad; Bashir, Aftab; Asif, Irsa; Shahid, Muhammad; Saeed, Asma; Brinch-Pedersen, Henrik; Malik, Kauser A

    2017-02-01

    Phytate is a major constituent of wheat seeds and chelates metal ions, thus reducing their bioavailability and so the nutritional value of grains. Transgenic plants expressing heterologous phytase are expected to enhance degradation of phytic acid stored in seeds and are proposed to increase the in vitro bioavailability of mineral nutrients. Wheat transgenic plants expressing Aspergillus japonicus phytase gene (phyA) in wheat endosperm were developed till T 3 generation. The transgenic lines exhibited 18-99 % increase in phytase activity and 12-76 % reduction of phytic acid content in seeds. The minimum phytic acid content was observed in chapatti (Asian bread) as compared to flour and dough. The transcript profiling of phyA mRNA indicated twofold to ninefold higher expression as compared to non transgenic controls. There was no significant difference in grain nutrient composition of transgenic and non-transgenic seeds. In vitro bioavailability assay for iron and zinc in dough and chapatti of transgenic lines revealed a significant increase in iron and zinc contents. The development of nutritionally enhanced cereals is a step forward to combat nutrition deficiency for iron and zinc in malnourished human population, especially women and children.

  2. How To Produce and Characterize Transgenic Plants.

    Science.gov (United States)

    Savka, Michael A.; Wang, Shu-Yi; Wilson, Mark

    2002-01-01

    Explains the process of establishing transgenic plants which is a very important tool in plant biology and modern agriculture. Produces transgenic plants with the ability to synthesize opines. (Contains 17 references.) (YDS)

  3. Transgenic Pm3 multilines of wheat show increased powdery mildew resistance in the field.

    Science.gov (United States)

    Brunner, Susanne; Stirnweis, Daniel; Diaz Quijano, Carolina; Buesing, Gabriele; Herren, Gerhard; Parlange, Francis; Barret, Pierre; Tassy, Caroline; Sautter, Christof; Winzeler, Michael; Keller, Beat

    2012-05-01

    Resistance (R) genes protect plants very effectively from disease, but many of them are rapidly overcome when present in widely grown cultivars. To overcome this lack of durability, strategies that increase host resistance diversity have been proposed. Among them is the use of multilines composed of near-isogenic lines (NILs) containing different disease resistance genes. In contrast to classical R-gene introgression by recurrent backcrossing, a transgenic approach allows the development of lines with identical genetic background, differing only in a single R gene. We have used alleles of the resistance locus Pm3 in wheat, conferring race-specific resistance to wheat powdery mildew (Blumeria graminis f. sp. tritici), to develop transgenic wheat lines overexpressing Pm3a, Pm3c, Pm3d, Pm3f or Pm3g. In field experiments, all tested transgenic lines were significantly more resistant than their respective nontransformed sister lines. The resistance level of the transgenic Pm3 lines was determined mainly by the frequency of virulence to the particular Pm3 allele in the powdery mildew population, Pm3 expression levels and most likely also allele-specific properties. We created six two-way multilines by mixing seeds of the parental line Bobwhite and transgenic Pm3a, Pm3b and Pm3d lines. The Pm3 multilines were more resistant than their components when tested in the field. This demonstrates that the difference in a single R gene is sufficient to cause host-diversity effects and that multilines of transgenic Pm3 wheat lines represent a promising strategy for an effective and sustainable use of Pm3 alleles. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  4. Improved antioxidant activity in transgenic Perilla frutescens plants via overexpression of the γ-tocopherol methyltransferase (γ-tmt) gene.

    Science.gov (United States)

    Ghimire, Bimal Kumar; Seong, Eun Soo; Lee, Chan Ok; Lee, Jae Geun; Yu, Chang Yeon; Kim, Seung Hyun; Chung, Ill Min

    2015-09-01

    The main goal of this study was to generate transgenic Perilla frutescens with enhanced antioxidant properties by overexpressing the γ-tocopherol methyltransferase (γ-tmt) gene. In this study, the antioxidant activity of methanolic crude extracts of transgenic and non-transgenic control plants was investigated using the 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging method. Free radical scavenging activity was evaluated using α-tocopherol and butylated hydroxyl toluene as standard antioxidants. In general, the ethyl acetate fraction of transgenic P. frutescens showed stronger DPPH radical scavenging activity than the ethyl acetate fraction from non-transgenic control plants (IC50 2.00 ± 0.10 and 5.53 ± 0.40 μg ∙ ml(-1), respectively). High-performance liquid chromatography analysis of phenolic acids in leaf extracts confirmed increased levels of 16 individual phenolic compounds in two transgenic lines (pf47-5 and pf47-8) compared with control plants. Changes in the phenolic compound profile and α-tocopherol content were correlated with the antioxidant properties of transgenic plants, indicating that the introduction of transgene γ-tmt influenced the metabolism of phenolic compounds and subsequently produced biochemical changes in the transformants. There were no significant differences in photosynthetic rate in the transgenic plants as compared to the non-transgenic control plants, suggesting that the alteration of phenolic compounds and tocopherol composition had little impact on photosynthesis.

  5. Expression of Recombinant Human Alpha-Lactalbumin in the Milk of Transgenic Goats Using a Hybrid Pomoter/Enhancer

    Directory of Open Access Journals (Sweden)

    Yu-Guo Yuan

    2014-01-01

    Full Text Available To improve nutrient content of goat milk, we describe the construction of a vector (pBLAC containing a hybrid goat β-lactoglobulin (BLG promoter/cytomegalovirus (CMV enhancer. We also describe the generation of transgenic goats expressing rhLA by somatic cell nuclear transfer (SCNT. Of 334 one-cell stage embryos derived from three transgenic cell lines and 99 embryos derived from non-transgenic (NT cells surgically transferred to the oviducts of 37 recipients, two recipients delivered two kids (2% from the non-transfected line and five recipients delivered six kids (1.8% from transgenic cell lines, three of which died within 2 days. Compared to the NT donor cells, transfection of donor cells does not negatively affect the development of nuclear transfer embryos into viable transgenic offspring. However, the clone efficiency in cell line number 1 was lower than that in numbers 2 and 3, and in the NT lines (0.9% versus 1.9% 2.4% and 2%; P<0.05. Two transgenic cloned goats expressed rhLA in the milk at 0.1–0.9 mg/mL. The mammary gland-specific expression vector pBLAC with hybrid BLG/CMV can drive the hLA gene to express in vitro and in vivo. These data establish the basis for use of a hybrid promoter/enhancer strategy to produce rhLA transgenic goats.

  6. RNAi-derived transgenic resistance to Mungbean yellow mosaic India virus in cowpea.

    Science.gov (United States)

    Kumar, Sanjeev; Tanti, Bhaben; Patil, Basavaprabhu L; Mukherjee, Sunil Kumar; Sahoo, Lingaraj

    2017-01-01

    Cowpea is an important grain legume crop of Africa, Latin America, and Southeast Asia. Leaf curl and golden mosaic diseases caused by Mungbean yellow mosaic India virus (MYMIV) have emerged as most devastating viral diseases of cowpea in Southeast Asia. In this study, we employed RNA interference (RNAi) strategy to control cowpea-infecting MYMIV. For this, we generated transgenic cowpea plants harbouring three different intron hairpin RNAi constructs, containing the AC2, AC4 and fusion of AC2 and AC4 (AC2+AC4) of seven cowpea-infecting begomoviruses. The T0 and T1 transgenic cowpea lines of all the three constructs accumulated transgene-specific siRNAs. Transgenic plants were further assayed up to T1 generations, for resistance to MYMIV using agro-infectious clones. Nearly 100% resistance against MYMIV infection was observed in transgenic lines, expressing AC2-hp and AC2+AC4-hp RNA, when compared with untransformed controls and plants transformed with empty vectors, which developed severe viral disease symptoms within 3 weeks. The AC4-hp RNA expressing lines displayed appearance of milder symptoms after 5 weeks of MYMIV-inoculation. Northern blots revealed a positive correlation between the level of transgene-specific siRNAs accumulation and virus resistance. The MYMIV-resistant transgenic lines accumulated nearly zero or very low titres of viral DNA. The transgenic cowpea plants had normal phenotype with no yield penalty in greenhouse conditions. This is the first demonstration of RNAi-derived resistance to MYMIV in cowpea.

  7. Transgenic potato plants expressing cry3A gene confer resistance to Colorado potato beetle.

    Science.gov (United States)

    Mi, Xiaoxiao; Ji, Xiangzhuo; Yang, Jiangwei; Liang, Lina; Si, Huaijun; Wu, Jiahe; Zhang, Ning; Wang, Di

    2015-07-01

    The Colorado potato beetle (Leptinotarsa decemlineata Say, CPB) is a fatal pest, which is a quarantine pest in China. The CPB has now invaded the Xinjiang Uygur Autonomous Region and is constantly spreading eastward in China. In this study, we developed transgenic potato plants expressing cry3A gene. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the cry3A gene expressed in leaves, stems and roots of the transgenic plants under the control of CaMV 35S promoter, while they expressed only in leaves and stems under the control of potato leaf and stem-specific promoter ST-LS1. The mortality of the larvae was higher (28% and 36%) on the transgenic plant line 35S1 on the 3rd and 4th days, and on ST3 (48%) on the 5th day after inoculation with instar larvae. Insect biomass accumulation on the foliage of the transgenic plant lines 35S1, 35S2 and ST3 was significantly lower (0.42%, 0.43% and 0.42%). Foliage consumption was lowest on transgenic lines 35S8 and ST2 among all plant foliage (7.47 mg/larvae/day and 12.46 mg/larvae/day). The different transgenic plant foliages had varied inhibition to larval growth. The survivors on the transgenic lines obviously were smaller than their original size and extremely weak. The transgenic potato plants with CPB resistance could be used to develop germplasms or varieties for controlling CPB damage and halting its spread in China. Copyright © 2015 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  8. Progress on researches of transgenic alfalfa

    International Nuclear Information System (INIS)

    Guo Huiqin; Wang Mi; Ren Weibo; Xu Zhu; Chen Libo

    2010-01-01

    In this paper, the progress on the researches of transgenic alfalfa in the past two decades had been reviewed in the aspects of regeneration system, transformation, improvement of the important traits and so on. Moreover, such problems as variation of transgene expression and safety of transgenic plant had also been discussed and propose had been given for the future research work. (authors)

  9. Accelerated Optical Projection Tomography Applied to In Vivo Imaging of Zebrafish.

    Directory of Open Access Journals (Sweden)

    Teresa Correia

    Full Text Available Optical projection tomography (OPT provides a non-invasive 3-D imaging modality that can be applied to longitudinal studies of live disease models, including in zebrafish. Current limitations include the requirement of a minimum number of angular projections for reconstruction of reasonable OPT images using filtered back projection (FBP, which is typically several hundred, leading to acquisition times of several minutes. It is highly desirable to decrease the number of required angular projections to decrease both the total acquisition time and the light dose to the sample. This is particularly important to enable longitudinal studies, which involve measurements of the same fish at different time points. In this work, we demonstrate that the use of an iterative algorithm to reconstruct sparsely sampled OPT data sets can provide useful 3-D images with 50 or fewer projections, thereby significantly decreasing the minimum acquisition time and light dose while maintaining image quality. A transgenic zebrafish embryo with fluorescent labelling of the vasculature was imaged to acquire densely sampled (800 projections and under-sampled data sets of transmitted and fluorescence projection images. The under-sampled OPT data sets were reconstructed using an iterative total variation-based image reconstruction algorithm and compared against FBP reconstructions of the densely sampled data sets. To illustrate the potential for quantitative analysis following rapid OPT data acquisition, a Hessian-based method was applied to automatically segment the reconstructed images to select the vasculature network. Results showed that 3-D images of the zebrafish embryo and its vasculature of sufficient visual quality for quantitative analysis can be reconstructed using the iterative algorithm from only 32 projections-achieving up to 28 times improvement in imaging speed and leading to total acquisition times of a few seconds.

  10. Field performance of transgenic citrus trees: assessment of the long-term expression of uidA and nptII transgenes and its impact on relevant agronomic and phenotypic characteristics.

