WorldWideScience

Sample records for transgenic potato line

  1. Cry1Ac Protein expression in tissues of potato (solanumtuberosum spp. andigena) transgenic lines var. Diacol Capiro

    International Nuclear Information System (INIS)

    Vanegas Araujo, Pablo Andres; Blanco Martinez, Jennifer Teresa; Chaparro Giraldo, Alejandro

    2010-01-01

    The potato plant is the fourth most important crop in the world. In Colombia around 2.8 million tons are produced annually economically supporting 90000 families. In the country, the major economic impact in the crop is caused by Tecia solanivora that originates loses up to 100% in the tuber production. The genetic plant breeding related to the introduction of Cry genes which codify insecticidal crystal proteins is an alternative for reducing the insect attack in commercial crops. In this work, the insertion, transcription and expression of Cry1Ac gen was characterized in different tissues and three development stages of two transgenic lines of Solanum tuberosum variety Diacol Capiro that were previously transformed by Agrobacterium tumefaciens method. The characterization was realized by PCR, RT-PCR and ELISA techniques. The gen insertion and transcription was confirmed using primers for Cry1Ac gen that amplified a specific band of 766 bp. The protein expression levels were higher than 45 µg/g and were not significantly different between the analyzed lines or the three development stages. Furthermore, taking into account some relevant phenotypic features, no significant differences were found between transgenic lines and controls. The results suggest that monitoring and biosecurity assays are necessary with this vegetal material because their high level expression inside all the tissues analyzed that could affect non-targeted insects.

  2. Monitoring changes in anthocyanin and steroid alkaloid glycoside content in lines of transgenic potato plants using liquid chromatography/mass spectrometry.

    Science.gov (United States)

    Stobiecki, Maciej; Matysiak-Kata, Iwona; Frański, Rafał; Skała, Jacek; Szopa, Jan

    2003-03-01

    Transgenic potato plants overexpressing and repressing enzymes of flavonoids biosynthesis were created and analyzed. The selected plants clearly showed the expected changes in anthocyanins synthesis level. Overexpression of a DNA encoding dihydroflavonol 4-reductase (DFR) in sense orientation resulted in an increase in tuber anthocyanins, a 4-fold increase in petunidin and pelargonidin derivatives. A significant decrease in anthocyanin level was observed when the plant was transformed with a corresponding antisense construct. The transformation of potato plants was also accompanied by significant changes in steroid alkaloid glycosides (SAG) level in transgenic potato tuber. The changes in SAGs content was not dependent on flavonoid composition in transgenic potato. However, in an extreme situation where the highest (DFR11) or the lowest (DFRa3) anthocyanin level was detected the positive correlation with steroid alkaloid content was clearly visible. It is suggested that the changes in SAGs content resulted from chromatin stressed upon transformation. A liquid chromatography/mass spectrometry (LC/MS) system with electrospray ionization was applied for profiling qualitative and quantitative changes of steroid alkaloid glycosides in tubers of twelve lines of transgenic potato plants. Except alpha-chaconine and alpha-solanine, in the extracts from dried tuber skin alpha-solamargine and alpha-solasonine, triglycosides of solasonine, were identified in minor amounts, triglycosides of solanidine dehydrodimers were also recognized.

  3. Regeneration of multiple shoots from transgenic potato events facilitates the recovery of phenotypically normal lines: assessing a cry9Aa2 gene conferring insect resistance

    Directory of Open Access Journals (Sweden)

    Jacobs Jeanne ME

    2011-10-01

    Full Text Available Abstract Background The recovery of high performing transgenic lines in clonal crops is limited by the occurrence of somaclonal variation during the tissue culture phase of transformation. This is usually circumvented by developing large populations of transgenic lines, each derived from the first shoot to regenerate from each transformation event. This study investigates a new strategy of assessing multiple shoots independently regenerated from different transformed cell colonies of potato (Solanum tuberosum L.. Results A modified cry9Aa2 gene, under the transcriptional control of the CaMV 35S promoter, was transformed into four potato cultivars using Agrobacterium-mediated gene transfer using a nptII gene conferring kanamycin resistance as a selectable marker gene. Following gene transfer, 291 transgenic lines were grown in greenhouse experiments to assess somaclonal variation and resistance to potato tuber moth (PTM, Phthorimaea operculella (Zeller. Independently regenerated lines were recovered from many transformed cell colonies and Southern analysis confirmed whether they were derived from the same transformed cell. Multiple lines regenerated from the same transformed cell exhibited a similar response to PTM, but frequently exhibited a markedly different spectrum of somaclonal variation. Conclusions A new strategy for the genetic improvement of clonal crops involves the regeneration and evaluation of multiple shoots from each transformation event to facilitate the recovery of phenotypically normal transgenic lines. Most importantly, regenerated lines exhibiting the phenotypic appearance most similar to the parental cultivar are not necessarily derived from the first shoot regenerated from a transformed cell colony, but can frequently be a later regeneration event.

  4. Transgenic potato plants expressing cry3A gene confer resistance to Colorado potato beetle.

    Science.gov (United States)

    Mi, Xiaoxiao; Ji, Xiangzhuo; Yang, Jiangwei; Liang, Lina; Si, Huaijun; Wu, Jiahe; Zhang, Ning; Wang, Di

    2015-07-01

    The Colorado potato beetle (Leptinotarsa decemlineata Say, CPB) is a fatal pest, which is a quarantine pest in China. The CPB has now invaded the Xinjiang Uygur Autonomous Region and is constantly spreading eastward in China. In this study, we developed transgenic potato plants expressing cry3A gene. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the cry3A gene expressed in leaves, stems and roots of the transgenic plants under the control of CaMV 35S promoter, while they expressed only in leaves and stems under the control of potato leaf and stem-specific promoter ST-LS1. The mortality of the larvae was higher (28% and 36%) on the transgenic plant line 35S1 on the 3rd and 4th days, and on ST3 (48%) on the 5th day after inoculation with instar larvae. Insect biomass accumulation on the foliage of the transgenic plant lines 35S1, 35S2 and ST3 was significantly lower (0.42%, 0.43% and 0.42%). Foliage consumption was lowest on transgenic lines 35S8 and ST2 among all plant foliage (7.47 mg/larvae/day and 12.46 mg/larvae/day). The different transgenic plant foliages had varied inhibition to larval growth. The survivors on the transgenic lines obviously were smaller than their original size and extremely weak. The transgenic potato plants with CPB resistance could be used to develop germplasms or varieties for controlling CPB damage and halting its spread in China. Copyright © 2015 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  5. Transgenic modification of potato pectic polysaccharides also affects type and level of cell wall xyloglucan

    NARCIS (Netherlands)

    Huang, Jie Hong; Jiang, Rui; Kortstee, Anne; Dees, Dianka C.T.; Trindade, Luisa M.; Gruppen, Harry; Schols, Henk A.

    2017-01-01

    BACKGROUND: Genes encoding pectic enzymes were introduced into wild-type potato Karnico. Cell wall materials were extracted from Karnico and transgenic lines expressing β-galactosidase (β-Gal-14) or rhamnogalacturonan lyase (RGL-18). Pectic polysaccharides from the β-Gal-14 transgenic line exhibited

  6. Glycinebetaine synthesizing transgenic potato plants exhibit enhanced tolerance to salt and cold stresses

    International Nuclear Information System (INIS)

    Ahmad, R.; Hussain, J.

    2014-01-01

    Abiotic stresses are the most important contributors towards low productivity of major food crops. Various attempts have been made to enhance abiotic stress tolerance of crop plants by classical breeding and genetic transformation. Genetic transformation with glycinebetaine (GB) synthesizing enzymes' gene(s) in naturally non accumulating plants has resulted in enhanced tolerance against variety of abiotic stresses. Present study was aimed to evaluate the performance of GB synthesizing transgenic potato plants against salt and cold stresses. Transgenic potato plants were challenged against salt and cold stresses at whole plant level. Transgenic lines were characterized to determine the transgene copy number. Different parameters like integrity, chlorophyll contents, tuber yield and vegetative biomass were studied to monitor the stress tolerance of transgenic potato plants. The results were compared with Non-transgenic (NT) plants and statistically analyzed to evaluate significant differences. Multi-copy insertion of expression cassette was found in both transgenic lines. Upon salt stress, transgenic plants maintained better growth as compared to NT plants. The tuber yield of transgenic plants was significantly greater than NT plants in salt stress. Transgenic plants showed improved membrane integrity against cold stress by depicting appreciably reduced ion leakage as compared to NT plants. Moreover, transgenic plants showed significantly less chlorophyll bleaching than NT plants upon cold stress. In addition, NT plants accumulated significantly less biomass, and yielded fewer tubers as compared to transgenic plants after cold stress treatment. The study will be a committed step for field evaluation of transgenic plants with the aim of commercialization. (author)

  7. Enhanced salt stress tolerance in transgenic potato plants expressing IbMYB1, a sweet potato transcription factor.

    Science.gov (United States)

    Cheng, Yu-Jie; Kim, Myoung-Duck; Deng, Xi-Ping; Kwak, Sang-Soo; Chen, Wei

    2013-12-01

    IbMYB1, a transcription factor (TF) for R2R3-type MYB TFs, is a key regulator of anthocyanin biosynthesis during storage of sweet potatoes. Anthocyanins provide important antioxidants of nutritional value to humans, and also protect plants from oxidative stress. This study aimed to increase transgenic potatoes' (Solanum tuberosum cv. LongShu No.3) tolerance to environmental stress and enhance their nutritional value. Transgenic potato plants expressing IbMYB1 genes under the control of an oxidative stress-inducible peroxidase (SWPA2) promoter (referred to as SM plants) were successfully generated through Agrobacterium-mediated transformation. Two representative transgenic SM5 and SM12 lines were evaluated for enhanced tolerance to salinity, UV-B rays, and drought conditions. Following treatment of 100 mM NaCl, seedlings of SM5 and SM12 lines showed less root damage and more shoot growth than control lines expressing only an empty vector. Transgenic potato plants in pots treated with 400 mM NaCl showed high amounts of secondary metabolites, including phenols, anthocyanins, and flavonoids, compared with control plants. After treatment of 400 mM NaCl, transgenic potato plants also showed high DDPH radical scavenging activity and high PS II photochemical efficiency compared with the control line. Furthermore, following treatment of NaCl, UV-B, and drought stress, the expression levels of IbMYB1 and several structural genes in the flavonoid biosynthesis such as CHS, DFR, and ANS in transgenic plants were found to be correlated with plant phenotype. The results suggest that enhanced IbMYB1 expression affects secondary metabolism, which leads to improved tolerance ability in transgenic potatoes.

  8. Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots.

    Science.gov (United States)

    Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke; Hühns, Maja; Broer, Inge; Valkonen, Jari P T

    2014-12-01

    Composite potato plants offer an extremely fast, effective and reliable system for studies on gene functions in roots using antisense or inverted-repeat but not sense constructs for gene inactivation. Composite plants, with transgenic roots on a non-transgenic shoot, can be obtained by shoot explant transformation with Agrobacterium rhizogenes. The aim of this study was to generate composite potato plants (Solanum tuberosum) to be used as a model system in future studies on root-pathogen interactions and gene silencing in the roots. The proportion of transgenic roots among the roots induced was high (80-100%) in the four potato cultivars tested (Albatros, Desirée, Sabina and Saturna). No wild-type adventitious roots were formed at mock inoculation site. All strains of A. rhizogenes tested induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots of composite potato plants expressed significantly higher amounts of β-glucuronidase (GUS) than the roots of a GUS-transgenic potato line event. Silencing of the uidA transgene (GUS) was tested by inducing roots on the GUS-transgenic cv. Albatros event with strains of A. rhizogenes over-expressing either the uidA sense or antisense transcripts, or inverted-repeat or hairpin uidA RNA. The three last mentioned constructs caused 2.5-4.0 fold reduction in the uidA mRNA expression. In contrast, over-expression of uidA resulted in over 3-fold increase in the uidA mRNA and GUS expression, indicating that sense-mediated silencing (co-suppression) was not functional in roots. The results suggest that composite plants offer a useful experimental system for potato research, which has gained little previous attention.

  9. Transgenic resistance of eggplants to the Colorado potato beetle

    NARCIS (Netherlands)

    Arpaia, S.

    1999-01-01

    The subject of this thesis is the use of transgenic plant resistance as a method to control the Colorado potato beetle, Leptinotarsa decemlineata Say in eggplant. The gene conferring resistance is coding for a Cry3B toxin and it is a synthetic version of a wild-type

  10. Transgenic rice plants harboring an introduced potato proteinase inhibitor II gene are insect resistant.

    Science.gov (United States)

    Duan, X; Li, X; Xue, Q; Abo-el-Saad, M; Xu, D; Wu, R

    1996-04-01

    We introduced the potato proteinase inhibitor II (PINII) gene (pin2) into several Japonica rice varieties, and regenerated a large number of transgenic rice plants. Wound-inducible expression of the pin2 gene driven by its own promoter, together with the first intron of the rice actin 1 gene (act1), resulted in high-level accumulation of the PINII protein in the transgenic plants. The introduced pin2 gene was stably inherited in the second, third, and fourth generations, as shown by molecular analyses. Based on data from the molecular analyses, several homozygous transgenic lines were obtained. Bioassay for insect resistance with the fifth-generation transgenic rice plants showed that transgenic rice plants had increased resistance to a major rice insect pest, pink stem borer (Sesamia inferens). Thus, introduction of an insecticidal proteinase inhibitor gene into cereal plants can be used as a general strategy for control of insect pests.

  11. 5-Azacytidine mediated reactivation of silenced transgenes in potato (Solanum tuberosum) at the whole plant level.

    Science.gov (United States)

    Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš

    2017-08-01

    Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.

  12. Overexpression of the IbMYB1 gene in an orange-fleshed sweet potato cultivar produces a dual-pigmented transgenic sweet potato with improved antioxidant activity.

    Science.gov (United States)

    Park, Sung-Chul; Kim, Yun-Hee; Kim, Sun Ha; Jeong, Yu Jeong; Kim, Cha Young; Lee, Joon Seol; Bae, Ji-Yeong; Ahn, Mi-Jeong; Jeong, Jae Cheol; Lee, Haeng-Soon; Kwak, Sang-Soo

    2015-04-01

    The R2R3-type protein IbMYB1 is a key regulator of anthocyanin biosynthesis in the storage roots of sweet potato [Ipomoea batatas (L.) Lam]. Previously, we demonstrated that IbMYB1 expression stimulated anthocyanin pigmentation in tobacco leaves and Arabidopsis. Here, we generated dual-pigmented transgenic sweet potato plants that accumulated high levels of both anthocyanins and carotenoids in a single sweet potato storage root. An orange-fleshed cultivar with high carotenoid levels was transformed with the IbMYB1 gene under the control of either the storage root-specific sporamin 1 (SPO1) promoter or the oxidative stress-inducible peroxidase anionic 2 (SWPA2) promoter. The SPO1-MYB transgenic lines exhibited higher anthocyanin levels in storage roots than empty vector control (EV) or SWPA2-MYB plants, but carotenoid content was unchanged. SWPA2-MYB transgenic lines exhibited higher levels of both anthocyanin and carotenoids than EV plants. Analysis of hydrolyzed anthocyanin extracts indicated that cyanidin and peonidin predominated in both overexpression lines. Quantitative reverse transcription-polymerase chain reaction analysis demonstrated that IbMYB1 expression in both IbMYB1 transgenic lines strongly induced the upregulation of several genes in the anthocyanin biosynthetic pathway, whereas the expression of carotenoid biosynthetic pathway genes varied between transgenic lines. Increased anthocyanin levels in transgenic plants also promoted the elevation of proanthocyanidin and total phenolic levels in fresh storage roots. Consequently, all IbMYB1 transgenic plants displayed much higher antioxidant activities than EV plants. In field cultivations, storage root yields varied between the transgenic lines. Taken together, our results indicate that overexpression of IbMYB1 is a highly promising strategy for the generation of transgenic plants with enhanced antioxidant capacity. © 2014 Scandinavian Plant Physiology Society.

  13. Highly phosphorylated functionalized rice starch produced by transgenic rice expressing the potato GWD1 gene

    DEFF Research Database (Denmark)

    Chen, Yaling; Sun, Xiao-Feng; Zhou, Xin

    2017-01-01

    Starch phosphorylation occurs naturally during starch metabolism in the plant and is catalysed by glucan water dikinases (GWD1) and phosphoglucan water dikinase/glucan water dikinase 3 (PWD/GWD3). We generated six stable individual transgenic lines by over-expressing the potato GWD1 in rice....... Transgenic rice grain starch had 9-fold higher 6-phospho (6-P) monoesters and double amounts of 3-phospho (3-P) monoesters, respectively, compared to control grain. The shape and topography of the transgenic starch granules were moderately altered including surface pores and less well defined edges...... content was positively correlated with short chains of DP6-12. The starch pasting temperature, peak viscosity and the breakdown were lower but the setback was higher for transgenic rice flour. The 6-P content was negatively correlated with texture adhesiveness but positively correlated...

  14. Expression of a cucumber class III chitinase and Nicotiana plumbaginifolia class I glucanase genes in transgenic potato plants

    NARCIS (Netherlands)

    Moravcikova, J.; Matusikova, I.; Libantova, J.; Bauer, M.; Mlynarova, L.

    2004-01-01

    The genes encoding for a cucumber class III chitinase and Nicotiana plumbaginifolia class I glucanase were co-introduced into Slovak potato (Solanum tuberosum L.) breeding line 116/86 using Agrobacterium tumefaciens. For both transgenes the number of integrated copies and level of RNA expression

  15. Highly phosphorylated functionalized rice starch produced by transgenic rice expressing the potato GWD1 gene

    DEFF Research Database (Denmark)

    Chen, Yaling; Sun, Xiao; Zhou, Xin Mao

    2017-01-01

    Starch phosphorylation occurs naturally during starch metabolism in the plant and is catalysed by glucan water dikinases (GWD1) and phosphoglucan water dikinase/glucan water dikinase 3 (PWD/GWD3). We generated six stable individual transgenic lines by over-expressing the potato GWD1 in rice....... Transgenic rice grain starch had 9-fold higher 6-phospho (6-P) monoesters and double amounts of 3-phospho (3-P) monoesters, respectively, compared to control grain. The shape and topography of the transgenic starch granules were moderately altered including surface pores and less well defined edges....... The gelatinization temperatures of both rice flour and extracted starch were significantly lower than those of the control and hence negatively correlated with the starch phosphate content. The 6-P content was positively correlated with amylose content and relatively long amylopectin chains with DP25-36, and the 3-P...

  16. Expression of the Galanthus nivalis agglutinin (GNA) gene in transgenic potato plants confers resistance to aphids.

    Science.gov (United States)

    Mi, Xiaoxiao; Liu, Xue; Yan, Haolu; Liang, Lina; Zhou, Xiangyan; Yang, Jiangwei; Si, Huaijun; Zhang, Ning

    2017-01-01

    Aphids, the largest group of sap-sucking pests, cause significant yield losses in agricultural crops worldwide every year. The massive use of pesticides to combat this pest causes severe damage to the environment, putting in risk the human health. In this study, transgenic potato plants expressing Galanthus nivalis agglutinin (GNA) gene were developed using CaMV 35S and ST-LS1 promoters generating six transgenic lines (35S1-35S3 and ST1-ST3 corresponding to the first and second promoter, respectively). Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the GNA gene was expressed in leaves, stems and roots of transgenic plants under the control of the CaMV 35S promoter, while it was only expressed in leaves and stems under the control of the ST-LS1 promoter. The levels of aphid mortality after 5 days of the inoculation in the assessed transgenic lines ranged from 20 to 53.3%. The range of the aphid population in transgenic plants 15 days after inoculation was between 17.0±1.43 (ST2) and 36.6±0.99 (35S3) aphids per plant, which corresponds to 24.9-53.5% of the aphid population in non-transformed plants. The results of our study suggest that GNA expressed in transgenic potato plants confers a potential tolerance to aphid attack, which appears to be an alternative against the use of pesticides in the future. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  17. Transgenic cassava lines carrying heterologous alternative oxidase ...

    African Journals Online (AJOL)

    Afuape

    2013-07-03

    Jul 3, 2013 ... production of flowers, apomixis (Nassar et al., 2000; ... In order to increase the stress tolerance capacity of ... stress-related procedure due to the activities of auxin ... the evaluation of the transgenic lines for rate of OES .... Some transgenic lines carrying the 35S-AOX fragment amplified using 35S303F1 and.

  18. Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots

    DEFF Research Database (Denmark)

    Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke

    2014-01-01

    induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots...

  19. Transgenic potatoes for potato cyst nematode control can replace pesticide use without impact on soil quality.

    Science.gov (United States)

    Green, Jayne; Wang, Dong; Lilley, Catherine J; Urwin, Peter E; Atkinson, Howard J

    2012-01-01

    Current and future global crop yields depend upon soil quality to which soil organisms make an important contribution. The European Union seeks to protect European soils and their biodiversity for instance by amending its Directive on pesticide usage. This poses a challenge for control of Globodera pallida (a potato cyst nematode) for which both natural resistance and rotational control are inadequate. One approach of high potential is transgenically based resistance. This work demonstrates the potential in the field of a new transgenic trait for control of G. pallida that suppresses root invasion. It also investigates its impact and that of a second transgenic trait on the non-target soil nematode community. We establish that a peptide that disrupts chemoreception of nematodes without a lethal effect provides resistance to G. pallida in both a containment and a field trial when precisely targeted under control of a root tip-specific promoter. In addition we combine DNA barcoding and quantitative PCR to recognise nematode genera from soil samples without microscope-based observation and use the method for nematode faunal analysis. This approach establishes that the peptide and a cysteine proteinase inhibitor that offer distinct bases for transgenic plant resistance to G. pallida do so without impact on the non-target nematode soil community.

  20. Transgenic potatoes for potato cyst nematode control can replace pesticide use without impact on soil quality.

    Directory of Open Access Journals (Sweden)

    Jayne Green

    Full Text Available Current and future global crop yields depend upon soil quality to which soil organisms make an important contribution. The European Union seeks to protect European soils and their biodiversity for instance by amending its Directive on pesticide usage. This poses a challenge for control of Globodera pallida (a potato cyst nematode for which both natural resistance and rotational control are inadequate. One approach of high potential is transgenically based resistance. This work demonstrates the potential in the field of a new transgenic trait for control of G. pallida that suppresses root invasion. It also investigates its impact and that of a second transgenic trait on the non-target soil nematode community. We establish that a peptide that disrupts chemoreception of nematodes without a lethal effect provides resistance to G. pallida in both a containment and a field trial when precisely targeted under control of a root tip-specific promoter. In addition we combine DNA barcoding and quantitative PCR to recognise nematode genera from soil samples without microscope-based observation and use the method for nematode faunal analysis. This approach establishes that the peptide and a cysteine proteinase inhibitor that offer distinct bases for transgenic plant resistance to G. pallida do so without impact on the non-target nematode soil community.

  1. Improved tolerance to various abiotic stresses in transgenic sweet potato (Ipomoea batatas expressing spinach betaine aldehyde dehydrogenase.

    Directory of Open Access Journals (Sweden)

    Weijuan Fan

    Full Text Available Abiotic stresses are critical delimiters for the increased productivity and cultivation expansion of sweet potato (Ipomoea batatas, a root crop with worldwide importance. The increased production of glycine betaine (GB improves plant tolerance to various abiotic stresses without strong phenotypic changes, providing a feasible approach to improve stable yield production under unfavorable conditions. The gene encoding betaine aldehyde dehydrogenase (BADH is involved in the biosynthesis of GB in plants, and the accumulation of GB by the heterologous overexpression of BADH improves abiotic stress tolerance in plants. This study is to improve sweet potato, a GB accumulator, resistant to multiple abiotic stresses by promoted GB biosynthesis. A chloroplastic BADH gene from Spinacia oleracea (SoBADH was introduced into the sweet potato cultivar Sushu-2 via Agrobacterium-mediated transformation. The overexpression of SoBADH in the transgenic sweet potato improved tolerance to various abiotic stresses, including salt, oxidative stress, and low temperature. The increased BADH activity and GB accumulation in the transgenic plant lines under normal and multiple environmental stresses resulted in increased protection against cell damage through the maintenance of cell membrane integrity, stronger photosynthetic activity, reduced reactive oxygen species (ROS production, and induction or activation of ROS scavenging by the increased activity of free radical-scavenging enzymes. The increased proline accumulation and systemic upregulation of many ROS-scavenging genes in stress-treated transgenic plants also indicated that GB accumulation might stimulate the ROS-scavenging system and proline biosynthesis via an integrative mechanism. This study demonstrates that the enhancement of GB biosynthesis in sweet potato is an effective and feasible approach to improve its tolerance to multiple abiotic stresses without causing phenotypic defects. This strategy for trait

  2. Transgenic cassava lines carrying heterologous alternative oxidase ...

    African Journals Online (AJOL)

    Afuape

    2013-07-03

    Jul 3, 2013 ... Organized embryogenic callus development: In our experiment, somatic embryos were developed from leaf lobes collected from transgenic cassava lines carrying the AtAOX1a gene. Immature leaf lobes measuring about 1 to 6 mm obtained from about six weeks old in vitro derived plants were used.

  3. Transgenic approaches in potato: effects on glycoalkaloids levels

    African Journals Online (AJOL)

    Sayyar

    2013-02-20

    Feb 20, 2013 ... Tax and Vernon, 2001). The inserted transgene varies in ... regions are disfavored under selective conditions as the case in previous studies. .... human consumption at concentration >200 mg/1000 g of total tuber weight ...

  4. Modifying glycoalkaloid content in transgenic potato – Metabolome impacts

    Science.gov (United States)

    Metabolite profiling has been used to assess the potential for unintended composition changes in potato (Solanum tuberosum L. cv. Desirée) tubers, which have been genetically modified (GM) to reduce glycoalkaloid content via the independent down-regulation of three genes SGT1, SGT2 and SGT3 known t...

  5. Inheritance and effectiveness of two transgenes determining PVY resistance in progeny from crossing independently transformed tobacco lines.

    Science.gov (United States)

    Czubacka, Anna; Sacco, Ermanno; Olszak-Przybyś, Hanna; Doroszewska, Teresa

    2017-05-01

    Genetic transformation of plants allows us to obtain improved genotypes enriched with the desired traits. However, if transgenic lines were to be used in breeding programs the stability of inserted transgenes is essential. In the present study, we followed the inheritance of transgenes in hybrids originated from crossing two transgenic tobacco lines resistant to Potato virus Y (PVY): MN 944 LMV with the transgene containing Lettuce mosaic virus coat protein gene (LMV CP) and AC Gayed ROKY2 with PVY replicase gene (ROKY2). Progeny populations generated by successive self-pollination were analyzed with respect to the transgene segregation ratio and resistance to Potato virus Y in tests carried out under greenhouse conditions. The presence of the virus in inoculated plants was detected by DAS-ELISA method. The results demonstrated the Mendelian fashion of inheritance of transgenes which were segregated independently and stably. As a result, we obtained T 4 generation of hybrid with both transgenes stacked and which was highly resistant to PVY.

  6. Expression of a potato antimicrobial peptide SN1 increases resistance to take-all pathogen Gaeumannomyces graminis var. tritici in transgenic wheat.

    Science.gov (United States)

    Rong, Wei; Qi, Lin; Wang, Jingfen; Du, Lipu; Xu, Huijun; Wang, Aiyun; Zhang, Zengyan

    2013-08-01

    Take-all, caused by soil-borne fungus Gaeumannomyces graminis var. tritici (Ggt), is a devastating root disease of wheat (Triticum aestivum) worldwide. Breeding resistant wheat cultivars is the most promising and reliable approach to protect wheat from take-all. Currently, no resistant wheat germplasm is available to breed cultivars using traditional methods. In this study, gene transformation was carried out using Snakin-1 (SN1) gene isolated from potato (Solanum tuberosum) because the peptide shows broad-spectrum antimicrobial activity in vitro. Purified SN1 peptide also inhibits in vitro the growth of Ggt mycelia. By bombardment-mediated method, the gene SN1 was transformed into Chinese wheat cultivar Yangmai 18 to generate SN1 transgenic wheat lines, which were used to assess the effectiveness of the SN1 peptide in protecting wheat from Ggt. Genomic PCR and Southern blot analyses indicated that the alien gene SN1 was integrated into the genomes of five transgenic wheat lines and heritable from T₀ to T₄ progeny. Reverse transcription-PCR and Western blot analyses showed that the introduced SN1 gene was transcribed and highly expressed in the five transgenic wheat lines. Following challenging with Ggt, disease test results showed that compared to segregants lacking the transgene and untransformed wheat plants, these five transgenic wheat lines expressing SN1 displayed significantly enhanced resistance to take-all. These results suggest that SN1 may be a potentially transgenic tool for improving the take-all resistance of wheat.

  7. Marker Removal in Transgenic Plants Using Cre Recombinase Delivered with Potato Virus X.

    Science.gov (United States)

    Kopertekh, Lilya; Schiemann, Joachim

    2017-01-01

    In this chapter we present an alternative method to develop marker-free transgenic plants. It makes use of the Cre/loxP recombination system from bacteriophage P1 and consists of two essential components. The first component is the transgenic plant containing a loxP-flanked marker gene. The second component is a cre transient expression vector based on potato virus X. The great benefit of this transient delivery method consists in the avoidance of stable integration of the cre recombinase gene into the plant genome. Upon infection of the loxP-target plant with PVX-Cre, the virus spreads systemically through the plant and causes the recombinase-mediated excision of the marker gene. Marker-free transgenic loci can be transmitted to the progeny by plant regeneration from PVX-Cre systemically infected leaves or self-pollination of virus-infected plants. The protocol covers generation of loxP-target transgenic plants, PVX-mediated delivery of Cre recombinase protein, phenotypic and molecular analysis of recombination events, and transmission of marker-free transgenic loci to the next generation. The transient expression system described in this chapter can be adapted for marker gene removal in other plant species that are amenable for virus infection.

  8. Establishment and characterization of CAG/EGFP transgenic rabbit line.

    Science.gov (United States)

    Takahashi, Ri-ichi; Kuramochi, Takashi; Aoyagi, Kazuki; Hashimoto, Shu; Miyoshi, Ichiro; Kasai, Noriyuki; Hakamata, Yoji; Kobayashi, Eiji; Ueda, Masatsugu

    2007-02-01

    Cell marking is a very important procedure for identifying donor cells after cell and/or organ transplantation in vivo. Transgenic animals expressing marker proteins such as enhanced green fluorescent protein (EGFP) in their tissues are a powerful tool for research in fields of tissue engineering and regenerative medicine. The purpose of this study was to establish transgenic rabbit lines that ubiquitously express EGFP under the control of the cytomegalovirus immediate early enhancer/beta-actin promoter (CAG) to provide a fluorescent transgenic animal as a bioresource. We microinjected the EGFP expression vector into 945 rabbit eggs and 4 independent transgenic candidate pups were obtained. Two of them died before sexual maturation and one was infertile. One transgenic male candidate founder rabbit was obtained and could be bred by artificial insemination. The rabbit transmitted the transgene in a Mendelian manner. Using fluorescence in situ hybridization analysis, we detected the transgene at 7q11 on chromosome 7 as a large centromeric region in two F1 offspring (one female and one male). Eventually, one transgenic line was established. Ubiquitous EGFP fluorescence was confirmed in all examined organs. There were no gender-related differences in fluorescence. The established CAG/EGFP transgenic rabbit will be an important bioresource and a useful tool for various studies in tissue engineering and regenerative medicine.

  9. Characteristics of mutant lines of sweet potato flour

    International Nuclear Information System (INIS)

    Aryanti

    2012-01-01

    Research on mutation induction of sweet potato Sari variety has been conducted. Flour mutant lines were obtained from selection of M1V5 tubers irradiated by gamma rays at the dose of 10 Gy. Flour was made by peeling of tubers, then dried, blended and sieved. The quality test of flour have been done by measuring degree of whiteness, proximate, amylose contents, water content, soluble water, swelling power, and flour characteristics. The result of this work showed that flour of C6.26.13 mutant line had higher protein content than the parent plant with concentration of 3.62 % and its amylose content was also higher than the other mutant lines. The soluble water value of mutant lines were significant different compared to the parent plant from 1.82 to 2.25 % and swelling power from 4.28 to 5.55 %. The flour granule of the mutant line was different compared to the parent plant. (author)

  10. Development of putative transgenic lines of cassava variety H-226 ...

    African Journals Online (AJOL)

    CMD) caused by the Indian cassava mosaic virus (ICMV) and Sri Lankan cassava mosaic virus (SLCMV). An attempt was done to develop transgenic cassava lines resistant to SLCMV through RNAi vector targeting a conserved 440 bp of 5' end ...

  11. Adaptability and stability of transgenic soybean lines and cultivars in ...

    African Journals Online (AJOL)

    Subsequently, genotypic adaptability and stability were evaluated by the methods of Eberhart and Russel (1966), Lin and Binns modified by Carneiro, Annicchiarico and Centroid. All methods presented partial coherence on classifying the best genotypes and allowed the identification of the transgenic lines L1 and L4, and ...

  12. Effects of biotic stress caused by Potato virus Y on photosynthesis in ipt transgenic and control Nicotiana tabacum L

    Czech Academy of Sciences Publication Activity Database

    Synková, Helena; Semorádová, Šárka; Schnablová, Renáta; Muller, K.; Pospíšilová, Jana; Ryšlavá, H.; Malbeck, Jiří; Čeřovská, Noemi

    2006-01-01

    Roč. 171, - (2006), s. 607-616 ISSN 0168-9452 R&D Projects: GA ČR GA206/03/0310 Grant - others:Grantová agentura University Karlovy GAUK428/2004/B-Ch/PrF Institutional research plan: CEZ:AV0Z50380511 Keywords : cytokinins * ipt * transgenic tobacco * photosynthesis * Potato virus Y Subject RIV: EF - Botanics Impact factor: 1.631, year: 2006

  13. Extreme resistance to two Brazilian strains of Potato virus Y (PVY in transgenic potato, cv. Achat, expressing the PVYº coat protein Resistência extrema a duas estirpes do Potato virus Y (PVY de batata transgênica, cv. Achat, expressando o gene da capa protéica do PVY O

    Directory of Open Access Journals (Sweden)

    Eduardo Romano

    2001-07-01

    Full Text Available The coat protein (CP gene of the potato virus Y strain "o" (PVY O was introduced into potato, cultivar Achat, via Agrobacterium tumefaciens-mediated transformation. Sixty three putative transgenic lines were challenged against the Brazilian strains PVY-OBR and PVY-NBR. An extremely resistant phenotype, against the two strains, was observed in one line, denominated 1P. No symptoms or positive ELISA results were observed in 16 challenged plants from this line. Another clone, named as 63P, showed a lower level of resistance. Southern blot analysis showed five copies of the CP gene in the extremely resistant line and at least three copies in the other resistant line. The stability of the integrated transgenes in the extreme resistant line was examined during several in vitro multiplications over a period of three years, with no modification in the Southern pattern was observed. The stability of the transgenes, the absence of primary infections and the relatively broad spectrum of resistance suggest that the extremely resistant line obtained in this work can be useful for agricultural purposes.O gene da capa protéica (CP do Potato virus Y estirpe "o", foi introduzido em batata cultivar Achat, via Agrobacterium tumefaciens. Sessenta e três linhas possivelmente transgênicas foram desafiadas com as estirpes brasileiras PVY-OBR e PVY-NBR. Uma linha apresentou extrema resistência às duas estirpes inoculadas, e foi denominado clone 1P. Não foram observados sintomas sistêmicos de infecção e as plantas foram negativas em Elisa. Outra linha, denominada clone 63P, mostrou algum nível de resistência. Análises por Southern blot indicaram a presença de pelo menos cinco cópias do gen CP no clone 1P e pelo menos três cópias no clone 63P. A estabilidade do gene introduzido no clone 1P foi avaliada durante três anos, após várias multiplicações in vitro. Não foram observadas mudanças no padrão do Southern blot. A estabilidade do transgene, na

  14. Case Study: Polycystic Livers in a Transgenic Mouse Line

    Energy Technology Data Exchange (ETDEWEB)

    Lovaglio, Jamie A.; Artwohl, James E.; Ward, Christopher J.; Diekwisch, Thomas G. H.; Ito, Yoshihiro; Fortman, Jeffrey D.

    2014-04-01

    Three mice (2 male, 1 female; age, 5 to 16 mo) from a mouse line transgenic for keratin 14 (K14)-driven LacZ expression and on an outbred Crl:CD1(ICR) background, were identified as having distended abdomens and livers that were diffusely enlarged by numerous cysts (diameter, 0.1 to 2.0 cm). Histopathology revealed hepatic cysts lined by biliary type epithelium and mild chronic inflammation, and confirmed the absence of parasites. Among 21 related mice, 5 additional affected mice were identified via laparotomy. Breeding of these 5 mice (after 5 mo of age) did not result in any offspring; the K14 mice with olycystic livers failed to reproduce. Affected male mice had degenerative testicular lesions, and their sperm was immotile. Nonpolycystic K14 control male mice bred well, had no testicular lesions, and had appropriate sperm motility. Genetic analysis did not identify an association of this phenotype with the transgene or insertion site.

  15. New line selected from irradiated cuttings of sweet potato

    International Nuclear Information System (INIS)

    Lu Shuyun; Wu Chongguang; Li Weiji; Feng Qihuan

    1992-01-01

    Some clonal lines of resistance to black rot were obtained from M 1 V 3 of Xu-18 variety. Through some regional tests, provincial yield trial and production test, the mutant line Nong-Da 601 (12-11-8) as spring sweet potato showed a better yield than the control, the dry matter content of Nong-Da 601 was also better than that of control, further more, the resistance to black rot of mutant selected in M 1 V 3 could be passed onto their progeny. The analysis of esterase isozyme showed zymogram variation between Nong-Da 601 and Xu-18. From the observation of the root tip cells, the chromosome bridge appeared obviously after irradiation, but the frequency of chromosome aberration in M 1 V 6 was decreased almost to the level of control (Xu-18). It seems that the changes of disease resistance from susceptible to resistant by irradiation was not due to chromosome aberration but due to gene mutation

  16. Transgenic potato (Solanum tuberosum) tubers synthesize the full spectrum of inulin molecules naturally occurring in globe artichoke (Cynara scolymus) roots

    Science.gov (United States)

    Hellwege, Elke M.; Czapla, Sylvia; Jahnke, Anuschka; Willmitzer, Lothar; Heyer, Arnd G.

    2000-01-01

    The ability to synthesize high molecular weight inulin was transferred to potato plants via constitutive expression of the 1-SST (sucrose:sucrose 1-fructosyltransferase) and the 1-FFT (fructan: fructan 1-fructosyltransferase) genes of globe artichoke (Cynara scolymus). The fructan pattern of tubers from transgenic potato plants represents the full spectrum of inulin molecules present in artichoke roots as shown by high-performance anion exchange chromatography, as well as size exclusion chromatography. These results demonstrate in planta that the enzymes sucrose:sucrose 1-fructosyltransferase and fructan:fructan 1-fructosyltransferase are sufficient to synthesize inulin molecules of all chain lengths naturally occurring in a given plant species. Inulin made up 5% of the dry weight of transgenic tubers, and a low level of fructan production also was observed in fully expanded leaves. Although inulin accumulation did not influence the sucrose concentration in leaves or tubers, a reduction in starch content occurred in transgenic tubers, indicating that inulin synthesis did not increase the storage capacity of the tubers. PMID:10890908

  17. Potato Annexin STANN1 Promotes Drought Tolerance and Mitigates Light Stress in Transgenic Solanum tuberosum L. Plants

    Science.gov (United States)

    Szalonek, Michal; Sierpien, Barbara; Rymaszewski, Wojciech; Gieczewska, Katarzyna; Garstka, Maciej; Lichocka, Malgorzata; Sass, Laszlo; Paul, Kenny; Vass, Imre; Vankova, Radomira; Dobrev, Peter; Szczesny, Pawel; Marczewski, Waldemar; Krusiewicz, Dominika; Strzelczyk-Zyta, Danuta; Hennig, Jacek; Konopka-Postupolska, Dorota

    2015-01-01

    Annexins are a family of calcium- and membrane-binding proteins that are important for plant tolerance to adverse environmental conditions. Annexins function to counteract oxidative stress, maintain cell redox homeostasis, and enhance drought tolerance. In the present study, an endogenous annexin, STANN1, was overexpressed to determine whether crop yields could be improved in potato (Solanum tuberosum L.) during drought. Nine potential potato annexins were identified and their expression characterized in response to drought treatment. STANN1 mRNA was constitutively expressed at a high level and drought treatment strongly increased transcription levels. Therefore, STANN1 was selected for overexpression analysis. Under drought conditions, transgenic potato plants ectopically expressing STANN1 were more tolerant to water deficit in the root zone, preserved more water in green tissues, maintained chloroplast functions, and had higher accumulation of chlorophyll b and xanthophylls (especially zeaxanthin) than wild type (WT). Drought-induced reductions in the maximum efficiency and the electron transport rate of photosystem II (PSII), as well as the quantum yield of photosynthesis, were less pronounced in transgenic plants overexpressing STANN1 than in the WT. This conferred more efficient non-photochemical energy dissipation in the outer antennae of PSII and probably more efficient protection of reaction centers against photooxidative damage in transgenic plants under drought conditions. Consequently, these plants were able to maintain effective photosynthesis during drought, which resulted in greater productivity than WT plants despite water scarcity. Although the mechanisms underlying this stress protection are not yet clear, annexin-mediated photoprotection is probably linked to protection against light-induced oxidative stress. PMID:26172952

  18. Potato Annexin STANN1 Promotes Drought Tolerance and Mitigates Light Stress in Transgenic Solanum tuberosum L. Plants.

    Science.gov (United States)

    Szalonek, Michal; Sierpien, Barbara; Rymaszewski, Wojciech; Gieczewska, Katarzyna; Garstka, Maciej; Lichocka, Malgorzata; Sass, Laszlo; Paul, Kenny; Vass, Imre; Vankova, Radomira; Dobrev, Peter; Szczesny, Pawel; Marczewski, Waldemar; Krusiewicz, Dominika; Strzelczyk-Zyta, Danuta; Hennig, Jacek; Konopka-Postupolska, Dorota

    2015-01-01

    Annexins are a family of calcium- and membrane-binding proteins that are important for plant tolerance to adverse environmental conditions. Annexins function to counteract oxidative stress, maintain cell redox homeostasis, and enhance drought tolerance. In the present study, an endogenous annexin, STANN1, was overexpressed to determine whether crop yields could be improved in potato (Solanum tuberosum L.) during drought. Nine potential potato annexins were identified and their expression characterized in response to drought treatment. STANN1 mRNA was constitutively expressed at a high level and drought treatment strongly increased transcription levels. Therefore, STANN1 was selected for overexpression analysis. Under drought conditions, transgenic potato plants ectopically expressing STANN1 were more tolerant to water deficit in the root zone, preserved more water in green tissues, maintained chloroplast functions, and had higher accumulation of chlorophyll b and xanthophylls (especially zeaxanthin) than wild type (WT). Drought-induced reductions in the maximum efficiency and the electron transport rate of photosystem II (PSII), as well as the quantum yield of photosynthesis, were less pronounced in transgenic plants overexpressing STANN1 than in the WT. This conferred more efficient non-photochemical energy dissipation in the outer antennae of PSII and probably more efficient protection of reaction centers against photooxidative damage in transgenic plants under drought conditions. Consequently, these plants were able to maintain effective photosynthesis during drought, which resulted in greater productivity than WT plants despite water scarcity. Although the mechanisms underlying this stress protection are not yet clear, annexin-mediated photoprotection is probably linked to protection against light-induced oxidative stress.

  19. Potato Annexin STANN1 Promotes Drought Tolerance and Mitigates Light Stress in Transgenic Solanum tuberosum L. Plants.

    Directory of Open Access Journals (Sweden)

    Michal Szalonek

    Full Text Available Annexins are a family of calcium- and membrane-binding proteins that are important for plant tolerance to adverse environmental conditions. Annexins function to counteract oxidative stress, maintain cell redox homeostasis, and enhance drought tolerance. In the present study, an endogenous annexin, STANN1, was overexpressed to determine whether crop yields could be improved in potato (Solanum tuberosum L. during drought. Nine potential potato annexins were identified and their expression characterized in response to drought treatment. STANN1 mRNA was constitutively expressed at a high level and drought treatment strongly increased transcription levels. Therefore, STANN1 was selected for overexpression analysis. Under drought conditions, transgenic potato plants ectopically expressing STANN1 were more tolerant to water deficit in the root zone, preserved more water in green tissues, maintained chloroplast functions, and had higher accumulation of chlorophyll b and xanthophylls (especially zeaxanthin than wild type (WT. Drought-induced reductions in the maximum efficiency and the electron transport rate of photosystem II (PSII, as well as the quantum yield of photosynthesis, were less pronounced in transgenic plants overexpressing STANN1 than in the WT. This conferred more efficient non-photochemical energy dissipation in the outer antennae of PSII and probably more efficient protection of reaction centers against photooxidative damage in transgenic plants under drought conditions. Consequently, these plants were able to maintain effective photosynthesis during drought, which resulted in greater productivity than WT plants despite water scarcity. Although the mechanisms underlying this stress protection are not yet clear, annexin-mediated photoprotection is probably linked to protection against light-induced oxidative stress.

  20. Cisgenic inhibition of the potato cold induced phosphorylase L gene ...

    African Journals Online (AJOL)

    transgenic line M4), implying that silencing of starch phosphorylase L gene reduced starch breakdown during cold storage conditions. Key words: Cold sweetening, potato (Solanum tuberosum L.), RNA interference, starch phosphorylase L. gene, ...

  1. Alteration of cell wall polysaccharides through transgenic expression of UDP-Glc 4-epimerase-encoding genes in potato tubers.

    Science.gov (United States)

    Huang, Jie-Hong; Kortstee, Anne; Dees, Dianka C T; Trindade, Luisa M; Schols, Henk A; Gruppen, Harry

    2016-08-01

    Uridine diphosphate (UDP)-glucose 4-epimerase (UGE) catalyzes the conversion of UDP-glucose to UDP-galactose. Cell wall materials from the cv. Kardal (wild-type, background) and two UGE transgenic lines (UGE 45-1 and UGE 51-16) were isolated and fractionated. The galactose (Gal) content (mg/100g tuber) from UGE 45-1 transgenic line was 38% higher than that of wild-type, and resulted in longer pectin side chains. The Gal content present in UGE 51-16 was 17% lower than that of wild-type, although most pectin populations maintained the same level of Gal. Both UGE transgenic lines showed unexpectedly a decrease in acetylation and an increase in methyl-esterification of pectin. Both UGE transgenic lines showed similar proportions of homogalacturonan and rhamnogalacturonan I within pectin backbone as the wild-type, except for the calcium-bound pectin fraction exhibiting relatively less rhamnogalacturonan I. Next to pectin modification, xyloglucan populations from both transgenic lines were altered resulting in different XSGG and XXGG proportion in comparison to wild-type. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Epigenetic variants of a transgenic petunia line show hypermethylation in transgene DNA: an indication for specific recognition of foreign DNA in transgenic plants.

    Science.gov (United States)

    Meyer, P; Heidmann, I

    1994-05-25

    We analysed de novo DNA methylation occurring in plants obtained from the transgenic petunia line R101-17. This line contains one copy of the maize A1 gene that leads to the production of brick-red pelargonidin pigment in the flowers. Due to its integration into an unmethylated genomic region the A1 transgene is hypomethylated and transcriptionally active. Several epigenetic variants of line 17 were selected that exhibit characteristic and somatically stable pigmentation patterns, displaying fully coloured, marbled or colourless flowers. Analysis of the DNA methylation patterns revealed that the decrease in pigmentation among the epigenetic variants was correlated with an increase in methylation, specifically of the transgene DNA. No change in methylation of the hypomethylated integration region could be detected. A similar increase in methylation, specifically in the transgene region, was also observed among progeny of R101-17del, a deletion derivative of R101-17 that no longer produces pelargonidin pigments due to a deletion in the A1 coding region. Again de novo methylation is specifically directed to the transgene, while the hypomethylated character of neighbouring regions is not affected. Possible mechanisms for transgene-specific methylation and its consequences for long-term use of transgenic material are discussed.

  3. Impacts on the metabolome of down-regulating polyphenol oxidase in transgenic potato tubers

    Science.gov (United States)

    Tubers of potato (Solanum tuberosum L. cv. Estima) genetically modified (GM) to reduce polyphenol oxidase (PPO) activity and enzymatic discolouration were assessed for changes in the metabolome using Liquid Chromatography-Mass Spectrometry (LC-MS) and Gas Chromatography (GC)-MS. Metabolome changes ...

  4. The influence of Potato virus Y infection on the ultrastructure of Pssu-ipt transgenic tobacco

    Czech Academy of Sciences Publication Activity Database

    Schnablová, Renáta; Synková, Helena; Čeřovská, Noemi

    2005-01-01

    Roč. 166, č. 5 (2005), s. 713-721 ISSN 1058-5893 Institutional research plan: CEZ:AV0Z50380511 Keywords : ultrastructure * viral infection * Potato virus Y-NTN Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.950, year: 2005

  5. [Expression of plant antimicrobial peptide pro-SmAMP2 gene increases resistance of transgenic potato plants to Alternaria and Fusarium pathogens].

    Science.gov (United States)

    Vetchinkina, E M; Komakhina, V V; Vysotskii, D A; Zaitsev, D V; Smirnov, A N; Babakov, A V; Komakhin, R A

    2016-09-01

    The chickweed (Stellaria media L.) pro-SmAMP2 gene encodes the hevein-like peptides that have in vitro antimicrobial activity against certain harmful microorganisms. These peptides play an important role in protecting the chickweed plants from infection, and the pro-SmAMP2 gene was previously used to protect transgenic tobacco and Arabidopsis plants from phytopathogens. In this study, the pro-SmAMP2 gene under control of viral CaMV35S promoter or under control of its own pro-SmAMP2 promoter was transformed into cultivated potato plants of two cultivars, differing in the resistance to Alternaria: Yubiley Zhukova (resistant) and Skoroplodny (susceptible). With the help of quantitative real-time PCR, it was demonstrated that transgenic potato plants expressed the pro-SmAMP2 gene under control of both promoters at the level comparable to or exceeding the level of the potato actin gene. Assessment of the immune status of the transformants demonstrated that expression of antimicrobial peptide pro-SmAMP2 gene was able to increase the resistance to a complex of Alternaria sp. and Fusarium sp. phytopathogens only in potato plants of the Yubiley Zhukova cultivar. The possible role of the pro-SmAMP2 products in protecting potatoes from Alternaria sp. and Fusarium sp. is discussed.

  6. M6: A diploid potato inbred line for use in breeding and genetics research

    Science.gov (United States)

    M6 is a vigorous, homozygous breeding line derived by self-pollinating the diploid wild potato relative Solanum chacoense for seven generations. While most wild Solanum species are self-incompatible, this clone is homozygous for the dominant self-incompatibility inhibitor gene Sli. It is homozygous ...

  7. Design, construction, and testing of an automated NIR in-line analysis system for potatoes. Part I: Off-line NIR feasibility study for the characterization of potato composition

    NARCIS (Netherlands)

    Brunt, K.; Drost, W.C.

    2010-01-01

    An off-line near-infrared reflectance (NIR) feasibility study was conducted to explore the critical steps in the NIR determination of the major potato constituents (dry matter, starch, and protein) in relatively large (10 kg) potato samples. The results were important for the design of an automated

  8. Hybridization of downregulated-COMT transgenic switchgrass lines with field selected switchgrass for improved biomass traits

    Science.gov (United States)

    Transgenic switchgrass (Panicum virgatum L.) has been produced for improved cell walls for biofuels. Downregulated caffeic acid 3-O-methyltransferase (COMT) switchgrass produced significantly more biomass and biofuel than the non-transgenic progenitor line. In the present study we sought to further...

  9. Development of technique on the induction and selection of in vitro mutant lines(Potato, Solanum tuberosum L.)

    International Nuclear Information System (INIS)

    Hong, Joo Bong; Lee, Young Il; Song, Hee Sup; Kim, Jae Sung; Byun, Myung Woo; Lee, Young Keun; Shin, In Chul; Lee, Sang Jae; Lee, Ki Woon; Lim, Yong Taek

    1992-08-01

    The radiosensitivity and salt resistance on the single cell and callus of potato, mass production method of plantlet and microtuber of potato by in vitro culture and microtuber formation from the stem irradiated with radiation were investigated to obtain a optimum condition for selection of mutant cell line. (Author)

  10. Simplified methodology for large scale isolation of homozygous transgenic lines of lettuce

    Directory of Open Access Journals (Sweden)

    Flavia S. Darqui

    2018-01-01

    Conclusions: This protocol allows a simplified scaling-up of the production of multiple homozygous transgenic progeny lines in the early generations avoiding expensive and time-consuming molecular assays.

  11. Stability of transgene expression, field performance and recombination breeding of transformed barley lines

    DEFF Research Database (Denmark)

    Horvath, H.; Jensen, L.G.; Wong, O.T.

    2001-01-01

    in homozygous transgenic T-3 plants, and these remained constant over a 3-year period. In micro-malting experiments, the heat-stable enzyme reached levels of up to 1.4 mug.mg(-1) protein and survived kiln drying at levels of 70-100%. In the field trials of 1997 and 1998 the transgenic lines had a reduced 1000...... lines yielded approximately 6 t.ha(-1) and Golden Promise 7.7 t.ha(-1). Cross-breeding was carried out to transfer the transgene into a more suitable genetic background. Crosses of the semi-dwarf ari-e mutant Golden Promise gave rise to the four morphological phenotypes nutans, high erect, erect...... transformants were observed in some F-4 lines homozygous for the morphological phenotypes and for the transgene. In the case of a homozygous nutans line, the transgenic plants had a higher 1000-grain weight than those lacking the transgene. Like mutants providing useful output traits, transgenic plants...

  12. Selection of maintaining, method for keeping of biologial purity, patternship and health, regarding viruses infection of distinguished potato breeding lines

    Directory of Open Access Journals (Sweden)

    Luiza MIKE

    2008-05-01

    Full Text Available A large number of potato varieties and distinguished breeding lines disappeared as an effect of nonfavourable climatically conditions and especially by viruses diseases, as well as other biological and viruses degeneration. To avoid the negative effect of degeneration on potato varieties and distinguished breeding lines, the method of selection for maintaining and multiplication of potato is applying in Romania in the frame of National Center for Maintaining of potato varieties and distinguished breeding lines Apa Rosie, Covasna County, which belong to the Station for Research and Development of Potato, Targu Secuiesc, Covasna County.In this center are maintained and multiplied all distinguished varieties and breeding centers from Romania (National Institute for research and Development of Potato and Sugar beet Brasov, Research and Development Station for Agriculture Suceava, Research and Development Station for Potato Targu Secuiesc, Research and development Station for Potato Miercurea Ciuc.Using the method of selection for maintaining it is possible an early identification of somatic mutations, disease (especially viruses infection by visual elimination or by serological testing.The viruses’ infection of potato leads to disturbed the metabolism of plants and produces anatomical – morphological alters as: mosaic, crinkle, rolling, browning of leaves and plants deformation.The disturbing of plant metabolism has as negative effect the reduction of vegetation period, decreasing the yield capacity, depreciation of physical and chemical quality of tubers.The genetically complex structure of cultivated potato (2n = 4x = 48 and strong segregation of long – expected characters in the obtained future progeny by sexual hybridization, complicated many times by nonfavourable linkage, are the backgrounds for initiation of maintain selection.

  13. Rhizosphere bacteria affected by transgenic potatoes with antibacterial activities compared with the effects of soil, wild-type potatoes, vegetation stage and pathogen exposure

    NARCIS (Netherlands)

    Rasche, F; Hodl, [No Value; Poll, C; Kandeler, E; Gerzabek, MH; van Elsas, JD; Sessitsch, A

    A greenhouse experiment was performed to analyze a potential effect of genetically modified potatoes expressing antibacterial compounds (attacin/cecropin, T4 lysozyme) and their nearly isogenic, nontransformed parental wild types on rhizosphere bacterial communities. To compare plant

  14. Spatio Temporal Expression Pattern of an Insecticidal Gene (cry2A in Transgenic Cotton Lines

    Directory of Open Access Journals (Sweden)

    Allah BAKHSH

    2012-11-01

    Full Text Available The production of transgenic plants with stable, high-level transgene expression is important for the success of crop improvement programs based on genetic engineering. The present study was conducted to evaluate genomic integration and spatio temporal expression of an insecticidal gene (cry2A in pre-existing transgenic lines of cotton. Genomic integration of cry2A was evaluated using various molecular approaches. The expression levels of cry2A were determined at vegetative and reproductive stages of cotton at regular intervals. These lines showed a stable integration of insecticidal gene in advance lines of transgenic cotton whereas gene expression was found variable with at various growth stages as well as in different plant parts throughout the season. The leaves of transgenic cotton were found to have maximum expression of cry2A gene followed by squares, bolls, anthers and petals. The protein level in fruiting part was less as compared to other parts showing inconsistency in gene expression. It was concluded that for culturing of transgenic crops, strategies should be developed to ensure the foreign genes expression efficient, consistent and in a predictable manner.

  15. Line 63-1: A New Virus-resistant Transgenic Papaya

    NARCIS (Netherlands)

    Tennant, P.; Souza, M.T.; Fitch, M.M.; Manshardt, R.; Slightom, J.L.; Gonsalves, D.

    2005-01-01

    The disease resistance of a transgenic line expressing the coat protein (CP) gene of the mild strain of the papaya ringspot virus (PRSV) from Hawaii was further analyzed against PRSV isolates from Hawaii and other geographical regions. Line 63-1 originated from the same transformation experiment

  16. The genome of cultivated sweet potato contains Agrobacterium T-DNAs with expressed genes: An example of a naturally transgenic food crop.

    Science.gov (United States)

    Kyndt, Tina; Quispe, Dora; Zhai, Hong; Jarret, Robert; Ghislain, Marc; Liu, Qingchang; Gheysen, Godelieve; Kreuze, Jan F

    2015-05-05

    Agrobacterium rhizogenes and Agrobacterium tumefaciens are plant pathogenic bacteria capable of transferring DNA fragments [transfer DNA (T-DNA)] bearing functional genes into the host plant genome. This naturally occurring mechanism has been adapted by plant biotechnologists to develop genetically modified crops that today are grown on more than 10% of the world's arable land, although their use can result in considerable controversy. While assembling small interfering RNAs, or siRNAs, of sweet potato plants for metagenomic analysis, sequences homologous to T-DNA sequences from Agrobacterium spp. were discovered. Simple and quantitative PCR, Southern blotting, genome walking, and bacterial artificial chromosome library screening and sequencing unambiguously demonstrated that two different T-DNA regions (IbT-DNA1 and IbT-DNA2) are present in the cultivated sweet potato (Ipomoea batatas [L.] Lam.) genome and that these foreign genes are expressed at detectable levels in different tissues of the sweet potato plant. IbT-DNA1 was found to contain four open reading frames (ORFs) homologous to the tryptophan-2-monooxygenase (iaaM), indole-3-acetamide hydrolase (iaaH), C-protein (C-prot), and agrocinopine synthase (Acs) genes of Agrobacterium spp. IbT-DNA1 was detected in all 291 cultigens examined, but not in close wild relatives. IbT-DNA2 contained at least five ORFs with significant homology to the ORF14, ORF17n, rooting locus (Rol)B/RolC, ORF13, and ORF18/ORF17n genes of A. rhizogenes. IbT-DNA2 was detected in 45 of 217 genotypes that included both cultivated and wild species. Our finding, that sweet potato is naturally transgenic while being a widely and traditionally consumed food crop, could affect the current consumer distrust of the safety of transgenic food crops.

  17. [Obtaining the transgenic lines of finger millet Eleusine coracana (L.) Gaertn. With dinitroaniline resistance].

    Science.gov (United States)

    Baer, G Ia; Emets, A I; Blium, Ia B

    2014-01-01

    The current data is dedicated to the study of bioballistic and Agrobacterium-mediated transformation of finger millet with the constructs carrying the mutant alpha-tubulin gene (TUAm 1), isolated from R-biotype goosegrass (Eleusine indica L.), for the decision of problem of dinitroaniline-resistance. It was found that 10 microM of trifluralin is optimal for the selection of transgene plants of finger millet. PCR analysis of transformed lines confirmed the transgene nature of plants. The analysis of seed of T1 oftransgene lines confirmed heterozygous character of inheritance of the resistance.

  18. Generation of doubled haploid transgenic wheat lines by microspore transformation.

    Directory of Open Access Journals (Sweden)

    Rhoda A T Brew-Appiah

    Full Text Available Microspores can be induced to develop homozygous doubled haploid plants in a single generation. In the present experiments androgenic microspores of wheat have been genetically transformed and developed into mature homozygous transgenic plants. Two different transformation techniques were investigated, one employing electroporation and the other co-cultivation with Agrobacterium tumefaciens. Different tissue culture and transfection conditions were tested on nine different wheat cultivars using four different constructs. A total of 19 fertile transformants in five genotypes from four market classes of common wheat were recovered by the two procedures. PCR followed by DNA sequencing of the products, Southern blot analyses and bio/histo-chemical and histological assays of the recombinant enzymes confirmed the presence of the transgenes in the T0 transformants and their stable inheritance in homozygous T1∶2 doubled haploid progenies. Several decisive factors determining the transformation and regeneration efficiency with the two procedures were determined: (i pretreatment of immature spikes with CuSO4 solution (500 mg/L at 4°C for 10 days; (ii electroporation of plasmid DNA in enlarged microspores by a single pulse of ∼375 V; (iii induction of microspores after transfection at 28°C in NPB-99 medium and regeneration at 26°C in MMS5 medium; (iv co-cultivation with Agrobacterium AGL-1 cells for transfer of plasmid T-DNA into microspores at day 0 for <24 hours; and (v elimination of AGL-1 cells after co-cultivation with timentin (200-400 mg/L.

  19. Enhanced resistance to blister blight in transgenic tea (Camellia sinensis [L.] O. Kuntze) by overexpression of class I chitinase gene from potato (Solanum tuberosum).