    Science.gov (United States)

    Pons, Elsa; Peris, Josep E; Peña, Leandro

    2012-07-15

    The future of genetic transformation as a tool for the improvement of fruit trees depends on the development of proper systems for the assessment of unintended effects in field-grown GM lines. In this study, we used eight transgenic lines of two different citrus types (sweet orange and citrange) transformed with the marker genes β-glucuronidase (uidA) and neomycin phosphotransferase II (nptII) as model systems to study for the first time in citrus the long-term stability of transgene expression and whether transgene-derived pleiotropic effects occur with regard to the morphology, development and fruit quality of orchard-grown GM citrus trees. The stability of the integration and expression of the transgenes was confirmed in 7-year-old, orchard-grown transgenic lines by Southern blot analysis and enzymatic assays (GUS and ELISA NPTII), respectively. Little seasonal variation was detected in the expression levels between plants of the same transgenic line in different organs and over the 3 years of analysis, confirming the absence of rearrangements and/or silencing of the transgenes after transferring the plants to field conditions. Comparisons between the GM citrus lines with their non-GM counterparts across the study years showed that the expression of these transgenes did not cause alterations of the main phenotypic and agronomic plant and fruit characteristics. However, when comparisons were performed between diploid and tetraploid transgenic citrange trees and/or between juvenile and mature transgenic sweet orange trees, significant and consistent differences were detected, indicating that factors other than their transgenic nature induced a much higher phenotypic variability. Our results indicate that transgene expression in GM citrus remains stable during long-term agricultural cultivation, without causing unexpected effects on crop characteristics. This study also shows that the transgenic citrus trees expressing the selectable marker genes that are most

  11. Highly efficient generation of knock-in transgenic medaka by CRISPR/Cas9-mediated genome engineering.

    Science.gov (United States)

    Watakabe, Ikuko; Hashimoto, Hisashi; Kimura, Yukiko; Yokoi, Saori; Naruse, Kiyoshi; Higashijima, Shin-Ichi

    2018-01-01

    Medaka ( Oryzias latipes ) is a popular animal model used in vertebrate genetic analysis. Recently, an efficient (~ 30%) knock-in system via non-homologous end joining (NHEJ) was established in zebrafish using the CRISPR/Cas9 system. If the same technique were applicable in medaka, it would greatly expand the usefulness of this model organism. The question of the applicability of CRISPR/Cas9 in medaka, however, has yet to be addressed. We report the highly efficient generation of knock-in transgenic medaka via non-homologous end joining (NHEJ). Donor plasmid containing a heat-shock promoter and a reporter gene was co-injected with a short guide RNA (sgRNA) targeted for genome digestion, an sgRNA targeted for donor plasmid digestion, and Cas9 mRNA. Broad transgene expression in the expression domain of a target gene was observed in approximately 25% of injected embryos. By raising these animals, we established stable knock-in transgenic fish with several different constructs for five genetic loci, obtaining transgenic founders at efficiencies of > 50% for all five loci. Further, we show that the method is useful for obtaining mutant alleles. In the experiments where transgene integrations were targeted between the transcription start site and the initiation methionine, the resultant transgenic fish became mutant alleles. With its simplicity, design flexibility, and high efficiency, we propose that CRISPR/Cas9-mediated knock-in via NHEJ will become a standard method for the generation of transgenic and mutant medaka.

  12. Use of zebrafish and knockdown technology to define proprotein convertase activity.

    Science.gov (United States)

    Chitramuthu, Babykumari P; Bennett, Hugh P J

    2011-01-01

    The Zebrafish (Danio rerio) is a powerful and well-established tool used extensively for the study of early vertebrate development and as a model of human diseases. Zebrafish genes orthologous to their mammalian counterparts generally share conserved biological function. Protein knockdown or overexpression can be effectively achieved by microinjection of morpholino antisense oligonucleotides (MOs) or mRNA, respectively, into developing embryos at the one- to two-cell stage. Correlating gene expression patterns with the characterizing of phenotypes resulting from over- or underexpression can reveal the function of a particular protein. The microinjection technique is simple and results are reproducible. We defined the expression pattern of the proprotein convertase PCSK5 within the lateral line neuromasts and various organs including the liver, gut and otic vesicle by whole-mount in situ hybridization (ISH) and immunofluorescence (IF). MO-mediated knockdown of zebrafish PCSK5 expression generated embryos that display abnormal neuromast deposition within the lateral line system resulting in uncoordinated patterns of swimming.

  13. Testing Transgenic Aspen Plants with bar Gene for Herbicide Resistance under Semi-natural Conditions.

    Science.gov (United States)

    Lebedev, V G; Faskhiev, V N; Kovalenko, N P; Shestibratov, K A; Miroshnikov, A I

    2016-01-01

    Obtaining herbicide resistant plants is an important task in the genetic engineering of forest trees. Transgenic European aspen plants (Populus tremula L.) expressing the bar gene for phosphinothricin resistance have been produced using Agrobacterium tumefaciens-mediated transformation. Successful genetic transformation was confirmed by PCR analysis for thirteen lines derived from two elite genotypes. In 2014-2015, six lines were evaluated for resistance to herbicide treatment under semi-natural conditions. All selected transgenic lines were resistant to the herbicide Basta at doses equivalent to 10 l/ha (twofold normal field dosage) whereas the control plants died at 2.5 l/ha. Foliar NH4-N concentrations in transgenic plants did not change after treatment. Extremely low temperatures in the third ten-day period of October 2014 revealed differences in freeze tolerance between the lines obtained from Pt of f2 aspen genotypes. Stable expression of the bar gene after overwintering outdoors was confirmed by RT-PCR. On the basis of the tests, four transgenic aspen lines were selected. The bar gene could be used for retransformation of transgenic forest trees expressing valuable traits, such as increased productivity.

  14. Zebrafish swimming in the flow: a particle image velocimetry study

    Directory of Open Access Journals (Sweden)

    Violet Mwaffo

    2017-11-01

    Full Text Available Zebrafish is emerging as a species of choice for the study of a number of biomechanics problems, including balance development, schooling, and neuromuscular transmission. The precise quantification of the flow physics around swimming zebrafish is critical toward a mechanistic understanding of the complex swimming style of this fresh-water species. Although previous studies have elucidated the vortical structures in the wake of zebrafish swimming in placid water, the flow physics of zebrafish swimming against a water current remains unexplored. In an effort to illuminate zebrafish swimming in a dynamic environment reminiscent of its natural habitat, we experimentally investigated the locomotion and hydrodynamics of a single zebrafish swimming in a miniature water tunnel using particle image velocimetry. Our results on zebrafish locomotion detail the role of flow speed on tail beat undulations, heading direction, and swimming speed. Our findings on zebrafish hydrodynamics offer a precise quantification of vortex shedding during zebrafish swimming and demonstrate that locomotory patterns play a central role on the flow physics. This knowledge may help clarify the evolutionary advantage of burst and cruise swimming movements in zebrafish.

  15. Imaging transient blood vessel fusion events in zebrafish by correlative volume electron microscopy.

    Directory of Open Access Journals (Sweden)

    Hannah E J Armer

    Full Text Available The study of biological processes has become increasingly reliant on obtaining high-resolution spatial and temporal data through imaging techniques. As researchers demand molecular resolution of cellular events in the context of whole organisms, correlation of non-invasive live-organism imaging with electron microscopy in complex three-dimensional samples becomes critical. The developing blood vessels of vertebrates form a highly complex network which cannot be imaged at high resolution using traditional methods. Here we show that the point of fusion between growing blood vessels of transgenic zebrafish, identified in live confocal microscopy, can subsequently be traced through the structure of the organism using Focused Ion Beam/Scanning Electron Microscopy (FIB/SEM and Serial Block Face/Scanning Electron Microscopy (SBF/SEM. The resulting data give unprecedented microanatomical detail of the zebrafish and, for the first time, allow visualization of the ultrastructure of a time-limited biological event within the context of a whole organism.

  16. Distinct Functions of Different scl Isoforms in Zebrafish Definitive Hematopoietic Stem Cell Initiation and Maintenance

    Science.gov (United States)

    Lan, Yahui

    2011-07-01

    The establishment of entire blood system relies on the multi-potent hematopoietic stem cells (HSCs), thus identifying the molecular mechanism in HSC generation is of importance for not only complementing the fundamental knowledge in stem cell biology, but also providing insights to the regenerative therapies. Recent researches have documented the formation of nascent HSCs through a direct transition from ventral aortic endothelium, named as endothelial hematopoietic transition (EHT) process. However, the precise genetic program engaged in this process remains largely elusive. The transcription factor scl plays pivotal and conserved roles in embryonic and adult hematopoiesis from teleosts to mammals. Our lab have previously identified a new truncated scl isoform, scl-beta, which is indispensible for the specification of HSCs in the ventral wall of dorsal aorta (VDA), the zebrafish equivalent of mammalian fetal hematopoietic organ. Here we observe that, by combining time-lapse confocal imaging of transgenic zebrafish and genetic epistasis analysis, scl-beta is expressed in a subset of ventral aortic endothelial cells and critical for their forthcoming transformation to hemogenic endothelium; in contrast, runx1 is required downstream to govern the successful egress of the hemogenic endothelial cells to become naive HSCs. In addition, the traditional known full-length scl-alpha isoform is firstly evidenced to be required for the maintenance or survival of newly formed HSCs in VDA. Collectively our data has established the genetic hierarchy controlling discrete steps in the consecutive process of HSC formation from endothelial cells and further development in VDA.

  17. Semi-automated detection of fractional shortening in zebrafish embryo heart videos

    Directory of Open Access Journals (Sweden)

    Nasrat Sara

    2016-09-01

    Full Text Available Quantifying cardiac functions in model organisms like embryonic zebrafish is of high importance in small molecule screens for new therapeutic compounds. One relevant cardiac parameter is the fractional shortening (FS. A method for semi-automatic quantification of FS in video recordings of zebrafish embryo hearts is presented. The software provides automated visual information about the end-systolic and end-diastolic stages of the heart by displaying corresponding colored lines into a Motion-mode display. After manually marking the ventricle diameters in frames of end-systolic and end-diastolic stages, the FS is calculated. The software was evaluated by comparing the results of the determination of FS with results obtained from another established method. Correlations of 0.96 < r < 0.99 between the two methods were found indicating that the new software provides comparable results for the determination of the FS.

  18. Self-organising aggregates of zebrafish retinal cells for investigating mechanisms of neural lamination.

    Science.gov (United States)

    Eldred, Megan K; Charlton-Perkins, Mark; Muresan, Leila; Harris, William A

    2017-03-15

    To investigate the cell-cell interactions necessary for the formation of retinal layers, we cultured dissociated zebrafish retinal progenitors in agarose microwells. Within these wells, the cells re-aggregated within hours, forming tight retinal organoids. Using a Spectrum of Fates zebrafish line, in which all different types of retinal neurons show distinct fluorescent spectra, we found that by 48 h in culture, the retinal organoids acquire a distinct spatial organisation, i.e. they became coarsely but clearly laminated. Retinal pigment epithelium cells were in the centre, photoreceptors and bipolar cells were next most central and amacrine cells and retinal ganglion cells were on the outside. Image analysis allowed us to derive quantitative measures of lamination, which we then used to find that Müller glia, but not RPE cells, are essential for this process. © 2017. Published by The Company of Biologists Ltd.

  19. Transgenic plants: from first successes to future applications.

    Science.gov (United States)

    Van Lijsebettens, Mieke; Angenon, Geert; De Block, Marc

    2013-01-01

    This dialogue was held between the Guest Editors of the Special Issue on "Plant Transgenesis" of the Int. J. Dev. Biol. and Marc De Block. He was one of the first scientists worldwide to obtain transgenic plants transformed with the chimeric selectable marker genes encoding neomycin phosphotransferase and bialaphos that confer resistance against the antibiotic kanamycin and the herbicide Basta®/glufosinate, respectively at the Department of Genetics of Ghent University and, later on, at the spin-off company, Plant Genetic Systems. Today, these two genes are still the most frequently utilized markers in transgene technology. Marc De Block chose to work on the improvement of crops in an industrial environment to help realize the production of superior seeds or products. He was part of the team that developed the male sterility/restorer system in canola (Brassica napus var. napus) that led to the first hybrid lines to be commercialized as successful products of transgene technology. In more than 30 years of research, he developed transformation procedures for numerous crops, designed histochemical, biochemical and physiological assays to monitor plant performance, and made original and innovative contributions to plant biology. Presently, he considers transgenic research part of the toolbox for plant improvement and essential for basic plant research.