    Science.gov (United States)

    Singh, H Ranjit; Deka, Manab; Das, Sudripta

    2015-07-01

    Tea is the second most consumed beverage in the world. A crop loss of up to 43 % has been reported due to blister blight disease of tea caused by a fungus, Exobasidium vexans. Thus, it directly affects the tea industry qualitatively and quantitatively. Solanum tuberosum class I chitinase gene (AF153195) is a plant pathogenesis-related gene. It was introduced into tea genome via Agrobacterium-mediated transformation with hygromycin phosphotransferase (hpt) gene conferring hygromycin resistance as plant selectable marker. A total of 41 hygromycin resistant plantlets were obtained, and PCR analysis established 12 plantlets confirming about the stable integration of transgene in the plant genome. Real-time PCR detected transgene expression in four transgenic plantlets (T28, C57, C9, and T31). Resistance to biotrophic fungal pathogen, E. vexans, was tested by detached leaf infection assay of greenhouse acclimated plantlets. An inhibitory activity against the fungal pathogen was evident from the detached leaves from the transformants compared with the control. Fungal lesion formed on control plantlet whereas the transgenic plantlets showed resistance to inoculated fungal pathogen by the formation of hypersensitivity reaction area. This result suggests that constitutive expression of the potato class I chitinase gene can be exploited to improve resistance to fungal pathogen, E. vexans, in economical perennial plantation crop like tea.

  20. Beta-cell lines derived from transgenic mice expressing a hybrid insulin gene-oncogene

    DEFF Research Database (Denmark)

    Efrat, S; Linde, S; Kofod, Hans

    1988-01-01

    Three pancreatic beta-cell lines have been established from insulinomas derived from transgenic mice carrying a hybrid insulin-promoted simian virus 40 tumor antigen gene. The beta tumor cell (beta TC) lines maintain the features of differentiated beta cells for about 50 passages in culture. The ...... both to immortalize a rare cell type and to provide a selection for the maintenance of its differentiated phenotype....

  1. Phenotypic performance of transgenic potato (Solanum tuberosum L.) plants with pyramided rice cystatin genes (OCI and OCII)

    Science.gov (United States)

    The evaluation of transgenic plants commonly carried out under controlled conditions in culture rooms and greenhouses can give valuable information about the influence of introduced genes on transgenic plant phenotype. However, an overall assessment of plant performance can only be made by testing t...

  2. Comparative analysis of transformed potato microtubers and its non ...

    African Journals Online (AJOL)

    The rapid progress of transgenic biotechnology has significantly promoted the development and production of genetically modified (GM) crops. The aim of this study was to compare some compositional analysis and genetic variation of transformed potato microtubers (Solanum tuberosum L. Desiree) line (which harbor ...

  3. Development of technique on the induction and selection of in vitro mutant lines (Potato, Solanum tuberosum L.)

    Energy Technology Data Exchange (ETDEWEB)

    Yoo, Jang Ryoel; Lee, Yeong Il; Song, Hee Seop; Kim, Jae Seong; Sin, In Cheol; Lee, Sang Jae; Lee, Ki Un; Lim, Yong Taek [Korea Atomic Energy Res. Inst., Taejon (Korea, Republic of)

    1993-09-01

    For the development of the technique on the plant tissue culture and application of nuclear technique in the in vitro mutation breeding, present research laid emphasis on the development of techniques of potato tissue culture, and on the induction and selection of radiation mutation. Another culture for haploid induction, optimum radiation dosage for cybrid formation of potato and mutation induction from in vitro cultured microtuber and plantlets were investigated for modelling the technique on the induction and selection of in vitro mutant lines. Inheritance stability of the selected mutants were also studied in field condition. In vitro system of micropropagation and selection of mutation was summarized.

  4. Development of technique on the induction and selection of in vitro mutant lines (Potato, Solanum tuberosum L.)

    International Nuclear Information System (INIS)

    Yoo, Jang Ryoel; Lee, Yeong Il; Song, Hee Seop; Kim, Jae Seong; Sin, In Cheol; Lee, Sang Jae; Lee, Ki Un; Lim, Yong Taek

    1993-09-01

    For the development of the technique on the plant tissue culture and application of nuclear technique in the in vitro mutation breeding, present research laid emphasis on the development of techniques of potato tissue culture, and on the induction and selection of radiation mutation. Another culture for haploid induction, optimum radiation dosage for cybrid formation of potato and mutation induction from in vitro cultured microtuber and plantlets were investigated for modelling the technique on the induction and selection of in vitro mutant lines. Inheritance stability of the selected mutants were also studied in field condition. In vitro system of micropropagation and selection of mutation was summarized

  5. FLAX OIL FROM TRANSGENIC LINUM USITATISSIMUM SELECTIVELY INHIBITS IN VITRO PROLIFERATION OF HUMAN CANCER CELL LINES.

    Science.gov (United States)

    Gebarowski, Tomasz; Gebczak, Katarzyna; Wiatrak, Benita; Kulma, Anna; Pelc, Katarzyna; Czuj, Tadeusz; Szopa, Jan; Gasiorowski, Kazimierz

    2017-03-01

    Emulsions made of oils from transgenic flaxseeds significantly decreased in vitro proliferation of six tested human cancer cell lines in 48-h cultures, as assessed with the standard sulforhodamine assay. However, the emulsions also increased proliferation rate of normal human dermal fibroblasts and, to a lower extend, of keratinocytes. Both inhibition of in vitro proliferation of human cancer cell lines and stimulation of proliferation of normal dermal fibroblasts and keratinocytes were especially strong with the emulsion type B and with emulsion type M. Oils from seeds of transgenic flax type B and M should be considered as valuable adjunct to standard cytostatic therapy of human cancers and also could be applied to improve the treatment of skin lesions in wound healing.

  6. RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

    International Nuclear Information System (INIS)

    Wang Tiegu; Huang Qunce; Feng Weisen

    2007-01-01

    Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning

  7. RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

    Science.gov (United States)

    Wang, Tiegu; Huang, Qunce; Feng, Weisen

    2007-10-01

    Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.

  8. RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

    Energy Technology Data Exchange (ETDEWEB)

    Tiegu, Wang [Henan Provincial Key Laboratory of Ion Beam Bio-Engineering, Zhengzhou University, Zhengzhou 450052 (China); Qunce, Huang [Henan Provincial Key Laboratory of Ion Beam Bio-Engineering, Zhengzhou University, Zhengzhou 450052 (China); Weisen, Feng [Luoyang Institute of Agricultural Science, Luoyang 471022 (China)

    2007-10-15

    Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.

  9. Characterization of susceptibility and resistance responses to potato cyst nematode (Globodera spp.) infection of tomato lines in the absence and presence of the broad-spectrum nematode resistance Hero gene.

    Science.gov (United States)

    Sobczak, Miroslaw; Avrova, Anna; Jupowicz, Justyna; Phillips, Mark S; Ernst, Karin; Kumar, Amar

    2005-02-01

    The tomato Hero A gene is the only member of a multigene family that confers a high level (>80%) of resistance to all the economically important pathotypes of potato cyst nematode (PCN) species Globodera rostochiensis and G. pallida. Although the resistance levels of transgenic tomato lines were similar to those of the tomato line LA1792 containing the introgressed Hero multigene family, transgenic potato plants expressing the tomato Hero A gene are not resistant to PCNs. Comparative microscopy studies of in vitro infected roots of PCN-susceptible tomato cv. Money Maker, the resistant breeding line LA1792, and transgenic line L10 with Ro1 pathotype have revealed no statistically significant difference in the number of juveniles invading roots. However, syncytia (specialized feeding cells) induced in LA1792 and L10 roots mostly were found to have degenerated a few days after their induction, and a few surviving syncytia were able to support only the development of males rather than females. Thus, the ratio between males and females was biased towards males on LA1792 and L10 roots. A series of changes occur in resistant plants leading to formation of a layer of necrotic cells separating the syncytium from stellar conductive tissues and this is followed by degradation of the syncytium. Although the Hero A gene is expressed in all tissues, including roots, stems, leaves, and flower buds, its expression is upregulated in roots in response to PCN infection. Moreover, the expression profiles of the Hero A correlates with the timing of death of the syncytium.

  10. Potato transformation and potato cyst nematode infection on potato plantlets in tissue culture

    Science.gov (United States)

    These two protocols describe the methods for generating transgenic potato plants and for evaluating potato cyst nematode (Globodera rostochiensis and G. pallida) infection on potato plantlets in tissue culture. These methods are useful tools that can be used in the study of the interactions between ...

  11. Evaluation of the agronomic performance of atrazine-tolerant transgenic japonica rice parental lines for utilization in hybrid seed production.

    Directory of Open Access Journals (Sweden)

    Luhua Zhang

    Full Text Available Currently, the purity of hybrid seed is a crucial limiting factor when developing hybrid japonica rice (Oryza sativa L.. To chemically control hybrid seed purity, we transferred an improved atrazine chlorohydrolase gene (atzA from Pseudomonas ADP into hybrid japonica parental lines (two maintainers, one restorer, and Nipponbare, by using Agrobacterium-mediated transformation. We subsequently selected several transgenic lines from each genotype by using PCR, RT-PCR, and germination analysis. In the presence of the investigated atrazine concentrations, particularly 150 µM atrazine, almost all of the transgenic lines produced significantly larger seedlings, with similar or higher germination percentages, than did the respective controls. Although the seedlings of transgenic lines were taller and gained more root biomass compared to the respective control plants, their growth was nevertheless inhibited by atrazine treatment compared to that without treatment. When grown in soil containing 2 mg/kg or 5 mg/kg atrazine, the transgenic lines were taller, and had higher total chlorophyll contents than did the respective controls; moreover, three of the strongest transgenic lines completely recovered after 45 days of growth. After treatment with 2 mg/kg or 5 mg/kg of atrazine, the atrazine residue remaining in the soil was 2.9-7.0% or 0.8-8.7% respectively, for transgenic lines, and 44.0-59.2% or 28.1-30.8%, respectively, for control plants. Spraying plants at the vegetative growth stage with 0.15% atrazine effectively killed control plants, but not transgenic lines. Our results indicate that transgenic atzA rice plants show tolerance to atrazine, and may be used as parental lines in future hybrid seed production.

  12. Characterization of gastric adenocarcinoma cell lines established from CEA424/SV40 T antigen-transgenic mice with or without a human CEA transgene

    International Nuclear Information System (INIS)

    Nöckel, Jessica; Engel, Natasja K van den; Winter, Hauke; Hatz, Rudolf A; Zimmermann, Wolfgang; Kammerer, Robert

    2006-01-01

    Gastric carcinoma is one of the most frequent cancers worldwide. Patients with gastric cancer at an advanced disease stage have a poor prognosis, due to the limited efficacy of available therapies. Therefore, the development of new therapies, like immunotherapy for the treatment of gastric cancer is of utmost importance. Since the usability of existing preclinical models for the evaluation of immunotherapies for gastric adenocarcinomas is limited, the goal of the present study was to establish murine in vivo models which allow the stepwise improvement of immunotherapies for gastric cancer. Since no murine gastric adenocarcinoma cell lines are available we established four cell lines (424GC, mGC3, mGC5, mGC8) from spontaneously developing tumors of CEA424/SV40 T antigen (CEA424/Tag) mice and three cell lines derived from double-transgenic offsprings of CEA424/Tag mice mated with human carcinoembryonic antigen (CEA)-transgenic (CEA424/Tag-CEA) mice (mGC2 CEA , mGC4 CEA , mGC11 CEA ). CEA424/Tag is a transgenic C57BL/6 mouse strain harboring the Tag under the control of a -424/-8 bp CEA gene promoter which leads to the development of invasive adenocarcinoma in the glandular stomach. Tumor cell lines established from CEA424/Tag-CEA mice express the well defined tumor antigen CEA under the control of its natural regulatory elements. The epithelial origin of the tumor cells was proven by morphological criteria including the presence of mucin within the cells and the expression of the cell adhesion molecules EpCAM and CEACAM1. All cell lines consistently express the transgenes CEA and/or Tag and MHC class I molecules leading to their susceptibility to lysis by Tag-specific CTL in vitro. Despite the presentation of CTL-epitopes derived from the transgene products the tumor cell lines were tumorigenic when grafted into C57BL/6, CEA424/Tag or CEA424/Tag-CEA-transgenic hosts and no significant differences in tumor take and tumor growth were observed in the different hosts

  13. GENETIC TRANSFORMATION AND ANALYSIS OF WHEAT TRANSGENIC CELL LINES BY IRAP-PCR

    Directory of Open Access Journals (Sweden)

    Bavol A. V.

    2013-12-01

    Full Text Available The transgenic wheat cell lines were obtained via biolistic transformation of the callus cultures initiated from the 3-day-old sterile seedling shoot apexes. The pAHC25 vector construction used for 14- and 28-day-old callus cultures transformation carried the selective phosphinothricin-N-acetyltransferase (bar gene and reporter ?-glucuronidase gene. The cell line selection was carried out on the media with phosphinothricin by means of graduated cell selection. The transgenic status of the obtained forms was proved by PCR-analysis. The presence of new relatively high molecular (more than 1 000 bp amplicons were found out for three transformed lines by means of IRAP PCRanalysis with the primers coding for long termainal repeats sequences of SIRE 1 retrotransposon. This fact may prove transposition of this mobile genetic element. The new DNA fragments were detected for three of the seven analyzed lines but for the control callus. It is possible to assume at induction of SIRE 1 transposition bis probably caused by the genomic stress of foreign DNA inserting or associated with the transformation process (mechanical wounding, cultivation on selective media.

  14. Production of human papillomavirus type16 E7 oncoprotein fused with ß-glucuronidase in transgenic tomato and potato

    Czech Academy of Sciences Publication Activity Database

    Bříza, Jindřich; Pavingerová, Daniela; Vlasák, Josef; Ludvíková, V.; Niedermeierová, Hana

    2007-01-01

    Roč. 51, č. 2 (2007), s. 268-276 ISSN 0006-3134 R&D Projects: GA ČR GA521/05/2092 Institutional research plan: CEZ:AV0Z50510513 Keywords : transgenic plants * human papillomavirus Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.259, year: 2007

  15. A hybrid Bacillus thuringiensis delta-endotoxin gene gives resistance against a coleopteran and a lepidopteran pest in transgenic potato

    NARCIS (Netherlands)

    Naimov, S.; Dukiandjiev, S.; Maagd, de R.A.

    2003-01-01

    Expression of Bacillus thuringiensis delta-endotoxins has proven to be a successful strategy for obtaining insect resistance in transgenic plants. Drawbacks of expression of a single resistance gene are the limited target spectrum and the potential for rapid adaptation of the pest. Hybrid toxins

  16. Establishment of a pig fibroblast-derived cell line for locus-directed transgene expression in cell cultures and blastocysts

    DEFF Research Database (Denmark)

    Jakobsen, Jannik E; Li, Juan; Moldt, Brian

    2011-01-01

    We report the establishment of a spontaneously immortalized pig cell line designated Pig Flip-in Visualize (PFV) for locus-directed transgene expression in pig cells and blastocysts. The PFV cell line was isolated from pig ear fibroblasts transfected with a Sleeping Beauty DNA transposon-based do......We report the establishment of a spontaneously immortalized pig cell line designated Pig Flip-in Visualize (PFV) for locus-directed transgene expression in pig cells and blastocysts. The PFV cell line was isolated from pig ear fibroblasts transfected with a Sleeping Beauty DNA transposon...

  17. Development of transgenic Brassica juncea lines for reduced seed sinapine content by perturbing phenylpropanoid pathway genes.

    Directory of Open Access Journals (Sweden)

    Sachin Kajla

    Full Text Available Sinapine is a major anti-nutritive compound that accumulates in the seeds of Brassica species. When ingested, sinapine imparts gritty flavuor in meat and milk of animals and fishy odor to eggs of brown egg layers, thereby compromising the potential use of the valuable protein rich seed meal. Sinapine content in Brassica juncea germplasm ranges from 6.7 to 15.1 mg/g of dry seed weight (DSW which is significantly higher than the prescribed permissible level of 3.0 mg/g of DSW. Due to limited natural genetic variability, conventional plant breeding approach for reducing the sinapine content has largely been unsuccessful. Hence, transgenic approach for gene silencing was adopted by targeting two genes-SGT and SCT, encoding enzymes UDP- glucose: sinapate glucosyltransferase and sinapoylglucose: choline sinapoyltransferase, respectively, involved in the final two steps of sinapine biosynthetic pathway. These two genes were isolated from B. juncea and eight silencing constructs were developed using three different RNA silencing approaches viz. antisense RNA, RNAi and artificial microRNA. Transgenics in B. juncea were developed following Agrobacterium-mediated transformation. From a total of 1232 independent T0 transgenic events obtained using eight silencing constructs, 25 homozygous lines showing single gene inheritance were identified in the T2 generation. Reduction of seed sinapine content in these lines ranged from 15.8% to 67.2%; the line with maximum reduction had sinapine content of 3.79 mg/g of DSW. The study also revealed that RNAi method was more efficient than the other two methods used in this study.

  18. Caffeoylquinic Acids Generated In Vitro in a High-Anthocyanin-Accumulating Sweet potato Cell Line

    Directory of Open Access Journals (Sweden)

    Izabela Konczak

    2004-01-01

    Full Text Available Accumulation of phenolic compounds has been monitored in a suspension culture of anthocyanin-accumulating sweet potato cell line grown under the conditions of modified Murashige and Skoog high-anthocyanin production medium (APM over a period of 24 days. Tissue samples extracted with 15% acetic acid were analysed using HPLC at a detection wavelength of 326 nm. Among others, the following derivatives of caffeoylquinic acids were detected: 4,5-dicaffeoylquinic acid, 3,5-dicaffeoylquinic acid, 3,4-dicaffeoylquinic acid, and 3,4,5-tricaffeoylquinic acid. Their total amount reached a maximum of 110 mg/gFW between the 4th and the 15th day of culture growth on APM. The major compound of the phenolic mixture was 3,5-dicaffeoylquinic acid with maximum accumulation level of 80 mg/100 gFW. The potential effects of targeted phenolic compounds on the nutraceutical qualities of in vitro produced anthocyanin-rich extracts are discussed.

  19. Transgenic Xenopus laevis Line for In Vivo Labeling of Nephrons within the Kidney

    Directory of Open Access Journals (Sweden)

    Mark E. Corkins

    2018-04-01

    Full Text Available Xenopus laevis embryos are an established model for studying kidney development. The nephron structure and genetic pathways that regulate nephrogenesis are conserved between Xenopus and humans, allowing for the study of human disease-causing genes. Xenopus embryos are also amenable to large-scale screening, but studies of kidney disease-related genes have been impeded because assessment of kidney development has largely been limited to examining fixed embryos. To overcome this problem, we have generated a transgenic line that labels the kidney. We characterize this cdh17:eGFP line, showing green fluorescent protein (GFP expression in the pronephric and mesonephric kidneys and colocalization with known kidney markers. We also demonstrate the feasibility of live imaging of embryonic kidney development and the use of cdh17:eGFP as a kidney marker for secretion assays. Additionally, we develop a new methodology to isolate and identify kidney cells for primary culture. We also use morpholino knockdown of essential kidney development genes to establish that GFP expression enables observation of phenotypes, previously only described in fixed embryos. Taken together, this transgenic line will enable primary kidney cell culture and live imaging of pronephric and mesonephric kidney development. It will also provide a simple means for high-throughput screening of putative human kidney disease-causing genes.

  20. Transgenic mice produced by retroviral transduction of male germ-line stem cells

    OpenAIRE

    Nagano, Makoto; Brinster, Clayton J.; Orwig, Kyle E.; Ryu, Buom-Yong; Avarbock, Mary R.; Brinster, Ralph L.

    2001-01-01

    Male germ-line stem cells are the only cell type in postnatal mammals that have the capability to self-renew and to contribute genes to the next generation. Genetic modification of these cells would provide an opportunity to study the biology of their complex self-renewal and differentiation processes, as well as enable the generation of transgenic animals in a wide range of species. Although retroviral vectors have been used as an efficient method to introduce genes into a variety of cell ty...

  1. Auxin synthesis gene tms1 driven by tuber-specific promoter alters hormonal status of transgenic potato plants and their responses to exogenous phytohormones.

    Science.gov (United States)

    Kolachevskaya, Oksana O; Sergeeva, Lidiya I; Floková, Kristyna; Getman, Irina A; Lomin, Sergey N; Alekseeva, Valeriya V; Rukavtsova, Elena B; Buryanov, Yaroslav I; Romanov, Georgy A

    2017-03-01

    Ectopic auxin overproduction in transgenic potato leads to enhanced productivity accompanied with concerted and occasional changes in hormonal status, and causing altered response of transformants to exogenous auxin or cytokinin. Previously, we generated potato transformants expressing Agrobacterium-derived auxin synthesis gene tms1 driven by tuber-specific patatin gene promoter (B33-promoter). Here, we studied the endogenous hormonal status and the response to exogenous phytohormones in tms1 transformants cultured in vitro. Adding indole-3-acetic acid (IAA) or kinetin to culture medium affected differently tuberization of tms1-transformed and control plants, depending also on sucrose content in the medium. Exogenous phytohormones ceased to stimulate the tuber initiation in transformants at high (5-8%) sucrose concentration, while in control plants the stimulation was observed in all experimental settings. Furthermore, exogenous auxin partly inhibited the tuber initiation, and exogenous cytokinin reduced the average tuber weight in most transformants at high sucrose content. The elevated auxin level in tubers of the transformants was accompanied with a decrease in content of cytokinin bases and their ribosides in tubers and most shoots. No concerted changes in contents of abscisic, jasmonic, salicylic acids and gibberellins in tubers were detected. The data on hormonal status indicated that the enhanced productivity of tms1 transformants was due to auxin and not mediated by other phytohormones. In addition, exogenous cytokinin was shown to upregulate the expression of genes encoding orthologs of auxin receptors. Overall, the results showed that tms1 expression and local increase in IAA level in transformants affect both the balance of endogenous cytokinins and the dynamics of tuberization in response to exogenous hormones (auxin, cytokinin), the latter reaction depending also on the carbohydrate supply. We introduce a basic model for the hormonal network

  2. A human beta cell line with drug inducible excision of immortalizing transgenes

    Science.gov (United States)

    Benazra, Marion; Lecomte, Marie-José; Colace, Claire; Müller, Andreas; Machado, Cécile; Pechberty, Severine; Bricout-Neveu, Emilie; Grenier-Godard, Maud; Solimena, Michele; Scharfmann, Raphaël; Czernichow, Paul; Ravassard, Philippe

    2015-01-01

    Objectives Access to immortalized human pancreatic beta cell lines that are phenotypically close to genuine adult beta cells, represent a major tool to better understand human beta cell physiology and develop new therapeutics for Diabetes. Here we derived a new conditionally immortalized human beta cell line, EndoC-βH3 in which immortalizing transgene can be efficiently removed by simple addition of tamoxifen. Methods We used lentiviral mediated gene transfer to stably integrate a tamoxifen inducible form of CRE (CRE-ERT2) into the recently developed conditionally immortalized EndoC βH2 line. The resulting EndoC-βH3 line was characterized before and after tamoxifen treatment for cell proliferation, insulin content and insulin secretion. Results We showed that EndoC-βH3 expressing CRE-ERT2 can be massively amplified in culture. We established an optimized tamoxifen treatment to efficiently excise the immortalizing transgenes resulting in proliferation arrest. In addition, insulin expression raised by 12 fold and insulin content increased by 23 fold reaching 2 μg of insulin per million cells. Such massive increase was accompanied by enhanced insulin secretion upon glucose stimulation. We further observed that tamoxifen treated cells maintained a stable function for 5 weeks in culture. Conclusions EndoC βH3 cell line represents a powerful tool that allows, using a simple and efficient procedure, the massive production of functional non-proliferative human beta cells. Such cells are close to genuine human beta cells and maintain a stable phenotype for 5 weeks in culture. PMID:26909308

  3. A comparative study on pathological features of transgenic rat lines expressing either three or four repeat misfolded tau.

    Science.gov (United States)

    Valachova, Bernadeta; Brezovakova, Veronika; Bugos, Ondrej; Jadhav, Santosh; Smolek, Tomas; Novak, Petr; Zilka, Norbert

    2018-08-01

    Human tauopathies represent a heterogeneous group of neurodegenerative disorders characterized by distinct clinical features, typical histopathological structures, and defined ratio(s) of three-repeat and four-repeat tau isoforms within pathological aggregates. How the optional microtubule-binding repeat of tau influences this differentiation of pathologies is understudied. We have previously generated and characterized transgenic rodent models expressing human truncated tau aa151-391 with either three (SHR24) or four microtubule-binding repeats (SHR72). Here, we compare the behavioral and neuropathological hallmarks of these two transgenic lines using a battery of tests for sensorimotor, cognitive, and neurological functions over the age range of 3.5-15 months. Progression of sensorimotor and neurological deficits was similar in both transgenic lines; however, the lifespan of transgenic line SHR72 expressing truncated four-repeat tau was markedly shorter than SHR24. Moreover, the expression of three or four-repeat tau induced distinct neurofibrillary pathology in these lines. Transgenic lines displayed different distribution of tau pathology and different type of neurofibrillary tangles. Our results suggest that three- and four-repeat isoforms of tau may display different modes of action in the diseased brain. © 2018 Wiley Periodicals, Inc.

  4. The behaviour of certain potato varieties and lines towards the attack of the Phytophthora infestans (Mont de Bary fungus

    Directory of Open Access Journals (Sweden)

    Daniela POPA

    2008-05-01

    Full Text Available This paper presents the behaviour of some potato varieties and lines towards the attack of the Phytophthora infestans (Mont de Bary fungus under the field conditions of the Potato Research and Development Station, Targu-Secuiesc. During the observed period (2001-2003 the appearance of new forms of attack was registered, for example the attack on the stem, on the leaf petioles, as well as a greater number of infected tubers. The greatest number of blighted stems belonged to the varieties Sante and Ostara, and the smallest one was registered in the case of the variety Lady Roseta, followed by Desiree and Nemere. The results prove that there is a direct relationship between the frequency of the attack on the stems and that of the blighted tubers in the case of every variety, except for the varieties Lady Roseta and Nemere at which the smallest number of infected tubers was registered.

  5. The use of molecular approaches in overcoming salinity stress in potato plants (abstract)

    International Nuclear Information System (INIS)

    Hmida-Sayari, A.; Jaoura, S.; Gargouri-Bouzid, R.

    2005-01-01

    Proline is known as compatible osmolyte accumulated by plant cells in response to salt and drought stresses. It is supposed to be an osmoprotectant involved in the protection of cellular structures under osmotic stress. Therefore, in an attempt to increase salt tolerance in potato, a pyrroline-5-carboxylate synthetase (P5CS) cDNA. Arabidopsis thaliana was transferred to potato plants via Agrobacterium-mediated transformation. This enzyme is responsible for conversion of glutamate to delta-pyrroline-5-carboxylate that is reduced to Proline. The resulting transgenic potato plants showed an important increase in Pro production levels compared to non-transgenic plants. This Proline accumulation was particularly enhanced in the presence of salt up to 100 mM NaCl. The transgenic potato plants showed also an improved tolerance to salinity through an increase of the tuber yield. Indeed the potato tuber yield in such transgenic lines was much less altered than in the non-transgenic plants. (author)

  6. Expression levels of antimicrobial peptide tachyplesin I in transgenic Ornithogalum lines affect the resistance to Pectobacterium infection.

    Science.gov (United States)

    Lipsky, Alexander; Joshi, Janak Raj; Carmi, Nir; Yedidia, Iris

    2016-11-20

    The genus Ornithogalum includes several ornamental species that suffer substantial losses from bacterial soft rot caused by Pectobacteria. The absence of effective control measures for use against soft rot bacteria led to the initiation of a project in which a small antimicrobial peptide from an Asian horseshoe crab, tachyplesin (tpnI), was introduced into two commercial cultivars: O. dubium and O. thyrsoides. Disease severity and bacterial colonization were examined in transgenic lines expressing this peptide. Disease resistance was evaluated in six lines of each species by measuring bacterial proliferation in the plant tissue. Three transgenic lines of each species were subjected to further analysis in which the expression level of the transgene was evaluated using RT-PCR and qRT-PCR. The development of disease symptoms and bacterial colonization of the plant tissue were also examined using GFP-expressing strain of P. carotovorum subsp. brasiliense Pcb3. Confocal-microscopy imaging revealed significantly reduced quantities of bacterial cells in the transgenic plant lines that had been challenged with the bacterium. The results clearly demonstrate that tpnI expression reduces bacterial proliferation, colonization and disease symptom (reduced by 95-100%) in the transgenic plant tissues. The quantity of tpnI transcripts, as measured by qRT-PCR, was negatively correlated with the protection afforded to the plants, as measured by the reduced severity of disease symptoms in the tissue. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Compositional and toxicological analysis of a GM potato line with reduced α-solanine content – A 90-day feeding study in the Syrian Golden hamster

    DEFF Research Database (Denmark)

    Langkilde, Søren; Schrøder, Malene; Frank, Thomas

    2012-01-01

    Steroidal glycoalkaloids (GAs) are toxins, produced by plants of the Solanaceae family. The potato plant (Solanum tuberosum L.) and its tubers predominantly contain the two GAs α-chaconine and α-solanine. These compounds are believed to act in synergy, and the degree of toxicity may therefore...... for compositional similarity by analysing for a range of potato constituents, and (2) used in a 90-day feeding trial with the Syrian Golden hamster to study differential toxicity. The animal feeding study used diets with up to 60% freeze-dried potato powder from either line. Whilst data indicated some compositional...... concerns with regard to human (or animal) consumption....

  8. Transgenic Chinese hamster V79 cell lines which exhibit variable levels of gpt mutagenesis

    International Nuclear Information System (INIS)

    Klein, C.B.; Rossman, T.G.

    1990-01-01

    The Escherichia coli gpt gene coding for xanthine-guanine phosphoribosyl transferase has been stably transfected into HPRT - Chinese hamster V79 cells. Several gpt - cell lines have been established, which retain the sequence(s) even after long-term culture without selection for gpt. While spontaneous mutagenesis to gpt - occurs rather frequently for most cell lines, it cannot be correlated with either the number of plasmid integration sites or deletion of the plasmid sequence(s). One transgenic cell line (g12), which continuously maintains a low spontaneous mutation frequency was used in comparative mutagenesis studies with wild-type V79 cells (gpt vs. hprt). Alkylating agents such as N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) and β-propiolactone (BPL) are shown to be equally toxic and mutagenic in both g12 and V79 cells. UV and X-rays are also equally toxic to both cell lines. The data presented here suggests that g12 cells may be useful to study mammalian mutagenesis by agents which yield limited response at the hprt locus

  9. Oral immunization with rotavirus VP7 expressed in transgenic potatoes induced high titers of mucosal neutralizing IgA

    International Nuclear Information System (INIS)

    Wu Yuzhang; Li Jintao; Mou Zhirong; Fei Lei; Ni Bing; Geng Miao; Jia Zhengcai; Zhou Wei; Zou Liyun; Tang Yan

    2003-01-01

    Rotaviruses (RV) are a common cause of severe diarrhea in young children, resulting in nearly one million deaths worldwide annually. Rotavirus VP7 was the rotavirus neutralizing protein. Previous study reported that VP7 DNA vaccine can induce high levels of IgG in mice but cannot protect mice against challenge (Choi, A.H., Basu, M., Rae, M.N., McNeal, M.M., Ward, R.L., 1998. Virology 250, 230-240). We found that rotavirus VP7 could maintain its neutralizing immunity when it was transformed into the potato genome. Mice immunized with the transformed tubers successfully elicited serum IgG and mucosal IgA specific for VP7. The mucosal IgA titer was as high as 1000, while serum IgG titer was only 600. Neutralizing assays indicated that IgA could neutralize rotavirus. These results indicate the potential usefulness of plants for production and delivery of edible rotavirus vaccines

  10. Effect of transgenic Bacillus thuringiensis rice lines on mortality and feeding behavior of rice stem borers (Lepidoptera: Crambidae).

    Science.gov (United States)

    Chen, Hao; Zhang, Guoan; Zhang, Qifa; Lin, Yongjun

    2008-02-01

    Ten transgenic Bacillus thuringiensis Bt rice, Oryza sativa L., lines with different Bt genes (two Cry1Ac lines, three Cry2A lines, and five Cry9C lines) derived from the same variety Minghui 63 were evaluated in both the laboratory and the field. Bioassays were conducted by using the first instars of two main rice lepidopteran insect species: yellow stem borer, Scirpophaga incertulas (Walker) and Asiatic rice borer, Chilo suppressalis (Walker). All transgenic lines exhibited high toxicity to these two rice borers. Field evaluation results also showed that all transgenic lines were highly insect resistant with both natural infestation and manual infestation of the neonate larvae of S. incertulas compared with the nontransformed Minghui63. Bt protein concentrations in leaves of 10 transgenic rice lines were estimated by the sandwich enzyme-linked immunosorbent assay. The cry9C gene had the highest expression level, next was cry2A gene, and the cry1Ac gene expressed at the lowest level. The feeding behavior of 7-d-old Asiatic rice borer to three classes of Bt transgenic rice lines also was detected by using rice culm cuttings. The results showed that 7-d-old larvae of Asiatic rice borer have the capacity to distinguish Bt and non-Bt culm cuttings and preferentially fed on non-Bt cuttings. When only Bt culm cuttings with three classes of different Bt proteins (CrylAc, Cry2A, and Cry9C) were fed, significant distribution difference of 7-d-old Asiatic rice borer in culm cuttings of different Bt proteins also was found. In the current study, we evaluate different Bt genes in the same rice variety in both the laboratory and the field, and also tested feeding behavior of rice insect to these Bt rice. These data are valuable for the further development of two-toxin Bt rice and establishment of appropriate insect resistance management in the future.

  11. Lactation Defect in a Widely Used MMTV-Cre Transgenic Line of Mice

    Science.gov (United States)

    Yuan, Taichang; Wang, Yongping; Pao, Lily; Anderson, Steve M.; Gu, Haihua

    2011-01-01

    Background MMTV-Cre mouse lines have played important roles in our understanding about the functions of numerous genes in mouse mammary epithelial cells during mammary gland development and tumorigenesis. However, numerous studies have not included MMTV-Cre mice as controls, and many investigators have not indicated which of the different MMTV-Cre founder lines were used in their studies. Here, we describe a lactation defect that severely limits the use of one of the most commonly used MMTV-Cre founder lines. Methodology/Principal Findings To explore the role of protein tyrosine phosphatase Shp1 in mammary gland development, mice bearing the floxed Shp1 gene were crossed with MMTV-Cre mice and mammary gland development was examined by histological and biochemical techniques, while lactation competency was assessed by monitoring pup growth. Surprisingly, both the Shp1fl/+;MMTV-Cre and MMTV-Cre female mice displayed a severe lactation defect when compared to the Shp1 fl/+ control mice. Histological and biochemical analyses reveal that female mice expressing the MMTV-Cre transgene, either alone or in combination with floxed genes, exhibit defects in lobuloalveolar expansion, presence of large cytoplasmic lipid droplets in luminal alveolar epithelial cells postpartum, and precocious induction of involution. Using a PCR-based genotyping method, the three different founder lines can be distinguished, and we determined that the MMTV-Cre line A, the most widely used MMTV-Cre founder line, exhibits a profound lactation defect that limits its use in studies on mammary gland development. Conclusions/Significance The identification of a lactation defect in the MMTV-Cre line A mice indicates that investigators must use MMTV-Cre alone mice as control in studies that utilize Cre recombinase to excise genes of interest from mammary epithelial cells. Our results also suggest that previous results obtained in studies using the MMTV-Cre line A line should be re-evaluated if the

  12. Development of transgenic cotton lines expressing Allium sativum agglutinin (ASAL) for enhanced resistance against major sap-sucking pests.

    Science.gov (United States)

    Vajhala, Chakravarthy S K; Sadumpati, Vijaya Kumar; Nunna, Hariprasad Rao; Puligundla, Sateesh Kumar; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2013-01-01

    Mannose-specific Allium sativum leaf agglutinin encoding gene (ASAL) and herbicide tolerance gene (BAR) were introduced into an elite cotton inbred line (NC-601) employing Agrobacterium-mediated genetic transformation. Cotton transformants were produced from the phosphinothricin (PPT)-resistant shoots obtained after co-cultivation of mature embryos with the Agrobacterium strain EHA105 harbouring recombinant binary vector pCAMBIA3300-ASAL-BAR. PCR and Southern blot analysis confirmed the presence and stable integration of ASAL and BAR genes in various transformants of cotton. Basta leaf-dip assay, northern blot, western blot and ELISA analyses disclosed variable expression of BAR and ASAL transgenes in different transformants. Transgenes, ASAL and BAR, were stably inherited and showed co-segregation in T1 generation in a Mendelian fashion for both PPT tolerance and insect resistance. In planta insect bioassays on T2 and T3 homozygous ASAL-transgenic lines revealed potent entomotoxic effects of ASAL on jassid and whitefly insects, as evidenced by significant decreases in the survival, development and fecundity of the insects when compared to the untransformed controls. Furthermore, the transgenic cotton lines conferred higher levels of resistance (1-2 score) with minimal plant damage against these major sucking pests when bioassays were carried out employing standard screening techniques. The developed transgenics could serve as a potential genetic resource in recombination breeding aimed at improving the pest resistance of cotton. This study represents the first report of its kind dealing with the development of transgenic cotton resistant to two major sap-sucking insects.

  13. Activity of the promoter of the Lhca3.St.1 gene, encoding the potato apoprotein 2 of the light-harvesting complex of Photosystem I, in transgenic potato and tobacco plants

    NARCIS (Netherlands)

    Nap, Jan; VANSPANJE, M; Dirkse, W.G.; BAARDA, G; Mlynarova, L; Loonen, A.; GRONDHUIS, P; STIEKEMA, WJ

    We have isolated cDNA and genomic clones for the potato (Solanum tuberosum) apoprotein 2 of the light harvesting complex of Photosystem 1, designated Lhca3.St.l. The protein shows all characteristics of the family of chlorophyll a/b-binding proteins. Potato Lhca3.1 gene expression occurs

  14. Analysis of T-DNA/Host-Plant DNA Junction Sequences in Single-Copy Transgenic Barley Lines

    Directory of Open Access Journals (Sweden)

    Joanne G. Bartlett

    2014-01-01

    Full Text Available Sequencing across the junction between an integrated transfer DNA (T-DNA and a host plant genome provides two important pieces of information. The junctions themselves provide information regarding the proportion of T-DNA which has integrated into the host plant genome, whilst the transgene flanking sequences can be used to study the local genetic environment of the integrated transgene. In addition, this information is important in the safety assessment of GM crops and essential for GM traceability. In this study, a detailed analysis was carried out on the right-border T-DNA junction sequences of single-copy independent transgenic barley lines. T-DNA truncations at the right-border were found to be relatively common and affected 33.3% of the lines. In addition, 14.3% of lines had rearranged construct sequence after the right border break-point. An in depth analysis of the host-plant flanking sequences revealed that a significant proportion of the T-DNAs integrated into or close to known repetitive elements. However, this integration into repetitive DNA did not have a negative effect on transgene expression.

  15. Zebrafish transgenic line huORFZ is an effective living bioindicator for detecting environmental toxicants.

    Directory of Open Access Journals (Sweden)

    Hung-Chieh Lee

    Full Text Available Reliable animal models are invaluable for monitoring the extent of pollution in the aquatic environment. In this study, we demonstrated the potential of huORFZ, a novel transgenic zebrafish line that harbors a human upstream open reading frame of the chop gene fused with GFP reporter, as an animal model for monitoring environmental pollutants and stress-related cellular processes. When huORFZ embryos were kept under normal condition, no leaked GFP signal could be detected. When treated with hazardous chemicals, including heavy metals and endocrine-disrupting chemicals near their sublethal concentrations (LC50, huORFZ embryos exhibited different tissue-specific GFP expression patterns. For further analysis, copper (Cu2+, cadmium (Cd2+ and Chlorpyrifos were applied. Cu2+ triggered GFP responses in skin and muscle, whereas Cd2+ treatment triggered GFP responses in skin, olfactory epithelium and pronephric ducts. Moreover, fluorescence intensity, as exhibited by huORFZ embryos, was dose-dependent. After surviving treated embryos were returned to normal condition, survival rates, as well as TUNEL signals, returned to pretreatment levels with no significant morphological defects observed. Such results indicated the reversibility of treatment conditions used in this study, as long as embryos survived such conditions. Notably, GFP signals decreased along with recovery, suggesting that GFP signaling of huORFZ embryos likely reflected the overall physiological condition of the individual. To examine the performance of the huORFZ line under real-world conditions, we placed huORFZ embryos in different river water samples. We found that the huORFZ embryos correctly detected the presence of various kinds of pollutants. Based on these findings, we concluded that such uORFchop-based system can be integrated into a first-line water alarm system monitoring the discharge of hazardous pollutants.

  16. Zebrafish Transgenic Line huORFZ Is an Effective Living Bioindicator for Detecting Environmental Toxicants

    Science.gov (United States)

    Chu, Chien; Li, Hong-Ping; Tsai, Huai-Jen

    2014-01-01

    Reliable animal models are invaluable for monitoring the extent of pollution in the aquatic environment. In this study, we demonstrated the potential of huORFZ, a novel transgenic zebrafish line that harbors a human upstream open reading frame of the chop gene fused with GFP reporter, as an animal model for monitoring environmental pollutants and stress-related cellular processes. When huORFZ embryos were kept under normal condition, no leaked GFP signal could be detected. When treated with hazardous chemicals, including heavy metals and endocrine-disrupting chemicals near their sublethal concentrations (LC50), huORFZ embryos exhibited different tissue-specific GFP expression patterns. For further analysis, copper (Cu2+), cadmium (Cd2+) and Chlorpyrifos were applied. Cu2+ triggered GFP responses in skin and muscle, whereas Cd2+ treatment triggered GFP responses in skin, olfactory epithelium and pronephric ducts. Moreover, fluorescence intensity, as exhibited by huORFZ embryos, was dose-dependent. After surviving treated embryos were returned to normal condition, survival rates, as well as TUNEL signals, returned to pretreatment levels with no significant morphological defects observed. Such results indicated the reversibility of treatment conditions used in this study, as long as embryos survived such conditions. Notably, GFP signals decreased along with recovery, suggesting that GFP signaling of huORFZ embryos likely reflected the overall physiological condition of the individual. To examine the performance of the huORFZ line under real-world conditions, we placed huORFZ embryos in different river water samples. We found that the huORFZ embryos correctly detected the presence of various kinds of pollutants. Based on these findings, we concluded that such uORFchop-based system can be integrated into a first-line water alarm system monitoring the discharge of hazardous pollutants. PMID:24594581

  17. Temperature-dependent regulation of sugar metabolism in wild-type and low-invertase transgenic chipping potatoes during and after cooling for low-temperature storage

    Science.gov (United States)

    Regulation of sugar metabolism in cold-stored potato tubers has significant ramifications for potato chip and French fry producers and consumers. Though low-temperature storage reduces losses due to sprouting and disease, it induces accumulation of the reducing sugars glucose and fructose. These rea...

  18. Impact of transgenic potatoes expressing anti-bacterial agents on bacterial endophytes is comparable with the effects of plant genotype, soil type and pathogen infection

    NARCIS (Netherlands)

    Rasche, F; Velvis, H; Zachow, C; Berg, G; Van Elsas, JD; Sessitsch, A

    1. Blackleg and soft rot disease of potatoes Solanum tuberosum L., mainly caused by the bacterial pathogen Erwinia carotovora ssp. atrospetica (Eca), lead to enormous yield losses world-wide. Genetically modified (GM) potatoes producing anti-bacterial agents, such as cecropin/attacin and T4

  19. Impact of transgenic potatoes expressing anti-bacterial agents on bacterial endophytes is comparable with the effects of plant genotype, soil type and pathogen infection

    NARCIS (Netherlands)

    Rasche, F.; Velvis, H.; Zachow, C.; Berg, G.; Elsas, van J.D.; Sessitsch, A.

    2006-01-01

    1. Blackleg and soft rot disease of potatoes Solanum tuberosum L., mainly caused by the bacterial pathogen Erwinia carotovora ssp. atrospetica (Eca), lead to enormous yield losses world-wide. Genetically modified (GM) potatoes producing anti-bacterial agents, such as cecropin/attacin and T4

  20. Investigating the application of a nitroreductase-expressing transgenic zebrafish line for high-throughput toxicity testing

    Directory of Open Access Journals (Sweden)

    Anna C. Chlebowski

    Full Text Available Nitroreductase enzymes are responsible for the reduction of nitro functional groups to amino functional groups, and are found in a range of animal models, zebrafish (Danio rerio excluded. Transgenic zebrafish models have been developed for tissue-specific cell ablation, which use nitroreductase to ablate specific tissues or cell types following exposure to the non-toxic pro-drug metronidazole (MTZ. When metabolized by nitroreductase, MTZ produces a potent cytotoxin, which specifically ablates the tissue in which metabolism occurs. Uses, beyond tissue-specific cell ablation, are possible for the hepatocyte-specific Tg(l-fabp:CFP-NTRs891 zebrafish line, including investigations of the role of nitroreductase in the toxicity of nitrated compounds. The hepatic ablation characteristics of this transgenic line were explored, in order to expand its potential uses. Embryos were exposed at 48, 72, or 96 h post fertilization (hpf to a range of MTZ concentrations, and the ablation profiles were compared. Ablation occurred at a 10-fold lower concentration than previously reported. Embryos were exposed to a selection of other compounds, with and without MTZ, in order to investigate alternative uses for this transgenic line. Test compounds were selected based on: their ability to undergo nitroreduction, known importance of hepatic metabolism to toxicity, and known pharmaceutical hepatotoxins. Selected compounds included nitrated polycyclic aromatic hydrocarbons (nitro-PAHs, the PAHs retene and benzo[a]pyrene, and the pharmaceuticals acetaminophen and flutamide. The results suggest a range of potential roles of the liver in the toxicity of these compounds, and highlight the additional uses of this transgenic model in toxicity testing. Keywords: Zebrafish, Transgenic, Nitroreductase, Nitrated polycyclic aromatic hydrocarbon, Tissue ablation, Pharmaceuticals

  1. Germline recombination in a novel Cre transgenic line, Prl3b1-Cre mouse.

    Science.gov (United States)

    Al-Soudy, Al-Sayed; Nakanishi, Tsuyoshi; Mizuno, Seiya; Hasegawa, Yoshikazu; Shawki, Hossam H; Katoh, Megumi C; Basha, Walaa A; Ibrahim, Abdelaziz E; El-Shemy, Hany A; Iseki, Hiroyoshi; Yoshiki, Atsushi; Hiromori, Youhei; Nagase, Hisamitsu; Takahashi, Satoru; Oishi, Hisashi; Sugiyama, Fumihiro

    2016-07-01

    Spermatogenesis is a complex and highly regulated process by which spermatogonial stem cells differentiate into spermatozoa. To better understand the molecular mechanisms of the process, the Cre/loxP system has been widely utilized for conditional gene knockout in mice. In this study, we generated a transgenic mouse line that expresses Cre recombinase under the control of the 2.5 kbp of the Prolactin family 3, subfamily b, member 1 (Prl3b1) gene promoter (Prl3b1-cre). Prl3b1 was initially reported to code for placental lactogen 2 (PL-2) protein in placenta along with increased expression toward the end of pregnancy. PL-2 was found to be expressed in germ cells in the testis, especially in spermatocytes. To analyze the specificity and efficiency of Cre recombinase activity in Prl3b1-cre mice, the mice were mated with reporter R26GRR mice, which express GFP ubiquitously before and tdsRed exclusively after Cre recombination. The systemic examination of Prl3b1-cre;R26GRR mice revealed that tdsRed-positive cells were detected only in the testis and epididymis. Fluorescence imaging of Prl3b1-cre;R26GRR testes suggested that Cre-mediated recombination took place in the germ cells with approximately 74% efficiency determined by in vitro fertilization. In conclusion, our results suggest that the Prl3b1-cre mice line provides a unique resource to understand testicular germ-cell development. genesis 54:389-397, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  2. Effects of plant genotype and growth stage on the structure of bacterial communities associated with potato (Solanum tuberosum L.)

    NARCIS (Netherlands)

    Overbeek, van L.S.; Elsas, van J.D.

    2008-01-01

    The effects of genotype, plant growth and experimental factors (soil and year) on potato-associated bacterial communities were studied. Cultivars Achirana Inta, Désirée, Merkur and transgenic Désirée line DL12 (containing T4 lysozyme gene) were assessed in two field experiments. Cross-comparisons

  3. Effects of plant genotype and growth stage on the structure of bacterial communities associated with potato (Solanum tuberosum L.)

    NARCIS (Netherlands)

    van Overbeek, Leo; van Elsas, Jan Dirk

    The effects of genotype, plant growth and experimental factors (soil and year) on potato-associated bacterial communities were studied. Cultivars Achirana Inta, Desiree, Merkur and transgenic Desiree line DL12 (containing T4 lysozyme gene) were assessed in two field experiments. Cross-comparisons

  4. Role of the durum wheat dehydrin in the function of proteases conferring salinity tolerance in Arabidopsis thaliana transgenic lines.

    Science.gov (United States)

    Saibi, Walid; Zouari, Nabil; Masmoudi, Khaled; Brini, Faiçal

    2016-04-01

    Dehydrins are claimed to stabilize macromolecules against freezing damage, dehydration, ionic or osmotic stresses, thermal stress and re-folding yield. However, their precise function remains unknown. In this context, we report the behavior of protease activities in dehydrin transgenic Arabidopsis lines against the wild type plant under salt stress (100mM NaCl). Indeed, proteases play key roles in plants, maintaining strict protein quality control and degrading specific sets of proteins in response to diverse environmental and developmental stimuli. We proved that durum wheat DHN-5 modulates the activity of some proteases, summarized on the promotion of the Cysteinyl protease and the decrease of the Aspartyl protease activity. This fact is also upgraded in salt stress conditions. We conclude that the dehydrin transgenic context encodes salinity tolerance in transgenic lines through the modulation of the interaction not only at transcriptional level but also at protein level and also with the impact of salt stress as an endogenous and exogenous effector on some biocatalysts like proteases. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Two types of Tet-On transgenic lines for doxycycline-inducible gene expression in zebrafish rod photoreceptors and a gateway-based tet-on toolkit.

    Directory of Open Access Journals (Sweden)

    Leah J Campbell

    Full Text Available The ability to control transgene expression within specific tissues is an important tool for studying the molecular and cellular mechanisms of development, physiology, and disease. We developed a Tet-On system for spatial and temporal control of transgene expression in zebrafish rod photoreceptors. We generated two transgenic lines using the Xenopus rhodopsin promoter to drive the reverse tetracycline-controlled transcriptional transactivator (rtTA, one with self-reporting GFP activity and one with an epitope tagged rtTA. The self-reporting line includes a tetracycline response element (TRE-driven GFP and, in the presence of doxycycline, expresses GFP in larval and adult rods. A time-course of doxycycline treatment demonstrates that maximal induction of GFP expression, as determined by the number of GFP-positive rods, is reached within approximately 24 hours of drug treatment. The epitope-tagged transgenic line eliminates the need for the self-reporting GFP activity by expressing a FLAG-tagged rtTA protein. Both lines demonstrate strong induction of TRE-driven transgenes from plasmids microinjected into one-cell embryos. These results show that spatial and temporal control of transgene expression can be achieved in rod photoreceptors. Additionally, system components are constructed in Gateway compatible vectors for the rapid cloning of doxycycline-inducible transgenes and use in other areas of zebrafish research.

  6. Generation of an ABCG2GFPn-puro transgenic line - A tool to study ABCG2 expression in mice

    International Nuclear Information System (INIS)

    Orford, Michael; Mean, Richard; Lapathitis, George; Genethliou, Nicholas; Panayiotou, Elena; Panayi, Helen; Malas, Stavros

    2009-01-01

    The ATP-binding cassette (ABC) transporter 2 (ABCG2) is expressed by stem cells in many organs and in stem cells of solid tumors. These cells are isolated based on the side population (SP) phenotype, a Hoechst 3342 dye efflux property believed to be conferred by ABCG2. Because of the limitations of this approach we generated transgenic mice that express Nuclear GFP (GFPn) coupled to the Puromycin-resistance gene, under the control of ABCG2 promoter/enhancer sequences. We show that ABCG2 is expressed in neural progenitors of the developing forebrain and spinal cord and in embryonic and adult endothelial cells of the brain. Using the neurosphere assay, we isolated tripotent ABCG2-expressing neural stem cells from embryonic mouse brain. This transgenic line is a powerful tool for studying the expression of ABCG2 in many tissues and for performing functional studies in different experimental settings.

  7. Generation of an ABCG2{sup GFPn-puro} transgenic line - A tool to study ABCG2 expression in mice

    Energy Technology Data Exchange (ETDEWEB)

    Orford, Michael; Mean, Richard; Lapathitis, George; Genethliou, Nicholas; Panayiotou, Elena; Panayi, Helen [The Cyprus Institute of Neurology and Genetics, Airport Avenue, No. 6, Agios Dometios 2370, Nicosia (Cyprus); Malas, Stavros, E-mail: smalas@cing.ac.cy [The Cyprus Institute of Neurology and Genetics, Airport Avenue, No. 6, Agios Dometios 2370, Nicosia (Cyprus); Department of Biological Sciences, University of Cyprus, P.O. Box 20537, 1678 Nicosia (Cyprus)

    2009-06-26

    The ATP-binding cassette (ABC) transporter 2 (ABCG2) is expressed by stem cells in many organs and in stem cells of solid tumors. These cells are isolated based on the side population (SP) phenotype, a Hoechst 3342 dye efflux property believed to be conferred by ABCG2. Because of the limitations of this approach we generated transgenic mice that express Nuclear GFP (GFPn) coupled to the Puromycin-resistance gene, under the control of ABCG2 promoter/enhancer sequences. We show that ABCG2 is expressed in neural progenitors of the developing forebrain and spinal cord and in embryonic and adult endothelial cells of the brain. Using the neurosphere assay, we isolated tripotent ABCG2-expressing neural stem cells from embryonic mouse brain. This transgenic line is a powerful tool for studying the expression of ABCG2 in many tissues and for performing functional studies in different experimental settings.

  8. Characterisation of the p53 pathway in cell lines established from TH-MYCN transgenic mouse tumours.

    Science.gov (United States)

    Chen, Lindi; Esfandiari, Arman; Reaves, William; Vu, Annette; Hogarty, Michael D; Lunec, John; Tweddle, Deborah A

    2018-03-01

    Cell lines established from the TH-MYCN transgenic murine model of neuroblastoma are a valuable preclinical, immunocompetent, syngeneic model of neuroblastoma, for which knowledge of their p53 pathway status is important. In this study, the Trp53 status and functional response to Nutlin-3 and ionising radiation (IR) were determined in 6 adherent TH-MYCN transgenic cell lines using Sanger sequencing, western blot analysis and flow cytometry. Sensitivity to structurally diverse MDM2 inhibitors (Nutlin-3, MI-63, RG7388 and NDD0005) was determined using XTT proliferation assays. In total, 2/6 cell lines were Trp53 homozygous mutant (NHO2A and 844MYCN+/+) and 1/6 (282MYCN+/-) was Trp53 heterozygous mutant. For 1/6 cell lines (NHO2A), DNA from the corresponding primary tumour was found to be Trp53 wt. In all cases, the presence of a mutation was consistent with aberrant p53 signalling in response to Nutlin-3 and IR. In comparison to TP53 wt human neuroblastoma cells, Trp53 wt murine control and TH-MYCN cell lines were significantly less sensitive to growth inhibition mediated by MI-63 and RG7388. These murine Trp53 wt and mutant TH-MYCN cell lines are useful syngeneic, immunocompetent neuroblastoma models, the former to test p53-dependent therapies in combination with immunotherapies, such as anti-GD2, and the latter as models of chemoresistant relapsed neuroblastoma when aberrations in the p53 pathway are more common. The spontaneous development of Trp53 mutations in 3 cell lines from TH-MYCN mice may have arisen from MYCN oncogenic driven and/or ex vivo selection. The identified species-dependent selectivity of MI-63 and RG7388 should be considered when interpreting in vivo toxicity studies of MDM2 inhibitors.

  9. T-DNA integration patterns in transgenic maize lines mediated by ...

    African Journals Online (AJOL)

    Jane

    2011-10-03

    Oct 3, 2011 ... locus can have profound effects on the level and stability of transgene ..... Thane N, Henke J, Wang T, Ruppert J, Shah N, Rotter K, Hodges J, ... Chia JM, Deragon JM, Estill JC, Fu Y, Jeddeloh JA, Han YJ, Lee H,. Li PH, Lisch ...

  10. N. plumbaginifolia zeaxanthin epoxidase transgenic lines have unaltered baseline ABA accumulations in roots and xylem sap, but contrasting sensitivities of ABA accumulation to water deficit.

    Science.gov (United States)

    Borel, C; Audran, C; Frey, A; Marion-Poll, A; Tardieu, F; Simonneau, T

    2001-03-01

    A series of transgenic lines of Nicotiana plumbaginifolia with modified expression of zeaxanthin epoxidase gene (ZEP) provided contrasting ABA accumulation in roots and xylem sap. For mild water stress, concentration of ABA in the xylem sap ([ABA](xylem)) was clearly lower in plants underexpressing ZEP mRNA (complemented mutants and antisense transgenic lines) than in wild-type. In well-watered conditions, all lines presented similar [ABA](xylem) and similar ABA accumulation rates in detached roots. Plants could, therefore, be grown under normal light intensities and evaporative demand. Both ZEP mRNA abundance and ABA accumulation rate in roots increased with water deficit in all transgenic lines, except in complemented aba2-s1 mutants in which the ZEP gene was controlled by a constitutive promoter which does not respond to water deficit. These lines presented no change in root ABA content either with time or dehydration. The increase in ZEP mRNA abundance in roots with decreasing RWC was more pronounced in detached roots than in whole plants, suggesting a difference in mechanism. In all transgenic lines, a linear relationship was observed between predawn leaf water potential and [ABA](xylem), which could be reproduced in several experiments in the greenhouse and in the growth chamber. It is therefore possible to represent the effect of the transformation by a single parameter, thereby allowing the use of a quantitative approach to assist understanding of the behaviour of transgenic lines.

  11. Promoter, transgene, and cell line effects in the transfection of mammalian cells using PDMAEMA-based nano-stars

    Directory of Open Access Journals (Sweden)

    Alexander Raup

    2016-09-01

    Full Text Available Non-viral transfection protocols are typically optimized using standard cells and reporter proteins, potentially underestimating cellular or transgene effects. Here such effects were studied for two human (Jurkat, HEK-293 and two rodent (CHO-K1, L929 cell lines and three fluorescent reporter proteins. Expression of the enhanced green fluorescent protein (EGFP was studied under the control of the human elongation factor 1 alpha promoter and three viral promoters (SV40, SV40/enhancer, CMV, that of ZsYellow1 (yellow fluorescence and mCherry (red fluorescence for the CMV promoter. Results varied with the cell line, in particular for the Jurkat cells. Pair-wise co-transfection of the CMV controlled transgenes resulted in a significant fraction of monochromatic cells (EGFP for EGFP/YFP and EGFP/RFP co-transfections, YFP in case of YFP/RFP co-transfections. Only Jurkat cells were almost incapable of expressing YFP. Dilution of the plasmid DNA with a non-expressed plasmid showed cell line dependent effects on transfection efficiency and/or expression levels.

  12. Transgene inheritances and genetic similarities of near isogenic lines of genetically modified common beans Herança de transgenes e similaridade genética de linhagens quase isogênicas de feijoeiro-comum geneticamente modificado

    Directory of Open Access Journals (Sweden)

    Patrícia Valle Pinheiro

    2009-09-01

    Full Text Available The objective of the present work was to determine the inheritance and stability of transgenes of a transgenic bean line expressing the genes rep-trap-ren from Bean golden mosaic virus and the bar gene. Crosses were done between the transgenic line and four commercial bean cultivars, followed by four backcrosses to the commercial cultivars. Progenies from each cross were evaluated for the presence of the transgenes by brushing the leaves with glufosinate ammonium and by polymerase chain reaction using specific oligonucleotides. Advanced generations were rub-inoculated with an isolate of Bean common mosaic necrosis virus (BCMNV. The transgenes were inherited consistently in a Mendelian pattern in the four crosses studied. The analyzed lines recovered close to 80% of the characteristics of the recurrent parent, as determined by the random amplified DNA markers used, besides maintaining important traits such as resistance to BCMNV. The presence of the transgene did not cause any detectable undesirable effect in the evaluated progenies.O objetivo do presente trabalho foi determinar a herança e a estabilidade de transgenes de uma linhagem de feijoeiro-comum com expressão dos genes rep-trap-ren, do Bean golden mosaic virus, e do gene bar. Foram realizados cruzamentos entre a linhagem transgênica e quatro cultivares comerciais de feijão, seguidos de quatro retrocruzamentos. As progênies de cada cruzamento foram avaliadas quanto à presença dos transgenes, com aplicação do glifosinato de amônia nas folhas e por meio da reação da polimerase em cadeia com uso de oligonucleotídeos específicos. O vírus do mosaico comum necrótico do feijoeiro, Bean common mosaic necrosis virus (BCMNV, foi inoculado mecanicamente nas gerações avançadas. Os transgenes foram herdados em padrão mendeliano nos quatro cruzamentos estudados. As linhagens analisadas apresentaram cerca de 80% das características do parental recorrente, conforme determinado por an

  13. Comparison of the rhizosphere bacterial communities of Zigongdongdou soybean and a high-methionine transgenic line of this cultivar.

    Directory of Open Access Journals (Sweden)

    Jingang Liang

    Full Text Available Previous studies have shown that methionine from root exudates affects the rhizosphere bacterial population involved in soil nitrogen fixation. A transgenic line of Zigongdongdou soybean cultivar (ZD91 that expresses Arabidopsis cystathionine γ-synthase resulting in an increased methionine production was examined for its influence to the rhizosphere bacterial population. Using 16S rRNA gene-based pyrosequencing analysis of the V4 region and DNA extracted from bacterial consortia collected from the rhizosphere of soybean plants grown in an agricultural field at the pod-setting stage, we characterized the populational structure of the bacterial community involved. In total, 87,267 sequences (approximately 10,908 per sample were analyzed. We found that Acidobacteria, Proteobacteria, Bacteroidetes, Actinobacteria, Chloroflexi, Planctomycetes, Gemmatimonadetes, Firmicutes, and Verrucomicrobia constitute the dominant taxonomic groups in either the ZD91 transgenic line or parental cultivar ZD, and that there was no statistically significant difference in the rhizosphere bacterial community structure between the two cultivars.

  14. Altered Tuber Yield in Genetically Modified High-Amylose and Oil Potato Lines Is Associated With Changed Whole-Plant Nitrogen Economy

    Directory of Open Access Journals (Sweden)

    Fereshteh Pourazari

    2018-03-01

    Full Text Available Breeding for improved crop quality traits can affect non-target traits related to growth and resource use, and these effects may vary in different cultivation conditions (e. g., greenhouse vs. field. The objectives of this study are to investigate the growth and whole-plant nitrogen (N economy of two genetically modified (GM potato lines compared to their non-GM parental varieties and when grown in different cultivation conditions. A high-amylose GM potato line and its parent were grown under field and greenhouse conditions for one growing season in Sweden; and a GM oil potato line and its parent were grown in greenhouse conditions only. Tuber yield, above ground biomass, N uptake efficiency and other plant N economy traits were assessed. In both cultivation conditions, the GM lines produced between 1.5 and two times more tubers as compared with their parents. In the greenhouse, fresh tuber yield and N uptake efficiency were unaffected by the genetic modifications, but the GM-lines produced less tuber biomass per plant-internal N compared to their parents. In the field, the fresh tuber yield was 40% greater in the high-amylose line as compared with its parent; the greater fresh tuber yield in the high-amylose GM line was accomplished by higher water allocation to the harvested tubers, and associated with increased N recovery from soil (+20%, N uptake efficiency (+53%, tuber N content (+20%, and N accumulation (+120% compared with the non-GM parent. The cultivation conditions influenced the yield and N economy. For example, the final fresh above-ground plant biomass and N pool were considerably higher in the greenhouse conditions, whilst the tuber yield was higher in the field conditions. In conclusion, the genetic modification inducing high accumulation of amylose in potato tubers affected several non-target traits related to plant N economy, and increased the plant N uptake and accumulation efficiency of the field-grown plants. Due to strongly

  15. Altered Tuber Yield in Genetically Modified High-Amylose and Oil Potato Lines Is Associated With Changed Whole-Plant Nitrogen Economy.

    Science.gov (United States)

    Pourazari, Fereshteh; Andersson, Mariette; Weih, Martin

    2018-01-01

    Breeding for improved crop quality traits can affect non-target traits related to growth and resource use, and these effects may vary in different cultivation conditions (e. g., greenhouse vs. field). The objectives of this study are to investigate the growth and whole-plant nitrogen (N) economy of two genetically modified (GM) potato lines compared to their non-GM parental varieties and when grown in different cultivation conditions. A high-amylose GM potato line and its parent were grown under field and greenhouse conditions for one growing season in Sweden; and a GM oil potato line and its parent were grown in greenhouse conditions only. Tuber yield, above ground biomass, N uptake efficiency and other plant N economy traits were assessed. In both cultivation conditions, the GM lines produced between 1.5 and two times more tubers as compared with their parents. In the greenhouse, fresh tuber yield and N uptake efficiency were unaffected by the genetic modifications, but the GM-lines produced less tuber biomass per plant-internal N compared to their parents. In the field, the fresh tuber yield was 40% greater in the high-amylose line as compared with its parent; the greater fresh tuber yield in the high-amylose GM line was accomplished by higher water allocation to the harvested tubers, and associated with increased N recovery from soil (+20%), N uptake efficiency (+53%), tuber N content (+20%), and N accumulation (+120%) compared with the non-GM parent. The cultivation conditions influenced the yield and N economy. For example, the final fresh above-ground plant biomass and N pool were considerably higher in the greenhouse conditions, whilst the tuber yield was higher in the field conditions. In conclusion, the genetic modification inducing high accumulation of amylose in potato tubers affected several non-target traits related to plant N economy, and increased the plant N uptake and accumulation efficiency of the field-grown plants. Due to strongly increased

  16. Establishment of a transgenic zebrafish line for superficial skin ablation and functional validation of apoptosis modulators in vivo.

    Directory of Open Access Journals (Sweden)

    Chi-Fang Chen

    Full Text Available BACKGROUND: Zebrafish skin is composed of enveloping and basal layers which form a first-line defense system against pathogens. Zebrafish epidermis contains ionocytes and mucous cells that aid secretion of acid/ions or mucous through skin. Previous studies demonstrated that fish skin is extremely sensitive to external stimuli. However, little is known about the molecular mechanisms that modulate skin cell apoptosis in zebrafish. METHODOLOGY/PRINCIPAL FINDINGS: This study aimed to create a platform to conduct conditional skin ablation and determine if it is possible to attenuate apoptotic stimuli by overexpressing potential apoptosis modulating genes in the skin of live animals. A transgenic zebrafish line of Tg(krt4:NTR-hKikGR(cy17 (killer line, which can conditionally trigger apoptosis in superficial skin cells, was first established. When the killer line was incubated with the prodrug metrodinazole, the superficial skin displayed extensive apoptosis as judged by detection of massive TUNEL- and active caspase 3-positive signals. Great reductions in NTR-hKikGR(+ fluorescent signals accompanied epidermal cell apoptosis. This indicated that NTR-hKikGR(+ signal fluorescence can be utilized to evaluate apoptotic events in vivo. After removal of metrodinazole, the skin integrity progressively recovered and NTR-hKikGR(+ fluorescent signals gradually restored. In contrast, either crossing the killer line with testing lines or transiently injecting the killer line with testing vectors that expressed human constitutive active Akt1, mouse constitutive active Stat3, or HPV16 E6 element displayed apoptosis-resistant phenotypes to cytotoxic metrodinazole as judged by the loss of reduction in NTR-hKikGR(+ fluorescent signaling. CONCLUSION/SIGNIFICANCE: The killer/testing line binary system established in the current study demonstrates a nitroreductase/metrodinazole system that can be utilized to conditionally perform skin ablation in a real-time manner, and

  17. The role of the potato (Solanum tuberosum) CCD8 gene in stolon and tuber development.

    Science.gov (United States)

    Pasare, Stefania A; Ducreux, Laurence J M; Morris, Wayne L; Campbell, Raymond; Sharma, Sanjeev K; Roumeliotis, Efstathios; Kohlen, Wouter; van der Krol, Sander; Bramley, Peter M; Roberts, Alison G; Fraser, Paul D; Taylor, Mark A

    2013-06-01

    · Strigolactones (SLs) are a class of phytohormones controlling shoot branching. In potato (Solanum tuberosum), tubers develop from underground stolons, diageotropic stems which originate from basal stem nodes. As the degree of stolon branching influences the number and size distribution of tubers, it was considered timely to investigate the effects of SL production on potato development and tuber life cycle. · Transgenic potato plants were generated in which the CAROTENOID CLEAVAGE DIOXYGENASE8 (CCD8) gene, key in the SL biosynthetic pathway, was silenced by RNA interference (RNAi). · The resulting CCD8-RNAi potato plants showed significantly more lateral and main branches than control plants, reduced stolon formation, together with a dwarfing phenotype and a lack of flowering in the most severely affected lines. New tubers were formed from sessile buds of the mother tubers. The apical buds of newly formed transgenic tubers grew out as shoots when exposed to light. In addition, we found that CCD8 transcript levels were rapidly downregulated in tuber buds by the application of sprout-inducing treatments. · These results suggest that SLs could have an effect, solely or in combination with other phytohormones, in the morphology of potato plants and also in controlling stolon development and maintaining tuber dormancy. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

  18. Pectin engineering to modify product quality in potato.

    Science.gov (United States)

    Ross, Heather A; Morris, Wayne L; Ducreux, Laurence J M; Hancock, Robert D; Verrall, Susan R; Morris, Jenny A; Tucker, Gregory A; Stewart, Derek; Hedley, Pete E; McDougall, Gordon J; Taylor, Mark A

    2011-10-01

    Although processed potato tuber texture is an important trait that influences consumer preference, a detailed understanding of tuber textural properties at the molecular level is lacking. Previous work has identified tuber pectin methyl esterase (PME) activity as a potential factor impacting on textural properties, and the expression of a gene encoding an isoform of PME (PEST1) was associated with cooked tuber textural properties. In this study, a transgenic approach was undertaken to investigate further the impact of the PEST1 gene. Antisense and over-expressing potato lines were generated. In over-expressing lines, tuber PME activity was enhanced by up to 2.3-fold; whereas in antisense lines, PME activity was decreased by up to 62%. PME isoform analysis indicated that the PEST1 gene encoded one isoform of PME. Analysis of cell walls from tubers from the over-expressing lines indicated that the changes in PME activity resulted in a decrease in pectin methylation. Analysis of processed tuber texture demonstrated that the reduced level of pectin methylation in the over-expressing transgenic lines was associated with a firmer processed texture. Thus, there is a clear link between PME activity, pectin methylation and processed tuber textural properties. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  19. Sensory and rheological properties of transgenically and chemically modified starch ingredients as evaluated in a food product model

    DEFF Research Database (Denmark)

    Ahmt, T.; Wischmann, Bente; Blennow, A.

    2004-01-01

    gels with a higher tendency to retrograde and a low freeze/thaw stability as compared to starches with shorter amylopectin chains and lower phosphorous content. The textural properties of the food product model prepared from genetically and chemically modified starches were characterised by sensory......Starches derived from five genetically modified potato lines, two chemically modified potato starches and two native starches from potato and maize were subjected to physical and chemical analyses and their functionality evaluated in a milk-based food product model. The transgenic starches were...... and rheological analyses. To clearly visualise the effects of the modifications, data was evaluated by radar plots and multiple regression analysis (chemometrics). Genetically modified potato starches with longer amylopectin chains and increased phosphorous content gave a more gelled and a shorter texture...

  20. A transgenic mouse line for molecular genetic analysis of excitatory glutamatergic neurons

    DEFF Research Database (Denmark)

    Borgius, Lotta; Restrepo, C. Ernesto; Leao, Richardson N.

    2010-01-01

    Excitatory glutamatergic neurons are part of most of the neuronal circuits in the mammalian nervous system. We have used BAC-technology to generate a BAC-Vglut2::Cre mouse line where Cre expression is driven by the vesicular glutamate transporter 2 (Vglut2) promotor. This BAC-Vglut2::Cre mouse line...... showed specific expression of Cre in Vglut2 positive cells in the spinal cord with no ectopic expression in GABAergic or glycinergic neurons. This mouse line also showed specific Cre expression in Vglut2 positive structures in the brain such as thalamus, hypothalamus, superior colliculi, inferior...... colliculi and deep cerebellar nuclei together with nuclei in the midbrain and hindbrain. Cre-mediated recombination was restricted to Cre expressing cells in the spinal cord and brain and occurred as early as E 12.5. Known Vglut2 positive neurons showed normal electrophysiological properties in the BAC...

  1. A Phox2b BAC Transgenic Rat Line Useful for Understanding Respiratory Rhythm Generator Neural Circuitry.

    Directory of Open Access Journals (Sweden)

    Keiko Ikeda

    Full Text Available The key role of the respiratory neural center is respiratory rhythm generation to maintain homeostasis through the control of arterial blood pCO2/pH and pO2 levels. The neuronal network responsible for respiratory rhythm generation in neonatal rat resides in the ventral side of the medulla and is composed of two groups; the parafacial respiratory group (pFRG and the pre-Bötzinger complex group (preBötC. The pFRG partially overlaps in the retrotrapezoid nucleus (RTN, which was originally identified in adult cats and rats. Part of the pre-inspiratory (Pre-I neurons in the RTN/pFRG serves as central chemoreceptor neurons and the CO2 sensitive Pre-I neurons express homeobox gene Phox2b. Phox2b encodes a transcription factor and is essential for the development of the sensory-motor visceral circuits. Mutations in human PHOX2B cause congenital hypoventilation syndrome, which is characterized by blunted ventilatory response to hypercapnia. Here we describe the generation of a novel transgenic (Tg rat harboring fluorescently labeled Pre-I neurons in the RTN/pFRG. In addition, the Tg rat showed fluorescent signals in autonomic enteric neurons and carotid bodies. Because the Tg rat expresses inducible Cre recombinase in PHOX2B-positive cells during development, it is a potentially powerful tool for dissecting the entire picture of the respiratory neural network during development and for identifying the CO2/O2 sensor molecules in the adult central and peripheral nervous systems.

  2. Engineering Potato Starch with a Higher Phosphate Content.

    Directory of Open Access Journals (Sweden)

    Xuan Xu

    Full Text Available Phosphate esters are responsible for valuable and unique functionalities of starch for industrial applications. Also in the cell phosphate esters play a role in starch metabolism, which so far has not been well characterized in storage starch. Laforin, a human enzyme composed of a carbohydrate-binding module and a dual-specificity phosphatase domain, is involved in the dephosphorylation of glycogen. To modify phosphate content and better understand starch (dephosphorylation in storage starch, laforin was engineered and introduced into potato (cultivar Kardal. Interestingly, expression of an (engineered laforin in potato resulted in significantly higher phosphate content of starch, and this result was confirmed in amylose-free potato genetic background (amf. Modified starches exhibited altered granule morphology and size compared to the control. About 20-30% of the transgenic lines of each series showed red-staining granules upon incubation with iodine, and contained higher phosphate content than the blue-stained starch granules. Moreover, low amylose content and altered gelatinization properties were observed in these red-stained starches. Principle component and correlation analysis disclosed a complex correlation between starch composition and starch physico-chemical properties. Ultimately, the expression level of endogenous genes involved in starch metabolism was analysed, revealing a compensatory response to the decrease of phosphate content in potato starch. This study provides a new perspective for engineering starch phosphate content in planta by making use of the compensatory mechanism in the plant itself.

  3. Murine transgenic embryonic stem cell lines for the investigation of sinoatrial node-related molecular pathways

    Directory of Open Access Journals (Sweden)

    Stefanie Schmitteckert

    2017-12-01

    Full Text Available The elucidation of molecular mechanisms that restrict the potential of pluripotent stem cells and promote cardiac lineage differentiation is of crucial relevance, since embryonic stem cells (ESCs hold great potential for cell based heart therapies. The homeodomain transcription factor Shox2 is essential for the development and proper function of the native cardiac pacemaker, the sinoatrial node. This prompted us to develop a cardiac differentiation model using ESC lines isolated from blastocysts of Shox2-deficient mice. The established cell model provides a fundamental basis for the investigation of molecular pathways under physiological and pathophysiological conditions for evaluating novel therapeutic approaches.

  4. An α-smooth muscle actin (acta2/αsma zebrafish transgenic line marking vascular mural cells and visceral smooth muscle cells.

    Directory of Open Access Journals (Sweden)

    Thomas R Whitesell

    Full Text Available Mural cells of the vascular system include vascular smooth muscle cells (SMCs and pericytes whose role is to stabilize and/or provide contractility to blood vessels. One of the earliest markers of mural cell development in vertebrates is α smooth muscle actin (acta2; αsma, which is expressed by pericytes and SMCs. In vivo models of vascular mural cell development in zebrafish are currently lacking, therefore we developed two transgenic zebrafish lines driving expression of GFP or mCherry in acta2-expressing cells. These transgenic fish were used to trace the live development of mural cells in embryonic and larval transgenic zebrafish. acta2:EGFP transgenic animals show expression that largely mirrors native acta2 expression, with early pan-muscle expression starting at 24 hpf in the heart muscle, followed by skeletal and visceral muscle. At 3.5 dpf, expression in the bulbus arteriosus and ventral aorta marks the first expression in vascular smooth muscle. Over the next 10 days of development, the number of acta2:EGFP positive cells and the number of types of blood vessels associated with mural cells increases. Interestingly, the mural cells are not motile and remain in the same position once they express the acta2:EGFP transgene. Taken together, our data suggests that zebrafish mural cells develop relatively late, and have little mobility once they associate with vessels.

  5. Aproach study of freedom to operate for transgenic line rice in Colombia

    Directory of Open Access Journals (Sweden)

    Alejandro Chaparro Giraldo

    2016-01-01

    Full Text Available The development of a genetically modified variety (GM is a scientific and legal challenge, by genetic engineering techniques used and the intellectual property rights (IPR involved. Approximate analysis of freedom of operation for a GM line derived from a Colombian rice variety, express an optimized version of the cry1Ac gene; in order to pursue their commercial release in Colombia was made. To do this, a deconstruction of innovation, which potentially protectable elements DPI on which patent searches and patent applications were made in the national and international context, databases were determined public access was performed. 59 patents and patent applications were found in the international arena. The Superintendency of Industry and Trade of Colombia (SIC three applications for patents that may affect the freedom of operation for this innovation were found. It is concluded that the higher the possibility of developing a GM rice line expressing cry1Ac gene without affecting the interest of third parties , as long as it is done in the country to commercialize.

  6. Transgenic Mouse Lines Subdivide External Segment of the Globus Pallidus (GPe) Neurons and Reveal Distinct GPe Output Pathways

    Science.gov (United States)

    Mastro, Kevin J.; Bouchard, Rachel S.; Holt, Hiromi A. K.

    2014-01-01

    Cell-type diversity in the brain enables the assembly of complex neural circuits, whose organization and patterns of activity give rise to brain function. However, the identification of distinct neuronal populations within a given brain region is often complicated by a lack of objective criteria to distinguish one neuronal population from another. In the external segment of the globus pallidus (GPe), neuronal populations have been defined using molecular, anatomical, and electrophysiological criteria, but these classification schemes are often not generalizable across preparations and lack consistency even within the same preparation. Here, we present a novel use of existing transgenic mouse lines, Lim homeobox 6 (Lhx6)–Cre and parvalbumin (PV)–Cre, to define genetically distinct cell populations in the GPe that differ molecularly, anatomically, and electrophysiologically. Lhx6–GPe neurons, which do not express PV, are concentrated in the medial portion of the GPe. They have lower spontaneous firing rates, narrower dynamic ranges, and make stronger projections to the striatum and substantia nigra pars compacta compared with PV–GPe neurons. In contrast, PV–GPe neurons are more concentrated in the lateral portions of the GPe. They have narrower action potentials, deeper afterhyperpolarizations, and make stronger projections to the subthalamic nucleus and parafascicular nucleus of the thalamus. These electrophysiological and anatomical differences suggest that Lhx6–GPe and PV–GPe neurons participate in different circuits with the potential to contribute to different aspects of motor function and dysfunction in disease. PMID:24501350

  7. Heterogeneous transgene expression in the retinas of the TH-RFP, TH-Cre, TH-BAC-Cre and DAT-Cre mouse lines.

    Science.gov (United States)

    Vuong, H E; Pérez de Sevilla Müller, L; Hardi, C N; McMahon, D G; Brecha, N C

    2015-10-29

    Transgenic mouse lines are essential tools for understanding the connectivity, physiology and function of neuronal circuits, including those in the retina. This report compares transgene expression in the retina of a tyrosine hydroxylase (TH)-red fluorescent protein (RFP) mouse line with three catecholamine-related Cre recombinase mouse lines [TH-bacterial artificial chromosome (BAC)-, TH-, and dopamine transporter (DAT)-Cre] that were crossed with a ROSA26-tdTomato reporter line. Retinas were evaluated and immunostained with commonly used antibodies including those directed to TH, GABA and glycine to characterize the RFP or tdTomato fluorescent-labeled amacrine cells, and an antibody directed to RNA-binding protein with multiple splicing to identify ganglion cells. In TH-RFP retinas, types 1 and 2 dopamine (DA) amacrine cells were identified by their characteristic cellular morphology and type 1 DA cells by their expression of TH immunoreactivity. In the TH-BAC-, TH-, and DAT-tdTomato retinas, less than 1%, ∼ 6%, and 0%, respectively, of the fluorescent cells were the expected type 1 DA amacrine cells. Instead, in the TH-BAC-tdTomato retinas, fluorescently labeled AII amacrine cells were predominant, with some medium diameter ganglion cells. In TH-tdTomato retinas, fluorescence was in multiple neurochemical amacrine cell types, including four types of polyaxonal amacrine cells. In DAT-tdTomato retinas, fluorescence was in GABA immunoreactive amacrine cells, including two types of bistratified and two types of monostratified amacrine cells. Although each of the Cre lines was generated with the intent to specifically label DA cells, our findings show a cellular diversity in Cre expression in the adult retina and indicate the importance of careful characterization of transgene labeling patterns. These mouse lines with their distinctive cellular labeling patterns will be useful tools for future studies of retinal function and visual processing. Published by Elsevier

  8. Efficient embryogenic suspension culturing and rapid transformation of a range of elite genotypes of sweet potato (Ipomoea batatas [L.] Lam.).

    Science.gov (United States)

    Yang, Jun; Bi, Hui-Ping; Fan, Wei-Juan; Zhang, Min; Wang, Hong-Xia; Zhang, Peng

    2011-12-01

    Efficient Agrobacterium tumefaciens-mediated transformation was developed using embryogenic suspension cell cultures of elite sweet potato (Ipomoea batatas [L.] Lam.) cultivars, including Ayamurasaki, Sushu2, Sushu9, Sushu11, Wanshu1, Xushu18 and Xushu22. Embryogenic suspension cultures were established in LCP medium using embryogenic calli induced from apical or axillary buds on an induction medium containing 2 mg l(-1) 2,4-D. Suspension cultures were co-cultivated with A. tumefaciens strain LBA4404 harboring the binary plasmid pCAMBIA1301 with the hpt gene as a selectable marker and an intron-interrupted uidA gene as a visible marker. Several key steps of the sweet potato transformation system have been investigated and optimized, including the appropriate antibiotics and their concentrations for suppressing Agrobacterium growth and the optimal doses of hygromycin for transformant selection. A total of 485 putative transgenic plant lines were produced from the transformed calli via somatic embryogenesis and germination to plants under 10 mg l(-1) hygromycin and 200 mg l(-1) cefotaxime. PCR, GUS and Southern blot analyses of the regenerated plants showed that 92.35% of them were transgenic. The number of T-DNA insertions varied from one to three in most transgenic plant lines. Plants showed 100% survival when 308 transgenics were transferred to soil in the greenhouse and then to the field. Most of them were morphologically normal, with the production of storage roots after 3 months of cultivation in the greenhouse or fields. The development of such a robust transformation method suitable to a range of sweet potato genotypes not only provides a routine tool for genetic improvement via transgenesis but also allows us to conduct a functional verification of endogenous genes in sweet potato. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  9. Effects of seed mixture sowing with transgenic Bt rice and its parental line on the population dynamics of target stemborers and leafrollers, and non-target planthoppers.

    Science.gov (United States)

    Li, Zhuo; Li, Li-Kun; Liu, Bin; Wang, Long; Parajulee, Megha N; Chen, Fa-Jun

    2018-01-24

    The widespread planting of insect-resistant crops has caused a dramatic shift in agricultural landscapes, thus raising concerns about the potential impacts on both target and non-target pests. In this study, we examined the potential effects of intra-specific seed mixture sowing with transgenic Bt rice (Bt) and its parental non-transgenic line (Nt) (100% Bt rice [Bt 100 ], 5% Nt+95% Bt [Nt 05 Bt 95 ], 10% Nt+90% Bt [Nt 10 Bt 90 ], 20% Nt+80% Bt [Nt 20 Bt 80 ], 40% Nt+60% Bt [Nt 40 Bt 60 ] and 100% Nt rice [Nt 100 ]) on target and non-target pests in a 2-year field trial in southern China. The occurrence of target pests, Sesamia inferens, Chilo suppressalis and Cnaphalocrocis medinalis, decreased with the increased ratio of Bt rice, and the mixture ratios with more than 90% Bt rice (Bt 100 and Nt 05 Bt 95 ) significantly increased the pest suppression efficiency, with the lowest occurrences of non-target planthoppers, Nilaparvata lugens and Sogatella furcifera in Nt 100 and Nt 05 Bt 95 . Furthermore, there were no significant differences in 1000-grain dry weight and grain dry weight per 100 plants between Bt 100 and Nt 05 Bt 95 . Seed mixture sowing of Bt rice with ≤10% (especially 5%) of its parent line was sufficient to overcome potential compliance issues that exist with the use of block or structured refuge to provide most effective control of both target and non-target pests without compromising the grain yield. It is also expected that the strategy of seed mixture sowing with transgenic Bt rice and the non-transgenic parental line would provide rice yield stability while decreasing the insecticide use frequency in rice production. © 2018 Institute of Zoology, Chinese Academy of Sciences.

  10. Development of on-line sorting system for detection of infected seed potatoes using visible near-infrared transmittance spectral technique

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dae Yong; Cho, Byoung Kwan [Dept. of Biosystems Engineering, Chungnam National University, Daejeon (Korea, Republic of); Mo, Chang Yeun [Rural Development Administration, National Institute of Agricultural Engineering, Jeonju (Korea, Republic of); Kang, Jun Soon [Dept. of Horticultural Bioscience, Pusan National University, Pusan (Korea, Republic of)

    2015-02-15

    In this study, an online seed potato sorting system using a visible and near infrared (40 1100 nm) transmittance spectral technique and statistical model was evaluated for the nondestructive determination of infected and sound seed potatoes. Seed potatoes that had been artificially infected with Pectobacterium atrosepticum, which is known to cause a soil borne disease infection, were prepared for the experiments. After acquiring transmittance spectra from sound and infected seed potatoes, a determination algorithm for detecting infected seed potatoes was developed using the partial least square discriminant analysis method. The coefficient of determination(R{sup 2}{sub p}) of the prediction model was 0.943, and the classification accuracy was above 99% (n = 80) for discriminating diseased seed potatoes from sound ones. This online sorting system has good potential for developing a technique to detect agricultural products that are infected and contaminated by pathogens.

  11. Rapid development of stable transgene CHO cell lines by CRISPR/Cas9-mediated site-specific integration into C12orf35.

    Science.gov (United States)

    Zhao, Menglin; Wang, Jiaxian; Luo, Manyu; Luo, Han; Zhao, Meiqi; Han, Lei; Zhang, Mengxiao; Yang, Hui; Xie, Yueqing; Jiang, Hua; Feng, Lei; Lu, Huili; Zhu, Jianwei

    2018-07-01

    Chinese hamster ovary (CHO) cells are the most widely used mammalian hosts for recombinant protein production. However, by conventional random integration strategy, development of a high-expressing and stable recombinant CHO cell line has always been a difficult task due to the heterogenic insertion and its caused requirement of multiple rounds of selection. Site-specific integration of transgenes into CHO hot spots is an ideal strategy to overcome these challenges since it can generate isogenic cell lines with consistent productivity and stability. In this study, we investigated three sites with potential high transcriptional activities: C12orf35, HPRT, and GRIK1, to determine the possible transcriptional hot spots in CHO cells, and further construct a reliable site-specific integration strategy to develop recombinant cell lines efficiently. Genes encoding representative proteins mCherry and anti-PD1 monoclonal antibody were targeted into these three loci respectively through CRISPR/Cas9 technology. Stable cell lines were generated successfully after a single round of selection. In comparison with a random integration control, all the targeted integration cell lines showed higher productivity, among which C12orf35 locus was the most advantageous in both productivity and cell line stability. Binding affinity and N-glycan analysis of the antibody revealed that all batches of product were of similar quality independent on integrated sites. Deep sequencing demonstrated that there was low level of off-target mutations caused by CRISPR/Cas9, but none of them contributed to the development process of transgene cell lines. Our results demonstrated the feasibility of C12orf35 as the target site for exogenous gene integration, and strongly suggested that C12orf35 targeted integration mediated by CRISPR/Cas9 is a reliable strategy for the rapid development of recombinant CHO cell lines.

  12. Insight into the role of catalases in salt stress in potato (Solanum tuberosum L.

    Directory of Open Access Journals (Sweden)

    M'Hamdi M.

    2009-01-01

    Full Text Available In order to investigate a possible link between catalase (CAT activity and salinity tolerance, an in vitro and in vivo study of the behavior of transgenic lines of potato (cv. ‘Désirée’ under salt stress conditions was carried out. Three groups of transgenic lines and non transformed control (DWT were used in this study: lines expressing a bacterial catalase gene and lines repressing catalase activity by either co-suppression or anti-sense strategies. Various concentrations of NaCl were tested: in vitro 0, 25, 50 and 75 mM and in vivo 25, 50 and 75 mM. The results of this work show that the genetic modification of CAT activity affects the multiplication rate of vitroplants, as well as vegetative and physiological growth parameters under salt stress conditions. At 25, 50 and 75 mM of NaCl, over-expression (line KatE16 and repression of CAT increased and reduced respectively the multiplication rate of vitroplants. Differences between the transgenic lines and the wild type were evident in tuber yield and leaf chlorophyll content. These parameters were significantly increased in CAT over-expressing and slightly decreased in SU3 line repressed in CAT under 25 mM of salt stress. A stability of the potential quantum yield (Fv/Fm was observed in the lines over-expressing the CAT at 25, 50 and 75 mM of NaCl. The repression of CAT was associated with a decrease of Fv/Fm value at 50 mM of NaCl. These results show that catalases contribute to salinity tolerance mechanisms in potato.

  13. Cloning and characterization of a potato StAN11 gene involved in anthocyanin biosynthesis regulation.

    Science.gov (United States)

    Li, Wang; Wang, Bing; Wang, Man; Chen, Min; Yin, Jing-Ming; Kaleri, Ghullam Murtaza; Zhang, Rui-Jie; Zuo, Tie-Niu; You, Xiong; Yang, Qing

    2014-04-01

    Anthocyanins are a class of products of plant secondary metabolism and are responsible for tubers color in potato. The biosynthesis of anthocyanins is a complex biological process, in which multiple genes are involved including structural genes and regulatory genes. In this study, StAN11, a WD40-repeat gene, was cloned from potato cultivar Chieftain (Solanum tuberosum L.). StAN11 (HQ599506) contained no intron and its open reading frame (ORF) was 1,029 bp long, encoding a putative protein of 342 amino acids. In order to verify its role in anthocyanin biosynthesis, StAN11 was inserted behind the CaMV-35S promoter of pCMBIA1304 and the recombination vector was introduced into the potato cultivar Désirée plants by Agrobacterium-mediated transformation. The color of transgenic tuber skin was significantly deepened, compared to the wild-type control, which was highly consistent with the accumulation of anthocyanin and expression of StAN11 in transgenic lines tuber skin. Further analysis on the expression of Flavonone-3-hydroxylase (F3H), Dihydroflavonol reductase (DFR), Anthocyanidin synthase (ANS), and Flavonoid 3-O-glucosyl transferase (3GT) in transgenic plants revealed that only DFR was upregulated. This result suggested that StAN11 regulated anthocyanin biosynthesis in potato by controlling DFR expression and accumulation of anthocyanin could be increased through overexpression of StAN11 in the tubers with the genetic background of anthocyanin biosynthesis. © 2013 Institute of Botany, Chinese Academy of Sciences.

  14. Generation and phenotypic analysis of a transgenic line of rabbits secreting active recombinant human erythropoietin in the milk

    Czech Academy of Sciences Publication Activity Database

    Mikuš, Tomáš; Poplštein, M.; Sedláková, J.; Landa, Vladimír; Jeníková, Gabriela; Trefil, P.; Lidický, J.; Malý, Petr

    2004-01-01

    Roč. 13, č. 5 (2004), s. 487-498 ISSN 0962-8819 R&D Projects: GA ČR GA304/03/0090 Institutional research plan: CEZ:AV0Z5052915 Keywords : erythropoietin, mammary gland, transgenic rabbit Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.107, year: 2004

  15. Derivation of mouse embryonic stem cell lines from tyrosine hydroxylase reporter mice crossed with a human SNCA transgenic mouse model of Parkinson's disease

    Directory of Open Access Journals (Sweden)

    Margarita Chumarina

    2017-03-01

    Full Text Available Mouse embryonic stem cell (mESC lines were derived by crossing heterozygous transgenic (tg mice expressing green fluorescent protein (GFP under the control of the rat tyrosine hydroxylase (TH promoter, with homozygous alpha-synuclein (aSYN mice expressing human mutant SNCAA53T under the control of the mouse Prion promoter (MoPrP, or wildtype (WT mice. The expression of GFP and human aSYN was validated by immunocytochemistry in midbrain neuron cultures upon differentiation of mESC lines using stromal cell-derived inducing activity. These mESC lines can help to study the impact of human aSYN expression in neurons and oligodendrocytes, and also trace GFP-expressing midbrain neurons.

  16. Production of polyhydroxyalkanoates (PHAs) in transgenic potato

    NARCIS (Netherlands)

    Romano, A.

    2002-01-01

    Polyhydroxyalkanoates (PHAs) represent a large class of microbial polyesters which are widely distributed in prokaryotes. Because of the current environmental concerns related to the use of mineral-oil-based plastics, PHAs gained a considerable interest for

  17. Top 5 exotic clones for potato breeding

    Science.gov (United States)

    Wild and cultivated relatives of potato feature prominently in breeding programs. In this short article, I describe five exotic clones that have promising traits for the future of the US potato industry. They include M6, an inbred line of S. chacoense that provides a source of genes for self-compati...

  18. Accurate measurement of transgene copy number in crop plants using droplet digital PCR.

    Science.gov (United States)

    Collier, Ray; Dasgupta, Kasturi; Xing, Yan-Ping; Hernandez, Bryan Tarape; Shao, Min; Rohozinski, Dominica; Kovak, Emma; Lin, Jeanie; de Oliveira, Maria Luiza P; Stover, Ed; McCue, Kent F; Harmon, Frank G; Blechl, Ann; Thomson, James G; Thilmony, Roger

    2017-06-01

    Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy number is estimated by either Southern blot hybridization analyses or quantitative polymerase chain reaction (qPCR) experiments. Southern hybridization is a convincing and reliable method, but it also is expensive, time-consuming and often requires a large amount of genomic DNA and radioactively labeled probes. Alternatively, qPCR requires less DNA and is potentially simpler to perform, but its results can lack the accuracy and precision needed to confidently distinguish between one- and two-copy events in transgenic plants with large genomes. To address this need, we developed a droplet digital PCR-based method for transgene copy number measurement in an array of crops: rice, citrus, potato, maize, tomato and wheat. The method utilizes specific primers to amplify target transgenes, and endogenous reference genes in a single duplexed reaction containing thousands of droplets. Endpoint amplicon production in the droplets is detected and quantified using sequence-specific fluorescently labeled probes. The results demonstrate that this approach can generate confident copy number measurements in independent transgenic lines in these crop species. This method and the compendium of probes and primers will be a useful resource for the plant research community, enabling the simple and accurate determination of transgene copy number in these six important crop species. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  19. H+ -pyrophosphatase IbVP1 promotes efficient iron use in sweet potato [Ipomoea batatas (L.) Lam.].

    Science.gov (United States)

    Fan, Weijuan; Wang, Hongxia; Wu, Yinliang; Yang, Nan; Yang, Jun; Zhang, Peng

    2017-06-01

    Iron (Fe) deficiency is one of the most common micronutrient deficiencies limiting crop production globally, especially in arid regions because of decreased availability of iron in alkaline soils. Sweet potato [Ipomoea batatas (L.) Lam.] grows well in arid regions and is tolerant to Fe deficiency. Here, we report that the transcription of type I H + -pyrophosphatase (H + -PPase) gene IbVP1 in sweet potato plants was strongly induced by Fe deficiency and auxin in hydroponics, improving Fe acquisition via increased rhizosphere acidification and auxin regulation. When overexpressed, transgenic plants show higher pyrophosphate hydrolysis and plasma membrane H + -ATPase activity compared with the wild type, leading to increased rhizosphere acidification. The IbVP1-overexpressing plants showed better growth, including enlarged root systems, under Fe-sufficient or Fe-deficient conditions. Increased ferric precipitation and ferric chelate reductase activity in the roots of transgenic lines indicate improved iron uptake, which is also confirmed by increased Fe content and up-regulation of Fe uptake genes, e.g. FRO2, IRT1 and FIT. Carbohydrate metabolism is significantly affected in the transgenic lines, showing increased sugar and starch content associated with the increased expression of AGPase and SUT1 genes and the decrease in β-amylase gene expression. Improved antioxidant capacities were also detected in the transgenic plants, which showed reduced H 2 O 2 accumulation associated with up-regulated ROS-scavenging activity. Therefore, H + -PPase plays a key role in the response to Fe deficiency by sweet potato and effectively improves the Fe acquisition by overexpressing IbVP1 in crops cultivated in micronutrient-deficient soils. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  20. Generation of mRx-Cre Transgenic Mouse Line for Efficient Conditional Gene Deletion in Early Retinal Progenitors

    Czech Academy of Sciences Publication Activity Database

    Klímová, Lucie; Láchová, Jitka; Machoň, Ondřej; Sedláček, Radislav; Kozmik, Zbyněk

    2013-01-01

    Roč. 8, č. 5 (2013), e63029 E-ISSN 1932-6203 R&D Projects: GA ČR GAP305/11/2198; GA MŠk(CZ) LK11214; GA MŠk(CZ) LM2011032; GA ČR GAP305/10/2143; GA MŠk ED1.1.00/02.0109 Institutional support: RVO:68378050 Keywords : eye development * lens * retina * transgenic mice Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.534, year: 2013

  1. Enhanced Salt Tolerance Conferred by the Complete 2.3 kb cDNA of the Rice Vacuolar Na(+)/H(+) Antiporter Gene Compared to 1.9 kb Coding Region with 5' UTR in Transgenic Lines of Rice.

    Science.gov (United States)

    Amin, U S M; Biswas, Sudip; Elias, Sabrina M; Razzaque, Samsad; Haque, Taslima; Malo, Richard; Seraj, Zeba I

    2016-01-01

    Soil salinity is one of the most challenging problems that restricts the normal growth and production of rice worldwide. It has therefore become very important to produce more saline tolerant rice varieties. This study shows constitutive over-expression of the vacuolar Na(+)/H(+) antiporter gene (OsNHX1) from the rice landrace (Pokkali) and attainment of enhanced level of salinity tolerance in transgenic rice plants. It also shows that inclusion of the complete un-translated regions (UTRs) of the alternatively spliced OsNHX1 gene provides a higher level of tolerance to the transgenic rice. Two separate transformation events of the OsNHX1 gene, one with 1.9 kb region containing the 5' UTR with CDS and the other of 2.3 kb, including 5' UTR, CDS, and the 3' UTR regions were performed. The transgenic plants with these two different constructs were advanced to the T3 generation and physiological and molecular screening of homozygous plants was conducted at seedling and reproductive stages under salinity (NaCl) stress. Both transgenic lines were observed to be tolerant compared to WT plants at both physiological stages. However, the transgenic lines containing the CDS with both the 5' and 3' UTR were significantly more tolerant compared to the transgenic lines containing OsNHX1 gene without the 3' UTR. At the seedling stage at 12 dS/m stress, the chlorophyll content was significantly higher (P kb > 1.9 kb > and WT lines. Yield in g/plant in the best line from the 2.3 kb plants was significantly more (P kb line and WT plants at stress of 6 dS/m. Transformation with the complete transcripts rather than the CDS may therefore provide more durable level of tolerance.

  2. The effects of enhanced methionine synthesis on amino acid and anthocyanin content of potato tubers

    Directory of Open Access Journals (Sweden)

    Bánfalvi Zsófia

    2008-06-01

    Full Text Available Abstract Background Potato is a staple food in the diet of the world's population and also being used as animal feed. Compared to other crops, however, potato tubers are relatively poor in the essential amino acid, methionine. Our aim was to increase the methionine content of tubers by co-expressing a gene involved in methionine synthesis with a gene encoding a methionine-rich storage protein in potato plants. Results In higher plants, cystathionine γ-synthase (CgS is the first enzyme specific to methionine biosynthesis. We attempted to increase the methionine content of tubers by expressing the deleted form of the Arabidopsis CgS (CgSΔ90, which is not regulated by methionine, in potato plants. To increase the incorporation of free methionine into a storage protein the CgSΔ90 was co-transformed with the methionine-rich 15-kD β-zein. Results demonstrated a 2- to 6-fold increase in the free methionine content and in the methionine content of the zein-containing protein fraction of the transgenic tubers. In addition, in line with higher methionine content, the amounts of soluble isoleucine and serine were also increased. However, all of the lines with high level of CgSΔ90 expression were phenotypically abnormal showing severe growth retardation, changes in leaf architecture and 40- to 60% reduction in tuber yield. Furthermore, the colour of the transgenic tubers was altered due to the reduced amounts of anthocyanin pigments. The mRNA levels of phenylalanine ammonia-lyase (PAL, the enzyme catalysing the first step of anthocyanin synthesis, were decreased. Conclusion Ectopic expression of CgSΔ90 increases the methionine content of tubers, however, results in phenotypic aberrations in potato. Co-expression of the 15-kD β-zein with CgSΔ90 results in elevation of protein-bound methionine content of tubers, but can not overcome the phenotypical changes caused by CgSΔ90 and can not significantly improve the nutritional value of tubers. The level

  3. Generation of Pet1210-Cre Transgenic Mouse Line Reveals Non-Serotonergic Expression Domains of Pet1 Both in CNS and Periphery

    Science.gov (United States)

    Pelosi, Barbara; Migliarini, Sara; Pacini, Giulia; Pratelli, Marta; Pasqualetti, Massimo

    2014-01-01

    Neurons producing serotonin (5-hydroxytryptamine, 5-HT) constitute one of the most widely distributed neuronal networks in the mammalian central nervous system (CNS) and exhibit a profuse innervation throughout the CNS already at early stages of development. Serotonergic neuron specification is controlled by a combination of secreted molecules and transcription factors such as Shh, Fgf4/8, Nkx2.2, Lmx1b and Pet1. In the mouse, Pet1 mRNA expression appears between 10 and 11 days post coitum (dpc) in serotonergic post-mitotic precursors and persists in serotonergic neurons up to adulthood, where it promotes the expression of genes defining the mature serotonergic phenotype such as tryptophan hydroxylase 2 (Tph2) and serotonin transporter (SERT). Hence, the generation of genetic tools based on Pet1 specific expression represents a valuable approach to study the development and function of the serotonergic system. Here, we report the generation of a Pet1210-Cre transgenic mouse line in which the Cre recombinase is expressed under the control of a 210 kb fragment from the Pet1 genetic locus to ensure a reliable and faithful control of somatic recombination in Pet1 cell lineage. Besides Cre-mediated recombination accurately occurred in the serotonergic system as expected and according to previous studies, Pet1210-Cre transgenic mouse line allowed us to identify novel, so far uncharacterized, Pet1 expression domains. Indeed, we showed that in the raphe Pet1 is expressed also in a non-serotonergic neuronal population intermingled with Tph2-expressing cells and mostly localized in the B8 and B9 nuclei. Moreover, we detected Cre-mediated recombination also in the developing pancreas and in the ureteric bud derivatives of the kidney, where it reflected a specific Pet1 expression. Thus, Pet1210-Cre transgenic mouse line faithfully drives Cre-mediated recombination in all Pet1 expression domains representing a valuable tool to genetically manipulate serotonergic and non

  4. Avaliação de processos nas linhas de beneficiamento e classificação de batatas Process evaluation on potato packing lines

    Directory of Open Access Journals (Sweden)

    Marcos David Ferreira

    2007-06-01

    ensaque. Nas unidades A, B e D as maiores médias de G ocorreram nas etapas iniciais de lavagem, apresentando valores próximos de 140 G (m/s².Potatoes are one of the most important vegetable crops in Brazil, and are especially important in São Paulo State. After harvesting, potatoes are sorted and classified in a packinghouse, then shipped to consumers. The goal of this research was to describe the main features and working systems used in a potato packing line. Therefore, the material type used was identified taking into account the dimensions of the equipments, brushes rotation on receiving belts and sorting lines, average velocity, tuber displacement velocity and rotation, and employee daily yield. The critical points for drop impact were measured using an instrumented sphere (70 mm, Techmark, Inc. Lansing, Michigan, USA. Results for maximum Acceleration (G and velocity changes (deltav were found. This research was done in five packinghouses of São Paulo State. A variation occurred in length among the lines, of about 26,5%. The water consuption varied among the units based on the washing system used, and volume dispended varied from 15,4 to 168 thousand liters/hour. The main brushing composition used on the washing brushes were nylon and coconut fiber, and brushes of animal origin were not used. The average rotation observed on the washing step was 157 ppm, with a variation of 75% (112-196 rpm. For the drying step, the average rotation was 122 rpm, varying from 68 to 210 rpm. The critical points that showed high G were the transfer points (washing entrance and packing. At units A, B and C the high G values were at the initial washing steps, closely to 140 G (m/s².

  5. Transgenic expression of an unedited mitochondrial orfB gene product from wild abortive (WA) cytoplasm of rice (Oryza sativa L.) generates male sterility in fertile rice lines.

    Science.gov (United States)

    Chakraborty, Anirban; Mitra, Joy; Bhattacharyya, Jagannath; Pradhan, Subrata; Sikdar, Narattam; Das, Srirupa; Chakraborty, Saikat; Kumar, Sachin; Lakhanpaul, Suman; Sen, Soumitra K

    2015-06-01

    Over-expression of the unedited mitochondrial orfB gene product generates male sterility in fertile indica rice lines in a dose-dependent manner. Cytoplasmic male sterility (CMS) and nuclear-controlled fertility restoration are widespread developmental features in plant reproductive systems. In self-pollinated crop plants, these processes often provide useful tools to exploit hybrid vigour. The wild abortive CMS has been employed in the majority of the "three-line" hybrid rice production since 1970s. In the present study, we provide experimental evidence for a positive functional relationship between the 1.1-kb unedited orfB gene transcript, and its translated product in the mitochondria with male sterility. The generation of the 1.1-kb unedited orfB gene transcripts increased during flowering, resulting in low ATP synthase activity in sterile plants. Following insertion of the unedited orfB gene into the genome of male-fertile plants, the plants became male sterile in a dose-dependent manner with concomitant reduction of ATPase activity of F1F0-ATP synthase (complex V). Fertility of the transgenic lines and normal activity of ATP synthase were restored by down-regulation of the unedited orfB gene expression through RNAi-mediated silencing. The genetic elements deciphered in this study could further be tested for their use in hybrid rice development.

  6. Investigating Pollen and Gene Flow of WYMV-Resistant Transgenic Wheat N12-1 Using a Dwarf Male-Sterile Line as the Pollen Receptor.

    Science.gov (United States)

    Dong, Shanshan; Liu, Yan; Yu, Cigang; Zhang, Zhenhua; Chen, Ming; Wang, Changyong

    2016-01-01

    Pollen-mediated gene flow (PMGF) is the main mode of transgene flow in flowering plants. The study of pollen and gene flow of transgenic wheat can help to establish the corresponding strategy for preventing transgene escape and contamination between compatible genotypes in wheat. To investigate the pollen dispersal and gene flow frequency in various directions and distances around the pollen source and detect the association between frequency of transgene flow and pollen density from transgenic wheat, a concentric circle design was adopted to conduct a field experiment using transgenic wheat with resistance to wheat yellow mosaic virus (WYMV) as the pollen donor and dwarf male-sterile wheat as the pollen receptor. The results showed that the pollen and gene flow of transgenic wheat varied significantly among the different compass sectors. A higher pollen density and gene flow frequency was observed in the downwind SW and W sectors, with average frequencies of transgene flow of 26.37 and 23.69% respectively. The pollen and gene flow of transgenic wheat declined dramatically with increasing distance from its source. Most of the pollen grains concentrated within 5 m and only a few pollen grains were detected beyond 30 m. The percentage of transgene flow was the highest where adjacent to the pollen source, with an average of 48.24% for all eight compass directions at 0 m distance. Transgene flow was reduced to 50% and 95% between 1.61 to 3.15 m, and 10.71 to 20.93 m, respectively. Our results suggest that climate conditions, especially wind direction, may significantly affect pollen dispersal and gene flow of wheat. The isolation-by-distance model is one of the most effective methods for achieving stringent transgene confinement in wheat. The frequency of transgene flow is directly correlated with the relative density of GM pollen grains in air currents, and pollen competition may be a major factor influencing transgene flow.

  7. Investigating Pollen and Gene Flow of WYMV-Resistant Transgenic Wheat N12-1 Using a Dwarf Male-Sterile Line as the Pollen Receptor.

    Directory of Open Access Journals (Sweden)

    Shanshan Dong

    Full Text Available Pollen-mediated gene flow (PMGF is the main mode of transgene flow in flowering plants. The study of pollen and gene flow of transgenic wheat can help to establish the corresponding strategy for preventing transgene escape and contamination between compatible genotypes in wheat. To investigate the pollen dispersal and gene flow frequency in various directions and distances around the pollen source and detect the association between frequency of transgene flow and pollen density from transgenic wheat, a concentric circle design was adopted to conduct a field experiment using transgenic wheat with resistance to wheat yellow mosaic virus (WYMV as the pollen donor and dwarf male-sterile wheat as the pollen receptor. The results showed that the pollen and gene flow of transgenic wheat varied significantly among the different compass sectors. A higher pollen density and gene flow frequency was observed in the downwind SW and W sectors, with average frequencies of transgene flow of 26.37 and 23.69% respectively. The pollen and gene flow of transgenic wheat declined dramatically with increasing distance from its source. Most of the pollen grains concentrated within 5 m and only a few pollen grains were detected beyond 30 m. The percentage of transgene flow was the highest where adjacent to the pollen source, with an average of 48.24% for all eight compass directions at 0 m distance. Transgene flow was reduced to 50% and 95% between 1.61 to 3.15 m, and 10.71 to 20.93 m, respectively. Our results suggest that climate conditions, especially wind direction, may significantly affect pollen dispersal and gene flow of wheat. The isolation-by-distance model is one of the most effective methods for achieving stringent transgene confinement in wheat. The frequency of transgene flow is directly correlated with the relative density of GM pollen grains in air currents, and pollen competition may be a major factor influencing transgene flow.

  8. WASTE-FREE PRODUCTION TECHNOLOGY OF DRY MASHED POTATOES

    Directory of Open Access Journals (Sweden)

    G. V. Kalashnikov

    2015-01-01

    Full Text Available Summary. According to data on norms of consumption of vegetable production of scientific research institute of Food of the Russian Academy of Medical Science, potatoes win first place with norm of 120 kg a year on the person. In this regard much attention is paid to processing of potatoes that allows to prolong the term of its validity, and also to reduce the capacity of storages and to reduce transport transportations as 1 kg of a dry potatoes produсt is equivalent 7-8 kg of fresh potatoes. Thus industrial processing of potatoes on dry mashed potatoes allows to reduce losses of potatoes at storage and transportation, there is a possibility of enrichment of products vitamins and other useful components, its nutrition value remains better, conditions for complex processing of raw materials with full recycling and creations of stocks of products from potatoes on a crop failure case are created. Dry mashed potatoes are a product of long storage. On the basis of studying of the production technology of mashed potatoes the analysis of technological processes as sources of creation of waste, and the directions of recovery of secondary raw materials for complex waste-free technology of processing of potatoes are defined is provided. The waste-free technological scheme of processing of potatoes and production of dry instant mashed potatoes on the basis of dehydration and moisture thermal treatment a component providing recovery of secondary carbohydrate content raw materials in the form of waste of the main production is developed. The main stages of production of dry instant mashed potatoes are described. It is offered the technological scheme of a production line of mashed potatoes on the basis of waste-free technology. Advantages of the offered waste-free production technology of dry instant mashed potatoes with processing of secondary starch-containing raw materials are given.

  9. Immunity to potato mop-top virus in Nicotiana benthamiana plants expressing the coat protein gene is effective against fungal inoculation of the virus.

    Science.gov (United States)

    Reavy, B; Arif, M; Kashiwazaki, S; Webster, K D; Barker, H

    1995-01-01

    Nicotiana benthamiana stem tissue was transformed with Agrobacterium tumefaciens harboring a binary vector containing the potato mop-top virus (PMTV) coat protein (CP) gene. PMTV CP was expressed in large amounts in some of the primary transformants. The five transgenic lines which produced the most CP were selected for resistance testing. Flowers on transformed plants were allowed to self-fertilize. Transgenic seedlings selected from the T1 seed were mechanically inoculated with two strains of PMTV. Virus multiplication, assayed by infectivity, was detected in only one transgenic plant of 98 inoculated. T1 plants were also highly resistant to graft inoculation; PMTV multiplied in only one plant of 45 inoculated. Transgenic T1 seedlings were challenged in a bait test in which they were grown in soil containing viruliferous spores of the vector fungus Spongospora subterranea. In these tests only two plants out of 99 became infected. Of the five transgenic lines tested, plants of three lines were immune to infection following manual, graft, or fungal inoculation.

  10. Development of a convenient in vivo hepatotoxin assay using a transgenic zebrafish line with liver-specific DsRed expression.

    Directory of Open Access Journals (Sweden)

    Xiaoyan Zhang

    Full Text Available Previously we have developed a transgenic zebrafish line (LiPan with liver-specific red fluorescent protein (DsRed expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine] caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics and chlorphenamine (pain killer did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry

  11. Development of a Convenient In Vivo Hepatotoxin Assay Using a Transgenic Zebrafish Line with Liver-Specific DsRed Expression

    Science.gov (United States)

    Zhang, Xiaoyan; Li, Caixia; Gong, Zhiyuan

    2014-01-01

    Previously we have developed a transgenic zebrafish line (LiPan) with liver-specific red fluorescent protein (DsRed) expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone) in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate) behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine]) caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics) and chlorphenamine (pain killer) did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry provide a rapid

  12. Metabolic engineering of potato carotenoid content through tuber-specific overexpression of a bacterial mini-pathway.

    Directory of Open Access Journals (Sweden)

    Gianfranco Diretto

    Full Text Available BACKGROUND: Since the creation of "Golden Rice", biofortification of plant-derived foods is a promising strategy for the alleviation of nutritional deficiencies. Potato is the most important staple food for mankind after the cereals rice, wheat and maize, and is extremely poor in provitamin A carotenoids. METHODOLOGY: We transformed potato with a mini-pathway of bacterial origin, driving the synthesis of beta-carotene (Provitamin A from geranylgeranyl diphosphate. Three genes, encoding phytoene synthase (CrtB, phytoene desaturase (CrtI and lycopene beta-cyclase (CrtY from Erwinia, under tuber-specific or constitutive promoter control, were used. 86 independent transgenic lines, containing six different promoter/gene combinations, were produced and analyzed. Extensive regulatory effects on the expression of endogenous genes for carotenoid biosynthesis are observed in transgenic lines. Constitutive expression of the CrtY and/or CrtI genes interferes with the establishment of transgenosis and with the accumulation of leaf carotenoids. Expression of all three genes, under tuber-specific promoter control, results in tubers with a deep yellow ("golden" phenotype without any adverse leaf phenotypes. In these tubers, carotenoids increase approx. 20-fold, to 114 mcg/g dry weight and beta-carotene 3600-fold, to 47 mcg/g dry weight. CONCLUSIONS: This is the highest carotenoid and beta-carotene content reported for biofortified potato as well as for any of the four major staple foods (the next best event being "Golden Rice 2", with 31 mcg/g dry weight beta-carotene. Assuming a beta-carotene to retinol conversion of 6ratio1, this is sufficient to provide 50% of the Recommended Daily Allowance of Vitamin A with 250 gms (fresh weight of "golden" potatoes.

  13. Comparison of nutritional value of transgenic peanut expressing bar and rcg3 genes with non-transgenic counterparts

    International Nuclear Information System (INIS)

    Robab, U.E.; )

    2014-01-01

    The transgenic peanut plants expressing bar and rcg3 genes were subjected to assessment of any change in nutritional value of the crop at various locations. The protein and fat contents of transgenic lines were compared with the non-transgenic parent varieties. Protein content in the transgenic lines was higher as compared to that in non-transgenic counterparts and differences among locations for fat and protein content were significant. No differences among fatty acids were recorded for genes, events and locations. Irrespective of small differences, all the values were in range described for this crop and transgenic lines appeared to be substantially equivalent to non-transgenic parent varieties. (author)

  14. Assessing Fungal Population in Soil Planted with Cry1Ac and CPTI Transgenic Cotton and Its Conventional Parental Line using 18S and ITS rDNA Sequences over Four Seasons

    Directory of Open Access Journals (Sweden)

    Xiemin Qi

    2016-07-01

    Full Text Available Long-term growth of genetically modified plants (GMPs has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S and region II (ITS1, 5.8S and ITS2 rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10 and 15-year plantation of various transgenic cotton cultivars (TC-15mix over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC were also compared. No notable differences were observed in soil fertility variables among CC, TC-10 and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line.

  15. Expression of bgt gene in transgenic birch (Betula platyphylla Suk ...

    African Journals Online (AJOL)

    Study on the characteristics of integration and expression is the basis of genetic stability of foreign genes in transgenic trees. To obtain insight into the relationship of transgene copy number and expression level, we screened 22 transgenic birch lines. Southern blot analysis of the transgenic birch plants indicated that the ...

  16. Expression of bgt gene in transgenic birch (Betula platyphylla Suk.)

    African Journals Online (AJOL)

    STORAGESEVER

    2009-08-04

    Aug 4, 2009 ... Study on the characteristics of integration and expression is the basis of genetic stability of foreign genes in transgenic trees. To obtain insight into the relationship of transgene copy number and expression level, we screened 22 transgenic birch lines. Southern blot analysis of the transgenic birch.

  17. Establishment and characterization of murine small cell lung carcinoma cell lines derived from HPV-16 E6/E7 transgenic mice.

    Science.gov (United States)

    Carraresi, Laura; Martinelli, Rosanna; Vannoni, Alessandro; Riccio, Massimo; Dembic, Maja; Tripodi, Sergio; Cintorino, Marcella; Santi, Spartaco; Bigliardi, Elisa; Carmellini, Mario; Rossini, Mara

    2006-01-08

    We have established two murine cell lines derived from Small Cell Lung Carcinomas (SCLCs) developed by HPV-E6/E7 transgenic mice. These cells named PPAP-9 and PPAP-10 were isolated from mice bearing tumors, 9 and 10 months old, respectively. The cells, 5 microm in diameter, express HPV oncoproteins and sustain tumor formation after subcutaneous injection in syngenic mice. A detailed analysis indicated the epithelial origin and the neuroendocrine differentiation of these cells. We showed by confocal immunofluorescence the expression of the epithelial marker cytokeratin 5, whose gene promoter was used to direct the expression of HPV E6/E. Cells express several neuroendocrine markers such as CGRP, MAP-2, Ash1, CgrA, Scg2. The neuroendocrine differentiation of these cells was further confirmed by electron microscopy demonstrating neuropeptides secreting granules in their cytoplasm. Furthermore, in agreement with the altered expression observed in the majority of human SCLC we showed in these cells the absence of both p53 and pRB and a dramatic reduction in the expression of Caveolin-1.

  18. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  19. Potato production in Thailand

    Science.gov (United States)

    Potato production has increased dramatically in recent years in Thailand. Consumer demand for fresh and processed potatoes has driven this trend. Most potatoes are produced in northern Thailand in either double cropping highland zones or as a single winter crop following rice in lowland regions. Maj...

  20. Harvesting soil with potatoes

    DEFF Research Database (Denmark)

    Egelyng, Henrik

    2017-01-01

    Norwegian authorities demand soil leaving potato packing plants to be deposited as waste. Depositing soil from potato processing plants is associated with significant cost for Norwegian producers. Therefore CYCLE investigated potato soil harvesting from an innovation and socio-economic perspective....

  1. Insect resistance to Nilaparvata lugens and Cnaphalocrocis medinalis in transgenic indica rice and the inheritance of gna+sbti transgenes.

    Science.gov (United States)

    Li, Guiying; Xu, Xinping; Xing, Hengtai; Zhu, Huachen; Fan, Qin

    2005-04-01

    Molecular genetic analysis and insect bioassay of transgenic indica rice 'Zhuxian B' plants carrying snowdrop lectin gene (gna) and soybean trypsin inhibitor gene (sbti) were investigated in detail. PCR, 'dot' blot and PCR-Southern blot analysis showed that both transgenes had been incorporated into the rice genome and transmitted up to R3 progeny in most lines tested. Some transgenic lines exhibited Mendelian segregation, but the other showed either 1:1 (positive: negative for the transgenes) or other aberrant segregation patterns. The segregation patterns of gna gene crossed between R2 and R3 progeny. In half of transgenic R3 lines, gna and sbti transgenes co-segregated. Two independent homozygous lines expressing double transgenes were identified in R3 progeny. Southern blot analysis demonstrated that the copy numbers of integrated gna and sbti transgenes varied from one to ten in different lines. Insect bioassay data showed that most transgenic plants had better resistance to both Nilaparvata lugens (Stahl) and Cnaphalocrocis medinalis (Guenee) than wild-type plants. The insect resistance of transgenic lines increased with the increase in transgene positive ratio in most of the transgenic lines. In all, we obtained nine lines of R3 transgenic plants, including one pure line, which had better resistance to both N lugens and C medinalis than wild-type plants. Copyright 2005 Society of Chemical Industry.

  2. Looking ahead…how biotechnology may change potato storage

    Science.gov (United States)

    We have been growing, harvesting, storing and characterizing tubers from transgenic potato plants for the past four years. The plants have low expression of the vacuolar invertase gene and were produced for research purposes by Jiming Jiang’s group at UW-Madison. We’ve analyzed sugars from over 2400...

  3. No direct effects of two transgenic Bt rice lines, T1C-19 and T2A-1, on the arthropod communities.

    Science.gov (United States)

    Lu, Z B; Tian, J C; Han, N S; Hu, C; Peng, Y F; Stanley, David; Ye, G Y

    2014-10-01

    A 2-yr field trial was conducted to assess the impacts of two new transgenic Bt rice lines, T1C-19 expressing Cry1C protein and T2A-1 expressing Cry2A protein, on the arthropod community sampled via vacuum. All the arthropods were classified into five guilds, including herbivores, parasitoids, predators, detritivores, and others. The seasonal density and dominance distribution of each guild and community-level indices (species richness, Shannon-Wiener diversity index, Simpson diversity index, and evenness index) were compared among rice types. Principal response curves were used to investigate the differences of entire arthropod community of Bt rice plots relative to non-Bt rice plots. The results showed no significant difference was detected in the community-level indices and dominance distribution of guilds between Bt and non-Bt rice plots. The seasonal density of herbivores, detritivores, and others as well as density of the arthropod overall community were also not significantly affected by rice types in either year, although the density of predators and parasitoids in Bt rice plots was significantly lower than those in non-Bt rice plots. The lower abundances of Braconidae, Eulophidae, Cyrtorhinus lividipennis (Reuter) (Hemiptera: Miridae), and Theridiidae in Bt rice plots are likely attributed to the lower abundances of prey species or hosts. Principal response curves revealed that arthropod community in Bt was similar with that in non-Bt rice plots. In conclusion, our findings indicate that these two tested Bt rice lines had no marked negative effects on the arthropod community in the paddy fields.