  20. Mechanosensory organ regeneration in zebrafish depends on a population of multipotent progenitor cells kept latent by Schwann cells.

    Science.gov (United States)

    Sánchez, Mario; Ceci, Maria Laura; Gutiérrez, Daniela; Anguita-Salinas, Consuelo; Allende, Miguel L

    2016-04-07

    Regenerating damaged tissue is a complex process, requiring progenitor cells that must be stimulated to undergo proliferation, differentiation and, often, migratory behaviors and morphological changes. Multiple cell types, both resident within the damaged tissue and recruited to the lesion site, have been shown to participate. However, the cellular and molecular mechanisms involved in the activation of progenitor cell proliferation and differentiation after injury, and their regulation by different cells types, are not fully understood. The zebrafish lateral line is a suitable system to study regeneration because most of its components are fully restored after damage. The posterior lateral line (PLL) is a mechanosensory system that develops embryonically and is initially composed of seven to eight neuromasts distributed along the trunk and tail, connected by a continuous stripe of interneuromastic cells (INCs). The INCs remain in a quiescent state owing to the presence of underlying Schwann cells. They become activated during development to form intercalary neuromasts. However, no studies have described if INCs can participate in a regenerative event, for example, after the total loss of a neuromast. We used electroablation in transgenic larvae expressing fluorescent proteins in PLL components to completely ablate single neuromasts in larvae and adult fish. This injury results in discontinuity of the INCs, Schwann cells, and the PLL nerve. In vivo imaging showed that the INCs fill the gap left after the injury and can regenerate a new neuromast in the injury zone. Further, a single INC is able to divide and form all cell types in a regenerated neuromast and, during this process, it transiently expresses the sox2 gene, a neural progenitor cell marker. We demonstrate a critical role for Schwann cells as negative regulators of INC proliferation and neuromast regeneration, and that this inhibitory property is completely dependent on active ErbB signaling. The potential

  1. Generation of single-copy transgenic mouse embryos directly from ES cells by tetraploid embryo complementation

    Directory of Open Access Journals (Sweden)

    Zhao Roong

    2001-12-01

    Full Text Available Abstract Background Transgenic mice have been used extensively to analyze gene function. Unfortunately, traditional transgenic procedures have only limited use in analyzing alleles that cause lethality because lines of founder mice cannot be established. This is frustrating given that such alleles often reveal crucial aspects of gene function. For this reason techniques that facilitate the generation of embryos expressing such alleles would be of enormous benefit. Although the transient generation of transgenic embryos has allowed limited analysis of lethal alleles, it is expensive, time consuming and technically challenging. Moreover a fundamental limitation with this approach is that each embryo generated is unique and transgene expression is highly variable due to the integration of different transgene copy numbers at random genomic sites. Results Here we describe an alternative method that allows the generation of clonal mouse embryos harboring a single-copy transgene at a defined genomic location. This was facilitated through the production of Hprt negative embryonic stem cells that allow the derivation of embryos by tetraploid embryo complementation. We show that targeting transgenes to the hprt locus in these ES cells by homologous recombination can be efficiently selected by growth in HAT medium. Moreover, embryos derived solely from targeted ES cells containing a single copy LacZ transgene under the control of the α-myosin heavy chain promoter exhibited the expected cardiac specific expression pattern. Conclusion Our results demonstrate that tetraploid embryo complementation by F3 hprt negative ES cells facilitates the generation of transgenic mouse embryos containing a single copy gene at a defined genomic locus. This approach is simple, extremely efficient and bypasses any requirement to generate chimeric mice. Moreover embryos generated by this procedure are clonal in that they are all derived from a single ES cell lines. This

  2. Biotechnology network promotes knowledge of transgenics

    International Nuclear Information System (INIS)

    Blanco Picado, Patricia; Valdez Melara, Marta

    2015-01-01

    Red de Ingenieria Genetica Aplicada al Mejoramiento de Cultivos Tropicales (Rigatrop) integrated by a group of scientists from the Universidad de Costa Rica (UCR), Universidad Nacional (UNA) and of the Instituto Tecnologico de Costa Rica (TEC) have organized two forums on the topic of transgenics. The first forum has shown successful experiences of development of transgenic crops in Latin America, as for example: the transgenic bean, project realized in Brazil and transgenic eggplant in Bangladesh. The second forum has been about transgenics and environment effected at the UCR, on the occasion of World Environment Day. Rigatrop members are working currently in two projects applying biotechnological tools to coffee [es

  3. Zebrafish in Toxicology and Environmental Health.

    Science.gov (United States)

    Bambino, Kathryn; Chu, Jaime

    2017-01-01

    As manufacturing processes and development of new synthetic compounds increase to keep pace with the expanding global demand, environmental health, and the effects of toxicant exposure are emerging as critical public health concerns. Additionally, chemicals that naturally occur in the environment, such as metals, have profound effects on human and animal health. Many of these compounds are in the news: lead, arsenic, and endocrine disruptors such as bisphenol A have all been widely publicized as causing disease or damage to humans and wildlife in recent years. Despite the widespread appreciation that environmental toxins can be harmful, there is limited understanding of how many toxins cause disease. Zebrafish are at the forefront of toxicology research; this system has been widely used as a tool to detect toxins in water samples and to investigate the mechanisms of action of environmental toxins and their related diseases. The benefits of zebrafish for studying vertebrate development are equally useful for studying teratogens. Here, we review how zebrafish are being used both to detect the presence of some toxins as well as to identify how environmental exposures affect human health and disease. We focus on areas where zebrafish have been most effectively used in ecotoxicology and in environmental health, including investigation of exposures to endocrine disruptors, industrial waste byproducts, and arsenic. © 2017 Elsevier Inc. All rights reserved.

  4. Visualizing infections and immune mechanisms in zebrafish

    DEFF Research Database (Denmark)

    Jørgensen, Louise von Gersdorff; Korbut, Rozalia; Mehrdana, Foojan

    , immunological reactions during e.g. transplant rejections or the spread and pathogenicity of pathogens. We have, in our laboratory, used the zebrafish as a model for aquacultured fish species and their pathogens. We have 1) visualized antigen uptake in vivo following a bath in a soup containing fluorescent...

  5. Highly Efficient ENU Mutagenesis in Zebrafish.

    NARCIS (Netherlands)

    de Bruijn, E.; Cuppen, E.; Feitsma, H.

    2009-01-01

    ENU (N-ethyl-N-nitrosourea) mutagenesis is a widely accepted and proven method to introduce random point mutations in the genome. Because there are no targeted knockout strategies available for zebrafish so far, random mutagenesis is currently the preferred method in both forward and reverse genetic

  6. Molecular genetics of pituitary development in zebrafish.

    Science.gov (United States)

    Pogoda, Hans-Martin; Hammerschmidt, Matthias

    2007-08-01

    The pituitary gland of vertebrates consists of two major parts, the neurohypophysis (NH) and the adenohypophysis (AH). As a central part of the hypothalamo-hypophyseal system (HHS), it constitutes a functional link between the nervous and the endocrine system to regulate basic body functions, such as growth, metabolism and reproduction. The development of the AH has been intensively studied in mouse, serving as a model for organogenesis and differential cell specification. However, given that the AH is a relatively recent evolutionary advance of the chordate phylum, it is also interesting to understand its development in lower chordate systems. In recent years, the zebrafish has emerged as a powerful lower vertebrate system for developmental studies, being amenable for large-scale genetic approaches, embryological manipulations, and in vivo imaging. Here, we present an overview of current knowledge of the mechanisms and genetic control of pituitary formation during zebrafish development. First, we describe the components of the zebrafish HHS, and the different pituitary cell types and hormones, followed by a description of the different steps of normal pituitary development. The central part of the review deals with the genes found to be essential for zebrafish AH development, accompanied by a description of the corresponding mutant phenotypes. Finally, we discuss future directions, with particular focus on evolutionary aspects, and some novel functional aspects with growing medical and social relevance.

  7. A zebrafish model of inflammatory lymphangiogenesis

    Directory of Open Access Journals (Sweden)

    Kazuhide S. Okuda

    2015-10-01

    Full Text Available Inflammatory bowel disease (IBD is a disabling chronic inflammatory disease of the gastrointestinal tract. IBD patients have increased intestinal lymphatic vessel density and recent studies have shown that this may contribute to the resolution of IBD. However, the molecular mechanisms involved in IBD-associated lymphangiogenesis are still unclear. In this study, we established a novel inflammatory lymphangiogenesis model in zebrafish larvae involving colitogenic challenge stimulated by exposure to 2,4,6-trinitrobenzenesulfonic acid (TNBS or dextran sodium sulphate (DSS. Treatment with either TNBS or DSS resulted in vascular endothelial growth factor receptor (Vegfr-dependent lymphangiogenesis in the zebrafish intestine. Reduction of intestinal inflammation by the administration of the IBD therapeutic, 5-aminosalicylic acid, reduced intestinal lymphatic expansion. Zebrafish macrophages express vascular growth factors vegfaa, vegfc and vegfd and chemical ablation of these cells inhibits intestinal lymphatic expansion, suggesting that the recruitment of macrophages to the intestine upon colitogenic challenge is required for intestinal inflammatory lymphangiogenesis. Importantly, this study highlights the potential of zebrafish as an inflammatory lymphangiogenesis model that can be used to investigate the role and mechanism of lymphangiogenesis in inflammatory diseases such as IBD.

  8. Axonal regeneration in zebrafish spinal cord

    Science.gov (United States)

    Hui, Subhra Prakash

    2018-01-01

    Abstract In the present review we discuss two interrelated events—axonal damage and repair—known to occur after spinal cord injury (SCI) in the zebrafish. Adult zebrafish are capable of regenerating axonal tracts and can restore full functionality after SCI. Unlike fish, axon regeneration in the adult mammalian central nervous system is extremely limited. As a consequence of an injury there is very little repair of disengaged axons and therefore functional deficit persists after SCI in adult mammals. In contrast, peripheral nervous system axons readily regenerate following injury and hence allow functional recovery both in mammals and fish. A better mechanistic understanding of these three scenarios could provide a more comprehensive insight into the success or failure of axonal regeneration after SCI. This review summarizes the present understanding of the cellular and molecular basis of axonal regeneration, in both the peripheral nervous system and the central nervous system, and large scale gene expression analysis is used to focus on different events during regeneration. The discovery and identification of genes involved in zebrafish spinal cord regeneration and subsequent functional experimentation will provide more insight into the endogenous mechanism of myelination and remyelination. Furthermore, precise knowledge of the mechanism underlying the extraordinary axonal regeneration process in zebrafish will also allow us to unravel the potential therapeutic strategies to be implemented for enhancing regrowth and remyelination of axons in mammals. PMID:29721326

  9. Patterns of free calcium in zebrafish embryos

    NARCIS (Netherlands)

    Creton, R; Speksnijder, JE; Jaffe, LF

    Direct knowledge of Ca2+ patterns in vertebrate development is largely restricted to early stages, in which they control fertilization, ooplasmic segregation and cleavage. To explore new roles of Ca2+ in vertebrate development, we injected the Ca2+ indicator aequorin into zebrafish eggs and imaged

  10. Effects of alpha particles on zebrafish embryos

    International Nuclear Information System (INIS)

    Yum, E.H.W.; Choi, V.W.Y.; Yu, K.N.; Li, V.W.T.; Cheng, S.H.