  4. Genetically pyramiding protease-inhibitor genes for dual broad-spectrum resistance against insect and phytopathogens in transgenic tobacco.

    Science.gov (United States)

    Senthilkumar, Rajendran; Cheng, Chiu-Ping; Yeh, Kai-Wun

    2010-01-01

    Protease inhibitors provide a promising means of engineering plant resistance against attack by insects and pathogens. Sporamin (trypsin inhibitor) from sweet potato and CeCPI (phytocystatin) from taro were stacked in a binary vector, using pMSPOA (a modified sporamin promoter) to drive both genes. Transgenic tobacco lines of T0 and T1 generation with varied inhibitory activity against trypsin and papain showed resistance to both insects and phytopathogens. Larvae of Helicoverpa armigera that ingested tobacco leaves either died or showed delayed growth and development relative to control larvae. Transgenic tobacco-overexpressing the stacked genes also exhibited strong resistance against bacterial soft rot disease caused by Erwinia carotovora and damping-off disease caused by Pythium aphanidermatum. Thus, stacking protease-inhibitor genes, driven by the wound and pathogen responsive pMSPOA promoter, is an effective strategy for engineering crops to resistance against insects and phytopathogens.

  5. Colonization of wild potato plants by Streptomyces scabies

    Science.gov (United States)

    The bacterial pathogen Streptomyces scabies produces lesions on potato tubers, reducing their marketability and profitability. M6 and 524-8 are two closely related inbred diploid lines of the wild potato species Solanum chacoense. After testing in both field and greenhouse assays, it was found that ...

  6. Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

    Science.gov (United States)

    Butler, Nathaniel M; Hannapel, David J

    2012-12-01

    Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

  7. Hot potato

    DEFF Research Database (Denmark)

    Hagemann, Kit S.; Scholderer, Joachim

    2009-01-01

    clear definitions and measurement rules exist. The concepts the consumers used when reasoning about biological processes were very abstract, suggesting that the participants had, at most, a holistic understanding. In line with this, issues of uncertainty played a prominent role for the consumers....

  8. Potato market in Ukraine

    Directory of Open Access Journals (Sweden)

    С. І. Мельник

    2017-06-01

    Full Text Available Purpose. To study Ukrainian potato market at the current stage of the development and determine its future prospects. Results. The features of Ukrainian potato market were determined. Production is almost fully provided by private households, meeting the needs of the domestic market. Main regions with the highest gross output and production of potatoes were defined. Ukraine is one of the major potato producing countries in the world. Today our country is not a key supplier or importer of this product because of the low export orientation of the industry, its technological backwardness, limited product range and the large number of small producers. Ukraine exports potato mainly to CIS countries, the highest share of potato import comes from the European Union. Now there are only a few large manufacturing companies in the market, which can be classified as industrial. Most potato varieties, officially permitted for dissemination in Ukraine, are classified as table ones and recommended for cultivation in the Forest-Steppe and Polissia zones. Achievements of the industry include the development of such very popular and promising trend as organic potato growing, which area in our country is one of the largest in the world. Conclusions. Potato produced in Ukraine is used for human consumption, animal feeding, planting and processing, its volumes are relatively stable. Large-scale industrial production of potato is not widely practiced because of low wholesale prices and high labor intensity of the cultivation process. During next few years, in view of current trends, production of potato and severe limitations of the domestic market for foreign operations will remain unchanged. A shift in emphasis in the product range – from fresh potato to processed food products should be a prospect for domestic industrial producers to improve their position in Ukraine and abroad.

  9. Potato (Solanum tuberosum L.).

    Science.gov (United States)

    Chetty, Venkateswari J; Narváez-Vásquez, Javier; Orozco-Cárdenas, Martha L

    2015-01-01

    Agrobacterium-mediated transformation is the most common method for the incorporation of foreign genes into the genome of potato as well as many other species in the Solanaceae family. This chapter describes protocols for the genetic transformation of three species of potato: Solanum tuberosum subsp. tuberosum (Desiréé), S. tuberosum subsp. andigenum (Blue potato), and S. tuberosum subsp. andigena using internodal segments as explants.

  10. Resistance of genetically modified potatoes to Potato virus Y under field conditions Resistência de plantas de batata geneticamente modificadas ao Potato virus Y em condições de campo

    Directory of Open Access Journals (Sweden)

    André Nepomuceno Dusi

    2009-09-01

    Full Text Available The objective of this work was to evaluate the resistance of genetically modified clones of potato to Potato virus Y (PVY under field conditions. Genetically modified plants were compared with nontransformed plants of the same cultivar. The plots were flanked with potato plants infected with both PVYº and PVY N strains (spread lines, in order to provide the experimental area with the source of virus, which was naturally spread by the native aphid population. The experiment was weekly monitored by visual inspections and by DAS-Elisa in the plants produced from the harvested tubers, in order to evaluate the resistance of transgenic plants throughout the plant growth cycle. By the end of the third year, no infection symptoms were observed in the 1P clone; clone 63P showed 1% of infection, in contrast to about 90% of nontransformed plants infected. The stable expression of resistance to PVY provided by the coat protein gene was obtained in genetically modified clones of potato plants cultivar Achat under field conditions, during three consecutive years.O objetivo deste trabalho foi avaliar a resistência de clones geneticamente modificados de batata ao Potato virus Y (PVY em condições de campo. As plantas geneticamente modificadas foram comparadas com plantas não modificadas da mesma cultivar. As parcelas foram delimitadas com plantas infectadas com as estirpes PVYº e PVY N (linhas disseminadoras, para tornar disponível, na área experimental, a fonte de inóculo de vírus, que foi naturalmente disseminada pela população nativa de afídeos. O experimento foi monitorado semanalmente por inspeção visual e por DAS-Elisa nas plantas produzidas a partir dos tubérculos colhidos, para avaliar a resistência de plantas transgênicas ao longo do ciclo de crescimento. Ao final do terceiro ano, nenhum sintoma de infecção foi observado no clone 1P; o clone 63P apresentou 1% de infecção, em contraste com cerca de 90% de plantas-controle infectadas

  11. The potato-specific apyrase is apoplastically localized and has influence on gene expression, growth, and development.

    Science.gov (United States)

    Riewe, David; Grosman, Lukasz; Fernie, Alisdair R; Wucke, Cornelia; Geigenberger, Peter

    2008-07-01

    Apyrases hydrolyze nucleoside triphosphates and diphosphates and are found in all eukaryotes and a few prokaryotes. Although their enzymatic properties have been well characterized, relatively little is known regarding their subcellular localization and physiological function in plants. In this study, we used reverse genetic and biochemical approaches to investigate the role of potato (Solanum tuberosum)-specific apyrase. Silencing of the apyrase gene family with RNA interference constructs under the control of the constitutive 35S promoter led to a strong decrease in apyrase activity to below 10% of the wild-type level. This decreased activity led to phenotypic changes in the transgenic lines, including a general retardation in growth, an increase in tuber number per plant, and differences in tuber morphology. Silencing of apyrase under the control of a tuber-specific promoter led to similar changes in tuber morphology; however, there were no direct effects of apyrase inhibition on tuber metabolism. DNA microarrays revealed that decreased expression of apyrase leads to increased levels of transcripts coding for cell wall proteins involved in growth and genes involved in energy transfer and starch synthesis. To place these results in context, we determined the subcellular localization of the potato-specific apyrase. Using a combination of approaches, we were able to demonstrate that this enzyme is localized to the apoplast. We describe the evidence that underlies both this fact and that potato-specific apyrase has a crucial role in regulating growth and development.

  12. Use of phosphomannose isomerase-based selection system for Agrobacterium-mediated transformation of tomato and potato

    Czech Academy of Sciences Publication Activity Database

    Bříza, Jindřich; Pavingerová, Daniela; Přikrylová, P.; Gazdová, J.; Vlasák, Josef; Niedermeierová, Hana

    2008-01-01

    Roč. 52, č. 3 (2008), s. 453-461 ISSN 0006-3134 R&D Projects: GA ČR GA521/05/2092 Institutional research plan: CEZ:AV0Z50510513 Keywords : transgenic plants * trnasgenic potato * transgenic tomato Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.426, year: 2008

  13. Potatoes, pathogens and pests

    NARCIS (Netherlands)

    Lazebnik, Jenny

    2017-01-01

    Currently, fungicides are necessary to protect potato crops against late blight, Phytophthora infestans, one of the world’s most damaging crop pathogens. The introgression of plant resistance genes from wild potato species targeted specifically to the late blight pathogen into

  14. Accumulation of nickel in transgenic tobacco

    Science.gov (United States)

    Sidik, Nik Marzuki; Othman, Noor Farhan

    2013-11-01

    The accumulation of heavy metal Ni in the roots and leaves of four T1 transgenic lines of tobacco (T(1)20E, T(1)24C, T(1)18B1 and T(1)20B) expressing eiMT1 from E.indica was assessed. The aim of the study was to investigate the level of Ni accumulation in the leaves and roots of each transgenic lines and to evaluate the eligibility of the plants to be classified as a phytoremediation agent. All of the transgenic lines showed different ability in accumulating different metals and has translocation factor (TF) less than 1 (TFtransgenic lines, transgenic line T(1)24C showed the highest accumulation of Ni (251.9 ± 0.014 mg/kg) and the lowest TF value (TFT(1)24C=0.0875) at 60 ppm Ni.

  15. Potato irradiation technology in Japan

    International Nuclear Information System (INIS)

    Takehisa, M.

    1981-01-01

    After the National research program on potato irradiation, the public consumption of potatoes irradiated to a maximum of 15 krad was authorized by the Ministry of Welfare. Shihoro Agricultural Cooperative Association, one of the largest potato producers in Japan with an annual production of 200,000 tons, intended an application of the irradiation to their potato storage system. This paper describes the technological background of the potato irradiation facility and operational experience. (author)

  16. Chromium in potatoes

    International Nuclear Information System (INIS)

    Stoddard-Gilbert, K.; Blincoe, C.

    1989-01-01

    Chromium concentration in potatoes was determined, and tubes were labeled either intrinsically or extrinsically with radioactive chromate ( 51 Cr). A labeled chromium complex was isolated from preparations of raw, baked, or fried potatoes and chromatographed on gel permeation media. Potato pulp and peel contained 1.63 and 2.70 μg of Cr/g tissue, respectively. There was no correlation between the two, nor did they respond similarly to changes of variety or locations. No significant differences were apparent in relative migration of the isolated complexes except between raw and cooked extrinsically labeled preparations

  17. Tocopherol deficiency reduces sucrose export from salt-stressed potato leaves independently of oxidative stress and symplastic obstruction by callose

    Science.gov (United States)

    Asensi-Fabado, María Amparo; Ammon, Alexandra; Sonnewald, Uwe; Munné-Bosch, Sergi; Voll, Lars M.

    2015-01-01

    Tocopherol cyclase, encoded by the gene SUCROSE EXPORT DEFECTIVE1, catalyses the second step in the synthesis of the antioxidant tocopherol. Depletion of SXD1 activity in maize and potato leaves leads to tocopherol deficiency and a ‘sugar export block’ phenotype that comprises massive starch accumulation and obstruction of plasmodesmata in paraveinal tissue by callose. We grew two transgenic StSXD1:RNAi potato lines with severe tocopherol deficiency under moderate light conditions and subjected them to salt stress. After three weeks of salt exposure, we observed a strongly reduced sugar exudation rate and a lack of starch mobilization in leaves of salt-stressed transgenic plants, but not in wild-type plants. However, callose accumulation in the vasculature declined upon salt stress in all genotypes, indicating that callose plugging of plasmodesmata was not the sole cause of the sugar export block phenotype in tocopherol-deficient leaves. Based on comprehensive gene expression analyses, we propose that enhanced responsiveness of SnRK1 target genes in mesophyll cells and altered redox regulation of phloem loading by SUT1 contribute to the attenuation of sucrose export from salt-stressed SXD:RNAi source leaves. Furthermore, we could not find any indication that elevated oxidative stress may have served as a trigger for the salt-induced carbohydrate phenotype of SXD1:RNAi transgenic plants. In leaves of the SXD1:RNAi plants, sodium accumulation was diminished, while proline accumulation and pools of soluble antioxidants were increased. As supported by phytohormone contents, these differences seem to increase longevity and prevent senescence of SXD:RNAi leaves under salt stress. PMID:25428995

  18. Expression of an engineered heterologous antimicrobial peptide in potato alters plant development and mitigates normal abiotic and biotic responses.

    Directory of Open Access Journals (Sweden)

    Ravinder K Goyal

    Full Text Available Antimicrobial cationic peptides (AMPs are ubiquitous small proteins used by living cells to defend against a wide spectrum of pathogens. Their amphipathic property helps their interaction with negatively charged cellular membrane of the pathogen causing cell lysis and death. AMPs also modulate signaling pathway(s and cellular processes in animal models; however, little is known of cellular processes other than the pathogen-lysis phenomenon modulated by AMPs in plants. An engineered heterologous AMP, msrA3, expressed in potato was previously shown to cause resistance of the transgenic plants against selected fungal and bacterial pathogens. These lines together with the wild type were studied for growth habits, and for inducible defense responses during challenge with biotic (necrotroph Fusarium solani and abiotic stressors (dark-induced senescence, wounding and temperature stress. msrA3-expression not only conferred protection against F. solani but also delayed development of floral buds and prolonged vegetative phase. Analysis of select gene transcript profiles showed that the transgenic potato plants were suppressed in the hypersensitive (HR and reactive oxygen species (ROS responses to both biotic and abiotic stressors. Also, the transgenic leaves accumulated lesser amounts of the defense hormone jasmonic acid upon wounding with only a slight change in salicylic acid as compared to the wild type. Thus, normal host defense responses to the pathogen and abiotic stressors were mitigated by msrA3 expression suggesting MSRA3 regulates a common step(s of these response pathways. The stemming of the pathogen growth and mitigating stress response pathways likely contributes to resource reallocation for higher tuber yield.

  19. 2013 North Dakota Transgenic Barley Research and FHB Nursery Report

    Science.gov (United States)

    Research continues to develop and test new transgenic plants using genes provided by collaborators. As lines are developed in Golden Promise, they are crossed to Conlon for field testing. Transgenic lines developed in Conlon are being crossed to resistant lines developed by the breeding programs. ...

  20. The mechanism of thioacetamide-induced apoptosis in the L37 albumin-SV40 T-antigen transgenic rat hepatocyte-derived cell line occurs without DNA fragmentation.

    Science.gov (United States)

    Bulera, S J; Sattler, C A; Gast, W L; Heath, S; Festerling, T A; Pitot, H C

    1998-10-01

    The hepatotoxicant thioacetamide (TH) has classically been used as a model to study hepatic necrosis; however, recent studies have shown that TH can also induce apoptosis. In this report we demonstrate that 2.68+/-0.54% of the albumin-SV40 T-antigen transgenic rat hepatocytes undergo TH-induced apoptosis, a level comparable to other in vivo models of liver apoptosis. In addition, TH could induce apoptosis and necrosis in the L37 albumin-SV40 T-antigen transgenic rat liver-derived cell line. Examination of dying L37 cells treated with 100 mM TH by electron microscopy revealed distinct morphological characteristics that could be attributed to apoptosis. Quantitation of apoptosis by FACS analysis 24 h after treatment with 100 mM TH revealed that 81.3+/-1.6% of the cells were undergoing apoptosis. In contrast, when L37 cells were treated with 250 mM TH, cells exhibited characteristics consistent with necrotic cell death. DNA fragmentation ladders were produced by growth factor withdrawal-induced apoptosis; however, in 100 mM TH-induced apoptosis, DNA fragmentation ladders were not observed. Analysis of endonuclease activity in L37 cells revealed that the enzymes were not inactivated in the presence of 100 mM TH. The data presented in this report indicate that the L37 cell line could be used to study the mechanism of TH-induced apoptosis that was not mediated through a mechanism requiring DNA fragmentation.

  1. You Say Potato!

    OpenAIRE

    Gillespie, Elgy

    2001-01-01

    "If we are what we eat, as they are forever telling, then we're mostly potato" sayd travel writer, journalist and enthusiastic cook Elgy Gillespie Now Elgy has drawn on her travel experiences and her love of food to gather over 100 potato recipes from Ireland and around the world" Taken from the back cover. Published by Wolfhound Press Ltd., 68 Mountjoy Square, Dublin in 2001. Illustrated by Rebecca Wildsmith. Cover illustration Eva Byrne, cover photograph Richard Gibson, cover design W...

  2. Nematode neuropeptides as transgenic nematicides.

    Directory of Open Access Journals (Sweden)

    Neil D Warnock

    2017-02-01

    Full Text Available Plant parasitic nematodes (PPNs seriously threaten global food security. Conventionally an integrated approach to PPN management has relied heavily on carbamate, organophosphate and fumigant nematicides which are now being withdrawn over environmental health and safety concerns. This progressive withdrawal has left a significant shortcoming in our ability to manage these economically important parasites, and highlights the need for novel and robust control methods. Nematodes can assimilate exogenous peptides through retrograde transport along the chemosensory amphid neurons. Peptides can accumulate within cells of the central nerve ring and can elicit physiological effects when released to interact with receptors on adjoining cells. We have profiled bioactive neuropeptides from the neuropeptide-like protein (NLP family of PPNs as novel nematicides, and have identified numerous discrete NLPs that negatively impact chemosensation, host invasion and stylet thrusting of the root knot nematode Meloidogyne incognita and the potato cyst nematode Globodera pallida. Transgenic secretion of these peptides from the rhizobacterium, Bacillus subtilis, and the terrestrial microalgae Chlamydomonas reinhardtii reduce tomato infection levels by up to 90% when compared with controls. These data pave the way for the exploitation of nematode neuropeptides as a novel class of plant protective nematicide, using novel non-food transgenic delivery systems which could be deployed on farmer-preferred cultivars.

  3. Overexpression of StNF-YB3.1 reduces photosynthetic capacity and tuber production, and promotes ABA-mediated stomatal closure in potato (Solanum tuberosum L.).

    Science.gov (United States)

    Xuanyuan, Guochao; Lu, Congming; Zhang, Ruofang; Jiang, Jiming

    2017-08-01

    Nuclear factor Y (NF-Y) is one of the most ubiquitous transcription factors (TFs), comprising NF-YA, NF-YB and NF-YC subunits, and has been identified and reported in various aspects of development for plants and animals. In this work, StNF-YB3.1, a putative potato NF-YB subunit encoding gene, was isolated from Solanum tuberosum by rapid amplification of cDNA ends (RACE). Overexpression of StNF-YB3.1 in potato (cv. Atlantic) resulted in accelerated onset of flowering, and significant increase in leaf chlorophyll content in field trials. However, transgenic potato plants overexpressing StNF-YB3.1 (OEYB3.1) showed significant decreases in photosynthetic rate and stomatal conductance both at tuber initiation and bulking stages. OEYB3.1 lines were associated with significantly fewer tuber numbers and yield reduction. Guard cell size and stomatal density were not changed in OEYB3.1 plants, whereas ABA-mediated stomatal closure was accelerated compared to that of wild type plants because of the up-regulation of genes for ABA signaling, such as StCPK10-like, StSnRK2.6/OST1-like, StSnRK2.7-like and StSLAC1-like. We speculate that the acceleration of stomatal closure was a possible reason for the significantly decreased stomatal conductance and photosynthetic rate. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Achieving sustainable cultivation of potatoes

    Science.gov (United States)

    Every phase of the production cycle impacts the sustainability of potato. Potato physiology determines how genetically encoded developmental attributes interact with local environmental conditions as modified through agricultural practice to produce a perishable crop. In this chapter we highlight ho...

  5. Structure of potato starch

    DEFF Research Database (Denmark)

    Bertoft, Eric; Blennow, Andreas

    2016-01-01

    Potato starch granules consist primarily of two tightly packed polysaccharides, amylose and amylopectin. Amylose, which amount for 20-30%, is the principal linear component, but a fraction is in fact slightly branched. Amylopectin is typically the major component and is extensively branched...... chains extending from the clusters. A range of enzymes is involved in the biosynthesis of the cluster structures and linear segments. These are required for sugar activation, chain elongation, branching, and trimming of the final branching pattern. As an interesting feature, potato amylopectin...... is substituted with low amounts of phosphate groups monoesterified to the C-3 and the C-6 carbons of the glucose units. They seem to align well in the granular structure and have tremendous effects on starch degradation in the potato and functionality of the refined starch. A specific dikinase catalyzes...

  6. [Progress in transgenic fish techniques and application].

    Science.gov (United States)

    Ye, Xing; Tian, Yuan-Yuan; Gao, Feng-Ying

    2011-05-01

    Transgenic technique provides a new way for fish breeding. Stable lines of growth hormone gene transfer carps, salmon and tilapia, as well as fluorescence protein gene transfer zebra fish and white cloud mountain minnow have been produced. The fast growth characteristic of GH gene transgenic fish will be of great importance to promote aquaculture production and economic efficiency. This paper summarized the progress in transgenic fish research and ecological assessments. Microinjection is still the most common used method, but often resulted in multi-site and multi-copies integration. Co-injection of transposon or meganuclease will greatly improve the efficiency of gene transfer and integration. "All fish" gene or "auto gene" should be considered to produce transgenic fish in order to eliminate misgiving on food safety and to benefit expression of the transferred gene. Environmental risk is the biggest obstacle for transgenic fish to be commercially applied. Data indicates that transgenic fish have inferior fitness compared with the traditional domestic fish. However, be-cause of the genotype-by-environment effects, it is difficult to extrapolate simple phenotypes to the complex ecological interactions that occur in nature based on the ecological consequences of the transgenic fish determined in the laboratory. It is critical to establish highly naturalized environments for acquiring reliable data that can be used to evaluate the environ-mental risk. Efficacious physical and biological containment strategies remain to be crucial approaches to ensure the safe application of transgenic fish technology.

  7. Neuroanatomy and transgenic technologies

    Science.gov (United States)

    This is a short review that introduces recent advances of neuroanatomy and transgenic technologies. The anatomical complexity of the nervous system remains a subject of tremendous fascination among neuroscientists. In order to tackle this extraordinary complexity, powerful transgenic technologies a...

  8. System Architecture For High Speed Sorting Of Potatoes

    Science.gov (United States)

    Marchant, J. A.; Onyango, C. M.; Street, M. J.

    1989-03-01

    This paper illustrates an industrial application of vision processing in which potatoes are sorted according to their size and shape at speeds of up to 40 objects per second. The result is a multi-processing approach built around the VME bus. A hardware unit has been designed and constructed to encode the boundary of the potatoes, to reducing the amount of data to be processed. A master 68000 processor is used to control this unit and to handle data transfers along the bus. Boundary data is passed to one of three 68010 slave processors each responsible for a line of potatoes across a conveyor belt. The slave processors calculate attributes such as shape, size and estimated weight of each potato and the master processor uses this data to operate the sorting mechanism. The system has been interfaced with a commercial grading machine and performance trials are now in progress.

  9. Transgenic approaches in potato: effects on glycoalkaloids levels

    African Journals Online (AJOL)

    Sayyar

    2013-02-20

    Feb 20, 2013 ... effects of plant transformation on known toxic compounds has been an area of immense interest. Compositional .... cells carrying rDNA molecules are induced to regenerate .... Glycoalkaloids in toxic levels disrupt membrane.

  10. Fructan as a new carbohydrate sink in transgenic potato plants.

    NARCIS (Netherlands)

    Meer, van der I.M.; Ebskamp, M.J.M.; Visser, R.G.F.; Weisbeek, P.J.; Smeekens, S.C.M.

    1994-01-01

    Fructans are polyfructose molecules that function as nonstructural storage carbohydrates in several plant species that are important crops. We have been studying plants for their ability to synthesize and degrade fructans to determine if this ability is advantageous. We have also been analyzing the

  11. Callus induction and growth in transgenic potato genotypes

    African Journals Online (AJOL)

    Administrator

    Solanum tuberosum L.). This has resulted in a range of protocols and procedures being established by researchers since tissue culture gained an importance in plant propagation, conservation and breeding (Ahloowalia 1982; Wareh et al., 1989).

  12. LINES

    Directory of Open Access Journals (Sweden)

    Minas Bakalchev

    2015-10-01

    Full Text Available The perception of elements in a system often creates their interdependence, interconditionality, and suppression. The lines from a basic geometrical element have become the model of a reductive world based on isolation according to certain criteria such as function, structure, and social organization. Their traces are experienced in the contemporary world as fragments or ruins of a system of domination of an assumed hierarchical unity. How can one release oneself from such dependence or determinism? How can the lines become less “systematic” and forms more autonomous, and less reductive? How is a form released from modernistic determinism on the new controversial ground? How can these elements or forms of representation become forms of action in the present complex world? In this paper, the meaning of lines through the ideas of Le Corbusier, Leonidov, Picasso, and Hitchcock is presented. Spatial research was made through a series of examples arising from the projects of the architectural studio “Residential Transformations”, which was a backbone for mapping the possibilities ranging from playfulness to exactness, as tactics of transformation in the different contexts of the contemporary world.

  13. 7 CFR 947.5 - Potatoes.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Potatoes. 947.5 Section 947.5 Agriculture Regulations... Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE IRISH POTATOES GROWN IN MODOC AND SISKIYOU... Definitions § 947.5 Potatoes. Potatoes means all varieties of Irish potatoes grown within the aforesaid...

  14. 7 CFR 947.12 - Seed potatoes.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Seed potatoes. 947.12 Section 947.12 Agriculture... and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE IRISH POTATOES GROWN IN MODOC AND... Definitions § 947.12 Seed potatoes. Seed potatoes means and includes all potatoes officially certified and...

  15. 7 CFR 1207.306 - Potatoes.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Potatoes. 1207.306 Section 1207.306 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POTATO RESEARCH AND PROMOTION PLAN Potato Research and Promotion Plan Definitions § 1207.306 Potatoes. Potatoes means any or all varieties...

  16. 7 CFR 946.5 - Potatoes.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Potatoes. 946.5 Section 946.5 Agriculture Regulations... Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE IRISH POTATOES GROWN IN WASHINGTON Order Regulating Handling Definitions § 946.5 Potatoes. Potatoes means all varieties of Irish potatoes grown within...

  17. 7 CFR 953.5 - Potatoes.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Potatoes. 953.5 Section 953.5 Agriculture Regulations... Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE IRISH POTATOES GROWN IN SOUTHEASTERN STATES Order Regulating Handling Definitions § 953.5 Potatoes. Potatoes means all varieties of Irish potatoes...

  18. 7 CFR 948.5 - Potatoes.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Potatoes. 948.5 Section 948.5 Agriculture Regulations... Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE IRISH POTATOES GROWN IN COLORADO Order Regulating Handling Definitions § 948.5 Potatoes. Potatoes means and includes all varieties of Irish potatoes...

  19. 7 CFR 948.6 - Seed potatoes.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Seed potatoes. 948.6 Section 948.6 Agriculture... and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE IRISH POTATOES GROWN IN COLORADO Order Regulating Handling Definitions § 948.6 Seed potatoes. Seed potatoes or seed means any potatoes...

  20. Transformation of heat shock protein gene (HspB-C) of helicobacter pylori into sweet potato varieties

    International Nuclear Information System (INIS)

    Wu Jie; Yan Wenzhao; Zhou Yu; Zhang Xuemei

    2010-01-01

    Sweet potato which is one of the most important crops in the world has many advantages as a new bioreactor. Helicobacter pylori, as a kind of cancer-causing factor by the World Health Organization, has a strong immunogenicity, and its monoclonal antibody has bactericidal activity, which has the possibility as the vaccine components. In this research, we have constructed the plant expression vector with heat shock protein gene (HspB-C) of Helicobacter pylori. This vector was transformed by agrobactrium tumefaciens EHA105 into four sweet potato varieties. After callus-induction and re-differentiation, we got the transgenic plants from sweet potato variety of Nancy holl. (authors)

  1. Growth and development of Colorado potato beetle larvae, Leptinotarsa decemlineata, on potato plants expressing the oryzacystatin II proteinase inhibitor.

    Science.gov (United States)

    Cingel, Aleksandar; Savić, Jelena; Vinterhalter, Branka; Vinterhalter, Dragan; Kostić, Miroslav; Jovanović, Darka Šešlija; Smigocki, Ann; Ninković, Slavica

    2015-08-01

    Plant proteinase inhibitors (PIs) are attractive tools for crop improvement and their heterologous expression can enhance insect resistance in transgenic plants. PI oryzacystatin II (OCII), isolated from rice, showed potential in controlling pests that utilize cysteine proteinases for protein digestion. To evaluate the applicability of the OCII gene in enhancing plant defence, OCII-transformed potatoes were bioassayed for resistance to Colorado potato beetle (Leptinotarsa decemlineata Say). Feeding on transformed leaves of potato cultivars Desiree and Jelica significantly affected larval growth and development, but did not change mortality rates. During the L2 and L3 developmental stages larvae consumed the OCII-transformed foliage faster as compared to the nontransformed control. Also these larvae reached the prepupal stage (end of L4 stage) 2 days earlier than those fed on control leaves. However, the total amounts of consumed OCII-transformed leaves were up to 23% lower than of control, and the maximal weights of prepupal larvae were reduced by up to 18% as compared to larvae fed on nontransformed leaves. The reduction in insect fitness reported in this study in combination with other control measures, could lead to improved CPB resistance management in potato.

  2. Transgenic plants with enhanced growth characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

    2018-01-09

    The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

  3. Transgenic plants with enhanced growth characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

    2016-09-06

    The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

  4. Marketing Maine Tablestock Potatoes

    OpenAIRE

    Berney, Gerald; Grajewski, Gregory; Hinman, Don; Prater, Marvin E.; Taylor, April

    2010-01-01

    The Marketing Services Division of USDA’s Agricultural Marketing Service (AMS) was asked by USDA’s Agricultural Research Service (ARS) National Program Leader and ARS’s New England Soil and Water Research Laboratory personnel to help with existing efforts to assist Maine fresh potato farmers in their search for alternative marketing strategies, and reverse the recent decline in the profitability of their operations. ARS researchers previously had conducted an exhaustive study defining possibl...

  5. Bean Yellow Dwarf Virus replicons for high-level transgene expression in transgenic plants and cell cultures.

    Science.gov (United States)

    Zhang, Xiuren; Mason, Hugh

    2006-02-05

    A novel stable transgenic plant expression system was developed using elements of the replication machinery of Bean Yellow Dwarf Virus (BeYDV). The system contains two transgenes: 1) The BeYDV replicon vector with an expression cassette flanked by cis-acting DNA elements of BeYDV, and 2) The viral replication initiator protein (Rep) controlled by an alcohol-inducible promoter. When Rep expression was triggered by treatment with ethanol, it induced release of the BeYDV replicon from stably integrated T-DNA and episomal replication to high copy number. Replicon amplification resulted in substantially increased transgene mRNA levels (up to 80-fold) and translation products (up to 10-fold) after induction of Rep expression by ethanol treatment in tobacco NT1 cells and leaves of whole potato plants. Thus, the BeYDV stable transformant replicon system is a powerful tool for plant-based production of recombinant proteins. (c) 2005 Wiley Periodicals, Inc.

  6. Repression of a novel isoform of disproportionating enzyme (stDPE2) in potato leads to inhibition of starch degradation in leaves but not tubers stored at low temperature

    DEFF Research Database (Denmark)

    Lloyd, J.R.; Blennow, A.; Burhenne, K.

    2004-01-01

    and tubers. Transgenic potato plants were made in which its presence was almost completely eliminated. It could be demonstrated that starch degradation was repressed in leaves of the transgenic plants but that cold-induced sweetening was not affected in tubers stored at 4degreesC. No evidence could be found...

  7. [Production of human proteins in the blood of transgenic animals

    NARCIS (Netherlands)

    Massoud, M.; Bischoff, Rainer; Dalemans, W.; Pointu, H.; Attal, J.; Schultz, H.; Clesse, D.; Stinnakre, M.G.; Pavirani, A.; Houdebine, L.M.

    1990-01-01

    The human alpha 1-antitrypsin gene has been microinjected into rabbit embryos. A line of transgenic rabbits has thus been established. Human alpha 1-antitrypsin was found in the blood of transgenic animals at the concentration of 1 mg/ml plasma. The human protein was active and separable from its

  8. Jasmonate-dependent modifications of the pectin matrix during potato development function as a defense mechanism targeted by Dickeya dadantii virulence factors.

    Science.gov (United States)

    Taurino, Marco; Abelenda, Jose A; Río-Alvarez, Isabel; Navarro, Cristina; Vicedo, Begonya; Farmaki, Theodora; Jiménez, Pedro; García-Agustín, Pilar; López-Solanilla, Emilia; Prat, Salomé; Rojo, Enrique; Sánchez-Serrano, José J; Sanmartín, Maite

    2014-02-01

    The plant cell wall constitutes an essential protection barrier against pathogen attack. In addition, cell-wall disruption leads to accumulation of jasmonates (JAs), which are key signaling molecules for activation of plant inducible defense responses. However, whether JAs in return modulate the cell-wall composition to reinforce this defensive barrier remains unknown. The enzyme 13-allene oxide synthase (13-AOS) catalyzes the first committed step towards biosynthesis of JAs. In potato (Solanum tuberosum), there are two putative St13-AOS genes, which we show here to be differentially induced upon wounding. We also determine that both genes complement an Arabidopsis aos null mutant, indicating that they encode functional 13-AOS enzymes. Indeed, transgenic potato plants lacking both St13-AOS genes (CoAOS1/2 lines) exhibited a significant reduction of JAs, a concomitant decrease in wound-responsive gene activation, and an increased severity of soft rot disease symptoms caused by Dickeya dadantii. Intriguingly, a hypovirulent D. dadantii pel strain lacking the five major pectate lyases, which causes limited tissue maceration on wild-type plants, regained infectivity in CoAOS1/2 plants. In line with this, we found differences in pectin methyl esterase activity and cell-wall pectin composition between wild-type and CoAOS1/2 plants. Importantly, wild-type plants had pectins with a lower degree of methyl esterification, which are the substrates of the pectate lyases mutated in the pel strain. These results suggest that, during development of potato plants, JAs mediate modification of the pectin matrix to form a defensive barrier that is counteracted by pectinolytic virulence factors from D. dadantii. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  9. Skin quality in red potatoes

    Science.gov (United States)

    Attractive appearance is a highly desirable characteristic of fresh market red-skinned potatoes. The ideal red potato has a rich, uniform, deep red color. Color fading, netting, browning, and discoloration caused by skinning and disease decrease marketability and may reduce profits to growers and pa...

  10. Acrylamide in processed potato products

    Science.gov (United States)

    Trace amounts of acrylamide are found in many foods cooked at high temperatures. Acrylamide in processed potato products is formed from reducing sugars and asparagine and is a product of the Maillard reaction. Processed potato products including fries and chips are relatively high in acrylamide comp...

  11. Hepatic steatosis in transgenic mice overexpressing human histone deacetylase 1

    International Nuclear Information System (INIS)

    Wang, Ai-Guo; Seo, Sang-Beom; Moon, Hyung-Bae; Shin, Hye-Jun; Kim, Dong Hoon; Kim, Jin-Man; Lee, Tae-Hoon; Kwon, Ho Jeong; Yu, Dae-Yeul; Lee, Dong-Seok

    2005-01-01

    It is generally thought that histone deacetylases (HDACs) play important roles in the transcriptional regulation of genes. However, little information is available concerning the specific functions of individual HDACs in disease states. In this study, two transgenic mice lines were established which harbored the human HDAC1 gene. Overexpressed HDAC1 was detected in the nuclei of transgenic liver cells, and HDAC1 enzymatic activity was significantly higher in the transgenic mice than in control littermates. The HDAC1 transgenic mice exhibited a high incidence of hepatic steatosis and nuclear pleomorphism. Molecular studies showed that HDAC1 may contribute to nuclear pleomorphism through the p53/p21 signaling pathway

  12. Developmental modulation of inulin accumulation in storage organs of transgenic maize and transgenic potato

    NARCIS (Netherlands)

    Stoop, J.M.; Arkel, van J.; Hakkert, J.C.; Tyree, C.; Caimi, P.G.; Koops, A.J.

    2007-01-01

    Many important health promoting and functional characteristics are attributed to the non-digestible polysaccharide, inulin. Its use as a prebiotic in functional food and feed has further increased inulin demand worldwide. Inulin production in crops used for food and feed application, such as maize

  13. Competitive performance of transgenic wheat resistant to powdery mildew.

    Directory of Open Access Journals (Sweden)

    Olena Kalinina

    Full Text Available Genetically modified (GM plants offer an ideal model system to study the influence of single genes that confer constitutive resistance to pathogens on the ecological behaviour of plants. We used phytometers to study competitive interactions between GM lines of spring wheat Triticum aestivum carrying such genes and control lines. We hypothesized that competitive performance of GM lines would be reduced due to enhanced transgene expression under pathogen levels typically encountered in the field. The transgenes pm3b from wheat (resistance against powdery mildew Blumeria graminis or chitinase and glucanase genes from barley (resistance against fungi in general were introduced with the ubiquitin promoter from maize (pm3b and chitinase genes or the actin promoter from rice (glucanase gene. Phytometers of 15 transgenic and non-transgenic wheat lines were transplanted as seedlings into plots sown with the same 15 lines as competitive environments and subject to two soil nutrient levels. Pm3b lines had reduced mildew incidence compared with control lines. Chitinase and chitinase/glucanase lines showed the same high resistance to mildew as their control in low-nutrient treatment and slightly lower mildew rates than the control in high-nutrient environment. Pm3b lines were weaker competitors than control lines. This resulted in reduced yield and seed number. The Pm3b line with the highest transgene expression had 53.2% lower yield than the control whereas the Pm3b line which segregated in resistance and had higher mildew rates showed only minor costs under competition. The line expressing both chitinase and glucanase genes also showed reduced yield and seed number under competition compared with its control. Our results suggest that single transgenes conferring constitutive resistance to pathogens can have ecological costs and can weaken plant competitiveness even in the presence of the pathogen. The magnitude of these costs appears related to the degree

  14. The Inter-genebank Potato Database and the dimensions of available wild potato germplasm

    NARCIS (Netherlands)

    Huamán, Z.; Hoekstra, R.; Bamberg, J.B.

    2000-01-01

    The Association of Potato Inter-genebank Collaborators (APIC) constructed a database of all wild potato holdings of the most important potato genebanks in Europe, the United States, Peru, and Argentina. The Inter-genebank Potato Database (IPD) now contains data of 11,819 wild potato accessions

  15. 21 CFR 102.41 - Potato chips made from dried potatoes.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Potato chips made from dried potatoes. 102.41... Specific Nonstandardized Foods § 102.41 Potato chips made from dried potatoes. (a) The common or usual name of the food product that resembles and is of the same composition as potato chips, except that it is...

  16. Potatoes in Space

    Science.gov (United States)

    2004-01-01

    Astroculture is a suite of technologies used to produce and maintain a closed controlled environment for plant growth. The two most recent missions supported growth of potato, dwarf wheat, and mustard plants and provided scientists with the first opportunity to conduct true plant research in space. Light emitting diodes have particular usefulness for plant growth lighting because they emit a much smaller amount of radiant heat than do conventional lighting sources and because they have potential of directing a higher percentage of the emitted light onto plants surfaces. Furthermore, the high output LED's have emissions in the 600-700 nm waveband, which is of highest efficiency for photosynthesis by plants.

  17. Welfare assessment in transgenic pigs expressing green fluorescent protein (GFP)

    DEFF Research Database (Denmark)

    Huber, Reinhard C.; Remuge, Liliana; Carlisle, Ailsa

    2012-01-01

    Since large animal transgenesis has been successfully attempted for the first time about 25 years ago, the technology has been applied in various lines of transgenic pigs. Nevertheless one of the concerns with the technology—animal welfare—has not been approached through systematic assessment...... and statements regarding the welfare of transgenic pigs have been based on anecdotal observations during early stages of transgenic programs. The main aim of the present study was therefore to perform an extensive welfare assessment comparing heterozygous transgenic animals expressing GFP with wildtype animals...... months. The absence of significant differences between GFP and wildtype animals in the parameters observed suggests that the transgenic animals in question are unlikely to suffer from deleterious effects of transgene expression on their welfare and thus support existing anecdotal observations of pigs...

  18. 7 CFR 946.12 - Seed potatoes.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Seed potatoes. 946.12 Section 946.12 Agriculture... and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE IRISH POTATOES GROWN IN WASHINGTON Order Regulating Handling Definitions § 946.12 Seed potatoes. Seed potatoes means and includes all...

  19. Accurate measure of transgene copy number in crop plants using droplet digital PCR

    Science.gov (United States)

    Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy numb...

  20. Effect of 5'-flanking sequence deletions on expression of the human insulin gene in transgenic mice

    DEFF Research Database (Denmark)

    Fromont-Racine, M; Bucchini, D; Madsen, O

    1990-01-01

    Expression of the human insulin gene was examined in transgenic mouse lines carrying the gene with various lengths of DNA sequences 5' to the transcription start site (+1). Expression of the transgene was demonstrated by 1) the presence of human C-peptide in urine, 2) the presence of specific...... of the transgene was observed in cell types other than beta-islet cells....

  1. A transgenic mouse model for trilateral retinoblastoma

    NARCIS (Netherlands)

    O'Brien, J.M.; Marcus, D.M.; Bernards, R.A.; Carpenter, J.L.; Windle, J.J.; Mellon, P.; Albert, D.M.

    1990-01-01

    We present a murine model of trilateral retinoblastoma. Ocular retinoblastoma and central nervous system tumors are observed in a line of mice formed by the transgenic expression of SV40 T-antigen. An oncogenic protein known to bind to the retinoblastoma gene product (p105-Rb) is specifically

  2. A Medicago truncatula H+-pyrophosphatase gene, MtVP1, improves sucrose accumulation and anthocyanin biosynthesis in potato (Solanum tuberosum L.).

    Science.gov (United States)

    Wang, J W; Wang, H Q; Xiang, W W; Chai, T Y

    2014-05-09

    We recently cloned MtVP1, a type I vacuolar-type H(+)-translocating inorganic pyrophosphatase from Medicago truncatula. In the present study, we investigated the cellular location and the function of this H(+)-PPase in Arabidopsis and potato (Solanum tuberosum L.). An MtVP1::enhanced green fluorescent protein fusion was constructed, which localized to the plasma membrane of onion epidermal cells. Transgenic Arabidopsis thaliana overexpressing MtVP1 had more robust root systems and redder shoots than wild-type (WT) plants under conditions of cold stress. Furthermore, overexpression of MtVP1 in potato accelerated the formation and growth of vegetative organs. The tuber buds and stem base of transgenic potatoes became redder than those of WT plants, but flowering was delayed by approximately half a month. Interestingly, anthocyanin biosynthesis was promoted in transgenic Arabidopsis seedlings and potato tuber buds. The sucrose concentration of transgenic potato tubers and tuber buds was enhanced compared with that of WT plants. Furthermore, sucrose concentration in tubers was higher than that in tuber buds. Although there was no direct evidence to support Fuglsang's hypothetical model regarding the effects of H(+)-PPase on sucrose phloem loading, we speculated that sucrose concentration was increased in tuber buds owing to the increased concentration in tubers. Therefore, overexpressed MtVP1 enhanced sucrose accumulation of source organs, which might enhance sucrose transport to sink organs, thus affecting anthocyanin biosynthesis.

  3. Cloning of genes and developing transgenic crops with enhanced tolerance to salinity and drought (abstract)

    International Nuclear Information System (INIS)

    Bansal, K.C.; Chinnusamy, V.; Tayal, D.; Das, A.; Goel, D.; Yadav, V.; Singh, A.K.; Lakhshmi, K.

    2005-01-01

    Abiotic stresses represent the most limiting factors affecting agricultural productivity. In India more than 60% of total cultivated land is still rainfed and crops experience frequent droughts. Thus, we need to develop transgenic crops tolerant to drought, and other related abiotic stress factors such as salinity, low and high temperature stresses. At the National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute (ICAR), we have initiated a programme on developing transgenic crops tolerant to a range of abiotic stresses. The major emphasis is on developing transgenic potato, tomato, mustard, rice and wheat. While, transgenic plants of potato. tomato and mustard have already been generated with osmotin gene and are at different stages of testing, other key genes imparting tolerance to abiotic stresses are being isolated from different species for producing transgenic rice and wheat cultivars tolerant to multiple stresses. Genes that have been isolated in our laboratory include ascorbate peroxidase gene (TaApx) and genes encoding transcription factor, CBFs (TaCBF2 and TaCBP3) from a drought tolerant wheat cultivar (C306), Lea1 cDNA from Brassica species, codA from Arthrobacter globiformis, and otsBA operon from E. coli. Apart from these stress-related genes, we have isolated a few stress-inducible promoters for deploying them in gene stacking in developing transgenic crops with enhanced tolerance to multiple abiotic stresses. The results will be presented. (author)

  4. Vacuolar invertase gene silencing in potato (Solanum tuberosum L. improves processing quality by decreasing the frequency of sugar-end defects.

    Directory of Open Access Journals (Sweden)

    Xiaobiao Zhu

    Full Text Available Sugar-end defect is a tuber quality disorder and persistent problem for the French fry processing industry that causes unacceptable darkening of one end of French fries. This defect appears when environmental stress during tuber growth increases post-harvest vacuolar acid invertase activity at one end of the tuber. Reducing sugars produced by invertase form dark-colored Maillard reaction products during frying. Acrylamide is another Maillard reaction product formed from reducing sugars and acrylamide consumption has raised health concerns worldwide. Vacuolar invertase gene (VInv expression was suppressed in cultivars Russet Burbank and Ranger Russet using RNA interference to determine if this approach could control sugar-end defect formation. Acid invertase activity and reducing sugar content decreased at both ends of tubers. Sugar-end defects and acrylamide in fried potato strips were strongly reduced in multiple transgenic potato lines. Thus vacuolar invertase silencing can minimize a long-standing French fry quality problem while providing consumers with attractive products that reduce health concerns related to dietary acrylamide.

  5. Cloning of transgenic tobacco BY-2 cells; an efficient method to analyse and reduce high natural heterogeneity of transgene expression.

    Science.gov (United States)

    Nocarova, Eva; Fischer, Lukas

    2009-04-22

    Phenotypic characterization of transgenic cell lines, frequently used in plant biology studies, is complicated because transgene expression in individual cells is often heterogeneous and unstable. To identify the sources and to reduce this heterogeneity, we transformed tobacco (Nicotiana tabacum L.) BY-2 cells with a gene encoding green fluorescent protein (GFP) using Agrobacterium tumefaciens, and then introduced a simple cloning procedure to generate cell lines derived from the individual transformed cells. Expression of the transgene was monitored by analysing GFP fluorescence in the cloned lines and also in lines obtained directly after transformation. The majority ( approximately 90%) of suspension culture lines derived from calli that were obtained directly from transformation consisted of cells with various levels of GFP fluorescence. In contrast, nearly 50% of lines generated by cloning cells from the primary heterogeneous suspensions consisted of cells with homogenous GFP fluorescence. The rest of the lines exhibited "permanent heterogeneity" that could not be resolved by cloning. The extent of fluorescence heterogeneity often varied, even among genetically identical clones derived from the primary transformed lines. In contrast, the offspring of subsequent cloning of the cloned lines was uniform, showing GFP fluorescence intensity and heterogeneity that corresponded to the original clone. The results demonstrate that, besides genetic heterogeneity detected in some lines, the primary lines often contained a mixture of epigenetically different cells that could be separated by cloning. This indicates that a single integration event frequently results in various heritable expression patterns, which are probably accidental and become stabilized in the offspring of the primary transformed cells early after the integration event. Because heterogeneity in transgene expression has proven to be a serious problem, it is highly advisable to use transgenes tagged with

  6. High-speed potato grading and quality inspection based on a color vision system

    Science.gov (United States)

    Noordam, Jacco C.; Otten, Gerwoud W.; Timmermans, Toine J. M.; van Zwol, Bauke H.

    2000-03-01

    A high-speed machine vision system for the quality inspection and grading of potatoes has been developed. The vision system grades potatoes on size, shape and external defects such as greening, mechanical damages, rhizoctonia, silver scab, common scab, cracks and growth cracks. A 3-CCD line-scan camera inspects the potatoes in flight as they pass under the camera. The use of mirrors to obtain a 360-degree view of the potato and the lack of product holders guarantee a full view of the potato. To achieve the required capacity of 12 tons/hour, 11 SHARC Digital Signal Processors perform the image processing and classification tasks. The total capacity of the system is about 50 potatoes/sec. The color segmentation procedure uses Linear Discriminant Analysis (LDA) in combination with a Mahalanobis distance classifier to classify the pixels. The procedure for the detection of misshapen potatoes uses a Fourier based shape classification technique. Features such as area, eccentricity and central moments are used to discriminate between similar colored defects. Experiments with red and yellow skin-colored potatoes have shown that the system is robust and consistent in its classification.

  7. Genetic transformation and gene silencing mediated by multiple copies of a transgene in eastern white pine.

    Science.gov (United States)

    Tang, Wei; Newton, Ronald J; Weidner, Douglas A

    2007-01-01

    An efficient transgenic eastern white pine (Pinus strobus L.) plant regeneration system has been established using Agrobacterium tumefaciens strain GV3850-mediated transformation and the green fluorescent protein (gfp) gene as a reporter in this investigation. Stable integration of transgenes in the plant genome of pine was confirmed by polymerase chain reaction (PCR), Southern blot, and northern blot analyses. Transgene expression was analysed in pine T-DNA transformants carrying different numbers of copies of T-DNA insertions. Post-transcriptional gene silencing (PTGS) was mostly obtained in transgenic lines with more than three copies of T-DNA, but not in transgenic lines with one copy of T-DNA. In situ hybridization chromosome analysis of transgenic lines demonstrated that silenced transgenic lines had two or more T-DNA insertions in the same chromosome. These results suggest that two or more T-DNA insertions in the same chromosome facilitate efficient gene silencing in transgenic pine cells expressing green fluorescent protein. There were no differences in shoot differentiation and development between transgenic lines with multiple T-DNA copies and transgenic lines with one or two T-DNA copies.

  8. in transgenic cucumber

    African Journals Online (AJOL)

    Jane

    2011-07-18

    Jul 18, 2011 ... College of Horticulture, South China Agriculture University, Guangzhou 510642, Guangdong ... The pattern of expression vector pBI-PacPAP. ..... Disease scale ... These transgenic T0 plants were self-pollinated and the.

  9. Transgene mus som sygdomsmodeller

    DEFF Research Database (Denmark)

    Schuster, Mikkel Bruhn; Porse, Bo Torben

    2003-01-01

    Transgenic animal models have proven to be useful tools in understanding both basic biology and the events associated with disease. Recent technical advances in the area of genomic manipulation in combination with the availability of the human and murine genomic sequences now allow the precise...... tailoring of the mouse genome. In this review we describe a few systems in which transgenic animal models have been employed for the purpose of studying the etiology of human diseases. Udgivelsesdato: 2003-Feb-17...

  10. PAMP-induced defense responses in potato require both salicylic acid and jasmonic acid.

    Science.gov (United States)

    Halim, Vincentius A; Altmann, Simone; Ellinger, Dorothea; Eschen-Lippold, Lennart; Miersch, Otto; Scheel, Dierk; Rosahl, Sabine

    2009-01-01

    To elucidate the molecular mechanisms underlying pathogen-associated molecular pattern (PAMP)-induced defense responses in potato (Solanum tuberosum), the role of the signaling compounds salicylic acid (SA) and jasmonic acid (JA) was analyzed. Pep-13, a PAMP from Phytophthora, induces the accumulation of SA, JA and hydrogen peroxide, as well as the activation of defense genes and hypersensitive-like cell death. We have previously shown that SA is required for Pep-13-induced defense responses. To assess the importance of JA, RNA interference constructs targeted at the JA biosynthetic genes, allene oxide cyclase and 12-oxophytodienoic acid reductase, were expressed in transgenic potato plants. In addition, expression of the F-box protein COI1 was reduced by RNA interference. Plants expressing the RNA interference constructs failed to accumulate the respective transcripts in response to wounding or Pep-13 treatment, neither did they contain significant amounts of JA after elicitation. In response to infiltration of Pep-13, the transgenic plants exhibited a highly reduced accumulation of reactive oxygen species as well as reduced hypersensitive cell death. The ability of the JA-deficient plants to accumulate SA suggests that SA accumulation is independent or upstream of JA accumulation. These data show that PAMP responses in potato require both SA and JA and that, in contrast to Arabidopsis, these compounds act in the same signal transduction pathway. Despite their inability to fully respond to PAMP treatment, the transgenic RNA interference plants are not altered in their basal defense against Phytophthora infestans.

  11. The potato tuber mitochondrial proteome

    DEFF Research Database (Denmark)

    Salvato, Fernanda; Havelund, Jesper Foged; Chen, Mingjie

    2014-01-01

    Mitochondria are called the powerhouses of the cell. To better understand the role of mitochondria in maintaining and regulating metabolism in storage tissues, highly purified mitochondria were isolated from dormant potato tubers (Solanum tuberosum 'Folva') and their proteome investigated. Proteins...... manner using normalized spectral counts including as many as 5-fold more "extreme" proteins (low mass, high isoelectric point, hydrophobic) than previous mitochondrial proteome studies. We estimate that this compendium of proteins represents a high coverage of the potato tuber mitochondrial proteome...

  12. Cloning and functional characterization of SAD genes in potato.

    Science.gov (United States)

    Li, Fei; Bian, Chun Song; Xu, Jian Fei; Pang, Wan Fu; Liu, Jie; Duan, Shao Guang; Lei, Zun-Guo; Jiwan, Palta; Jin, Li-Ping

    2015-01-01

    Stearoyl-acyl carrier protein desaturase (SAD), locating in the plastid stroma, is an important fatty acid biosynthetic enzyme in higher plants. SAD catalyzes desaturation of stearoyl-ACP to oleyl-ACP and plays a key role in determining the homeostasis between saturated fatty acids and unsaturated fatty acids, which is an important player in cold acclimation in plants. Here, four new full-length cDNA of SADs (ScoSAD, SaSAD, ScaSAD and StSAD) were cloned from four Solanum species, Solanum commersonii, S. acaule, S. cardiophyllum and S. tuberosum, respectively. The ORF of the four SADs were 1182 bp in length, encoding 393 amino acids. A sequence alignment indicated 13 amino acids varied among the SADs of three wild species. Further analysis showed that the freezing tolerance and cold acclimation capacity of S. commersonii are similar to S. acaule and their SAD amino acid sequences were identical but differed from that of S. cardiophyllum, which is sensitive to freezing. Furthermore, the sequence alignments between StSAD and ScoSAD indicated that only 7 different amino acids at residues were found in SAD of S. tuberosum (Zhongshu8) against the protein sequence of ScoSAD. A phylogenetic analysis showed the three wild potato species had the closest genetic relationship with the SAD of S. lycopersicum and Nicotiana tomentosiformis but not S. tuberosum. The SAD gene from S. commersonii (ScoSAD) was cloned into multiple sites of the pBI121 plant binary vector and transformed into the cultivated potato variety Zhongshu 8. A freeze tolerance analysis showed overexpression of the ScoSAD gene in transgenic plants significantly enhanced freeze tolerance in cv. Zhongshu 8 and increased their linoleic acid content, suggesting that linoleic acid likely plays a key role in improving freeze tolerance in potato plants. This study provided some new insights into how SAD regulates in the freezing tolerance and cold acclimation in potato.

  13. Cloning and functional characterization of SAD genes in potato.

    Directory of Open Access Journals (Sweden)

    Fei Li

    Full Text Available Stearoyl-acyl carrier protein desaturase (SAD, locating in the plastid stroma, is an important fatty acid biosynthetic enzyme in higher plants. SAD catalyzes desaturation of stearoyl-ACP to oleyl-ACP and plays a key role in determining the homeostasis between saturated fatty acids and unsaturated fatty acids, which is an important player in cold acclimation in plants. Here, four new full-length cDNA of SADs (ScoSAD, SaSAD, ScaSAD and StSAD were cloned from four Solanum species, Solanum commersonii, S. acaule, S. cardiophyllum and S. tuberosum, respectively. The ORF of the four SADs were 1182 bp in length, encoding 393 amino acids. A sequence alignment indicated 13 amino acids varied among the SADs of three wild species. Further analysis showed that the freezing tolerance and cold acclimation capacity of S. commersonii are similar to S. acaule and their SAD amino acid sequences were identical but differed from that of S. cardiophyllum, which is sensitive to freezing. Furthermore, the sequence alignments between StSAD and ScoSAD indicated that only 7 different amino acids at residues were found in SAD of S. tuberosum (Zhongshu8 against the protein sequence of ScoSAD. A phylogenetic analysis showed the three wild potato species had the closest genetic relationship with the SAD of S. lycopersicum and Nicotiana tomentosiformis but not S. tuberosum. The SAD gene from S. commersonii (ScoSAD was cloned into multiple sites of the pBI121 plant binary vector and transformed into the cultivated potato variety Zhongshu 8. A freeze tolerance analysis showed overexpression of the ScoSAD gene in transgenic plants significantly enhanced freeze tolerance in cv. Zhongshu 8 and increased their linoleic acid content, suggesting that linoleic acid likely plays a key role in improving freeze tolerance in potato plants. This study provided some new insights into how SAD regulates in the freezing tolerance and cold acclimation in potato.

  14. Split-Cre complementation restores combination activity on transgene excision in hair roots of transgenic tobacco.

    Directory of Open Access Journals (Sweden)

    Mengling Wen

    Full Text Available The Cre/loxP system is increasingly exploited for genetic manipulation of DNA in vitro and in vivo. It was previously reported that inactive ''split-Cre'' fragments could restore Cre activity in transgenic mice when overlapping co-expression was controlled by two different promoters. In this study, we analyzed recombination activities of split-Cre proteins, and found that no recombinase activity was detected in the in vitro recombination reaction in which only the N-terminal domain (NCre of split-Cre protein was expressed, whereas recombination activity was obtained when the C-terminal (CCre or both NCre and CCre fragments were supplied. We have also determined the recombination efficiency of split-Cre proteins which were co-expressed in hair roots of transgenic tobacco. No Cre recombination event was observed in hair roots of transgenic tobacco when the NCre or CCre genes were expressed alone. In contrast, an efficient recombination event was found in transgenic hairy roots co-expressing both inactive split-Cre genes. Moreover, the restored recombination efficiency of split-Cre proteins fused with the nuclear localization sequence (NLS was higher than that of intact Cre in transgenic lines. Thus, DNA recombination mediated by split-Cre proteins provides an alternative method for spatial and temporal regulation of gene expression in transgenic plants.

  15. 78 FR 30737 - Irish Potatoes Grown in Colorado; Reestablishment of Membership on the Colorado Potato...

    Science.gov (United States)

    2013-05-23

    ... FR] Irish Potatoes Grown in Colorado; Reestablishment of Membership on the Colorado Potato...: This final rule reestablishes the membership on the Colorado Potato Administrative Committee, Area No... Irish potatoes grown in Colorado. This action modifies the Committee membership structure by amending...

  16. Morphological characterization of the local potato (Solanum ...

    African Journals Online (AJOL)

    user

    2011-02-07

    Feb 7, 2011 ... agronomical characteristics of the genotypes were described according to the criteria developed for potato .... potato tubers were stored at 4°C and 80% moisture storage con- ...... Starch and Sugar Plant Production, Turkey VII.

  17. Detection of irradiated potatoes by conductivity measurements

    International Nuclear Information System (INIS)

    Scherz, H.

    1991-01-01

    In this paper, the author shows that the conductivity of irradiated potatoes measured by a sticking electrode depend on the irradiation dose and is independent on the potato variety. The measured values remain constant over a six month storage period

  18. Characterization of Digestion Resistance Sweet Potato Starch ...

    African Journals Online (AJOL)

    Purpose: To analyze the physicochemical properties and in vitro digestibility of sweet potato starchphosphodiester prepared using sodium trimetaphosphate. Methods: The physicochemical properties of sweet potato starch phosphodiester were analyzed by using infrared spectrometry (IR), differential scanning calorimetry ...

  19. Glycoalkaloids in potatoes: Content of glycoalkaloids in potatoes for consumption

    DEFF Research Database (Denmark)

    Knuthsen, Pia; Jensen, Udo; Schmidt, Bjørn

    2009-01-01

    mg/kg. Thus the aim of this study was to make a survey of the distribution and contents of TGA in potatoes on the Danish market, including many different and relevant varieties during a 6-year period. A total of 386 samples of potato tubers were analysed for α-solanine and α-chaconine by extraction...... with acetic acid and determination by RP-HPLC with UV-detection at 202 nm. The results not only confirmed that contents above 100 mg TGA/kg in potato tubers frequently occurred in some years, but also showed the possibility of finding lower contents in the same varieties other years. This led to the cautious...

  20. Potato Organic Farming in Batu City, Indonesia

    OpenAIRE

    Sugiarto, Sugiarto; Sulistiono, Rudi; Sudiarso, Sudiarso; Soemarno, Soemarno

    2013-01-01

    Organic potato cultivation was an effort to improve declining quality of potato agroecosystems and to preserve soil fertility. This study was conducted to analyze pattern of farming system and land management on the area of organic potatoes in Batu city. Research was conducted by the survey method, respondents were determined by the method of stratified cluster sampling. Farmer respondents were experienced organic potato farmer and as "expert leaders". Results show that the mindset of farmer...

  1. Recent advances in the development of new transgenic animal technology.

    Science.gov (United States)

    Miao, Xiangyang

    2013-03-01

    Transgenic animal technology is one of the fastest growing biotechnology areas. It is used to integrate exogenous genes into the animal genome by genetic engineering technology so that these genes can be inherited and expressed by offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors in the production of transgenic animals. A variety of transgenic technologies are available. Each has its own advantages and disadvantages and needs further study because of unresolved technical and safety issues. Further studies will allow transgenic technology to explore gene function, animal genetic improvement, bioreactors, animal disease models, and organ transplantation. This article reviews the recently developed animal transgenic technologies, including the germ line stem cell-mediated method to improve efficiency, gene targeting to improve accuracy, RNA interference-mediated gene silencing technology, zinc-finger nuclease gene targeting technology and induced pluripotent stem cell technology. These new transgenic techniques can provide a better platform to develop transgenic animals for breeding new animal varieties and promote the development of medical sciences, livestock production, and other fields.

  2. Alcoholic fermentation of stored sweet potatoes

    Energy Technology Data Exchange (ETDEWEB)

    Yutaka, Y; One, H

    1958-01-01

    Sweet potatoes were ground and stored in a ground hold. The stored sweet potatoes gave about 90% fermentation efficiency by the koji process. A lower fermentation efficiency by the amylo process was improved by adding 20 to 30 mg/100 ml of organic N. Inorganic N has no effect in improving the fermentation efficiency of the stored sweet potatoes by the amylo process.

  3. Sustainable potato production: global case studies

    Science.gov (United States)

    Potato (Solanum tuberosum L.) is grown in over 100 countries throughout the world. As a staple food, potato is the fourth most important crop after rice, wheat, and maize, and has historically contributed to food and nutrition security in the world. Global interest in potato increased sharply in 200...

  4. Consumptive qualities of different potato varieties

    Directory of Open Access Journals (Sweden)

    М. М. Фурдига

    2017-03-01

    Full Text Available Purpose. To summarize results of studying consumptive qualities of different varieties of potato and define basic characteristics which allow to subsume them under specific economic categories. Methods. Field study, laboratory test, summarizing, analytical approach. Results. Potato varieties entered in the State register of plant varieties suitable to dissemination in Ukraine and new ones especially to be bred at the Institute of Potato Growing of NAAS were studied during the period of 2005–2016 for such basic economic characters as consumptive quality of tubers, content of starch, dry matters, protein, sugar, vitamins, carotenoids and mineral substances as well as aminoacids, color of flesh, suitability for industrial manufacturing of potato products and for purpose of technology. Attention was paid to the good prospects to use varie­ties with purple, blue and red potato tuber flesh with high antioxidant capacity. Potato varieties with above cha­racteristics and their complex combination were defined and described. The requirements of processing industry for potato as a raw material for manufacturing of potato food were given. Conclusions. The major criterion for consumptive qualities of a potato variety and correspondingly division for the commercial use is consumptive quality of tubers, especially content of essential nutrients and their favorable combination, improved taste and cooking quality, high antioxidant capacity, suitability for potato products manufacturing and use for purpose of technology. Potato varieties can be divided for economic purposes into edible, suitable for potato products manufacturing, technical and multipurpose ones.

  5. Acrylamide Mitigation Procedures in Fried Potatoes

    DEFF Research Database (Denmark)

    Pedreschi, Franco; Kaack, Karl; Granby, Kit

    2008-01-01

    frying, whereas acrylamide content was determined in the fried potato chips and French fries French fries. Blanching reduced in potato chips on average 76 percent and 68 percent of the glucose and asparagine content compared to the control. Potato slices blanched at 50 degrees C for 70 minutes......) of 0.79 and 0.83, respectively) with French fry acrylamide content....

  6. 7 CFR 945.5 - Potatoes.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Potatoes. 945.5 Section 945.5 Agriculture Regulations... Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE IRISH POTATOES GROWN IN CERTAIN DESIGNATED COUNTIES IN IDAHO, AND MALHEUR COUNTY, OREGON Order Regulating Handling Definitions § 945.5 Potatoes...

  7. Potato proteins : their properties and nutritive value

    NARCIS (Netherlands)

    Labib, A.I.

    1962-01-01

    Physical and biological investigations were carried out on the nitrogenous substances in the potato tuber. The importance of the potato as a food was considered in the introduction. By paper electrophoresis proteins in potato tuber sap could be separated into at least six fractions. The protein

  8. Retrospective view of North American potato (Solanum tuberosum L.) breeding in the 20th and 21st centuries.

    Science.gov (United States)

    Hirsch, Candice N; Hirsch, Cory D; Felcher, Kimberly; Coombs, Joseph; Zarka, Dan; Van Deynze, Allen; De Jong, Walter; Veilleux, Richard E; Jansky, Shelley; Bethke, Paul; Douches, David S; Buell, C Robin

    2013-06-21

    Cultivated potato (Solanum tuberosum L.), a vegetatively propagated autotetraploid, has been bred for distinct market classes, including fresh market, pigmented, and processing varieties. Breeding efforts have relied on phenotypic selection of populations developed from intra- and intermarket class crosses and introgressions of wild and cultivated Solanum relatives. To retrospectively explore the effects of potato breeding at the genome level, we used 8303 single-nucleotide polymorphism markers to genotype a 250-line diversity panel composed of wild species, genetic stocks, and cultivated potato lines with release dates ranging from 1857 to 2011. Population structure analysis revealed four subpopulations within the panel, with cultivated potato lines grouping together and separate from wild species and genetic stocks. With pairwise kinship estimates clear separation between potato market classes was observed. Modern breeding efforts have scarcely changed the percentage of heterozygous loci or the frequency of homozygous, single-dose, and duplex loci on a genome level, despite concerted efforts by breeders. In contrast, clear selection in less than 50 years of breeding was observed for alleles in biosynthetic pathways important for market class-specific traits such as pigmentation and carbohydrate composition. Although improvement and diversification for distinct market classes was observed through whole-genome analysis of historic and current potato lines, an increased rate of gain from selection will be required to meet growing global food demands and challenges due to climate change. Understanding the genetic basis of diversification and trait improvement will allow for more rapid genome-guided improvement of potato in future breeding efforts.

  9. Gene flow from transgenic common beans expressing the bar gene.

    Science.gov (United States)

    Faria, Josias C; Carneiro, Geraldo E S; Aragão, Francisco J L

    2010-01-01

    Gene flow is a common phenomenon even in self-pollinated plant species. With the advent of genetically modified plants this subject has become of the utmost importance due to the need for controlling the spread of transgenes. This study was conducted to determine the occurrence and intensity of outcrossing in transgenic common beans. In order to evaluate the outcross rates, four experiments were conducted in Santo Antonio de Goiás (GO, Brazil) and one in Londrina (PR, Brazil), using transgenic cultivars resistant to the herbicide glufosinate ammonium and their conventional counterparts as recipients of the transgene. Experiments with cv. Olathe Pinto and the transgenic line Olathe M1/4 were conducted in a completely randomized design with ten replications for three years in one location, whereas the experiments with cv. Pérola and the transgenic line Pérola M1/4 were conducted at two locations for one year, with the transgenic cultivar surrounded on all sides by the conventional counterpart. The outcross occurred at a negligible rate of 0.00741% in cv. Pérola, while none was observed (0.0%) in cv. Olathe Pinto. The frequency of gene flow was cultivar dependent and most of the observed outcross was within 2.5 m from the edge of the pollen source. Index terms: Phaseolus vulgaris, outcross, glufosinate ammonium.

  10. Design and Management of Field Trials of Transgenic Cereals

    Science.gov (United States)

    Bedő, Zoltán; Rakszegi, Mariann; Láng, László

    The development of gene transformation systems has allowed the introgression of alien genes into plant genomes, thus providing a mechanism for broadening the genetic resources available to plant breeders. The design and the management of field trials vary according to the purpose for which transgenic cereals are developed. Breeders study the phenotypic and genotypic stability of transgenic plants, monitor the increase in homozygosity of transgenic genotypes under field conditions, and develop backcross generations to transfer the introduced genes into secondary transgenic cereal genotypes. For practical purposes, they may also multiply seed of the transgenic lines to produce sufficient amounts of grain for the detailed analysis of trait(s) of interest, to determine the field performance of transgenic lines, and to compare them with the non-transformed parental genotypes. Prior to variety registration, the Distinctness, Uniformity and Stability (DUS) tests and Value for Cultivation and Use (VCU) experiments are carried out in field trials. Field testing includes specific requirements for transgenic cereals to assess potential environmental risks. The capacity of the pollen to survive, establish and disseminate in the field test environment, the potential for gene transfer, the effects of products expressed by the introduced sequences and phenotypic and genotypic instability that might cause deleterious effects must all be specifically monitored, as required by EU Directives 2003/701/EC (1) on the release of genetically modified higher plants in the environment.

  11. Mathematical model for solar drying of potato cylinders with thermal conductivity radially modulated

    Science.gov (United States)

    Trujillo Arredondo, Mariana

    2014-05-01

    A mathematical model for drying potato cylinders using solar radiation is proposed and solved analytically. The model incorporates the energy balance for the heat capacity of the potato, the radiation heat transfer from the potato toward the drying chamber and the solar radiation absorbed by the potato during the drying process. Potato cylinders are assumed to exhibit a thermal conductivity which is radially modulated. The method of the Laplace transform, with integral Bromwich and residue theorem will be applied and the analytic solutions for the temperature profiles in the potato cylinder will be derived in the form of an infinite series of Bessel functions, when the thermal conductivity is constant; and in the form of an infinite series of Heun functions, when the thermal conductivity has a linear radial modulation. All computations are performed using computer algebra, specifically Maple. It is expected that the analytical results obtained will be useful in food engineering and industry. Our results suggest some lines for future investigations such as the adoption of more general forms of radial modulation for the thermal conductivity of potato cylinders; and possible applications of other computer algebra software such as Maxima and Mathematica.

  12. Salicylic acid is an indispensable component of the Ny-1 resistance-gene-mediated response against Potato virus Y infection in potato.

    Science.gov (United States)

    Baebler, Š; Witek, K; Petek, M; Stare, K; Tušek-Žnidarič, M; Pompe-Novak, M; Renaut, J; Szajko, K; Strzelczyk-Żyta, D; Marczewski, W; Morgiewicz, K; Gruden, K; Hennig, J

    2014-03-01

    The purpose of the study was to investigate the role of salicylic acid (SA) signalling in Ny-1-mediated hypersensitive resistance (HR) of potato (Solanum tuberosum L.) to Potato virus Y (PVY). The responses of the Ny-1 allele in the Rywal potato cultivar and transgenic NahG-Rywal potato plants that do not accumulate SA were characterized at the cytological, biochemical, transcriptome, and proteome levels. Analysis of noninoculated and inoculated leaves revealed that HR lesions started to develop from 3 d post inoculation and completely restricted the virus spread. At the cytological level, features of programmed cell death in combination with reactive oxygen species burst were observed. In response to PVY infection, SA was synthesized de novo. The lack of SA accumulation in the NahG plants led to the disease phenotype due to unrestricted viral spreading. Grafting experiments show that SA has a critical role in the inhibition of PVY spreading in parenchymal tissue, but not in vascular veins. The whole transcriptome analysis confirmed the central role of SA in orchestrating Ny-1-mediated responses and showed that the absence of SA leads to significant changes at the transcriptome level, including a delay in activation of expression of genes known to participate in defence responses. Moreover, perturbations in the expression of hormonal signalling genes were detected, shown as a switch from SA to jasmonic acid/ethylene signalling. Viral multiplication in the NahG plants was accompanied by downregulation of photosynthesis genes and activation of multiple energy-producing pathways.

  13. A dominant-negative mutation within AtMYB90 blocks flower pigment production in transgenic tobacco.

    Science.gov (United States)

    During de novo shoot induction in cultured transgenic tobacco callus a spontaneous mutation within the coding region of a AtMYB90 transgene produced a plant line in which the original transgene-induced over-pigmented phenotype (dark red/purple from anthocyanin overproduction in most tissues) was los...

  14. Microbiological quality of five potato products obtained at retail markets.

    OpenAIRE

    Duran, A P; Swartzentruber, A; Lanier, J M; Wentz, B A; Schwab, A H; Barnard, R J; Read, R B

    1982-01-01

    The microbiological quality of frozen hash brown potatoes, dried hash brown potatoes with onions, frozen french fried potatoes, dried instant mashed potatoes, and potato salad was determined by a national sampling at the retail level. A wide range of results was obtained, with most sampling units of each products having excellent microbiological quality. Geometric mean aerobic plate counts were as follows: dried hash brown potatoes, 270/g; frozen hash brown potatoes with onions, 580/g; frozen...

  15. Transgenics in Agriculture

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 6; Issue 2. Transgenics in Agriculture. D Rex Arunraj B Gajendra Babu. Classroom Volume 6 Issue 2 February 2001 pp 83-92. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/006/02/0083-0092 ...

  16. Inheritance and segregation of exogenous genes in transgenic cotton

    Indian Academy of Sciences (India)

    Three transgenic cotton varieties (lines) were chosen for the study of inheritance and segregation of foreign Bt (Bacillus thuringiensis toxin) and tfdA genes in cotton. The transformed cotton varieties CCRI 30 and NewCott 33B expressing the Bt cryIA gene, and cotton line TFD expressing the tfdA gene were crossed with ...

  17. Adoption of Improved Potato Varieties in Nepal

    Directory of Open Access Journals (Sweden)

    Samaya Gairhe

    2017-05-01

    Full Text Available Nepal is one of the top twenty countries where potato contributes substantially for the human diet. Enhancing adoption of improved potato varieties could impact on farmer’s income, household food and nutritional security. As such, using a multistage sampling procedure, a study was conducted to assess the determinants of improved potato varieties adoption in Nepal covering 180 samples in four districts, two in hills and two in Tarai region. The study revealed that; Kavre and Bardiya districts in the hills and Tarai, respectively, were dominated by improved potato varieties adoption. On the other hand, Dhankuta and Jhapa in the hills and Tarai, respectively, were dominated by local potato varieties adoption. The informal seed sources followed by agro-vet and market were the major sources for improved varietal adoption. Farmers’ accesses to training and formal seed sources were important factor determining improved potato varietal adoption. However, households with larger farm size were less likely to allocate more area for improved potato varieties as many of farmers were reluctant to take potato cultivation as agri-business and still follow subsistence farming. Potato R&D programs, therefore, need to strengthen formal seed system to enhance access to quality potato seeds and build producer’s capacity through regular training and exposer visits in order to improve adoption of improved potato varieties in Nepal.

  18. Flavouring compounds in Indian potato snacks.

    Science.gov (United States)

    Raigond, Pinky; Singh, Brajesh; Dhulia, Akshita; Chopra, Shelly; Dutt, Som

    2015-12-01

    Market for processed potato products is rising day by day. Flavour plays important role in decision making by consumers due to their preferences for better tasting food. In potato and potato products, glutamic acid, aspartic acid, guanosine 5'-monophosphate (GMP) and adenosine 5'-monophosphate (AMP) are the major umami compounds which contribute towards flavour. Therefore, umami 5' nucleotides (AMP+GMP) were estimated from local potato products available as common fried products in the Indian markets and processed potato products being sold by the retailers. The analysis was also carried in raw, microwaved and pressure cooked tubers of forty seven Indian potato cultivars. Umami 5' nucleotide content ranged from 2.63 (Aloo seekh) to 8.26 μg/g FW (fried lachcha) in local potato products. In processed potato products, the content ranged from 2.72 μg/g FW (Smiles) to 14.75 μg/g FW (Aloo Bhujia). Along with aloo bhujia, umami 5' nucleotides were also high in dehydrated aloo lachcha (11.14 μg/g FW) and dehydrated potato chips (10.13 μg/g FW) and low in Smiles (2.72 μg/g FW) and Potato Shortz (3.40 μg/g FW). The study suggests that the potato products prepared solely from potato contained higher levels of umami 5' nucleotides compared to other products prepared by mixing potato with other cereals and vegetables. In Indian potato cultivars overall there was 14 % increase on microwave cooking and 31 % increase in flavouring compounds on pressure cooking. This type of study enabled in identifying better tasting cultivars for further product development and also to develop products with less addition of salt.

  19. Acrylamide in Fried Potato Products

    NARCIS (Netherlands)

    Luning, Pieternel; Sanny, Maimunah

    2016-01-01

    High acrylamide levels have been detected in fried potato products. Dietary intake studies observed large differences in acrylamide between single foodstuffs, within food categories, and within batches of similarly processed products. FAO/WHO emphasized that causes of variation need to be

  20. Growth of potatoes for CELSS

    Science.gov (United States)

    Tibbitts, T. W.; Cao, W.; Wheeler, R. M.

    1994-01-01

    This report summarizes research on the utilization of white potatoes (Solanum tuberosum L.) for space life support systems at the University of Wisconsin-Madison over the period of 1984 to 1993. At full maturity the tuber productivity was 37.5 gm(exp -2) d(exp -1), equating to a growing area requirement for one human (2800 kcal d(exp -1)) of 10.1 m(exp -2). A recirculating nutrient system using slanted trays produced best potato growth and tuber yields when a 2-3 cm layer of gravel or arcillite media was utilized. Potato production was close to maximum under lighting levels of 400 micromol m(exp -2) s(exp -1) of photosynthetic photo flux (PPF) for 24 hours or 800 micromol m(exp -2) s(exp -1) for 12 hours, alternating diurnal temperatures of 22 C and 14 C, relative humidity of 85 percent, and a carbon dioxide level of 1000 micromol m(exp -1). The range of effective concentrations of each separate nutrient is reported. The extensive studies with potatoes in this project have demonstrated that this crop has high productivity of nutritous tubers with a high harvest index in controlled environments, and can fulfill a significant portion of the energy and protein requirements for humans in space.

  1. Shihoro irradiation plant for potato

    International Nuclear Information System (INIS)

    Kameyama, Kenji

    1985-01-01

    There have been rapid moves toward the commercialization of food irradiation around the world since November, 1980, when a joint FAO/IAEA/WHO expert committee made a recommendation on the wholesomeness of irradiated foods. The bold US move toward the commercialization has had a great impact. Ahead of these move around the world, Japan built a commercial irradiation plant in 1974, which has been operated for inhibiting the sprouting of potatoes. This plant was built in Shihoro, Hokkaido, and two thirds of the 400 million yen construction cost was provided by the Government and Hokkaido authorities for five agricultural cooperative associations of four local townships. Since then, the plant has been under the joint management of these cooperatives. The aim and circumstance of the plant construction are described. The mechanism of the plant with conveyors, a turntable and a Co-60 source of 300,000 Ci is shown. The plant processes 15 tons of potatoes per hour with the dose from 60 to 150 Gy. Potato bruise and irradiation effect, irradiation time and effect, and post-irradiation storage temperature and potato quality are reported. (Kako, I.)

  2. Efficient genetic transformation of okra (Abelmoschus esculentus (L.) Moench) and generation of insect-resistant transgenic plants expressing the cry1Ac gene.

    Science.gov (United States)

    Narendran, M; Deole, Satish G; Harkude, Satish; Shirale, Dattatray; Nanote, Asaram; Bihani, Pankaj; Parimi, Srinivas; Char, Bharat R; Zehr, Usha B

    2013-08-01

    Agrobacterium -mediated transformation system for okra using embryos was devised and the transgenic Bt plants showed resistance to the target pest, okra shoot, and fruit borer ( Earias vittella ). Okra is an important vegetable crop and progress in genetic improvement via genetic transformation has been impeded by its recalcitrant nature. In this paper, we describe a procedure using embryo explants for Agrobacterium-mediated transformation and tissue culture-based plant regeneration for efficient genetic transformation of okra. Twenty-one transgenic okra lines expressing the Bacillus thuringiensis gene cry1Ac were generated from five transformation experiments. Molecular analysis (PCR and Southern) confirmed the presence of the transgene and double-antibody sandwich ELISA analysis revealed Cry1Ac protein expression in the transgenic plants. All 21 transgenic plants were phenotypically normal and fertile. T1 generation plants from these lines were used in segregation analysis of the transgene. Ten transgenic lines were selected randomly for Southern hybridization and the results confirmed the presence of transgene integration into the genome. Normal Mendelian inheritance (3:1) of cry1Ac gene was observed in 12 lines out of the 21 T0 lines. We selected 11 transgenic lines segregating in a 3:1 ratio for the presence of one transgene for insect bioassays using larvae of fruit and shoot borer (Earias vittella). Fruit from seven transgenic lines caused 100 % larval mortality. We demonstrate an efficient transformation system for okra which will accelerate the development of transgenic okra with novel agronomically useful traits.

  3. 7 CFR 51.1578 - Off-Grade potatoes.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Off-Grade potatoes. 51.1578 Section 51.1578... STANDARDS) United States Consumer Standards for Potatoes Off-Grade § 51.1578 Off-Grade potatoes. Potatoes which fail to meet the requirements of any of the foregoing grades shall be Off-Grade potatoes...

  4. 7 CFR 945.7 - Certified seed potatoes.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Certified seed potatoes. 945.7 Section 945.7... Agreements and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE IRISH POTATOES GROWN IN CERTAIN... Certified seed potatoes. Certified seed potatoes means and includes all potatoes officially certified and...

  5. Analysis of tomato gene promoters activated in syncytia induced in tomato and potato hairy roots by Globodera rostochiensis.

    Science.gov (United States)

    Wiśniewska, A; Dąbrowska-Bronk, J; Szafrański, K; Fudali, S; Święcicka, M; Czarny, M; Wilkowska, A; Morgiewicz, K; Matusiak, J; Sobczak, M; Filipecki, M

    2013-06-01

    The potato cyst nematode (Globodera rostochiensis) induces feeding sites (syncytia) in tomato and potato roots. In a previous study, 135 tomato genes up-regulated during G. rostochiensis migration and syncytium development were identified. Five genes (CYP97A29, DFR, FLS, NIK and PMEI) were chosen for further study to examine their roles in plant-nematode interactions. The promoters of these genes were isolated and potential cis regulatory elements in their sequences were characterized using bioinformatics tools. Promoter fusions with the β-glucuronidase gene were constructed and introduced into tomato and potato genomes via transformation with Agrobacterium rhizogenes to produce hairy roots. The analysed promoters displayed different activity patterns in nematode-infected and uninfected transgenic hairy roots.

  6. Salicylic and jasmonic acid pathways are necessary for defence against Dickeya solani as revealed by a novel method for Blackleg disease screening of in vitro grown potato.

    Science.gov (United States)

    Burra, D D; Mühlenbock, P; Andreasson, E

    2015-09-01

    Potato is major crop ensuring food security in Europe, and blackleg disease is increasingly causing losses in yield and during storage. Recently, one blackleg pathogen, Dickeya solani has been shown to be spreading in Northern Europe that causes aggressive disease development. Currently, identification of tolerant commercial potato varieties has been unsuccessful; this is confounded by the complicated etiology of the disease and a strong environmental influence on disease development. There is currently a lack of efficient testing systems. Here, we describe a system for quantification of blackleg symptoms on shoots of sterile in vitro potato plants, which saves time and space compared to greenhouse and existing field assays. We found no evidence for differences in infection between the described in vitro-based screening method and existing greenhouse assays. This system facilitates efficient screening of blackleg disease response of potato plants independent of other microorganisms and variable environmental conditions. We therefore used the in vitro screening method to increase understanding of plant mechanisms involved in blackleg disease development by analysing disease response of hormone- related (salicylic and jasmonic acid) transgenic potato plants. We show that both jasmonic (JA) and salicylic (SA) acid pathways regulate tolerance to blackleg disease in potato, a result unlike previous findings in Arabidopsis defence response to necrotrophic bacteria. We confirm this by showing induction of a SA marker, pathogenesis-related protein 1 (StPR1), and a JA marker, lipoxygenase (StLOX), in Dickeya solani infected in vitro potato plants. We also observed that tubers of transgenic potato plants were more susceptible to soft rot compared to wild type, suggesting a role for SA and JA pathways in general tolerance to Dickeya. © 2015 German Botanical Society and The Royal Botanical Society of the Netherlands.

  7. Expression of an osmotin-like protein from Solanum nigrum confers drought tolerance in transgenic soybean.

    Science.gov (United States)

    Weber, Ricardo Luís Mayer; Wiebke-Strohm, Beatriz; Bredemeier, Christian; Margis-Pinheiro, Márcia; de Brito, Giovani Greigh; Rechenmacher, Ciliana; Bertagnolli, Paulo Fernando; de Sá, Maria Eugênia Lisei; Campos, Magnólia de Araújo; de Amorim, Regina Maria Santos; Beneventi, Magda Aparecida; Margis, Rogério; Grossi-de-Sa, Maria Fátima; Bodanese-Zanettini, Maria Helena

    2014-12-10

    Drought is by far the most important environmental factor contributing to yield losses in crops, including soybeans [Glycine max (L.) Merr.]. To address this problem, a gene that encodes an osmotin-like protein isolated from Solanum nigrum var. americanum (SnOLP) driven by the UBQ3 promoter from Arabidopsis thaliana was transferred into the soybean genome by particle bombardment. Two independently transformed soybean lines expressing SnOLP were produced. Segregation analyses indicated single-locus insertions for both lines. qPCR analysis suggested a single insertion of SnOLP in the genomes of both transgenic lines, but one copy of the hpt gene was inserted in the first line and two in the second line. Transgenic plants exhibited no remarkable phenotypic alterations in the seven analyzed generations. When subjected to water deficit, transgenic plants performed better than the control ones. Leaf physiological measurements revealed that transgenic soybean plants maintained higher leaf water potential at predawn, higher net CO2 assimilation rate, higher stomatal conductance and higher transpiration rate than non-transgenic plants. Grain production and 100-grain weight were affected by water supply. Decrease in grain productivity and 100-grain weight were observed for both transgenic and non-transgenic plants under water deficit; however, it was more pronounced for non-transgenic plants. Moreover, transgenic lines showed significantly higher 100-grain weight than non-transgenic plants under water shortage. This is the first report showing that expression of SnOLP in transgenic soybeans improved physiological responses and yield components of plants when subjected to water deficit, highlighting the potential of this gene for biotechnological applications.

  8. Postharvest changes in glycoalkaloid content of potatoes.

    Science.gov (United States)

    Friedman, M; McDonald, G M

    1999-01-01

    Potatoes contain antinutritional and potentially toxic compounds including inhibitors of digestive enzymes, hemagglutinins, and glycoalkaloids. Solanum glycoalkaloids are reported to inhibit cholinesterase, disrupt cell membranes, and induce teratogenicity. In this overview, we describe the role of potatoes in the human diet, reported changes in glycoalkaloid content of fresh and processed potatoes during storage, under the influence of light and radiation, following mechanical damage, and as a result of food processing. Also covered are safety aspects and suggested research needs to develop a protocol that can be adopted by the potato producers and processors to minimize post-harvest synthesis of glycoalkaloids in potatoes. Reducing the glycoalkaloid content of potatoes will provide a variety of benefits extending from the farm to processing, shipping, marketing, and consumption of potatoes and potato products. A commercially available ELISA kit is described which permits rapid assay of glycoalkaloid content of parts of the potato plant including leaves, tubers, and peel, as well as processed potato products including french fries, chips, and skins. Understanding the multiple overlapping aspects of glycoalkaloids in the plant and in the diet will permit controlling postharvest glycoalkaloid production for the benefit of the producer and consumer.

  9. RNA-dependent RNA polymerase 1 in potato (Solanum tuberosum) and its relationship to other plant RNA-dependent RNA polymerases.

    Science.gov (United States)

    Hunter, Lydia J R; Brockington, Samuel F; Murphy, Alex M; Pate, Adrienne E; Gruden, Kristina; MacFarlane, Stuart A; Palukaitis, Peter; Carr, John P

    2016-03-16

    Cellular RNA-dependent RNA polymerases (RDRs) catalyze synthesis of double-stranded RNAs that can serve to initiate or amplify RNA silencing. Arabidopsis thaliana has six RDR genes; RDRs 1, 2 and 6 have roles in anti-viral RNA silencing. RDR6 is constitutively expressed but RDR1 expression is elevated following plant treatment with defensive phytohormones. RDR1 also contributes to basal virus resistance. RDR1 has been studied in several species including A. thaliana, tobacco (Nicotiana tabacum), N. benthamiana, N. attenuata and tomato (Solanum lycopersicum) but not to our knowledge in potato (S. tuberosum). StRDR1 was identified and shown to be salicylic acid-responsive. StRDR1 transcript accumulation decreased in transgenic potato plants constitutively expressing a hairpin construct and these plants were challenged with three viruses: potato virus Y, potato virus X, and tobacco mosaic virus. Suppression of StRDR1 gene expression did not increase the susceptibility of potato to these viruses. Phylogenetic analysis of RDR genes present in potato and in a range of other plant species identified a new RDR gene family, not present in potato and found only in Rosids (but apparently lost in the Rosid A. thaliana) for which we propose the name RDR7.

  10. Dehydrins Impart Protection against Oxidative Stress in Transgenic Tobacco Plants.

    Science.gov (United States)

    Halder, Tanmoy; Upadhyaya, Gouranga; Basak, Chandra; Das, Arup; Chakraborty, Chandrima; Ray, Sudipta

    2018-01-01

    Environmental stresses generate reactive oxygen species (ROS) which might be detrimental to the plants when produced in an uncontrolled way. However, the plants ameliorate such stresses by synthesizing antioxidants and enzymes responsible for the dismutation of ROS. Additionally, the dehydrins were also able to protect the inactivation of the enzyme lactate dehydrogenase against hydroxyl radicals (OH ⋅ ) generated during Fenton's reaction. SbDhn1 and SbDhn2 overexpressing transgenic tobacco plants were able to protect against oxidative damage. Transgenic tobacco lines showed better photosynthetic efficiency along with high chlorophyll content, soluble sugar and proline. However, the malonyl dialdehyde (MDA) content was significantly lower in transgenic lines. Experimental evidence demonstrates the protective effect of dehydrins on electron transport chain in isolated chloroplast upon methyl viologen (MV) treatment. The transgenic tobacco plants showed significantly lower superoxide radical generation () upon MV treatment. The accumulation of the H 2 O 2 was also lower in the transgenic plants. Furthermore, in the transgenic plants the expression of ROS scavenging enzymes was higher compared to non-transformed (NT) or vector transformed (VT) plants. Taken together these data, during oxidative stress dehydrins function by scavenging the () directly and also by rendering protection to the enzymes responsible for the dismutation of () thereby significantly reducing the amount of hydrogen peroxides formed. Increase in proline content along with other antioxidants might also play a significant role in stress amelioration. Dehydrins thus function co-operatively with other protective mechanisms under oxidative stress conditions rendering protection in stress environment.

  11. Population dynamics of potato cyst nematodes and associated damage to potato

    NARCIS (Netherlands)

    Schans, J.

    1993-01-01

    Population dynamics of potato cyst nematodes (PCN; Globoderarostochiensis (Woll.) Skarbilovich and G. pallida Stone) and their interactions with potato plants are insufficiently understood to explain variations of population

  12. Proteome Analysis of Disease Resistance against Ralstonia solanacearum in Potato Cultivar CT206-10

    Directory of Open Access Journals (Sweden)

    Sangryeol Park

    2016-02-01

    Full Text Available Potato is one of the most important crops worldwide. Its commercial cultivars are highly susceptible to many fungal and bacterial diseases. Among these, bacterial wilt caused by Ralstonia solanacearum causes significant yield loss. In the present study, integrated proteomics and genomics approaches were used in order to identify bacterial wilt resistant genes from Rs resistance potato cultivar CT-206-10. 2-DE and MALDI-TOF/TOF-MS analysis identified eight differentially abundant proteins including glycine-rich RNA binding protein (GRP, tomato stress induced-1 (TSI-1 protein, pathogenesis-related (STH-2 protein and pentatricopeptide repeat containing (PPR protein in response to Rs infection. Further, semi-quantitative RT-PCR identified up-regulation in transcript levels of all these genes upon Rs infection. Taken together, our results showed the involvement of the identified proteins in the Rs stress tolerance in potato. In the future, it would be interesting to raise the transgenic plants to further validate their involvement in resistance against Rs in potato.

  13. Cloning and functional characterization of a p-coumaroyl quinate/shikimate 3'-hydroxylase from potato (Solanum tuberosum).

    Science.gov (United States)

    Knollenberg, Benjamin J; Liu, Jingjing; Yu, Shu; Lin, Hong; Tian, Li

    2018-02-05

    Chlorogenic acid (CGA) plays an important role in protecting plants against pathogens and promoting human health. Although CGA accumulates to high levels in potato tubers, the key enzyme p-coumaroyl quinate/shikimate 3'-hydroxylase (C3'H) for CGA biosynthesis has not been isolated and functionally characterized in potato. In this work, we cloned StC3'H from potato and showed that it catalyzed the formation of caffeoylshikimate and CGA (caffeoylquinate) from p-coumaroyl shikimate and p-coumaroyl quinate, respectively, but was inactive towards p-coumaric acid in in vitro enzyme assays. When the expression of StC3'H proteins was blocked through antisense (AS) inhibition under the control of a tuber-specific patatin promoter, moderate changes in tuber yield as well as phenolic metabolites in the core tuber tissue were observed for several AS lines. On the other hand, the AS and control potato lines exhibited similar responses to a bacterial pathogen Pectobacterium carotovorum. These results suggest that StC3'H is implicated in phenolic metabolism in potato. They also suggest that CGA accumulation in the core tissue of potato tubers is an intricately controlled process and that additional C3'H activity may also be involved in CGA biosynthesis in potato. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. Recent Advances in Solanum Potato Improvement In Uganda

    African Journals Online (AJOL)

    The paper reviews the major production constraints for extension of potato production and the role of potato ... Viable, commercial seed schemes and appropriate low cost storage methods are ..... national Potato Centre (CIP), Lima, (Peru). In-.

  15. THE INFLUENCE OF POTATO CYST NEMATODE G. ROSTOCHIENSIS INFESTATION ON DIFFERENT POTATO CULTIVARS

    OpenAIRE

    Gregor Urek; S Širca; Stare Geric; B Dolničar; P Strajnar

    2008-01-01

    The potato cyst nematode Globodera rostochiensis is one of the most serious pests of potato in Slovenia. Precise nematode identification and knowledge about potato cultivars, which are most suitable for growing in the Slovenian climate conditions and most resistant to G. rostochiensis, are necessary to develop an effective integrated pest control. Here we report the results of the influence of G. rostochiensis pathotype Ro1/4 on the yield of different potato cultivars: the susceptible cultiva...

  16. Multiple different defense mechanisms are activated in the young transgenic tobacco plants which express the full length genome of the Tobacco mosaic virus, and are resistant against this virus.

    Science.gov (United States)

    Jada, Balaji; Soitamo, Arto J; Siddiqui, Shahid Aslam; Murukesan, Gayatri; Aro, Eva-Mari; Salakoski, Tapio; Lehto, Kirsi

    2014-01-01

    Previously described transgenic tobacco lines express the full length infectious Tobacco mosaic virus (TMV) genome under the 35S promoter (Siddiqui et al., 2007. Mol Plant Microbe Interact, 20: 1489-1494). Through their young stages these plants exhibit strong resistance against both the endogenously expressed and exogenously inoculated TMV, but at the age of about 7-8 weeks they break into TMV infection, with typical severe virus symptoms. Infections with some other viruses (Potato viruses Y, A, and X) induce the breaking of the TMV resistance and lead to synergistic proliferation of both viruses. To deduce the gene functions related to this early resistance, we have performed microarray analysis of the transgenic plants during the early resistant stage, and after the resistance break, and also of TMV-infected wild type tobacco plants. Comparison of these transcriptomes to those of corresponding wild type healthy plants indicated that 1362, 1150 and 550 transcripts were up-regulated in the transgenic plants before and after the resistance break, and in the TMV-infected wild type tobacco plants, respectively, and 1422, 1200 and 480 transcripts were down-regulated in these plants, respectively. These transcriptome alterations were distinctly different between the three types of plants, and it appears that several different mechanisms, such as the enhanced expression of the defense, hormone signaling and protein degradation pathways contributed to the TMV-resistance in the young transgenic plants. In addition to these alterations, we also observed a distinct and unique gene expression alteration in these plants, which was the strong suppression of the translational machinery. This may also contribute to the resistance by slowing down the synthesis of viral proteins. Viral replication potential may also be suppressed, to some extent, by the reduction of the translation initiation and elongation factors eIF-3 and eEF1A and B, which are required for the TMV replication

  17. The Use of TILLING Technique to Detect Mutations and genetic diversity in Potato

    International Nuclear Information System (INIS)

    Elias, R; Al-Safadi, B; Till, B

    2008-01-01

    TILLING technique has been used, for the first time, to detect genetic variation, at the molecular level, among potato mutants (induced by gamma irradiation) and genetic diversity among 3 potato cultivars. Three potato mutant lines (every mutant represents a cultivar) tolerant to salinity have been used along with their controls. Three primer pairs were designed with the help of Potato Genome Sequencing Consortium on the web and were evaluated using agarose gel then sequencing. Primer pairs passing these tests were fluorescently labeled. Li-Cor based TILLING was applied using 2 forward primers one of them is labeled and 2 reverse primers one of them is labeled. The results have shown the success of using this technique on potato (tetraploid species) where the average density of nucleotide polymorphisms per sample was 16 polymorphisms per 1 kb. The optimal concentration was also determined between 0.1 and 1 ng/ul for potato genomic DNAs to be used in Li-Cor based TILLING assays. (author)

  18. Greatly reduced phylogenetic structure in the cultivated potato clade of potatoes, Solanum section Petota

    Science.gov (United States)

    The species boundaries of wild and cultivated potatoes, Solanum section Petota, are controversial with most of the taxonomic problems in a clade containing cultivated potatoes. We here provide the first in-depth phylogenetic study of the cultivated potato clade to explore possible causes of these pr...

  19. 78 FR 9629 - Irish Potatoes Grown in Colorado; Reestablishment of Membership on the Colorado Potato...

    Science.gov (United States)

    2013-02-11

    ... Service 7 CFR Part 948 [Doc. No. AMS-FV-12-0044; FV12-948-2 PR] Irish Potatoes Grown in Colorado; Reestablishment of Membership on the Colorado Potato Administrative Committee, Area No. 2 AGENCY: Agricultural... membership on the Colorado Potato Administrative Committee, Area No. 2 (Committee). The Committee locally...

  20. Preservation of potatoes by gamma irradiation

    International Nuclear Information System (INIS)

    Nouani, A.; Boussaha, A.

    1987-01-01

    In Algeria, potatoes are a major food item in nutrition habits. Because of lack of cold storage facilities, losses can reach up to 40% of the total output of summer harvest. This paper describes the first experiments on the application of gamma irradiation for the preservation of local varieties of potatoes. Losses are strongly reduced by inhibition sprouting effect of irradiation and reduction of sugars content has no significant influence on the acceptability of irradiated potatoes

  1. Detection of irradiated potatoes by impedance measurements

    International Nuclear Information System (INIS)

    Hayashi, Toru; Sugiyama, Junnichi; Otobe, Kazuki; Todoriki, Setsuko

    1993-01-01

    The impedance ratio at 5kHz to 50kHz (Z 6K /Z 50K ) determined at 22degC at an apical region of potato tuber which was pre-incubated at 22degC for 3 days or longer resulted in the best detection of radian treatment. Irradiated potatoes of 10 cultivars could be detected with this method, and potatoes 'Danshaku' commercially irradiated at Shihoro could be distinguished from unirradiated 'Danshaku'. (author)

  2. Hygiene assessment of irradiated potato mutagenic activity

    International Nuclear Information System (INIS)

    Uralova, M.; Grunt, J.; Patzeltova, N.

    1977-01-01

    Albino rat males were fed on gamma-irradiated potatoes for one month and mated with two intact female rats each. The dominant lethal mutation method was then used for the study of possible mutagenic activity of the irradiated potatoes. No statistically significant differences were observed and no mutagenic activity was found. Thus, the test showed that potatoes irradiated with a dose of 10 krad of gamma radiation does not present genetic hazards for albino rats. (L.O.)

  3. Transgenic algae engineered for higher performance

    Science.gov (United States)

    Unkefer, Pat J; Anderson, Penelope S; Knight, Thomas J

    2014-10-21

    The present disclosure relates to transgenic algae having increased growth characteristics, and methods of increasing growth characteristics of algae. In particular, the disclosure relates to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and a glutamine synthetase.

  4. Bioproducts from Potatoes. A Review

    Science.gov (United States)

    Priedniece, Vivita; Spalvins, Kriss; Ivanovs, Kaspars; Pubule, Jelena; Blumberga, Dagnija

    2017-12-01

    The increasing amount of food waste througout the world is becoming a major problem for waste management plants. The food waste produced amounts to 1.3 million tons a year. This is a resource that could be used for production of new products. Decreasing fossil resources and a rapidly growing population lead to the necessity to produce more food and to replace existing with new materials ones that are biological and produce little effect on environment. Bioeconomy is a method that can help achieve production of value-added products that use local resources and waste to manufacture products efficiently. In this article, we are looking at possibilities to use potatoes for production of new materials, such as bioplastics, antioxidants, proteins, instead of their conventional use for food production. We have studied potato components, extraction technologies and summed up possible directions for development for new products, looking at the use of processing waste as a raw material.

  5. Bioproducts from Potatoes. A Review

    Directory of Open Access Journals (Sweden)

    Priedniece Vivita

    2017-12-01

    Full Text Available The increasing amount of food waste througout the world is becoming a major problem for waste management plants. The food waste produced amounts to 1.3 million tons a year. This is a resource that could be used for production of new products. Decreasing fossil resources and a rapidly growing population lead to the necessity to produce more food and to replace existing with new materials ones that are biological and produce little effect on environment. Bioeconomy is a method that can help achieve production of value-added products that use local resources and waste to manufacture products efficiently. In this article, we are looking at possibilities to use potatoes for production of new materials, such as bioplastics, antioxidants, proteins, instead of their conventional use for food production. We have studied potato components, extraction technologies and summed up possible directions for development for new products, looking at the use of processing waste as a raw material.

  6. Transgenic Cavendish bananas with resistance to Fusarium wilt tropical race 4.

    Science.gov (United States)

    Dale, James; James, Anthony; Paul, Jean-Yves; Khanna, Harjeet; Smith, Mark; Peraza-Echeverria, Santy; Garcia-Bastidas, Fernando; Kema, Gert; Waterhouse, Peter; Mengersen, Kerrie; Harding, Robert

    2017-11-14

    Banana (Musa spp.) is a staple food for more than 400 million people. Over 40% of world production and virtually all the export trade is based on Cavendish banana. However, Cavendish banana is under threat from a virulent fungus, Fusarium oxysporum f. sp. cubense tropical race 4 (TR4) for which no acceptable resistant replacement has been identified. Here we report the identification of transgenic Cavendish with resistance to TR4. In our 3-year field trial, two lines of transgenic Cavendish, one transformed with RGA2, a gene isolated from a TR4-resistant diploid banana, and the other with a nematode-derived gene, Ced9, remain disease free. Transgene expression in the RGA2 lines is strongly correlated with resistance. Endogenous RGA2 homologs are also present in Cavendish but are expressed tenfold lower than that in our most resistant transgenic line. The expression of these homologs can potentially be elevated through gene editing, to provide non-transgenic resistance.

  7. Overexpression of host plant urease in transgenic silkworms.

    Science.gov (United States)

    Jiang, Liang; Huang, Chunlin; Sun, Qiang; Guo, Huizhen; Peng, Zhengwen; Dang, Yinghui; Liu, Weiqiang; Xing, Dongxu; Xu, Guowen; Zhao, Ping; Xia, Qingyou

    2015-06-01

    Bombyx mori and mulberry constitute a model of insect-host plant interactions. Urease hydrolyzes urea to ammonia and is important for the nitrogen metabolism of silkworms because ammonia is assimilated into silk protein. Silkworms do not synthesize urease and acquire it from mulberry leaves. We synthesized the artificial DNA sequence ureas using the codon bias of B. mori to encode the signal peptide and mulberry urease protein. A transgenic vector that overexpresses ure-as under control of the silkworm midgut-specific P2 promoter was constructed. Transgenic silkworms were created via embryo microinjection. RT-PCR results showed that urease was expressed during the larval stage and qPCR revealed the expression only in the midgut of transgenic lines. Urea concentration in the midgut and hemolymph of transgenic silkworms was significantly lower than in a nontransgenic line when silkworms were fed an artificial diet. Analysis of the daily body weight and food conversion efficiency of the fourth and fifth instar larvae and economic characteristics indicated no differences between transgenic silkworms and the nontransgenic line. These results suggested that overexpression of host plant urease promoted nitrogen metabolism in silkworms.

  8. Work of multiple organizations to improve seed potato health in U.S.A. and an example of change to reduce Potato virus Y in seed potato lots

    Science.gov (United States)

    Work of multiple organizations to improve seed potato health in U.S.A. and an example of change to reduce Potato virus Y in seed lots. In the United States, seed potato improvement starts with the individual seed potato grower. The seed grower also has resources that are available from university e...

  9. Reactivation of meristem activity and sprout growth in potato tubers require both cytokinin and gibberellin.

    Science.gov (United States)

    Hartmann, Anja; Senning, Melanie; Hedden, Peter; Sonnewald, Uwe; Sonnewald, Sophia

    2011-02-01

    Reactivation of dormant meristems is of central importance for plant fitness and survival. Due to their large meristem size, potato (Solanum tuberosum) tubers serve as a model system to study the underlying molecular processes. The phytohormones cytokinins (CK) and gibberellins (GA) play important roles in releasing potato tuber dormancy and promoting sprouting, but their mode of action in these processes is still obscure. Here, we established an in vitro assay using excised tuber buds to study the dormancy-releasing capacity of GA and CK and show that application of gibberellic acid (GA(3)) is sufficient to induce sprouting. In contrast, treatment with 6-benzylaminopurine induced bud break but did not support further sprout growth unless GA(3) was administered additionally. Transgenic potato plants expressing Arabidopsis (Arabidopsis thaliana) GA 20-oxidase or GA 2-oxidase to modify endogenous GA levels showed the expected phenotypical changes as well as slight effects on tuber sprouting. The isopentenyltransferase (IPT) from Agrobacterium tumefaciens and the Arabidopsis cytokinin oxidase/dehydrogenase1 (CKX) were exploited to modify the amounts of CK in transgenic potato plants. IPT expression promoted earlier sprouting in vitro. Strikingly, CKX-expressing tubers exhibited a prolonged dormancy period and did not respond to GA(3). This supports an essential role of CK in terminating tuber dormancy and indicates that GA is not sufficient to break dormancy in the absence of CK. GA(3)-treated wild-type and CKX-expressing tuber buds were subjected to a transcriptome analysis that revealed transcriptional changes in several functional groups, including cell wall metabolism, cell cycle, and auxin and ethylene signaling, denoting events associated with the reactivation of dormant meristems.

  10. Plant biotechnology: transgenic crops.

    Science.gov (United States)

    Shewry, Peter R; Jones, Huw D; Halford, Nigel G

    2008-01-01

    Transgenesis is an important adjunct to classical plant breeding, in that it allows the targeted manipulation of specific characters using genes from a range of sources. The current status of crop transformation is reviewed, including methods of gene transfer, the selection of transformed plants and control of transgene expression. The application of genetic modification technology to specific traits is then discussed, including input traits relating to crop production (herbicide tolerance and resistance to insects, pathogens and abiotic stresses) and output traits relating to the composition and quality of the harvested organs. The latter include improving the nutritional quality for consumers as well as the improvement of functional properties for food processing.

  11. Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus.

    Science.gov (United States)

    Le, Dung Tien; Chu, Ha Duc; Sasaya, Takahide

    2015-01-01

    Rice tungro spherical virus (RTSV), also known as Rice waika virus, does not cause visible symptoms in infected rice plants. However, the virus plays a critical role in spreading Rice tungro bacilliform virus (RTBV), which is the major cause of severe symptoms of rice tungro disease. Recent studies showed that RNA interference (RNAi) can be used to develop virus-resistance transgenic rice plants. In this report, we presented simple procedures and protocols needed for the creation of transgenic rice plants capable of producing small interfering RNA specific against RTSV sequences. Notably, our study showed that 60 out of 64 individual hygromycin-resistant lines (putative transgenic lines) obtained through transformation carried transgenes designed for producing hairpin double-stranded RNA. Northern blot analyses revealed the presence of small interfering RNA of 21- to 24-mer in 46 out of 56 confirmed transgenic lines. Taken together, our study indicated that transgenic rice plants carrying an inverted repeat of 500-bp fragments encoding various proteins of RTSV can produce small interfering RNA from the hairpin RNA transcribed from that transgene. In light of recent studies with other viruses, it is possible that some of these transgenic rice lines might be resistant to RTSV.

  12. Transgenic poplars with reduced lignin show impaired xylem conductivity, growth efficiency and survival

    Science.gov (United States)

    Steven L. Voelker; Barbara Lachenbruch; Frederick C. Meinzer; Peter Kitin; Steven H. Strauss

    2011-01-01

    We studied xylem anatomy and hydraulic architecture in 14 transgenic insertion events and a control line of hybrid poplar (Populus spp.) that varied in lignin content. Transgenic events had different levels of down-regulation of two genes encoding 4-coumarate:coenzyme A ligase (4CL). Two-year-old trees were characterized after...

  13. Cereal cystatins delay sprouting and nutrient loss in tubers of potato, Solanum tuberosum.

    Science.gov (United States)

    Munger, Aurélie; Simon, Marie-Aube; Khalf, Moustafa; Goulet, Marie-Claire; Michaud, Dominique

    2015-12-21

    Recent studies have reported agronomically useful ectopic effects for recombinant protease inhibitors expressed in leaves of transgenic plants, including improved tolerance to abiotic stress conditions and partial resistance to necrotrophic pathogens. Here we assessed the effects of these proteins on the post-dormancy sprouting of storage organs, using as a model potato tubers expressing cysteine protease inhibitors of the cystatin protein superfamily. Sprout emergence and distribution, soluble proteins, starch and soluble sugars were monitored in tubers of cereal cystatin-expressing clones stored for several months at 4 °C. Cystatin expression had a strong repressing effect on sprout growth, associated with an apparent loss of apical dominance and an increased number of small buds at the skin surface. Soluble protein content remained high for up to 48 weeks in cystatin-expressing tubers compared to control (untransformed) tubers, likely explained by a significant stabilization of the major storage protein patatin, decreased hydrolysis of the endogenous protease inhibitor multicystatin and low cystatin-sensitive cysteine protease activity in tuber tissue. Starch content decreased after several months in cystatin-expressing tubers but remained higher than in control tubers, unlike sucrose showing a slower accumulation in the transgenics. Plantlet emergence, storage protein processing and height of growing plants showed similar time-course patterns for control and transgenic tubers, except for a systematic delay of 2 or 3 d in the latter group likely due to limited sprout size at sowing. Our data point overall to the onset of metabolic interference effects for cereal cystatins in sprouting potato tubers. They suggest, in practice, the potential of endogenous cysteine proteases as relevant targets for the development of potato varieties with longer storage capabilities.

  14. [TSA improve transgenic porcine cloned embryo development and transgene expression].

    Science.gov (United States)

    Kong, Qing-Ran; Zhu, Jiang; Huang, Bo; Huan, Yan-Jun; Wang, Feng; Shi, Yong-Qian; Liu, Zhong-Feng; Wu, Mei-Ling; Liu, Zhong-Hua

    2011-07-01

    Uncompleted epigenetic reprogramming is attributed to the low efficiency of producing transgenic cloned animals. Histone modification associated with epigenetics can directly influence the embryo development and transgene expression. Trichostatin A (TSA), as an inhibitor of histone deacetylase, can change the status of histone acetylation, improve somatic cell reprogramming, and enhance cloning efficiency. TSA prevents the chromatin structure from being condensed, so that transcription factor could binds to DNA sequence easily and enhance transgene expression. Our study established the optimal TSA treatment on porcine donor cells and cloned embryos, 250 nmol/L, 24 h and 40 nmol/L, 24 h, respectively. Furthermore, we found that both the cloned embryo and the donor cell treated by TSA resulted in the highest development efficiency. Meanwhile, TSA can improve transgene expression in donor cell and cloned embryo. In summary, TSA can significantly improve porcine reconstructed embryo development and transgene expression.

  15. Development of transgenic watermelon resistant to Cucumber mosaic virus and Watermelon mosaic virus by using a single chimeric transgene construct.

    Science.gov (United States)

    Lin, Ching-Yi; Ku, Hsin-Mei; Chiang, Yi-Hua; Ho, Hsiu-Yin; Yu, Tsong-Ann; Jan, Fuh-Jyh

    2012-10-01

    Watermelon, an important fruit crop worldwide, is prone to attack by several viruses that often results in destructive yield loss. To develop a transgenic watermelon resistant to multiple virus infection, a single chimeric transgene comprising a silencer DNA from the partial N gene of Watermelon silver mottle virus (WSMoV) fused to the partial coat protein (CP) gene sequences of Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV) and Watermelon mosaic virus (WMV) was constructed and transformed into watermelon (cv. Feeling) via Agrobacterium-mediated transformation. Single or multiple transgene copies randomly inserted into various locations in the genome were confirmed by Southern blot analysis. Transgenic watermelon R(0) plants were individually challenged with CMV, CGMMV or WMV, or with a mixture of these three viruses for resistance evaluation. Two lines were identified to exhibit resistance to CMV, CGMMV, WMV individually, and a mixed inoculation of the three viruses. The R(1) progeny of the two resistant R(0) lines showed resistance to CMV and WMV, but not to CGMMV. Low level accumulation of transgene transcripts in resistant plants and small interfering (si) RNAs specific to CMV and WMV were readily detected in the resistant R(1) plants by northern blot analysis, indicating that the resistance was established via RNA-mediated post-transcriptional gene silencing (PTGS). Loss of the CGMMV CP-transgene fragment in R1 progeny might be the reason for the failure to resistant CGMMV infection, as shown by the absence of a hybridization signal and no detectable siRNA specific to CGMMV in Southern and northern blot analyses. In summary, this study demonstrated that fusion of different viral CP gene fragments in transgenic watermelon contributed to multiple virus resistance via PTGS. The construct and resistant watermelon lines developed in this study could be used in a watermelon breeding program for resistance to multiple viruses.

  16. Mutagenesis in sweet potato

    International Nuclear Information System (INIS)

    Zhen Hai Rou

    1997-01-01

    Stem explants of cv. 'Gao line 14' were cultured on the MS medium supplemented with 0.01 mg BA+1.0 mg NAA+2.0 mg IAA/l. The calli thus formed were irradiated with 5 Gy from a 60 Co gamma-ray. Irradiated calli were transferred to half-strength MS medium containing 2.0 mg KIN + 2.0 mg IAA/l to induce plant regeneration. An early ripening mutant with high yield and low tuber number was selected among the regenerated plants grown in a field. Embryogenic calli were obtained from stem pieces, stem-tips and leaves on MS medium supplemented with 2,4-D. (author). 1 ref

  17. Mutagenesis in sweet potato

    Energy Technology Data Exchange (ETDEWEB)

    Rou, Zhen Hai [Horticultural Research Inst., Shanghai Academy of Agricultural Sciences, Shanghai (China)

    1997-07-01

    Stem explants of cv. `Gao line 14` were cultured on the MS medium supplemented with 0.01 mg BA+1.0 mg NAA+2.0 mg IAA/l. The calli thus formed were irradiated with 5 Gy from a {sup 60}Co gamma-ray. Irradiated calli were transferred to half-strength MS medium containing 2.0 mg KIN + 2.0 mg IAA/l to induce plant regeneration. An early ripening mutant with high yield and low tuber number was selected among the regenerated plants grown in a field. Embryogenic calli were obtained from stem pieces, stem-tips and leaves on MS medium supplemented with 2,4-D. (author). 1 ref.

  18. Intein-mediated Cre protein assembly for transgene excision in hybrid progeny of transgenic Arabidopsis.

    Science.gov (United States)

    Ge, Jia; Wang, Lijun; Yang, Chen; Ran, Lingyu; Wen, Mengling; Fu, Xianan; Fan, Di; Luo, Keming

    2016-10-01

    An approach for restoring recombination activity of complementation split-Cre was developed to excise the transgene in hybrid progeny of GM crops. Growing concerns about the biosafety of genetically modified (GM) crops has currently become a limited factor affecting the public acceptance. Several approaches have been developed to generate selectable-marker-gene-free GM crops. However, no strategy was reported to be broadly applicable to hybrid crops. Previous studies have demonstrated that complementation split-Cre recombinase restored recombination activity in transgenic plants. In this study, we found that split-Cre mediated by split-intein Synechocystis sp. DnaE had high recombination efficiency when Cre recombinase was split at Asp232/Asp233 (866 bp). Furthermore, we constructed two plant expression vectors, pCA-NCre-In and pCA-Ic-CCre, containing NCre866-In and Ic-CCre866 fragments, respectively. After transformation, parent lines of transgenic Arabidopsis with one single copy were generated and used for hybridization. The results of GUS staining demonstrated that the recombination activity of split-Cre could be reassembled in these hybrid progeny of transgenic plants through hybridization and the foreign genes flanked by two loxP sites were efficiently excised. Our strategy may provide an effective approach for generating the next generation of GM hybrid crops without biosafety concerns.

  19. Molecular and genetic characterization of the Ry adg locus on chromosome XI from Andigena potatoes conferring extreme resistance to potato virus Y.

    Science.gov (United States)

    Herrera, María Del Rosario; Vidalon, Laura Jara; Montenegro, Juan D; Riccio, Cinzia; Guzman, Frank; Bartolini, Ida; Ghislain, Marc

    2018-05-31

    We have elucidated the Andigena origin of the potato Ry adg gene on chromosome XI of CIP breeding lines and developed two marker assays to facilitate its introgression in potato by marker-assisted selection. Potato virus Y (PVY) is causing yield and quality losses forcing farmers to renew periodically their seeds from clean stocks. Two loci for extreme resistance to PVY, one on chromosome XI and the other on XII, have been identified and used in breeding. The latter corresponds to a well-known source of resistance (Solanum stoloniferum), whereas the one on chromosome XI was reported from S. stoloniferum and S. tuberosum group Andigena as well. To elucidate its taxonomic origin in our breeding lines, we analyzed the nucleotide sequences of tightly linked markers (M45, M6) and screened 251 landraces of S. tuberosum group Andigena for the presence of this gene. Our results indicate that the PVY resistance allele on chromosome XI in our breeding lines originated from S. tuberosum group Andigena. We have developed two marker assays to accelerate the introgression of Ry adg gene into breeding lines by marker-assisted selection (MAS). First, we have multiplexed RYSC3, M6 and M45 DNA markers flanking the Ry adg gene and validated it on potato varieties with known presence/absence of the Ry adg gene and a progeny of 6,521 individuals. Secondly, we developed an allele-dosage assay particularly useful to identify multiplex Ry adg progenitors. The assay based on high-resolution melting analysis at the M6 marker confirmed Ry adg plex level as nulliplex, simplex and duplex progenitors and few triplex progenies. These marker assays have been validated and can be used to facilitate MAS in potato breeding.

  20. Single molecule Raman spectroscopic assay to detect transgene from GM plants.

    Science.gov (United States)

    Kadam, Ulhas S; Chavhan, Rahul L; Schulz, Burkhard; Irudayaraj, Joseph

    2017-09-01

    Substantial concerns have been raised for the safety of transgenics on human health and environment. Many organizations, consumer groups, and environmental agencies advocate for stringent regulations to avoid transgene products' contamination in food cycle or in nature. Here we demonstrate a novel approach using surface enhanced Raman spectroscopy (SERS) to detect and quantify transgene from GM plants. We show a highly sensitive and accurate quantification of transgene DNA from multiple transgenic lines of Arabidopsis. The assay allows us to detect and quantify the transgenes as low as 0.10 pg without need for PCR-amplification. This technology is relatively cheap, quick, simple, and suitable for detection at low target concentration. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. The potato chips and dry mashed as products of potato rational processing

    Directory of Open Access Journals (Sweden)

    A. Mazur

    2015-05-01

    Full Text Available Introduction. The percentage of potato processing for food products in the former Soviet Union decreased to 1%, at the same time in some countries of Europe and the USA the share of potato processing is 60-80%. Numerous works have shown the economic feasibility of potato processing for food products. Materials and methods. In laboratory and industrial conditions of the open stock company «Mashpishcheprod» (Maryina Gorka, Minsk region, Belarus researches have been conducted on increase of efficiency of technological processes potato processing. Sampling, preparation and conducting of tests were performed by standard and special methods of analysis. Results and discussion. Potato varieties suitable for the production of dry mashed potatoes and potatocrisps have been determined, acclimatization before processing ensures minimumthe content of the reducing sugars, which provide high quality of the finished product. Studies have shown that the process of kneading potato at temperatures close to cooking temperature is optimal, in which the process of destruction cells is hardly taking place. Pneumatic dryers for drying boiled potato provide high product quality due to the low temperature of heating and short contact of a powdered product with a drying agent. However, the contents of damaged cells in the finished product do not exceed 1.3-2.6%. The optimum modes and parameters of potato crisps production have been defined, the processes of cutting, blanching, treatment with salt, drying and roasting have been scientifically grounded, that provide a finished product with fat content not more than 27.7%. Conclusion. Economic expediency of processing the following varieties of potato Desire, Temp, Synthesis for dry mashed potato and potato crisps has been proved. The processes of kneading and drying potato are decisive stages of the processing, because they determine the number of destroyedcells in the finished product. Optimal parameters of production

  2. Comparative study of potato cultivation through micropropagation ...

    African Journals Online (AJOL)

    A trial was carried out to evaluate the productivity of Solanum tuberosum L. cultivated through conventional farming and micropropagation method. Survival rate, biomass and tuber yield of both micropropagated and tuber propagated potatoes was evaluated. Survival percentages of potatoes were 90% for conventional ...

  3. Geographic distribution of wild potato species

    NARCIS (Netherlands)

    Hijmans, R.J.; Spooner, D.M.

    2001-01-01

    The geographic distribution of wild potatoes (Solanaceae sect. Petota) was analyzed using a database of 6073 georeferenced observations. Wild potatoes occur in 16 countries, but 88% of the observations are from Argentina, Bolivia, Mexico, and Peru. Most species are rare and narrowly endemic: for 77

  4. Proximate analysis of Sweet Potato Toasted Granules

    African Journals Online (AJOL)

    Revd Dr Olaleye

    Sweet potato varieties with dark orange flesh have more beta carotene than those with light colored flesh and their increased cultivation is being encouraged in Africa where Vitamin A deficiency is a serious health problem. Sweet potato fries are a common preparation in most African homes. Its leaves are a common side ...

  5. PCR detection of potato cyst nematode.

    Science.gov (United States)

    Reid, Alex

    2009-01-01

    Potato cyst nematode (PCN) is responsible for losses in potato production totalling millions of euros every year in the EC. It is important for growers to know which species is present in their land as this determines its subsequent use. The two species Globodera pallida and Globodera rostochiensis can be differentiated using an allele-specific PCR.