    2008-01-01

    Full text: Ionizing radiation such as X-ray and alpha particles can damage cellular macromolecules, which can lead to DNA single- and double-strand breaks. In the present work, we studied the effects of alpha particles on dechorionated zebrafish embryos. Thin polyallyldiglycol carbonate (PADC) films with a thickness of 16 μm were prepared from commercially available PADC films (with thickness of 100 μm) by chemical etching and used as support substrates for holding zebrafish embryos for alpha-particle irradiation. These films recorded alpha-particle hit positions, quantified the number and energy of alpha particles actually incident on the embryo cells, and thus enabled the calculation of the dose absorbed by the embryo cells. Irradiation was made at 1.25 hours post fertilization (hpf) with various absorbed dose. TdT-mediated dUTP Nick-End Labeling (TUNEL) assay was performed on the embryos at different time stages after irradiation. Marked apoptosis was detected only in embryos at earlier time stages. The results showed that DNA double-strand break during zebrafish embryogenesis can be induced by alpha-particle irradiation, which suggests that zebrafish is a potential model for assessing the effects of alpha-particle radiation

  11. Defects of the Glycinergic Synapse in Zebrafish

    Science.gov (United States)

    Ogino, Kazutoyo; Hirata, Hiromi

    2016-01-01

    Glycine mediates fast inhibitory synaptic transmission. Physiological importance of the glycinergic synapse is well established in the brainstem and the spinal cord. In humans, the loss of glycinergic function in the spinal cord and brainstem leads to hyperekplexia, which is characterized by an excess startle reflex to sudden acoustic or tactile stimulation. In addition, glycinergic synapses in this region are also involved in the regulation of respiration and locomotion, and in the nociceptive processing. The importance of the glycinergic synapse is conserved across vertebrate species. A teleost fish, the zebrafish, offers several advantages as a vertebrate model for research of glycinergic synapse. Mutagenesis screens in zebrafish have isolated two motor defective mutants that have pathogenic mutations in glycinergic synaptic transmission: bandoneon (beo) and shocked (sho). Beo mutants have a loss-of-function mutation of glycine receptor (GlyR) β-subunit b, alternatively, sho mutant is a glycinergic transporter 1 (GlyT1) defective mutant. These mutants are useful animal models for understanding of glycinergic synaptic transmission and for identification of novel therapeutic agents for human diseases arising from defect in glycinergic transmission, such as hyperekplexia or glycine encephalopathy. Recent advances in techniques for genome editing and for imaging and manipulating of a molecule or a physiological process make zebrafish more attractive model. In this review, we describe the glycinergic defective zebrafish mutants and the technical advances in both forward and reverse genetic approaches as well as in vivo visualization and manipulation approaches for the study of the glycinergic synapse in zebrafish. PMID:27445686

  12. Morphological and Physiological Interactions Between GnRH3 and Hypocretin/Orexin Neuronal Systems in Zebrafish (Danio rerio).

    Science.gov (United States)

    Zhao, Yali; Singh, Chanpreet; Prober, David A; Wayne, Nancy L

    2016-10-01

    GnRH neurons integrate internal and external cues to control sexual maturation and fertility. Homeostasis of energy balance and food intake correlates strongly with the status of reproduction. Neuropeptides secreted by the hypothalamus involved in modulating energy balance and feeding may play additional roles in the regulation of reproduction. Hypocretin (Hcrt) (also known as orexin) is one such peptide, primarily controlling sleep/wakefulness, food intake, and reward processing. There is a growing body of evidence indicating that Hcrt/orexin (Hcrt) modulates reproduction through interacting with the hypothalamo-pituitary-gonadal axis in mammals. To explore potential morphological and functional interactions between the GnRH and Hcrt neuronal systems, we employed a variety of experimental approaches including confocal imaging, immunohistochemistry, and electrophysiology in transgenic zebrafish, in which fluorescent proteins are genetically expressed in GnRH3 and Hcrt neurons. Our imaging data revealed close apposition and direct connection between GnRH3 and Hcrt neuronal systems in the hypothalamus during larval development through adulthood. Furthermore, the Hcrt receptor (HcrtR) is expressed in GnRH3 neurons. Electrophysiological data revealed a reversible inhibitory effect of Hcrt on GnRH3 neuron electrical activity, which was blocked by the HcrtR antagonist almorexant. In addition, Hcrt had no effect on the electrical activity of GnRH3 neurons in the HcrtR null mutant zebrafish (HcrtR -/- ). Our findings demonstrate a close anatomical and functional relationship between Hcrt and GnRH neuronal systems in zebrafish. It is the first demonstration of a link between neuronal circuits controlling sleeping/arousal/feeding and reproduction in zebrafish, an important animal model for investigating the molecular genetics of development.

  13. Adult zebrafish intestine resection: a novel model of short bowel syndrome, adaptation, and intestinal stem cell regeneration.

    Science.gov (United States)

    Schall, K A; Holoyda, K A; Grant, C N; Levin, D E; Torres, E R; Maxwell, A; Pollack, H A; Moats, R A; Frey, M R; Darehzereshki, A; Al Alam, D; Lien, C; Grikscheit, T C

    2015-08-01

    Loss of significant intestinal length from congenital anomaly or disease may lead to short bowel syndrome (SBS); intestinal failure may be partially offset by a gain in epithelial surface area, termed adaptation. Current in vivo models of SBS are costly and technically challenging. Operative times and survival rates have slowed extension to transgenic models. We created a new reproducible in vivo model of SBS in zebrafish, a tractable vertebrate model, to facilitate investigation of the mechanisms of intestinal adaptation. Proximal intestinal diversion at segment 1 (S1, equivalent to jejunum) was performed in adult male zebrafish. SBS fish emptied distal intestinal contents via stoma as in the human disease. After 2 wk, S1 was dilated compared with controls and villus ridges had increased complexity, contributing to greater villus epithelial perimeter. The number of intervillus pockets, the intestinal stem cell zone of the zebrafish increased and contained a higher number of bromodeoxyuridine (BrdU)-labeled cells after 2 wk of SBS. Egf receptor and a subset of its ligands, also drivers of adaptation, were upregulated in SBS fish. Igf has been reported as a driver of intestinal adaptation in other animal models, and SBS fish exposed to a pharmacological inhibitor of the Igf receptor failed to demonstrate signs of intestinal adaptation, such as increased inner epithelial perimeter and BrdU incorporation. We describe a technically feasible model of human SBS in the zebrafish, a faster and less expensive tool to investigate intestinal stem cell plasticity as well as the mechanisms that drive intestinal adaptation. Copyright © 2015 the American Physiological Society.

  14. Transgenic Epigenetics: Using Transgenic Organisms to Examine Epigenetic Phenomena

    Directory of Open Access Journals (Sweden)

    Lori A. McEachern

    2012-01-01

    Full Text Available Non-model organisms are generally more difficult and/or time consuming to work with than model organisms. In addition, epigenetic analysis of model organisms is facilitated by well-established protocols, and commercially-available reagents and kits that may not be available for, or previously tested on, non-model organisms. Given the evolutionary conservation and widespread nature of many epigenetic mechanisms, a powerful method to analyze epigenetic phenomena from non-model organisms would be to use transgenic model organisms containing an epigenetic region of interest from the non-model. Interestingly, while transgenic Drosophila and mice have provided significant insight into the molecular mechanisms and evolutionary conservation of the epigenetic processes that target epigenetic control regions in other model organisms, this method has so far been under-exploited for non-model organism epigenetic analysis. This paper details several experiments that have examined the epigenetic processes of genomic imprinting and paramutation, by transferring an epigenetic control region from one model organism to another. These cross-species experiments demonstrate that valuable insight into both the molecular mechanisms and evolutionary conservation of epigenetic processes may be obtained via transgenic experiments, which can then be used to guide further investigations and experiments in the species of interest.

  15. Detection of vitellogenin incorporation into zebrafish oocytes by FITC fluorescence

    Directory of Open Access Journals (Sweden)

    Yokoi Hayato

    2011-04-01

    Full Text Available Abstract Background Large volumes of lymph can be collected from the eye-sacs of bubble-eye goldfish. We attempted to induce vitellogenin (Vtg in the eye-sac lymph of bubble-eye goldfish and develop a method for visualizing Vtg incorporation by zebrafish oocytes using FITC-labeling. Methods Estrogen efficiently induced Vtg in the eye-sac lymph of goldfish. After FITC-labeled Vtg was prepared, it was injected into mature female zebrafish. Results Incorporation of FITC-labeled Vtg by zebrafish oocytes was detected in in vivo and in vitro experiments. The embryos obtained from zebrafish females injected with FITC-labeled Vtg emitted FITC fluorescence from the yolk sac and developed normally. Conclusion This method for achieving Vtg incorporation by zebrafish oocytes could be useful in experiments related to the development and endocrinology of zebrafish oocytes.

  16. Analysis of Lethality and Malformations During Zebrafish (Danio rerio) Development.

    Science.gov (United States)

    Raghunath, Azhwar; Perumal, Ekambaram

    2018-01-01

    The versatility offered by zebrafish (Danio rerio) makes it a powerful and an attractive vertebrate model in developmental toxicity and teratogenicity assays. Apart from the newly introduced chemicals as drugs, xenobiotics also induce abnormal developmental abnormalities and congenital malformations in living organisms. Over the recent decades, zebrafish embryo/larva has emerged as a potential tool to test teratogenicity potential of these chemicals. Zebrafish responds to compounds as mammals do as they share similarities in their development, metabolism, physiology, and signaling pathways with that of mammals. The methodology used by the different scientists varies enormously in the zebrafish embryotoxicity test. In this chapter, we present methods to assess lethality and malformations during zebrafish development. We propose two major malformations scoring systems: binomial and relative morphological scoring systems to assess the malformations in zebrafish embryos/larvae. Based on the scoring of the malformations, the test compound can be classified as a teratogen or a nonteratogen and its teratogenic potential is evaluated.

  17. Laser capture microdissection of gonads from juvenile zebrafish

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Nielsen, John; Morthorst, Jane Ebsen

    2009-01-01

    was adjusted and optimised to isolate juvenile zebrafish gonads. Results: The juvenile zebrafish gonad is not morphologically distinguishable when using dehydrated cryosections on membrane slides and a specific staining method is necessary to identify the gonads. The protocol setup in this study allows......Background: Investigating gonadal gene expression is important in attempting to elucidate the molecular mechanism of sex determination and differentiation in the model species zebrafish. However, the small size of juvenile zebrafish and correspondingly their gonads complicates this type...... of investigation. Furthermore, the lack of a genetic sex marker in juvenile zebrafish prevents pooling gonads from several individuals. The aim of this study was to establish a method to isolate the gonads from individual juvenile zebrafish allowing future investigations of gonadal gene expression during sex...

  18. Enhanced virus resistance in transgenic maize expressing a dsRNA-specific endoribonuclease gene from E. coli.

    Directory of Open Access Journals (Sweden)

    Xiuling Cao

    Full Text Available Maize rough dwarf disease (MRDD, caused by several Fijiviruses in the family Reoviridae, is a global disease that is responsible for substantial yield losses in maize. Although some maize germplasm have low levels of polygenic resistance to MRDD, highly resistant cultivated varieties are not available for agronomic field production in China. In this work, we have generated transgenic maize lines that constitutively express rnc70, a mutant E. coli dsRNA-specific endoribonuclease gene. Transgenic lines were propagated and screened under field conditions for 12 generations. During three years of evaluations, two transgenic lines and their progeny were challenged with Rice black-streaked dwarf virus (RBSDV, the causal agent of MRDD in China, and these plants exhibited reduced levels of disease severity. In two normal years of MRDD abundance, both lines were more resistant than non-transgenic plants. Even in the most serious MRDD year, six out of seven progeny from one line were resistant, whereas non-transgenic plants were highly susceptible. Molecular approaches in the T12 generation revealed that the rnc70 transgene was integrated and expressed stably in transgenic lines. Under artificial conditions permitting heavy virus inoculation, the T12 progeny of two highly resistant lines had a reduced incidence of MRDD and accumulation of RBSDV in infected plants. In addition, we confirmed that the RNC70 protein could bind directly to RBSDV dsRNA in vitro. Overall, our data show that RNC70-mediated resistance in transgenic maize can provide efficient protection against dsRNA virus infection.

  19. Nucleocapsid Gene-Mediated Transgenic Resistance Provides Protection Against Tomato spotted wilt virus Epidemics in the Field.

    Science.gov (United States)

    Herrero, S; Culbreath, A K; Csinos, A S; Pappu, H R; Rufty, R C; Daub, M E

    2000-02-01

    ABSTRACT Transformation of plants with the nucleocapsid (N) gene of Tomato spotted wilt tospovirus (TSWV) provides resistance to disease development; however, information is lacking on the response of plants to natural inoculum in the field. Three tobacco cultivars were transformed with the N gene of a dahlia isolate of TSWV (TSWV-D), and plants were evaluated over several generations in the greenhouse. The resistant phenotype was more frequently observed in 'Burley 21' than in 'KY-14' or 'K-326', but highly resistant 'Burley 21' transgenic lines were resistant to only 44% of the heterologous TSWV isolates tested. Advanced generation (R(3) and R(4)) transgenic resistant lines of 'Burley 21' and a 'K-326' F(1) hybrid containing the N genes of two TSWV isolates were evaluated in the field near Tifton, GA, where TSWV is endemic. Disease development was monitored by symptom expression and enzyme-linked immunosorbent assay (ELISA) analysis. Whereas incidence of TSWV infection in 'Burley 21' susceptible controls was 20% in 1996 and 62% in 1997, the mean incidence in transgenic lines was reduced to 4 and 31%, respectively. Three transgenic 'Burley 21' lines were identified that had significantly lower incidence of disease than susceptible controls over the two years of the study. In addition, the rate of disease increase at the onset of the 1997 epidemic was reduced for all the 'Burley 21' transgenic lines compared with the susceptible controls. The 'K-326' F(1) hybrid was as susceptible as the 'K-326' nontransformed control. ELISA analysis demonstrated that symptomless plants from the most resistant 'Burley 21' transgenic lines accumulated detectable nucleocapsid protein, whereas symptomless plants from more susceptible lines did not. We conclude that transgenic resistance to TSWV is effective in reducing incidence of the disease in the field, and that accumulation of transgene protein may be important in broad-spectrum resistance.

  20. Modified expression of alternative oxidase in transgenic tomato and petunia affects the level of tomato spotted wilt virus resistance.

    Science.gov (United States)

    Ma, Hao; Song, Congfeng; Borth, Wayne; Sether, Diane; Melzer, Michael; Hu, John

    2011-10-20

    Tomato spotted wilt virus (TSWV) has a very wide host range, and is transmitted in a persistent manner by several species of thrips. These characteristics make this virus difficult to control. We show here that the over-expression of the mitochondrial alternative oxidase (AOX) in tomato and petunia is related to TSWV resistance. The open reading frame and full-length sequence of the tomato AOX gene LeAox1au were cloned and introduced into tomato 'Healani' and petunia 'Sheer Madness' using Agrobacterium-mediated transformation. Highly expressed AOX transgenic tomato and petunia plants were selfed and transgenic R1 seedlings from 10 tomato lines and 12 petunia lines were used for bioassay. For each assayed line, 22 to 32 tomato R1 progeny in three replications and 39 to 128 petunia progeny in 13 replications were challenged with TSWV. Enzyme-Linked Immunosorbent Assays showed that the TSWV levels in transgenic tomato line FKT4-1 was significantly lower than that of wild-type controls after challenge with TSWV. In addition, transgenic petunia line FKP10 showed significantly less lesion number and smaller lesion size than non-transgenic controls after inoculation by TSWV. In all assayed transgenic tomato lines, a higher percentage of transgenic progeny had lower TSWV levels than non-transgenic plants after challenge with TSWV, and the significantly increased resistant levels of tomato and petunia lines identified in this study indicate that altered expression levels of AOX in tomato and petunia can affect the levels of TSWV resistance.

  1. Modified expression of alternative oxidase in transgenic tomato and petunia affects the level of tomato spotted wilt virus resistance

    Directory of Open Access Journals (Sweden)

    Ma Hao

    2011-10-01

    Full Text Available Abstract Background Tomato spotted wilt virus (TSWV has a very wide host range, and is transmitted in a persistent manner by several species of thrips. These characteristics make this virus difficult to control. We show here that the over-expression of the mitochondrial alternative oxidase (AOX in tomato and petunia is related to TSWV resistance. Results The open reading frame and full-length sequence of the tomato AOX gene LeAox1au were cloned and introduced into tomato 'Healani' and petunia 'Sheer Madness' using Agrobacterium-mediated transformation. Highly expressed AOX transgenic tomato and petunia plants were selfed and transgenic R1 seedlings from 10 tomato lines and 12 petunia lines were used for bioassay. For each assayed line, 22 to 32 tomato R1 progeny in three replications and 39 to 128 petunia progeny in 13 replications were challenged with TSWV. Enzyme-Linked Immunosorbent Assays showed that the TSWV levels in transgenic tomato line FKT4-1 was significantly lower than that of wild-type controls after challenge with TSWV. In addition, transgenic petunia line FKP10 showed significantly less lesion number and smaller lesion size than non-transgenic controls after inoculation by TSWV. Conclusion In all assayed transgenic tomato lines, a higher percentage of transgenic progeny had lower TSWV levels than non-transgenic plants after challenge with TSWV, and the significantly increased resistant levels of tomato and petunia lines identified in this study indicate that altered expression levels of AOX in tomato and petunia can affect the levels of TSWV resistance.

  2. Effective generation of transgenic pigs and mice by linker based sperm-mediated gene transfer.

    Directory of Open Access Journals (Sweden)

    Shih Ping Yao

    2002-04-01

    Full Text Available Abstract Background Transgenic animals have become valuable tools for both research and applied purposes. The current method of gene transfer, microinjection, which is widely used in transgenic mouse production, has only had limited success in producing transgenic animals of larger or higher species. Here, we report a linker based sperm-mediated gene transfer method (LB-SMGT that greatly improves the production efficiency of large transgenic animals. Results The linker protein, a monoclonal antibody (mAb C, is reactive to a surface antigen on sperm of all tested species including pig, mouse, chicken, cow, goat, sheep, and human. mAb C is a basic protein that binds to DNA through ionic interaction allowing exogenous DNA to be linked specifically to sperm. After fertilization of the egg, the DNA is shown to be successfully integrated into the genome of viable pig and mouse offspring with germ-line transfer to the F1 generation at a highly efficient rate: 37.5% of pigs and 33% of mice. The integration is demonstrated again by FISH analysis and F2 transmission in pigs. Furthermore, expression of the transgene is demonstrated in 61% (35/57 of transgenic pigs (F0 generation. Conclusions Our data suggests that LB-SMGT could be used to generate transgenic animals efficiently in many different species.

  3. Transgenic Arabidopsis Gene Expression System

    Science.gov (United States)

    Ferl, Robert; Paul, Anna-Lisa

    2009-01-01

    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  4. Tie-1-directed expression of Cre recombinase in endothelial cells of embryoid bodies and transgenic mice

    DEFF Research Database (Denmark)

    Gustafsson, E; Brakebusch, C; Hietanen, K

    2001-01-01

    Tissue-specific gene inactivation using the Cre-loxP system has become an important tool to unravel functions of genes when the conventional null mutation is lethal. We report here the generation of a transgenic mouse line expressing Cre recombinase in endothelial cells. In order to avoid...... the production and screening of multiple transgenic lines we used embryonic stem cell and embryoid body technology to identify recombinant embryonic stem cell clones with high, endothelial-specific Cre activity. One embryonic stem cell clone that showed high Cre activity in endothelial cells was used to generate...... germline chimeras. The in vivo efficiency and specificity of the transgenic Cre was analysed by intercrossing the tie-1-Cre line with the ROSA26R reporter mice. At initial stages of vascular formation (E8-9), LacZ staining was detected in almost all cells of the forming vasculature. Between E10 and birth...

  5. Overexpression of Akt1 enhances adipogenesis and leads to lipoma formation in zebrafish.

    Directory of Open Access Journals (Sweden)

    Che-Yu Chu

    Full Text Available BACKGROUND: Obesity is a complex, multifactorial disorder influenced by the interaction of genetic, epigenetic, and environmental factors. Obesity increases the risk of contracting many chronic diseases or metabolic syndrome. Researchers have established several mammalian models of obesity to study its underlying mechanism. However, a lower vertebrate model for conveniently performing drug screening against obesity remains elusive. The specific aim of this study was to create a zebrafish obesity model by over expressing the insulin signaling hub of the Akt1 gene. METHODOLOGY/PRINCIPAL FINDINGS: Skin oncogenic transformation screening shows that a stable zebrafish transgenic of Tg(krt4Hsa.myrAkt1(cy18 displays severely obese phenotypes at the adult stage. In Tg(krt4:Hsa.myrAkt1(cy18, the expression of exogenous human constitutively active Akt1 (myrAkt1 can activate endogenous downstream targets of mTOR, GSK-3α/β, and 70S6K. During the embryonic to larval transitory phase, the specific over expression of myrAkt1 in skin can promote hypertrophic and hyperplastic growth. From 21 hour post-fertilization (hpf onwards, myrAkt1 transgene was ectopically expressed in several mesenchymal derived tissues. This may be the result of the integration position effect. Tg(krt4:Hsa.myrAkt1(cy18 caused a rapid increase of body weight, hyperplastic growth of adipocytes, abnormal accumulation of fat tissues, and blood glucose intolerance at the adult stage. Real-time RT-PCR analysis showed the majority of key genes on regulating adipogenesis, adipocytokine, and inflammation are highly upregulated in Tg(krt4:Hsa.myrAkt1(cy18. In contrast, the myogenesis- and skeletogenesis-related gene transcripts are significantly downregulated in Tg(krt4:Hsa.myrAkt1(cy18, suggesting that excess adipocyte differentiation occurs at the expense of other mesenchymal derived tissues. CONCLUSION/SIGNIFICANCE: Collectively, the findings of this study provide direct evidence that Akt1

  6. Phytoremediation of the organic Xenobiotic simazine by p450-1a2 transgenic Arabidopsis thaliana plants.

    Science.gov (United States)

    Azab, Ehab; Hegazy, Ahmad K; El-Sharnouby, Mohamed E; Abd Elsalam, Hassan E

    2016-01-01

    The potential use of human P450-transgenic plants for phytoremediation of pesticide contaminated soils was tested in laboratory and greenhouse experiments. The transgenic P450 CYP1A2 gene Arabidopsis thaliana plants metabolize number of herbicides, insecticides and industrial chemicals. The P450 isozymes CYP1A2 expressed in A. thaliana were examined regarding the herbicide simazine (SIM). Transgenic A. thaliana plants expressing CYP1A2 gene showed significant resistance to SIM supplemented either in plant growth medium or sprayed on foliar parts. The results showed that SIM produces harmful effect on both rosette diameter and primary root length of the wild type (WT) plants. In transgenic A. thaliana lines, the rosette diameter and primary root length were not affected by SIM concentrations used in this experiment. The results indicate that CYP1A2 can be used as a selectable marker for plant transformation, allowing efficient selection of transgenic lines in growth medium and/or in soil-grown plants. The transgenic A. thaliana plants exhibited a healthy growth using doses of up to 250 μmol SIM treatments, while the non-transgenic A. thaliana plants were severely damaged with doses above 50 μmol SIM treatments. The transgenic A. thaliana plants can be used as phytoremediator of environmental SIM contaminants.