  6. Potato cyst nematodes: pests of national importance

    Science.gov (United States)

    Potato cyst nematodes (PCN; G. rostochiensis and G. pallida) are internationally-recognized quarantine pests and considered the most devastating pests of potatoes due to annual worldwide yield losses estimated at 12.2%. PCNs continue to spread throughout North America and were recently detected in I...

  7. Ensuring the genetic diversity of potatoes

    Science.gov (United States)

    Opportunities for advances in the potato crop through genetics are great, since potato has many needs for improvement, and many related species with the traits required are available. Genebanks provide a centralized and specialized resource for providing the services of acquisition, classification, ...

  8. Detection of irradiated potatoes by impedance measurement

    International Nuclear Information System (INIS)

    Hayashi, T.; Todoriki, S.; Otobe, K.; Sugiyama, J.

    1996-01-01

    Potato is one of the major food items to be treated with ionising radiation and potatoes are irradiated on a large scale in several countries. Every year around 15,000 t of potatoes are irradiated at doses of 60 to 150 Gy (average dose is about 100 Gy) in Japan. Although various methods to detect irradiated potatoes have been investigated, no established method has been reported. Measuring electrical conductivity or impedance of potatoes has been reported as a promising method for the detection of irradiated potatoes. In previous studies it has been found that the ratio of impedance magnitude at 50 kHz to that at 5 kHz, measured immediately after puncturing a potato tuber, is dependent upon the dose applied to the tuber, independent of storage temperature and stable during storage after irradiation. The aim of this study was to establish the optimum conditions for impedance measurement and to examine the applicability of the impedance measuring method to various cultivars (cv.) of potatoes. (author)

  9. Sweet potato in gluten-free pancakes.

    Science.gov (United States)

    Gluten-free pancakes were prepared using rice flour, and rice flour replaced with various amounts, at 10, 20, and 40% of sweet potato flour. At 40% sweet potato, the apparent viscosity became comparable to that of the traditional wheat pancake batter. Texture properties of the cooked pancakes, such...

  10. Production of transgenic brassica juncea with the synthetic chitinase gene (nic) conferring resistance to alternaria brassicicola

    International Nuclear Information System (INIS)

    Munir, I.; Hussan, W.; Kazi, M.; Mian, A.

    2016-01-01

    Brassica juncea is an important oil seed crop throughout the world. The demand and cultivation of oil seed crops has gained importance due to rapid increase in world population and industrialization. Fungal diseases pose a great threat to Brassica productivity worldwide. Absence of resistance genes against fungal infection within crossable germplasms of this crop necessitates deployment of genetic engineering approaches to produce transgenic plants with resistance against fungal infections. In the current study, hypocotyls and cotyledons of Brassica juncea, used as explants, were transformed with Agrobacterium tumefacien strain EHA101 harboring binary vector pEKB/NIC containing synthetic chitinase gene (NIC), an antifungal gene under the control of cauliflower mosaic virus promoter (CaMV35S). Bar genes and nptII gene were used as selectable markers. Presence of chitinase gene in trangenic lines was confirmed by PCR and southern blotting analysis. Effect of the extracted proteins from non-transgenic and transgenic lines was observed on the growth of Alternaria brassicicola, a common disease causing pathogen in brassica crop. In comparison to non-transgenic control lines, the leaf tissue extracts of the transgenic lines showed considerable resistance and antifungal activity against A. brassicicola. The antifungal activity in transgenic lines was observed as corresponding to the transgene copy number. (author)

  11. Recombineering strategies for developing next generation BAC transgenic tools for optogenetics and beyond.

    Science.gov (United States)

    Ting, Jonathan T; Feng, Guoping

    2014-01-01

    The development and application of diverse BAC transgenic rodent lines has enabled rapid progress for precise molecular targeting of genetically-defined cell types in the mammalian central nervous system. These transgenic tools have played a central role in the optogenetic revolution in neuroscience. Indeed, an overwhelming proportion of studies in this field have made use of BAC transgenic Cre driver lines to achieve targeted expression of optogenetic probes in the brain. In addition, several BAC transgenic mouse lines have been established for direct cell-type specific expression of Channelrhodopsin-2 (ChR2). While the benefits of these new tools largely outweigh any accompanying challenges, many available BAC transgenic lines may suffer from confounds due in part to increased gene dosage of one or more "extra" genes contained within the large BAC DNA sequences. Here we discuss this under-appreciated issue and propose strategies for developing the next generation of BAC transgenic lines that are devoid of extra genes. Furthermore, we provide evidence that these strategies are simple, reproducible, and do not disrupt the intended cell-type specific transgene expression patterns for several distinct BAC clones. These strategies may be widely implemented for improved BAC transgenesis across diverse disciplines.

  12. TL transgenic mouse strains

    International Nuclear Information System (INIS)

    Obata, Y.; Matsudaira, Y.; Hasegawa, H.; Tamaki, H.; Takahashi, T.; Morita, A.; Kasai, K.

    1993-01-01

    As a result of abnormal development of the thymus of these mice, TCR αβ lineage of the T cell differentiation is disturbed and cells belonging to the TCR γδ CD4 - CD8 - double negative (DN) lineage become preponderant. The γδ DN cells migrate into peripheral lymphoid organs and constitute nearly 50% of peripheral T cells. Immune function of the transgenic mice is severely impaired, indicating that the γδ cells are incapable of participating in these reactions. Molecular and serological analyses of T-cell lymphomas reveal that they belong to the γδ lineage. Tg.Tla a -3-1 mice should be useful in defining the role of TL in normal and abnormal T cell differentiation as well as in the development of T-cell lymphomas, and further they should facilitate studies on the differentiation and function of γδ T cells. We isolated T3 b -TL gene from B6 mice and constructed a chimeric gene in which T3 b -TL is driven by the promoter of H-2K b . With the chimeric gene, two transgenic mouse strains, Tg. Con.3-1 and -2 have been derived in C3H background. Both strains express TL antigen in various tissues including skin. The skin graft of transgenic mice on C3H and (B6 X C3H)F 1 mice were rejected. In the mice which rejected the grafts, CD8 + TCRαβ cytotoxic T cells (CTL) against TL antigens were recognized. The recognition of TL by CTL did not require the antigen presentation by H-2 molecules. The results indicated that TL antigen in the skin becomes a transplantation antigen and behaves like a typical allogeneic MHC class I antigen. The facts that (B6 X C3H)F 1 mice rejected the skin expressing T3 b -TL antigen and induced CTL that killed TL + lymphomas of B6 origin revealed that TL antigen encoded by T3 b -TL is recognized as non-self in B6 mice. Experiments are now extended to analyze immune responses to TL antigen expressed on autochthonous T cell lymphomas. (J.P.N.)

  13. A new index to assess nitrogen dynamics in potato (Solanum tuberosum L.) production systems of Bolivia

    Science.gov (United States)

    Bolivia is the poorest country in South America with over 80% of the rural population under the poverty line. Agricultural productivity is closely correlated with poverty levels across rural Bolivia. Potato (Solanum tuberosum L.) is one of the most important crops for food security in Bolivia and th...

  14. Segregation and expression of transgenes in the progenies of Bt ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-04-17

    Apr 17, 2012 ... segregation was observed in BC1F1, BC1F2 and F2 populations derived .... randomly chosen at the tillering stage respectively and were ground .... Figure 2. Southern blot of Hind III-digested DNA from Bt transgenic rice line ...

  15. Transgenic engineering of male-specific muscular hypertrophy

    DEFF Research Database (Denmark)

    Pirottin, D.; Grobet, L.; Adamantidis, A.

    2005-01-01

    Using a two-step procedure involving insertional gene targeting and recombinase-mediated cassette exchange in ES cells, we have produced two lines of transgenic mice expressing a dominant-negative latency-associated myostatin propeptide under control of the myosin light chain 1F promoter and 1/3 ...

  16. Complex genomic rearrangement in CCS-LacZ transgenic mice.

    Science.gov (United States)

    Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I

    2007-02-01

    The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.

  17. Storage performance of Taiwanese sweet potato cultivars.

    Science.gov (United States)

    Huang, Che-Lun; Liao, Wayne C; Chan, Chin-Feng; Lai, Yung-Chang

    2014-12-01

    Three sweet potato cultivars (TNG57, TNG66, and TNG73), provided by the Taiwanese Agricultural Research Institute (TARI), were stored at either 15 °C or under ambient conditions (23.8 ~ 28.4 °C and 77.1 ~ 81.0 % of relative humidity). Sweet potato roots were randomly chosen from each replicate and evaluated for measurement of weight loss, sugar content analysis, and sprouting after 0, 14, 24, 48, 56, 70, 84, and 98 days of storage. Fresh sweet potato roots were baked at 200 °C for 60 min then samples were taken for sugar analysis. After 14 days of ambient condition storage, the sprouting percentages for TNG57, TNG66, and TNG73 were 100, 85, and 95 % respectively. When sweet potatoes were stored at 15 °C, the weight loss became less and no sweet potato root sprouted after 14 days of storage. Because manufacturers can store sweet potatoes at 15 °C for almost 2 month without other treatments, the supply capacity shortage in July and September can be reduced. The total sugar content slowly increased along with increasing the storage time. After baking, the total sugar content of sweet potatoes significantly increased due to the formation of maltose. Maltose became the major sugar of baked sweet potatoes. Raw sweet potatoes stored at 15 °C had higher total sugar contents after baking than those stored under ambient conditions. Raw sweet potatoes were recommended to be stored at 15 °C before baking.

  18. Lateral Root Development in Potato Is Mediated by Stu-mi164 Regulation of NAC Transcription Factor

    Directory of Open Access Journals (Sweden)

    Li Zhang

    2018-03-01

    Full Text Available The NAC designation is derived from petunia (Petunia hybrida gene NO APICAL MERISTEM (NAM and Arabidopsis genes ATAF1/ATAF2 and CUP-SHAPED COTYLEDON2 (CUC2, which belongs to the family of plant-specific transcription factors (TFs, and plays important role in plant development processes, such as response to biotic and abiotic stress, and hormone signaling. MicroRNAs (miRNAs are a class of small, non-coding endogenous RNAs which play versatile and significant role in plant stress response and development via negatively affecting gene expression at a post-transcriptional level. Here, we showed that Stu-mi164 had a complementary sequence in the CDS sequence of potato NAC TFs, and that NAC expression exhibited significant differences under osmotic stress. We measured expression levels of the Stu-mi164 target gene StNAC262 between control and PEG-treated plants using real-time PCR, and the results demonstrated that they had inverse relationship. We suggested that Stu-miR164 might drive overexpression of NAC gene under osmotic stress in potato. To confirm the regulation of NAC TFs by Stu-mi164, we developed transgenic plants, using Agrobacterium tumefaciens–mediated transformation, of the potato cultivars “Gannongshu 2” and “Kexin 3” overexpressing the Stu-mi164 or the TF StNAC262. Real-time PCR analysis of transgenic potato plants under osmotic (PEG stress, showed that potato plants overexpressing Stu-mi164 had reduced expression of StNAC262 and their osmotic resistance decreased. Furthermore, these plants had low number of lateral roots although the same length as the control. Our findings support the regulatory role of Stu-miRNAs in controlling plant response to osmotic stress via StNAC262.

  19. The potato tuber mitochondrial proteome

    DEFF Research Database (Denmark)

    Møller, Ian Max; Salvato, Fernanda; Havelund, Jesper

    We are testing the hypothesis that oxidized peptides are released from stressed mitochondria and contribute to retrograde signalling (Møller IM & Sweetlove LJ 2010 Trends Plant Sci 15, 370-374). However, there is a large gap between the number of experimentally verified mitochondrial proteins (~450......) and in silico-predicted mitochondrial proteins (2000-3000). Thus, before starting to look for oxidized peptides, we wanted to expand the current compendium of plant mitochondrial proteins while obtaining what could be termed the "baseline proteome" from our model organelle, the potato tuber mitochondrion. Its...

  20. 7 CFR 948.51 - Colorado Potato Committee.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Colorado Potato Committee. 948.51 Section 948.51... Agreements and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE IRISH POTATOES GROWN IN COLORADO Order Regulating Handling Committees § 948.51 Colorado Potato Committee. The Colorado Potato Committee...

  1. Improving seed potato quality in Ethiopia: a value chain perspective

    NARCIS (Netherlands)

    Hirpa, A.; Gielen-Meuwissen, M.P.M.; Lommen, W.J.M.; Oude Lansink, A.G.J.M.; Tsegaye, A.; Struik, Paul

    2016-01-01

    In Ethiopia, use of low-quality seed potatoes by the majority of potato growers is
    associated with underdevelopment of the seed potato value chains. Three seed potato systems are present in Ethiopia: the informal seed system, the alternative seed system and the formal seed system. This chapter

  2. Chitinase activities, scab resistance, mycorrhization rates and biomass of own-rooted and grafted transgenic apple

    Directory of Open Access Journals (Sweden)

    Tina Schäfer

    2012-01-01

    Full Text Available This study investigated the impact of constitutively expressed Trichoderma atroviride genes encoding exochitinase nag70 or endochitinase ech42 in transgenic lines of the apple cultivar Pinova on the symbiosis with arbuscular mycorrhizal fungi (AMF. We compared the exo- and endochitinase activities of leaves and roots from non-transgenic Pinova and the transgenic lines T386 and T389. Local and systemic effects were examined using own-rooted trees and trees grafted onto rootstock M9. Scab susceptibility was also assessed in own-rooted and grafted trees. AMF root colonization was assessed microscopically in the roots of apple trees cultivated in pots with artificial substrate and inoculated with the AMF Glomus intraradices and Glomus mosseae. Own-rooted transgenic lines had significantly higher chitinase activities in their leaves and roots compared to non-transgenic Pinova. Both of the own-rooted transgenic lines showed significantly fewer symptoms of scab infection as well as significantly lower root colonization by AMF. Biomass production was significantly reduced in both own-rooted transgenic lines. Rootstock M9 influenced chitinase activities in the leaves of grafted scions. When grafted onto M9, the leaf chitinase activities of non-transgenic Pinova (M9/Pinova and transgenic lines (M9/T386 and M9/T389 were not as different as when grown on their own roots. M9/T386 and M9/T389 were only temporarily less infected by scab than M9/Pinova. M9/T386 and M9/T389 did not differ significantly from M9/Pinova in their root chitinase activities, AMF root colonization and biomass.

  3. Detection of sweet potato virus C, sweet potato virus 2 and sweet potato feathery mottle virus in Portugal.

    Science.gov (United States)

    Varanda, Carla M R; Santos, Susana J; Oliveira, Mônica D M; Clara, Maria Ivone E; Félix, Maria Rosário F

    2015-06-01

    Field sweet potato plants showing virus-like symptoms, as stunting, leaf distortion, mosaic and chlorosis, were collected in southwest Portugal and tested for the presence of four potyviruses, sweet potato virus C (SPVC), sweet potato virus 2 (SPV2), sweet potato feathery mottle virus (SPFMV), sweet potato virus G (SPVG), and the crinivirus sweet potato chlorotic stunt virus (SPCSV). DsRNA fractions were extracted from symptomatic leaves and used as templates in single and multiplex RT-PCR assays using previously described specific primers for each analyzed virus. The amplified reaction products for SPVC, SPV2 and SPFMV were of expected size, and direct sequencing of PCR products revealed that they correspond to the coat protein gene (CP) and showed 98%, 99% and 99% identity, respectively, to those viruses. Comparison of the CP genomic and amino acid sequences of the Portuguese viral isolates recovered here with those of ten other sequences of isolates obtained in different countries retrieved from the GenBank showed very few differences. The application of the RT-PCR assays revealed for the first time the presence of SPVC and SPFMV in the sweet potato crop in Portugal, the absence of SPVG and SPCSV in tested plants, as well as the occurrence of triple virus infections under field conditions.

  4. Transgene Expression and Repression in Transgenic Rats Bearing the Phosphoenolpyruvate Carboxykinase-Simian Virus 40 T Antigen or the Phosphoenolpyruvate Carboxykinase-Transforming Growth Factor-α Constructs

    Science.gov (United States)

    Haas, Michael J.; Dragan, Yvonne P.; Hikita, Hiroshi; Shimel, Randee; Takimoto, Koichi; Heath, Susan; Vaughan, Jennifer; Pitot, Henry C.

    1999-01-01

    Transgenic Sprague-Dawley rats expressing either human transforming growth factor-α (TGFα) or simian virus 40 large and small T antigen (TAg), each under the control of the phosphoenolpyruvate carboxykinase (PEPCK) promoter, were developed as an approach to the study of the promotion of hepatocarcinogenesis in the presence of a transgene regulatable by diet and/or hormones. Five lines of PEPCK-TGFα transgenic rats were established, each genetic line containing from one to several copies of the transgene per haploid genome. Two PEPCK-TAg transgenic founder rats were obtained, each with multiple copies of the transgene. Expression of the transgene was undetectable in the TGFα transgenic rats and could not be induced when the animals were placed on a high-protein, low-carbohydrate diet. The transgene was found to be highly methylated in all of these lines. No pathological alterations in the liver and intestine were observed at any time (up to 2 years) during the lives of these rats. One line of transgenic rats expressing the PEPCK-TAg transgene developed pancreatic islet cell hyperplasias and carcinomas, with few normal islets evident in the pancreas. This transgene is integrated as a hypomethylated tandem array of 10 to 12 copies on chromosome 8q11. Expression of large T antigen is highest in pancreatic neoplasms, but is also detectable in the normal brain, kidney, and liver. Mortality is most rapid in males, starting at 5 months of age and reaching 100% by 8 months. Morphologically, islet cell differentiation in the tumors ranges from poor to well differentiated, with regions of necrosis and fibrosis. Spontaneous metastasis of TAg-positive tumor cells to regional lymph nodes was observed. These studies indicate the importance of DNA methylation in the repression of specific transgenes in the rat. However, the expression of the PEPCK-TAg induces neoplastic transformation in islet cells, probably late in neuroendocrine cell differentiation. T antigen expression

  5. Detection of Potato Leaf Roll Virus (PLRV), Potato Virus Y (PVY) and Potato Virus X (PVX) on Five Potato Varieties by Using of DAS-ELISA and RT-PCR Methods

    OpenAIRE

    Kuswinanti, Tutik

    2012-01-01

    Potato is a staple food crop that widely grown around the world. Virus infection is main factor that affects great loss of the potato production. Potato virus X(PVX), potato virus Y(PVY),and potato leaf roll virus(PLRV) are top three viruses that result in decreased yield of potato in Indonesia. Therefore, the rapid methods of DAS-ELISA was studied to test tuber samples of five potato varieties, Granola, Atlantik, Raja, Super John, Kalosi, and Masalle. Two simple, rapid, sensitive, reliable...

  6. Microbiological quality of five potato products obtained at retail markets.

    Science.gov (United States)

    Duran, A P; Swartzentruber, A; Lanier, J M; Wentz, B A; Schwab, A H; Barnard, R J; Read, R B

    1982-01-01

    The microbiological quality of frozen hash brown potatoes, dried hash brown potatoes with onions, frozen french fried potatoes, dried instant mashed potatoes, and potato salad was determined by a national sampling at the retail level. A wide range of results was obtained, with most sampling units of each products having excellent microbiological quality. Geometric mean aerobic plate counts were as follows: dried hash brown potatoes, 270/g; frozen hash brown potatoes with onions, 580/g; frozen french fried potatoes 78/g; dried instant mashed potatoes, 1.1 x 10(3)/g; and potato salad, 3.6 x 10(3)/g. Mean values of coliforms, Escherichia coli, and Staphylococcus aureus were less than 10/g. PMID:6758695

  7. Transgene x environment interactions in genetically modified wheat.

    Science.gov (United States)

    Zeller, Simon L; Kalinina, Olena; Brunner, Susanne; Keller, Beat; Schmid, Bernhard

    2010-07-12

    The introduction of transgenes into plants may cause unintended phenotypic effects which could have an impact on the plant itself and the environment. Little is published in the scientific literature about the interrelation of environmental factors and possible unintended effects in genetically modified (GM) plants. We studied transgenic bread wheat Triticum aestivum lines expressing the wheat Pm3b gene against the fungus powdery mildew Blumeria graminis f.sp. tritici. Four independent offspring pairs, each consisting of a GM line and its corresponding non-GM control line, were grown under different soil nutrient conditions and with and without fungicide treatment in the glasshouse. Furthermore, we performed a field experiment with a similar design to validate our glasshouse results. The transgene increased the resistance to powdery mildew in all environments. However, GM plants reacted sensitive to fungicide spraying in the glasshouse. Without fungicide treatment, in the glasshouse GM lines had increased vegetative biomass and seed number and a twofold yield compared with control lines. In the field these results were reversed. Fertilization generally increased GM/control differences in the glasshouse but not in the field. Two of four GM lines showed up to 56% yield reduction and a 40-fold increase of infection with ergot disease Claviceps purpurea compared with their control lines in the field experiment; one GM line was very similar to its control. Our results demonstrate that, depending on the insertion event, a particular transgene can have large effects on the entire phenotype of a plant and that these effects can sometimes be reversed when plants are moved from the glasshouse to the field. However, it remains unclear which mechanisms underlie these effects and how they may affect concepts in molecular plant breeding and plant evolutionary ecology.

  8. Transgene x environment interactions in genetically modified wheat.

    Directory of Open Access Journals (Sweden)

    Simon L Zeller

    Full Text Available BACKGROUND: The introduction of transgenes into plants may cause unintended phenotypic effects which could have an impact on the plant itself and the environment. Little is published in the scientific literature about the interrelation of environmental factors and possible unintended effects in genetically modified (GM plants. METHODS AND FINDINGS: We studied transgenic bread wheat Triticum aestivum lines expressing the wheat Pm3b gene against the fungus powdery mildew Blumeria graminis f.sp. tritici. Four independent offspring pairs, each consisting of a GM line and its corresponding non-GM control line, were grown under different soil nutrient conditions and with and without fungicide treatment in the glasshouse. Furthermore, we performed a field experiment with a similar design to validate our glasshouse results. The transgene increased the resistance to powdery mildew in all environments. However, GM plants reacted sensitive to fungicide spraying in the glasshouse. Without fungicide treatment, in the glasshouse GM lines had increased vegetative biomass and seed number and a twofold yield compared with control lines. In the field these results were reversed. Fertilization generally increased GM/control differences in the glasshouse but not in the field. Two of four GM lines showed up to 56% yield reduction and a 40-fold increase of infection with ergot disease Claviceps purpurea compared with their control lines in the field experiment; one GM line was very similar to its control. CONCLUSIONS: Our results demonstrate that, depending on the insertion event, a particular transgene can have large effects on the entire phenotype of a plant and that these effects can sometimes be reversed when plants are moved from the glasshouse to the field. However, it remains unclear which mechanisms underlie these effects and how they may affect concepts in molecular plant breeding and plant evolutionary ecology.

  9. Regulation, overexpression, and target gene identification of Potato Homeobox 15 (POTH15) – a class-I KNOX gene in potato

    Science.gov (United States)

    Mahajan, Ameya S.; Kondhare, Kirtikumar R.; Rajabhoj, Mohit P.; Kumar, Amit; Ghate, Tejashree; Ravindran, Nevedha; Habib, Farhat; Siddappa, Sundaresha; Banerjee, Anjan K.

    2016-01-01

    Potato Homeobox 15 (POTH15) is a KNOX-I (Knotted1-like homeobox) family gene in potato that is orthologous to Shoot Meristemless (STM) in Arabidopsis. Despite numerous reports on KNOX genes from different species, studies in potato are limited. Here, we describe photoperiodic regulation of POTH15, its overexpression phenotype, and identification of its potential targets in potato (Solanum tuberosum ssp. andigena). qRT-PCR analysis showed a higher abundance of POTH15 mRNA in shoot tips and stolons under tuber-inducing short-day conditions. POTH15 promoter activity was detected in apical and axillary meristems, stolon tips, tuber eyes, and meristems of tuber sprouts, indicating its role in meristem maintenance and leaf development. POTH15 overexpression altered multiple morphological traits including leaf and stem development, leaflet number, and number of nodes and branches. In particular, the rachis of the leaf was completely reduced and leaves appeared as a bouquet of leaflets. Comparative transcriptomic analysis of 35S::GUS and two POTH15 overexpression lines identified more than 6000 differentially expressed genes, including 2014 common genes between the two overexpression lines. Functional analysis of these genes revealed their involvement in responses to hormones, biotic/abiotic stresses, transcription regulation, and signal transduction. qRT-PCR of selected candidate target genes validated their differential expression in both overexpression lines. Out of 200 randomly chosen POTH15 targets, 173 were found to have at least one tandem TGAC core motif, characteristic of KNOX interaction, within 3.0kb in the upstream sequence of the transcription start site. Overall, this study provides insights to the role of POTH15 in controlling diverse developmental processes in potato. PMID:27217546

  10. Transgenics, agroindustry and food sovereignty

    Directory of Open Access Journals (Sweden)

    Xavier Alejandro León Vega

    2014-10-01

    Full Text Available Food sovereignty has been implemented constitutionally in Ecuador; however, many of the actions and policies are designed to benefit the dominant model of food production, based in agroindustry, intensive monocultures, agrochemicals and transgenics. This article reflects upon the role of family farming as a generator of food sovereignty, and secondly the threat to them by agroindustry agriculture based in transgenic. The role played by food aid in the introduction of transgenic in Latin America and other regions of the world is also analyzed.

  11. Post-mortem re-cloning of a transgenic red fluorescent protein dog.

    Science.gov (United States)

    Hong, So Gun; Koo, Ok Jae; Oh, Hyun Ju; Park, Jung Eun; Kim, Minjung; Kim, Geon-A; Park, Eun Jung; Jang, Goo; Lee, Byeong-Chun

    2011-12-01

    Recently, the world's first transgenic dogs were produced by somatic cell nuclear transfer. However, cellular senescence is a major limiting factor for producing more advanced transgenic dogs. To overcome this obstacle, we rejuvenated transgenic cells using a re-cloning technique. Fibroblasts from post-mortem red fluorescent protein (RFP) dog were reconstructed with in vivo matured oocytes and transferred into 10 surrogate dogs. One puppy was produced and confirmed as a re-cloned dog. Although the puppy was lost during birth, we successfully established a rejuvenated fibroblast cell line from this animal. The cell line was found to stably express RFP and is ready for additional genetic modification.

  12. Image recognition on raw and processed potato detection: a review

    Science.gov (United States)

    Qi, Yan-nan; Lü, Cheng-xu; Zhang, Jun-ning; Li, Ya-shuo; Zeng, Zhen; Mao, Wen-hua; Jiang, Han-lu; Yang, Bing-nan

    2018-02-01

    Objective: Chinese potato staple food strategy clearly pointed out the need to improve potato processing, while the bottleneck of this strategy is technology and equipment of selection of appropriate raw and processed potato. The purpose of this paper is to summarize the advanced raw and processed potato detection methods. Method: According to consult research literatures in the field of image recognition based potato quality detection, including the shape, weight, mechanical damage, germination, greening, black heart, scab potato etc., the development and direction of this field were summarized in this paper. Result: In order to obtain whole potato surface information, the hardware was built by the synchronous of image sensor and conveyor belt to achieve multi-angle images of a single potato. Researches on image recognition of potato shape are popular and mature, including qualitative discrimination on abnormal and sound potato, and even round and oval potato, with the recognition accuracy of more than 83%. Weight is an important indicator for potato grading, and the image classification accuracy presents more than 93%. The image recognition of potato mechanical damage focuses on qualitative identification, with the main affecting factors of damage shape and damage time. The image recognition of potato germination usually uses potato surface image and edge germination point. Both of the qualitative and quantitative detection of green potato have been researched, currently scab and blackheart image recognition need to be operated using the stable detection environment or specific device. The image recognition of processed potato mainly focuses on potato chips, slices and fries, etc. Conclusion: image recognition as a food rapid detection tool have been widely researched on the area of raw and processed potato quality analyses, its technique and equipment have the potential for commercialization in short term, to meet to the strategy demand of development potato as

  13. Enhanced leaf photosynthesis as a target to increase grain yield: insights from transgenic rice lines with variable Rieske FeS protein content in the cytochrome b6 /f complex.

    Science.gov (United States)

    Yamori, Wataru; Kondo, Eri; Sugiura, Daisuke; Terashima, Ichiro; Suzuki, Yuji; Makino, Amane

    2016-01-01

    Although photosynthesis is the most important source for biomass and grain yield, a lack of correlation between photosynthesis and plant yield among different genotypes of various crop species has been frequently observed. Such observations contribute to the ongoing debate whether enhancing leaf photosynthesis can improve yield potential. Here, transgenic rice plants that contain variable amounts of the Rieske FeS protein in the cytochrome (cyt) b6 /f complex between 10 and 100% of wild-type levels have been used to investigate the effect of reductions of these proteins on photosynthesis, plant growth and yield. Reductions of the cyt b6 /f complex did not affect the electron transport rates through photosystem I but decreased electron transport rates through photosystem II, leading to concomitant decreases in CO2 assimilation rates. There was a strong control of plant growth and grain yield by the rate of leaf photosynthesis, leading to the conclusion that enhancing photosynthesis at the single-leaf level would be a useful target for improving crop productivity and yield both via conventional breeding and biotechnology. The data here also suggest that changing photosynthetic electron transport rates via manipulation of the cyt b6 /f complex could be a potential target for enhancing photosynthetic capacity in higher plants. © 2015 John Wiley & Sons Ltd.

  14. Transgenic mosquitoes expressing a phospholipase A(2 gene have a fitness advantage when fed Plasmodium falciparum-infected blood.

    Directory of Open Access Journals (Sweden)

    Ryan C Smith

    Full Text Available Genetically modified mosquitoes have been proposed as an alternative strategy to reduce the heavy burden of malaria. In recent years, several proof-of-principle experiments have been performed that validate the idea that mosquitoes can be genetically modified to become refractory to malaria parasite development.We have created two transgenic lines of Anophelesstephensi, a natural vector of Plasmodium falciparum, which constitutively secrete a catalytically inactive phospholipase A2 (mPLA2 into the midgut lumen to interfere with Plasmodium ookinete invasion. Our experiments show that both transgenic lines expressing mPLA2 significantly impair the development of rodent malaria parasites, but only one line impairs the development of human malaria parasites. In addition, when fed on malaria-infected blood, mosquitoes from both transgenic lines are more fecund than non-transgenic mosquitoes. Consistent with these observations, cage experiments with mixed populations of transgenic and non-transgenic mosquitoes show that the percentage of transgenic mosquitoes increases when maintained on Plasmodium-infected blood.Our results suggest that the expression of an anti-Plasmodium effector gene gives transgenic mosquitoes a fitness advantage when fed malaria-infected blood. These findings have important implications for future applications of transgenic mosquito technology in malaria control.

  15. Control of sweet potato virus diseases.

    Science.gov (United States)

    Loebenstein, Gad

    2015-01-01

    Sweet potato (Ipomoea batatas) is ranked seventh in global food crop production and is the third most important root crop after potato and cassava. Sweet potatoes are vegetative propagated from vines, root slips (sprouts), or tubers. Therefore, virus diseases can be a major constrain, reducing yields markedly, often more than 50%. The main viruses worldwide are Sweet potato feathery mottle virus (SPFMV) and Sweet potato chlorotic stunt virus (SPCSV). Effects on yields by SPFMV or SPCSV alone are minor, or but in complex infection by the two or other viruses yield losses of 50%. The orthodox way of controlling viruses in vegetative propagated crops is by supplying the growers with virus-tested planting material. High-yielding plants are tested for freedom of viruses by PCR, serology, and grafting to sweet potato virus indicator plants. After this, meristem tips are taken from those plants that reacted negative. The meristems were grown into plants which were kept under insect-proof conditions and away from other sweet potato material for distribution to farmers after another cycle of reproduction. © 2015 Elsevier Inc. All rights reserved.

  16. Pyramiding of transgenic Pm3 alleles in wheat results in improved powdery mildew resistance in the field.

    Science.gov (United States)

    Koller, Teresa; Brunner, Susanne; Herren, Gerhard; Hurni, Severine; Keller, Beat

    2018-04-01

    The combined effects of enhanced total transgene expression level and allele-specificity combination in transgenic allele-pyramided Pm3 wheat lines result in improved powdery mildew field resistance without negative pleiotropic effects. Allelic Pm3 resistance genes of wheat confer race-specific resistance to powdery mildew (Blumeria graminis f. sp. tritici, Bgt) and encode nucleotide-binding domain, leucine-rich repeat (NLR) receptors. Transgenic wheat lines overexpressing alleles Pm3a, b, c, d, f, and g have previously been generated by transformation of cultivar Bobwhite and tested in field trials, revealing varying degrees of powdery mildew resistance conferred by the transgenes. Here, we tested four transgenic lines each carrying two pyramided Pm3 alleles, which were generated by crossbreeding of lines transformed with single Pm3 alleles. All four allele-pyramided lines showed strongly improved powdery mildew resistance in the field compared to their parental lines. The improved resistance results from the two effects of enhanced total transgene expression levels and allele-specificity combinations. In contrast to leaf segment tests on greenhouse-grown seedlings, no allelic suppression was observed in the field. Plant development and yield scores of the pyramided lines were similar to the mean scores of the corresponding parental lines, and thus, the allele pyramiding did not cause any negative effects. On the contrary, in pyramided line, Pm3b × Pm3f normal plant development was restored compared to the delayed development and reduced seed set of parental line Pm3f. Allele-specific RT qPCR revealed additive transgene expression levels of the two Pm3 alleles in the pyramided lines. A positive correlation between total transgene expression level and powdery mildew field resistance was observed. In summary, allele pyramiding of Pm3 transgenes proved to be successful in enhancing powdery mildew field resistance.

  17. Silencing of vacuolar invertase and asparagine synthetase genes and its impact on acrylamide formation of fried potato products.

    Science.gov (United States)

    Zhu, Xiaobiao; Gong, Huiling; He, Qunyan; Zeng, Zixian; Busse, James S; Jin, Weiwei; Bethke, Paul C; Jiang, Jiming

    2016-02-01

    Acrylamide is produced in a wide variety of carbohydrate-rich foods during high-temperature cooking. Dietary acrylamide is a suspected human carcinogen, and health concerns related to dietary acrylamide have been raised worldwide. French fries and potato chips contribute a significant proportion to the average daily intake of acrylamide, especially in developed countries. One way to mitigate health concerns related to acrylamide is to develop potato cultivars that have reduced contents of the acrylamide precursors asparagine, glucose and fructose in tubers. We generated a large number of silencing lines of potato cultivar Russet Burbank by targeting the vacuolar invertase gene VInv and the asparagine synthetase genes StAS1 and StAS2 with a single RNA interference construct. The transcription levels of these three genes were correlated with reducing sugar (glucose and fructose) and asparagine content in tubers. Fried potato products from the best VInv/StAS1/StAS2-triple silencing lines contained only one-fifteenth of the acrylamide content of the controls. Interestingly, the extent of acrylamide reduction of the best triple silencing lines was similar to that of the best VInv-single silencing lines developed previously from the same potato cultivar Russet Burbank. These results show that an acrylamide mitigation strategy focused on developing potato cultivars with low reducing sugars is likely to be an effective and sufficient approach for minimizing the acrylamide-forming potential of French fry processing potatoes. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  18. Sweet Potato [Ipomoea batatas (L.) Lam].

    Science.gov (United States)

    Song, Guo-qing; Yamaguchi, Ken-ichi

    2006-01-01

    Among the available transformation methods reported on sweet potato, Agrobacterium tumefaciens-mediated transformation is more successful and desirable. Stem explants have shown to be ideal for the transformation of sweet potato because of their ready availability as explants, the simple transformation process, and high-frequency-regeneration via somatic embryogenesis. Under the two-step kanamycin-hygromycin selection method and using the appropriate explants type (stem explants), the efficiency of transformation can be considerably improved in cv. Beniazuma. The high efficiency in the transformation of stem explants suggests that the transformation protocol described in this chapter warrants testing for routine stable transformation of diverse varieties of sweet potato.

  19. Identification of irradiated potatoes by impedance

    International Nuclear Information System (INIS)

    Singh, Rita; Singh, Antaryami; Wadhawan, A.K.

    1997-01-01

    The electrical impedance of potatoes irradiated at 60, 90, 150 and 1000 Gy was measured using various frequencies of alternating current. The impedance of the irradiated potatoes was higher than the unirradiated potatoes particularly in the frequency range of 100 Hz to 10 kHz. The ratio of the impedance at 5 kHz to that at 50 Hz (Z5k/Z50) was found to be the best indicator for detection of radiation treatment. (author). 4 refs., 2 figs

  20. Initiating genomic selection in tetraploid potato

    DEFF Research Database (Denmark)

    Sverrisdóttir, Elsa; Janss, Luc; Byrne, Stephen

    Breeding for more space and resource efficient crops is important to feed the world’s increasing population. Potatoes produce approximately twice the amount of calories per hectare compared to cereals. The traditional “mate and phenotype” breeding approach is costly and time-consuming; however......, the completion of the genome sequence of potato has enabled the application of genomics-assisted breeding technologies. Genomic selection using genome-wide molecular markers is becoming increasingly applicable to crops as the genotyping costs continue to reduce and it is thus an attractive breeding alternative...... selection, can be obtained with good prediction accuracies in tetraploid potato....

  1. Transgene teknikker erstatter problematisk avl

    DEFF Research Database (Denmark)

    Alstrup, Aage Kristian Olsen; Hansen, Axel Kornerup

    2016-01-01

    Dyremodeller har ofte været baseret på avl, der ud fra et alment velfærdsmæssigt synspunkt var problematisk. Transgene teknikker kan ofte forbedre dyrevelfærden ved at erstatte disse traditionelle avlsmetoder.......Dyremodeller har ofte været baseret på avl, der ud fra et alment velfærdsmæssigt synspunkt var problematisk. Transgene teknikker kan ofte forbedre dyrevelfærden ved at erstatte disse traditionelle avlsmetoder....

  2. Development of transgenic wheat (Triticum aestivum L.) expressing avidin gene conferring resistance to stored product insects.

    Science.gov (United States)

    Abouseadaa, Heba H; Osman, Gamal H; Ramadan, Ahmed M; Hassanein, Sameh E; Abdelsattar, Mohamed T; Morsy, Yasser B; Alameldin, Hussien F; El-Ghareeb, Doaa K; Nour-Eldin, Hanan A; Salem, Reda; Gad, Adel A; Elkhodary, Soheir E; Shehata, Maher M; Mahfouz, Hala M; Eissa, Hala F; Bahieldin, Ahmed

    2015-07-22

    Wheat is considered the most important cereal crop all over the world. The wheat weevil Sitophilus granarius is a serious insect pests in much of the wheat growing area worldwide and is responsible for significant loss of yield. Avidin proteins has been proposed to function as plant defense agents against insect pests. A synthetic avidin gene was introduced into spring wheat (Triticum aestivum L.) cv. Giza 168 using a biolistic bombardment protocol. The presence and expression of the transgene in six selected T0 transgenic wheat lines were confirmed at the molecular level. Accumulation of avidin protein was detected in transgenic plants compared to non-transgenic plants. Avidin transgene was stably integrated, transcribed and translated as indicated by Southern blot, ELISA, and dot blot analyses, with a high level of expression in transgenic wheat seeds. However, no expression was detected in untransformed wheat seeds. Functional integrity of avidin was confirmed by insect bioassay. The results of bioassay using transgenic wheat plants challenged with wheat weevil revealed 100 % mortality of the insects reared on transgenic plants after 21 days. Transgenic wheat plants had improved resistance to Sitophilus granarius.

  3. Detailed characterization of Mirafiori lettuce virus-resistant transgenic lettuce.

    Science.gov (United States)

    Kawazu, Yoichi; Fujiyama, Ryoi; Noguchi, Yuji; Kubota, Masaharu; Ito, Hidekazu; Fukuoka, Hiroyuki

    2010-04-01

    Lettuce big-vein disease is caused by Mirafiori lettuce virus (MiLV), which is vectored by the soil-borne fungus Olpidium brassicae. A MiLV-resistant transgenic lettuce line was developed through introducing inverted repeats of the MiLV coat protein (CP) gene. Here, a detailed characterization study of this lettuce line was conducted by comparing it with the parental, non-transformed 'Kaiser' cultivar. There were no significant differences between transgenic and non-transgenic lettuce in terms of pollen fertility, pollen dispersal, seed production, seed dispersal, dormancy, germination, growth of seedlings under low or high temperature, chromatographic patterns of leaf extracts, or effects of lettuce on the growth of broccoli or soil microflora. A significant difference in pollen size was noted, but the difference was small. The length of the cotyledons of the transgenic lettuce was shorter than that of 'Kaiser,' but there were no differences in other morphological characteristics. Agrobacterium tumefaciens used for the production of transgenic lettuce was not detected in transgenic seeds. The transgenic T(3), T(4), and T(5) generations showed higher resistance to MiLV and big-vein symptoms expression than the resistant 'Pacific' cultivar, indicating that high resistance to lettuce big-vein disease is stably inherited. PCR analysis showed that segregation of the CP gene was nearly 3:1 in the T(1) and T(2) generations, and that the transgenic T(3) generation was homozygous for the CP gene. Segregation of the neomycin phosphotransferase II (npt II) gene was about 3:1 in the T(1) generation, but the full length npt II gene was not detected in the T(2) or T(3) generation. The segregation pattern of the CP and npt II genes in the T(1) generation showed the expected 9:3:3:1 ratio. These results suggest that the fragment including the CP gene and that including the npt II gene have been integrated into two unlinked loci, and that the T(1) plant selected in our study did

  4. Participatory assessment of potato production constraints and trait preferences in potato cultivar development in Rwanda

    Directory of Open Access Journals (Sweden)

    Jean Baptiste Muhinyuza

    2012-09-01

    Full Text Available Potato (Solanum tuberosum L. is the major food and cash crop in the highland regions of Rwanda. However, farmers are not integrated into the potato breeding process. The objectives of this research were to identify farmers’ key potato production constraints and establish preferred traits in potato cultivar development in Rwanda. A participatory rural appraisal (PRA study was conducted through structured survey involving 144 households and 22 focus groups with 258 participants in Musanze, Gicumbi and Nyamagabe districts. The structured survey used a questionnaire administered to farmers to collect information on importance of potatoes and other main crops. While focus groups discussions used matrix scoring of key production constraints and pair-wise ranking of traits. Potato is the most important food and cash crop, followed by maize, beans and wheat. The dominant potato varieties are Kirundo, Cruza, Mabondo and Victoria. The most important potato production constraints are lack of access to credit, lack of high yielding cultivars, insufficient clean seeds and late blight disease. Variety Mabondo is the most tolerant to late blight, followed by Cruza, Kirundo, Kinigi and Rutuku in all the districts. High yield, disease tolerance and high dry matter content are the most important attributes preferred by farmers. Active farmer participation in early breeding stages is critical for a successful potato breeding programme.

  5. Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

    Science.gov (United States)

    Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

    2000-06-01

    Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.

  6. Identification of Secretory Odontoblasts Using DMP1-GFP Transgenic Mice

    Science.gov (United States)

    Balic, Anamaria; Mina, Mina

    2011-01-01

    Terminal differentiation of odontoblasts from dental papilla is a long process involving several intermediate steps and changes in the transcriptional profile and expression of proteins secreted by cells in the odontoblast lineage. Transgenic mouse lines in which GFP expression is under the control of tissue-and stage specific promoters have provided powerful experimental tools for identification and isolation of cells at specific stages of differentiation along a lineage. Our previous studies showed utilization of pOBCol3.6GFP and pOBCol2.3GFP animals for identification of odontoblasts at early and late stages of polarization respectively. In the present study we used the DMP1-GFP transgenic animal as an experimental model to examine its expression during the differentiation of odontoblasts from progenitor cells in vivo and in vitro. Our observations showed that DMP1-GFP transgene is first activated in secretory/functional odontoblasts engaged in secretion of predentin and then transiently expressed at high levels in newly differentiated odontoblasts. Expression of DMP1-GFP was down-regulated in highly differentiated odontoblasts. The temporal and spatial pattern of expression of DMP1-GFP transgene closely mimics the expression of endogenous DMP1. This transgenic animal will facilitate studies of gene expression and biological functions in secretory/functional odontoblasts. PMID:21172466

  7. Heart-specific expression of laminopathic mutations in transgenic zebrafish.

    Science.gov (United States)

    Verma, Ajay D; Parnaik, Veena K

    2017-07-01

    Lamins are key determinants of nuclear organization and function in the metazoan nucleus. Mutations in human lamin A cause a spectrum of genetic diseases that affect cardiac muscle and skeletal muscle as well as other tissues. A few laminopathies have been modeled using the mouse. As zebrafish is a well established model for the study of cardiac development and disease, we have investigated the effects of heart-specific lamin A mutations in transgenic zebrafish. We have developed transgenic lines of zebrafish expressing conserved lamin A mutations that cause cardiac dysfunction in humans. Expression of zlamin A mutations Q291P and M368K in the heart was driven by the zebrafish cardiac troponin T2 promoter. Homozygous mutant embryos displayed nuclear abnormalities in cardiomyocyte nuclei. Expression analysis showed the upregulation of genes involved in heart regeneration in transgenic mutant embryos and a cell proliferation marker was increased in adult heart tissue. At the physiological level, there was deviation of up to 20% from normal heart rate in transgenic embryos expressing mutant lamins. Adult homozygous zebrafish were fertile and did not show signs of early mortality. Our results suggest that transgenic zebrafish models of heart-specific laminopathies show cardiac regeneration and moderate deviations in heart rate during embryonic development. © 2017 International Federation for Cell Biology.

  8. Reduction of the plastidial phosphorylase in potato (Solanum tuberosum L.) reveals impact on storage starch structure during growth at low temperature.

    Science.gov (United States)

    Orawetz, Tom; Malinova, Irina; Orzechowski, Slawomir; Fettke, Joerg

    2016-03-01

    Tubers of potato (Solanum tuberosum L.), one of the most important crops, are a prominent example for an efficient production of storage starch. Nevertheless, the synthesis of this storage starch is not completely understood. The plastidial phosphorylase (Pho1; EC 2.4.1.1) catalyzes the reversible transfer of glucosyl residues from glucose-1-phosphate to the non-reducing end of α-glucans with the release of orthophosphate. Thus, the enzyme is in principle able to act during starch synthesis. However, so far under normal growth conditions no alterations in tuber starch metabolism were observed. Based on analyses of other species and also from in vitro experiments with potato tuber slices it was supposed, that Pho1 has a stronger impact on starch metabolism, when plants grow under low temperature conditions. Therefore, we analyzed the starch content, granule size, as well as the internal structure of starch granules isolated from potato plants grown under low temperatures. Besides wild type, transgenic potato plants with a strong reduction in the Pho1 activity were analyzed. No significant alterations in starch content and granule size were detected. In contrast, when plants were cultivated at low temperatures the chain length distributions of the starch granules were altered. Thus, the granules contained more short glucan chains. That was not observed in the transgenic plants, revealing that Pho1 in wild type is involved in the formation of the short glucan chains, at least at low temperatures. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  9. A wheat calreticulin gene (TaCRT1) contributes to drought tolerance in transgenic arabidopsis

    International Nuclear Information System (INIS)

    Xiang, V.; Du, C.; Jia, H.; Song, M.; Wang, Y.; Ma, Z.

    2018-01-01

    The TaCRT1 gene is a member of calreticulin (CRT) family in wheat. In our previous study, we showed that transgenic tobacco lines over expressing wheat TaCRT1 showed enhanced tolerance to salt stress. This study aimed to determine whether TaCRT1 over expression would increase drought tolerance in transgenic Arabidopsis. Over expression of TaCRT1 in Arabidopsis plants enhances tolerance to drought stress. However, the transgenic line was found to retard the growth. Moreover, the transgenic line showed decreased water loss but higher sensitivity to exogenous abscisic acid (ABA) compared with the wild type (Col-0). Meanwhile, the transgenic line had the elevated endogenous ABA level. The semi-quantitative RT-PCR (sqRT-PCR) analysis showed that transcription levels of ABA-biosynthesizing gene (NCED3) and ABA-responsive gene (ABF3) were higher in the transgenic line than that in the Col-0 under normal condition. The above results implied that the TaCRT1 might be able to used as a potential target to improve the drought tolerance in crops. (author)

  10. Production of Bioethanol from Waste Potato

    Directory of Open Access Journals (Sweden)

    Merve Duruyurek

    2015-02-01

    Full Text Available Using primary energy sources in World as fossil fuels, causes air pollution and climate change. Because of these reasons, people looking for renewable energy suppliers which has less carbondioxide and less pollution. Carbon in biofuels is producing from photosynthesis. For this, burning biofuels don’t increase carbondioxide in atmosphere. Scientists predict that plants with high carbonhydrate and protein contents are 21. centuries biofuels. Potatoes are producing over 280 million in whole world and Turkey is 6th potato producer. Turkey produces 5250000 tonne of potatoes. Approximately 20% of potatoes are waste in Niğde. Our study aimed to produce bioethanol from Solanum tuberosum by using the yeast Saccharomyces cerevisiae. As a result renewable energy sources can be produced from natural wastes.

  11. Cooking Potatoes: Experimentation and Mathematical Modeling.

    Science.gov (United States)

    Chen, Xiao Dong

    2002-01-01

    Describes a laboratory activity involving a mathematical model of cooking potatoes that can be solved analytically. Highlights the microstructure aspects of the experiment. Provides the key aspects of the results, detailed background readings, laboratory procedures and data analyses. (MM)

  12. physiological mechanisms for potato dormancy release

    African Journals Online (AJOL)

    ACSS

    of deep dormancy, during which potato seeds do not germinate after ... dormancy period and sprouting behaviour are major criteria ... develop once sprouting begins; such as changes ...... an example of plant information processing. Plant Cell ...

  13. Analysis of Seed Potato Systems in Ethiopia

    NARCIS (Netherlands)

    Hirpa, A.; Meuwissen, M.P.M.; Tesfaye, A.; Lommen, W.J.M.; Oude Lansink, A.G.J.M.; Tsegaye, A.; Struik, P.C.

    2010-01-01

    This study aimed to analyze the seed potato systems in Ethiopia, identify constraints and prioritize improvement options, combining desk research, rapid appraisal and formal surveys, expert elicitation, field observations and local knowledge. In Ethiopia, informal, alternative and formal seed

  14. Heat toxicant contaminant mitigation in potato chips

    DEFF Research Database (Denmark)

    Mariotti, Maria; Cortes, Pablo; Fromberg, Arvid

    2015-01-01

    Heating foods immersed in oil during frying provides many attractive sensorial attributes including taste, flavor and color. However, some toxic compounds formed during frying of potatoes such as furan and acrylamide may constitute an increased cancer risk for consumers. The objective of this work...... was to mitigate the furan and acrylamide formation in potato chips without increasing their oil uptake by optimizing the blanching treatment before final frying. Potato slices were blanched in order to simultaneously leach out ascorbic acid and reducing sugars, the most important precursors of furan...... and acrylamide generation in thermally treated starchy foods. A central composite design was implemented to optimize the temperature-time blanching conditions under which furan, acrylamide and oil content in potato chips were minimized. The optimum blanching conditions were 64 degrees C and 17 min in which...

  15. High blood pressure in transgenic mice carrying the rat angiotensinogen gene.

    Science.gov (United States)

    Kimura, S; Mullins, J J; Bunnemann, B; Metzger, R; Hilgenfeldt, U; Zimmermann, F; Jacob, H; Fuxe, K; Ganten, D; Kaling, M

    1992-01-01

    Transgenic mice were generated by injecting the entire rat angiotensinogen gene into the germline of NMRI mice. The resulting transgenic animals were characterized with respect to hemodynamics, parameters of the renin angiotension system, and expression of the transgene. The transgenic line TGM(rAOGEN)123 developed hypertension with a mean arterial blood pressure of 158 mmHg in males and 132 mmHg in females. In contrast, the transgenic line TGM(rAOGEN)92 was not hypertensive. Rat angiotensinogen was detectable only in plasma of animals of line 123. Total plasma angiotensinogen and plasma angiotensin II concentrations were about three times as high as those of negative control mice. In TGM(rAOGEN)123 the transgene was highly expressed in liver and brain. Transcripts were also detected in heart, kidney and testis. In TGM(rAOGEN)92 the brain was the main expressing organ. In situ hybridization revealed an mRNA distribution in the brain of TGM(rAOGEN)123 similar to the one in rat. In TGM(rAOGEN)92 the expression pattern in the brain was aberrant. These data indicate that overexpression of the angiotensinogen gene in liver and brain leads to the development of hypertension in transgenic mice. The TGM(rAOGEN)123 constitutes a high angiotensin II type of hypertension and may provide a new experimental animal model to study the kinetics and function of the renin angiotensin system. Images PMID:1547785

  16. Initial infection of roots and leaves reveals different resistance phenotypes associated with coat protein gene-mediated resistance to Potato mop-top virus.

    Science.gov (United States)

    Germundsson, Anna; Sandgren, Maria; Barker, Hugh; Savenkov, Eugene I; Valkonen, Jari P T

    2002-05-01

    Resistance to the pomovirus Potato mop-top virus (PMTV) was studied in potato (Solanum tuberosum cv. Saturna) and Nicotiana benthamiana transformed with the coat protein (CP) gene of PMTV. The incidence of PMTV infections was reduced in tubers of the CP-transgenic potatoes grown in the field in soil infested with the viruliferous vector, Spongospora subterranea. However, in those tubers that were infected, all three virus RNAs were detected and virus titres were high. The CP-transgenic N. benthamiana plants were inoculated with PMTV using two methods. Following mechanical inoculation of leaves, no RNA 3 (the CP-encoding RNA homologous to the transgene) was detected in leaves, but in some plants low amounts of RNA 3 were detected in roots; RNA 2 was readily detected in leaves and roots of several plants. Inoculation of roots using viruliferous S. subterranea resulted in infection of roots in all plants and the three PMTV RNAs were detected. However, no systemic movement of PMTV from roots to the above-ground parts was observed, indicating a novel expression of resistance. These data indicate that the CP gene-mediated resistance to PMTV specifically restricts accumulation of PMTV RNA 3, and is more effective in leaves than roots. Furthermore, expression of resistance is different depending on whether leaves or roots are inoculated. Data do not exclude the possibility that both a protein-mediated and an RNA-mediated resistance mechanism are involved.

  17. Radiation sterilization of potato starch and Sedonik

    International Nuclear Information System (INIS)

    Tashmetov, M.Yu.; Ismatov, N.B.; Saidov, R.P. et al.

    2016-01-01

    The raw material of pharmaceutical preparations potato starch and sedative means of Sedonik are sterilized at the electron's accelerator Electronics U-003. It is established that at 20.3 kGy absorbed dose and electron's energy 3 - 5 MeV the results of microbiological analysis showed sterility of potato starch and Sedonik and correspondence of their physical-optical properties to the requirements of normative documents. (authors)

  18. Global field experiments for potato simulations

    DEFF Research Database (Denmark)

    Raymundo, Rubí; Asseng, Senthold; Prasad, Rishi

    2018-01-01

    A large field potato experimental dataset has been assembled for simulation modeling. The data are from temperate, subtropical, and tropical regions across the world and include 87 experiments with 204 treatments. Treatments include nitrogen fertilizer, irrigation, atmospheric CO2 levels, tempera......A large field potato experimental dataset has been assembled for simulation modeling. The data are from temperate, subtropical, and tropical regions across the world and include 87 experiments with 204 treatments. Treatments include nitrogen fertilizer, irrigation, atmospheric CO2 levels...

  19. Effect of potato used as a trap crop on potato cyst nematodes and other soil pathogens and on the growth of a subsequent main potato crop

    NARCIS (Netherlands)

    Scholte, K.

    2000-01-01

    A field experiment in which main-crop potatoes were grown every other year was conducted on a sandy soil from 1994 to 1999. The aim of the experiment was to control soil-borne pathogens of potato with ecologically sound methods. Potato grown as a trap crop from the end of April to the end of June (8

  20. Application of gamma irradiation for storage potato

    International Nuclear Information System (INIS)

    Rezaee, M.; Almasi, M.

    2009-01-01

    Since deficiency of controlled store in Iran and environmental problems of chemical material the use of gamma irradiation to control sprouting and increase the length of storage time of potatoes has been proposed as an alternative to cold storage or the use of chemical sprout suppressants. In this study potatoes of Agria Variety were irradiated at a dose of 0.10 KGY and stored along with the unirradiated controls at 12±3°C for a period of more than 6 month from October to April .After 4 month of storage the sprouting ranged from 5 to 12% in irradiated potatoes and 45 to 74% in unirradiated samples and after 6 month the unirradiated potatoes were discarded because of heavy sprouting and rotting. The rot attack was approximately double in unirradiated samples. It was found that losses through dehydration were 10.3 to 15.1 % in the irradiated potatoes. Also a comparative study of reducing and non-reducing sugars, vitamin-C content, total sugar, starch and protein was carried out between unirradiated and irradiated samples. The results suggested the efficacy of Gamma irradiation for ensuring availability of the storing quality of potato during lean periods from October to April. (author)

  1. Excision of Nucleopolyhedrovirus Form Transgenic Silkworm Using the CRISPR/Cas9 System

    Directory of Open Access Journals (Sweden)

    Zhanqi Dong

    2018-02-01

    Full Text Available The CRISPR/Cas9-mediated genome engineering has been shown to efficiently suppress infection by disrupting genes of the pathogen. We recently constructed transgenic lines expressing CRISPR/Cas9 and the double sgRNA target Bombyx mori nucleopolyhedrovirus (BmNPV immediate early-1 (ie-1 gene in the silkworm, respectively, and obtained four transgenic hybrid lines by G1 generation hybridization: Cas9(-/sgRNA(-, Cas9(+/sgRNA(-, Cas9(-/sgRNA(+, and Cas9(+/sgRNA(+. We demonstrated that the Cas9(+/sgRNA(+ transgenic lines effectively edited the target site of the BmNPV genome, and large fragment deletion was observed after BmNPV infection. Further antiviral analysis of the Cas9(+/sgRNA(+ transgenic lines shows that the median lethal dose (LD50 is 1,000-fold higher than the normal lines after inoculation with occlusion bodies. The analysis of economic characters and off-target efficiency of Cas9(+/sgRNA(+ transgenic hybrid line showed no significant difference compared with the normal lines. Our findings indicate that CRISPR/Cas9-mediated genome engineering more effectively targets the BmNPV genomes and could be utilized as an insect antiviral treatment.

  2. Excision of Nucleopolyhedrovirus Form Transgenic Silkworm Using the CRISPR/Cas9 System.

    Science.gov (United States)

    Dong, Zhanqi; Dong, Feifan; Yu, Xinbo; Huang, Liang; Jiang, Yaming; Hu, Zhigang; Chen, Peng; Lu, Cheng; Pan, Minhui

    2018-01-01

    The CRISPR/Cas9-mediated genome engineering has been shown to efficiently suppress infection by disrupting genes of the pathogen. We recently constructed transgenic lines expressing CRISPR/Cas9 and the double sgRNA target Bombyx mori nucleopolyhedrovirus (BmNPV) immediate early-1 ( ie-1 ) gene in the silkworm, respectively, and obtained four transgenic hybrid lines by G1 generation hybridization: Cas9(-)/sgRNA(-), Cas9(+)/sgRNA(-), Cas9(-)/sgRNA(+), and Cas9(+)/sgRNA(+). We demonstrated that the Cas9(+)/sgRNA(+) transgenic lines effectively edited the target site of the BmNPV genome, and large fragment deletion was observed after BmNPV infection. Further antiviral analysis of the Cas9(+)/sgRNA(+) transgenic lines shows that the median lethal dose (LD50) is 1,000-fold higher than the normal lines after inoculation with occlusion bodies. The analysis of economic characters and off-target efficiency of Cas9(+)/sgRNA(+) transgenic hybrid line showed no significant difference compared with the normal lines. Our findings indicate that CRISPR/Cas9-mediated genome engineering more effectively targets the BmNPV genomes and could be utilized as an insect antiviral treatment.

  3. Influence of γ-irradiation on drying of slice potato

    International Nuclear Information System (INIS)

    Wang Jun; Chao Yan; Fu Junjie; Wang Jianping

    2001-01-01

    A new technology is introduced to dry food products by hot-air after pretreated by irradiation. The influence of different dosage of irradiation, temperature of hot air, thickness of the slice potato on the rate of dehydration temperature of irradiated potato were studied. A conclusion is reached that the 3 factors, irradiation dosage, hot-air temperature and thickness of slice potato, affect the rate of dehydration and temperature of slice potato. The higher the dosage is, the greater the rate of dehydration of potato becomes, and the higher the temperature of the slice potato gets. (authors)

  4. Tolerance of some Potato Mutants Induced with Gamma Irradiation to Drought in Vitro

    International Nuclear Information System (INIS)

    Al-Safadi, B.; Al-Ayyoubi, Z.

    2007-01-01

    An in vitro selection program was conducted in order to improve potato (Solanum tuberosum,L.) tolerance to drought. Potato mutant plants were obtained through a previously conducted mutation breeding program on three potato cultivars (Draga, Spunta, and Diamant) aimed to improve potato tolerance to salinity and resistance to late blight disease. In order to apply selection pressure, growth media (MS based) were prepared with the addition of 1%, 2%, 3% concentrations of Poly Ethylene Glycol (PEG). As a result, three mutants were selected that were tolerant to water stress (i.e. drought tolerant), two of them were derived from the cultivar Draga and one came from Spunta. Physiological growth parameters (plant length, leaf number, branch number, roots number, leaf area, stomata number, and chlorophyll concentration content) were determined on the growing plantlets. The selected mutants were distinguished based on some characteristics which being associated with in their tolerance to drought. Such as an increases in leaf number, root number, and a decrease in stomata number. However a reduction in chlorophyll content was observed as compared with the control. This is considered a negative parameter which may result in a decrease in number and size of tubers. Thus it is important to continue selection for higher chlorophyll content. Also, these mutant lines will need further selection in the field for plants with larger tubers before they can be considered as certified lines.

  5. Tolerance of some potato mutants induced with gamma irradiation to drought in vitro

    International Nuclear Information System (INIS)

    Al-Safadi, B.; Ayyoubi, Z.

    2006-04-01

    An in vitro selection program was conducted in order to improve potato (Solanum tuberosum) tolerance to drought. Potato mutant plants were obtained through a previously conducted mutation breeding program on three potato cultivars (Draga, Spunta, and Diamant) aimed at improving potato tolerance to salinity and resistance to late blight disease. In order to apply selection pressure, growth media (MS based) were prepared with the addition of 1%, 2%, 3% concentrations of Poly Ethylene Glycol (PEG). As a result, three mutants were selected that were tolerant to water stress (i.e. drought tolerant) two of which came from the cultivar Draga and one from Spunta. Physiological growth parameters (plant length, leaf number, branch number, roots number, leaf area, stomata number, and chlorophyll concentration content) were taken on the growing plantlets. The selected mutants were distinguished with some characteristics which can help in their tolerance to drought. Some of these characteristics were an increase in leaf number, root number, and a decrease in stomata number. However a reduction in chlorophyll content was observed as compared with the control. These mutant lines will need further selection in the field for plants with larger tubers before they can be considered as certified lines. (author)

  6. Potato crop growth as influenced by potato cyst nematodes (Globodera pallida) and abiotic factors

    NARCIS (Netherlands)

    Ruijter, de F.

    1998-01-01

    The objective of the research described in this thesis was to determine the major mechanisms by which potato cyst nematodes reduce potato crop growth and to explain interactions known to occur with cultivar and abiotic factors. Understanding of these interactions may lead to strategies that

  7. Localization of potato leafroll virus in leaves of secondarily-infected potato plants

    NARCIS (Netherlands)

    Heuvel, van den J.F.J.M.; Blank, de C.M.; Peters, D.; Lent, van J.W.M.

    1995-01-01

    Potato leafroll virus (PLRV) antigen was localized by immunogold labelling in semi-thin leaf sections of secondarily-infected potato plants cv. Bintje. Viral antigen was present in all cell types of the phloem tissue. but occurred most abundantly in the companion cells. Detectable amounts of PLRV

  8. Substituent distribution within cross-linked and hydroxypropylated sweet potato starch and potato starch

    NARCIS (Netherlands)

    Zhao, J.; Schols, H.A.; Chen Zenghong,; Jin Zhengyu,; Buwalda, P.L.; Gruppen, H.

    2012-01-01

    Revealing the substituents distribution within starch can help to understand the changes of starch properties after modification. The distribution of substituents over cross-linked and hydroxypropylated sweet potato starch was investigated and compared with modified potato starch. The starches were

  9. Symptom expression of Potato virus Y across all market classes of U.S. potato varieties

    Science.gov (United States)

    Potato virus Y (PVY) can cause a range of foliar and tuber symptoms that can lead to reduced yield and quality defects in the daughter tubers. Five strains of PVY were used to inoculate 70 potato varieties in aphid screened greenhouses in Idaho and New York. Three to five isolates per strain were ...

  10. Infection of potato plants with potato leafroll virus changes attraction and feeding behaviour of Myzus persicae

    NARCIS (Netherlands)

    Alvarez, A.E.; Garzo, E.; Verbeek, M.; Vosman, B.; Dicke, M.; Tjallingii, W.F.

    2007-01-01

    Potato leafroll virus (PLRV; genus Polerovirus, family Luteoviridae) is a persistently transmitted circulative virus that depends on aphids for spreading. The primary vector of PLRV is the aphid Myzus persicae (Sulzer) (Homoptera: Aphididae). Solanum tuberosum L. potato cv. Kardal (Solanaceae) has a

  11. The Relationship between Insect Resistance and Tree Age of Transgenic Triploid Populus tomentosa Plants.

    Science.gov (United States)

    Ren, Yachao; Zhang, Jun; Wang, Guiying; Liu, Xiaojie; Li, Li; Wang, Jinmao; Yang, Minsheng

    2018-01-01

    To explore the stability of insect resistance during the development of transgenic insect-resistant trees, this study investigated how insect resistance changes as transgenic trees age. We selected 19 transgenic insect-resistant triploid Populus tomentosa lines as plant material. The presence of exogenous genes and Cry1Ac protein expression were verified using polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA) analyses. The toxicity for Clostera anachoreta and Lymantria dispar was evaluated by feeding fresh leaves to first instar larvae after the trees were planted in the field for 2 years and after the sixth year. Results of PCR showed that the exogenous genes had a long-term presence in the poplar genome. ELISA analyses showed significant differences existed on the 6-year-old transgenic lines. The insect-feeding experiment demonstrated significant differences in the mortality rates of C. anachoreta and L. dispar among different transgenic lines. The average corrected mortality rates of C. anachoreta and L. dispar ranged from 5.6-98.7% to 35.4-7.2% respectively. The larval mortality rates differed significantly between the lines at different ages. Up to 52.6% of 1-year-old transgenic lines and 42.1% of 2-year-old transgenic lines caused C. anachoreta larval mortality rates to exceed 80%, whereas only 26.3% of the 6-year-old transgenic lines. The mortality rates of L. dispar exhibited the same trend: 89.5% of 1-year-old transgenic lines and 84.2% of 2-year-old transgenic lines caused L. dispar larval mortality rates to exceed 80%; this number decreased to 63.2% for the 6-year-old plants. The proportion of 6-year-old trees with over 80% larval mortality rates was clearly lower than that of the younger trees. The death distribution of C. anachoreta in different developmental stages also showed the larvae that fed on the leaves of 1-year-old trees were killed mostly during L 1 and L 2 stages, whereas the proportion of larvae that died in L 3

  12. [Biofuels, food security and transgenic crops].

    Science.gov (United States)

    Acosta, Orlando; Chaparro-Giraldo, Alejandro

    2009-01-01

    Soaring global food prices are threatening to push more poor people back below the poverty line; this will probably become aggravated by the serious challenge that increasing population and climate changes are posing for food security. There is growing evidence that human activities involving fossil fuel consumption and land use are contributing to greenhouse gas emissions and consequently changing the climate worldwide. The finite nature of fossil fuel reserves is causing concern about energy security and there is a growing interest in the use of renewable energy sources such as biofuels. There is growing concern regarding the fact that biofuels are currently produced from food crops, thereby leading to an undesirable competition for their use as food and feed. Nevertheless, biofuels can be produced from other feedstocks such as lingo-cellulose from perennial grasses, forestry and vegetable waste. Biofuel energy content should not be exceeded by that of the fossil fuel invested in its production to ensure that it is energetically sustainable; however, biofuels must also be economically competitive and environmentally acceptable. Climate change and biofuels are challenging FAO efforts aimed at eradicating hunger worldwide by the next decade. Given that current crops used in biofuel production have not been domesticated for this purpose, transgenic technology can offer an enormous contribution towards improving biofuel crops' environmental and economic performance. The present paper critically presents some relevant relationships between biofuels, food security and transgenic plant technology.

  13. Increased yield of heterologous viral glycoprotein in the seeds of homozygous transgenic tobacco plants cultivated underground.

    Science.gov (United States)

    Tackaberry, Eilleen S; Prior, Fiona; Bell, Margaret; Tocchi, Monika; Porter, Suzanne; Mehic, Jelica; Ganz, Peter R; Sardana, Ravinder; Altosaar, Illimar; Dudani, Anil

    2003-06-01

    The use of transgenic plants in the production of recombinant proteins for human therapy, including subunit vaccines, is being investigated to evaluate the efficacy and safety of these emerging biopharmaceutical products. We have previously shown that synthesis of recombinant glycoprotein B (gB) of human cytomegalovirus can be targeted to seeds of transgenic tobacco when directed by the rice glutelin 3 promoter, with gB retaining critical features of immunological reactivity (E.S. Tackaberry et al. 1999. Vaccine, 17: 3020-3029). Here, we report development of second generation transgenic plant lines (T1) homozygous for the transgene. Twenty progeny plants from two lines (A23T(1)-2 and A24T(1)-3) were grown underground in an environmentally contained mine shaft. Based on yields of gB in their seeds, the A23T(1)-2 line was then selected for scale-up in the same facility. Analyses of mature seeds by ELISA showedthat gB specific activity in A23T(1)-2 seeds was over 30-fold greater than the best T0 plants from the same transformation series, representing 1.07% total seed protein. These data demonstrate stable inheritance, an absence of transgene inactivation, and enhanced levels of gB expression in a homozygous second generation plant line. They also provide evidence for the suitability of using this environmentally secure facility to grow transgenic plants producing therapeutic biopharmaceuticals.

  14. PDH45 overexpressing transgenic tobacco and rice plants provide salinity stress tolerance via less sodium accumulation.

    Science.gov (United States)

    Nath, Manoj; Garg, Bharti; Sahoo, Ranjan Kumar; Tuteja, Narendra

    2015-01-01

    Salinity stress negatively affects the crop productivity worldwide, including that of rice. Coping with these losses is a major concern for all countries. The pea DNA helicase, PDH45 is a unique member of helicase family involved in the salinity stress tolerance. However, the exact mechanism of the PDH45 in salinity stress tolerance is yet to be established. Therefore, the present study was conducted to investigate the mechanism of PDH45-mediated salinity stress tolerance in transgenic tobacco and rice lines along with wild type (WT) plants using CoroNa Green dye based sodium localization in root and shoot sections. The results showed that under salinity stress root and shoot of PDH45 overexpressing transgenic tobacco and rice accumulated less sodium (Na(+)) as compared to their respective WT. The present study also reports salinity tolerant (FL478) and salinity susceptible (Pusa-44) varieties of rice accumulated lowest and highest Na(+) level, respectively. All the varieties and transgenic lines of rice accumulate differential Na(+) ions in root and shoot. However, roots accumulate high Na(+) as compared to the shoots in both tobacco and rice transgenic lines suggesting that the Na(+) transport in shoot is somehow inhibited. It is proposed that the PDH45 is probably involved in the deposition of apoplastic hydrophobic barriers and consequently inhibit Na(+) transport to shoot and therefore confers salinity stress tolerance to PDH45 overexpressing transgenic lines. This study concludes that tobacco (dicot) and rice (monocot) transgenic plants probably share common salinity tolerance mechanism mediated by PDH45 gene.

  15. Constitutive expression of a fungus-inducible carboxylesterase improves disease resistance in transgenic pepper plants.

    Science.gov (United States)

    Ko, Moonkyung; Cho, Jung Hyun; Seo, Hyo-Hyoun; Lee, Hyun-Hwa; Kang, Ha-Young; Nguyen, Thai Son; Soh, Hyun Cheol; Kim, Young Soon; Kim, Jeong-Il

    2016-08-01

    Resistance against anthracnose fungi was enhanced in transgenic pepper plants that accumulated high levels of a carboxylesterase, PepEST in anthracnose-susceptible fruits, with a concurrent induction of antioxidant enzymes and SA-dependent PR proteins. A pepper esterase gene (PepEST) is highly expressed during the incompatible interaction between ripe fruits of pepper (Capsicum annuum L.) and a hemibiotrophic anthracnose fungus (Colletotrichum gloeosporioides). In this study, we found that exogenous application of recombinant PepEST protein on the surface of the unripe pepper fruits led to a potentiated state for disease resistance in the fruits, including generation of hydrogen peroxide and expression of pathogenesis-related (PR) genes that encode mostly small proteins with antimicrobial activity. To elucidate the role of PepEST in plant defense, we further developed transgenic pepper plants overexpressing PepEST under the control of CaMV 35S promoter. Molecular analysis confirmed the establishment of three independent transgenic lines carrying single copy of transgenes. The level of PepEST protein was estimated to be approximately 0.002 % of total soluble protein in transgenic fruits. In response to the anthracnose fungus, the transgenic fruits displayed higher expression of PR genes, PR3, PR5, PR10, and PepThi, than non-transgenic control fruits did. Moreover, immunolocalization results showed concurrent localization of ascorbate peroxidase (APX) and PR3 proteins, along with the PepEST protein, in the infected region of transgenic fruits. Disease rate analysis revealed significantly low occurrence of anthracnose disease in the transgenic fruits, approximately 30 % of that in non-transgenic fruits. Furthermore, the transgenic plants also exhibited resistance against C. acutatum and C. coccodes. Collectively, our results suggest that overexpression of PepEST in pepper confers enhanced resistance against the anthracnose fungi by activating the defense signaling

  16. Untranslatable tospoviral NSs fragment coupled with L conserved region enhances transgenic resistance against the homologous virus and a serologically unrelated tospovirus.

    Science.gov (United States)

    Yazhisai, Uthaman; Rajagopalan, Prem Anand; Raja, Joseph A J; Chen, Tsung-Chi; Yeh, Shyi-Dong

    2015-08-01

    Tospoviruses cause severe damages to important crops worldwide. In this study, Nicotiana benthamiana transgenic lines carrying individual untranslatable constructs comprised of the conserved region of the L gene (denoted as L), the 5' half of NSs coding sequence (NSs) or the antisense fragment of whole N coding sequence (N) of Watermelon silver mottle virus (WSMoV), individually or in combination, were generated. A total of 15-17 transgenic N. benthamiana lines carrying individual transgenes were evaluated against WSMoV and the serologically unrelated Tomato spotted wilt virus (TSWV). Among lines carrying single or chimeric transgenes, the level of resistance ranged from susceptible to completely resistant against WSMoV. From the lines carrying individual transgenes and highly resistant to WSMoV (56-63% of lines assayed), 30% of the L lines (3/10 lines assayed) and 11% of NSs lines (1/9 lines assayed) were highly resistant against TSWV. The chimeric transgenes provided higher degrees of resistance against WSMoV (80-88%), and the NSs fragment showed an additive effect to enhance the resistance to TSWV. Particularly, the chimeric transgenes with the triple combination of fragments, namely L/NSs/N or HpL/NSs/N (a hairpin construct), provided a higher degree of resistance (both 50%, with 7/14 lines assayed) against TSWV. Our results indicate that the untranslatable NSs fragment is able to enhance the transgenic resistance conferred by the L conserved region. The better performance of L/NSs/N and HpL/NSs/N in transgenic N. benthamiana lines suggests their potential usefulness in generating high levels of enhanced transgenic resistance against serologically unrelated tospoviruses in agronomic crops.

  17. A Fixed-Precision Sequential Sampling Plan for the Potato Tuberworm Moth, Phthorimaea operculella Zeller (Lepidoptera: Gelechidae), on Potato Cultivars.

    Science.gov (United States)

    Shahbi, M; Rajabpour, A

    2017-08-01

    Phthorimaea operculella Zeller is an important pest of potato in Iran. Spatial distribution and fixed-precision sequential sampling for population estimation of the pest on two potato cultivars, Arinda ® and Sante ® , were studied in two separate potato fields during two growing seasons (2013-2014 and 2014-2015). Spatial distribution was investigated by Taylor's power law and Iwao's patchiness. Results showed that the spatial distribution of eggs and larvae was random. In contrast to Iwao's patchiness, Taylor's power law provided a highly significant relationship between variance and mean density. Therefore, fixed-precision sequential sampling plan was developed by Green's model at two precision levels of 0.25 and 0.1. The optimum sample size on Arinda ® and Sante ® cultivars at precision level of 0.25 ranged from 151 to 813 and 149 to 802 leaves, respectively. At 0.1 precision level, the sample sizes varied from 5083 to 1054 and 5100 to 1050 leaves for Arinda ® and Sante ® cultivars, respectively. Therefore, the optimum sample sizes for the cultivars, with different resistance levels, were not significantly different. According to the calculated stop lines, the sampling must be continued until cumulative number of eggs + larvae reached to 15-16 or 96-101 individuals at precision levels of 0.25 or 0.1, respectively. The performance of the sampling plan was validated by resampling analysis using resampling for validation of sampling plans software. The sampling plant provided in this study can be used to obtain a rapid estimate of the pest density with minimal effort.

  18. ZyFISH: a simple, rapid and reliable zygosity assay for transgenic mice.

    Directory of Open Access Journals (Sweden)

    Donal McHugh

    Full Text Available Microinjection of DNA constructs into fertilized mouse oocytes typically results in random transgene integration at a single genomic locus. The resulting transgenic founders can be used to establish hemizygous transgenic mouse lines. However, practical and experimental reasons often require that such lines be bred to homozygosity. Transgene zygosity can be determined by progeny testing assays which are expensive and time-consuming, by quantitative Southern blotting which is labor-intensive, or by quantitative PCR (qPCR which requires transgene-specific design. Here, we describe a zygosity assessment procedure based on fluorescent in situ hybridization (zyFISH. The zyFISH protocol entails the detection of transgenic loci by FISH and the concomitant assignment of homozygosity using a concise and unbiased scoring system. The method requires small volumes of blood, is scalable to at least 40 determinations per assay, and produces results entirely consistent with the progeny testing assay. This combination of reliability, simplicity and cost-effectiveness makes zyFISH a method of choice for transgenic mouse zygosity determinations.

  19. Transgenic expression of phytase in wheat endosperm increases bioavailability of iron and zinc in grains.

    Science.gov (United States)

    Abid, Nabeela; Khatoon, Asia; Maqbool, Asma; Irfan, Muhammad; Bashir, Aftab; Asif, Irsa; Shahid, Muhammad; Saeed, Asma; Brinch-Pedersen, Henrik; Malik, Kauser A

    2017-02-01

    Phytate is a major constituent of wheat seeds and chelates metal ions, thus reducing their bioavailability and so the nutritional value of grains. Transgenic plants expressing heterologous phytase are expected to enhance degradation of phytic acid stored in seeds and are proposed to increase the in vitro bioavailability of mineral nutrients. Wheat transgenic plants expressing Aspergillus japonicus phytase gene (phyA) in wheat endosperm were developed till T 3 generation. The transgenic lines exhibited 18-99 % increase in phytase activity and 12-76 % reduction of phytic acid content in seeds. The minimum phytic acid content was observed in chapatti (Asian bread) as compared to flour and dough. The transcript profiling of phyA mRNA indicated twofold to ninefold higher expression as compared to non transgenic controls. There was no significant difference in grain nutrient composition of transgenic and non-transgenic seeds. In vitro bioavailability assay for iron and zinc in dough and chapatti of transgenic lines revealed a significant increase in iron and zinc contents. The development of nutritionally enhanced cereals is a step forward to combat nutrition deficiency for iron and zinc in malnourished human population, especially women and children.

  20. Determinants of Sweet Potato Value Addition among Smallholder

    African Journals Online (AJOL)

    sweet potato harvested significantly increased farmers' decision to add value by 0.494 ... (2004), bulkiness and perishability affect post- ..... credit makes it possible for farmers to purchase .... Promotion of the Sweet Potato for the Food Industry.

  1. Challenges and opportunities for quality seed potato availability and ...

    African Journals Online (AJOL)

    ACSS

    Key words: Quality seed potato, seed system and challenges ... systems, inadequate seed production and ... informal sources of seed potato, despite ..... Directorate General for International. Co-operation (DGIC), Brussels,. Belgium. 1540pp.

  2. How To Produce and Characterize Transgenic Plants.

    Science.gov (United States)

    Savka, Michael A.; Wang, Shu-Yi; Wilson, Mark

    2002-01-01

    Explains the process of establishing transgenic plants which is a very important tool in plant biology and modern agriculture. Produces transgenic plants with the ability to synthesize opines. (Contains 17 references.) (YDS)

  3. Transgenic Pm3 multilines of wheat show increased powdery mildew resistance in the field.

    Science.gov (United States)

    Brunner, Susanne; Stirnweis, Daniel; Diaz Quijano, Carolina; Buesing, Gabriele; Herren, Gerhard; Parlange, Francis; Barret, Pierre; Tassy, Caroline; Sautter, Christof; Winzeler, Michael; Keller, Beat

    2012-05-01

    Resistance (R) genes protect plants very effectively from disease, but many of them are rapidly overcome when present in widely grown cultivars. To overcome this lack of durability, strategies that increase host resistance diversity have been proposed. Among them is the use of multilines composed of near-isogenic lines (NILs) containing different disease resistance genes. In contrast to classical R-gene introgression by recurrent backcrossing, a transgenic approach allows the development of lines with identical genetic background, differing only in a single R gene. We have used alleles of the resistance locus Pm3 in wheat, conferring race-specific resistance to wheat powdery mildew (Blumeria graminis f. sp. tritici), to develop transgenic wheat lines overexpressing Pm3a, Pm3c, Pm3d, Pm3f or Pm3g. In field experiments, all tested transgenic lines were significantly more resistant than their respective nontransformed sister lines. The resistance level of the transgenic Pm3 lines was determined mainly by the frequency of virulence to the particular Pm3 allele in the powdery mildew population, Pm3 expression levels and most likely also allele-specific properties. We created six two-way multilines by mixing seeds of the parental line Bobwhite and transgenic Pm3a, Pm3b and Pm3d lines. The Pm3 multilines were more resistant than their components when tested in the field. This demonstrates that the difference in a single R gene is sufficient to cause host-diversity effects and that multilines of transgenic Pm3 wheat lines represent a promising strategy for an effective and sustainable use of Pm3 alleles. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  4. Improved antioxidant activity in transgenic Perilla frutescens plants via overexpression of the γ-tocopherol methyltransferase (γ-tmt) gene.

    Science.gov (United States)

    Ghimire, Bimal Kumar; Seong, Eun Soo; Lee, Chan Ok; Lee, Jae Geun; Yu, Chang Yeon; Kim, Seung Hyun; Chung, Ill Min

    2015-09-01

    The main goal of this study was to generate transgenic Perilla frutescens with enhanced antioxidant properties by overexpressing the γ-tocopherol methyltransferase (γ-tmt) gene. In this study, the antioxidant activity of methanolic crude extracts of transgenic and non-transgenic control plants was investigated using the 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging method. Free radical scavenging activity was evaluated using α-tocopherol and butylated hydroxyl toluene as standard antioxidants. In general, the ethyl acetate fraction of transgenic P. frutescens showed stronger DPPH radical scavenging activity than the ethyl acetate fraction from non-transgenic control plants (IC50 2.00 ± 0.10 and 5.53 ± 0.40 μg ∙ ml(-1), respectively). High-performance liquid chromatography analysis of phenolic acids in leaf extracts confirmed increased levels of 16 individual phenolic compounds in two transgenic lines (pf47-5 and pf47-8) compared with control plants. Changes in the phenolic compound profile and α-tocopherol content were correlated with the antioxidant properties of transgenic plants, indicating that the introduction of transgene γ-tmt influenced the metabolism of phenolic compounds and subsequently produced biochemical changes in the transformants. There were no significant differences in photosynthetic rate in the transgenic plants as compared to the non-transgenic control plants, suggesting that the alteration of phenolic compounds and tocopherol composition had little impact on photosynthesis.

  5. Spatial characterization of red and white skin potatoes using nano-second laser induced breakdown in air

    Science.gov (United States)

    Rehan, Imran; Rehan, Kamran; Sultana, S.; Haq, M. Oun ul; Niazi, Muhammad Zubair Khan; Muhammad, Riaz

    2016-01-01

    We presents spectroscopic study of the plasma generated by a Q-switched Nd:YAG (1064 nm) laser irradiation of the flesh of red and white skin potatoes. From the spectra recorded with spectrometer (LIBS2500+, Ocean Optics, USA) 11 elements were identified in red skin potato, whereas, the white skin potato was found to have nine elements. Their relative concentrations were estimated using CF-LIBS method for the plasma in local thermodynamic equilibrium. The target was placed in ambient air at atmospheric pressure. The electron temperature and number density were calculated from Boltzmann plot and stark broadened line profile methods, respectively using Fe I spectral lines. The spatial distribution of plasma parameters were also studied which show a decreasing trend of 6770 K-4266 K and (3-2.0) × 1016 cm-3. Concentrations of the detected elements were monitored as a function of depth of the potatoes. Our study reveals a decreasing tendency in concentration of iron from top to the centre of potato's flesh, whereas, the concentrations of other elements vary randomly.

  6. Expression of Recombinant Human Alpha-Lactalbumin in the Milk of Transgenic Goats Using a Hybrid Pomoter/Enhancer

    Directory of Open Access Journals (Sweden)

    Yu-Guo Yuan

    2014-01-01

    Full Text Available To improve nutrient content of goat milk, we describe the construction of a vector (pBLAC containing a hybrid goat β-lactoglobulin (BLG promoter/cytomegalovirus (CMV enhancer. We also describe the generation of transgenic goats expressing rhLA by somatic cell nuclear transfer (SCNT. Of 334 one-cell stage embryos derived from three transgenic cell lines and 99 embryos derived from non-transgenic (NT cells surgically transferred to the oviducts of 37 recipients, two recipients delivered two kids (2% from the non-transfected line and five recipients delivered six kids (1.8% from transgenic cell lines, three of which died within 2 days. Compared to the NT donor cells, transfection of donor cells does not negatively affect the development of nuclear transfer embryos into viable transgenic offspring. However, the clone efficiency in cell line number 1 was lower than that in numbers 2 and 3, and in the NT lines (0.9% versus 1.9% 2.4% and 2%; P<0.05. Two transgenic cloned goats expressed rhLA in the milk at 0.1–0.9 mg/mL. The mammary gland-specific expression vector pBLAC with hybrid BLG/CMV can drive the hLA gene to express in vitro and in vivo. These data establish the basis for use of a hybrid promoter/enhancer strategy to produce rhLA transgenic goats.

  7. WEED MANAGEMENT AND CONTROL IN POTATOES

    Directory of Open Access Journals (Sweden)

    Marcelo Cleón de Castro Silva

    2011-07-01

    Full Text Available This review shows instructions to potatoes' farmer about behavior of the weeds and how to manage them so as to minimize loss of productivity through the use of control strategies for potato crop. The prevention consists in adoption of practices that prevents entry of unwanted species of weeds in the planting site. The control reduces the infestation of these species, but this practice does not eradicate them completely. However, it needs to control the weeds before the area preparation for planting the tubers until complete closure of the soil by shoots of potatoes during the critical period. After covering the soil, the potato crop does not suffer negative interference caused by weeds. The cultural practices include a good plane for harvest, plant crop rotation, the planting of appropriate plants for covering the soil, the ideal space to the planting and the correct time to potato planting. The control must be efficient to reduce the number of weeds in the area to avoid economic losses to farmers. It is necessary to establish weed management strategies in order to maintain sustainable farming systems, preserving the environment and quality of life of the farmer.

  8. Production of bio ethanol from waste potatoes

    Science.gov (United States)

    Jaber Noufal, Mohamad; Li, Baizhan; Maalla, Zena Ali

    2017-03-01

    In this research, production of ethanol from waste potatoes fermentation was studied using Saccharomyces cerevisiae. Potato Flour prepared from potato tubers after cooking and drying at 85°C. A homogenous slurry of potato flour prepared in water at solid-liquid ratio 1:10. Liquefaction of potato starch slurry was done with α-amylase at 80°C for 40 min followed by saccharification process which was done with glucoamylase at 65°C for two hr. Fermentation of hydrolysate with Saccharomyces cerevisiae at 35°C for two days resulted in the production of 33 g/l ethanol. The following parameters have been analysed: temperature, time of fermentation and pH. It found that Saccharification process is affected by enzyme Amylase 300 concentration and concentration of 1000μl/100ml gives the efficient effect of the process. The best temperature for fermentation process was found to be about 35°C. Also, it noticed that ethanol production increased as a time of fermentation increased but after 48 hr further growth in fermentation time did not have an appreciable effect. Finally, the optimal value of pH for fermentation process was about 5 to 6.

  9. Memristors: Memory elements in potato tubers.

    Science.gov (United States)

    Volkov, Alexander G; Nyasani, Eunice K; Blockmon, Avery L; Volkova, Maya I

    2015-01-01

    A memristor is a nonlinear element because its current-voltage characteristic is similar to that of a Lissajous pattern for nonlinear systems. This element was postulated recently and researchers are looking for it in different biosystems. We investigated electrical circuitry of red Irish potato tubers (Solanum tuberosum L.). The goal was to discover if potato tubers might have a new electrical component - a resistor with memory. The analysis was based on a cyclic current-voltage characteristic where the resistor with memory should manifest itself. We found that the electrostimulation by bipolar sinusoidal or triangle periodic waves induces electrical responses in the potato tubers with fingerprints of memristors. Tetraethylammonium chloride, an inhibitor of voltage gated K(+) channels, transforms a memristor to a resistor in potato tubers. Our results demonstrate that a voltage gated K(+) channel in the excitable tissue of potato tubers has properties of a memristor. Uncoupler carbonylcyanide-4-trifluoromethoxy-phenyl hydrazone decreases the amplitude of electrical responses at low and high frequencies of bipolar periodic sinusoidal or triangle electrostimulating waves. The discovery of memristors in plants creates a new direction in the understanding of electrical phenomena in plants.

  10. RNAi-derived transgenic resistance to Mungbean yellow mosaic India virus in cowpea.

    Science.gov (United States)

    Kumar, Sanjeev; Tanti, Bhaben; Patil, Basavaprabhu L; Mukherjee, Sunil Kumar; Sahoo, Lingaraj

    2017-01-01

    Cowpea is an important grain legume crop of Africa, Latin America, and Southeast Asia. Leaf curl and golden mosaic diseases caused by Mungbean yellow mosaic India virus (MYMIV) have emerged as most devastating viral diseases of cowpea in Southeast Asia. In this study, we employed RNA interference (RNAi) strategy to control cowpea-infecting MYMIV. For this, we generated transgenic cowpea plants harbouring three different intron hairpin RNAi constructs, containing the AC2, AC4 and fusion of AC2 and AC4 (AC2+AC4) of seven cowpea-infecting begomoviruses. The T0 and T1 transgenic cowpea lines of all the three constructs accumulated transgene-specific siRNAs. Transgenic plants were further assayed up to T1 generations, for resistance to MYMIV using agro-infectious clones. Nearly 100% resistance against MYMIV infection was observed in transgenic lines, expressing AC2-hp and AC2+AC4-hp RNA, when compared with untransformed controls and plants transformed with empty vectors, which developed severe viral disease symptoms within 3 weeks. The AC4-hp RNA expressing lines displayed appearance of milder symptoms after 5 weeks of MYMIV-inoculation. Northern blots revealed a positive correlation between the level of transgene-specific siRNAs accumulation and virus resistance. The MYMIV-resistant transgenic lines accumulated nearly zero or very low titres of viral DNA. The transgenic cowpea plants had normal phenotype with no yield penalty in greenhouse conditions. This is the first demonstration of RNAi-derived resistance to MYMIV in cowpea.

  11. Reaction of sweet pepper to the potato virus y (PVYm

    Directory of Open Access Journals (Sweden)

    Echer Márcia de Moraes

    2002-01-01

    Full Text Available Traditional sweet pepper cultivars showing susceptibility to the Potato virus Y (PVY are being replaced by resistant hybrids with higher commercial value. Despite of much information about resistance source reaction and their inheritance, there is no knowledge about the genetic background of commercial resistant hybrids. Reaction of sweet pepper (Capsicum annuum L. hybrids to the Potato virus Y (PVYm such as Acuario, Magali R, Nathalie and their respective generations F2 and F3 as well as hybrids Amanda, Corteso W208, CPC-6272, Dagmar, Elisa, Magali, Margarita, Monteiro, Quantum, Vivo W205 was evaluated. Reaction to PVYm was evaluated as resistant or susceptible. Magali R and Nathalie hybrid did not show any mosaic symptoms. Magali R and Nathalie hybrids resistance is due to a single dominant gene indicating resistant versus susceptible parental lines crossing pedigree. Amanda, Acuario, Corteso W208, Dagmar, Elisa, Margarita, Monteiro, Quantum and Vivo W205, considered resistant to PVY, were highly susceptibility to PVY strain m. Hybrids, claimed as resistant to the Pepper mottle virus (PepMoV, were also resistant to PVYm.

  12. Progress on researches of transgenic alfalfa

    International Nuclear Information System (INIS)

    Guo Huiqin; Wang Mi; Ren Weibo; Xu Zhu; Chen Libo

    2010-01-01

    In this paper, the progress on the researches of transgenic alfalfa in the past two decades had been reviewed in the aspects of regeneration system, transformation, improvement of the important traits and so on. Moreover, such problems as variation of transgene expression and safety of transgenic plant had also been discussed and propose had been given for the future research work. (authors)

  13. Performance stability of potato genotypes under rainfed and ...

    African Journals Online (AJOL)

    YDessalegn

    The prevailing average monthly maximum temperature is higher in the irrigated potato production system than in the rainfed system. The average monthly minimum temperature is low and causes frost injury to the plant during the irrigated potato production system. Therefore, irrigated potato production is affected both by the.

  14. 7 CFR 318.13-25 - Sweet potatoes from Hawaii.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 5 2010-01-01 2010-01-01 false Sweet potatoes from Hawaii. 318.13-25 Section 318.13... INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE STATE OF HAWAII AND TERRITORIES QUARANTINE NOTICES Regulated Articles From Hawaii and the Territories § 318.13-25 Sweet potatoes from Hawaii. (a) Sweet potatoes may be...

  15. Glycoalkaloids and phenolic compounds in gamma irradiated potatoes

    International Nuclear Information System (INIS)

    Bergers, W.W.A.

    1980-01-01

    Potatoes were used to study the metabolic stress effects in irradiated vegetable products. The changes of the contents of specific target compounds (glycoalkaloids, phenolic acids and coumarins) in alcoholic extracts of gamma irradiated potatoes were studied for metabolic irradiation stress. Doses of up to 3 kGy were applied to potatoes of several varieties. (Auth.)

  16. influence of treatment of seed potato tubers with plant crude

    African Journals Online (AJOL)

    ACSS

    essential oil extracts, on the growth and yield of the potato crop. Treatments consisted of .... Seed potato tuber treatment with plant crude essential oil extracts. 297 were pipetted on to ..... and clove essential oils on sprout suppression in potato ...

  17. Molecular and genetic analyses of potato cyst nematode resistance loci

    NARCIS (Netherlands)

    Bakker, E.H.

    2003-01-01

    This thesis describes the genomic localisation and organisation of loci that harbour resistance to the potato cyst nematode species Globodera pallida and G. rostochiensis . Resistance to the potato cyst nematodes G. pallida and G. rostochiensis is an important aspect in potato breeding. To gain

  18. Proximate analysis of Sweet Potato Toasted Granules | Meludu ...

    African Journals Online (AJOL)

    Sweet potato is an important root crop in the food system of many African countries. The yield, nutrition and economic potential of sweet potato have been identified as very high. In this study, sweet potato was processed and toasted into granules. The proximate analysis performed on the toasted granules showed protein, ...

  19. Evaluation of five pre-emergence herbicides for volunteer potato ...

    African Journals Online (AJOL)

    Volunteer potatoes can cause significant weed problems in crops following potatoes as large numbers of potato tubers remain behind in the field after mechanical harvesting. These volunteer plants can create havoc with rotation programs and serve as a source of pests and diseases. The aim of this project was to identify a ...

  20. Developmental dynamics of Globodera ellingtonae in field-grown potato

    Science.gov (United States)

    Globodera ellingtonae is a recently described nematode parasite of potato, which is closely related to the economically-significant potato cyst nematodes, G. rostochiensis and G. pallida. Because of the close relationship of G. ellingtonae to the potato cyst nematodes, a greater understanding of its...

  1. Increasing genetic gain by reducing ploidy in potato

    Science.gov (United States)

    While potato cultivars in major world production regions are tetraploid, wild and cultivated potatoes in the crop’s center of origin range from diploid to hexaploid. Landrace potato varieties cannot be distinguished based on ploidy. Contrary to popular belief, tetraploidy does not appear to be neces...

  2. Potato psyllid vector of zebra chip disease in Pacific Northwest

    Science.gov (United States)

    Zebra chip is a destructive disease of potatoes in the Pacific Northwest and other potato production regions of North America. The pathogen associated with this disease is transmitted by the potato psyllid. A team of researchers which included a scientist at the ARS in Wapato, WA updated an extens...

  3. Irradiation of potatoes for long-term storage

    International Nuclear Information System (INIS)

    Srapenjanz, R.

    1976-01-01

    In the USSR gamma irradiation of potatoes is used for extending the storage life. The properties of potatoes are not changed, and the irradiation procedure is lower in cost than chemical treatments for sprout inhibition. Finally, a brief outline is given of investigations on sprout inhibition of potatoes in other socialist countries

  4. 76 FR 16323 - Irish Potatoes Grown in Washington; Continuance Referendum

    Science.gov (United States)

    2011-03-23

    ...; FV11-946-1 CR] Irish Potatoes Grown in Washington; Continuance Referendum AGENCY: Agricultural... conducted among eligible Washington potato growers to determine whether they favor continuance of the marketing order regulating the handling of Irish potatoes grown in Washington. DATES: The referendum will be...

  5. 7 CFR 1207.514 - Exemption for organic potatoes.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Exemption for organic potatoes. 1207.514 Section 1207... SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POTATO RESEARCH AND PROMOTION PLAN Rules and Regulations Assessments § 1207.514 Exemption for organic potatoes. (a...

  6. Calcium soil amendment increases resistance of potato to blackleg ...

    African Journals Online (AJOL)

    This study shows that calcium soil amendments reduce blackleg and soft rot diseases under Zimbabwe's growing seasons in red fersiallitic soils. Compound S produces better results in potato production than compound D and farmers should be encouraged to use compound S when growing potatoes. Key words: potato ...

  7. 75 FR 14491 - Potato Research and Promotion Plan

    Science.gov (United States)

    2010-03-26

    ...] Potato Research and Promotion Plan AGENCY: Agricultural Marketing Service, USDA. ACTION: Correcting amendments. SUMMARY: The Agricultural Marketing Service is making corrections to its Potato Research and... potatoes by U.S. Customs and Border Protection (Customs). This document also corrects Customs' name within...

  8. Reduction of greening in potatoes by gamma irradiation

    International Nuclear Information System (INIS)

    Winchester, R.V.; Thomas, A.C.; Brodrick, H.T.

    1976-01-01

    Potatoes which are exposed to light gradually turn green at the surface due to the formation of chlorophyll. Since these potatoes are unattractive to the consumer, various methods have been used to delay the rate of greening. This paper describes a method whereby potatoes were irradiated within one week of harvest and then exposed to continuous fluorescent light

  9. 7 CFR 457.142 - Northern potato crop insurance provisions.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 6 2010-01-01 2010-01-01 false Northern potato crop insurance provisions. 457.142... INSURANCE CORPORATION, DEPARTMENT OF AGRICULTURE COMMON CROP INSURANCE REGULATIONS § 457.142 Northern potato crop insurance provisions. The Northern Potato Crop Insurance Provisions for the 2008 and succeeding...

  10. Least-Cost Seed Potato Production in Ethiopia

    NARCIS (Netherlands)

    Tufa, A.H.; Gielen-Meuwissen, M.P.M.; Lommen, W.J.M.; Tsegaye, A.; Struik, P.C.; Oude Lansink, A.G.J.M.

    2015-01-01

    Improved potato varieties can increase potato yields of smallholders, and thus contribute to food security improvement in Ethiopia. However, the uptake of these varieties by farmers is very limited so far and this is one of the causes of insufficient seed quality in the seed potato system in

  11. Pinpointing the weed sources of potato psyllid in Washington

    Science.gov (United States)

    A major challenge in controlling zebra chip disease of potatoes is our inability to predict what potato fields are likely to be colonized by potato psyllid, the vector of the pathogen that causes zebra chip. Researchers at the USDA-ARS laboratory in Wapato, WA developed a novel method to identify w...

  12. Tuber formation in the wild potato species Solanum demissum Lindl.

    NARCIS (Netherlands)

    Helder, J.

    1994-01-01

    1. How does a potato plant form tubers?

    Potato plants produce sexual multiplication and survival structures, true seeds, and asexual multiplication and survival bodies, tubers. Berries of the potato plant contain a large number of minute seeds. Relatively large

  13. Involvement of potato (Solanum tuberosum L.) MKK6 in response to potato virus Y.

    Science.gov (United States)

    Lazar, Ana; Coll, Anna; Dobnik, David; Baebler, Spela; Bedina-Zavec, Apolonija; Zel, Jana; Gruden, Kristina

    2014-01-01

    Mitogen-activated protein kinase (MAPK) cascades have crucial roles in the regulation of plant development and in plant responses to stress. Plant recognition of pathogen-associated molecular patterns or pathogen-derived effector proteins has been shown to trigger activation of several MAPKs. This then controls defence responses, including synthesis and/or signalling of defence hormones and activation of defence related genes. The MAPK cascade genes are highly complex and interconnected, and thus the precise signalling mechanisms in specific plant-pathogen interactions are still not known. Here we investigated the MAPK signalling network involved in immune responses of potato (Solanum tuberosum L.) to Potato virus Y, an important potato pathogen worldwide. Sequence analysis was performed to identify the complete MAPK kinase (MKK) family in potato, and to identify those regulated in the hypersensitive resistance response to Potato virus Y infection. Arabidopsis has 10 MKK family members, of which we identified five in potato and tomato (Solanum lycopersicum L.), and eight in Nicotiana benthamiana. Among these, StMKK6 is the most strongly regulated gene in response to Potato virus Y. The salicylic acid treatment revealed that StMKK6 is regulated by the hormone that is in agreement with the salicylic acid-regulated domains found in the StMKK6 promoter. The involvement of StMKK6 in potato defence response was confirmed by localisation studies, where StMKK6 accumulated strongly only in Potato-virus-Y-infected plants, and predominantly in the cell nucleus. Using a yeast two-hybrid method, we identified three StMKK6 targets downstream in the MAPK cascade: StMAPK4_2, StMAPK6 and StMAPK13. These data together provide further insight into the StMKK6 signalling module and its involvement in plant defence.

  14. Field performance of transgenic citrus trees: assessment of the long-term expression of uidA and nptII transgenes and its impact on relevant agronomic and phenotypic characteristics.

    Science.gov (United States)

    Pons, Elsa; Peris, Josep E; Peña, Leandro

    2012-07-15

    The future of genetic transformation as a tool for the improvement of fruit trees depends on the development of proper systems for the assessment of unintended effects in field-grown GM lines. In this study, we used eight transgenic lines of two different citrus types (sweet orange and citrange) transformed with the marker genes β-glucuronidase (uidA) and neomycin phosphotransferase II (nptII) as model systems to study for the first time in citrus the long-term stability of transgene expression and whether transgene-derived pleiotropic effects occur with regard to the morphology, development and fruit quality of orchard-grown GM citrus trees. The stability of the integration and expression of the transgenes was confirmed in 7-year-old, orchard-grown transgenic lines by Southern blot analysis and enzymatic assays (GUS and ELISA NPTII), respectively. Little seasonal variation was detected in the expression levels between plants of the same transgenic line in different organs and over the 3 years of analysis, confirming the absence of rearrangements and/or silencing of the transgenes after transferring the plants to field conditions. Comparisons between the GM citrus lines with their non-GM counterparts across the study years showed that the expression of these transgenes did not cause alterations of the main phenotypic and agronomic plant and fruit characteristics. However, when comparisons were performed between diploid and tetraploid transgenic citrange trees and/or between juvenile and mature transgenic sweet orange trees, significant and consistent differences were detected, indicating that factors other than their transgenic nature induced a much higher phenotypic variability. Our results indicate that transgene expression in GM citrus remains stable during long-term agricultural cultivation, without causing unexpected effects on crop characteristics. This study also shows that the transgenic citrus trees expressing the selectable marker genes that are most

  15. The “potato road” and biogeographic history of potato cyst nematode populations from different continents

    Directory of Open Access Journals (Sweden)

    Or Violeta

    2014-01-01

    Full Text Available The general opinion about the introduction of potato in Europe is the one regarding the direction from South America to Spain and subsequent distribution to other continents. Some historical data point out an alternative road. The potato spread from its place of origin to other continents in the light of parasite-host relationship, relying on nematode molecular data, is discussed in the present work. Biogeographic history of potato cyst nematode populations from different continents is in congruence with historical records. [Projekat Ministarstva nauke Republike Srbije, br. TR 31018 i br. III 46007

  16. Diffusion of PAH in potato and carrot slices and application for a potato model

    DEFF Research Database (Denmark)

    Trapp, Stefan; Cammarano, A.; Capri, E.

    2007-01-01

    of water, potato tissue, and carrot tissue. Naphthalene, phenanthrene, anthracene, and fluoranthene served as model substances. Their transfer from source to sink disk was measured by HPLC to determine a velocity rate constant proportional to the diffusive conductivity. The diffusive flux through the plant...... of the chemical. The findings of this study provide a convenient method to estimate the diffusion of nonvolatile organic chemicals through various plant materials. The application to a radial diffusion model suggests that "growth dilution" renders the concentration of highly hydrophobic chemicals in potatoes...... below their equilibrium partitioning level. This is in agreement with field results for the bioconcentration of PAHs in potatoes....

  17. Plastid transformation in potato: Solanum tuberosum.

    Science.gov (United States)

    Valkov, Vladimir T; Gargano, Daniela; Scotti, Nunzia; Cardi, Teodoro

    2014-01-01

    Although plastid transformation has attractive advantages and potential applications in plant biotechnology, for long time it has been highly efficient only in tobacco. The lack of efficient selection and regeneration protocols and, for some species, the inefficient recombination using heterologous flanking regions in transformation vectors prevented the extension of the technology to major crops. However, the availability of this technology for species other than tobacco could offer new possibilities in plant breeding, such as resistance management or improvement of nutritional value, with no or limited environmental concerns. Herein we describe an efficient plastid transformation protocol for potato (Solanum tuberosum subsp. tuberosum). By optimizing the tissue culture system and using transformation vectors carrying homologous potato flanking sequences, we obtained up to one transplastomic shoot per bombardment. Such efficiency is comparable to that usually achieved in tobacco. The method described in this chapter can be used to regenerate potato transplastomic plants expressing recombinant proteins in chloroplasts as well as in amyloplasts.

  18. Treated Wastewater Reuse on Potato (Solanum Tuberosum)

    DEFF Research Database (Denmark)

    Battilani, A; Plauborg, Finn; Andersen, Mathias Neumann

    2014-01-01

    A field experiment was carried out in Northern Italy (Po Valley), within the frame of the EU project SAFIR, to asses the impact of treated wastewater reuse on potato yield, quality and hygiene. The potato crop was drip irrigated and fertigated. Wastewater produced by small communities (≤2000 EI......) was treated by Membrane Bio Reactor (MBR) technology and gravel filter (FTS) during three cropping seasons. Treated wastewater, soil and tubers were analysed for the faecal indicator bacterium E. coli and heavy metals contents. Potato total yield was similar for tap and reused water, while the marketable...... production has been found higher with the latter. The tuber dry matter content as well as reducing sugars were not affected by reused water. Total sugars content was higher with MBR and FTS water. Water use efficiency (WUE) was significantly higher with reused water. Compared to tap water, crop gross margin...

  19. Testing Transgenic Aspen Plants with bar Gene for Herbicide Resistance under Semi-natural Conditions.

    Science.gov (United States)

    Lebedev, V G; Faskhiev, V N; Kovalenko, N P; Shestibratov, K A; Miroshnikov, A I

    2016-01-01

    Obtaining herbicide resistant plants is an important task in the genetic engineering of forest trees. Transgenic European aspen plants (Populus tremula L.) expressing the bar gene for phosphinothricin resistance have been produced using Agrobacterium tumefaciens-mediated transformation. Successful genetic transformation was confirmed by PCR analysis for thirteen lines derived from two elite genotypes. In 2014-2015, six lines were evaluated for resistance to herbicide treatment under semi-natural conditions. All selected transgenic lines were resistant to the herbicide Basta at doses equivalent to 10 l/ha (twofold normal field dosage) whereas the control plants died at 2.5 l/ha. Foliar NH4-N concentrations in transgenic plants did not change after treatment. Extremely low temperatures in the third ten-day period of October 2014 revealed differences in freeze tolerance between the lines obtained from Pt of f2 aspen genotypes. Stable expression of the bar gene after overwintering outdoors was confirmed by RT-PCR. On the basis of the tests, four transgenic aspen lines were selected. The bar gene could be used for retransformation of transgenic forest trees expressing valuable traits, such as increased productivity.

  20. ANALYSIS OF INTERACTION OF PLANT GENOTYPE AND STRAIN AGROBACTERIUM TUMEFACIENS IN BREEDING OF POTATO RESISTANCE TO COLORADO POTATO BEETLE

    Directory of Open Access Journals (Sweden)

    Denis I Bogomaz

    2005-03-01

    Full Text Available Efficiency of potato transformation depends on plant genotype and bacterial strain. Genotypes with high regeneration ability have high transformation ability. It is shown, that transgenosis of Bt gene increases potato resistance to collorado potato beetle, transgenosis of ipt gene does not influence on resistance.

  1. Transgenic plants: from first successes to future applications.

    Science.gov (United States)

    Van Lijsebettens, Mieke; Angenon, Geert; De Block, Marc

    2013-01-01

    This dialogue was held between the Guest Editors of the Special Issue on "Plant Transgenesis" of the Int. J. Dev. Biol. and Marc De Block. He was one of the first scientists worldwide to obtain transgenic plants transformed with the chimeric selectable marker genes encoding neomycin phosphotransferase and bialaphos that confer resistance against the antibiotic kanamycin and the herbicide Basta®/glufosinate, respectively at the Department of Genetics of Ghent University and, later on, at the spin-off company, Plant Genetic Systems. Today, these two genes are still the most frequently utilized markers in transgene technology. Marc De Block chose to work on the improvement of crops in an industrial environment to help realize the production of superior seeds or products. He was part of the team that developed the male sterility/restorer system in canola (Brassica napus var. napus) that led to the first hybrid lines to be commercialized as successful products of transgene technology. In more than 30 years of research, he developed transformation procedures for numerous crops, designed histochemical, biochemical and physiological assays to monitor plant performance, and made original and innovative contributions to plant biology. Presently, he considers transgenic research part of the toolbox for plant improvement and essential for basic plant research.

  2. Generation of single-copy transgenic mouse embryos directly from ES cells by tetraploid embryo complementation

    Directory of Open Access Journals (Sweden)

    Zhao Roong

    2001-12-01

    Full Text Available Abstract Background Transgenic mice have been used extensively to analyze gene function. Unfortunately, traditional transgenic procedures have only limited use in analyzing alleles that cause lethality because lines of founder mice cannot be established. This is frustrating given that such alleles often reveal crucial aspects of gene function. For this reason techniques that facilitate the generation of embryos expressing such alleles would be of enormous benefit. Although the transient generation of transgenic embryos has allowed limited analysis of lethal alleles, it is expensive, time consuming and technically challenging. Moreover a fundamental limitation with this approach is that each embryo generated is unique and transgene expression is highly variable due to the integration of different transgene copy numbers at random genomic sites. Results Here we describe an alternative method that allows the generation of clonal mouse embryos harboring a single-copy transgene at a defined genomic location. This was facilitated through the production of Hprt negative embryonic stem cells that allow the derivation of embryos by tetraploid embryo complementation. We show that targeting transgenes to the hprt locus in these ES cells by homologous recombination can be efficiently selected by growth in HAT medium. Moreover, embryos derived solely from targeted ES cells containing a single copy LacZ transgene under the control of the α-myosin heavy chain promoter exhibited the expected cardiac specific expression pattern. Conclusion Our results demonstrate that tetraploid embryo complementation by F3 hprt negative ES cells facilitates the generation of transgenic mouse embryos containing a single copy gene at a defined genomic locus. This approach is simple, extremely efficient and bypasses any requirement to generate chimeric mice. Moreover embryos generated by this procedure are clonal in that they are all derived from a single ES cell lines. This

  3. Transgenic tobacco plants carrying the non-structural P3 gene of potato virus A

    Czech Academy of Sciences Publication Activity Database

    Nováková, S.; Mazúrová, Ľ.; Čeřovská, Noemi; šubr, Z. W.

    2005-01-01

    Roč. 49, č. 4 (2005), s. 593-598 ISSN 0006-3134 Institutional research plan: CEZ:AV0Z5038910 Keywords : potyvirus * Agrobacterium tumefaciens * Nicotiana tabacum Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.792, year: 2005

  4. Protease inhibitor from insect silk - activities of derivatives expressed in vitro and in transgenic potato

    Czech Academy of Sciences Publication Activity Database

    Kodrík, Dalibor; Kludkiewicz, Barbara; Navrátil, Oldřich; Skoková Habuštová, Oxana; Horáčková, V.; Svobodová, Z.; Vinokurov, Konstantin; Sehnal, František

    2013-01-01

    Roč. 171, č. 1 (2013), s. 209-224 ISSN 0273-2289 R&D Projects: GA MZe QI91A229 Institutional support: RVO:60077344 ; RVO:61389030 Keywords : genetically modified organism * silk protease inhibitor * protease Subject RIV: ED - Physiology Impact factor: 1.687, year: 2013 http://link.springer.com/content/pdf/10.1007%2Fs12010-013-0325-9.pdf

  5. Decreased amount of reducing sugars in transgenic potato tubers and its influence on yield characteristics

    Czech Academy of Sciences Publication Activity Database

    Navrátil, Oldřich; Fischer, L.; Čmejlová, J.; Linhart, M.; Vacek, J.

    2007-01-01

    Roč. 51, č. 1 (2007), s. 56-60 ISSN 0006-3134 R&D Projects: GA ČR GA521/03/1380 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje Keywords : Lactobacillus bulgaricus * low temperature sweetening * phosphofructokinase Subject RIV: ED - Physiology Impact factor: 1.259, year: 2007

  6. Biotechnology network promotes knowledge of transgenics

    International Nuclear Information System (INIS)

    Blanco Picado, Patricia; Valdez Melara, Marta

    2015-01-01

    Red de Ingenieria Genetica Aplicada al Mejoramiento de Cultivos Tropicales (Rigatrop) integrated by a group of scientists from the Universidad de Costa Rica (UCR), Universidad Nacional (UNA) and of the Instituto Tecnologico de Costa Rica (TEC) have organized two forums on the topic of transgenics. The first forum has shown successful experiences of development of transgenic crops in Latin America, as for example: the transgenic bean, project realized in Brazil and transgenic eggplant in Bangladesh. The second forum has been about transgenics and environment effected at the UCR, on the occasion of World Environment Day. Rigatrop members are working currently in two projects applying biotechnological tools to coffee [es

  7. Structure, processing, and properties of potatoes

    Science.gov (United States)

    Lloyd, Isabel K.; Kolos, Kimberly R.; Menegaux, Edmond C.; Luo, Huy; McCuen, Richard H.; Regan, Thomas M.

    1992-06-01

    The objective of this experiment and lesson intended for high school students in an engineering or materials science course or college freshmen is to demonstrate the relation between processing, structure, and thermodynamic and physical properties. The specific objectives are to show the effect of structure and structural changes on thermodynamic properties (specific heat) and physical properties (compressive strength); to illustrate the first law of thermodynamics; to compare boiling a potato in water with cooking it in a microwave in terms of the rate of structural change and the energy consumed to 'process' the potato; and to demonstrate compression testing.

  8. Structure, processing, and properties of potatoes

    Science.gov (United States)

    Lloyd, Isabel K.; Kolos, Kimberly R.; Menegaux, Edmond C.; Luo, Huy; Mccuen, Richard H.; Regan, Thomas M.

    1992-01-01

    The objective of this experiment and lesson intended for high school students in an engineering or materials science course or college freshmen is to demonstrate the relation between processing, structure, and thermodynamic and physical properties. The specific objectives are to show the effect of structure and structural changes on thermodynamic properties (specific heat) and physical properties (compressive strength); to illustrate the first law of thermodynamics; to compare boiling a potato in water with cooking it in a microwave in terms of the rate of structural change and the energy consumed to 'process' the potato; and to demonstrate compression testing.

  9. Irradiation processing of potatoes, onions and garlic

    International Nuclear Information System (INIS)

    Jan, M.; Starr, A.; Wahid, M.; Ahmad, A.; Khan, I.

    1992-07-01

    In this report, studies have been conducted on irradiation preservation of potatoes, onions and garlic involving different varieties, harvesting season and storage life. As a result of these investigations, optimum conditions were established for each crop. The effect of irradiation and storage on sprouting, rottage and weight loss of potatoes is presented. The sprouting initiated in the unirradiated samples after 2 months reaching 51, 80 and 100% on 4, 5 and 6 months storage respectively. Weight losses were observed in the irradiated and unirradiated samples. (A.B.)

  10. Eradication of sweet potato weevil using Co-60 gamma radiation

    International Nuclear Information System (INIS)

    Tokunaga, Taizo

    2007-01-01

    Sweet potato weevil which is a harmful insect injuring sweet potatoes was found out at Yoron Island in 1915 for the first time in Kagoshima prefecture, Japan. Here the eradication of sweet potato weevils using cobalt 60 irradiation achieved at Kikai Island is described. The mass-reared male weevils in potatoes are in pasture after sterilized by gamma irradiation. If the sexually sterile male copulates with a wild female, the egg does not incubate. By the repeated sterilization during several generations, the eradication of sweet potato weevils was accomplished. (M.H.)

  11. Effect of radiation on potato susceptibility to plant diseases

    International Nuclear Information System (INIS)

    Younis, N.A.

    1982-01-01

    The average world production of potatoes is about 7 billion bushels, having a value nearly, if not quite, equal to that of wheat. Hence, it has for years been recognized as the world's leading food crop (Thompson, 1949). Potato is the world's leading vegetable crop and rivals wheat in total value. There is probably no food article in daily diet of the white race more common than the potato. Potato tuber contains nearly 80 per cent water in it's uncooked state. Most of the remainder consists of about 2 per cent protein and 18 per cent starch. The potato is one of the cheapest and most common sources of carbohydrate food

  12. Studies on potato irradiation in the G.D.R

    International Nuclear Information System (INIS)

    Luther, Th.; Huebner, G.; Grahn, Ch.; Doellstaedt, R.

    1990-01-01

    The studies of potato irradiation have been conducted in the framework of the National Food Irradiation Research Project for 4 years. Although in the G.D.R. the use of chemical sprout inhibitors is allowed, potato irradiation can be an alternative technique for potato processing. Before irradiation a wound healing period of approx. 2 weeks is absolutely necessary to protect the potatoes from Fusarium. The method that presents the minimum risk of damage is irradiation in containers. Economic evaluations for the irradiation of potatoes are also made. (author)

  13. Transgenic Epigenetics: Using Transgenic Organisms to Examine Epigenetic Phenomena

    Directory of Open Access Journals (Sweden)

    Lori A. McEachern

    2012-01-01

    Full Text Available Non-model organisms are generally more difficult and/or time consuming to work with than model organisms. In addition, epigenetic analysis of model organisms is facilitated by well-established protocols, and commercially-available reagents and kits that may not be available for, or previously tested on, non-model organisms. Given the evolutionary conservation and widespread nature of many epigenetic mechanisms, a powerful method to analyze epigenetic phenomena from non-model organisms would be to use transgenic model organisms containing an epigenetic region of interest from the non-model. Interestingly, while transgenic Drosophila and mice have provided significant insight into the molecular mechanisms and evolutionary conservation of the epigenetic processes that target epigenetic control regions in other model organisms, this method has so far been under-exploited for non-model organism epigenetic analysis. This paper details several experiments that have examined the epigenetic processes of genomic imprinting and paramutation, by transferring an epigenetic control region from one model organism to another. These cross-species experiments demonstrate that valuable insight into both the molecular mechanisms and evolutionary conservation of epigenetic processes may be obtained via transgenic experiments, which can then be used to guide further investigations and experiments in the species of interest.

  14. Lethal and Sublethal Effects of Mineral Oil on Potato Pests.

    Science.gov (United States)

    Galimberti, Andrew; Alyokhin, Andrei

    2018-05-28

    Mineral oil is a product used to reduce Potato Virus Y transmission in potato fields. However, there is little information available about other effects that oil may have on insect pests of potato. To better understand how mineral oil affects potato pests, we performed a series of experiments testing the effects of oil on mortality, behavior, and development of potato aphids, Macrosiphum euphorbiae (Thomas) (Hemiptera: Aphididae), green peach aphids, Myzus persicae (Sulzer) (Hemiptera: Aphididae), and Colorado potato beetles, Leptinotarsa decemlineata (Say) (Coleoptera: Chrysomelidae). All three species showed negative behavioral responses to oil-treated potato foliage. Oil treatment also increased aphid mortality. Colorado potato beetle mortality was not affected, but developing on oil-treated potato plants resulted in prolonged development and smaller adults. Additionally, oil acted synergistically with the entomopathogenic fungus Beauveria bassiana (Balsamo) Vuillemin (Hypocreales: Clavicipitaceae); Colorado potato beetle larvae were killed more rapidly when sprayed with both products compared with when sprayed with B. bassiana alone. Based on these results, mineral oil has the potential for expanded use in potato IPM programs.

  15. The potential of soil fungi associated with potato rhizosphere to control root knot nematode (Meloidogyne spp.) on potato

    Science.gov (United States)

    Utari, E.; Lisnawita; Safni, I.; Lubis, K.; Tantawi, AR; Hasanuddin

    2018-02-01

    The root knot nematode (Meloidogyne spp.) is one of important pathogens on potato crops in North Sumatra, Indonesia. This nematode causes significant crop losses on potatoes directly and indirectly. The effect of fungal isolates (Trichoderma sp. 1, Mucor sp.1, Aspergillus sp. 2, Mucor sp. 2) that were isolated from rhizosphere of potato in North Sumatra were studied in green house experiments on the growth of potato and the reproduction of the nematode (Meloidogyne spp). The results showed that Trichoderma sp. 1 caused a significant gall reduction, while Mucor sp.1 and Mucor sp.2 could improve the growth of potato.

  16. Preliminary survey of potato virus Y (PVy) strains in potato samples from Kurdistan (Iran).

    Science.gov (United States)

    Bahrami-Kamangar, S; De Jonghe, K; Kamangar, S; Maes, M; Smagghe, G

    2010-01-01

    Potato virus Y (PVY) is the type species in the potyvirus genus of the family potyviridae. This plant pathogenic virus is transmitted through plant sap inoculation by stem and core grafting and by at least 25 aphid species in a non-persistent manner. According to potato specialists in most parts of the world, PVY is currently considered as the most harmful virus in cultivated potatoes. This is also the case for potato production in Iran. In this project we investigated potato leaves that were collected in the Kurdistan province in Iran for the presence of PVY with use of different biochemical/molecular techniques as ELISA, RT-PCR and qPCR. The different PVY strains, including PVY-O, PVY-N, PVYN-TN, PVY-NWi, were determined by using a triplex RT-PCR. In conclusion, the results demonstrated the presence of PVY-NWi strains in the potato leaf samples from Kurdistan (Iran). The data are discussed in relation to prevalence of PVY strains in Iran.