  7. Dynamic nucleosome organization at hox promoters during zebrafish embryogenesis.

    Directory of Open Access Journals (Sweden)

    Steven E Weicksel

    Full Text Available Nucleosome organization at promoter regions plays an important role in regulating gene activity. Genome-wide studies in yeast, flies, worms, mammalian embryonic stem cells and transformed cell lines have found well-positioned nucleosomes flanking a nucleosome depleted region (NDR at transcription start sites. This nucleosome arrangement depends on DNA sequence (cis-elements as well as DNA binding factors and ATP-dependent chromatin modifiers (trans-factors. However, little is understood about how the nascent embryonic genome positions nucleosomes during development. This is particularly intriguing since the embryonic genome must undergo a broad reprogramming event upon fusion of sperm and oocyte. Using four stages of early embryonic zebrafish development, we map nucleosome positions at the promoter region of 37 zebrafish hox genes. We find that nucleosome arrangement at the hox promoters is a progressive process that takes place over several stages. At stages immediately after fertilization, nucleosomes appear to be largely disordered at hox promoter regions. At stages after activation of the embryonic genome, nucleosomes are detectable at hox promoters, with positions becoming more uniform and more highly occupied. Since the genomic sequence is invariant during embryogenesis, this progressive change in nucleosome arrangement suggests that trans-factors play an important role in organizing nucleosomes during embryogenesis. Separating hox genes into expressed and non-expressed groups shows that expressed promoters have better positioned and occupied nucleosomes, as well as distinct NDRs, than non-expressed promoters. Finally, by blocking the retinoic acid-signaling pathway, we disrupt early hox gene transcription, but observe no effect on nucleosome positions, suggesting that active hox transcription is not a driving force behind the arrangement of nucleosomes at the promoters of hox genes during early development.

  8. Selectivity of natural, synthetic and environmental estrogens for zebrafish estrogen receptors

    Energy Technology Data Exchange (ETDEWEB)

    Pinto, Caroline [Center for Nuclear Receptors and Cell Signaling, Department of Biology and Biochemistry, University of Houston, Houston, TX 77204-5056 (United States); Grimaldi, Marina; Boulahtouf, Abdelhay [Institut de Recherche en Cancérologie de Montpellier, Institut National de la Santé de la Recherche Médicale U896, Institut Régional de Cancérologie de Montpellier, Université Montpellier 1, 34298 Montpellier (France); Pakdel, Farzad [Institut de Recherche sur la Santé, Environnement et Travail (IRSET), INSERM U1085, Université de Rennes 1, Rennes (France); Brion, François; Aït-Aïssa, Sélim [Unité Écotoxicologie In Vitro et In Vivo, INERIS, Parc ALATA, 60550 Verneuil-en-Halatte (France); Cavaillès, Vincent [Institut de Recherche en Cancérologie de Montpellier, Institut National de la Santé de la Recherche Médicale U896, Institut Régional de Cancérologie de Montpellier, Université Montpellier 1, 34298 Montpellier (France); Bourguet, William [U1054, Centre de Biochimie Structurale, CNRS UMR5048, Université Montpellier 1 et 2, 34290 Montpellier (France); Gustafsson, Jan-Ake [Center for Nuclear Receptors and Cell Signaling, Department of Biology and Biochemistry, University of Houston, Houston, TX 77204-5056 (United States); Department of Biosciences and Nutrition, Karolinska Institutet, 14183 Huddinge (Sweden); and others

    2014-10-01

    Zebrafish, Danio rerio, is increasingly used as an animal model to study the effects of pharmaceuticals and environmental estrogens. As most of these estrogens have only been tested on human estrogen receptors (ERs), it is necessary to measure their effects on zebrafish ERs. In humans there are two distinct nuclear ERs (hERα and hERβ), whereas the zebrafish genome encodes three ERs, zfERα and two zfERβs (zfERβ1 and zfERβ2). In this study, we established HeLa-based reporter cell lines stably expressing each of the three zfERs. We first reported that estrogens more efficiently activate the zfERs at 28 °C as compared to 37 °C, thus reflecting the physiological temperature of zebrafish in wildlife. We then showed significant differences in the ability of agonist and antagonist estrogens to modulate activation of the three zfER isotypes in comparison to hERs. Environmental compounds (bisphenol A, alkylphenols, mycoestrogens) which are hER panagonists and hERβ selective agonists displayed greater potency for zfERα as compared to zfERβs. Among hERα selective synthetic agonists, PPT did not activate zfERα while 16α-LE2 was the most zfERα selective compound. Altogether, these results confirm that all hER ligands control in a similar manner the transcriptional activity of zfERs although significant differences in selectivity were observed among subtypes. The zfER subtype selective ligands that we identified thus represent new valuable tools to dissect the physiological roles of the different zfERs. Finally, our work also points out that care has to be taken in transposing the results obtained using the zebrafish as a model for human physiopathology. - Highlights: • Zebrafish is increasingly used to study the effects of estrogens. • We assessed the activity of pharmaceutical and environmental estrogens on zfERs. • Environmental estrogens displayed greater potency for zfERα compared to zfERβs. • hERβ selective agonists displayed greater potency for zf

  9. Combination of Trichoderma harzianum endochitinase and a membrane-affecting fungicide on control of Alternaria leaf spot in transgenic broccoli plants.

    Science.gov (United States)

    Mora, A; Earle, E D

    2001-04-01

    Progeny from transgenic broccoli (cv. Green Comet) expressing a Trichoderma harzianum endochitinase gene were used to assess the interaction between endochitinase and the fungicide Bayleton in the control of Alternaria brassicicola. In vitro assays have shown synergistic effects of endochitinase and fungicides on fungal pathogens. Our study examined the in planta effects of endochitinase and Bayleton, individually and in combination. Two month old transgenic and non-transgenic plants were sprayed with ED50 levels of Bayleton and/or inoculated with an A. brassicicola spore suspension. Disease levels in non-sprayed transgenic plants were not statistically different from sprayed transgenic plants nor from sprayed non-transgenic controls. Thus endochitinase-transgenic plants alone provided a significant reduction of disease severity, comparable to the protection by fungicide on non-transgenic plants. Comparison of the expected additive and observed effects revealed no synergism between endochitinase and Bayleton (at ED50 level), and usually less than an additive effect. Some transgenic lines sprayed with fungicide at doses higher than ED50 showed resistance similar to the non-sprayed transgenic lines, again suggesting no synergistic effect. Lack of synergism may be due to incomplete digestion of the cell wall by endochitinase, so that the effect of Bayleton at the cell membrane is not enhanced.

  10. Antiangiogenic effects of AA-PMe on HUVECs in vitro and zebrafish in vivo

    Directory of Open Access Journals (Sweden)

    Jing Y

    2018-04-01

    Full Text Available Yue Jing,1,2,* Gang Wang,1,* Qi Xiao,1 Yachun Zhou,1 Yingjie Wei,3 Zhunan Gong1 1Center for New Drug Research and Development, College of Life Science, Nanjing Normal University, Nanjing, China; 2Central Laboratory of Stomatology, Nanjing Stomatological Hospital, Medical School of Nanjing University, Nanjing, China; 3Key Laboratory of Oral Drug Delivery System of Chinese Materia Medica of State Administration of Traditional Chinese Medicine, Jiangsu Branch of China Academy of Chinese Medical Science, Nanjing, China *These authors contributed equally to this work Abstract: Angiogenesis plays a vital role in many physiological and pathological processes and several diseases are connected with its dysregulation. Asiatic acid (AA has demonstrated anticancer properties and we suspect this might be attributable to an effect on angiogenesis. A modified derivative of AA, N-(2α,3β,23-acetoxyurs-12-en-28-oyl-L-proline methyl ester (AA-PMe, has improved efficacy over its parent compound, but its effect on blood vessel development remains unclear. Methods: In this study, we investigated the antiangiogenic activity of AA and AA-PMe in zebrafish embryos and human umbilical vein endothelial cells (HUVECs. First of all, we treated HUVECs with increasing concentrations of AA-PMe or AA, with or without vascular endothelial growth factor (VEGF present, and assessed cell viability, tube formation, and cell migration and invasion. Quantitative real-time polymerase chain reaction and Western blot analysis were later used to determine the role of vascular endothelial growth factor receptor 2 (VEGFR2-mediated signaling in AA-PMe inhibition of angiogenesis. We extended these studies to follow angiogenesis using Tg(fli:EGFP transgenic zebrafish embryos. For these experiments, embryos were treated with varying concentrations of AA-PMe or AA from 24 to 72 hours postfertilization prior to morphological observation, angiogenesis assessment, and endogenous alkaline

  11. Highly phosphorylated functionalized rice starch produced by transgenic rice expressing the potato GWD1 gene

    DEFF Research Database (Denmark)

    Chen, Yaling; Sun, Xiao-Feng; Zhou, Xin

    2017-01-01

    Starch phosphorylation occurs naturally during starch metabolism in the plant and is catalysed by glucan water dikinases (GWD1) and phosphoglucan water dikinase/glucan water dikinase 3 (PWD/GWD3). We generated six stable individual transgenic lines by over-expressing the potato GWD1 in rice....... Transgenic rice grain starch had 9-fold higher 6-phospho (6-P) monoesters and double amounts of 3-phospho (3-P) monoesters, respectively, compared to control grain. The shape and topography of the transgenic starch granules were moderately altered including surface pores and less well defined edges...... content was positively correlated with short chains of DP6-12. The starch pasting temperature, peak viscosity and the breakdown were lower but the setback was higher for transgenic rice flour. The 6-P content was negatively correlated with texture adhesiveness but positively correlated...

  12. A transgenic approach to study argininosuccinate synthetase gene expression

    Science.gov (United States)

    2014-01-01

    Background Argininosuccinate synthetase (ASS) participates in urea, nitric oxide and arginine production. Besides transcriptional regulation, a post-transcriptional regulation affecting nuclear precursor RNA stability has been reported. To study whether such post-transcriptional regulation underlines particular temporal and spatial ASS expression, and to investigate how human ASS gene behaves in a mouse background, a transgenic mouse system using a modified bacterial artificial chromosome carrying the human ASS gene tagged with EGFP was employed. Results Two lines of ASS-EGFP transgenic mice were generated: one with EGFP under transcriptional control similar to that of the endogenous ASS gene, another with EGFP under both transcriptional and post-transcriptional regulation as that of the endogenous ASS mRNA. EGFP expression in the liver, the organ for urea production, and in the intestine and kidney that are responsible for arginine biosynthesis, was examined. Organs taken from embryos E14.5 stage to young adult were examined under a fluorescence microscope either directly or after cryosectioning. The levels of EGFP and endogenous mouse Ass mRNAs were also quantified by S1 nuclease mapping. EGFP fluorescence and EGFP mRNA levels in both the liver and kidney were found to increase progressively from embryonic stage toward birth. In contrast, EGFP expression in the intestine was higher in neonates and started to decline at about 3 weeks after birth. Comparison between the EGFP profiles of the two transgenic lines indicated the developmental and tissue-specific regulation was mainly controlled at the transcriptional level. The ASS transgene was of human origin. EGFP expression in the liver followed essentially the mouse Ass pattern as evidenced by zonation distribution of fluorescence and the level of EGFP mRNA at birth. However, in the small intestine, Ass mRNA level declined sharply at 3 week of age, and yet substantial EGFP mRNA was still detectable at this stage

  13. [Transgenic wheat (Triticum aestivum L.) with increased resistance to the storage pest obtained by Agrobacterium tumefaciens--mediated].

    Science.gov (United States)

    Bi, Rui-Ming; Jia, Hai-Yan; Feng, De-Shun; Wang, Hong-Gang

    2006-05-01

    The transgenic wheat of improved resistance to the storage pest was production. We have introduced the cowpea trypsin inhibitor gene (CpTI) into cultured embryonic callus cells of immature embryos of wheat elite line by Agrobacterium-mediated method. Independent plantlets were obtained from the kanamycin-resistant calli after screening. PCR and real time PCR analysis, PCR-Southern and Southern blot hybridization indicated that there were 3 transgenic plants viz. transformed- I, II and III (T- I, T-II and T-III). The transformation frequencies were obviously affected by Agrobacterium concentration, the infection duration and transformation treatment. The segregations of CpTI in the transgenic wheat progenies were not easily to be elucidated, and some transgenic wheat lines (T- I and T-III) showed Mendelian segregations. The determinations of insect resistance to the stored grain insect of wheat viz. the grain moth (Sitotroga cerealella Olivier) indicated that the 3 transgenic wheat progeny seeds moth-resistance was improved significantly. The seed moth-eaten ratio of T- I, T-II, T-III and nontransformed control was 19.8%, 21.9%, 32.9% and 58.3% respectively. 3 transgenic wheat T1 PCR-positive plants revealed that the 3 transgenic lines had excellent agronomic traits. They supplied good germplasm resource of insect-resistance for wheat genetic improvement.

  14. Overexpression of GmDREB1 improves salt tolerance in transgenic wheat and leaf protein response to high salinity

    Directory of Open Access Journals (Sweden)

    Qiyan Jiang

    2014-04-01

    Full Text Available The transcription factor dehydration-responsive element binding protein (DREB is able to improve tolerance to abiotic stress in plants by regulating the expression of downstream genes involved in environmental stress resistance. The objectives of this study were to evaluate the salt tolerance of GmDREB1 transgenic wheat (Triticum aestivum L. and to evaluate its physiological and protein responses to salt stress. Compared with the wild type, the transgenic lines overexpressing GmDREB1 showed longer coleoptiles and radicles and a greater radicle number at the germination stage, as well as greater root length, fresh weight, and tiller number per plant at the seedling stage. The yield-related traits of transgenic lines were also improved compared with the wild type, indicating enhanced salt tolerance in transgenic lines overexpressing GmDREB1. Proteomics analysis revealed that osmotic- and oxidative-stress-related proteins were up-regulated in transgenic wheat leaves under salt stress conditions. Transgenic wheat had higher levels of proline and betaine and lower levels of malondialdehyde and relative electrolyte leakage than the wild type. These results suggest that GmDREB1 regulates the expression of osmotic- and oxidative-stress-related proteins that reduce the occurrence of cell injury caused by high salinity, thus improving the salt tolerance of transgenic wheat.

  15. Overexpression of TiERF1 enhances resistance to sharp eyespot in transgenic wheat

    OpenAIRE

    Chen, Liang; Zhang, ZengYan; Liang, HongXia; Liu, HongXia; Du, LiPu; Xu, Huijun; Xin, Zhiyong

    2008-01-01

    Wheat sharp eyespot, primarily caused by a soil-borne fungus Rhizoctonia cerealis, has become one of the most serious diseases of wheat in China. In this study, an ethylene response factor (ERF) gene from a wheat relative Thinopyrum intermedium, TiERF1, was characterized further, transgenic wheat lines expressing TiERF1 were developed, and the resistance of the transgenic wheat lines against R. cerealis was investigated. Southern blotting analysis indicated that at least two copies of the TiE...

  16. Fishing on chips: up-and-coming technological advances in analysis of zebrafish and Xenopus embryos.

    Science.gov (United States)

    Zhu, Feng; Skommer, Joanna; Huang, Yushi; Akagi, Jin; Adams, Dany; Levin, Michael; Hall, Chris J; Crosier, Philip S; Wlodkowic, Donald

    2014-11-01

    Biotests performed on small vertebrate model organisms provide significant investigative advantages as compared with bioassays that employ cell lines, isolated primary cells, or tissue samples. The main advantage offered by whole-organism approaches is that the effects under study occur in the context of intact physiological milieu, with all its intercellular and multisystem interactions. The gap between the high-throughput cell-based in vitro assays and low-throughput, disproportionally expensive and ethically controversial mammal in vivo tests can be closed by small model organisms such as zebrafish or Xenopus. The optical transparency of their tissues, the ease of genetic manipulation and straightforward husbandry, explain the growing popularity of these model organisms. Nevertheless, despite the potential for miniaturization, automation and subsequent increase in throughput of experimental setups, the manipulation, dispensing and analysis of living fish and frog embryos remain labor-intensive. Recently, a new generation of miniaturized chip-based devices have been developed for zebrafish and Xenopus embryo on-chip culture and experimentation. In this work, we review the critical developments in the field of Lab-on-a-Chip devices designed to alleviate the limits of traditional platforms for studies on zebrafish and clawed frog embryo and larvae. © 2014 International Society for Advancement of Cytometry. © 2014 International Society for Advancement of Cytometry.

  17. Single-Event Transgene Product Levels Predict Levels in Genetically Modified Breeding Stacks.

    Science.gov (United States)

    Gampala, Satyalinga Srinivas; Fast, Brandon J; Richey, Kimberly A; Gao, Zhifang; Hill, Ryan; Wulfkuhle, Bryant; Shan, Guomin; Bradfisch, Greg A; Herman, Rod A

    2017-09-13

    The concentration of transgene products (proteins and double-stranded RNA) in genetically modified (GM) crop tissues is measured to support food, feed, and environmental risk assessments. Measurement of transgene product concentrations in breeding stacks of previously assessed and approved GM events is required by many regulatory authorities to evaluate unexpected transgene interactions that might affect expression. Research was conducted to determine how well concentrations of transgene products in single GM events predict levels in breeding stacks composed of these events. The concentrations of transgene products were compared between GM maize, soybean, and cotton breeding stacks (MON-87427 × MON-89034 × DAS-Ø15Ø7-1 × MON-87411 × DAS-59122-7 × DAS-40278-9 corn, DAS-81419-2 × DAS-44406-6 soybean, and DAS-21023-5 × DAS-24236-5 × SYN-IR102-7 × MON-88913-8 × DAS-81910-7 cotton) and their component single events (MON-87427, MON-89034, DAS-Ø15Ø7-1, MON-87411, DAS-59122-7, and DAS-40278-9 corn, DAS-81419-2, and DAS-44406-6 soybean, and DAS-21023-5, DAS-24236-5, SYN-IR102-7, MON-88913-8, and DAS-81910-7 cotton). Comparisons were made within a crop and transgene product across plant tissue types and were also made across transgene products in each breeding stack for grain/seed. Scatter plots were generated comparing expression in the stacks to their component events, and the percent of variability accounted for by the line of identity (y = x) was calculated (coefficient of identity, I 2 ). Results support transgene concentrations in single events predicting similar concentrations in breeding stacks containing the single events. Therefore, food, feed, and environmental risk assessments based on concentrations of transgene products in single GM events are generally applicable to breeding stacks composed of these events.

  18. Zebrafish mutants in the von Hippel-Lindau tumor suppressor display a hypoxic response and recapitulate key aspects of Chuvash polycythemia

    NARCIS (Netherlands)

    van Rooijen, E.; Voest, E.E.; Logister, I.; Korving, J.; Schwerte, T.; Schulte-Merker, S.; Giles, R.H.; van Eeden, F.J.

    2009-01-01

    We have generated 2 zebrafish lines carrying inactivating germline mutations in the von Hippel-Lindau (VHL) tumor suppressor gene ortholog vhl. Mutant embryos display a general systemic hypoxic response, including the up-regulation of hypoxia-induced genes by 1 day after fertilization and a severe

  19. Accurate measurement of transgene copy number in crop plants using droplet digital PCR.

    Science.gov (United States)

    Collier, Ray; Dasgupta, Kasturi; Xing, Yan-Ping; Hernandez, Bryan Tarape; Shao, Min; Rohozinski, Dominica; Kovak, Emma; Lin, Jeanie; de Oliveira, Maria Luiza P; Stover, Ed; McCue, Kent F; Harmon, Frank G; Blechl, Ann; Thomson, James G; Thilmony, Roger

    2017-06-01

    Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy number is estimated by either Southern blot hybridization analyses or quantitative polymerase chain reaction (qPCR) experiments. Southern hybridization is a convincing and reliable method, but it also is expensive, time-consuming and often requires a large amount of genomic DNA and radioactively labeled probes. Alternatively, qPCR requires less DNA and is potentially simpler to perform, but its results can lack the accuracy and precision needed to confidently distinguish between one- and two-copy events in transgenic plants with large genomes. To address this need, we developed a droplet digital PCR-based method for transgene copy number measurement in an array of crops: rice, citrus, potato, maize, tomato and wheat. The method utilizes specific primers to amplify target transgenes, and endogenous reference genes in a single duplexed reaction containing thousands of droplets. Endpoint amplicon production in the droplets is detected and quantified using sequence-specific fluorescently labeled probes. The results demonstrate that this approach can generate confident copy number measurements in independent transgenic lines in these crop species. This method and the compendium of probes and primers will be a useful resource for the plant research community, enabling the simple and accurate determination of transgene copy number in these six important crop species. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  20. Evaluation of visible implant elastomer tags in zebrafish (Danio rerio

    Directory of Open Access Journals (Sweden)

    Claudia Hohn

    2013-11-01

    The use of the visible implant elastomer (VIE tagging system in zebrafish (Danio rerio was examined. Two tag orientations (horizontal and vertical at the dorsal fin base were tested for tag retention, tag fragmentation and whether VIE tags affected growth and survival of juvenile zebrafish (1–4 month post hatch. Six tag locations (abdomen, anal fin base, caudal peduncle, dorsal fin base, pectoral fin base, isthmus and 5 tag colors (yellow, red, pink, orange, blue were evaluated for ease of VIE tag application and tag visibility in adult zebrafish. Long-term retention (1 year and multiple tagging sites (right and left of dorsal fin and pectoral fin base were examined in adult zebrafish. Lastly, survival of recombination activation gene 1−/− (rag1−/− zebrafish was evaluated after VIE tagging. The best tag location was the dorsal fin base, and the most visible tag color was pink. Growth rate of juvenile zebrafish was not affected by VIE tagging. Horizontal tagging is recommended in early stages of fish growth (1–2 months post hatch. VIE tags were retained for 1 year and tagging did not interfere with long-term growth and survival. There was no mortality associated with VIE tagging in rag1−/− zebrafish. The VIE tagging system is highly suitable for small-sized zebrafish. When familiar with the procedure, 120 adult zebrafish can be tagged in one hour. It does not increase mortality in adult zebrafish or interfere with growth in juvenile or adult zebrafish.

  1. Zebrafish tissue injury causes upregulation of interleukin-1 and caspase-dependent amplification of the inflammatory response

    Directory of Open Access Journals (Sweden)

    Nikolay V. Ogryzko

    2014-02-01

    Full Text Available Interleukin-1 (IL-1, the ‘gatekeeper’ of inflammation, is the apical cytokine in a signalling cascade that drives the early response to injury or infection. Expression, processing and secretion of IL-1 are tightly controlled, and dysregulated IL-1 signalling has been implicated in a number of pathologies ranging from atherosclerosis to complications of infection. Our understanding of these processes comes from in vitro monocytic cell culture models as lines or primary isolates, in which a range and spectra of IL-1 secretion mechanisms have been described. We therefore investigated whether zebrafish embryos provide a suitable in vivo model for studying IL-1-mediated inflammation. Structurally, zebrafish IL-1β shares a β-sheet-rich trefoil structure with its human counterpart. Functionally, leukocyte expression of IL-1β was detectable only following injury, which activated leukocytes throughout zebrafish embryos. Migration of macrophages and neutrophils was attenuated by inhibitors of either caspase-1 or P2X7, which similarly inhibited the activation of NF-κB at the site of injury. Zebrafish offer a new and versatile model to study the IL-1β pathway in inflammatory disease and should offer unique insights into IL-1 biology in vivo.

  2. Zebrafish tissue injury causes upregulation of interleukin-1 and caspase-dependent amplification of the inflammatory response.

    Science.gov (United States)

    Ogryzko, Nikolay V; Hoggett, Emily E; Solaymani-Kohal, Sara; Tazzyman, Simon; Chico, Timothy J A; Renshaw, Stephen A; Wilson, Heather L

    2014-02-01

    Interleukin-1 (IL-1), the 'gatekeeper' of inflammation, is the apical cytokine in a signalling cascade that drives the early response to injury or infection. Expression, processing and secretion of IL-1 are tightly controlled, and dysregulated IL-1 signalling has been implicated in a number of pathologies ranging from atherosclerosis to complications of infection. Our understanding of these processes comes from in vitro monocytic cell culture models as lines or primary isolates, in which a range and spectra of IL-1 secretion mechanisms have been described. We therefore investigated whether zebrafish embryos provide a suitable in vivo model for studying IL-1-mediated inflammation. Structurally, zebrafish IL-1β shares a β-sheet-rich trefoil structure with its human counterpart. Functionally, leukocyte expression of IL-1β was detectable only following injury, which activated leukocytes throughout zebrafish embryos. Migration of macrophages and neutrophils was attenuated by inhibitors of either caspase-1 or P2X7, which similarly inhibited the activation of NF-κB at the site of injury. Zebrafish offer a new and versatile model to study the IL-1β pathway in inflammatory disease and should offer unique insights into IL-1 biology in vivo.