  17. Enhanced virus resistance in transgenic maize expressing a dsRNA-specific endoribonuclease gene from E. coli.

    Directory of Open Access Journals (Sweden)

    Xiuling Cao

    Full Text Available Maize rough dwarf disease (MRDD, caused by several Fijiviruses in the family Reoviridae, is a global disease that is responsible for substantial yield losses in maize. Although some maize germplasm have low levels of polygenic resistance to MRDD, highly resistant cultivated varieties are not available for agronomic field production in China. In this work, we have generated transgenic maize lines that constitutively express rnc70, a mutant E. coli dsRNA-specific endoribonuclease gene. Transgenic lines were propagated and screened under field conditions for 12 generations. During three years of evaluations, two transgenic lines and their progeny were challenged with Rice black-streaked dwarf virus (RBSDV, the causal agent of MRDD in China, and these plants exhibited reduced levels of disease severity. In two normal years of MRDD abundance, both lines were more resistant than non-transgenic plants. Even in the most serious MRDD year, six out of seven progeny from one line were resistant, whereas non-transgenic plants were highly susceptible. Molecular approaches in the T12 generation revealed that the rnc70 transgene was integrated and expressed stably in transgenic lines. Under artificial conditions permitting heavy virus inoculation, the T12 progeny of two highly resistant lines had a reduced incidence of MRDD and accumulation of RBSDV in infected plants. In addition, we confirmed that the RNC70 protein could bind directly to RBSDV dsRNA in vitro. Overall, our data show that RNC70-mediated resistance in transgenic maize can provide efficient protection against dsRNA virus infection.

  18. Nucleocapsid Gene-Mediated Transgenic Resistance Provides Protection Against Tomato spotted wilt virus Epidemics in the Field.

    Science.gov (United States)

    Herrero, S; Culbreath, A K; Csinos, A S; Pappu, H R; Rufty, R C; Daub, M E

    2000-02-01

    ABSTRACT Transformation of plants with the nucleocapsid (N) gene of Tomato spotted wilt tospovirus (TSWV) provides resistance to disease development; however, information is lacking on the response of plants to natural inoculum in the field. Three tobacco cultivars were transformed with the N gene of a dahlia isolate of TSWV (TSWV-D), and plants were evaluated over several generations in the greenhouse. The resistant phenotype was more frequently observed in 'Burley 21' than in 'KY-14' or 'K-326', but highly resistant 'Burley 21' transgenic lines were resistant to only 44% of the heterologous TSWV isolates tested. Advanced generation (R(3) and R(4)) transgenic resistant lines of 'Burley 21' and a 'K-326' F(1) hybrid containing the N genes of two TSWV isolates were evaluated in the field near Tifton, GA, where TSWV is endemic. Disease development was monitored by symptom expression and enzyme-linked immunosorbent assay (ELISA) analysis. Whereas incidence of TSWV infection in 'Burley 21' susceptible controls was 20% in 1996 and 62% in 1997, the mean incidence in transgenic lines was reduced to 4 and 31%, respectively. Three transgenic 'Burley 21' lines were identified that had significantly lower incidence of disease than susceptible controls over the two years of the study. In addition, the rate of disease increase at the onset of the 1997 epidemic was reduced for all the 'Burley 21' transgenic lines compared with the susceptible controls. The 'K-326' F(1) hybrid was as susceptible as the 'K-326' nontransformed control. ELISA analysis demonstrated that symptomless plants from the most resistant 'Burley 21' transgenic lines accumulated detectable nucleocapsid protein, whereas symptomless plants from more susceptible lines did not. We conclude that transgenic resistance to TSWV is effective in reducing incidence of the disease in the field, and that accumulation of transgene protein may be important in broad-spectrum resistance.

  19. Modified expression of alternative oxidase in transgenic tomato and petunia affects the level of tomato spotted wilt virus resistance.

    Science.gov (United States)

    Ma, Hao; Song, Congfeng; Borth, Wayne; Sether, Diane; Melzer, Michael; Hu, John

    2011-10-20

    Tomato spotted wilt virus (TSWV) has a very wide host range, and is transmitted in a persistent manner by several species of thrips. These characteristics make this virus difficult to control. We show here that the over-expression of the mitochondrial alternative oxidase (AOX) in tomato and petunia is related to TSWV resistance. The open reading frame and full-length sequence of the tomato AOX gene LeAox1au were cloned and introduced into tomato 'Healani' and petunia 'Sheer Madness' using Agrobacterium-mediated transformation. Highly expressed AOX transgenic tomato and petunia plants were selfed and transgenic R1 seedlings from 10 tomato lines and 12 petunia lines were used for bioassay. For each assayed line, 22 to 32 tomato R1 progeny in three replications and 39 to 128 petunia progeny in 13 replications were challenged with TSWV. Enzyme-Linked Immunosorbent Assays showed that the TSWV levels in transgenic tomato line FKT4-1 was significantly lower than that of wild-type controls after challenge with TSWV. In addition, transgenic petunia line FKP10 showed significantly less lesion number and smaller lesion size than non-transgenic controls after inoculation by TSWV. In all assayed transgenic tomato lines, a higher percentage of transgenic progeny had lower TSWV levels than non-transgenic plants after challenge with TSWV, and the significantly increased resistant levels of tomato and petunia lines identified in this study indicate that altered expression levels of AOX in tomato and petunia can affect the levels of TSWV resistance.

  20. Modified expression of alternative oxidase in transgenic tomato and petunia affects the level of tomato spotted wilt virus resistance

    Directory of Open Access Journals (Sweden)

    Ma Hao

    2011-10-01

    Full Text Available Abstract Background Tomato spotted wilt virus (TSWV has a very wide host range, and is transmitted in a persistent manner by several species of thrips. These characteristics make this virus difficult to control. We show here that the over-expression of the mitochondrial alternative oxidase (AOX in tomato and petunia is related to TSWV resistance. Results The open reading frame and full-length sequence of the tomato AOX gene LeAox1au were cloned and introduced into tomato 'Healani' and petunia 'Sheer Madness' using Agrobacterium-mediated transformation. Highly expressed AOX transgenic tomato and petunia plants were selfed and transgenic R1 seedlings from 10 tomato lines and 12 petunia lines were used for bioassay. For each assayed line, 22 to 32 tomato R1 progeny in three replications and 39 to 128 petunia progeny in 13 replications were challenged with TSWV. Enzyme-Linked Immunosorbent Assays showed that the TSWV levels in transgenic tomato line FKT4-1 was significantly lower than that of wild-type controls after challenge with TSWV. In addition, transgenic petunia line FKP10 showed significantly less lesion number and smaller lesion size than non-transgenic controls after inoculation by TSWV. Conclusion In all assayed transgenic tomato lines, a higher percentage of transgenic progeny had lower TSWV levels than non-transgenic plants after challenge with TSWV, and the significantly increased resistant levels of tomato and petunia lines identified in this study indicate that altered expression levels of AOX in tomato and petunia can affect the levels of TSWV resistance.

  1. Effective generation of transgenic pigs and mice by linker based sperm-mediated gene transfer.

    Directory of Open Access Journals (Sweden)

    Shih Ping Yao

    2002-04-01

    Full Text Available Abstract Background Transgenic animals have become valuable tools for both research and applied purposes. The current method of gene transfer, microinjection, which is widely used in transgenic mouse production, has only had limited success in producing transgenic animals of larger or higher species. Here, we report a linker based sperm-mediated gene transfer method (LB-SMGT that greatly improves the production efficiency of large transgenic animals. Results The linker protein, a monoclonal antibody (mAb C, is reactive to a surface antigen on sperm of all tested species including pig, mouse, chicken, cow, goat, sheep, and human. mAb C is a basic protein that binds to DNA through ionic interaction allowing exogenous DNA to be linked specifically to sperm. After fertilization of the egg, the DNA is shown to be successfully integrated into the genome of viable pig and mouse offspring with germ-line transfer to the F1 generation at a highly efficient rate: 37.5% of pigs and 33% of mice. The integration is demonstrated again by FISH analysis and F2 transmission in pigs. Furthermore, expression of the transgene is demonstrated in 61% (35/57 of transgenic pigs (F0 generation. Conclusions Our data suggests that LB-SMGT could be used to generate transgenic animals efficiently in many different species.

  2. Transgenic Arabidopsis Gene Expression System

    Science.gov (United States)

    Ferl, Robert; Paul, Anna-Lisa

    2009-01-01

    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  3. Tie-1-directed expression of Cre recombinase in endothelial cells of embryoid bodies and transgenic mice

    DEFF Research Database (Denmark)

    Gustafsson, E; Brakebusch, C; Hietanen, K

    2001-01-01

    Tissue-specific gene inactivation using the Cre-loxP system has become an important tool to unravel functions of genes when the conventional null mutation is lethal. We report here the generation of a transgenic mouse line expressing Cre recombinase in endothelial cells. In order to avoid...... the production and screening of multiple transgenic lines we used embryonic stem cell and embryoid body technology to identify recombinant embryonic stem cell clones with high, endothelial-specific Cre activity. One embryonic stem cell clone that showed high Cre activity in endothelial cells was used to generate...... germline chimeras. The in vivo efficiency and specificity of the transgenic Cre was analysed by intercrossing the tie-1-Cre line with the ROSA26R reporter mice. At initial stages of vascular formation (E8-9), LacZ staining was detected in almost all cells of the forming vasculature. Between E10 and birth...

  4. Leaf wetness distribution within a potato crop

    Science.gov (United States)

    Heusinkveld, B. G.

    2010-07-01

    The Netherlands has a mild maritime climate and therefore the major interest in leaf wetness is associated with foliar plant diseases. During moist micrometeorological conditions (i.e. dew, fog, rain), foliar fungal diseases may develop quickly and thereby destroy a crop quickly. Potato crop monocultures covering several hectares are especially vulnerable to such diseases. Therefore understanding and predicting leaf wetness in potato crops is crucial in crop disease control strategies. A field experiment was carried out in a large homogeneous potato crop in the Netherlands during the growing season of 2008. Two innovative sensor networks were installed as a 3 by 3 grid at 3 heights covering an area of about 2 hectares within two larger potato crops. One crop was located on a sandy soil and one crop on a sandy peat soil. In most cases leaf wetting starts in the top layer and then progresses downward. Leaf drying takes place in the same order after sunrise. A canopy dew simulation model was applied to simulate spatial leaf wetness distribution. The dew model is based on an energy balance model. The model can be run using information on the above-canopy wind speed, air temperature, humidity, net radiation and within canopy air temperature, humidity and soil moisture content and temperature conditions. Rainfall was accounted for by applying an interception model. The results of the dew model agreed well with the leaf wetness sensors if all local conditions were considered. The measurements show that the spatial correlation of leaf wetness decreases downward.

  5. Carbohydrates and gibberellins relationship in potato tuberization

    Czech Academy of Sciences Publication Activity Database

    Ševčíková, H.; Mašková, P.; Tarkowská, Danuše; Mašek, T.; Lipavská, H.

    2017-01-01

    Roč. 214, JUL (2017), s. 53-63 ISSN 0176-1617 R&D Projects: GA ČR GA14-34792S Institutional support: RVO:61389030 Keywords : Carbohydrate distribution * Gibberellin * Photoautotrophic cultivation * Potato * Tuberization Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Plant sciences, botany Impact factor: 3.121, year: 2016

  6. Electroantennogram responses of the potato tuber moth ...

    Indian Academy of Sciences (India)

    PRAKASH

    lay eggs in soil cracks and on exposed tubers (Radcliffe ... Compounds belonging to the fatty acid derivatives class appear to be important for an oligophagous pest such as the potato tuber moth and the findings are discussed in relation to host plant selection in ..... specific adaptation of the set of olfactory receptors on the.

  7. Potato pathogens in Northern and Western Europe

    NARCIS (Netherlands)

    Schepers, H.T.A.M.; Cooke, L.R.

    2015-01-01

    The climatic conditions in Northern and Western (NW) Europe, which are very suitable for the cultivation of potatoes, are also very favourable for a range of diseases of which late blight, caused by Phytophthora infestans, is by far the most important with the potential to cause total crop loss. It

  8. Potato developments in a changing Europe

    NARCIS (Netherlands)

    Haase, N.U.; Haverkort, A.J.

    2006-01-01

    The papers in this book reflect societal and commercial changes such as consumer behaviour and marketing aspects in relation to fresh and processed potatoes in western, central and eastern Europe. Seed trade between western and central Europe is entering a new stage with altered inspection

  9. ( amala ) made from sweet potato flour ( elubo )

    African Journals Online (AJOL)

    Describing the sensory characteristics of new or modified products is an integral part of food quality control. Sweet potato amala as an important end product could serve as an avenue for utilization of the crop, however, sensory attributes that will influence and ensure consumer acceptability need to be determined.

  10. Internal ballistics of a pneumatic potato cannon

    International Nuclear Information System (INIS)

    Mungan, Carl E

    2009-01-01

    Basic laws of thermodynamics and mechanics are used to analyse an air gun. Such devices are often employed in outdoor physics demonstrations to launch potatoes using compressed gas that is here assumed to expand reversibly and adiabatically. Reasonable agreement is found with reported muzzle speeds for such homebuilt cannons. The treatment is accessible to undergraduate students who have taken calculus-based introductory physics

  11. Internal ballistics of a pneumatic potato cannon

    Energy Technology Data Exchange (ETDEWEB)

    Mungan, Carl E [Physics Department, US Naval Academy, Annapolis, MD 21402-5002 (United States)], E-mail: mungan@usna.edu

    2009-05-15

    Basic laws of thermodynamics and mechanics are used to analyse an air gun. Such devices are often employed in outdoor physics demonstrations to launch potatoes using compressed gas that is here assumed to expand reversibly and adiabatically. Reasonable agreement is found with reported muzzle speeds for such homebuilt cannons. The treatment is accessible to undergraduate students who have taken calculus-based introductory physics.

  12. Global field experiments for potato simulations

    NARCIS (Netherlands)

    Raymundo, Rubi; Asseng, Senthold; Prasad, Rishi; Kleinwechter, Ulrich; Condori, Bruno; Bowen, Walter; Wolf, Joost; Olesen, Jørgen E.; Dong, Qiaoxue; Zotarelli, Lincoln; Gastelo, Manuel; Alva, Ashok; Travasso, Maria; Arora, Vijay

    2018-01-01

    A large field potato experimental data set has been assembled for simulation modeling. The data are from temperate, subtropical, and tropical regions across the world and include 87 experiments with 204 treatments. Treatments include nitrogen fertilizer, irrigation, atmospheric CO2 levels,

  13. Responses of potatoes plants inoculated with arbuscular ...

    African Journals Online (AJOL)

    A pot experiment was set to examine the impact of the foliar litter (Hardwickia binata and Azadirachta indica) and an arbuscular mycorrhizal (AM) fungus on the development of two varieties of potato plants (Aida, Atlas). Three litter doses (0, 25 and 50 g) were applied to the pots after bedding plantlets. The plants were ...

  14. Resistance to Black Dot in Potato

    Science.gov (United States)

    Black dot fungus can colonize tubers on the surface, in the stolon end, or in a combination of both.On the surface the fungus is prevalent as sclerotia, and in the stolon end the fungus colonizes the vascular tissuesas hyphae. The fungus is introduced to non-infested soils mostly by infected potato ...

  15. Comparing methods of ploidy estimation in potato.

    Science.gov (United States)

    Ploidy manipulation and the resulting need for rapid ploidy screening is an important part of a potato research and breeding program. Determining ploidy by counting chromosomes or measuring DNA in individual cells is definitive, but takes time, technical skills and equipment. We tested three predi...

  16. Pink eye in potato is problematic

    Science.gov (United States)

    Fall of 2017 was a challenging harvest season for potato growers in Central Wisconsin because of the less-than-ideal patterns of temperature and precipitation. Late September had several days with high temperatures above 85'F that shut down most harvest operations. Early October brought in quite a f...

  17. Internal Ballistics of a Pneumatic Potato Cannon

    Science.gov (United States)

    Mungan, Carl E.

    2009-01-01

    Basic laws of thermodynamics and mechanics are used to analyse an air gun. Such devices are often employed in outdoor physics demonstrations to launch potatoes using compressed gas that is here assumed to expand reversibly and adiabatically. Reasonable agreement is found with reported muzzle speeds for such homebuilt cannons. The treatment is…

  18. Use of induced mutations for potato improvement

    International Nuclear Information System (INIS)

    Kishore, H.; Das, B.; Subramanyam, K.N.; Chandra, R.; Upadhya, M.D.

    1975-01-01

    The investigations aim at the utilization of induced mutations for potato improvement. The effect of γ-rays was tested on selfed seeds and hybrid seeds as well as on tubers of several potato varieties. Chemical mutagens have been successfully employed to produce daylength neutral clones. An attempt to induce resistance against Pseudomonas solanacearum did not give conclusive results. Potato improvement in relation of yield and other characters of economic significance like maturity and attributes of tubers has been handicapped by several technical considerations world over. The crux of the problem lies in the narrow genetic base (variability) for potato breeders to work with. The use of mutation breeding, therefore, offers a good tool for this. Improvement by mutation breeding for the quantitative characters besides the resistance to disease and pest has been demonstrated in other crops like white mustard variety Primex (Anderson and Olsson, 1954), barley (Gustafsson, 1965) and peanut (Gregory, 1956). Keeping these in view and the success we had in isolating photoperiod insensitive types (Upadhaya et al, 1973, 1974) study was enlarged to use mutagens to increase as wide a spectrum as possible of the variability for quantative and qualitative characters. (author)

  19. Comparative study of potato cultivation through micropropagation ...

    African Journals Online (AJOL)

    sonu

    Comparative study of potato cultivation through micropropagation and conventional farming methods .... and Murate potash were used as fertilizer source of nitrogen, phosphorus and potassium, respectively (Table 1) ..... through Tissue culture- Application and Feasibility. U.S.D.A.,. Beltsville. Agric. Res. Sci. Educ. Admin.

  20. Engineering resistance against potato virus Y

    NARCIS (Netherlands)

    Vlugt, van der R.A.A.

    1993-01-01

    Potato virus Y is the type species of the potyvirus genus, the largest genus of the plant virus family Potyviridae. The virus causes serious problems in the cultivation of several Solanaceous crops and although certain poly- and monogenic resistances are available,

  1. Hairy nightshade as a potential Potato leafroll virus (Luteoviridae: Polerovirus) inoculum source in Pacific Northwest potato ecosystems.

    Science.gov (United States)

    Srinivasan, R; Alvarez, J M

    2008-09-01

    Hairy nightshade, Solanum sarrachoides, is a solanaceous weed found abundantly in Pacific Northwest potato ecosystems. It serves as a reservoir for one of the important potato viruses, Potato leafroll virus (PLRV) (Luteoviridae: Polerovirus), and its most important vector, the green peach aphid, Myzus persicae (Homoptera: Aphididae). Laboratory research indicated an increased green peach aphid settling and performance on S. sarrachoides than on potato. It also revealed that green peach aphids transmitted PLRV more efficiently from S. sarrachoides to potato than from potato to potato. To test the efficiency of S. sarrachoides as an inoculum source in the field, a two season (2004 and 2005) trial was conducted at Kimberly, Idaho. Two inoculum sources, PLRV-infected potato and PLRV-infected S. sarrachoides, were compared in this trial. Green peach aphid density and temporal and spatial PLRV spread were monitored at weekly intervals. Higher densities of green peach aphids were observed on plots with S. sarrachoides and inoculum sources (PLRV-infected S. sarrachoides and potato) than on plots without S. sarrachoides and inoculum sources. PLRV infection in plots with PLRV-infected S. sarrachoides was similar to or slightly higher than in plots with PLRV-infected potato as an inoculum source. Temporal and spatial PLRV spread was similar in plots with either inoculum source. Thus, S. sarrachoides is as efficient as or a better PLRV inoculum source than potato.

  2. Phytoremediation of the organic Xenobiotic simazine by p450-1a2 transgenic Arabidopsis thaliana plants.

    Science.gov (United States)

    Azab, Ehab; Hegazy, Ahmad K; El-Sharnouby, Mohamed E; Abd Elsalam, Hassan E

    2016-01-01

    The potential use of human P450-transgenic plants for phytoremediation of pesticide contaminated soils was tested in laboratory and greenhouse experiments. The transgenic P450 CYP1A2 gene Arabidopsis thaliana plants metabolize number of herbicides, insecticides and industrial chemicals. The P450 isozymes CYP1A2 expressed in A. thaliana were examined regarding the herbicide simazine (SIM). Transgenic A. thaliana plants expressing CYP1A2 gene showed significant resistance to SIM supplemented either in plant growth medium or sprayed on foliar parts. The results showed that SIM produces harmful effect on both rosette diameter and primary root length of the wild type (WT) plants. In transgenic A. thaliana lines, the rosette diameter and primary root length were not affected by SIM concentrations used in this experiment. The results indicate that CYP1A2 can be used as a selectable marker for plant transformation, allowing efficient selection of transgenic lines in growth medium and/or in soil-grown plants. The transgenic A. thaliana plants exhibited a healthy growth using doses of up to 250 μmol SIM treatments, while the non-transgenic A. thaliana plants were severely damaged with doses above 50 μmol SIM treatments. The transgenic A. thaliana plants can be used as phytoremediator of environmental SIM contaminants.

  3. The effect of gamma-irradiation on the sucrose content in sweet potato roots and potato tubers

    International Nuclear Information System (INIS)

    Hayashi, T.; Kawashima, K.

    1982-01-01

    The sucrose content in both potato tubers and sweet potato roots was considerably increased by gamma-irradiation. The maximum increase was achieved by an irradiation dose of 3 to 4 kGy for potatoes and 0.8 to 2 kGy for sweet potatoes. Cooling treatment (15°C, 2 weeks) for sweet potato roots also enhanced the sucrose content (almost 2 times) but was not additive to the irradiation treatment; the maximum sucrose content in irradiated sweet potato roots was in the range of 7 to 12% irrespective of the cooling treatment, depending on the variety of sweet potatoes. Irradiation made the sucrose content in the roots 2 to 4 times higher

  4. Carotenoids and β-carotene in orange fleshed sweet potato: A possible solution to vitamin A deficiency.

    Science.gov (United States)

    Islam, Sheikh Nazrul; Nusrat, Tania; Begum, Parveen; Ahsan, Monira

    2016-05-15

    The present study, in line with a plant-food-based approach to address vitamin A deficiency, reports the analysis of total carotenoids, and trans- and cis-β-carotenes, in different varieties of raw and boiled orange-fleshed sweet potatoes (OFSP). Carotenoids were isolated using acetone-petroleum ether extraction followed by spectrophotometric determination. trans- and cis-β-Carotenes were analyzed by reversed-phase HPLC method using a mobile phase containing acetonitrile:methanol:2-propanol in the ratio of 85:15:33 with 0.01% ammonium acetate. Intra-varietal difference in carotenoids as well as trans- and cis-β-carotenes were noted in both the raw and boiled potatoes. Carotenoid content was found to be higher in the raw potatoes compared to the boiled samples from the same variety. Amongst the OFSP varieties, Kamalasundari (BARI SP-2) was found to contain the most carotenoids in both the raw and boiled samples. β-Carotene was significantly higher in the Kamalsundari and BARI SP-5 varieties. trans-β-Carotene was found to be the major carotenoid in all of the raw potatoes, but boiling was associated with an increase in cis-β-carotene and a decrease in the trans isomer. Kamalsundari and BARI SP-5 orange-fleshed sweet potatoes have the potential to be used as food-based supplements to reduce vitamin A deficiency. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Combination of Trichoderma harzianum endochitinase and a membrane-affecting fungicide on control of Alternaria leaf spot in transgenic broccoli plants.

    Science.gov (United States)

    Mora, A; Earle, E D

    2001-04-01

    Progeny from transgenic broccoli (cv. Green Comet) expressing a Trichoderma harzianum endochitinase gene were used to assess the interaction between endochitinase and the fungicide Bayleton in the control of Alternaria brassicicola. In vitro assays have shown synergistic effects of endochitinase and fungicides on fungal pathogens. Our study examined the in planta effects of endochitinase and Bayleton, individually and in combination. Two month old transgenic and non-transgenic plants were sprayed with ED50 levels of Bayleton and/or inoculated with an A. brassicicola spore suspension. Disease levels in non-sprayed transgenic plants were not statistically different from sprayed transgenic plants nor from sprayed non-transgenic controls. Thus endochitinase-transgenic plants alone provided a significant reduction of disease severity, comparable to the protection by fungicide on non-transgenic plants. Comparison of the expected additive and observed effects revealed no synergism between endochitinase and Bayleton (at ED50 level), and usually less than an additive effect. Some transgenic lines sprayed with fungicide at doses higher than ED50 showed resistance similar to the non-sprayed transgenic lines, again suggesting no synergistic effect. Lack of synergism may be due to incomplete digestion of the cell wall by endochitinase, so that the effect of Bayleton at the cell membrane is not enhanced.

  6. A transgenic approach to study argininosuccinate synthetase gene expression

    Science.gov (United States)

    2014-01-01

    Background Argininosuccinate synthetase (ASS) participates in urea, nitric oxide and arginine production. Besides transcriptional regulation, a post-transcriptional regulation affecting nuclear precursor RNA stability has been reported. To study whether such post-transcriptional regulation underlines particular temporal and spatial ASS expression, and to investigate how human ASS gene behaves in a mouse background, a transgenic mouse system using a modified bacterial artificial chromosome carrying the human ASS gene tagged with EGFP was employed. Results Two lines of ASS-EGFP transgenic mice were generated: one with EGFP under transcriptional control similar to that of the endogenous ASS gene, another with EGFP under both transcriptional and post-transcriptional regulation as that of the endogenous ASS mRNA. EGFP expression in the liver, the organ for urea production, and in the intestine and kidney that are responsible for arginine biosynthesis, was examined. Organs taken from embryos E14.5 stage to young adult were examined under a fluorescence microscope either directly or after cryosectioning. The levels of EGFP and endogenous mouse Ass mRNAs were also quantified by S1 nuclease mapping. EGFP fluorescence and EGFP mRNA levels in both the liver and kidney were found to increase progressively from embryonic stage toward birth. In contrast, EGFP expression in the intestine was higher in neonates and started to decline at about 3 weeks after birth. Comparison between the EGFP profiles of the two transgenic lines indicated the developmental and tissue-specific regulation was mainly controlled at the transcriptional level. The ASS transgene was of human origin. EGFP expression in the liver followed essentially the mouse Ass pattern as evidenced by zonation distribution of fluorescence and the level of EGFP mRNA at birth. However, in the small intestine, Ass mRNA level declined sharply at 3 week of age, and yet substantial EGFP mRNA was still detectable at this stage

  7. [Transgenic wheat (Triticum aestivum L.) with increased resistance to the storage pest obtained by Agrobacterium tumefaciens--mediated].

    Science.gov (United States)

    Bi, Rui-Ming; Jia, Hai-Yan; Feng, De-Shun; Wang, Hong-Gang

    2006-05-01

    The transgenic wheat of improved resistance to the storage pest was production. We have introduced the cowpea trypsin inhibitor gene (CpTI) into cultured embryonic callus cells of immature embryos of wheat elite line by Agrobacterium-mediated method. Independent plantlets were obtained from the kanamycin-resistant calli after screening. PCR and real time PCR analysis, PCR-Southern and Southern blot hybridization indicated that there were 3 transgenic plants viz. transformed- I, II and III (T- I, T-II and T-III). The transformation frequencies were obviously affected by Agrobacterium concentration, the infection duration and transformation treatment. The segregations of CpTI in the transgenic wheat progenies were not easily to be elucidated, and some transgenic wheat lines (T- I and T-III) showed Mendelian segregations. The determinations of insect resistance to the stored grain insect of wheat viz. the grain moth (Sitotroga cerealella Olivier) indicated that the 3 transgenic wheat progeny seeds moth-resistance was improved significantly. The seed moth-eaten ratio of T- I, T-II, T-III and nontransformed control was 19.8%, 21.9%, 32.9% and 58.3% respectively. 3 transgenic wheat T1 PCR-positive plants revealed that the 3 transgenic lines had excellent agronomic traits. They supplied good germplasm resource of insect-resistance for wheat genetic improvement.

  8. Overexpression of GmDREB1 improves salt tolerance in transgenic wheat and leaf protein response to high salinity

    Directory of Open Access Journals (Sweden)

    Qiyan Jiang

    2014-04-01

    Full Text Available The transcription factor dehydration-responsive element binding protein (DREB is able to improve tolerance to abiotic stress in plants by regulating the expression of downstream genes involved in environmental stress resistance. The objectives of this study were to evaluate the salt tolerance of GmDREB1 transgenic wheat (Triticum aestivum L. and to evaluate its physiological and protein responses to salt stress. Compared with the wild type, the transgenic lines overexpressing GmDREB1 showed longer coleoptiles and radicles and a greater radicle number at the germination stage, as well as greater root length, fresh weight, and tiller number per plant at the seedling stage. The yield-related traits of transgenic lines were also improved compared with the wild type, indicating enhanced salt tolerance in transgenic lines overexpressing GmDREB1. Proteomics analysis revealed that osmotic- and oxidative-stress-related proteins were up-regulated in transgenic wheat leaves under salt stress conditions. Transgenic wheat had higher levels of proline and betaine and lower levels of malondialdehyde and relative electrolyte leakage than the wild type. These results suggest that GmDREB1 regulates the expression of osmotic- and oxidative-stress-related proteins that reduce the occurrence of cell injury caused by high salinity, thus improving the salt tolerance of transgenic wheat.

  9. Economic viability and commercial experience with shihoro potato irradiation

    International Nuclear Information System (INIS)

    Kume, T.

    1985-01-01

    A commercial potato irradiation plant was established in 1973 at Shihoro in Hokkaido, Japan, with a capacity of about 10,000 tons per month using large baskets containing 1.5 tons of potatoes. For twelve seasons potatoes have been irradiated and marketed by the plant. The paper will discuss the experience with the Shihoro potato irradiator from the technical and economic viewpoints. From the technical viewpoint, the following are the main factors that have contributed to the success of potato irradiation. First, the Japanese government initiated research on food irradiation as a national project and provided financial support. Second, the presence of the Shihoro Agricultural Cooperative Association which handles a large amount of potatoes; and third, the mock-up test for the conceptual design of irradiation was conducted using large baskets for storage and transportation. The cost of the irradiation plant was about 389 million yen, of which 253 million yen was provided by the government. The irradiation plant processes about 15,000 tons of potatoes a year and the costs are 2,000 to 4,500 yen per ton. This accounts for 2 to 3% of the potato price and is within the range of commercial feasibility. The irradiated potatoes effectively controlled the market price and is within the range of commercial feasibility. The irradiated potatoes effectively controlled the market price fluctuations during the off-season

  10. Overexpression of TiERF1 enhances resistance to sharp eyespot in transgenic wheat

    OpenAIRE

    Chen, Liang; Zhang, ZengYan; Liang, HongXia; Liu, HongXia; Du, LiPu; Xu, Huijun; Xin, Zhiyong

    2008-01-01

    Wheat sharp eyespot, primarily caused by a soil-borne fungus Rhizoctonia cerealis, has become one of the most serious diseases of wheat in China. In this study, an ethylene response factor (ERF) gene from a wheat relative Thinopyrum intermedium, TiERF1, was characterized further, transgenic wheat lines expressing TiERF1 were developed, and the resistance of the transgenic wheat lines against R. cerealis was investigated. Southern blotting analysis indicated that at least two copies of the TiE...

  11. Evaluation of N-Nitrosamine Formation in Routine Potato Cooking

    Directory of Open Access Journals (Sweden)

    Qajarbeygi

    2015-08-01

    Full Text Available Background Nitrosamine is amongst carcinogen chemical compounds, which can enter the human body through consumption of food. Potatoes are a root vegetable consumed by many people around the world, however their potential for nitrosamine formation during cooking processes needs to be considered for public health matters. Objectives In this study we evaluated the effect of conventional potato cooking method on N-nitrosamine compound formation. Materials and Methods The amounts of four nitrosamines, namely N-nitrosodimethylamine (NDMA, N-nitrosodiethylamine (NDEA, N-nitrosopiperidine (NPIP and N-nitrosopyrrolidine (NPYR were determined in four different potato-baking methods. Sixty potato samples were randomly collected from Hamadan city. Fried potato samples were roasted at 180°C and boiled potato samples were scalded at 120°C. Nitrosamine levels were measured using gas chromatography coupled with electronic ionization detector (GC-EID, and spectrophotometry was used for measuring nitrite. Results Fried samples that were measured by the gas chromatography method had the highest average levels of nitrosamine compounds; NDMA, 5.09 ng kg-1, and NDEA, 8.66 ng kg-1. Low levels of nitrosamine compounds were associated with raw potatoes, in which no nitrosamine compound was detected. Based on the analysis of the potato samples by spectrophotometry, the highest levels of nitrite was found in raw potatoes with a mean of 2.43 mg kg-1 and the lowest levels of nitrite were detected in boiled potatoes with an average of 1.172 mg kg-1. Conclusions Nitrosamine was formed with conventional potato baking methods with the most nitrosamine formation found on the surface fried samples. Nitrites amount in baked potatoes decreased. Generally, the amount of nitrosamine in baked potato samples was lower than acceptable limits.

  12. Single-Event Transgene Product Levels Predict Levels in Genetically Modified Breeding Stacks.

    Science.gov (United States)

    Gampala, Satyalinga Srinivas; Fast, Brandon J; Richey, Kimberly A; Gao, Zhifang; Hill, Ryan; Wulfkuhle, Bryant; Shan, Guomin; Bradfisch, Greg A; Herman, Rod A

    2017-09-13

    The concentration of transgene products (proteins and double-stranded RNA) in genetically modified (GM) crop tissues is measured to support food, feed, and environmental risk assessments. Measurement of transgene product concentrations in breeding stacks of previously assessed and approved GM events is required by many regulatory authorities to evaluate unexpected transgene interactions that might affect expression. Research was conducted to determine how well concentrations of transgene products in single GM events predict levels in breeding stacks composed of these events. The concentrations of transgene products were compared between GM maize, soybean, and cotton breeding stacks (MON-87427 × MON-89034 × DAS-Ø15Ø7-1 × MON-87411 × DAS-59122-7 × DAS-40278-9 corn, DAS-81419-2 × DAS-44406-6 soybean, and DAS-21023-5 × DAS-24236-5 × SYN-IR102-7 × MON-88913-8 × DAS-81910-7 cotton) and their component single events (MON-87427, MON-89034, DAS-Ø15Ø7-1, MON-87411, DAS-59122-7, and DAS-40278-9 corn, DAS-81419-2, and DAS-44406-6 soybean, and DAS-21023-5, DAS-24236-5, SYN-IR102-7, MON-88913-8, and DAS-81910-7 cotton). Comparisons were made within a crop and transgene product across plant tissue types and were also made across transgene products in each breeding stack for grain/seed. Scatter plots were generated comparing expression in the stacks to their component events, and the percent of variability accounted for by the line of identity (y = x) was calculated (coefficient of identity, I 2 ). Results support transgene concentrations in single events predicting similar concentrations in breeding stacks containing the single events. Therefore, food, feed, and environmental risk assessments based on concentrations of transgene products in single GM events are generally applicable to breeding stacks composed of these events.

  13. Induction and use of artificial mutants in sweet potato

    International Nuclear Information System (INIS)

    Marumine, Shokichi

    1984-01-01

    X-ray, ethylene imine, 32 P and 60 Co were used as mutagen for sweet potato mutation breeding and visible variations were observed for all mutagen. In the case of 60 Co irradiation, mutation rate of skin color is 0.5-1.3% based on cutting. Direction and variation of dry matter and tuber yield of mutants which were induced by 32 P and/or 60 Co irradiation showed more deteriorative variation than progressive variation but some induced mutant lines show same or superior characters than original line. In the case of 32 P irradiation to tuber, obstruction is not so much up to dese of 10,000 μci per tuber but treatment of 330 μci per cutting approximate to LD 50 . By tuber treatment with 60 Co gamma rays, suppression of sprouting occurred in dose of 30kR. Tendency to increase a variation was not observed at higher doses. 50-200 μci per cutting or 300-500 μci per tuber in 32 P treatment and 15 kR in 60 Co gamma-irradiation for tuber seemed to be optimum dosages. Hybrid seed of mutant selected for dry matter content was compared with that of original line and it was concluded that the variation of selected line was genetic. Mutant induced by 32 P and 60 Co treatment was used as a parental material and progeny of the cross was selected for practical characters. As a result, a line of higher starch yield with high resistance to pest and disease was selected and this line was used as parental material of further breeding. (author)

  14. A temporal assessment of nematode community structure and diversity in the rhizosphere of cisgenic Phytophthora infestans-resistant potatoes.

    Science.gov (United States)

    Ortiz, Vilma; Phelan, Sinead; Mullins, Ewen

    2016-12-01

    Nematodes play a key role in soil processes with alterations in the nematode community structure having the potential to considerably influence ecosystem functioning. As a result fluctuations in nematode diversity and/or community structure can be gauged as a 'barometer' of a soil's functional biodiversity. However, a deficit exists in regards to baseline knowledge and on the impact of specific GM crops on soil nematode populations and in particular in regard to the impact of GM potatoes on the diversity of nematode populations in the rhizosphere. The goal of this project was to begin to address this knowledge gap in regards to a GM potato line, cisgenically engineered for resistance to Phytophthora infestans (responsible organism of the Irish potato famine causing late blight disease). For this, a 3 year (2013, 2014, 2015) field experimental study was completed, containing two conventional genotypes (cvs. Desiree and Sarpo Mira) and a cisgenic genotype (cv. Desiree + Rpi-vnt1). Each potato genotype was treated with different disease management strategies (weekly chemical applications and corresponding no spray control). Hence affording the opportunity to investigate the temporal impact of potato genotype, disease management strategy (and their interaction) on the potato rhizosphere nematode community. Nematode structure and diversity were measured through established indices, accounts and taxonomy with factors recording a significant effect limited to the climatic conditions across the three seasons of the study and chemical applications associated with the selected disease management strategy. Based on the metrics studied, the cultivation of the cisgenic potato genotype exerted no significant effect (P > 0.05) on nematode community diversity or structure. The disease management treatments led to a reduction of specific trophic groups (e.g. Predacious c-p = 4), which of interest appeared to be counteracted by a potato genotype with vigorous growth phenotype

  15. Comparison of nutrition composition of transgenic maize (chitinase gene) with its non-transgenic counterpart

    OpenAIRE

    Ping-mei, Yan; Yu-kui, Rui; Xiao-yan, Yan; Zheng, Chai; Qing, Wang; Jian-zhong, Du; Yi, Sun

    2011-01-01

    In order to compare the nutrition components of transgenic maize seeds (chitinase gene), achieved by the pollen-mediated approach, with its non-transgenic counterpart, Vitamin B1, vitamin B2, fatty acids and essential amino acids of transgenic maize seeds and their counterparts were analyzed by the Chinese national standard methods or AOAC methods. The results showed that the contents of all the six kinds of fatty acids detected in transgenic maize seeds were significantly higher than those i...

  16. Effect of heat treatment to sweet potato flour on dough properties and characteristics of sweet potato-wheat bread.

    Science.gov (United States)

    Pérez, Isela Carballo; Mu, Tai-Hua; Zhang, Miao; Ji, Lei-Lei

    2017-12-01

    The effect of heat treatment at 90, 100, 110 and 120 ℃ for 20 min to sweet potato flour on dough properties and characteristics of sweet potato-wheat bread was investigated. The lightness (L*) and a* of sweet potato flour samples after heat treatment were increased, while the b* were decreased significantly, as well as the particle size, volume and area mean diameter ( p sweet potato flour was observed, where the number of irregular granules increased as the temperature increased from 90 to 120 ℃. Compared with sweet potato flour samples without heat treatment and with heat treatment at 90, 100 and 120 ℃, the gelatinization temperature and enthalpy change of sweet potato flour at 110 ℃ were the lowest, which were 77.94 ℃ and 3.67 J/g, respectively ( p sweet potato flour increased significantly from 1199 ml without heat treatment to 1214 ml at 90 ℃ ( p sweet potato-wheat bread with sweet potato flour after heat treatment increased significantly, which was the largest at 90 ℃ (2.53 cm 3 /g) ( p sweet potato flour could be potentially used in wheat bread production.

  17. Selection of Housekeeping Genes for Transgene Expression Analysis in Eucommia ulmoides Oliver Using Real-Time RT-PCR

    Directory of Open Access Journals (Sweden)

    Ren Chen

    2010-01-01

    Full Text Available In order to select appropriate housekeeping genes for accurate calibration of experimental variations in real-time (RT- PCR results in transgene expression analysis, particularly with respect to the influence of transgene on stability of endogenous housekeeping gene expression in transgenic plants, we outline a reliable strategy to identify the optimal housekeeping genes from a set of candidates by combining statistical analyses of their (RT- PCR amplification efficiency, gene expression stability, and transgene influences. We used the strategy to select two genes, ACTα and EF1α, from 10 candidate housekeeping genes, as the optimal housekeeping genes to evaluate transgenic Eucommia ulmoides Oliver root lines overexpressing IPPI or FPPS1 genes, which are involved in isoprenoid biosynthesis.

  18. Herbicidal and antioxidant responses of transgenic rice overexpressing Myxococcus xanthus protoporphyrinogen oxidase.

    Science.gov (United States)

    Jung, Sunyo; Back, Kyoungwhan

    2005-05-01

    We analyzed the herbicidal and antioxidant defense responses of transgenic rice plants that overexpressed the Myxococcus xanthus protoporphyrinogen oxidase gene. Leaf squares of the wild-type incubated with oxyfluorfen were characterized by necrotic leaf lesions and increases in conductivity and malonyldialdehyde levels, whereas transgenic lines M4 and M7 did not show any change with up to 100 microM oxyfluorfen. The wild-type had decreased F(v)/F(m) and produced a high level of H(2)O(2) at 18 h after foliar application of oxyfluorfen, whereas transgenic lines M4 and M7 were unaffected. In response to oxyfluorfen, violaxanthin, beta-carotene, and chlorophylls (Chls) decreased in wild-type plants, whereas antheraxanthin and zeaxanthin increased. Only a slight decline in Chls was observed in transgenic lines at 48 h after oxyfluorfen treatment. Noticeable increases of cytosolic Cu/Zn-superoxide dismutase, peroxidase isozymes 1 and 2, and catalase were observed after at 48 h of oxyfluorfen treatment in the wild-type. Non-enzymatic antioxidants appeared to respond faster to oxyfluorfen-induced photodynamic stress than did enzymatic antioxidants. Protective responses for the detoxification of active oxygen species were induced to counteract photodynamic stress in oxyfluorfen-treated, wild-type plants. However, oxyfluorfen-treated, transgenic plants suffered less oxidative stress, confirming increased herbicidal resistance resulted from dual expression of M. xanthus Protox in chloroplasts and mitochondria.

  19. Suppression of the vacuolar invertase gene delays senescent sweetening in chipping potatoes

    Science.gov (United States)

    Background: Potato chip processors require potato tubers that meet quality specifications for fried chip color, and color depends largely upon tuber sugar contents. At later times in storage, potatoes accumulate sucrose, glucose and fructose. This developmental process, senescent sweetening, manifes...

  20. Use of the viral 2A peptide for bicistronic expression in transgenic mice

    Directory of Open Access Journals (Sweden)

    Trichas Georgios

    2008-09-01

    Full Text Available Abstract Background Transgenic animals are widely used in biomedical research and biotechnology. Multicistronic constructs, in which several proteins are encoded by a single messenger RNA, are commonly used in genetically engineered animals. This is currently done by using an internal ribosomal entry site to separate the different coding regions. 2A peptides result in the co-translational 'cleavage' of proteins and are an attractive alternative to the internal ribosomal entry site. They are more reliable than the internal ribosomal entry site and lead to expression of multiple cistrons at equimolar levels. They work in a wide variety of eukaryotic cells, but to date have not been demonstrated to function in transgenic mice in an inheritable manner. Results To test 2A function in transgenic mice and uncover any possible toxicity of widespread expression of the 2A peptide, we made a bicistronic reporter construct containing the coding sequence for a membrane localised red fluorescent protein (Myr-TdTomato and a nuclear localised green fluorescent protein (H2B-GFP, separated by a 2A sequence. When this reporter is transfected into HeLa cells, the two fluorescent proteins correctly localise to mutually exclusive cellular compartments, demonstrating that the bicistronic construct is a reliable readout of 2A function. The two fluorescent proteins also correctly localise when the reporter is electroporated into chick neural tube cells. We made two independent transgenic mouse lines that express the bicistronic reporter ubiquitously. For both lines, transgenic mice are born in Mendelian frequencies and are found to be healthy and fertile. Myr-TdTomato and H2B-GFP segregate to mutually exclusive cellular compartments in all tissues examined from a broad range of developmental stages, ranging from embryo to adult. One transgenic line shows X-linked inheritance of the transgene and mosaic expression in females but uniform expression in males, indicating

  1. THE INFLUENCE OF POTATO CYST NEMATODE G. ROSTOCHIENSIS INFESTATION ON DIFFERENT POTATO CULTIVARS

    Directory of Open Access Journals (Sweden)

    Gregor Urek

    2008-07-01

    Full Text Available The potato cyst nematode Globodera rostochiensis is one of the most serious pests of potato in Slovenia. Precise nematode identification and knowledge about potato cultivars, which are most suitable for growing in the Slovenian climate conditions and most resistant to G. rostochiensis, are necessary to develop an effective integrated pest control. Here we report the results of the influence of G. rostochiensis pathotype Ro1/4 on the yield of different potato cultivars: the susceptible cultivar Desiree, the resistant cultivars White Lady, Miranda, Aladin, Sante and Adora, and the clone KIS 94-1/5-14. The yield of cv. White Lady was the highest and that of susceptible cv. Desiree the lowest. The influence of several resistant and one susceptible potato cultivars on population dynamics of G. rostochiensis was also determined. The total number of cysts/100 cm3 and the number of eggs and juveniles per cyst increased in the susceptible cv. Desiree and decreased in the resistant cultivars White Lady, Sante and Adora.

  2. Bacterial diversity on the surface of potato tubers in soil and the influence of the plant genotype.

    Science.gov (United States)

    Weinert, Nicole; Meincke, Remo; Gottwald, Christine; Heuer, Holger; Schloter, Michael; Berg, Gabriele; Smalla, Kornelia

    2010-10-01

    The surface of tubers might be a reservoir for bacteria that are disseminated with seed potatoes or that affect postharvest damage. The numbers of culturable bacteria and their antagonistic potential, as well as bacterial community fingerprints were analysed from tubers of seven field-grown potato genotypes, including two lines with tuber-accumulated zeaxanthin. The plant genotype significantly affected the number of culturable bacteria only at one field site. Zeaxanthin had no effect on the bacterial plate counts. In dual culture, 72 of 700 bacterial isolates inhibited at least one of the potato pathogens Rhizoctonia solani, Verticillium dahliae or Phytophthora infestans, 12 of them suppressing all three. Most of these antagonists were identified as Bacillus or Streptomyces. From tubers of two plant genotypes, including one zeaxanthin line, higher numbers of antagonists were isolated. Most antagonists showed glucanase, cellulase and protease activity, which could represent mechanisms for pathogen suppression. PCR-DGGE fingerprints of the 16S rRNA genes of bacterial communities from the tuber surfaces revealed that the potato genotype significantly affected the Pseudomonas community structure at one site. However, the genotypes showed nearly identical fingerprints for Bacteria, Actinobacteria, Alphaproteobacteria, Betaproteobacteria, Bacillus and Streptomycetaceae. In conclusion, tuber-associated bacteria were only weakly affected by the plant genotype. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  3. Silencing Agrobacterium oncogenes in transgenic grapevine results in strain-specific crown gall resistance.

    Science.gov (United States)

    Galambos, A; Zok, A; Kuczmog, A; Oláh, R; Putnoky, P; Ream, W; Szegedi, E

    2013-11-01

    Grapevine rootstock transformed with an Agrobacterium oncogene-silencing transgene was resistant to certain Agrobacterium strains but sensitive to others. Thus, genetic diversity of Agrobacterium oncogenes may limit engineering crown gall resistance. Crown gall disease of grapevine induced by Agrobacterium vitis or Agrobacterium tumefaciens causes serious economic losses in viticulture. To establish crown gall-resistant lines, somatic proembryos of Vitis berlandieri × V. rupestris cv. 'Richter 110' rootstock were transformed with an oncogene-silencing transgene based on iaaM and ipt oncogene sequences from octopine-type, tumor-inducing (Ti) plasmid pTiA6. Twenty-one transgenic lines were selected, and their transgenic nature was confirmed by polymerase chain reaction (PCR). These lines were inoculated with two A. tumefaciens and three A. vitis strains. Eight lines showed resistance to octopine-type A. tumefaciens A348. Resistance correlated with the expression of the silencing genes. However, oncogene silencing was mostly sequence specific because these lines did not abolish tumorigenesis by A. vitis strains or nopaline-type A. tumefaciens C58.

  4. Indirect effect of a transgenic wheat on aphids through enhanced powdery mildew resistance.

    Science.gov (United States)

    von Burg, Simone; Álvarez-Alfageme, Fernando; Romeis, Jörg

    2012-01-01

    In agricultural ecosystems, arthropod herbivores and fungal pathogens are likely to colonise the same plant and may therefore affect each other directly or indirectly. The fungus that causes powdery mildew (Blumeria graminis tritici) and cereal aphids are important pests of wheat but interactions between them have seldom been investigated. We studied the effects of powdery mildew of wheat on two cereal aphid species, Metopolophium dirhodum and Rhopalosiphum padi. We hypothesized that aphid number and size will be smaller on powdery mildew-infected plants than on non-infected plants. In a first experiment we used six commercially available wheat varieties whereas in the second experiment we used a genetically modified (GM) mildew-resistant wheat line and its non-transgenic sister line. Because the two lines differed only in the presence of the transgene and in powdery mildew resistance, experiment 2 avoided the confounding effect of variety. In both experiments, the number of M. dirhodum but not of R. padi was reduced by powdery mildew infection. Transgenic mildew-resistant lines therefore harboured bigger aphid populations than the non-transgenic lines. For both aphid species individual size was mostly influenced by aphid number. Our results indicate that plants that are protected from a particular pest (powdery mildew) became more favourable for another pest (aphids).

  5. Indirect effect of a transgenic wheat on aphids through enhanced powdery mildew resistance.

    Directory of Open Access Journals (Sweden)

    Simone von Burg

    Full Text Available In agricultural ecosystems, arthropod herbivores and fungal pathogens are likely to colonise the same plant and may therefore affect each other directly or indirectly. The fungus that causes powdery mildew (Blumeria graminis tritici and cereal aphids are important pests of wheat but interactions between them have seldom been investigated. We studied the effects of powdery mildew of wheat on two cereal aphid species, Metopolophium dirhodum and Rhopalosiphum padi. We hypothesized that aphid number and size will be smaller on powdery mildew-infected plants than on non-infected plants. In a first experiment we used six commercially available wheat varieties whereas in the second experiment we used a genetically modified (GM mildew-resistant wheat line and its non-transgenic sister line. Because the two lines differed only in the presence of the transgene and in powdery mildew resistance, experiment 2 avoided the confounding effect of variety. In both experiments, the number of M. dirhodum but not of R. padi was reduced by powdery mildew infection. Transgenic mildew-resistant lines therefore harboured bigger aphid populations than the non-transgenic lines. For both aphid species individual size was mostly influenced by aphid number. Our results indicate that plants that are protected from a particular pest (powdery mildew became more favourable for another pest (aphids.

  6. Presence and Distribution of Economically Important Potato Viruses in Montenegro

    Directory of Open Access Journals (Sweden)

    Jelena Zindović

    2011-01-01

    Full Text Available The research was carried out, in the period 2002-2004 in order to determine the presence and distribution of potato viruses at 12 different locations and on 9 different potato varieties grown in Montenegro. The research included collecting of samples in seed potato crops and testing of six economically important potato viruses: Potato leaf roll virus (PLRV, Potato virus Y (PVY, Potato virus X (PVX, Potato virus S (PVS, Potato virus A (PVA i Potato virus M (PVM. Using the direct enzyme-linked immunosorbent assay (DAS-ELISA and commercial antisera specific for six potato viruses, it was found that PVY was the most frequent virus during the three-year research period. The second frequent virus was PVS, followed by PVA, PLRV, PVM and PVX. Single and mixed infections were detected, and the most prevalent were the single infections of PVY. Also, in the period 2002-2004, PVY had the highest distribution and the number of present viruses was different at different localities and on different potato varieties. Further investigations were related to detailed characterization of the most prevalent virus (PVY, which is at the same time economically the most important one. Serological characterization of PVY was performed utilizing DAS-ELISA kit with commercial monoclonal antibodies specific for detection of the three strain groups of PVY, and the two straingroups - necrotic (PVYN/PVYNTN and common (PVYO, were identified. Necrotic strains were prevalent in 2002 and 2004, while in 2003 PVYO was the most frequent strain in virus population. The presence of stipple streak strain (PVYC was not detected in any of the testedsamples.

  7. Mutagenicity studies on alcohol extracts from gamma-irradiated potatoes

    International Nuclear Information System (INIS)

    Shinozaki, Yoshiharu; Hogetsu, Daisuke; Okuyama, Norio; Manabe, Takashi; Sasagawa, Tatsuru.

    1981-01-01

    The preparation of alcohol extracts from gamma-irradiated potatoes of the ''Danshaku'' variety and their chemical aspects were studied. The final concentrate of alcohol extracts from potatoes showed pH values of 3 -- 4. The o-quinones or ''radiotoxins'' reported by Kuzin, et al. were not detected in the alcohol extracts from potatoes of this variety by high performance liquid chromatography (HPLC) analysis, paper chromatography and the model enzymatic experiment. (author)

  8. Synthetic Hexaploids Derived from Wild Species Related to Sweet Potato

    OpenAIRE

    SHIOTANI, Itaru; KAWASE, Tsuneo; 塩谷, 格; 川瀬, 恒男

    1987-01-01

    The utilization of germplasm of the wild species in sweet-potato breeding has been conducted for the last three decades. Such attempts brought some remarkable achievments in improving root yield, starch content and resistance to the nematodes of sweet potato. Some wild plants in polyploid series may have many genes potentially important for further improvement of the agronomic traits. However, the genomic relationship between the wild relatives and hexaploid sweet potato (2n=6x=90) has been u...

  9. Study on the cytogenetic activity of freshly irradiated potatoes

    International Nuclear Information System (INIS)

    Zajtsev, A.N.; Osipova, I.N.

    1978-01-01

    Cytogenetic activity of potatoes, subjected to gamma irradiation in the dose of 10 Krad, feeding the animals in a day after irradiation, has been investigated. The frequency of chromosomal aberrations in bone marrow cells of mice, who obtained newly irradiated raw or baked potatoes, has no substantial difference from the analogous mutageneity index of mice from the control group. The data obtained are of practical importance when considering the problem of using gamma-irradiated potatoes in the people nourishment

  10. Infection of potato mesophyll protoplasts with five plant viruses.

    Science.gov (United States)

    Barker, H; Harrison, B D

    1982-12-01

    Methods are described for preparing potato mesophyll protoplasts that are suitable for infection with inocula of virus nucleoprotein or RNA. The protoplasts could be infected with four sap-transmissible viruses (tobacco mosaic, tobacco rattle, tobacco ringspot and tomato black ring viruses) and with potato leafroll virus, which is not saptransmissible. No differences were observed in ability to infect protoplasts with potato leafroll virus strains differing either in virulence in intact plants or in aphid transmissibility.

  11. Combination processes for improving storage of irradiated potatoes

    International Nuclear Information System (INIS)

    Shirsat, S.G.; Thomas, P.; Nair, P.M.

    1990-01-01

    Various combined treatments of harvested potatoes to reduce microbial spoilage of irradiated potatoes in storage were studied. Treatments studied were irradiation in conjunction with hot water dip, cold or hot salicylic acid dip, dusting with salicylic acid powder, and sodium hypochlorite wash followed by storage in well aerated containers. Microbial spoilage in irradiated potatoes was found to be greatly reduced by storage at 10deg or 15degC in well aerated containers. (M.G.B.). 9 refs., 1 tab

  12. Studies on the storage of irradiated potatoes

    Energy Technology Data Exchange (ETDEWEB)

    Sharabash, M; Orabi, I O [National Center for research and radiation Technology, Nasr City, Cairo (Egypt); Eloksh, I I; Abd-Alia, M A [Faculty of Agric. Ain Shams University, Cairo (Egypt)

    1995-10-01

    Tubers of alpha and king edward potato cultivars were exposed to O, 10 or 50 krad and stored under room temperature and good ventilation in perforated standard carton boxes. 10 Krad was the promising dosage for sprouting inhibition for both the two cultivars. Total losses in weight were partially dependent on the volume of the dosage, the time elapsed after irradiation and cultivar used. Ascorbic acid slightly decreased, whilst sugar fractions were increased during storage in irradiated tubers. Sugar fractions were sharply decreased in boiled or fried potatoes. Also, chlorogenic acid was increased by prolonging the storage time and/or increasing the exposure dose. After-cooking discoloration (darkening) was reduced by gamma irradiation and/or extending the storage period. Using 0.5% citric acid or 0.5% sodium citrate solution inhibited the after-cooking discoloration. 8 tabs.

  13. Studies on the storage of irradiated potatoes

    International Nuclear Information System (INIS)

    Sharabash, M.; Orabi, I.O.; Eloksh, I.I.; Abd-Alia, M.A.

    1995-01-01

    Tubers of alpha and king edward potato cultivars were exposed to O, 10 or 50 krad and stored under room temperature and good ventilation in perforated standard carton boxes. 10 Krad was the promising dosage for sprouting inhibition for both the two cultivars. Total losses in weight were partially dependent on the volume of the dosage, the time elapsed after irradiation and cultivar used. Ascorbic acid slightly decreased, whilst sugar fractions were increased during storage in irradiated tubers. Sugar fractions were sharply decreased in boiled or fried potatoes. Also, chlorogenic acid was increased by prolonging the storage time and/or increasing the exposure dose. After-cooking discoloration (darkening) was reduced by gamma irradiation and/or extending the storage period. Using 0.5% citric acid or 0.5% sodium citrate solution inhibited the after-cooking discoloration. 8 tabs

  14. A method for estimating the contribution of seed potatoes, machinery and soil tare in field infestations with potato cyst nematodes on a national scale.

    Science.gov (United States)

    Goeminne, M; Demeulemeester, K; Viaene, N

    2011-01-01

    In order to make a cost benefit analysis for the management of the potato cyst nematodes Globodera rostochiensis and G. pallida, we developed a method to estimate the relative importance of three basic distribution channels of potato cyst nematodes: seed potatoes, machinery and soil tare. The baseline is determined by the area planted with potatoes, the area infested with potato cysts, the proportion of resistant potato cultivars and the distribution of cysts trough different channels. This quantification forms a basis for the evaluation of the effects of different control measures for potato cyst nematode on a national scale. The method can be useful as an example for application in other countries.

  15. [Multi-Target Recognition of Internal and External Defects of Potato by Semi-Transmission Hyperspectral Imaging and Manifold Learning Algorithm].

    Science.gov (United States)

    Huang, Tao; Li, Xiao-yu; Jin, Rui; Ku, Jing; Xu, Sen-miao; Xu, Meng-ling; Wu, Zhen-zhong; Kong, De-guo

    2015-04-01

    external defects potatoes and also provide technical reference for rapid on-line non-destructive detecting of the internal and external defects potatoes.

  16. Recent progress on technologies and applications of transgenic ...

    African Journals Online (AJOL)

    USER

    2010-06-14

    Jun 14, 2010 ... this, the methods for producing transgenic poultry must become routine. ... and spermatogonial stem cells (SSCs) have been developed to generate transgenic chickens. ... any procedure aimed at generating transgenic birds.

  17. Taxonomy Icon Data: potato [Taxonomy Icon

    Lifescience Database Archive (English)

    Full Text Available potato Solanum tuberosum Solanum_tuberosum_L.png Solanum_tuberosum_NL.png Solanum_tuber...osum_S.png Solanum_tuberosum_NS.png http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Solanum+tuberosum&t...=L http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Solanum+tuberosum&t=NL http://biosciencedbc.jp/taxonomy_...icon/icon.cgi?i=Solanum+tuberosum&t=S http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Solanum+tuberosum&t=NS ...

  18. Seed Potato Production and Its Importance

    OpenAIRE

    Erdoğan ÖZTÜRK; Taşkın POLAT

    2017-01-01

    Our country has different agricultural regions showed different ecological properties in terms of climate and soil characteristics increase the plant variety. Within this variety the potato is one of the most important plants for agriculture and economic of our country, also it is an important food source for human. It is important to use productive and quality seed for healthy agricultural production. With the using of good quality seed, can be obtained about 20% increase in yield. Certified...

  19. Effects of gamma radiation on potato meristems

    International Nuclear Information System (INIS)

    Fernandez Gonzalez, J.; Garcia Collantes, M.A.

    1976-01-01

    The development of buds in potato tubers subjected to gamma radiation at doses of 3, 6, 8 and 12 Krad is studied at histological level. The irradiation was supplied at the beguining and end of the resting period, and the irradiated buds were observed at different stages of their development. Meristem's sensitivity depends on the state of activity involved at the moment of irradiation. Different parts of the meristem present different radiosensitivity, being the most radioresistant. (author) [es

  20. Expression of a methionine-rich storage albumin from the Brazil nut (Bertholletia excelsa H.B.K., Lecythidaceae in transgenic bean plants (Phaseolus vulgaris L., Fabaceae

    Directory of Open Access Journals (Sweden)

    Aragão F.J.L.

    1999-01-01

    Full Text Available Bean (Phaseolus vulgaris, an important component in the diet of people in developing countries, has low levels of the essential amino acid, methionine. We have attempted to correct this deficiency by introducing a transgene coding for a methionine-rich storage albumin from the Brazil nut via biolistic methods. The transgene's coding sequence was driven by a doubled 35S CaMV promoter and AMV enhancer sequences. The transgene was stable and correctly expressed in homozygous R2 to R5 seeds. In two of the five transgenic lines the methionine content was significantly increased (14 and 23% over the values found in untransformed plants.