  3. Dissection of vertebrate hematopoiesis using zebrafish thrombopoietin

    Czech Academy of Sciences Publication Activity Database

    Svoboda, Ondřej; Stachura, D.L.; Machoňová, Olga; Pajer, Petr; Brynda, Jiří; Zon, L.I.; Traver, D.; Bartůněk, Petr

    2014-01-01

    Roč. 124, č. 2 (2014), s. 220-228 ISSN 0006-4971 R&D Projects: GA ČR GAP305/10/0953 Grant - others:NIH(US) K01-DK087814-01A1; NIH(US) R01-DK074482 Keywords : Zebrafish * hematopoiesis * progenitors * thrombopoietin * erythropoietin Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 10.452, year: 2014

  4. Ethanol Exposure Causes Muscle Degeneration in Zebrafish

    Directory of Open Access Journals (Sweden)

    Elizabeth C. Coffey

    2018-03-01

    Full Text Available Alcoholic myopathies are characterized by neuromusculoskeletal symptoms such as compromised movement and weakness. Although these symptoms have been attributed to neurological damage, EtOH may also target skeletal muscle. EtOH exposure during zebrafish primary muscle development or adulthood results in smaller muscle fibers. However, the effects of EtOH exposure on skeletal muscle during the growth period that follows primary muscle development are not well understood. We determined the effects of EtOH exposure on muscle during this phase of development. Strikingly, muscle fibers at this stage are acutely sensitive to EtOH treatment: EtOH induces muscle degeneration. The severity of EtOH-induced muscle damage varies but muscle becomes more refractory to EtOH as muscle develops. NF-kB induction in muscle indicates that EtOH triggers a pro-inflammatory response. EtOH-induced muscle damage is p53-independent. Uptake of Evans blue dye shows that EtOH treatment causes sarcolemmal instability before muscle fiber detachment. Dystrophin-null sapje mutant zebrafish also exhibit sarcolemmal instability. We tested whether Trichostatin A (TSA, which reduces muscle degeneration in sapje mutants, would affect EtOH-treated zebrafish. We found that TSA and EtOH are a lethal combination. EtOH does, however, exacerbate muscle degeneration in sapje mutants. EtOH also disrupts adhesion of muscle fibers to their extracellular matrix at the myotendinous junction: some detached muscle fibers retain beta-Dystroglycan indicating failure of muscle end attachments. Overexpression of Paxillin, which reduces muscle degeneration in zebrafish deficient for beta-Dystroglycan, is not sufficient to rescue degeneration. Taken together, our results suggest that EtOH exposure has pleiotropic deleterious effects on skeletal muscle.

  5. Comparison of nutrition composition of transgenic maize (chitinase gene) with its non-transgenic counterpart

    OpenAIRE

    Ping-mei, Yan; Yu-kui, Rui; Xiao-yan, Yan; Zheng, Chai; Qing, Wang; Jian-zhong, Du; Yi, Sun

    2011-01-01

    In order to compare the nutrition components of transgenic maize seeds (chitinase gene), achieved by the pollen-mediated approach, with its non-transgenic counterpart, Vitamin B1, vitamin B2, fatty acids and essential amino acids of transgenic maize seeds and their counterparts were analyzed by the Chinese national standard methods or AOAC methods. The results showed that the contents of all the six kinds of fatty acids detected in transgenic maize seeds were significantly higher than those i...

  6. Selection of Housekeeping Genes for Transgene Expression Analysis in Eucommia ulmoides Oliver Using Real-Time RT-PCR

    Directory of Open Access Journals (Sweden)

    Ren Chen

    2010-01-01

    Full Text Available In order to select appropriate housekeeping genes for accurate calibration of experimental variations in real-time (RT- PCR results in transgene expression analysis, particularly with respect to the influence of transgene on stability of endogenous housekeeping gene expression in transgenic plants, we outline a reliable strategy to identify the optimal housekeeping genes from a set of candidates by combining statistical analyses of their (RT- PCR amplification efficiency, gene expression stability, and transgene influences. We used the strategy to select two genes, ACTα and EF1α, from 10 candidate housekeeping genes, as the optimal housekeeping genes to evaluate transgenic Eucommia ulmoides Oliver root lines overexpressing IPPI or FPPS1 genes, which are involved in isoprenoid biosynthesis.

  7. Herbicidal and antioxidant responses of transgenic rice overexpressing Myxococcus xanthus protoporphyrinogen oxidase.

    Science.gov (United States)

    Jung, Sunyo; Back, Kyoungwhan

    2005-05-01

    We analyzed the herbicidal and antioxidant defense responses of transgenic rice plants that overexpressed the Myxococcus xanthus protoporphyrinogen oxidase gene. Leaf squares of the wild-type incubated with oxyfluorfen were characterized by necrotic leaf lesions and increases in conductivity and malonyldialdehyde levels, whereas transgenic lines M4 and M7 did not show any change with up to 100 microM oxyfluorfen. The wild-type had decreased F(v)/F(m) and produced a high level of H(2)O(2) at 18 h after foliar application of oxyfluorfen, whereas transgenic lines M4 and M7 were unaffected. In response to oxyfluorfen, violaxanthin, beta-carotene, and chlorophylls (Chls) decreased in wild-type plants, whereas antheraxanthin and zeaxanthin increased. Only a slight decline in Chls was observed in transgenic lines at 48 h after oxyfluorfen treatment. Noticeable increases of cytosolic Cu/Zn-superoxide dismutase, peroxidase isozymes 1 and 2, and catalase were observed after at 48 h of oxyfluorfen treatment in the wild-type. Non-enzymatic antioxidants appeared to respond faster to oxyfluorfen-induced photodynamic stress than did enzymatic antioxidants. Protective responses for the detoxification of active oxygen species were induced to counteract photodynamic stress in oxyfluorfen-treated, wild-type plants. However, oxyfluorfen-treated, transgenic plants suffered less oxidative stress, confirming increased herbicidal resistance resulted from dual expression of M. xanthus Protox in chloroplasts and mitochondria.

  8. Disease modeling in genetic kidney diseases: zebrafish.

    Science.gov (United States)

    Schenk, Heiko; Müller-Deile, Janina; Kinast, Mark; Schiffer, Mario

    2017-07-01

    Growing numbers of translational genomics studies are based on the highly efficient and versatile zebrafish (Danio rerio) vertebrate model. The increasing types of zebrafish models have improved our understanding of inherited kidney diseases, since they not only display pathophysiological changes but also give us the opportunity to develop and test novel treatment options in a high-throughput manner. New paradigms in inherited kidney diseases have been developed on the basis of the distinct genome conservation of approximately 70 % between zebrafish and humans in terms of existing gene orthologs. Several options are available to determine the functional role of a specific gene or gene sets. Permanent genome editing can be induced via complete gene knockout by using the CRISPR/Cas-system, among others, or via transient modification by using various morpholino techniques. Cross-species rescues succeeding knockdown techniques are employed to determine the functional significance of a target gene or a specific mutation. This article summarizes the current techniques and discusses their perspectives.

  9. Social dominance modulates eavesdropping in zebrafish

    Science.gov (United States)

    Abril-de-Abreu, Rodrigo; Cruz, Ana S.; Oliveira, Rui F.

    2015-01-01

    Group living animals may eavesdrop on signalling interactions between conspecifics and integrate it with their own past social experience in order to optimize the use of relevant information from others. However, little is known about this interplay between public (eavesdropped) and private social information. To investigate it, we first manipulated the dominance status of bystander zebrafish. Next, we either allowed or prevented bystanders from observing a fight. Finally, we assessed their behaviour towards the winners and losers of the interaction, using a custom-made video-tracking system and directional analysis. We found that only dominant bystanders who had seen the fight revealed a significant increase in directional focus (a measure of attention) towards the losers of the fights. Furthermore, our results indicate that information about the fighters' acquired status was collected from the signalling interaction itself and not from post-interaction status cues, which implies the existence of individual recognition in zebrafish. Thus, we show for the first time that zebrafish, a highly social model organism, eavesdrop on conspecific agonistic interactions and that this process is modulated by the eavesdroppers' dominance status. We suggest that this type of integration of public and private information may be ubiquitous in social learning processes. PMID:26361550

  10. Afferent connectivity of the zebrafish habenulae

    Directory of Open Access Journals (Sweden)

    Katherine Jane Turner

    2016-04-01

    Full Text Available The habenulae are bilateral nuclei located in the dorsal diencephalon that are conserved across vertebrates.Here we describe the main afferents to the habenulae in larval and adult zebrafish.We observe afferents from the subpallium, nucleus rostrolateralis,posterior tuberculum, posterior hypothalamic lobe, median raphe, olfactory bulb to the right habenula and from the parapineal to the lefthabenula.In addition,we find afferents from a ventrolateral telencephalic nucleus that neurochemical and hodological data identify as the ventral entopeduncular nucleus(vENT,confirming and extending observations of Amo et al.(2014.Fate map and marker studies suggest that vENT originates from the diencephalic prethalamic eminence and extends into the lateral telencephalon from 48 to 120 hpf.No afferents to the habenula were observed from the dorsal entopeduncular nucleus(dENT.Consequently,we confirm that the vENT(and not the dENT should be considered as the entopeduncular nucleus proper in zebrafish.Furthermore,comparison with data in other vertebrates suggests that the vENT is a conserved basal ganglia nucleus,being homologous to the entopeduncular nucleus of mammals(internal segment of the globus pallidus of primates by both embryonic origin and projections,as previously suggested by Amo et al.(2014.Key words: habenula,connections,afferents,entopeduncular nucleus,posterior tuberculum,basal ganglia,zebrafish

  11. CERKL knockdown causes retinal degeneration in zebrafish.

    Directory of Open Access Journals (Sweden)

    Marina Riera

    Full Text Available The human CERKL gene is responsible for common and severe forms of retinal dystrophies. Despite intense in vitro studies at the molecular and cellular level and in vivo analyses of the retina of murine knockout models, CERKL function remains unknown. In this study, we aimed to approach the developmental and functional features of cerkl in Danio rerio within an Evo-Devo framework. We show that gene expression increases from early developmental stages until the formation of the retina in the optic cup. Unlike the high mRNA-CERKL isoform multiplicity shown in mammals, the moderate transcriptional complexity in fish facilitates phenotypic studies derived from gene silencing. Moreover, of relevance to pathogenicity, teleost CERKL shares the two main human protein isoforms. Morpholino injection has been used to generate a cerkl knockdown zebrafish model. The morphant phenotype results in abnormal eye development with lamination defects, failure to develop photoreceptor outer segments, increased apoptosis of retinal cells and small eyes. Our data support that zebrafish Cerkl does not interfere with proliferation and neural differentiation during early developmental stages but is relevant for survival and protection of the retinal tissue. Overall, we propose that this zebrafish model is a powerful tool to unveil CERKL contribution to human retinal degeneration.

  12. Use of zebrafish to study Shigella infection

    Science.gov (United States)

    Duggan, Gina M.

    2018-01-01

    ABSTRACT Shigella is a leading cause of dysentery worldwide, responsible for up to 165 million cases of shigellosis each year. Shigella is also recognised as an exceptional model pathogen to study key issues in cell biology and innate immunity. Several infection models have been useful to explore Shigella biology; however, we still lack information regarding the events taking place during the Shigella infection process in vivo. Here, we discuss a selection of mechanistic insights recently gained from studying Shigella infection of zebrafish (Danio rerio), with a focus on cytoskeleton rearrangements and cellular immunity. We also discuss how infection of zebrafish can be used to investigate new concepts underlying infection control, including emergency granulopoiesis and the use of predatory bacteria to combat antimicrobial resistance. Collectively, these insights illustrate how Shigella infection of zebrafish can provide fundamental advances in our understanding of bacterial pathogenesis and vertebrate host defence. This information should also provide vital clues for the discovery of new therapeutic strategies against infectious disease in humans. PMID:29590642

  13. Use of zebrafish to study Shigella infection

    Directory of Open Access Journals (Sweden)

    Gina M. Duggan